#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								10198	SO:0001628	intergenic_variant	4537																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	10198		Missense_Mutation	SNP	HMMPfam_Oxidored_q4	p.A47T		37	c.139		MT																																																																																			-	HMMPfam_Oxidored_q4	0	0					MT-ND3			G			10198	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361227	ensembl	human	known	54_36p	missense	SNP	NULL	A
PSMF1	9491	genome.wustl.edu	37	20	1145091	1145091	+	Silent	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr20:1145091C>A	ENST00000335877.6	+	6	911	c.735C>A	c.(733-735)ccC>ccA	p.P245P	PSMF1_ENST00000484891.1_3'UTR|PSMF1_ENST00000381898.4_Silent_p.P157P|PSMF1_ENST00000246015.4_Silent_p.P245P|PSMF1_ENST00000438768.2_Silent_p.P183P|PSMF1_ENST00000333082.3_Silent_p.P245P	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	245	Pro-rich.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)	p.P245P(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						GCTTTGACCCCTTTGGACCCA	0.587																																																1	Substitution - coding silent(1)	lung(1)	20											110.0	119.0	116.0					20																	1145091		2203	4300	6503	1093091	SO:0001819	synonymous_variant	9491			D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.735C>A	20.37:g.1145091C>A		Somatic		Capture	Illumina GAIIx	4	1093091	A0AVQ9|D3DVW3|Q9H4I1	Silent	SNP	HMMPfam_PI31_Prot_Reg	p.P245	ENST00000335877.6	37	c.735	CCDS13010.1	20	.	.	.	.	.	.	.	.	.	.	C	10.98	1.504738	0.26949	.	.	ENSG00000125818	ENST00000435720	.	.	.	6.07	0.286	0.15710	.	.	.	.	.	T	0.52581	0.1743	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44267	-0.9339	4	.	.	.	-9.0677	6.9931	0.24765	0.0:0.584:0.1203:0.2957	.	.	.	.	I	87	.	.	L	+	1	0	PSMF1	1093091	0.940000	0.31905	1.000000	0.80357	0.988000	0.76386	-0.023000	0.12456	0.448000	0.26722	0.655000	0.94253	CTT	-	HMMPfam_PI31_Prot_Reg		0.587	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMF1	protein_coding	OTTHUMT00000077504.2	C	NM_178578		1093091	+1	no_errors	NM_006814	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
OR52M1	119772	genome.wustl.edu	37	11	4566788	4566788	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr11:4566788A>G	ENST00000360213.1	+	1	368	c.368A>G	c.(367-369)gAt>gGt	p.D123G		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATGGCTTTTGATCGCTACGTG	0.537																																																0			11											146.0	127.0	134.0					11																	4566788		2201	4298	6499	4523364	SO:0001583	missense	119772			AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.368A>G	11.37:g.4566788A>G	ENSP00000353343:p.Asp123Gly	Somatic		Capture	Illumina GAIIx	4	4523364		Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.D123G	ENST00000360213.1	37	c.368	CCDS31353.1	11	.	.	.	.	.	.	.	.	.	.	A	19.23	3.787553	0.70337	.	.	ENSG00000197790	ENST00000360213	T	0.57107	0.42	4.98	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000152	T	0.81138	0.4760	H	0.98629	4.285	0.41614	D	0.988925	D	0.89917	1.0	D	0.87578	0.998	D	0.85055	0.0931	10	0.87932	D	0	.	9.8023	0.40773	0.9176:0.0:0.0824:0.0	.	123	Q8NGK5	O52M1_HUMAN	G	123	ENSP00000353343:D123G	ENSP00000353343:D123G	D	+	2	0	OR52M1	4523364	1.000000	0.71417	0.998000	0.56505	0.903000	0.53119	6.034000	0.70933	1.030000	0.39839	0.528000	0.53228	GAT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.537	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52M1	protein_coding	OTTHUMT00000385847.1	A	NM_001004137		4523364	+1	no_errors	NM_001004137	genbank	human	provisional	54_36p	missense	SNP	1.000	G
OR52E8	390079	genome.wustl.edu	37	11	5878440	5878440	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr11:5878440G>T	ENST00000537935.1	-	1	524	c.493C>A	c.(493-495)Ctg>Atg	p.L165M	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAAACACCAGTGGAACAACC	0.517																																																0			11											124.0	134.0	131.0					11																	5878440		2151	4296	6447	5835016	SO:0001583	missense	390079			BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.493C>A	11.37:g.5878440G>T	ENSP00000444054:p.Leu165Met	Somatic		Capture	Illumina GAIIx	4	5835016	B9EH38	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L165M	ENST00000537935.1	37	c.493	CCDS31400.1	11	.	.	.	.	.	.	.	.	.	.	G	8.555	0.876428	0.17395	.	.	ENSG00000183269	ENST00000537935	T	0.00123	8.7	4.35	-3.63	0.04529	GPCR, rhodopsin-like superfamily (1);	1.529080	0.04294	N	0.346008	T	0.00109	0.0003	L	0.35854	1.095	0.09310	N	1	B	0.25206	0.12	B	0.26310	0.068	T	0.10823	-1.0613	10	0.40728	T	0.16	.	3.9759	0.09473	0.0742:0.3073:0.3075:0.311	.	165	Q6IFG1	O52E8_HUMAN	M	165	ENSP00000444054:L165M	ENSP00000444054:L165M	L	-	1	2	OR52E8	5835016	0.000000	0.05858	0.000000	0.03702	0.322000	0.28314	-5.638000	0.00108	-0.368000	0.08040	0.549000	0.68633	CTG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.517	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E8	protein_coding	OTTHUMT00000401145.1	G	NM_001005168		5835016	-1	no_errors	NM_001005168	genbank	human	provisional	54_36p	missense	SNP	0.000	T
TRIM5	85363	genome.wustl.edu	37	11	5922126	5922126	+	IGR	SNP	C	C	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr11:5922126C>G								OR52E4 (15599 upstream) : AC025016.1 (37854 downstream)																							ATCTAACAGCCCTTCTAGGGA	0.507																																																0			11																																								5878702	SO:0001628	intergenic_variant	390082																															11.37:g.5922126C>G		Somatic		Capture	Illumina GAIIx	4	5878702		Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A40		37	c.120		11																																																																																			-	superfamily_Family A G protein-coupled receptor-like	0	0.507					OR52E5			C			5878702	+1	no_errors	ENST00000316698	ensembl	human	known	54_36p	silent	SNP	0.000	G
PMS2CL	441194	genome.wustl.edu	37	7	6777375	6777375	+	RNA	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr7:6777375G>A	ENST00000486256.1	+	0	1502					NR_002217.1		Q68D20	PMS2L_HUMAN	PMS2 C-terminal like pseudogene																		CAGCTTCTCAGGTTGATGTAG	0.358																																																0			7																																								6743900			441194			BC041364		7p22.1	2010-10-26			ENSG00000187953	ENSG00000187953			30061	pseudogene	pseudogene	"""postmeiotic segregation increased 2 pseudogene 13"""					15256438, 17253626	Standard	NR_002217		Approved	PMS2P13	uc011jxb.1	Q68D20	OTTHUMG00000151857		7.37:g.6777375G>A		Somatic		Capture	Illumina GAIIx	4	6743900	B4DK88|Q764P1	RNA	SNP	-	NULL	ENST00000486256.1	37	NULL		7																																																																																			-	-		0.358	PMS2CL-002	KNOWN	basic	processed_transcript	PMS2CL	pseudogene	OTTHUMT00000324193.1	G	NR_002217		6743900	+1	pseudogene	NR_002217	genbank	human	provisional	54_36p	rna	SNP	0.316	A
LAMA1	284217	genome.wustl.edu	37	18	6950797	6950797	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr18:6950797T>A	ENST00000389658.3	-	58	8474	c.8381A>T	c.(8380-8382)gAt>gTt	p.D2794V		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2794	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCACTTGCCATCACTGAGCAG	0.552																																																0			18											125.0	107.0	113.0					18																	6950797		2203	4300	6503	6940797	SO:0001583	missense	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8381A>T	18.37:g.6950797T>A	ENSP00000374309:p.Asp2794Val	Somatic		Capture	Illumina GAIIx	4	6940797		Missense_Mutation	SNP	HMMSmart_SM00136,HMMPfam_Laminin_N,superfamily_Galactose-binding domain-like,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_Concanavalin A-like lectins/glucanases,PatternScan_EGF_1,PatternScan_EGF_LAM_1,HMMSmart_SM00181,superfamily_EGF/Laminin,PatternScan_EGF_2,HMMSmart_SM00281,HMMPfam_Laminin_B,HMMPfam_Laminin_I,HMMPfam_Laminin_II,HMMSmart_SM00282,HMMPfam_Laminin_G_1,HMMPfam_Laminin_G_2	p.D2794V	ENST00000389658.3	37	c.8381	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	T	18.35	3.604673	0.66445	.	.	ENSG00000101680	ENST00000389658	T	0.79247	-1.25	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.90981	0.7164	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	D	0.93299	0.6675	10	0.87932	D	0	.	15.5892	0.76512	0.0:0.0:0.0:1.0	.	2794;124	P25391;B3KSD8	LAMA1_HUMAN;.	V	2794	ENSP00000374309:D2794V	ENSP00000374309:D2794V	D	-	2	0	LAMA1	6940797	1.000000	0.71417	0.143000	0.22291	0.698000	0.40448	6.920000	0.75799	2.086000	0.62901	0.459000	0.35465	GAT	-	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_1		0.552	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	protein_coding	OTTHUMT00000257369.1	T	NM_005559		6940797	-1	no_errors	NM_005559	genbank	human	validated	54_36p	missense	SNP	0.995	A
TP53	7157	genome.wustl.edu	37	17	7573982	7573982	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr17:7573982C>A	ENST00000269305.4	-	10	1234	c.1045G>T	c.(1045-1047)Gaa>Taa	p.E349*	TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000445888.2_Nonsense_Mutation_p.E349*|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	349	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		E -> D (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E349*(11)|p.0?(8)|p.L348_E349>F*(2)|p.E349fs*21(2)|p.?(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCTTGAGTTCCAAGGCCTCA	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	25	Substitution - Nonsense(11)|Whole gene deletion(8)|Deletion - Frameshift(3)|Complex - compound substitution(2)|Unknown(1)	lung(6)|bone(4)|central_nervous_system(3)|large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|liver(2)|skin(2)|stomach(1)|urinary_tract(1)|ovary(1)|breast(1)	17											62.0	48.0	52.0					17																	7573982		2203	4300	6503	7514707	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1045G>T	17.37:g.7573982C>A	ENSP00000269305:p.Glu349*	Somatic		Capture	Illumina GAIIx	4	7514707	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.E349*	ENST00000269305.4	37	c.1045	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	38	7.072789	0.98044	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	4.45	0.53987	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-35.1174	13.3529	0.60611	0.159:0.841:0.0:0.0	.	.	.	.	X	349;349;338	.	ENSP00000269305:E349X	E	-	1	0	TP53	7514707	1.000000	0.71417	0.837000	0.33122	0.960000	0.62799	4.805000	0.62561	1.268000	0.44264	0.561000	0.74099	GAA	-	HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7514707	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
