#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NOXRED1	122945	hgsc.bcm.edu	37	14	77880459	77880459	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr14:77880459T>A	ENST00000380835.2	-	2	333	c.167A>T	c.(166-168)aAt>aTt	p.N56I	FKSG61_ENST00000595520.1_5'Flank|NOXRED1_ENST00000298358.3_Missense_Mutation_p.N56I	NM_001113475.2	NP_001106946.1	Q6NXP6	NXRD1_HUMAN	NADP-dependent oxidoreductase domain containing 1	56					proline biosynthetic process (GO:0006561)		pyrroline-5-carboxylate reductase activity (GO:0004735)	p.N56I(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9						TTGATTCTTATTTAATGATGC	0.393																																																1	Substitution - Missense(1)	ovary(1)	14											63.0	59.0	60.0					14																	77880459		2203	4300	6503	76950212	SO:0001583	missense	122945			AK057371	CCDS45142.1	14q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000165555	ENSG00000165555			20487	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 148"""	C14orf148			Standard	NM_001113475		Approved	FLJ32809	uc001xtr.3	Q6NXP6	OTTHUMG00000171554	ENST00000380835.2:c.167A>T	14.37:g.77880459T>A	ENSP00000370215:p.Asn56Ile	Somatic		WXS	SOLID	Phase_III	76950212	B3KQ47|O95435	Missense_Mutation	SNP	ENST00000380835.2	37	CCDS45142.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.431063	0.25726	.	.	ENSG00000165555	ENST00000380835;ENST00000298358;ENST00000555603	T;T;T	0.55413	0.54;0.52;0.55	5.34	-4.04	0.04010	.	2.283350	0.01159	N	0.006607	T	0.22475	0.0542	N	0.03608	-0.345	0.09310	N	1	B;B	0.12630	0.006;0.001	B;B	0.06405	0.001;0.002	T	0.06356	-1.0831	10	0.17832	T	0.49	2.59	0.5164	0.00604	0.2901:0.296:0.1488:0.2651	.	56;56	Q6NXP6-2;Q6NXP6	.;NXRD1_HUMAN	I	56	ENSP00000370215:N56I;ENSP00000298358:N56I;ENSP00000450597:N56I	ENSP00000298358:N56I	N	-	2	0	C14orf148	76950212	0.000000	0.05858	0.000000	0.03702	0.109000	0.19521	-0.187000	0.09656	-0.502000	0.06596	0.460000	0.39030	AAT		0.393	NOXRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414103.1	NM_138791	
MICAL1	64780	hgsc.bcm.edu	37	6	109766139	109766139	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr6:109766139T>G	ENST00000358807.3	-	23	3252	c.2941A>C	c.(2941-2943)Aaa>Caa	p.K981Q	MICAL1_ENST00000368952.4_Missense_Mutation_p.K1000Q|MICAL1_ENST00000358577.3_Missense_Mutation_p.K895Q	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	981				K -> N (in Ref. 3; BAB13949). {ECO:0000305}.	actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)	p.K981Q(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		AGGCTGTTTTTCTTGTCAACG	0.567																																																1	Substitution - Missense(1)	ovary(1)	6											158.0	154.0	156.0					6																	109766139		2203	4300	6503	109872832	SO:0001583	missense	64780			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2941A>C	6.37:g.109766139T>G	ENSP00000351664:p.Lys981Gln	Somatic		WXS	SOLID	Phase_III	109872832	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	ENST00000358807.3	37	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216620	0.79352	.	.	ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577;ENST00000368957;ENST00000335266	T;T;T	0.59224	0.28;0.28;0.28	5.85	5.85	0.93711	Domain of unknown function DUF3585 (1);	0.059818	0.64402	D	0.000005	T	0.76076	0.3937	M	0.91612	3.225	0.39292	D	0.964755	D;D;D	0.89917	0.993;1.0;0.993	D;D;D	0.83275	0.912;0.996;0.912	T	0.82729	-0.0313	10	0.87932	D	0	.	12.6221	0.56610	0.0:0.0:0.0:1.0	.	1000;895;981	B7Z3R5;Q8TDZ2-2;Q8TDZ2	.;.;MICA1_HUMAN	Q	981;1000;895;505;237	ENSP00000351664:K981Q;ENSP00000357948:K1000Q;ENSP00000351385:K895Q	ENSP00000335372:K237Q	K	-	1	0	MICAL1	109872832	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	5.751000	0.68720	2.233000	0.73108	0.533000	0.62120	AAA		0.567	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
POM121	9883	hgsc.bcm.edu	37	7	72420421	72420421	+	3'UTR	DEL	T	T	-	rs72283468		TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr7:72420421delT	ENST00000395270.1	+	0	5453				NSUN5P2_ENST00000388955.4_RNA	NM_001257190.1	NP_001244119.1	Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.K56fs*9(1)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				GTGACTGGTCTTTATTGCCTG	0.582																																																1	Deletion - Frameshift(1)	ovary(1)	7											44.0	46.0	46.0					7																	72420421		2198	4300	6498	72058357	SO:0001624	3_prime_UTR_variant	260294			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000395270.1:c.*1412T>-	7.37:g.72420421delT		Somatic		WXS	SOLID	Phase_III	72058357	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Frame_Shift_Del	DEL	ENST00000395270.1	37	CCDS59059.1																																																																																				0.582	POM121-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252020.1		
PDAP1	11333	hgsc.bcm.edu	37	7	99001069	99001069	+	Frame_Shift_Del	DEL	C	C	-			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr7:99001069delC	ENST00000350498.3	-	3	445	c.165delG	c.(163-165)aagfs	p.K56fs		NM_014891.6	NP_055706.1	Q13442	HAP28_HUMAN	PDGFA associated protein 1	56					cell proliferation (GO:0008283)|signal transduction (GO:0007165)		poly(A) RNA binding (GO:0044822)	p.K56fs*3(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)|prostate(1)|skin(1)	9	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CTAGAGATTTCTTCTCCTTTT	0.443																																																2	Deletion - Frameshift(2)	ovary(2)	7											187.0	160.0	169.0					7																	99001069		2203	4297	6500	98839005	SO:0001589	frameshift_variant	11333			U41745	CCDS5662.1	7q	2008-07-18			ENSG00000106244	ENSG00000106244			14634	protein-coding gene	gene with protein product	"""PDGF associated protein"""	607075				8780057	Standard	NM_014891		Approved	PAP1, PAP, HASPP28	uc003uqe.3	Q13442	OTTHUMG00000154629	ENST00000350498.3:c.165delG	7.37:g.99001069delC	ENSP00000222968:p.Lys56fs	Somatic		WXS	SOLID	Phase_III	98839005	D6W5S5|Q92906	Frame_Shift_Del	DEL	ENST00000350498.3	37	CCDS5662.1																																																																																				0.443	PDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336388.2	NM_014891	
ST3GAL2	6483	hgsc.bcm.edu	37	16	70417119	70417119	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr16:70417119A>G	ENST00000393640.4	-	4	2840	c.733T>C	c.(733-735)Tcc>Ccc	p.S245P	RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000342907.2_Missense_Mutation_p.S245P			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	245					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)	p.S245A(1)|p.S245P(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				CGAAGGAAGGACTTCACTGGG	0.527																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	16											86.0	80.0	82.0					16																	70417119		2198	4300	6498	68974620	SO:0001583	missense	6483			U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.733T>C	16.37:g.70417119A>G	ENSP00000377257:p.Ser245Pro	Somatic		WXS	SOLID	Phase_III	68974620	O00654	Missense_Mutation	SNP	ENST00000393640.4	37	CCDS10890.1	.	.	.	.	.	.	.	.	.	.	A	12.36	1.915477	0.33815	.	.	ENSG00000157350	ENST00000342907;ENST00000393640	T;T	0.30981	1.51;1.51	4.72	4.72	0.59763	.	0.177421	0.51477	D	0.000083	T	0.15478	0.0373	N	0.17379	0.485	0.33877	D	0.635704	B	0.06786	0.001	B	0.09377	0.004	T	0.13710	-1.0499	10	0.29301	T	0.29	-9.9266	3.9268	0.09267	0.6571:0.2088:0.1341:0.0	.	245	Q16842	SIA4B_HUMAN	P	245	ENSP00000345477:S245P;ENSP00000377257:S245P	ENSP00000345477:S245P	S	-	1	0	ST3GAL2	68974620	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.628000	0.61282	2.004000	0.58718	0.528000	0.53228	TCC		0.527	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268968.1	NM_006927	
TP53	7157	hgsc.bcm.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	17	GRCh37	CM056413|CM920678	TP53	M	rs28934574	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	7517819	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp	Somatic		WXS	SOLID	Phase_III	7517819	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
VAV3	10451	hgsc.bcm.edu	37	1	108299882	108299882	+	Splice_Site	SNP	C	C	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:108299882C>G	ENST00000370056.4	-	11	1361		c.e11+1		VAV3_ENST00000343258.4_Splice_Site|VAV3_ENST00000527011.1_Splice_Site|VAV3_ENST00000371846.4_Splice_Site	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor						angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.?(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		ATCTGCCCTACCTTCATGGCA	0.383																																																1	Unknown(1)	ovary(1)	1											150.0	144.0	146.0					1																	108299882		2203	4300	6503	108101405	SO:0001630	splice_region_variant	10451			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1086+1G>C	1.37:g.108299882C>G		Somatic		WXS	SOLID	Phase_III	108101405	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Splice_Site	SNP	ENST00000370056.4	37	CCDS785.1	.	.	.	.	.	.	.	.	.	.	c	20.6	4.023527	0.75390	.	.	ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000490388;ENST00000371846	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1174	0.97942	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VAV3	108101405	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	7.381000	0.79718	2.755000	0.94549	0.639000	0.83563	.		0.383	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	Intron
XRN2	22803	hgsc.bcm.edu	37	20	21336789	21336789	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr20:21336789G>T	ENST00000377191.3	+	22	2187	c.2092G>T	c.(2092-2094)Gag>Tag	p.E698*	XRN2_ENST00000430571.2_Nonsense_Mutation_p.E622*|XRN2_ENST00000539513.1_Nonsense_Mutation_p.E644*	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	698					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E698*(1)		endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						CTTCATTTTAGAGCTGTACCA	0.363																																																1	Substitution - Nonsense(1)	ovary(1)	20											128.0	121.0	123.0					20																	21336789		2203	4300	6503	21284789	SO:0001587	stop_gained	22803			AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.2092G>T	20.37:g.21336789G>T	ENSP00000366396:p.Glu698*	Somatic		WXS	SOLID	Phase_III	21284789	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Nonsense_Mutation	SNP	ENST00000377191.3	37	CCDS13144.1	.	.	.	.	.	.	.	.	.	.	G	40	8.284543	0.98742	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	.	.	.	5.93	4.98	0.66077	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-15.2059	17.2228	0.86962	0.0:0.1259:0.8741:0.0	.	.	.	.	X	698;622;644	.	ENSP00000366396:E698X	E	+	1	0	XRN2	21284789	1.000000	0.71417	0.934000	0.37439	0.991000	0.79684	7.561000	0.82288	1.495000	0.48549	0.591000	0.81541	GAG		0.363	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078273.2	NM_012255	
APC	324	hgsc.bcm.edu	37	5	112176619	112176619	+	Silent	SNP	A	A	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr5:112176619A>G	ENST00000457016.1	+	16	5708	c.5328A>G	c.(5326-5328)gtA>gtG	p.V1776V	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Silent_p.V1776V|APC_ENST00000508376.2_Silent_p.V1776V			P25054	APC_HUMAN	adenomatous polyposis coli	1776	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.K1192fs*3(1)|p.?(1)|p.V1776V(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTTCACCAGTAAAACCTATAC	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	3	Unknown(1)|Substitution - coding silent(1)|Deletion - Frameshift(1)	ovary(1)|soft_tissue(1)|skin(1)	5											40.0	41.0	40.0					5																	112176619		2202	4299	6501	112204518	SO:0001819	synonymous_variant	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.5328A>G	5.37:g.112176619A>G		Somatic		WXS	SOLID	Phase_III	112204518	D3DT03|Q15162|Q15163|Q93042	Silent	SNP	ENST00000457016.1	37	CCDS4107.1																																																																																				0.358	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
BMI1	648	hgsc.bcm.edu	37	10	22615464	22615464	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr10:22615464C>A	ENST00000376663.3	+	2	591	c.86C>A	c.(85-87)aCa>aAa	p.T29K	COMMD3-BMI1_ENST00000602390.1_Missense_Mutation_p.T172K	NM_005180.8	NP_005171.4	P35226	BMI1_HUMAN	BMI1 proto-oncogene, polycomb ring finger	29					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|regulation of gene expression (GO:0010468)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|ubiquitin ligase complex (GO:0000151)	RING-like zinc finger domain binding (GO:0071535)|zinc ion binding (GO:0008270)	p.T29K(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|urinary_tract(1)	12						ATTGATGCCACAACCATAATA	0.398																																																1	Substitution - Missense(1)	ovary(1)	10											228.0	201.0	210.0					10																	22615464		2203	4300	6503	22655470	SO:0001583	missense	648			BC011652	CCDS7138.1	10p13	2014-06-26	2014-06-26	2006-04-26	ENSG00000168283	ENSG00000168283		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	1066	protein-coding gene	gene with protein product		164831	"""polycomb group ring finger 4"", ""B lymphoma Mo-MLV insertion region 1 homolog (mouse)"""	PCGF4		8268912	Standard	NM_005180		Approved	RNF51		P35226	OTTHUMG00000017807	ENST00000376663.3:c.86C>A	10.37:g.22615464C>A	ENSP00000365851:p.Thr29Lys	Somatic		WXS	SOLID	Phase_III	22655470	Q16030|Q5T8Z3|Q96F37	Missense_Mutation	SNP	ENST00000376663.3	37	CCDS7138.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675642	0.88445	.	.	ENSG00000168283	ENST00000417470;ENST00000376691;ENST00000376663;ENST00000442508;ENST00000456675;ENST00000416820;ENST00000443519	T;T;T;T	0.68025	0.97;0.97;0.97;-0.3	5.67	5.67	0.87782	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	T	0.79317	0.4425	L	0.52823	1.66	0.80722	D	1	D;D	0.59767	0.986;0.975	D;D	0.70227	0.958;0.968	T	0.80271	-0.1452	10	0.87932	D	0	-16.1989	18.5442	0.91040	0.0:1.0:0.0:0.0	.	29;29	Q5U0M5;P35226	.;BMI1_HUMAN	K	29;13;29;29;29;29;6	ENSP00000365851:T29K;ENSP00000397912:T29K;ENSP00000399220:T29K;ENSP00000390768:T6K	ENSP00000365851:T29K	T	+	2	0	BMI1	22655470	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.991000	0.70602	2.689000	0.91719	0.650000	0.86243	ACA		0.398	BMI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047176.1	NM_005180	
FAM212B	55924	hgsc.bcm.edu	37	1	112269817	112269817	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:112269817C>A	ENST00000357260.5	-	2	848	c.667G>T	c.(667-669)Gac>Tac	p.D223Y	FAM212B_ENST00000444059.2_Missense_Mutation_p.D208Y|FAM212B_ENST00000534365.1_Intron	NM_019099.4	NP_061972.1	Q9NTI7	F212B_HUMAN	family with sequence similarity 212, member B	223								p.D223Y(1)		cervix(1)|endometrium(1)	2						AGCAGCCGGTCACGGTCAGGC	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											52.0	54.0	54.0					1																	112269817		2203	4300	6503	112071340	SO:0001583	missense	55924			AK055667	CCDS841.1, CCDS44195.1	1p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000197852	ENSG00000197852			28045	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 183"""	C1orf183			Standard	NM_019099		Approved	FLJ31105	uc001ebo.2	Q9NTI7	OTTHUMG00000011953	ENST00000357260.5:c.667G>T	1.37:g.112269817C>A	ENSP00000349805:p.Asp223Tyr	Somatic		WXS	SOLID	Phase_III	112071340	B3KP38|B4DF94|Q9NTI6	Missense_Mutation	SNP	ENST00000357260.5	37	CCDS841.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640540	0.87859	.	.	ENSG00000197852	ENST00000357260;ENST00000444059	.	.	.	5.07	5.07	0.68467	.	0.052739	0.64402	D	0.000001	T	0.57548	0.2061	N	0.20986	0.625	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.65768	-0.6088	9	0.87932	D	0	-29.3326	17.1972	0.86895	0.0:1.0:0.0:0.0	.	208;223	Q9NTI7-2;Q9NTI7	.;CA183_HUMAN	Y	223;208	.	ENSP00000349805:D223Y	D	-	1	0	C1orf183	112071340	1.000000	0.71417	0.975000	0.42487	0.990000	0.78478	7.405000	0.80007	2.357000	0.79964	0.484000	0.47621	GAC		0.607	FAM212B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033060.2	NM_019099	
CLEC4F	165530	hgsc.bcm.edu	37	2	71036484	71036484	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr2:71036484T>G	ENST00000272367.2	-	7	1765	c.1689A>C	c.(1687-1689)agA>agC	p.R563S	CLEC4F_ENST00000426626.1_Intron	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	563	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R563S(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						TAATATACTTTCTGAGTGGGC	0.532																																					Colon(107;10 2157 6841 26035)											1	Substitution - Missense(1)	ovary(1)	2											64.0	63.0	63.0					2																	71036484		2203	4300	6503	70889992	SO:0001583	missense	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1689A>C	2.37:g.71036484T>G	ENSP00000272367:p.Arg563Ser	Somatic		WXS	SOLID	Phase_III	70889992	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	T	8.387	0.838850	0.16891	.	.	ENSG00000152672	ENST00000272367	T	0.01665	4.7	2.49	1.31	0.21738	C-type lectin (2);	.	.	.	.	T	0.00906	0.0030	N	0.05554	-0.025	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.47959	-0.9076	9	0.07175	T	0.84	.	4.3784	0.11281	0.0:0.1664:0.0:0.8336	.	563	Q8N1N0	CLC4F_HUMAN	S	563	ENSP00000272367:R563S	ENSP00000272367:R563S	R	-	3	2	CLEC4F	70889992	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.053000	0.14184	0.381000	0.24851	0.254000	0.18369	AGA		0.532	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
CNGA3	1261	hgsc.bcm.edu	37	2	98994252	98994252	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr2:98994252G>T	ENST00000272602.2	+	2	243	c.204G>T	c.(202-204)caG>caT	p.Q68H	CNGA3_ENST00000436404.2_Missense_Mutation_p.Q68H|CNGA3_ENST00000393504.1_Missense_Mutation_p.Q68H|CNGA3_ENST00000409937.1_Missense_Mutation_p.Q17H			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	68					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)	p.Q68H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						TCACCGGCCAGGGGATCGCCA	0.602																																																1	Substitution - Missense(1)	ovary(1)	2											25.0	23.0	24.0					2																	98994252		2203	4300	6503	98360684	SO:0001583	missense	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.204G>T	2.37:g.98994252G>T	ENSP00000272602:p.Gln68His	Somatic		WXS	SOLID	Phase_III	98360684	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.989902	0.35131	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	T;T;T;D	0.98876	0.79;0.79;0.79;-5.2	5.01	-0.703	0.11261	.	10.923100	0.00357	N	0.000029	D	0.96414	0.8830	L	0.60455	1.87	0.09310	N	1	P;P;B	0.45283	0.855;0.511;0.0	B;B;B	0.37780	0.258;0.19;0.001	D	0.90665	0.4593	10	0.45353	T	0.12	.	0.643	0.00813	0.1961:0.2637:0.2666:0.2736	.	17;68;68	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	H	68;68;68;17	ENSP00000377140:Q68H;ENSP00000410070:Q68H;ENSP00000272602:Q68H;ENSP00000386761:Q17H	ENSP00000272602:Q68H	Q	+	3	2	CNGA3	98360684	0.031000	0.19500	0.000000	0.03702	0.013000	0.08279	-0.110000	0.10824	-0.243000	0.09653	0.655000	0.94253	CAG		0.602	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
DMXL2	23312	hgsc.bcm.edu	37	15	51791851	51791851	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr15:51791851A>T	ENST00000251076.5	-	18	3857	c.3570T>A	c.(3568-3570)aaT>aaA	p.N1190K	DMXL2_ENST00000449909.3_Intron|RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.N1190K	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1190						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.N1190K(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ACATGAAGATATTCGCACCGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	15											83.0	75.0	78.0					15																	51791851		2195	4293	6488	49579143	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.3570T>A	15.37:g.51791851A>T	ENSP00000251076:p.Asn1190Lys	Somatic		WXS	SOLID	Phase_III	49579143	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	A	5.122	0.208097	0.09704	.	.	ENSG00000104093	ENST00000251076;ENST00000543779	T;T	0.18502	2.21;2.21	5.24	1.59	0.23543	.	0.085770	0.85682	D	0.000000	T	0.09247	0.0228	N	0.05534	-0.03	0.80722	D	1	B;D	0.57899	0.28;0.981	B;P	0.50082	0.075;0.63	T	0.14811	-1.0459	10	0.02654	T	1	.	9.6225	0.39730	0.6558:0.0:0.3442:0.0	.	1190;1190	F5GWF1;Q8TDJ6	.;DMXL2_HUMAN	K	1190	ENSP00000251076:N1190K;ENSP00000441858:N1190K	ENSP00000251076:N1190K	N	-	3	2	DMXL2	49579143	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.019000	0.30014	0.327000	0.23409	0.482000	0.46254	AAT		0.413	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