CHD3	1107	genome.wustl.edu	37	17	7798346	7798346	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr17:7798346G>C	ENST00000330494.7	+	9	1531	c.1381G>C	c.(1381-1383)Gta>Cta	p.V461L	CHD3_ENST00000380358.4_Missense_Mutation_p.V520L|CHD3_ENST00000358181.4_Missense_Mutation_p.V461L	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	461					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GTACTGCCGCGTATGCAAGGA	0.562																																																0			17											211.0	146.0	168.0					17																	7798346		2203	4300	6503	7739071	SO:0001583	missense	1107			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.1381G>C	17.37:g.7798346G>C	ENSP00000332628:p.Val461Leu	Somatic		Capture	Illumina GAIIx	4	7739071	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	HMMPfam_CHDNT,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,HMMSmart_SM00298,superfamily_Chromo domain-like,HMMPfam_Chromo,superfamily_P-loop containing nucleoside triphosphate hydrolases,PatternScan_CHROMO_1,HMMSmart_SM00487,HMMPfam_SNF2_N,PatternScan_DEAH_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_DUF1087,HMMPfam_DUF1086,HMMPfam_CHDCT2	p.V506L	ENST00000330494.7	37	c.1516	CCDS32554.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.63|16.63	3.177439|3.177439	0.57692|0.57692	.|.	.|.	ENSG00000170004|ENSG00000170004	ENST00000452447|ENST00000380358;ENST00000358181;ENST00000330494	T|D;D;D	0.39229|0.85258	1.09|-1.96;-1.96;-1.96	5.11|5.11	5.11|5.11	0.69529|0.69529	.|Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	.|0.000000	.|0.40064	.|N	.|0.001182	D|D	0.89181|0.89181	0.6642|0.6642	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.996;0.997;0.999	.|D;D;D	.|0.83275	.|0.989;0.994;0.996	D|D	0.89500|0.89500	0.3763|0.3763	7|10	0.87932|0.54805	D|T	0|0.06	-23.7845|-23.7845	18.3108|18.3108	0.90199|0.90199	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|461;461;520	.|Q12873-2;Q12873;E9PG89	.|.;CHD3_HUMAN;.	P|L	331|520;461;461	ENSP00000405861:R331P|ENSP00000369716:V520L;ENSP00000350907:V461L;ENSP00000332628:V461L	ENSP00000405861:R331P|ENSP00000332628:V461L	R|V	+|+	2|1	0|0	CHD3|CHD3	7739071|7739071	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.622000|0.622000	0.37654|0.37654	9.657000|9.657000	0.98554|0.98554	2.657000|2.657000	0.90304|0.90304	0.561000|0.561000	0.74099|0.74099	CGT|GTA	-	PatternScan_ZF_PHD_1,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD		0.562	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	protein_coding	OTTHUMT00000318050.1	G	NM_001005273		7739071	+1	no_errors	NM_001005271	genbank	human	reviewed	54_36p	missense	SNP	0.999	C
WDR16	146845	genome.wustl.edu	37	17	9538754	9538754	+	Silent	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr17:9538754G>A	ENST00000352665.5	+	11	1422	c.1353G>A	c.(1351-1353)caG>caA	p.Q451Q	WDR16_ENST00000396219.3_Silent_p.Q383Q|WDR16_ENST00000299764.5_Silent_p.Q461Q|WDR16_ENST00000576714.1_3'UTR	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						GTCAGACCCAGAAGCTGGAGG	0.527																																																0			17											128.0	103.0	111.0					17																	9538754		2203	4300	6503	9479479	SO:0001819	synonymous_variant	146845			AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.1353G>A	17.37:g.9538754G>A		Somatic		Capture	Illumina GAIIx	4	9479479		Silent	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.Q451	ENST00000352665.5	37	c.1353	CCDS11149.2	17																																																																																			-	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40		0.527	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR16	protein_coding	OTTHUMT00000316569.2	G	NM_145054		9479479	+1	no_errors	NM_145054	genbank	human	validated	54_36p	silent	SNP	0.999	A
S1PR2	9294	genome.wustl.edu	37	19	10335255	10335255	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr19:10335255C>A	ENST00000590320.1	-	2	437	c.327G>T	c.(325-327)gaG>gaT	p.E109D	CTD-2369P2.2_ENST00000317726.4_lincRNA	NM_004230.3	NP_004221.3	O95136	S1PR2_HUMAN	sphingosine-1-phosphate receptor 2	109					activation of MAPK activity (GO:0000187)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of endothelial barrier (GO:1903142)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|integrin binding (GO:0005178)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						AGGCAGAGCCCTCCCGGGCAA	0.627																																					Pancreas(194;229 3020 15179 45747)											0			19											34.0	34.0	34.0					19																	10335255		2203	4300	6503	10196255	SO:0001583	missense	9294			AF034780	CCDS12229.1	19q13	2013-03-13	2008-04-30	2008-04-30	ENSG00000267534	ENSG00000267534		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3169	protein-coding gene	gene with protein product		605111	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 5"""	EDG5		8087418, 8878560	Standard	NM_004230		Approved	Gpcr13, H218, AGR16	uc002mnl.2	O95136	OTTHUMG00000180399	ENST00000590320.1:c.327G>T	19.37:g.10335255C>A	ENSP00000466933:p.Glu109Asp	Somatic		Capture	Illumina GAIIx	4	10196255	Q86UN8	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.E109D	ENST00000590320.1	37	c.327	CCDS12229.1	19	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273290	0.80580	.	.	ENSG00000175898	ENST00000317726	.	.	.	5.46	5.46	0.80206	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.74846	0.3770	L	0.46567	1.45	0.58432	D	0.999995	D	0.89917	1.0	D	0.87578	0.998	T	0.75314	-0.3361	9	0.54805	T	0.06	.	18.0738	0.89421	0.0:1.0:0.0:0.0	.	109	O95136	S1PR2_HUMAN	D	109	.	ENSP00000322049:E109D	E	-	3	2	S1PR2	10196255	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.470000	0.45119	2.557000	0.86248	0.586000	0.80456	GAG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.627	S1PR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR2	protein_coding	OTTHUMT00000451194.1	C	NM_004230		10196255	-1	no_errors	NM_004230	genbank	human	validated	54_36p	missense	SNP	1.000	A
PTCHD2	57540	genome.wustl.edu	37	1	11562878	11562878	+	Missense_Mutation	SNP	C	C	T	rs576336989		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:11562878C>T	ENST00000294484.6	+	3	1378	c.1240C>T	c.(1240-1242)Cgc>Tgc	p.R414C	PTCHD2_ENST00000389575.3_Missense_Mutation_p.R414C	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	414					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)	p.R631C(1)		NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		AGTAGATGACCGCTGGGAGGA	0.562																																																1	Substitution - Missense(1)	endometrium(1)	1											92.0	94.0	93.0					1																	11562878		2006	4173	6179	11485465	SO:0001583	missense	57540			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1240C>T	1.37:g.11562878C>T	ENSP00000294484:p.Arg414Cys	Somatic		Capture	Illumina GAIIx	4	11485465	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	HMMPfam_Patched,superfamily_Multidrug efflux transporter AcrB transmembrane domain	p.R414C	ENST00000294484.6	37	c.1240	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199298	0.79015	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.91521	-2.85;-2.86	6.08	5.17	0.71159	.	0.054048	0.85682	N	0.000000	D	0.93268	0.7855	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	D	0.93871	0.7162	10	0.87932	D	0	-36.8993	13.9911	0.64367	0.0:0.9274:0.0:0.0726	.	414	Q9P2K9	PTHD2_HUMAN	C	414	ENSP00000294484:R414C;ENSP00000374226:R414C	ENSP00000294484:R414C	R	+	1	0	PTCHD2	11485465	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.821000	0.48065	1.592000	0.50018	0.655000	0.94253	CGC	-	HMMPfam_Patched		0.562	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	protein_coding	OTTHUMT00000005770.2	C	XM_052561		11485465	+1	no_errors	NM_020780	genbank	human	validated	54_36p	missense	SNP	1.000	T
GSTM5P1	100505557	genome.wustl.edu	37	3	12299332	12299332	+	IGR	SNP	A	A	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr3:12299332A>T								SYN2 (72104 upstream) : PPARG (29534 downstream)																							TTCCCAAACAAAGGACCTTGG	0.542																																																0			3																																								12274332	SO:0001628	intergenic_variant	2945																															3.37:g.12299332A>T		Somatic		Capture	Illumina GAIIx	4	12274332		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.542					GSTM1L			A			12274332	-1	pseudogene	NR_003112	genbank	human	provisional	54_36p	rna	SNP	0.995	T
SPTLC3	55304	genome.wustl.edu	37	20	13098259	13098259	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr20:13098259A>T	ENST00000399002.2	+	8	1313	c.1039A>T	c.(1039-1041)Acc>Tcc	p.T347S	SPTLC3_ENST00000378194.4_Intron	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3	347					small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						CGTGGGCCCAACCGGCCGGGG	0.498																																																0			20											99.0	102.0	101.0					20																	13098259		1858	4101	5959	13046259	SO:0001583	missense	55304			AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.1039A>T	20.37:g.13098259A>T	ENSP00000381968:p.Thr347Ser	Somatic		Capture	Illumina GAIIx	4	13046259	A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	Missense_Mutation	SNP	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_1_2,PatternScan_AA_TRANSFER_CLASS_2	p.T347S	ENST00000399002.2	37	c.1039	CCDS13115.2	20	.	.	.	.	.	.	.	.	.	.	A	11.62	1.691807	0.30052	.	.	ENSG00000172296	ENST00000399002	D	0.95447	-3.71	6.16	6.16	0.99307	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.188820	0.56097	D	0.000034	D	0.94663	0.8279	M	0.65320	2	0.58432	D	0.999995	B	0.23128	0.08	B	0.32090	0.14	D	0.92053	0.5650	10	0.25751	T	0.34	-13.0456	16.8061	0.85666	1.0:0.0:0.0:0.0	.	347	Q9NUV7	SPTC3_HUMAN	S	347	ENSP00000381968:T347S	ENSP00000381968:T347S	T	+	1	0	SPTLC3	13046259	0.545000	0.26449	0.217000	0.23759	0.958000	0.62258	4.195000	0.58400	2.367000	0.80283	0.528000	0.53228	ACC	-	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_1_2		0.498	SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC3	protein_coding	OTTHUMT00000254544.1	A	NM_018327		13046259	+1	no_errors	NM_018327	genbank	human	validated	54_36p	missense	SNP	0.697	T
Unknown	0	genome.wustl.edu	37	17	16520379	16520379	+	IGR	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr17:16520379C>T								ZNF287 (47859 upstream) : ZNF624 (3671 downstream)																							AGACCTGCTTCGATATTTCTC	0.478																																																0			17																																								16461104	SO:0001628	intergenic_variant	644422																															17.37:g.16520379C>T		Somatic		Capture	Illumina GAIIx	4	16461104		RNA	SNP	-	NULL		37	NULL		17																																																																																			-	-	0	0.478					LOC644422			C			16461104	-1	pseudogene	XR_017541	genbank	human	model	54_36p	rna	SNP	1.000	T
TAS1R2	80834	genome.wustl.edu	37	1	19186053	19186053	+	Silent	SNP	G	G	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:19186053G>T	ENST00000375371.3	-	1	123	c.102C>A	c.(100-102)ctC>ctA	p.L34L	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	34					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	GGCCACCCAGGAGGTAATCCC	0.587																																																0			1											119.0	110.0	113.0					1																	19186053		2203	4300	6503	19058640	SO:0001819	synonymous_variant	80834				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.102C>A	1.37:g.19186053G>T		Somatic		Capture	Illumina GAIIx	4	19058640	Q5TZ19	Silent	SNP	PatternScan_G_PROTEIN_RECEP_F3_1,PatternScan_G_PROTEIN_RECEP_F3_3,superfamily_SSF53822,HMMPfam_ANF_receptor,HMMPfam_NCD3G,superfamily_SSF57586,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3	p.L34	ENST00000375371.3	37	c.102	CCDS187.1	1																																																																																			-	superfamily_SSF53822		0.587	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	protein_coding	OTTHUMT00000006953.1	G			19058640	-1	no_errors	NM_152232	genbank	human	validated	54_36p	silent	SNP	0.994	T
SPAG5	10615	genome.wustl.edu	37	17	26912141	26912141	+	Silent	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr17:26912141C>A	ENST00000321765.5	-	10	2378	c.2046G>T	c.(2044-2046)gtG>gtT	p.V682V		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	682	Gln-rich.|Interaction with KNSTRN.				chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					CCTCAATTGCCACATCACGTT	0.498																																																0			17											198.0	173.0	181.0					17																	26912141		2203	4300	6503	23936268	SO:0001819	synonymous_variant	10615			AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.2046G>T	17.37:g.26912141C>A		Somatic		Capture	Illumina GAIIx	4	23936268	O95213|Q9BWE8|Q9NT17|Q9UFE6	Silent	SNP	NULL	p.V682	ENST00000321765.5	37	c.2046	CCDS32594.1	17																																																																																			-	NULL		0.498	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG5	protein_coding	OTTHUMT00000390564.2	C	NM_006461		23936268	-1	no_errors	NM_006461	genbank	human	reviewed	54_36p	silent	SNP	0.362	A
CRYBA4	1413	genome.wustl.edu	37	22	27024284	27024284	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr22:27024284G>C	ENST00000354760.3	+	5	368	c.333G>C	c.(331-333)gaG>gaC	p.E111D	CRYBA4_ENST00000466315.1_3'UTR	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4	111	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						CAATCTTCGAGCAAGAGAACT	0.567																																																0			22											137.0	118.0	125.0					22																	27024284		2203	4300	6503	25354284	SO:0001583	missense	1413				CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.333G>C	22.37:g.27024284G>C	ENSP00000346805:p.Glu111Asp	Somatic		Capture	Illumina GAIIx	4	25354284	Q4VB22|Q6ICE4	Missense_Mutation	SNP	superfamily_G_crystallin_SF,HMMPfam_Crystall,HMMSmart_XTALbg	p.E111D	ENST00000354760.3	37	c.333	CCDS13841.1	22	.	.	.	.	.	.	.	.	.	.	G	17.35	3.367602	0.61513	.	.	ENSG00000196431	ENST00000354760	T	0.80824	-1.42	4.3	3.25	0.37280	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	T	0.80099	0.4561	M	0.79011	2.435	0.80722	D	1	B	0.30068	0.267	B	0.35971	0.215	T	0.77970	-0.2387	10	0.52906	T	0.07	.	8.6077	0.33784	0.123:0.0:0.877:0.0	.	111	P53673	CRBA4_HUMAN	D	111	ENSP00000346805:E111D	ENSP00000346805:E111D	E	+	3	2	CRYBA4	25354284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.274000	0.65569	0.956000	0.37904	0.655000	0.94253	GAG	-	superfamily_G_crystallin_SF,HMMPfam_Crystall,HMMSmart_XTALbg		0.567	CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYBA4	protein_coding	OTTHUMT00000320793.1	G	NM_001886		25354284	+1	no_errors	NM_001886	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
BTNL2	56244	genome.wustl.edu	37	6	32370751	32370751	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr6:32370751C>T	ENST00000374993.1	-	3	669	c.670G>A	c.(670-672)Gtc>Atc	p.V224I	BTNL2_ENST00000414363.1_Intron|BTNL2_ENST00000544175.1_Intron|BTNL2_ENST00000374995.3_Intron|BTNL2_ENST00000454136.3_Missense_Mutation_p.V224I|BTNL2_ENST00000429232.2_Intron|BTNL2_ENST00000540315.1_Intron	NM_019602.1	NP_062548.1	Q9UIR0	BTNL2_HUMAN	butyrophilin-like 2 (MHC class II associated)	224	Ig-like V-type 2.					integral component of membrane (GO:0016021)		p.V224I(1)		central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|urinary_tract(1)	19						TCAGTGAGGACGGGGTTGTGG	0.592																																																1	Substitution - Missense(1)	large_intestine(1)	6											73.0	61.0	65.0					6																	32370751		1511	2708	4219	32478729	SO:0001583	missense	56244			AF186588		6p21.3	2014-01-14			ENSG00000204290	ENSG00000204290		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1142	protein-coding gene	gene with protein product		606000				10803852, 15735647	Standard	XM_006726138		Approved	HSBLMHC1, BTL-II, BTN7	uc003obg.1	Q9UIR0	OTTHUMG00000031102	ENST00000374993.1:c.670G>A	6.37:g.32370751C>T	ENSP00000364132:p.Val224Ile	Somatic		Capture	Illumina GAIIx	4	32478729	A0PJV5|B0UYW9|B0V0N6|O98261|Q08E96|Q58R22|Q58R23|Q5JYF9|Q5MP42|Q5MP43|Q5RIF8|Q5SP08|Q5SP09|Q5SRW3|Q5SRW4|Q5SU36|Q95HK0	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00406,HMMPfam_C2-set_2,HMMSmart_SM00407	p.V224I	ENST00000374993.1	37	c.670		6	.	.	.	.	.	.	.	.	.	.	C	1.530	-0.544595	0.04024	.	.	ENSG00000204290	ENST00000468270;ENST00000374993	T	0.75589	-0.95	4.71	-5.73	0.02398	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.451450	0.04328	N	0.351912	T	0.18718	0.0449	N	0.05487	-0.04	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.06570	-1.0819	10	0.07482	T	0.82	.	1.9694	0.03402	0.1228:0.378:0.2442:0.255	.	224	Q9UIR0	BTNL2_HUMAN	I	224	ENSP00000364132:V224I	ENSP00000364132:V224I	V	-	1	0	BTNL2	32478729	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	-2.170000	0.01268	-0.689000	0.05149	-0.172000	0.13284	GTC	-	superfamily_Immunoglobulin,HMMPfam_C2-set_2,HMMSmart_SM00407		0.592	BTNL2-201	KNOWN	basic|appris_principal	protein_coding	BTNL2	protein_coding		C	NM_019602		32478729	-1	no_errors	NM_019602	genbank	human	validated	54_36p	missense	SNP	0.000	T
KIAA1755	85449	genome.wustl.edu	37	20	36869861	36869861	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr20:36869861G>T	ENST00000279024.4	-	3	943	c.672C>A	c.(670-672)gaC>gaA	p.D224E		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	224										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GCACCTGGTTGTCTGGGGAGC	0.592																																																0			20											93.0	89.0	90.0					20																	36869861		2203	4300	6503	36303275	SO:0001583	missense	85449			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.672C>A	20.37:g.36869861G>T	ENSP00000279024:p.Asp224Glu	Somatic		Capture	Illumina GAIIx	4	36303275	Q9C0A8	Missense_Mutation	SNP	superfamily_Spectrin repeat	p.D224E	ENST00000279024.4	37	c.672	CCDS33467.1	20	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.518864	0.00967	.	.	ENSG00000149633	ENST00000279024	T	0.05447	3.44	5.46	3.5	0.40072	.	0.498121	0.18686	N	0.134011	T	0.04952	0.0133	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44329	-0.9335	10	0.10902	T	0.67	.	7.9207	0.29843	0.0812:0.0:0.7591:0.1597	.	224	Q5JYT7	K1755_HUMAN	E	224	ENSP00000279024:D224E	ENSP00000279024:D224E	D	-	3	2	KIAA1755	36303275	0.000000	0.05858	0.003000	0.11579	0.062000	0.15995	0.231000	0.17872	0.842000	0.35045	0.655000	0.94253	GAC	-	NULL		0.592	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	protein_coding	OTTHUMT00000079144.3	G	NM_001029864		36303275	-1	no_errors	NM_001029864	genbank	human	predicted	54_36p	missense	SNP	0.002	T
KRTAP4-6	81871	genome.wustl.edu	37	17	39296356	39296356	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr17:39296356C>G	ENST00000345847.4	-	1	383	c.384G>C	c.(382-384)caG>caC	p.Q128H		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	128	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						ACTGGCAGCACTGGGACCTGC	0.662																																																0			17																																								36549882	SO:0001583	missense	81871			AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.384G>C	17.37:g.39296356C>G	ENSP00000328270:p.Gln128His	Somatic		Capture	Illumina GAIIx	4	36549882	Q9BYR1	Missense_Mutation	SNP	NULL	p.S207T	ENST00000345847.4	37	c.620	CCDS54125.1	17	.	.	.	.	.	.	.	.	.	.	.	14.52	2.561257	0.45590	.	.	ENSG00000198090	ENST00000345847	T	0.00593	6.34	3.75	-6.29	0.02013	.	.	.	.	.	T	0.00906	0.0030	L	0.61218	1.895	0.09310	N	0.999998	.	.	.	.	.	.	T	0.19976	-1.0289	7	0.54805	T	0.06	.	6.6375	0.22891	0.1181:0.2937:0.5072:0.081	.	.	.	.	H	128	ENSP00000328270:Q128H	ENSP00000328270:Q128H	Q	-	3	2	KRTAP4-6	36549882	0.141000	0.22595	0.001000	0.08648	0.601000	0.36947	0.042000	0.13949	-0.784000	0.04528	-0.171000	0.13296	CAG	-	NULL		0.662	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-6	protein_coding	OTTHUMT00000257779.1	C			36549882	-1	no_errors	XM_926610	genbank	human	model	54_36p	missense	SNP	0.277	G
KLHL11	55175	genome.wustl.edu	37	17	40010777	40010777	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr17:40010777G>C	ENST00000319121.3	-	2	1402	c.1342C>G	c.(1342-1344)Cta>Gta	p.L448V		NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	448										NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				ACTTCTGTTAGTCCAAAAGAA	0.378																																																0			17											122.0	124.0	123.0					17																	40010777		2203	4300	6503	37264303	SO:0001583	missense	55175				CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.1342C>G	17.37:g.40010777G>C	ENSP00000314608:p.Leu448Val	Somatic		Capture	Illumina GAIIx	4	37264303		Missense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB,HMMPfam_BACK,superfamily_Gal_oxid_central,HMMSmart_Kelch,HMMPfam_Kelch_1	p.L448V	ENST00000319121.3	37	c.1342	CCDS11411.1	17	.	.	.	.	.	.	.	.	.	.	G	3.405	-0.121394	0.06838	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	T	0.74632	-0.86	4.73	3.73	0.42828	Galactose oxidase, beta-propeller (1);	0.000000	0.64402	D	0.000001	T	0.59689	0.2212	N	0.16201	0.385	0.54753	D	0.999988	P	0.36086	0.536	P	0.44477	0.451	T	0.56902	-0.7902	10	0.02654	T	1	0.8919	12.5022	0.55962	0.0848:0.0:0.9152:0.0	.	448	Q9NVR0	KLH11_HUMAN	V	448;311	ENSP00000314608:L448V	ENSP00000314608:L448V	L	-	1	2	KLHL11	37264303	1.000000	0.71417	0.995000	0.50966	0.970000	0.65996	4.309000	0.59135	1.274000	0.44362	0.585000	0.79938	CTA	-	superfamily_Gal_oxid_central,HMMSmart_Kelch,HMMPfam_Kelch_1		0.378	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL11	protein_coding	OTTHUMT00000257464.2	G	NM_018143		37264303	-1	no_errors	NM_018143	genbank	human	provisional	54_36p	missense	SNP	1.000	C