FAM102A	399665	hgsc.bcm.edu	37	9	130716122	130716122	+	Silent	SNP	G	G	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr9:130716122G>A	ENST00000373095.1	-	2	604	c.229C>T	c.(229-231)Ctg>Ttg	p.L77L		NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	77								p.L77L(1)		breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						GGGTCCAGCAGGCCGGTGGCC	0.632																																																1	Substitution - coding silent(1)	ovary(1)	9											99.0	100.0	99.0					9																	130716122		2203	4300	6503	129755943	SO:0001819	synonymous_variant	399665				CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.229C>T	9.37:g.130716122G>A		Somatic		WXS	SOLID	Phase_III	129755943	A2A329|Q8TEL4	Silent	SNP	ENST00000373095.1	37	CCDS35150.1																																																																																				0.632	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054298.2		
GPR4	2828	hgsc.bcm.edu	37	19	46094160	46094160	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr19:46094160G>T	ENST00000323040.4	-	2	1909	c.965C>A	c.(964-966)aCc>aAc	p.T322N	GPR4_ENST00000591614.1_5'Flank|OPA3_ENST00000544371.1_Intron	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	322					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T322N(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		GGTCTCCAGGGTGAGCGAGGC	0.667																																					Esophageal Squamous(117;181 1612 1673 14956 42937)											1	Substitution - Missense(1)	ovary(1)	19											94.0	85.0	88.0					19																	46094160		2203	4300	6503	50786000	SO:0001583	missense	2828			BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.965C>A	19.37:g.46094160G>T	ENSP00000319744:p.Thr322Asn	Somatic		WXS	SOLID	Phase_III	50786000	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000323040.4	37	CCDS12669.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787343	0.70337	.	.	ENSG00000177464	ENST00000323040	T	0.61859	0.07	4.53	4.53	0.55603	.	0.000000	0.64402	D	0.000002	T	0.47248	0.1435	N	0.08118	0	0.46823	D	0.999213	D	0.67145	0.996	P	0.53649	0.731	T	0.49579	-0.8925	10	0.37606	T	0.19	.	12.6317	0.56661	0.0:0.0:1.0:0.0	.	322	P46093	GPR4_HUMAN	N	322	ENSP00000319744:T322N	ENSP00000319744:T322N	T	-	2	0	GPR4	50786000	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	6.903000	0.75703	2.356000	0.79943	0.455000	0.32223	ACC		0.667	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459603.1	NM_005282	
GTF2IRD1	9569	hgsc.bcm.edu	37	7	74005218	74005218	+	Silent	SNP	C	C	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr7:74005218C>T	ENST00000265755.3	+	24	2901	c.2508C>T	c.(2506-2508)gaC>gaT	p.D836D	GTF2IRD1_ENST00000455841.2_Silent_p.D853D|GTF2IRD1_ENST00000476977.1_Silent_p.D821D|GTF2IRD1_ENST00000424337.2_Silent_p.D821D	NM_005685.3|NM_016328.2	NP_005676.3|NP_057412.1	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1	836					multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transition between slow and fast fiber (GO:0014886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D836D(2)		NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(19)|ovary(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ACAGCCCAGACGCCGTGGAGG	0.602																																																2	Substitution - coding silent(2)	ovary(2)	7											61.0	55.0	57.0					7																	74005218		2203	4300	6503	73643154	SO:0001819	synonymous_variant	9569			AF151354	CCDS5571.1, CCDS47613.1, CCDS56492.1	7q11.23	2008-04-18	2002-01-14		ENSG00000006704	ENSG00000006704			4661	protein-coding gene	gene with protein product	"""binding factor for early enhancer"""	604318	"""GTF2I repeat domain-containing 1"""	WBSCR11		9774679, 10198167	Standard	NM_016328		Approved	MusTRD1, RBAP2, GTF3, WBSCR12, BEN, Cream1	uc010lbq.3	Q9UHL9	OTTHUMG00000023782	ENST00000265755.3:c.2508C>T	7.37:g.74005218C>T		Somatic		WXS	SOLID	Phase_III	73643154	O95444|Q6DSU6|Q75MX7|Q86UM3|Q8WVC4|Q9UHK8|Q9UI91	Silent	SNP	ENST00000265755.3	37	CCDS5571.1	.	.	.	.	.	.	.	.	.	.	C	1.456	-0.563771	0.03939	.	.	ENSG00000006704	ENST00000470715	.	.	.	5.51	-11.0	0.00169	.	.	.	.	.	T	0.59418	0.2192	.	.	.	0.41778	D	0.989804	.	.	.	.	.	.	T	0.76865	-0.2801	4	.	.	.	-17.5779	15.5739	0.76359	0.0808:0.6979:0.0818:0.1395	.	.	.	.	C	199	.	.	R	+	1	0	GTF2IRD1	73643154	0.000000	0.05858	0.017000	0.16124	0.205000	0.24178	-3.385000	0.00489	-3.796000	0.00106	-2.069000	0.00389	CGC		0.602	GTF2IRD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252654.2	NM_016328	
IFI6	2537	hgsc.bcm.edu	37	1	27992950	27992950	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:27992950C>G	ENST00000361157.6	-	5	462	c.335G>C	c.(334-336)gGt>gCt	p.G112A	IFI6_ENST00000362020.4_Missense_Mutation_p.G116A|IFI6_ENST00000339145.4_Missense_Mutation_p.G120A	NM_002038.3|NM_022872.2|NM_022873.2	NP_002029.3|NP_075010.1|NP_075011.1	P09912	IFI6_HUMAN	interferon, alpha-inducible protein 6	112					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of mitochondrial depolarization (GO:0051902)|release of cytochrome c from mitochondria (GO:0001836)|type I interferon signaling pathway (GO:0060337)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)		p.G112A(1)		lung(1)|ovary(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;7.75e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CATCAGGGCACCAATATTACC	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											78.0	68.0	71.0					1																	27992950		2203	4300	6503	27865537	SO:0001583	missense	2537			BC015603	CCDS306.1, CCDS307.1, CCDS308.1	1p35	2008-02-05	2006-04-21	2006-04-21	ENSG00000126709	ENSG00000126709			4054	protein-coding gene	gene with protein product		147572	"""interferon, alpha-inducible protein (clone IFI-6-16)"""	G1P3			Standard	NM_002038		Approved	IFI616, FAM14C, 6-16, IFI-6-16	uc001bon.1	P09912	OTTHUMG00000003518	ENST00000361157.6:c.335G>C	1.37:g.27992950C>G	ENSP00000354736:p.Gly112Ala	Somatic		WXS	SOLID	Phase_III	27865537	Q13141|Q13142|Q5VVR2|Q5VVR3|Q6IE95|Q969M8	Missense_Mutation	SNP	ENST00000361157.6	37	CCDS306.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.693720	0.48202	.	.	ENSG00000126709	ENST00000361157;ENST00000339145;ENST00000362020	T;T;T	0.41065	1.01;1.01;1.01	2.49	2.49	0.30216	.	0.065662	0.64402	D	0.000011	T	0.62024	0.2394	M	0.83953	2.67	0.19300	N	0.999971	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.91635	0.999;0.999;0.997	T	0.49854	-0.8895	10	0.72032	D	0.01	.	8.6193	0.33851	0.0:1.0:0.0:0.0	.	116;112;120	Q5VVR2;P09912;P09912-3	.;IFI6_HUMAN;.	A	112;120;116	ENSP00000354736:G112A;ENSP00000342513:G120A;ENSP00000355152:G116A	ENSP00000342513:G120A	G	-	2	0	IFI6	27865537	0.038000	0.19896	0.163000	0.22734	0.063000	0.16089	2.054000	0.41335	1.721000	0.51461	0.655000	0.94253	GGT		0.547	IFI6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009780.1	NM_022873	
INADL	10207	hgsc.bcm.edu	37	1	62365312	62365312	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:62365312G>T	ENST00000371158.2	+	23	3303	c.3189G>T	c.(3187-3189)tgG>tgT	p.W1063C	INADL_ENST00000316485.6_Missense_Mutation_p.W1063C	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1063					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.W1063C(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						TTAGCCACTGGGGTCCACCGA	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											169.0	167.0	168.0					1																	62365312		2203	4300	6503	62137900	SO:0001583	missense	10207			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3189G>T	1.37:g.62365312G>T	ENSP00000360200:p.Trp1063Cys	Somatic		WXS	SOLID	Phase_III	62137900	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869669	0.72065	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.41758	0.99;0.99	5.26	5.26	0.73747	PDZ/DHR/GLGF (1);	0.000000	0.64402	D	0.000001	T	0.67785	0.2930	M	0.78801	2.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.71167	-0.4672	10	0.72032	D	0.01	.	19.2911	0.94100	0.0:0.0:1.0:0.0	.	1063;1063;1063	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	C	1063	ENSP00000360200:W1063C;ENSP00000326199:W1063C	ENSP00000255202:W1063C	W	+	3	0	INADL	62137900	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	8.440000	0.90311	2.636000	0.89361	0.579000	0.79373	TGG		0.398	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
IVNS1ABP	10625	hgsc.bcm.edu	37	1	185270654	185270654	+	Silent	SNP	G	G	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:185270654G>A	ENST00000367498.3	-	9	1429	c.807C>T	c.(805-807)agC>agT	p.S269S	IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_Silent_p.S51S	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	269	Sufficient for AHR interaction and signaling.				negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)		p.S269S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						CAGTTGAACTGCTACTTATCT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	1											254.0	229.0	238.0					1																	185270654		2203	4300	6503	183537277	SO:0001819	synonymous_variant	10625			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.807C>T	1.37:g.185270654G>A		Somatic		WXS	SOLID	Phase_III	183537277	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Silent	SNP	ENST00000367498.3	37	CCDS1368.1																																																																																				0.408	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085774.1	NM_006469	