TLR1	7096	genome.wustl.edu	37	4	38798936	38798936	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr4:38798936G>A	ENST00000502213.2	-	3	1746	c.1517C>T	c.(1516-1518)tCg>tTg	p.S506L	TLR1_ENST00000510552.1_5'Flank|TLR1_ENST00000308979.2_Missense_Mutation_p.S506L			Q15399	TLR1_HUMAN	toll-like receptor 1	506					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						GAAATCAGCCGATGGGTGGGA	0.418																																					GBM(5;216 373 40795 46382)											0			4											74.0	77.0	76.0					4																	38798936		2202	4280	6482	38475331	SO:0001583	missense	7096			U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1517C>T	4.37:g.38798936G>A	ENSP00000421259:p.Ser506Leu	Somatic		Capture	Illumina GAIIx	4	38475331	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,superfamily_Outer arm dynein light chain 1,HMMSmart_SM00364,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.S506L	ENST00000502213.2	37	c.1517	CCDS33973.1	4	.	.	.	.	.	.	.	.	.	.	G	15.95	2.984061	0.53827	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	T;T	0.18174	2.23;2.23	4.75	4.75	0.60458	.	0.104218	0.42053	D	0.000769	T	0.46927	0.1418	M	0.89715	3.055	0.47214	D	0.999357	D	0.69078	0.997	P	0.58928	0.848	T	0.59637	-0.7417	10	0.87932	D	0	.	18.3059	0.90180	0.0:0.0:1.0:0.0	.	506	Q15399	TLR1_HUMAN	L	506	ENSP00000354932:S506L;ENSP00000421259:S506L	ENSP00000354932:S506L	S	-	2	0	TLR1	38475331	1.000000	0.71417	0.906000	0.35671	0.172000	0.22775	4.535000	0.60629	2.636000	0.89361	0.650000	0.86243	TCG	-	superfamily_L domain-like		0.418	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR1	protein_coding	OTTHUMT00000360510.3	G			38475331	-1	no_errors	NM_003263	genbank	human	reviewed	54_36p	missense	SNP	0.989	A
TLR1	7096	genome.wustl.edu	37	4	38800400	38800400	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr4:38800400C>A	ENST00000502213.2	-	3	282	c.53G>T	c.(52-54)aGa>aTa	p.R18I	TLR1_ENST00000308979.2_Missense_Mutation_p.R18I			Q15399	TLR1_HUMAN	toll-like receptor 1	18					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TAATTGTATTCTGATCTGAAG	0.338																																					GBM(5;216 373 40795 46382)											0			4											41.0	44.0	43.0					4																	38800400		2193	4292	6485	38476795	SO:0001583	missense	7096			U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.53G>T	4.37:g.38800400C>A	ENSP00000421259:p.Arg18Ile	Somatic		Capture	Illumina GAIIx	4	38476795	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	HMMPfam_TIR,HMMSmart_SM00255,superfamily_Toll/Interleukin receptor TIR domain,HMMPfam_LRRCT,HMMSmart_SM00082,HMMPfam_LRR_1,HMMSmart_SM00369,HMMSmart_SM00364,superfamily_L domain-like,superfamily_Outer arm dynein light chain 1	p.R18I	ENST00000502213.2	37	c.53	CCDS33973.1	4	.	.	.	.	.	.	.	.	.	.	C	8.914	0.959348	0.18507	.	.	ENSG00000174125	ENST00000308979;ENST00000502213;ENST00000505940;ENST00000515861;ENST00000506146;ENST00000508364	T;T;T;T;T	0.44881	4.58;4.58;1.32;2.26;0.91	5.09	0.702	0.18110	.	1.163120	0.06173	N	0.678113	T	0.25531	0.0621	N	0.20766	0.605	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.21793	-1.0235	10	0.34782	T	0.22	.	3.529	0.07770	0.2565:0.2756:0.0:0.468	.	18	Q15399	TLR1_HUMAN	I	18	ENSP00000354932:R18I;ENSP00000421259:R18I;ENSP00000421856:R18I;ENSP00000423017:R18I;ENSP00000423725:R18I	ENSP00000354932:R18I	R	-	2	0	TLR1	38476795	0.000000	0.05858	0.061000	0.19648	0.230000	0.25150	0.057000	0.14279	0.289000	0.22422	0.655000	0.94253	AGA	-	superfamily_L domain-like		0.338	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR1	protein_coding	OTTHUMT00000360510.3	C			38476795	-1	no_errors	NM_003263	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
DNAH8	1769	genome.wustl.edu	37	6	38942236	38942236	+	Silent	SNP	G	G	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr6:38942236G>C	ENST00000359357.3	+	83	12368	c.12114G>C	c.(12112-12114)ctG>ctC	p.L4038L	DNAH8_ENST00000441566.1_Silent_p.L4002L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4038	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AAGACCTTCTGGACATCAGTA	0.423																																																0			6											96.0	87.0	90.0					6																	38942236		2203	4300	6503	39050214	SO:0001819	synonymous_variant	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12114G>C	6.37:g.38942236G>C		Somatic		Capture	Illumina GAIIx	4	39050214	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,PatternScan_THIOL_PROTEASE_HIS,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.L4038	ENST00000359357.3	37	c.12114		6																																																																																			-	HMMPfam_Dynein_heavy		0.423	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	G	NM_001206927		39050214	+1	no_errors	NM_001371	genbank	human	validated	54_36p	silent	SNP	1.000	C
ZFP14	57677	genome.wustl.edu	37	19	36851341	36851341	+	Silent	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr19:36851341G>A	ENST00000270001.7	-	4	346	c.231C>T	c.(229-231)tgC>tgT	p.C77C	ZFP14_ENST00000589280.1_Silent_p.C78C	NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	77	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					ACTCACCAGGGCAGTATCTTC	0.478																																																0			19											198.0	149.0	165.0					19																	36851341		2203	4300	6503	41543181	SO:0001819	synonymous_variant	57677			AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.231C>T	19.37:g.36851341G>A		Somatic		Capture	Illumina GAIIx	4	41543181	A7MD23	Silent	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.C77	ENST00000270001.7	37	c.231	CCDS33002.1	19																																																																																			-	NULL		0.478	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP14	protein_coding	OTTHUMT00000452528.1	G	NM_020917		41543181	-1	no_errors	NM_020917	genbank	human	provisional	54_36p	silent	SNP	0.002	A
DGKH	160851	genome.wustl.edu	37	13	42783556	42783556	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr13:42783556C>G	ENST00000337343.4	+	23	2826	c.2805C>G	c.(2803-2805)atC>atG	p.I935M	DGKH_ENST00000538674.1_Missense_Mutation_p.I690M|DGKH_ENST00000379274.2_Missense_Mutation_p.I799M|DGKH_ENST00000536612.1_Missense_Mutation_p.I799M|DGKH_ENST00000261491.5_Missense_Mutation_p.I935M|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000540693.1_Missense_Mutation_p.I935M	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	935					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		CAGGGATTATCAAAATTGTGC	0.388																																																0			13											90.0	83.0	85.0					13																	42783556		2203	4300	6503	41681556	SO:0001583	missense	160851			AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.2805C>G	13.37:g.42783556C>G	ENSP00000337572:p.Ile935Met	Somatic		Capture	Illumina GAIIx	4	41681556	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,HMMPfam_DAGK_cat,HMMSmart_SM00046,HMMPfam_DAGK_acc,HMMSmart_SM00045,superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_2	p.I935M	ENST00000337343.4	37	c.2805	CCDS9381.1	13	.	.	.	.	.	.	.	.	.	.	C	16.70	3.196363	0.58126	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71;0.71	5.68	2.47	0.30058	.	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	M	0.86268	2.805	0.54753	D	0.999984	D;D;D;D	0.89917	1.0;0.998;0.982;0.994	D;D;D;D	0.85130	0.997;0.971;0.915;0.965	T	0.63359	-0.6655	10	0.87932	D	0	.	2.2104	0.03946	0.2315:0.4053:0.0:0.3632	.	690;799;935;935	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	M	935;935;935;799;799;690	ENSP00000440823:I935M;ENSP00000337572:I935M;ENSP00000261491:I935M;ENSP00000368576:I799M;ENSP00000445114:I799M;ENSP00000441308:I690M	ENSP00000261491:I935M	I	+	3	3	DGKH	41681556	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.200000	0.32247	0.831000	0.34780	-0.216000	0.12614	ATC	-	NULL		0.388	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKH	protein_coding	OTTHUMT00000044699.2	C	NM_178009		41681556	+1	no_errors	NM_178009	genbank	human	reviewed	54_36p	missense	SNP	0.999	G
IPO13	9670	genome.wustl.edu	37	1	44422884	44422884	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:44422884C>T	ENST00000372343.3	+	6	1951	c.1289C>T	c.(1288-1290)aCg>aTg	p.T430M	IPO13_ENST00000492152.1_3'UTR	NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	430					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				ATCTCAGACACGCTCATGTAT	0.567																																																0			1											104.0	104.0	104.0					1																	44422884		2203	4300	6503	44195471	SO:0001583	missense	9670			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.1289C>T	1.37:g.44422884C>T	ENSP00000361418:p.Thr430Met	Somatic		Capture	Illumina GAIIx	4	44195471	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_IBN_N,HMMPfam_Xpo1	p.T430M	ENST00000372343.3	37	c.1289	CCDS503.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114562	0.77210	.	.	ENSG00000117408	ENST00000372343	T	0.68624	-0.34	5.79	5.79	0.91817	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82356	0.5019	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.79909	-0.1604	10	0.37606	T	0.19	-16.6704	20.031	0.97536	0.0:1.0:0.0:0.0	.	430	O94829	IPO13_HUMAN	M	430	ENSP00000361418:T430M	ENSP00000361418:T430M	T	+	2	0	IPO13	44195471	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	7.716000	0.84723	2.728000	0.93425	0.561000	0.74099	ACG	-	superfamily_ARM-type_fold		0.567	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO13	protein_coding	OTTHUMT00000022846.1	C	NM_014652		44195471	+1	no_errors	NM_014652	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MED29	55588	genome.wustl.edu	37	19	39882165	39882165	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr19:39882165C>T	ENST00000599213.2	+	1	130	c.103C>T	c.(103-105)Cca>Tca	p.P35S	MED29_ENST00000315588.5_Missense_Mutation_p.P56S|PAF1_ENST00000595564.1_5'Flank|MED29_ENST00000594368.1_Missense_Mutation_p.P35S|PAF1_ENST00000221265.3_5'Flank|PAF1_ENST00000221266.7_5'Flank			Q9NX70	MED29_HUMAN	mediator complex subunit 29	35	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleus (GO:0005634)				lung(2)|ovary(1)|pancreas(1)	4	all_cancers(60;7.82e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;1.04e-26)|all cancers(26;7.68e-24)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			GCCGCAACCGCCAGCACAACT	0.637																																																0			19											21.0	24.0	23.0					19																	39882165		2192	4282	6474	44574005	SO:0001583	missense	55588			AL137304, AY729650	CCDS33021.1	19q13.2	2007-07-30	2007-07-30	2007-07-30		ENSG00000063322			23074	protein-coding gene	gene with protein product		612914	"""intersex-like (Drosophila)"""	IXL		15555573	Standard	NM_017592		Approved	DKFZp434H247	uc010xux.3	Q9NX70		ENST00000599213.2:c.103C>T	19.37:g.39882165C>T	ENSP00000471802:p.Pro35Ser	Somatic		Capture	Illumina GAIIx	4	44574005	B4DNQ6|M0R2E4|Q5XX09|Q9NTF4	Missense_Mutation	SNP	NULL	p.P56S	ENST00000599213.2	37	c.166		19	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455387	0.84209	.	.	ENSG00000063322	ENST00000315588	.	.	.	5.26	4.2	0.49525	.	0.418212	0.23277	N	0.049942	T	0.10895	0.0266	N	0.08118	0	0.20307	N	0.999919	P;B	0.35507	0.506;0.005	B;B	0.24155	0.051;0.009	T	0.19549	-1.0302	9	0.07644	T	0.81	-20.8551	10.0305	0.42099	0.0:0.9067:0.0:0.0933	.	35;56	Q9NX70;B4DUA7	MED29_HUMAN;.	S	56	.	ENSP00000314343:P56S	P	+	1	0	MED29	44574005	0.872000	0.30054	0.995000	0.50966	0.994000	0.84299	1.403000	0.34612	2.734000	0.93682	0.655000	0.94253	CCA	-	NULL		0.637	MED29-011	KNOWN	basic|appris_candidate	protein_coding	MED29	protein_coding	OTTHUMT00000470870.1	C	XM_290829		44574005	+1	no_errors	NM_017592	genbank	human	provisional	54_36p	missense	SNP	0.923	T