KAL1	3730	hgsc.bcm.edu	37	X	8555963	8555963	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chrX:8555963G>T	ENST00000262648.3	-	5	747	c.598C>A	c.(598-600)Ctg>Atg	p.L200M		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	200	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.L200M(1)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						TTAACCTCCAGCTGTCCAGAC	0.428																																																1	Substitution - Missense(1)	ovary(1)	X											82.0	69.0	73.0					X																	8555963		2203	4300	6503	8515963	SO:0001583	missense	3730				CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.598C>A	X.37:g.8555963G>T	ENSP00000262648:p.Leu200Met	Somatic		WXS	SOLID	Phase_III	8515963	B2RPF8	Missense_Mutation	SNP	ENST00000262648.3	37	CCDS14130.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964037	0.53507	.	.	ENSG00000011201	ENST00000262648	T	0.58358	0.34	4.05	3.13	0.36017	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.67664	0.2917	M	0.67953	2.075	0.46028	D	0.998825	D	0.89917	1.0	D	0.97110	1.0	T	0.71290	-0.4637	10	0.72032	D	0.01	.	11.5453	0.50690	0.0:0.0:0.8213:0.1787	.	200	P23352	KALM_HUMAN	M	200	ENSP00000262648:L200M	ENSP00000262648:L200M	L	-	1	2	KAL1	8515963	1.000000	0.71417	0.908000	0.35775	0.970000	0.65996	4.409000	0.59768	1.633000	0.50488	0.600000	0.82982	CTG		0.428	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216	
KIAA1217	56243	hgsc.bcm.edu	37	10	24832403	24832403	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr10:24832403G>T	ENST00000376454.3	+	19	4234	c.4204G>T	c.(4204-4206)Gat>Tat	p.D1402Y	KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.D1085Y|KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000396446.1_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1402					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.D1402Y(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GGAGGTGCATGATATTGTTAG	0.458																																																1	Substitution - Missense(1)	ovary(1)	10											91.0	90.0	91.0					10																	24832403		2203	4300	6503	24872409	SO:0001583	missense	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.4204G>T	10.37:g.24832403G>T	ENSP00000365637:p.Asp1402Tyr	Somatic		WXS	SOLID	Phase_III	24872409	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308782	0.40895	.	.	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000450158;ENST00000376451	T;T	0.35605	1.72;1.3	5.66	5.66	0.87406	.	0.172862	0.48767	D	0.000173	T	0.59918	0.2229	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.70935	0.971;0.971;0.939	T	0.60885	-0.7174	10	0.87932	D	0	.	19.7465	0.96253	0.0:0.0:1.0:0.0	.	1085;1085;1402	C9JRK3;Q5T5P2-3;Q5T5P2	.;.;SKT_HUMAN	Y	1085;1402;1085;1085	ENSP00000365637:D1402Y;ENSP00000365634:D1085Y	ENSP00000365634:D1085Y	D	+	1	0	KIAA1217	24872409	1.000000	0.71417	0.086000	0.20670	0.015000	0.08874	7.503000	0.81632	2.680000	0.91292	0.561000	0.74099	GAT		0.458	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
LAMA1	284217	hgsc.bcm.edu	37	18	6986307	6986307	+	Silent	SNP	G	G	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr18:6986307G>A	ENST00000389658.3	-	37	5301	c.5208C>T	c.(5206-5208)taC>taT	p.Y1736Y		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1736	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.Y1736Y(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GCGGCTTCTGGTAATTTTCCT	0.423																																																1	Substitution - coding silent(1)	ovary(1)	18											83.0	79.0	80.0					18																	6986307		2203	4300	6503	6976307	SO:0001819	synonymous_variant	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5208C>T	18.37:g.6986307G>A		Somatic		WXS	SOLID	Phase_III	6976307		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																				0.423	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
MAN2B2	23324	hgsc.bcm.edu	37	4	6619181	6619181	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr4:6619181G>T	ENST00000285599.3	+	17	2812	c.2776G>T	c.(2776-2778)Gac>Tac	p.D926Y	MAN2B2_ENST00000504248.1_Missense_Mutation_p.D875Y	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	926					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.D926Y(1)		breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						AGTGGGCGAGGACCCAGTCCT	0.597																																																1	Substitution - Missense(1)	ovary(1)	4											83.0	69.0	74.0					4																	6619181		2203	4300	6503	6670082	SO:0001583	missense	23324			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.2776G>T	4.37:g.6619181G>T	ENSP00000285599:p.Asp926Tyr	Somatic		WXS	SOLID	Phase_III	6670082	Q66MP2|Q86T67	Missense_Mutation	SNP	ENST00000285599.3	37	CCDS33951.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.44|15.44	2.833149|2.833149	0.50951|0.50951	.|.	.|.	ENSG00000013288|ENSG00000013288	ENST00000285599;ENST00000504248|ENST00000505907	D;D|.	0.85171|.	-1.95;-1.95|.	4.88|4.88	1.26|1.26	0.21427|0.21427	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);|.	0.056918|.	0.64402|.	D|.	0.000002|.	T|T	0.74238|0.74238	0.3690|0.3690	M|M	0.79926|0.79926	2.475|2.475	0.40114|0.40114	D|D	0.97652|0.97652	D;D;D|.	0.71674|.	0.996;0.998;0.991|.	D;D;P|.	0.68621|.	0.935;0.959;0.879|.	T|T	0.74822|0.74822	-0.3534|-0.3534	10|5	0.66056|.	D|.	0.02|.	-20.7711|-20.7711	15.2077|15.2077	0.73192|0.73192	0.0:0.5572:0.4428:0.0|0.0:0.5572:0.4428:0.0	.|.	875;926;926|.	E9PCD7;Q9Y2E5;Q9Y2E5-2|.	.;MA2B2_HUMAN;.|.	Y|S	926;875|924	ENSP00000285599:D926Y;ENSP00000423129:D875Y|.	ENSP00000285599:D926Y|.	D|R	+|+	1|3	0|2	MAN2B2|MAN2B2	6670082|6670082	1.000000|1.000000	0.71417|0.71417	0.347000|0.347000	0.25668|0.25668	0.718000|0.718000	0.41266|0.41266	2.210000|2.210000	0.42816|0.42816	-0.152000|-0.152000	0.11156|0.11156	0.655000|0.655000	0.94253|0.94253	GAC|AGG		0.597	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274	
MYCL	4610	hgsc.bcm.edu	37	1	40363242	40363242	+	Silent	SNP	C	C	G	rs371566708		TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:40363242C>G	ENST00000372816.2	-	2	1344	c.897G>C	c.(895-897)tcG>tcC	p.S299S	RP1-118J21.5_ENST00000418255.1_RNA|MYCL_ENST00000397332.2_Silent_p.S329S			P12524	MYCL_HUMAN	v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog	299	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S329S(1)									CCAAGAATCGCGAACGCAGGT	0.567																																																1	Substitution - coding silent(1)	ovary(1)	1											77.0	76.0	76.0					1																	40363242		2203	4300	6503	40135829	SO:0001819	synonymous_variant	4610				CCDS30682.1, CCDS44117.1, CCDS44117.2, CCDS53300.1	1p34.3	2013-07-09	2013-07-09	2013-07-09	ENSG00000116990	ENSG00000116990		"""Basic helix-loop-helix proteins"""	7555	protein-coding gene	gene with protein product	"""l-myc protein"", ""myc-related gene from lung cancer"", ""oncogene lmyc"""	164850	"""v-myc avian myelocytomatosis viral oncogene homolog 1, lung carcinoma derived"""	MYCL1		8978772	Standard	NM_001033082		Approved	LMYC, bHLHe38	uc001cer.2	P12524	OTTHUMG00000009243	ENST00000372816.2:c.897G>C	1.37:g.40363242C>G		Somatic		WXS	SOLID	Phase_III	40135829	A2A2C9|B4DJH2|Q14897|Q5QPL0|Q5QPL1|Q9NUE9	Silent	SNP	ENST00000372816.2	37	CCDS30682.1																																																																																				0.567	MYCL-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277004.1	NM_001033082	
MFSD2A	84879	hgsc.bcm.edu	37	1	40422814	40422814	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:40422814C>G	ENST00000372809.5	+	2	292	c.149C>G	c.(148-150)gCa>gGa	p.A50G	MFSD2A_ENST00000372811.5_Missense_Mutation_p.A50G|MFSD2A_ENST00000420632.2_Intron	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A	50					establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)	p.A50G(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CTTTGCTATGCACTTGGGGGA	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											196.0	209.0	205.0					1																	40422814		2203	4300	6503	40195401	SO:0001583	missense	84879			AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.149C>G	1.37:g.40422814C>G	ENSP00000361895:p.Ala50Gly	Somatic		WXS	SOLID	Phase_III	40195401	A8K675|Q6UWU5|Q96F59|Q9BRC8	Missense_Mutation	SNP	ENST00000372809.5	37	CCDS44118.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.185721	0.38609	.	.	ENSG00000168389	ENST00000372811;ENST00000434861;ENST00000372809	D;D;D	0.83673	-1.75;-1.75;-1.75	4.86	4.86	0.63082	Major facilitator superfamily domain, general substrate transporter (1);	0.051554	0.85682	D	0.000000	T	0.76586	0.4008	L	0.28740	0.885	0.80722	D	1	P;P	0.42735	0.788;0.562	P;B	0.46076	0.503;0.315	T	0.73839	-0.3856	10	0.02654	T	1	-10.8441	16.9853	0.86338	0.0:1.0:0.0:0.0	.	50;50	Q8NA29;Q8NA29-2	MFS2A_HUMAN;.	G	50;48;50	ENSP00000361898:A50G;ENSP00000407606:A48G;ENSP00000361895:A50G	ENSP00000361895:A50G	A	+	2	0	MFSD2A	40195401	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	4.408000	0.59761	2.250000	0.74265	0.462000	0.41574	GCA		0.512	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025756.1	NM_032793	
MYPN	84665	hgsc.bcm.edu	37	10	69926392	69926392	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr10:69926392G>C	ENST00000358913.5	+	10	2430	c.1942G>C	c.(1942-1944)Gag>Cag	p.E648Q	MYPN_ENST00000540630.1_Missense_Mutation_p.E648Q|MYPN_ENST00000354393.2_Missense_Mutation_p.E373Q	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	648					sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.E648Q(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						CCCCGTGAAAGAGCCCCCTCC	0.498																																																1	Substitution - Missense(1)	ovary(1)	10											38.0	38.0	38.0					10																	69926392		2203	4300	6503	69596398	SO:0001583	missense	84665			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1942G>C	10.37:g.69926392G>C	ENSP00000351790:p.Glu648Gln	Somatic		WXS	SOLID	Phase_III	69596398	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.877458	0.91664	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.61980	0.06;0.14;0.12	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.79913	0.4528	M	0.74881	2.28	0.54753	D	0.999987	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.85130	0.994;0.997;0.994	T	0.79667	-0.1708	9	.	.	.	.	19.2596	0.93962	0.0:0.0:1.0:0.0	.	648;373;648	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	Q	373;373;648;648	ENSP00000346369:E373Q;ENSP00000351790:E648Q;ENSP00000441668:E648Q	.	E	+	1	0	MYPN	69596398	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.164000	0.94755	2.543000	0.85770	0.655000	0.94253	GAG		0.498	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