KRTAP10-5	386680	genome.wustl.edu	37	21	45999893	45999893	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr21:45999893C>G	ENST00000400372.1	-	1	588	c.563G>C	c.(562-564)tGt>tCt	p.C188S	TSPEAR_ENST00000323084.4_Intron	NM_198694.2	NP_941967.2	P60370	KR105_HUMAN	keratin associated protein 10-5	188	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(2)|kidney(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	14						GACGGGCACACAGCAGATGGG	0.617																																																0			21											187.0	193.0	191.0					21																	45999893		2203	4300	6503	44824321	SO:0001583	missense	386680			AJ566384	CCDS42958.1	21q22.3	2007-10-05			ENSG00000241123	ENSG00000241123		"""Keratin associated proteins"""	22969	protein-coding gene	gene with protein product				KRTAP18-5			Standard	NM_198694		Approved	KAP10.5, KAP18.5	uc002zfl.1	P60370	OTTHUMG00000057638	ENST00000400372.1:c.563G>C	21.37:g.45999893C>G	ENSP00000383223:p.Cys188Ser	Somatic		Capture	Illumina GAIIx	4	44824321	Q0VAR7|Q0VAR8|Q70LJ3	Missense_Mutation	SNP	HMMPfam_Keratin_B2	p.C188S	ENST00000400372.1	37	c.563	CCDS42958.1	21	.	.	.	.	.	.	.	.	.	.	c	5.995	0.367445	0.11352	.	.	ENSG00000241123	ENST00000400372	T	0.02280	4.36	2.5	1.54	0.23209	.	.	.	.	.	T	0.09730	0.0239	M	0.81112	2.525	0.09310	N	0.999992	P	0.38223	0.623	P	0.55615	0.78	T	0.06789	-1.0807	9	0.51188	T	0.08	.	8.2293	0.31589	0.0:0.5112:0.4888:0.0	.	188	P60370	KR105_HUMAN	S	188	ENSP00000383223:C188S	ENSP00000383223:C188S	C	-	2	0	KRTAP10-5	44824321	0.037000	0.19845	0.012000	0.15200	0.007000	0.05969	0.511000	0.22739	0.333000	0.23563	0.305000	0.20034	TGT	-	HMMPfam_Keratin_B2		0.617	KRTAP10-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-5	protein_coding	OTTHUMT00000128042.1	C			44824321	-1	no_errors	NM_198694	genbank	human	reviewed	54_36p	missense	SNP	0.006	G
UROD	7389	genome.wustl.edu	37	1	45481027	45481027	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:45481027G>A	ENST00000246337.4	+	10	1080	c.961G>A	c.(961-963)Gtg>Atg	p.V321M	UROD_ENST00000494399.1_3'UTR	NM_000374.4	NP_000365.3	P06132	DCUP_HUMAN	uroporphyrinogen decarboxylase	321					heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	uroporphyrinogen decarboxylase activity (GO:0004853)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	Acute lymphoblastic leukemia(166;0.155)					CGGGCAGTTGGTGAAGCAGAT	0.537									Porphyria Cutanea Tarda, Type II		OREG0013449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			1											129.0	111.0	117.0					1																	45481027		2203	4300	6503	45253614	SO:0001583	missense	7389	Familial Cancer Database	PCT-II	BC001778	CCDS518.1	1p34	2012-10-02			ENSG00000126088	ENSG00000126088	4.1.1.37		12591	protein-coding gene	gene with protein product		613521				3015909, 3460962	Standard	NM_000374		Approved		uc001cna.2	P06132	OTTHUMG00000008949	ENST00000246337.4:c.961G>A	1.37:g.45481027G>A	ENSP00000246337:p.Val321Met	Somatic	931	Capture	Illumina GAIIx	4	45253614	A8K762|Q16863|Q16883|Q53YB8|Q53ZP6|Q6IB28|Q9BUZ0	Missense_Mutation	SNP	superfamily_UROD/MetE-like,HMMPfam_URO-D,PatternScan_UROD_1,PatternScan_UROD_2	p.V321M	ENST00000246337.4	37	c.961	CCDS518.1	1	.	.	.	.	.	.	.	.	.	.	G	18.56	3.649907	0.67472	.	.	ENSG00000126088	ENST00000246337	D	0.95724	-3.79	4.89	4.89	0.63831	Uroporphyrinogen decarboxylase (URO-D) (1);	0.000000	0.85682	D	0.000000	D	0.98257	0.9423	M	0.93241	3.395	0.80722	D	1	D	0.76494	0.999	D	0.68039	0.955	D	0.99174	1.0865	10	0.87932	D	0	-39.5658	18.5947	0.91226	0.0:0.0:1.0:0.0	.	321	P06132	DCUP_HUMAN	M	321	ENSP00000246337:V321M	ENSP00000246337:V321M	V	+	1	0	UROD	45253614	1.000000	0.71417	0.974000	0.42286	0.042000	0.13812	8.911000	0.92721	2.710000	0.92621	0.655000	0.94253	GTG	-	superfamily_UROD/MetE-like,HMMPfam_URO-D		0.537	UROD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROD	protein_coding	OTTHUMT00000024803.1	G	NM_000374		45253614	+1	no_errors	NM_000374	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CHD9	80205	genome.wustl.edu	37	16	53262952	53262952	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr16:53262952C>G	ENST00000398510.3	+	7	2313	c.2226C>G	c.(2224-2226)atC>atG	p.I742M	CHD9_ENST00000564845.1_Missense_Mutation_p.I742M|CHD9_ENST00000566029.1_Missense_Mutation_p.I742M|CHD9_ENST00000447540.1_Missense_Mutation_p.I742M			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	742	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				ATAAAAGGATCCAGCAGAAAA	0.318																																																0			16											37.0	33.0	34.0					16																	53262952		1804	4073	5877	51820453	SO:0001583	missense	80205			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.2226C>G	16.37:g.53262952C>G	ENSP00000381522:p.Ile742Met	Somatic		Capture	Illumina GAIIx	4	51820453	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	superfamily_Chromodomain-like,HMMSmart_CHROMO,HMMPfam_Chromo,superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_SNF2_N,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_BRK,HMMSmart_BRK	p.I742M	ENST00000398510.3	37	c.2226		16	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311456	0.60414	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	D;D	0.87887	-2.23;-2.31	5.36	-2.64	0.06114	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.284949	0.26496	N	0.024058	D	0.91274	0.7249	M	0.87269	2.87	0.52501	D	0.999958	D;D;D;D	0.71674	0.985;0.998;0.997;0.997	D;D;D;D	0.83275	0.962;0.991;0.996;0.994	D	0.87563	0.2473	10	0.72032	D	0.01	-9.1684	5.2085	0.15304	0.2258:0.4472:0.0:0.327	.	268;742;742;742	B4DR07;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	M	742;742;268	ENSP00000396345:I742M;ENSP00000381522:I742M	ENSP00000219084:I268M	I	+	3	3	CHD9	51820453	0.995000	0.38212	0.993000	0.49108	0.996000	0.88848	0.447000	0.21710	-0.247000	0.09597	0.460000	0.39030	ATC	-	superfamily_Chromodomain-like,HMMSmart_CHROMO,HMMPfam_Chromo		0.318	CHD9-020	KNOWN	basic	protein_coding	CHD9	protein_coding	OTTHUMT00000422345.1	C	NM_025134		51820453	+1	no_errors	NM_025134	genbank	human	validated	54_36p	missense	SNP	0.997	G
GPR137C	283554	genome.wustl.edu	37	14	53066941	53066941	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr14:53066941C>A	ENST00000321662.6	+	3	599	c.599C>A	c.(598-600)aCt>aAt	p.T200N		NM_001099652.1	NP_001093122.1	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C	200						integral component of membrane (GO:0016021)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8	Breast(41;0.0716)					TTGAAGTGGACTGTGTTTGTT	0.373																																																0			14											254.0	220.0	231.0					14																	53066941		1868	4117	5985	52136691	SO:0001583	missense	283554			BX647179	CCDS45106.1	14q22.1	2012-08-10				ENSG00000180998			25445	protein-coding gene	gene with protein product							Standard	NM_001099652		Approved	DKFZp762F0713, TM7SF1L2	uc001wzu.4	Q8N3F9		ENST00000321662.6:c.599C>A	14.37:g.53066941C>A	ENSP00000315106:p.Thr200Asn	Somatic		Capture	Illumina GAIIx	4	52136691	Q86SM2	Missense_Mutation	SNP	NULL	p.T200N	ENST00000321662.6	37	c.599	CCDS45106.1	14	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	18.42|18.42|18.42	3.620033|3.620033|3.620033	0.66787|0.66787|0.66787	.|.|.	.|.|.	ENSG00000180998|ENSG00000180998|ENSG00000180998	ENST00000542169|ENST00000555622|ENST00000321662	.|.|T	.|.|0.44482	.|.|0.92	5.44|5.44|5.44	5.44|5.44|5.44	0.79542|0.79542|0.79542	.|.|.	.|.|0.103858	.|.|0.64402	.|.|D	.|.|0.000003	T|T|T	0.51873|0.51873|0.51873	0.1700|0.1700|0.1700	L|L|L	0.40543|0.40543|0.40543	1.245|1.245|1.245	0.38970|0.38970|0.38970	D|D|D	0.958736|0.958736|0.958736	.|.|D;D	.|.|0.71674	.|.|0.998;0.998	.|.|P;P	.|.|0.62649	.|.|0.905;0.905	T|T|T	0.56141|0.56141|0.56141	-0.8028|-0.8028|-0.8028	5|5|10	.|.|0.72032	.|.|D	.|.|0.01	-24.1677|-24.1677|-24.1677	12.5885|12.5885|12.5885	0.56430|0.56430|0.56430	0.0:0.924:0.0:0.076|0.0:0.924:0.0:0.076|0.0:0.924:0.0:0.076	.|.|.	.|.|200;29	.|.|Q8N3F9;B3KW22	.|.|G137C_HUMAN;.	E|M|N	153|132|200	.|.|ENSP00000315106:T200N	.|.|ENSP00000315106:T200N	D|L|T	+|+|+	3|1|2	2|2|0	GPR137C|GPR137C|GPR137C	52136691|52136691|52136691	0.977000|0.977000|0.977000	0.34250|0.34250|0.34250	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	1.197000|1.197000|1.197000	0.32211|0.32211|0.32211	2.534000|2.534000|2.534000	0.85438|0.85438|0.85438	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GAC|CTG|ACT	-	NULL		0.373	GPR137C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR137C	protein_coding	OTTHUMT00000411685.1	C	XM_290615		52136691	+1	no_errors	NM_001099652	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ITGA2	3673	genome.wustl.edu	37	5	52363081	52363081	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr5:52363081C>T	ENST00000296585.5	+	16	2220	c.2077C>T	c.(2077-2079)Caa>Taa	p.Q693*		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	693					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				GCAAAACAATCAAGTGGGTGC	0.358																																																0			5											79.0	76.0	77.0					5																	52363081		2202	4300	6502	52398838	SO:0001587	stop_gained	3673				CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2077C>T	5.37:g.52363081C>T	ENSP00000296585:p.Gln693*	Somatic		Capture	Illumina GAIIx	4	52398838	Q14595	Nonsense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.Q693*	ENST00000296585.5	37	c.2077	CCDS3957.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.489328	0.97607	.	.	ENSG00000164171	ENST00000296585	.	.	.	5.09	5.09	0.68999	.	0.381500	0.27966	N	0.017130	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	11.9411	0.52901	0.0:0.9207:0.0:0.0793	.	.	.	.	X	693	.	ENSP00000296585:Q693X	Q	+	1	0	ITGA2	52398838	0.902000	0.30710	0.868000	0.34077	0.819000	0.46315	1.908000	0.39907	2.382000	0.81193	0.655000	0.94253	CAA	-	HMMPfam_Integrin_alpha2,superfamily_Integrin domains		0.358	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2	protein_coding	OTTHUMT00000253857.2	C	NM_002203		52398838	+1	no_errors	NM_002203	genbank	human	reviewed	54_36p	nonsense	SNP	0.936	T
ITIH6	347365	genome.wustl.edu	37	X	54785304	54785304	+	Silent	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chrX:54785304C>T	ENST00000218436.6	-	8	1232	c.1203G>A	c.(1201-1203)acG>acA	p.T401T		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	401	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										TCACGCCGGCCGTGGGCTCCC	0.607																																																0			X											51.0	40.0	44.0					X																	54785304		2203	4300	6503	54802029	SO:0001819	synonymous_variant	347365			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1203G>A	X.37:g.54785304C>T		Somatic		Capture	Illumina GAIIx	4	54802029	A6NN03	Silent	SNP	HMMSmart_VIT,HMMPfam_VIT,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,HMMPfam_ITI_HC_C	p.T401	ENST00000218436.6	37	c.1203	CCDS14361.1	X																																																																																			-	superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA		0.607	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH5L	protein_coding	OTTHUMT00000056814.2	C	NM_198510		54802029	-1	no_errors	NM_198510	genbank	human	provisional	54_36p	silent	SNP	0.334	T