NFASC	23114	hgsc.bcm.edu	37	1	204939827	204939827	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:204939827A>T	ENST00000401399.1	+	10	1286	c.1087A>T	c.(1087-1089)Aac>Tac	p.N363Y	NFASC_ENST00000403080.1_Missense_Mutation_p.N363Y|NFASC_ENST00000360049.4_Missense_Mutation_p.N374Y|NFASC_ENST00000539706.1_Missense_Mutation_p.N374Y|NFASC_ENST00000339876.6_Missense_Mutation_p.N363Y|NFASC_ENST00000404076.1_Missense_Mutation_p.N357Y|NFASC_ENST00000367170.4_Missense_Mutation_p.N363Y|NFASC_ENST00000404907.1_Missense_Mutation_p.N374Y|NFASC_ENST00000367171.4_Missense_Mutation_p.N363Y|NFASC_ENST00000338515.6_Missense_Mutation_p.N363Y|NFASC_ENST00000367169.4_Missense_Mutation_p.N363Y|NFASC_ENST00000513543.1_Missense_Mutation_p.N374Y|NFASC_ENST00000338586.6_Missense_Mutation_p.N363Y|NFASC_ENST00000367172.4_Missense_Mutation_p.N363Y			O94856	NFASC_HUMAN	neurofascin	363	Ig-like C2-type 4.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.N374Y(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGCCAATGGAAACCCCAAACC	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											126.0	101.0	110.0					1																	204939827		2203	4300	6503	203206450	SO:0001583	missense	23114			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1087A>T	1.37:g.204939827A>T	ENSP00000385637:p.Asn363Tyr	Somatic		WXS	SOLID	Phase_III	203206450	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	31|31	5.075579|5.075579	0.94000|0.94000	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367173|ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.68025	.|-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	.|0.000000	.|0.64402	.|D	.|0.000015	T|T	0.77350|0.77350	0.4117|0.4117	L|L	0.52126|0.52126	1.63|1.63	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;D;D;D	.|0.76494	.|0.999;0.998;0.999;0.999;0.993;0.999;0.999	.|D;P;D;D;P;P;D	.|0.70716	.|0.915;0.811;0.97;0.928;0.682;0.898;0.943	T|T	0.79017|0.79017	-0.1975|-0.1975	5|10	.|0.62326	.|D	.|0.03	.|.	15.5193|15.5193	0.75854|0.75854	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|374;374;459;363;363;374;363	.|O94856-11;O94856-8;B4DRH7;F8W791;O94856-9;O94856-3;O94856-2	.|.;.;.;.;.;.;.	D|Y	332|363;363;363;363;363;363;374;374;374;363;363;357;363;374;374;350	.|ENSP00000356140:N363Y;ENSP00000356139:N363Y;ENSP00000356138:N363Y;ENSP00000342128:N363Y;ENSP00000344786:N363Y;ENSP00000343509:N363Y;ENSP00000438614:N374Y;ENSP00000353154:N374Y;ENSP00000356137:N363Y;ENSP00000384875:N363Y;ENSP00000385676:N357Y;ENSP00000385637:N363Y;ENSP00000384061:N374Y;ENSP00000425908:N374Y;ENSP00000415031:N350Y	.|ENSP00000295776:N374Y	E|N	+|+	3|1	2|0	NFASC|NFASC	203206450|203206450	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.234000|9.234000	0.95347|0.95347	2.147000|2.147000	0.66899|0.66899	0.533000|0.533000	0.62120|0.62120	GAA|AAC		0.532	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
PGBD1	84547	hgsc.bcm.edu	37	6	28269538	28269538	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr6:28269538T>G	ENST00000405948.2	+	7	2327	c.1907T>G	c.(1906-1908)tTg>tGg	p.L636W	PGBD1_ENST00000259883.3_Missense_Mutation_p.L636W	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	636						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L636W(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						GTCAAATTGTTGTCAGCCTTG	0.403																																																1	Substitution - Missense(1)	ovary(1)	6											117.0	114.0	115.0					6																	28269538		2203	4300	6503	28377517	SO:0001583	missense	84547			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1907T>G	6.37:g.28269538T>G	ENSP00000385213:p.Leu636Trp	Somatic		WXS	SOLID	Phase_III	28377517	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	T	16.34	3.095290	0.56075	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.19669	2.13;2.13	4.84	4.84	0.62591	.	1.035590	0.07743	N	0.947310	T	0.25306	0.0615	L	0.48642	1.525	0.27343	N	0.956454	D	0.59357	0.985	D	0.64687	0.928	T	0.14144	-1.0483	10	0.56958	D	0.05	-9.0839	11.0071	0.47641	0.0:0.0:0.0:1.0	.	636	Q96JS3	PGBD1_HUMAN	W	636	ENSP00000385213:L636W;ENSP00000259883:L636W	ENSP00000259883:L636W	L	+	2	0	PGBD1	28377517	0.951000	0.32395	0.801000	0.32222	0.753000	0.42808	4.339000	0.59322	2.167000	0.68274	0.533000	0.62120	TTG		0.403	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2		
PPHLN1	51535	hgsc.bcm.edu	37	12	42729719	42729719	+	Silent	SNP	A	A	C			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr12:42729719A>C	ENST00000395568.2	+	2	99	c.15A>C	c.(13-15)ggA>ggC	p.G5G	PPHLN1_ENST00000550535.1_3'UTR|PPHLN1_ENST00000337898.6_Silent_p.G5G|PPHLN1_ENST00000432191.2_Silent_p.G5G|PPHLN1_ENST00000256678.8_Intron|PPHLN1_ENST00000358314.7_Silent_p.G5G|PPHLN1_ENST00000552761.1_Silent_p.G12G|PPHLN1_ENST00000395580.3_Silent_p.G12G|PPHLN1_ENST00000449194.2_Silent_p.G5G|PPHLN1_ENST00000549190.1_Silent_p.G23G|PPHLN1_ENST00000317560.9_Silent_p.G12G	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	5					keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G5G(1)		breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		GGTCTGAGGGACGATATGAAT	0.378																																																1	Substitution - coding silent(1)	ovary(1)	12											132.0	134.0	133.0					12																	42729719		2203	4300	6503	41015986	SO:0001819	synonymous_variant	51535			AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.15A>C	12.37:g.42729719A>C		Somatic		WXS	SOLID	Phase_III	41015986	E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Silent	SNP	ENST00000395568.2	37	CCDS31777.1																																																																																				0.378	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404047.1	NM_201515	
RND1	27289	hgsc.bcm.edu	37	12	49259510	49259510	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr12:49259510C>A	ENST00000309739.5	-	1	171	c.41G>T	c.(40-42)tGt>tTt	p.C14F		NM_014470.3	NP_055285.1	Q92730	RND1_HUMAN	Rho family GTPase 1	14					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|GTP catabolic process (GO:0006184)|negative regulation of cell adhesion (GO:0007162)|neuron remodeling (GO:0016322)|small GTPase mediated signal transduction (GO:0007264)	adherens junction (GO:0005912)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)	p.C14F(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(2)|skin(1)|urinary_tract(1)	10						AACGAGCTTACATCTGGCCAC	0.617																																																1	Substitution - Missense(1)	ovary(1)	12											100.0	82.0	88.0					12																	49259510		2203	4300	6503	47545777	SO:0001583	missense	27289			Y07923	CCDS8771.1	12q12	2008-01-23				ENSG00000172602			18314	protein-coding gene	gene with protein product	"""ras homolog gene family, member S"""	609038				9531558	Standard	NM_014470		Approved	Rho6, ARHS, RHOS	uc001rsn.3	Q92730	OTTHUMG00000170400	ENST00000309739.5:c.41G>T	12.37:g.49259510C>A	ENSP00000308461:p.Cys14Phe	Somatic		WXS	SOLID	Phase_III	47545777	A8K9P7	Missense_Mutation	SNP	ENST00000309739.5	37	CCDS8771.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216028	0.79352	.	.	ENSG00000172602	ENST00000309739	T	0.67523	-0.27	4.94	4.94	0.65067	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.65491	0.2696	N	0.04090	-0.28	0.80722	D	1	D	0.65815	0.995	D	0.74674	0.984	T	0.74349	-0.3694	10	0.59425	D	0.04	-3.3364	17.5205	0.87786	0.0:1.0:0.0:0.0	.	14	Q92730	RND1_HUMAN	F	14	ENSP00000308461:C14F	ENSP00000308461:C14F	C	-	2	0	RND1	47545777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.958000	0.76025	2.753000	0.94483	0.650000	0.86243	TGT		0.617	RND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408915.1	NM_014470	
RNF128	79589	hgsc.bcm.edu	37	X	106034427	106034427	+	Silent	SNP	A	A	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chrX:106034427A>G	ENST00000255499.2	+	6	1366	c.1116A>G	c.(1114-1116)acA>acG	p.T372T	RNF128_ENST00000324342.3_Silent_p.T346T	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	372					negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T372T(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						TACAGGGAACAGATGAACCGC	0.453																																																1	Substitution - coding silent(1)	ovary(1)	X											191.0	169.0	176.0					X																	106034427		2203	4300	6503	105921083	SO:0001819	synonymous_variant	79589			AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.1116A>G	X.37:g.106034427A>G		Somatic		WXS	SOLID	Phase_III	105921083	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Silent	SNP	ENST00000255499.2	37	CCDS14521.1																																																																																				0.453	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	
SARS2	54938	hgsc.bcm.edu	37	19	39421226	39421226	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr19:39421226C>A	ENST00000221431.6	-	1	310	c.151G>T	c.(151-153)Ggc>Tgc	p.G51C	SARS2_ENST00000600042.1_Missense_Mutation_p.G51C|SARS2_ENST00000430193.3_Missense_Mutation_p.G51C|MRPS12_ENST00000308018.4_5'UTR|SARS2_ENST00000594171.1_5'Flank|SARS2_ENST00000448145.2_Intron|CTC-360G5.8_ENST00000599996.1_Intron|MRPS12_ENST00000407800.2_5'Flank|MRPS12_ENST00000402029.3_5'Flank	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	51					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)	p.G51C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCGCTGTAGCCCTCGCGCGCA	0.627											OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	19											96.0	83.0	88.0					19																	39421226		2203	4300	6503	44113066	SO:0001583	missense	54938			AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.151G>T	19.37:g.39421226C>A	ENSP00000221431:p.Gly51Cys	Somatic	885	WXS	SOLID	Phase_III	44113066	A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	37	CCDS33017.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.451009	0.84209	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000455102	T;T;T	0.57752	0.38;0.38;0.63	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.72252	0.3437	M	0.73598	2.24	.	.	.	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.966	T	0.76271	-0.3020	9	0.87932	D	0	.	15.093	0.72211	0.0:1.0:0.0:0.0	.	51;51;51	B4DJP6;B4DE10;Q9NP81	.;.;SYSM_HUMAN	C	51	ENSP00000406754:G51C;ENSP00000221431:G51C;ENSP00000414954:G51C	ENSP00000221431:G51C	G	-	1	0	FBXO17	44113066	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	5.354000	0.66040	2.941000	0.99782	0.655000	0.94253	GGC		0.627	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
SLC23A2	9962	hgsc.bcm.edu	37	20	4837800	4837800	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr20:4837800C>G	ENST00000379333.1	-	17	2163	c.1771G>C	c.(1771-1773)Ggg>Cgg	p.G591R	SLC23A2_ENST00000338244.1_Missense_Mutation_p.G591R|SLC23A2_ENST00000424750.2_Missense_Mutation_p.G477R	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	591					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.G591R(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GATTTGTTCCCTTTGCCCACA	0.453																																																1	Substitution - Missense(1)	ovary(1)	20											213.0	190.0	198.0					20																	4837800		2203	4300	6503	4785800	SO:0001583	missense	9962			AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1771G>C	20.37:g.4837800C>G	ENSP00000368637:p.Gly591Arg	Somatic		WXS	SOLID	Phase_III	4785800	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	ENST00000379333.1	37	CCDS13085.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.202086	0.38905	.	.	ENSG00000089057	ENST00000379333;ENST00000338244;ENST00000424750	T;T;T	0.17691	2.26;2.26;2.28	5.6	5.6	0.85130	.	0.052292	0.85682	D	0.000000	T	0.16896	0.0406	N	0.12637	0.245	0.80722	D	1	P;B	0.48162	0.906;0.001	P;B	0.49752	0.621;0.003	T	0.07578	-1.0765	10	0.27082	T	0.32	-12.8276	18.1739	0.89756	0.0:1.0:0.0:0.0	.	477;591	B4DJZ1;Q9UGH3	.;S23A2_HUMAN	R	591;591;477	ENSP00000368637:G591R;ENSP00000344322:G591R;ENSP00000406601:G477R	ENSP00000344322:G591R	G	-	1	0	SLC23A2	4785800	1.000000	0.71417	1.000000	0.80357	0.493000	0.33554	5.347000	0.65998	2.642000	0.89623	0.563000	0.77884	GGG		0.453	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
TMED6	146456	hgsc.bcm.edu	37	16	69377331	69377331	+	Silent	SNP	A	A	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr16:69377331A>G	ENST00000288025.3	-	4	757	c.702T>C	c.(700-702)gaT>gaC	p.D234D	RP11-343C2.7_ENST00000564737.1_Intron|RP11-343C2.9_ENST00000563634.1_Intron	NM_144676.3	NP_653277.2	Q8WW62	TMED6_HUMAN	transmembrane emp24 protein transport domain containing 6	234					transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.D234D(1)		breast(1)|endometrium(2)|kidney(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	9						GCTTCTTTGTATCTGTAGTTG	0.428																																																1	Substitution - coding silent(1)	ovary(1)	16											113.0	109.0	110.0					16																	69377331		2198	4300	6498	67934832	SO:0001819	synonymous_variant	146456			BC020827	CCDS10878.1	16q22.1	2008-02-05			ENSG00000157315	ENSG00000157315			28331	protein-coding gene	gene with protein product						12477932	Standard	NM_144676		Approved	MGC23911	uc002exc.2	Q8WW62	OTTHUMG00000137571	ENST00000288025.3:c.702T>C	16.37:g.69377331A>G		Somatic		WXS	SOLID	Phase_III	67934832	Q6UXN5	Silent	SNP	ENST00000288025.3	37	CCDS10878.1																																																																																				0.428	TMED6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268951.1	NM_144676	
VIT	5212	hgsc.bcm.edu	37	2	37010538	37010538	+	Silent	SNP	A	A	G	rs145378979		TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr2:37010538A>G	ENST00000389975.3	+	10	1160	c.858A>G	c.(856-858)ggA>ggG	p.G286G	VIT_ENST00000404084.1_Silent_p.G238G|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000401530.1_Intron|VIT_ENST00000379242.3_Silent_p.G301G|VIT_ENST00000379241.3_Silent_p.G264G	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	286					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)	p.G301G(1)		autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				TATCCCTGGGAGATCCAAGTA	0.453																																																1	Substitution - coding silent(1)	ovary(1)	2											92.0	85.0	87.0					2																	37010538		2203	4300	6503	36864042	SO:0001819	synonymous_variant	5212			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.858A>G	2.37:g.37010538A>G		Somatic		WXS	SOLID	Phase_III	36864042	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Silent	SNP	ENST00000389975.3	37	CCDS54347.1	.	.	.	.	.	.	.	.	.	.	A	10.48	1.362025	0.24684	.	.	ENSG00000205221	ENST00000464309	.	.	.	5.91	4.73	0.59995	.	.	.	.	.	T	0.61615	0.2361	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58657	-0.7598	4	.	.	.	-14.5648	10.0551	0.42239	0.8309:0.1691:0.0:0.0	.	.	.	.	G	53	.	.	E	+	2	0	VIT	36864042	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.525000	0.53502	1.023000	0.39654	0.533000	0.62120	GAG		0.453	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			
DENND1A	57706	hgsc.bcm.edu	37	9	126392756	126392756	+	Splice_Site	SNP	C	C	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr9:126392756C>G	ENST00000373624.2	-	10	820		c.e10-1		DENND1A_ENST00000373620.3_Splice_Site|DENND1A_ENST00000394219.3_Splice_Site|DENND1A_ENST00000473039.1_Splice_Site|DENND1A_ENST00000542603.1_Splice_Site|DENND1A_ENST00000373618.1_Splice_Site|DENND1A_ENST00000394215.2_Splice_Site	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A						endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.?(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						AGGCAGTCAGCTGGAACAGAG	0.502																																																1	Unknown(1)	ovary(1)	9											29.0	26.0	27.0					9																	126392756		2202	4298	6500	125432577	SO:0001630	splice_region_variant	57706			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.619-1G>C	9.37:g.126392756C>G		Somatic		WXS	SOLID	Phase_III	125432577	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Splice_Site	SNP	ENST00000373624.2	37	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363734	0.82353	.	.	ENSG00000119522	ENST00000373624;ENST00000394219;ENST00000373620;ENST00000394215;ENST00000373618	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2509	0.90002	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DENND1A	125432577	1.000000	0.71417	0.998000	0.56505	0.861000	0.49209	7.631000	0.83237	2.536000	0.85505	0.655000	0.94253	.		0.502	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820	Intron
HTATSF1	27336	hgsc.bcm.edu	37	X	135579862	135579862	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chrX:135579862G>C	ENST00000218364.4	+	1	193	c.19G>C	c.(19-21)Gat>Cat	p.D7H	HTATSF1_ENST00000535601.1_Missense_Mutation_p.D7H	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	7					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D7H(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					CACCAACTTGGATGGGAACGA	0.542																																																1	Substitution - Missense(1)	ovary(1)	X											149.0	137.0	141.0					X																	135579862		2203	4300	6503	135407528	SO:0001583	missense	27336			U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.19G>C	X.37:g.135579862G>C	ENSP00000218364:p.Asp7His	Somatic		WXS	SOLID	Phase_III	135407528	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440751	0.43326	.	.	ENSG00000102241	ENST00000535601;ENST00000448450;ENST00000425695;ENST00000218364;ENST00000415377	T;T	0.27557	1.66;1.66	4.86	0.866	0.19079	.	0.562177	0.19447	N	0.114039	T	0.36991	0.0987	L	0.58101	1.795	0.09310	N	1	D	0.57571	0.98	P	0.52710	0.707	T	0.20706	-1.0267	10	0.72032	D	0.01	-1.9364	7.842	0.29403	0.501:0.0:0.499:0.0	.	7	O43719	HTSF1_HUMAN	H	7	ENSP00000442699:D7H;ENSP00000218364:D7H	ENSP00000218364:D7H	D	+	1	0	HTATSF1	135407528	0.432000	0.25554	0.243000	0.24186	0.495000	0.33615	1.588000	0.36633	-0.138000	0.11434	0.292000	0.19580	GAT		0.542	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
UNC79	57578	hgsc.bcm.edu	37	14	94063746	94063746	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr14:94063746T>C	ENST00000393151.2	+	24	3232	c.3232T>C	c.(3232-3234)Tca>Cca	p.S1078P	UNC79_ENST00000555664.1_Missense_Mutation_p.S1078P|UNC79_ENST00000553484.1_Missense_Mutation_p.S1078P|UNC79_ENST00000256339.4_Missense_Mutation_p.S901P			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1078					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S901P(1)		breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GGATATTCACTCAGTAACCAA	0.468																																																1	Substitution - Missense(1)	ovary(1)	14											131.0	114.0	120.0					14																	94063746		2203	4300	6503	93133499	SO:0001583	missense	57578			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3232T>C	14.37:g.94063746T>C	ENSP00000376858:p.Ser1078Pro	Somatic		WXS	SOLID	Phase_III	93133499	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	37		.	.	.	.	.	.	.	.	.	.	T	9.835	1.189363	0.21954	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.84	4.67	0.58626	.	0.138072	0.49916	D	0.000134	T	0.16300	0.0392	N	0.01352	-0.895	0.41614	D	0.988928	P	0.45827	0.867	P	0.49829	0.623	T	0.20605	-1.0270	10	0.14656	T	0.56	-6.5975	13.0067	0.58710	0.0:0.0:0.1349:0.8651	.	1078	C9JQL1	.	P	901;1078;1078;1078;1078	ENSP00000256339:S901P;ENSP00000450868:S1078P;ENSP00000451360:S1078P;ENSP00000376858:S1078P	ENSP00000256339:S901P	S	+	1	0	KIAA1409	93133499	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.267000	0.58877	1.002000	0.39104	0.528000	0.53228	TCA		0.468	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