SSRP1	6749	genome.wustl.edu	37	11	57093899	57093899	+	Silent	SNP	C	C	T	rs564469054		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr11:57093899C>T	ENST00000278412.2	-	17	2378	c.2112G>A	c.(2110-2112)gcG>gcA	p.A704A	TNKS1BP1_ENST00000358252.3_5'Flank|snoU13_ENST00000459327.1_RNA|RP11-872D17.4_ENST00000534162.1_RNA	NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	704	Ser-rich.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						CGGATCCTGACGCTGAGTCCT	0.527																																					Colon(89;1000 1340 6884 23013 41819)											0			11											139.0	126.0	130.0					11																	57093899		2201	4296	6497	56850475	SO:0001819	synonymous_variant	6749			M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.2112G>A	11.37:g.57093899C>T		Somatic		Capture	Illumina GAIIx	4	56850475	Q5BJG8	Silent	SNP	HMMPfam_SSrecog,superfamily_HMG-box,HMMSmart_HMG,HMMPfam_HMG_box	p.A704	ENST00000278412.2	37	c.2112	CCDS7952.1	11																																																																																			-	NULL		0.527	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSRP1	protein_coding	OTTHUMT00000392460.1	C	NM_003146		56850475	-1	no_errors	NM_003146	genbank	human	reviewed	54_36p	silent	SNP	0.265	T
ZNF479	90827	genome.wustl.edu	37	7	57188294	57188294	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr7:57188294T>A	ENST00000331162.4	-	5	1098	c.828A>T	c.(826-828)caA>caT	p.Q276H		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			GCCTAAAGGCTTGGCCACATT	0.458																																																0			7											38.0	39.0	39.0					7																	57188294		2102	4230	6332	57192236	SO:0001583	missense	90827			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.828A>T	7.37:g.57188294T>A	ENSP00000333776:p.Gln276His	Somatic		Capture	Illumina GAIIx	4	57192236		Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.Q276H	ENST00000331162.4	37	c.828	CCDS43590.1	7	.	.	.	.	.	.	.	.	.	.	t	12.34	1.908947	0.33721	.	.	ENSG00000185177	ENST00000331162	T	0.35973	1.28	1.01	1.01	0.19927	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30070	0.0753	N	0.17379	0.485	0.09310	N	1	P	0.47484	0.896	P	0.52267	0.694	T	0.13019	-1.0525	9	0.87932	D	0	.	5.8565	0.18722	0.0:0.0:0.0:1.0	.	276	Q96JC4	ZN479_HUMAN	H	276	ENSP00000333776:Q276H	ENSP00000333776:Q276H	Q	-	3	2	ZNF479	57192236	0.004000	0.15560	0.101000	0.21167	0.097000	0.18754	0.306000	0.19279	0.384000	0.24942	0.374000	0.22700	CAA	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.458	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF479	protein_coding	OTTHUMT00000345302.1	T	XM_291202		57192236	-1	no_errors	NM_033273	genbank	human	provisional	54_36p	missense	SNP	0.006	A
RPSAP52	204010	genome.wustl.edu	37	12	66152208	66152208	+	RNA	SNP	T	T	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr12:66152208T>C	ENST00000489520.2	-	0	735					NR_026825.2				ribosomal protein SA pseudogene 52																		CCCATGGGTGTTGCAGGAAAT	0.502																																																0			12																																								64438475			0					12q14.3	2010-09-24			ENSG00000241749	ENSG00000241749			35752	pseudogene	pseudogene						19123937	Standard	NR_026825		Approved		uc001sso.4		OTTHUMG00000157608		12.37:g.66152208T>C		Somatic		Capture	Illumina GAIIx	4	64438475		Silent	SNP	NULL	p.Q105	ENST00000489520.2	37	c.315		12																																																																																			-	NULL		0.502	RPSAP52-002	KNOWN	basic	processed_transcript	RPSAP52	pseudogene	OTTHUMT00000349256.2	T	NG_006174		64438475	-1	no_errors	ENST00000379004	ensembl	human	known	54_36p	silent	SNP	1.000	C
HYDIN	54768	genome.wustl.edu	37	16	71171252	71171252	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr16:71171252T>C	ENST00000393567.2	-	8	995	c.845A>G	c.(844-846)gAa>gGa	p.E282G	HYDIN_ENST00000288168.10_Missense_Mutation_p.E299G|HYDIN_ENST00000448691.1_Missense_Mutation_p.E282G|HYDIN_ENST00000321489.5_Missense_Mutation_p.E282G|HYDIN_ENST00000448089.2_Missense_Mutation_p.E282G|HYDIN_ENST00000393550.2_Missense_Mutation_p.E282G|HYDIN_ENST00000541601.1_Missense_Mutation_p.E299G|HYDIN_ENST00000538248.1_Missense_Mutation_p.E309G	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	282					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AAACACCTTTTCACCTAGGAA	0.358																																																0			16											2.0	1.0	2.0					16																	71171252		1274	2525	3799	69728753	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.845A>G	16.37:g.71171252T>C	ENSP00000377197:p.Glu282Gly	Somatic		Capture	Illumina GAIIx	4	69728753	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.E282G	ENST00000393567.2	37	c.845	CCDS59269.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.39|16.39	3.110830|3.110830	0.56398|0.56398	.|.	.|.	ENSG00000157423|ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601;ENST00000288168;ENST00000393550|ENST00000538382	T;T;T;T;T;T;T;T|.	0.17370|.	5.31;3.5;3.5;3.5;3.51;3.51;3.14;2.28|.	4.48|4.48	4.48|4.48	0.54585|0.54585	.|.	0.000000|.	0.31949|.	U|.	0.006801|.	T|T	0.75361|0.75361	0.3839|0.3839	M|M	0.81802|0.81802	2.56|2.56	0.46609|0.46609	D|D	0.999121|0.999121	P;P;D;B;P;D|.	0.76494|.	0.921;0.921;0.999;0.03;0.921;0.999|.	P;P;D;B;P;D|.	0.87578|.	0.842;0.842;0.998;0.027;0.901;0.998|.	T|T	0.77768|0.77768	-0.2464|-0.2464	10|5	0.30854|.	T|.	0.27|.	.|.	13.4905|13.4905	0.61393|0.61393	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	309;299;282;299;282;282|.	B4DRN4;F5H6V3;Q4G0P3;F8WD03;Q4G0P3-5;F8WD23|.	.;.;HYDIN_HUMAN;.;.;.|.	G|E	282;282;282;282;282;309;299;299;282|121	ENSP00000377197:E282G;ENSP00000398544:E282G;ENSP00000394826:E282G;ENSP00000314736:E282G;ENSP00000444970:E309G;ENSP00000437341:E299G;ENSP00000288168:E299G;ENSP00000377181:E282G|.	ENSP00000288168:E299G|.	E|K	-|-	2|1	0|0	HYDIN|HYDIN	69728753|69728753	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.823000|0.823000	0.46562|0.46562	6.042000|6.042000	0.70996|0.70996	1.989000|1.989000	0.58080|0.58080	0.369000|0.369000	0.22263|0.22263	GAA|AAA	-	NULL		0.358	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	T			69728753	-1	no_errors	NM_032821	genbank	human	validated	54_36p	missense	SNP	1.000	C
GOLGA6B	55889	genome.wustl.edu	37	15	72954797	72954797	+	Missense_Mutation	SNP	T	T	C	rs201618622	byFrequency	TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr15:72954797T>C	ENST00000421285.3	+	11	1052	c.1052T>C	c.(1051-1053)gTg>gCg	p.V351A	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	351						Golgi apparatus (GO:0005794)		p.V351A(4)		NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						GAGCAGGAGGTGCAGAGAGTG	0.562													t|||	142	0.0283546	0.0159	0.0274	5008	,	,		15500	0.0258		0.0249	False		,,,				2504	0.0521															4	Substitution - Missense(4)	skin(2)|lung(1)|endometrium(1)	15											81.0	81.0	81.0					15																	72954797		2063	3889	5952	70741851	SO:0001583	missense	55889				CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.1052T>C	15.37:g.72954797T>C	ENSP00000408132:p.Val351Ala	Somatic		Capture	Illumina GAIIx	4	70741851	A8MYY7	Missense_Mutation	SNP	NULL	p.V351A	ENST00000421285.3	37	c.1052	CCDS10245.2	15	.	.	.	.	.	.	.	.	.	.	.	0.612	-0.824760	0.02755	.	.	ENSG00000215186	ENST00000421285	T	0.21031	2.03	0.372	0.372	0.16173	.	.	.	.	.	T	0.07143	0.0181	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36601	-0.9741	9	0.27082	T	0.32	.	4.8248	0.13410	0.0:0.7182:0.0:0.2818	.	351	A6NDN3	GOG6B_HUMAN	A	351	ENSP00000408132:V351A	ENSP00000408132:V351A	V	+	2	0	GOLGA6B	70741851	0.000000	0.05858	0.144000	0.22314	0.053000	0.15095	-2.065000	0.01386	-1.296000	0.02353	-1.896000	0.00531	GTG	-	NULL		0.562	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6B	protein_coding	OTTHUMT00000257474.4	T	NM_018652		70741851	+1	no_errors	ENST00000268079	ensembl	human	known	54_36p	missense	SNP	0.441	C
TRHDE	29953	genome.wustl.edu	37	12	72969316	72969316	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr12:72969316T>A	ENST00000261180.4	+	12	2276	c.2180T>A	c.(2179-2181)cTa>cAa	p.L727Q	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	727					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						GCCTTCAGCCTAGCCAGGTAT	0.388																																																0			12											95.0	96.0	96.0					12																	72969316		2203	4299	6502	71255583	SO:0001583	missense	29953			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2180T>A	12.37:g.72969316T>A	ENSP00000261180:p.Leu727Gln	Somatic		Capture	Illumina GAIIx	4	71255583	A5PL19|Q6UWJ4	Missense_Mutation	SNP	superfamily_SSF63737,HMMPfam_Peptidase_M1,superfamily_SSF55486,PatternScan_ZINC_PROTEASE	p.L727Q	ENST00000261180.4	37	c.2180	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	T	23.5	4.427785	0.83667	.	.	ENSG00000072657	ENST00000261180	T	0.09538	2.97	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000001	T	0.42562	0.1208	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.54523	-0.8281	10	0.87932	D	0	.	15.6596	0.77174	0.0:0.0:0.0:1.0	.	727	Q9UKU6	TRHDE_HUMAN	Q	727	ENSP00000261180:L727Q	ENSP00000261180:L727Q	L	+	2	0	TRHDE	71255583	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.160000	0.77495	2.157000	0.67596	0.533000	0.62120	CTA	-	NULL		0.388	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	protein_coding	OTTHUMT00000405380.1	T	NM_013381		71255583	+1	no_errors	NM_013381	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CAPS2	84698	genome.wustl.edu	37	12	75687068	75687068	+	Missense_Mutation	SNP	C	C	T	rs373505414		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr12:75687068C>T	ENST00000409445.3	-	13	1377	c.1181G>A	c.(1180-1182)cGa>cAa	p.R394Q	CAPS2_ENST00000393284.3_Missense_Mutation_p.R162Q|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000442339.2_5'UTR|RP11-560G2.1_ENST00000549953.1_RNA|CAPS2_ENST00000409799.1_Missense_Mutation_p.R312Q|RP11-560G2.1_ENST00000534648.2_RNA	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	394							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						ATTTGTGATTCGGAGTTTAAG	0.318													C|||	1	0.000199681	0.0	0.0	5008	,	,		15115	0.001		0.0	False		,,,				2504	0.0															0			12											123.0	113.0	116.0					12																	75687068		2203	4300	6503	73973335	SO:0001583	missense	84698			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1181G>A	12.37:g.75687068C>T	ENSP00000386959:p.Arg394Gln	Somatic		Capture	Illumina GAIIx	4	73973335	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	superfamily_SSF47473,HMMSmart_EFh	p.R162Q	ENST00000409445.3	37	c.485	CCDS9008.2	12	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313982	0.60414	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000378703;ENST00000393284	T;T;T	0.30182	1.78;1.54;1.7	4.6	4.6	0.57074	.	0.130292	0.34245	N	0.004139	T	0.52322	0.1727	M	0.81239	2.535	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.999;0.998	P;P;P;P	0.55577	0.779;0.596;0.629;0.545	T	0.60115	-0.7326	10	0.52906	T	0.07	-8.0574	17.7821	0.88527	0.0:1.0:0.0:0.0	.	162;130;394;312	Q9BXY5-2;Q9BXY5-3;Q9BXY5;B9A061	.;.;CAYP2_HUMAN;.	Q	312;394;130;162	ENSP00000386977:R312Q;ENSP00000386959:R394Q;ENSP00000376963:R162Q	ENSP00000367975:R130Q	R	-	2	0	CAPS2	73973335	1.000000	0.71417	0.999000	0.59377	0.096000	0.18686	5.588000	0.67517	2.282000	0.76494	0.446000	0.29264	CGA	-	NULL		0.318	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	protein_coding	OTTHUMT00000327880.2	C			73973335	-1	no_errors	NM_032606	genbank	human	validated	54_36p	missense	SNP	1.000	T