LCT	3938	hgsc.bcm.edu	37	2	136575148	136575148	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr2:136575148C>A	ENST00000264162.2	-	6	1480	c.1470G>T	c.(1468-1470)gaG>gaT	p.E490D	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	490	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.E490D(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TGGCCATGGGCTCGATGCCCG	0.627																																																1	Substitution - Missense(1)	ovary(1)	2											74.0	61.0	65.0					2																	136575148		2203	4300	6503	136291618	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1470G>T	2.37:g.136575148C>A	ENSP00000264162:p.Glu490Asp	Somatic		WXS	SOLID	Phase_III	136291618	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	C	11.04	1.521620	0.27211	.	.	ENSG00000115850	ENST00000264162	T	0.55760	0.5	5.77	0.481	0.16809	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.447198	0.25119	N	0.032998	T	0.57315	0.2045	M	0.83384	2.64	0.34262	D	0.680062	B	0.31054	0.306	B	0.38985	0.287	T	0.64774	-0.6328	10	0.41790	T	0.15	-9.8147	10.8747	0.46904	0.0:0.516:0.0:0.484	.	490	P09848	LPH_HUMAN	D	490	ENSP00000264162:E490D	ENSP00000264162:E490D	E	-	3	2	LCT	136291618	0.284000	0.24287	0.508000	0.27688	0.246000	0.25737	0.084000	0.14891	0.095000	0.17434	-0.136000	0.14681	GAG		0.627	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
LGR6	59352	hgsc.bcm.edu	37	1	202249950	202249962	+	Frame_Shift_Del	DEL	GCTTCGAGGGGCT	GCTTCGAGGGGCT	-	rs144135845|rs546447981		TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	GCTTCGAGGGGCT	GCTTCGAGGGGCT	GCTTCGAGGGGCT	-	GCTTCGAGGGGCT	GCTTCGAGGGGCT	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:202249950_202249962delGCTTCGAGGGGCT	ENST00000367278.3	+	6	775_787	c.686_698delGCTTCGAGGGGCT	c.(685-699)agcttcgaggggctgfs	p.SFEGL229fs	LGR6_ENST00000439764.2_Intron|LGR6_ENST00000308543.3_3'UTR|LGR6_ENST00000255432.7_Frame_Shift_Del_p.SFEGL177fs	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	229					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)	p.F230fs*6(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						GGGACCCACAGCTTCGAGGGGCTGCACAATCTG	0.573																																																1	Deletion - Frameshift(1)	ovary(1)	1																																								200516585	SO:0001589	frameshift_variant	59352			AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.686_698delGCTTCGAGGGGCT	1.37:g.202249950_202249962delGCTTCGAGGGGCT	ENSP00000356247:p.Ser229fs	Somatic		WXS	SOLID	Phase_III	200516573	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Frame_Shift_Del	DEL	ENST00000367278.3	37	CCDS30971.1																																																																																				0.573	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636	
MAP3K10	4294	hgsc.bcm.edu	37	19	40704297	40704297	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr19:40704297C>A	ENST00000253055.3	+	2	986	c.698C>A	c.(697-699)gCc>gAc	p.A233D	MAP3K10_ENST00000593906.1_3'UTR	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)	p.A233D(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						ATCCTGGAGGCCATCGAGAAC	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											87.0	74.0	78.0					19																	40704297		2203	4300	6503	45396137	SO:0001583	missense	4294			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.698C>A	19.37:g.40704297C>A	ENSP00000253055:p.Ala233Asp	Somatic		WXS	SOLID	Phase_III	45396137	Q12761|Q14871	Missense_Mutation	SNP	ENST00000253055.3	37	CCDS12549.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.296109	0.60086	.	.	ENSG00000130758	ENST00000253055	T	0.74737	-0.87	5.08	3.96	0.45880	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.194452	0.44483	D	0.000441	T	0.57140	0.2033	N	0.04116	-0.275	0.38770	D	0.954532	P	0.35139	0.486	B	0.43082	0.407	T	0.61083	-0.7134	10	0.35671	T	0.21	.	10.3602	0.43989	0.3099:0.6901:0.0:0.0	.	233	Q02779	M3K10_HUMAN	D	233	ENSP00000253055:A233D	ENSP00000253055:A233D	A	+	2	0	MAP3K10	45396137	0.973000	0.33851	1.000000	0.80357	0.960000	0.62799	1.013000	0.29937	2.549000	0.85964	0.306000	0.20318	GCC		0.632	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446	
TENM1	10178	hgsc.bcm.edu	37	X	123517633	123517633	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chrX:123517633C>T	ENST00000371130.3	-	29	7190	c.7127G>A	c.(7126-7128)aGg>aAg	p.R2376K	TENM1_ENST00000422452.2_Missense_Mutation_p.R2383K|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2376					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.R2378K(1)									ATCATAATCCCTTTGCCCCAG	0.418																																																1	Substitution - Missense(1)	ovary(1)	X											138.0	130.0	132.0					X																	123517633		2203	4300	6503	123345314	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7127G>A	X.37:g.123517633C>T	ENSP00000360171:p.Arg2376Lys	Somatic		WXS	SOLID	Phase_III	123345314	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.043921	0.75732	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.92149	-2.98;-2.94	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.95965	0.8686	M	0.79011	2.435	0.58432	D	0.999997	D;D;B	0.64830	0.982;0.994;0.287	D;D;B	0.70716	0.952;0.97;0.085	D	0.95608	0.8669	10	0.49607	T	0.09	.	18.7972	0.91999	0.0:1.0:0.0:0.0	.	2382;2383;2376	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	K	2376;2383	ENSP00000360171:R2376K;ENSP00000403954:R2383K	ENSP00000360171:R2376K	R	-	2	0	ODZ1	123345314	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.050000	0.71063	2.471000	0.83476	0.600000	0.82982	AGG		0.418	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
PDE6H	5149	hgsc.bcm.edu	37	12	15131081	15131081	+	Splice_Site	SNP	G	G	C			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr12:15131081G>C	ENST00000266395.2	+	2	240		c.e2+1			NM_006205.2	NP_006196.1	Q13956	CNCG_HUMAN	phosphodiesterase 6H, cGMP-specific, cone, gamma						activation of MAPK activity (GO:0000187)|negative regulation of catalytic activity (GO:0043086)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|response to stimulus (GO:0050896)|visual perception (GO:0007601)		3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|enzyme inhibitor activity (GO:0004857)	p.?(1)		endometrium(1)|lung(6)|ovary(1)|skin(2)	10					Sildenafil(DB00203)|Vardenafil(DB00862)	GTGTGAAAGGGTAAGACCAAA	0.423																																																1	Unknown(1)	ovary(1)	12											54.0	50.0	52.0					12																	15131081		2203	4300	6503	15022348	SO:0001630	splice_region_variant	5149				CCDS8672.1	12p13	2008-03-18					3.1.4.17	"""Phosphodiesterases"""	8790	protein-coding gene	gene with protein product		601190				8786098	Standard	NM_006205		Approved		uc001rcr.3	Q13956		ENST00000266395.2:c.134+1G>C	12.37:g.15131081G>C		Somatic		WXS	SOLID	Phase_III	15022348	Q52LY7	Splice_Site	SNP	ENST00000266395.2	37	CCDS8672.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248441	0.80024	.	.	ENSG00000139053	ENST00000266395	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2338	0.82360	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDE6H	15022348	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.107000	0.94261	2.686000	0.91538	0.655000	0.94253	.		0.423	PDE6H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400880.1		Intron
PDGFC	56034	hgsc.bcm.edu	37	4	157731997	157731997	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr4:157731997C>A	ENST00000502773.1	-	3	977	c.487G>T	c.(487-489)Gtc>Ttc	p.V163F	PDGFC_ENST00000542208.1_5'UTR|PDGFC_ENST00000541126.1_5'UTR|PDGFC_ENST00000422544.2_Missense_Mutation_p.V163F	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	163	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)	p.V163F(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		ACTGGCATGACAATGTTGTAG	0.333																																																1	Substitution - Missense(1)	ovary(1)	4											89.0	91.0	90.0					4																	157731997		2203	4300	6503	157951447	SO:0001583	missense	56034			AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.487G>T	4.37:g.157731997C>A	ENSP00000422464:p.Val163Phe	Somatic		WXS	SOLID	Phase_III	157951447	B4DU34|B9EGR8|Q4W5M9|Q9UL22	Missense_Mutation	SNP	ENST00000502773.1	37	CCDS3795.1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.545152	0.45280	.	.	ENSG00000145431	ENST00000502773;ENST00000422544	T;T	0.18657	2.26;2.2	5.18	2.3	0.28687	CUB (3);	0.342485	0.30732	N	0.008992	T	0.25195	0.0612	M	0.89715	3.055	0.80722	D	1	B	0.24823	0.112	B	0.21360	0.034	T	0.04976	-1.0914	10	0.18710	T	0.47	-7.907	5.9207	0.19080	0.0:0.4442:0.3526:0.2032	.	163	Q9NRA1	PDGFC_HUMAN	F	163	ENSP00000422464:V163F;ENSP00000410048:V163F	ENSP00000410048:V163F	V	-	1	0	PDGFC	157951447	0.995000	0.38212	0.046000	0.18839	0.995000	0.86356	2.267000	0.43329	1.294000	0.44707	0.563000	0.77884	GTC		0.333	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366123.1		
RAPGEF6	51735	hgsc.bcm.edu	37	5	130815373	130815373	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr5:130815373T>G	ENST00000509018.1	-	16	2119	c.1914A>C	c.(1912-1914)aaA>aaC	p.K638N	RAPGEF6_ENST00000512052.1_Missense_Mutation_p.K353N|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.K638N|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.K638N|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.K638N|RAPGEF6_ENST00000510071.1_Missense_Mutation_p.K638N|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.K638N|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.K688N	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	638					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)	p.K688N(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		GATTACTTTTTTTTTCAGCAA	0.363																																					Melanoma(168;435 1955 13113 13877 23213)											1	Substitution - Missense(1)	ovary(1)	5											150.0	146.0	147.0					5																	130815373		2203	4300	6503	130843272	SO:0001583	missense	51735			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.1914A>C	5.37:g.130815373T>G	ENSP00000421684:p.Lys638Asn	Somatic		WXS	SOLID	Phase_III	130843272	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	37	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.968234	0.74131	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000510071;ENST00000514667	T;T;T;T;T;T;T;T	0.28069	1.79;1.69;1.7;1.79;1.64;1.63;2.17;1.88	5.91	2.31	0.28768	Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.44582	0.1300	M	0.63843	1.955	0.80722	D	1	B;D;B;D;D;D;P	0.69078	0.415;0.984;0.365;0.974;0.974;0.997;0.621	B;P;B;P;P;D;B	0.66979	0.205;0.811;0.131;0.597;0.782;0.948;0.279	T	0.29397	-1.0013	10	0.59425	D	0.04	.	6.2526	0.20854	0.0:0.5496:0.0:0.4504	.	638;638;638;353;688;638;638	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	N	638;638;638;638;638;353;638;638;688	ENSP00000421684:K638N;ENSP00000309298:K638N;ENSP00000426081:K638N;ENSP00000296859:K638N;ENSP00000426910:K353N;ENSP00000311419:K638N;ENSP00000425389:K638N;ENSP00000426948:K688N	ENSP00000426948:K688N	K	-	3	2	RAPGEF6;FNIP1	130843272	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.455000	0.35190	0.506000	0.28125	0.533000	0.62120	AAA		0.363	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
SEC63	11231	hgsc.bcm.edu	37	6	108246057	108246057	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr6:108246057C>A	ENST00000369002.4	-	3	483	c.304G>T	c.(304-306)Gaa>Taa	p.E102*		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	102					liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.E102*(1)		endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		GGATTGTATTCTTGGTATTCT	0.328																																																1	Substitution - Nonsense(1)	ovary(1)	6											134.0	133.0	133.0					6																	108246057		2203	4300	6503	108352750	SO:0001587	stop_gained	11231			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.304G>T	6.37:g.108246057C>A	ENSP00000357998:p.Glu102*	Somatic		WXS	SOLID	Phase_III	108352750	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Nonsense_Mutation	SNP	ENST00000369002.4	37	CCDS5061.1	.	.	.	.	.	.	.	.	.	.	C	32	5.129994	0.94473	.	.	ENSG00000025796	ENST00000369002;ENST00000429168	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-22.3229	19.6307	0.95700	0.0:1.0:0.0:0.0	.	.	.	.	X	102;46	.	ENSP00000357998:E102X	E	-	1	0	SEC63	108352750	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.453000	0.80700	2.645000	0.89757	0.585000	0.79938	GAA		0.328	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
SLAMF1	6504	hgsc.bcm.edu	37	1	160616707	160616707	+	Missense_Mutation	SNP	G	G	A	rs146508660		TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr1:160616707G>A	ENST00000302035.6	-	1	378	c.29C>T	c.(28-30)aCc>aTc	p.T10I	SLAMF1_ENST00000235739.5_Missense_Mutation_p.T10I|SLAMF1_ENST00000355199.3_Missense_Mutation_p.T10I|SLAMF1_ENST00000538290.1_Missense_Mutation_p.T10I	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	10					lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)	p.T10I(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CAGCACGAAGGTCAAGGAGAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	1						G	ILE/THR	1,4405	2.1+/-5.4	0,1,2202	67.0	61.0	63.0		29	-5.7	0.0	1	dbSNP_134	63	0,8600		0,0,4300	no	missense	SLAMF1	NM_003037.2	89	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	10/336	160616707	1,13005	2203	4300	6503	158883331	SO:0001583	missense	6504			U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.29C>T	1.37:g.160616707G>A	ENSP00000306190:p.Thr10Ile	Somatic		WXS	SOLID	Phase_III	158883331	Q5W172|Q9HBE8	Missense_Mutation	SNP	ENST00000302035.6	37	CCDS1207.1	.	.	.	.	.	.	.	.	.	.	G	1.963	-0.438369	0.04636	2.27E-4	0.0	ENSG00000117090	ENST00000302035;ENST00000235739;ENST00000392208;ENST00000538290;ENST00000355199	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	3.84	-5.65	0.02459	Signaling lymphocytic activation molecule, N-terminal (2);	2.269430	0.01361	N	0.012239	T	0.06962	0.0177	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.09773	-1.0659	10	0.20519	T	0.43	-10.3085	0.3538	0.00353	0.2704:0.2573:0.2686:0.2036	.	10;10	B4E2E4;Q13291	.;SLAF1_HUMAN	I	10	ENSP00000306190:T10I;ENSP00000235739:T10I;ENSP00000438406:T10I;ENSP00000347333:T10I	ENSP00000235739:T10I	T	-	2	0	SLAMF1	158883331	0.001000	0.12720	0.000000	0.03702	0.017000	0.09413	-0.214000	0.09292	-1.113000	0.02981	-1.118000	0.02043	ACC		0.562	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060454.1		
SLC26A4	5172	hgsc.bcm.edu	37	7	107342393	107342393	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr7:107342393C>A	ENST00000265715.3	+	17	2149	c.1925C>A	c.(1924-1926)tCt>tAt	p.S642Y	SLC26A4_ENST00000541474.1_Missense_Mutation_p.S203Y|SLC26A4_ENST00000544569.1_Missense_Mutation_p.S229Y|SLC26A4_ENST00000543100.1_Missense_Mutation_p.S211Y	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	642	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.S642Y(1)		central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						GATTGGAACTCTGAGCTTCCA	0.428									Pendred syndrome																																							1	Substitution - Missense(1)	ovary(1)	7											127.0	112.0	117.0					7																	107342393		2203	4300	6503	107129629	SO:0001583	missense	5172	Familial Cancer Database	Goiter-Deafness syndrome	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1925C>A	7.37:g.107342393C>A	ENSP00000265715:p.Ser642Tyr	Somatic		WXS	SOLID	Phase_III	107129629	B7Z266|O43170	Missense_Mutation	SNP	ENST00000265715.3	37	CCDS5746.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.430812	0.83776	.	.	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.95069	-3.27;-3.52;-3.58;-3.6	5.89	5.89	0.94794	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.000000	0.85682	D	0.000000	D	0.97114	0.9057	M	0.70595	2.14	0.51233	D	0.999915	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.77557	0.972;0.985;0.99	D	0.96986	0.9718	10	0.66056	D	0.02	.	20.2576	0.98430	0.0:1.0:0.0:0.0	.	203;229;642	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	Y	642;203;229;211	ENSP00000265715:S642Y;ENSP00000439743:S203Y;ENSP00000437427:S229Y;ENSP00000441209:S211Y	ENSP00000265715:S642Y	S	+	2	0	SLC26A4	107129629	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.831000	0.75324	2.783000	0.95769	0.655000	0.94253	TCT		0.428	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441	
SNPH	9751	hgsc.bcm.edu	37	20	1277867	1277867	+	Nonsense_Mutation	SNP	C	C	G			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr20:1277867C>G	ENST00000381873.3	+	4	365	c.129C>G	c.(127-129)taC>taG	p.Y43*	SNPH_ENST00000381867.1_Nonsense_Mutation_p.Y87*	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	43					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)	p.Y43*(1)		endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CTGGCTCCTACAAGGGCAGTG	0.627																																																1	Substitution - Nonsense(1)	ovary(1)	20											57.0	43.0	47.0					20																	1277867		2203	4300	6503	1225867	SO:0001587	stop_gained	9751				CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.129C>G	20.37:g.1277867C>G	ENSP00000371297:p.Tyr43*	Somatic		WXS	SOLID	Phase_III	1225867	Q8IYI3	Nonsense_Mutation	SNP	ENST00000381873.3	37	CCDS13012.1	.	.	.	.	.	.	.	.	.	.	C	35	5.471279	0.96274	.	.	ENSG00000101298	ENST00000381873;ENST00000381867	.	.	.	5.03	4.02	0.46733	.	0.286322	0.33875	N	0.004475	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-9.1565	14.0266	0.64590	0.0:0.916:0.0:0.084	.	.	.	.	X	43;87	.	ENSP00000371291:Y87X	Y	+	3	2	SNPH	1225867	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.747000	0.55134	2.608000	0.88229	0.655000	0.94253	TAC		0.627	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723	
CFAP70	118491	hgsc.bcm.edu	37	10	75114530	75114530	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1567-01A-01W-0615-10	TCGA-24-1567-10A-01W-0615-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA			Illumina GAIIx	de46c81d-93cb-458b-a745-a54d346a5981	d2d268b0-6174-488b-a18b-cbba452158a2	g.chr10:75114530T>C	ENST00000310715.3	-	2	145	c.25A>G	c.(25-27)Aga>Gga	p.R9G	TTC18_ENST00000394865.1_Missense_Mutation_p.R9G|TTC18_ENST00000340329.3_Missense_Mutation_p.R9G|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000401621.2_Missense_Mutation_p.R9G|TTC18_ENST00000355577.3_5'UTR	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		9						extracellular vesicular exosome (GO:0070062)		p.R9G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					TGCACGAGTCTGCCTGCTGAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	10											137.0	103.0	114.0					10																	75114530		2203	4300	6503	74784536	SO:0001583	missense	118491																														ENST00000310715.3:c.25A>G	10.37:g.75114530T>C	ENSP00000310829:p.Arg9Gly	Somatic		WXS	SOLID	Phase_III	74784536	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Missense_Mutation	SNP	ENST00000310715.3	37	CCDS7324.3	.	.	.	.	.	.	.	.	.	.	T	14.55	2.570288	0.45798	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000340329;ENST00000372928;ENST00000394865;ENST00000394862	T;T;T;T	0.48522	1.82;1.83;0.81;1.41	5.6	3.17	0.36434	.	0.751962	0.13469	N	0.385574	T	0.40498	0.1119	L	0.50333	1.59	0.09310	N	1	B	0.28713	0.22	B	0.21151	0.033	T	0.29792	-1.0000	10	0.72032	D	0.01	-2.489	9.7922	0.40713	0.0:0.0:0.3361:0.6639	.	9	Q5T0N1	TTC18_HUMAN	G	9	ENSP00000310829:R9G;ENSP00000384479:R9G;ENSP00000343650:R9G;ENSP00000378334:R9G	ENSP00000310829:R9G	R	-	1	2	TTC18	74784536	0.080000	0.21391	0.005000	0.12908	0.403000	0.30841	1.461000	0.35255	0.368000	0.24481	0.533000	0.62120	AGA		0.443	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