LMO7	4008	genome.wustl.edu	37	13	76409451	76409451	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr13:76409451T>A	ENST00000321797.8	+	16	3331	c.2610T>A	c.(2608-2610)gaT>gaA	p.D870E	LMO7_ENST00000377534.3_Missense_Mutation_p.D1155E|LMO7_ENST00000341547.4_Missense_Mutation_p.D821E|LMO7_ENST00000357063.3_Missense_Mutation_p.D1155E|LMO7_ENST00000526202.1_Missense_Mutation_p.D747E|LMO7_ENST00000465261.2_Missense_Mutation_p.D870E			Q8WWI1	LMO7_HUMAN	LIM domain 7	1155					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TAACAACTGATTTCTCCGAAA	0.363																																																0			13											80.0	81.0	81.0					13																	76409451		2203	4300	6503	75307452	SO:0001583	missense	4008			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.2610T>A	13.37:g.76409451T>A	ENSP00000317802:p.Asp870Glu	Somatic		Capture	Illumina GAIIx	4	75307452	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	superfamily_Calponin-homology,HMMSmart_CH,HMMPfam_CH,superfamily_PDZ,HMMSmart_PDZ,HMMPfam_PDZ,HMMSmart_LIM,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM	p.D821E	ENST00000321797.8	37	c.2463		13	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	12.97|12.97|12.97	2.097110|2.097110|2.097110	0.37048|0.37048|0.37048	.|.|.	.|.|.	ENSG00000136153|ENSG00000136153|ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261|ENST00000447038;ENST00000525914|ENST00000524651;ENST00000525107	T;T;T;T;T;T;T|.|.	0.44881|.|.	1.48;1.48;1.49;0.91;0.92;0.94;0.91|.|.	5.67|5.67|5.67	1.86|1.86|1.86	0.25419|0.25419|0.25419	.|.|.	0.398466|.|.	0.31897|.|.	N|.|.	0.006884|.|.	T|T|T	0.40694|0.40694|0.40694	0.1127|0.1127|0.1127	L|L|L	0.48362|0.48362|0.48362	1.52|1.52|1.52	0.31167|0.31167|0.31167	N|N|N	0.703623|0.703623|0.703623	B;P;B;B;B|.|.	0.36683|.|.	0.429;0.565;0.134;0.058;0.177|.|.	B;B;B;B;B|.|.	0.32149|.|.	0.067;0.141;0.037;0.023;0.067|.|.	T|T|T	0.42949|0.42949|0.42949	-0.9421|-0.9421|-0.9421	10|5|5	0.27785|.|.	T|.|.	0.31|.|.	-24.0089|-24.0089|-24.0089	4.0218|4.0218|4.0218	0.09668|0.09668|0.09668	0.236:0.2009:0.0:0.5631|0.236:0.2009:0.0:0.5631|0.236:0.2009:0.0:0.5631	.|.|.	747;821;1155;870;1103|.|.	E9PMS6;Q8WWI1-3;Q8WWI1;E9PLH4;F8J2B5|.|.	.;.;LMO7_HUMAN;.;.|.|.	E|I|N	821;1155;1155;769;870;747;870|779;58|202;109	ENSP00000342112:D821E;ENSP00000349571:D1155E;ENSP00000366757:D1155E;ENSP00000366719:D769E;ENSP00000317802:D870E;ENSP00000431129:D747E;ENSP00000433352:D870E|.|.	ENSP00000317802:D870E|.|.	D|F|I	+|+|+	3|1|2	2|0|0	LMO7|LMO7|LMO7	75307452|75307452|75307452	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.321000|0.321000|0.321000	0.28281|0.28281|0.28281	0.508000|0.508000|0.508000	0.22692|0.22692|0.22692	0.151000|0.151000|0.151000	0.19162|0.19162|0.19162	0.482000|0.482000|0.482000	0.46254|0.46254|0.46254	GAT|TTT|ATT	-	NULL		0.363	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	LMO7	protein_coding	OTTHUMT00000045301.3	T	NM_005358		75307452	+1	no_errors	NM_005358	genbank	human	reviewed	54_36p	missense	SNP	0.993	A
LHX8	431707	genome.wustl.edu	37	1	75606703	75606703	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:75606703T>C	ENST00000294638.5	+	5	965	c.301T>C	c.(301-303)Tcc>Ccc	p.S101P	LHX8_ENST00000559413.1_3'UTR|LHX8_ENST00000356261.3_Missense_Mutation_p.S91P	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	101	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						CCGGTGTCTCTCCTGCAGTGT	0.398																																																0			1											145.0	140.0	142.0					1																	75606703		2203	4300	6503	75379291	SO:0001583	missense	431707			AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.301T>C	1.37:g.75606703T>C	ENSP00000294638:p.Ser101Pro	Somatic		Capture	Illumina GAIIx	4	75379291	E9PGE3	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00132,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.S101P	ENST00000294638.5	37	c.301	CCDS30756.1	1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.275351	0.80580	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.87809	-2.3;-2.3	5.55	5.55	0.83447	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.91109	0.7201	M	0.69358	2.11	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.91960	0.5578	10	0.59425	D	0.04	.	15.6932	0.77473	0.0:0.0:0.0:1.0	.	101	Q68G74	LHX8_HUMAN	P	101;91	ENSP00000294638:S101P;ENSP00000348597:S91P	ENSP00000294638:S101P	S	+	1	0	LHX8	75379291	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.895000	0.69814	2.107000	0.64212	0.528000	0.53228	TCC	-	HMMSmart_SM00132,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM,superfamily_Glucocorticoid receptor-like (DNA-binding domain)		0.398	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LHX8	protein_coding	OTTHUMT00000026700.1	T	NM_001001933		75379291	+1	no_errors	NM_001001933	genbank	human	validated	54_36p	missense	SNP	1.000	C
ROBO1	6091	genome.wustl.edu	37	3	78766435	78766435	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr3:78766435G>A	ENST00000464233.1	-	7	1020	c.907C>T	c.(907-909)Ccc>Tcc	p.P303S	ROBO1_ENST00000436010.2_Missense_Mutation_p.P264S|ROBO1_ENST00000467549.1_Missense_Mutation_p.P264S|ROBO1_ENST00000495273.1_Missense_Mutation_p.P264S	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	303	Ig-like C2-type 3.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CTGGATTTGGGCAGCTCTCCA	0.448																																																0			3											259.0	254.0	256.0					3																	78766435		1985	4152	6137	78849125	SO:0001583	missense	6091			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.907C>T	3.37:g.78766435G>A	ENSP00000420321:p.Pro303Ser	Somatic		Capture	Illumina GAIIx	4	78849125	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.P303S	ENST00000464233.1	37	c.907	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731102	0.89390	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.54	5.54	0.83059	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.66528	0.2798	N	0.16130	0.375	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;0.997;0.999	D;D;D;D	0.97110	0.971;1.0;0.971;0.95	T	0.65772	-0.6087	9	.	.	.	.	19.4858	0.95028	0.0:0.0:1.0:0.0	.	303;264;264;264	Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	ROBO1_HUMAN;.;.;.	S	264;264;303;264;264;303	ENSP00000406043:P264S;ENSP00000420321:P303S;ENSP00000420637:P264S;ENSP00000417992:P264S	.	P	-	1	0	ROBO1	78849125	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.230000	0.95299	2.607000	0.88179	0.462000	0.41574	CCC	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406		0.448	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	protein_coding	OTTHUMT00000352610.1	G	NM_002941		78849125	-1	no_errors	NM_002941	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
VPS13A	23230	genome.wustl.edu	37	9	79984213	79984213	+	Splice_Site	SNP	A	A	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr9:79984213A>G	ENST00000360280.3	+	63	8813		c.e63-1		VPS13A_ENST00000376636.3_Splice_Site|VPS13A_ENST00000376634.4_Splice_Site|VPS13A_ENST00000357409.5_Splice_Site	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)						cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TTTTATTTTTAGGCCATTAAG	0.303																																																0			9											124.0	124.0	124.0					9																	79984213		2203	4300	6503	79174033	SO:0001630	splice_region_variant	23230			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.8554-1A>G	9.37:g.79984213A>G		Somatic		Capture	Illumina GAIIx	4	79174033	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Splice_Site	SNP	-	e63-2	ENST00000360280.3	37	c.8554-2	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	A	23.1	4.379588	0.82682	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.42	0.75003	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	VPS13A	79174033	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.962000	0.93254	2.054000	0.61138	0.477000	0.44152	.	-	-		0.303	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	protein_coding	OTTHUMT00000052753.2	A	NM_015186	Intron	79174033	+1	no_errors	NM_033305	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	X	80185902	80185902	+	IGR	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chrX:80185902C>A								RNU6-493P (29539 upstream) : RNU6-995P (6030 downstream)																							TAGCTACCTTCAGAATTTAGT	0.348																																																0			X																																								80072558	SO:0001628	intergenic_variant	0																															X.37:g.80185902C>A		Somatic		Capture	Illumina GAIIx	4	80072558		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.348					LOC642585			C			80072558	+1	pseudogene	XR_038848	genbank	human	model	54_36p	rna	SNP	1.000	A
BNC1	646	genome.wustl.edu	37	15	83926623	83926623	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr15:83926623C>G	ENST00000345382.2	-	5	2641	c.2556G>C	c.(2554-2556)gaG>gaC	p.E852D	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.E845D	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	852					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GGATGGTGCCCTCGCTCAAGG	0.542																																																0			15											127.0	99.0	108.0					15																	83926623		2203	4300	6503	81717627	SO:0001583	missense	646			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2556G>C	15.37:g.83926623C>G	ENSP00000307041:p.Glu852Asp	Somatic		Capture	Illumina GAIIx	4	81717627	Q15840	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.E852D	ENST00000345382.2	37	c.2556	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	C	2.393	-0.339476	0.05243	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.36340	1.26	5.94	2.83	0.33086	.	0.104305	0.64402	N	0.000006	T	0.11110	0.0271	N	0.04203	-0.255	0.32227	N	0.574521	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.27673	-1.0067	10	0.02654	T	1	-26.0832	1.9581	0.03380	0.1709:0.4366:0.2276:0.1649	.	845;852	F5GY04;Q01954	.;BNC1_HUMAN	D	852;845	ENSP00000307041:E852D	ENSP00000307041:E852D	E	-	3	2	BNC1	81717627	0.997000	0.39634	1.000000	0.80357	0.848000	0.48234	0.501000	0.22578	0.307000	0.22880	0.563000	0.77884	GAG	-	NULL		0.542	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	protein_coding	OTTHUMT00000304006.1	C	NM_001717		81717627	-1	no_errors	NM_001717	genbank	human	reviewed	54_36p	missense	SNP	0.997	G
SLITRK5	26050	genome.wustl.edu	37	13	88330472	88330472	+	Silent	SNP	G	G	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr13:88330472G>C	ENST00000325089.6	+	2	3048	c.2829G>C	c.(2827-2829)ccG>ccC	p.P943P	SLITRK5_ENST00000400028.3_Silent_p.P702P	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	943					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					ACGTTGAGCCGGACTACCTCG	0.468																																																0			13											107.0	116.0	113.0					13																	88330472		2195	4275	6470	87128473	SO:0001819	synonymous_variant	26050			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2829G>C	13.37:g.88330472G>C		Somatic		Capture	Illumina GAIIx	4	87128473	B3KNB8|B4DSH5|Q5VT81	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRNT	p.P943	ENST00000325089.6	37	c.2829	CCDS9465.1	13																																																																																			-	NULL		0.468	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	protein_coding	OTTHUMT00000045416.3	G			87128473	+1	no_errors	NM_015567	genbank	human	validated	54_36p	silent	SNP	1.000	C
BACH2	60468	genome.wustl.edu	37	6	90660241	90660241	+	Silent	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr6:90660241G>A	ENST00000257749.4	-	7	2291	c.1584C>T	c.(1582-1584)taC>taT	p.Y528Y	BACH2_ENST00000343122.3_Silent_p.Y528Y|BACH2_ENST00000537989.1_Silent_p.Y528Y|RP3-512E2.2_ENST00000413986.1_RNA|RP3-512E2.2_ENST00000445838.1_RNA	NM_021813.2	NP_068585.1	Q9BYV9	BACH2_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 2	528						cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	45		all_cancers(76;7.37e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.0063)		BRCA - Breast invasive adenocarcinoma(108;0.0799)		CGTCCTCCGCGTAGGAATAGG	0.627																																																0			6											55.0	59.0	58.0					6																	90660241		2203	4300	6503	90716962	SO:0001819	synonymous_variant	60468			AL121787	CCDS5026.1	6q15	2013-01-10			ENSG00000112182	ENSG00000112182		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	14078	protein-coding gene	gene with protein product		605394				10949928, 12829606	Standard	NM_001170794		Approved	BTBD25	uc003pnw.3	Q9BYV9	OTTHUMG00000015216	ENST00000257749.4:c.1584C>T	6.37:g.90660241G>A		Somatic		Capture	Illumina GAIIx	4	90716962	E1P518|Q59H70|Q5T793|Q9NTS5	Silent	SNP	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB,superfamily_Euk_transcr_DNA,HMMSmart_BRLZ,PatternScan_BZIP_BASIC,HMMPfam_bZIP_1	p.Y528	ENST00000257749.4	37	c.1584	CCDS5026.1	6																																																																																			-	NULL		0.627	BACH2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BACH2	protein_coding	OTTHUMT00000041522.2	G	NM_021813		90716962	-1	no_errors	NM_021813	genbank	human	validated	54_36p	silent	SNP	1.000	A
FAT3	120114	genome.wustl.edu	37	11	92592408	92592408	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr11:92592408A>C	ENST00000298047.6	+	20	11595	c.11578A>C	c.(11578-11580)Aaa>Caa	p.K3860Q	FAT3_ENST00000525166.1_Missense_Mutation_p.K3710Q|FAT3_ENST00000409404.2_Missense_Mutation_p.K3860Q|FAT3_ENST00000533797.1_Missense_Mutation_p.K195Q			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3860	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGAGGATTTCAAACTAGCTCT	0.393										TCGA Ovarian(4;0.039)																																						0			11											88.0	84.0	85.0					11																	92592408		1842	4093	5935	92232056	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11578A>C	11.37:g.92592408A>C	ENSP00000298047:p.Lys3860Gln	Somatic		Capture	Illumina GAIIx	4	92232056	B5MDB0|Q96AU6	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.K3860Q	ENST00000298047.6	37	c.11578		11	.	.	.	.	.	.	.	.	.	.	A	19.85	3.903402	0.72754	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.32	4.18	0.49190	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	.	.	.	.	T	0.69691	0.3139	L	0.37800	1.135	0.80722	D	1	D;P	0.76494	0.999;0.63	D;B	0.67382	0.951;0.254	T	0.63866	-0.6540	9	0.16420	T	0.52	.	12.535	0.56137	0.8523:0.1477:0.0:0.0	.	3860;3860	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	Q	3860;3860;3710;195	ENSP00000298047:K3860Q;ENSP00000387040:K3860Q;ENSP00000432586:K3710Q;ENSP00000436399:K195Q	ENSP00000298047:K3860Q	K	+	1	0	FAT3	92232056	1.000000	0.71417	0.798000	0.32154	0.603000	0.37013	5.751000	0.68720	0.969000	0.38237	0.533000	0.62120	AAA	-	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282		0.393	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		A	NM_001008781		92232056	+1	no_errors	NM_001008781	genbank	human	validated	54_36p	missense	SNP	1.000	C
PPP3CA	5530	genome.wustl.edu	37	4	101961685	101961685	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr4:101961685T>G	ENST00000394854.3	-	11	1878	c.1195A>C	c.(1195-1197)Aag>Cag	p.K399Q	PPP3CA_ENST00000394853.4_Missense_Mutation_p.K399Q|PPP3CA_ENST00000523694.2_Missense_Mutation_p.K332Q|PPP3CA_ENST00000323055.6_Missense_Mutation_p.K357Q|PPP3CA_ENST00000507176.1_Missense_Mutation_p.K301Q|PPP3CA_ENST00000512215.1_Missense_Mutation_p.K167Q	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	399	Calmodulin-binding. {ECO:0000255}.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		GCTCGGATCTTGTTCCTTATC	0.393																																																0			4											231.0	175.0	194.0					4																	101961685		2203	4300	6503	102180708	SO:0001583	missense	5530				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.1195A>C	4.37:g.101961685T>G	ENSP00000378323:p.Lys399Gln	Somatic		Capture	Illumina GAIIx	4	102180708	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	superfamily_Metallo-dependent phosphatases,HMMSmart_SM00156,HMMPfam_Metallophos,PatternScan_SER_THR_PHOSPHATASE	p.K399Q	ENST00000394854.3	37	c.1195	CCDS34037.1	4	.	.	.	.	.	.	.	.	.	.	T	32	5.160160	0.94727	.	.	ENSG00000138814	ENST00000512215;ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694	T;T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32;3.32	5.9	5.9	0.94986	.	0.107337	0.64402	D	0.000010	T	0.31544	0.0800	M	0.89968	3.075	0.80722	D	1	D;D;P;D;P;D	0.65815	0.991;0.994;0.956;0.995;0.605;0.978	P;D;P;P;P;P	0.69142	0.801;0.962;0.872;0.902;0.53;0.701	T	0.20207	-1.0282	10	0.87932	D	0	-20.1671	15.3148	0.74065	0.0:0.0:0.0:1.0	.	399;167;357;399;301;332	Q08209;A8W6Z8;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.;.	Q	167;399;357;399;301;332	ENSP00000422781:K167Q;ENSP00000378323:K399Q;ENSP00000320580:K357Q;ENSP00000378322:K399Q;ENSP00000422990:K301Q;ENSP00000429350:K332Q	ENSP00000320580:K357Q	K	-	1	0	PPP3CA	102180708	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.237000	0.78164	2.251000	0.74343	0.528000	0.53228	AAG	-	superfamily_Metallo-dependent phosphatases		0.393	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PPP3CA	protein_coding	OTTHUMT00000258379.2	T	NM_000944		102180708	-1	no_errors	NM_000944	genbank	human	validated	54_36p	missense	SNP	1.000	G
TCP11L2	255394	genome.wustl.edu	37	12	106704894	106704894	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr12:106704894A>T	ENST00000299045.3	+	2	215	c.41A>T	c.(40-42)cAg>cTg	p.Q14L	TCP11L2_ENST00000546625.1_Missense_Mutation_p.Q14L|TCP11L2_ENST00000547153.1_Missense_Mutation_p.Q14L	NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	14										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						GGAGAGGACCAGCCAAGCGAT	0.512																																																0			12											170.0	141.0	151.0					12																	106704894		2203	4300	6503	105229024	SO:0001583	missense	255394			BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.41A>T	12.37:g.106704894A>T	ENSP00000299045:p.Gln14Leu	Somatic		Capture	Illumina GAIIx	4	105229024	B2RA65|G3V1Y9	Missense_Mutation	SNP	HMMPfam_Tcp11	p.Q14L	ENST00000299045.3	37	c.41	CCDS9104.1	12	.	.	.	.	.	.	.	.	.	.	A	15.66	2.898994	0.52227	.	.	ENSG00000166046	ENST00000553143;ENST00000547153;ENST00000299045;ENST00000546625;ENST00000553098;ENST00000551802;ENST00000548428;ENST00000551228	T;T;T;T;T;T	0.33438	2.19;2.84;2.18;2.19;1.85;1.41	5.91	4.72	0.59763	.	0.159187	0.56097	D	0.000023	T	0.32376	0.0827	L	0.56769	1.78	0.47819	D	0.999527	P;P;P	0.48764	0.915;0.763;0.763	B;P;P	0.44897	0.397;0.463;0.463	T	0.04737	-1.0930	10	0.26408	T	0.33	-2.4279	11.8703	0.52517	0.727:0.2729:0.0:0.0	.	14;14;14	Q8N4U5;G3V1Y9;G3V1Z2	T11L2_HUMAN;.;.	L	14	ENSP00000448952:Q14L;ENSP00000299045:Q14L;ENSP00000449123:Q14L;ENSP00000448629:Q14L;ENSP00000447174:Q14L;ENSP00000447457:Q14L	ENSP00000299045:Q14L	Q	+	2	0	TCP11L2	105229024	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.182000	0.50910	2.254000	0.74563	0.533000	0.62120	CAG	-	NULL		0.512	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP11L2	protein_coding	OTTHUMT00000407206.1	A	NM_152772		105229024	+1	no_errors	NM_152772	genbank	human	provisional	54_36p	missense	SNP	1.000	T
COL4A6	1288	genome.wustl.edu	37	X	107447757	107447757	+	Intron	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chrX:107447757C>A	ENST00000372216.4	-	12	791				COL4A6_ENST00000538570.1_Intron|COL4A6_ENST00000394872.2_Nonsense_Mutation_p.E219*|COL4A6_ENST00000545689.1_Intron|COL4A6_ENST00000334504.7_Intron	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6						cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						ACTTTGGCCTCTTCACCCTCA	0.453									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											0			X											31.0	30.0	30.0					X																	107447757		876	1990	2866	107334413	SO:0001627	intron_variant	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.691-115G>T	X.37:g.107447757C>A		Somatic		Capture	Illumina GAIIx	4	107334413	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Nonsense_Mutation	SNP	HMMPfam_Collagen,HMMPfam_C4,HMMSmart_C4,superfamily_C-type_lectin_fold	p.E219*	ENST00000372216.4	37	c.655	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	36	5.805064	0.96967	.	.	ENSG00000197565	ENST00000394872	.	.	.	3.82	0.983	0.19767	.	2.428340	0.02075	N	0.051899	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	2.7493	0.05275	0.2238:0.521:0.0:0.2551	.	.	.	.	X	219	.	ENSP00000378340:E219X	E	-	1	0	COL4A6	107334413	0.000000	0.05858	0.014000	0.15608	0.592000	0.36648	-0.234000	0.09028	0.063000	0.16370	0.513000	0.50165	GAG	-	NULL		0.453	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	protein_coding	OTTHUMT00000057875.2	C			107334413	-1	no_errors	ENST00000394872	ensembl	human	known	54_36p	nonsense	SNP	0.039	A
MYO16	23026	genome.wustl.edu	37	13	109318455	109318455	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr13:109318455G>A	ENST00000357550.2	+	1	225	c.184G>A	c.(184-186)Gac>Aac	p.D62N	MYO16_ENST00000356711.2_Missense_Mutation_p.D62N|MYO16_ENST00000251041.5_Missense_Mutation_p.D62N	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CAACCTCACGGACATGCTACA	0.438																																																0			13											65.0	57.0	60.0					13																	109318455		2203	4300	6503	108116456	SO:0001583	missense	23026				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.184G>A	13.37:g.109318455G>A	ENSP00000350160:p.Asp62Asn	Somatic		Capture	Illumina GAIIx	4	108116456		Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMPfam_IQ	p.D62N	ENST00000357550.2	37	c.184	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806143	0.70682	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041	T;T;T	0.55760	0.5;0.5;0.5	5.37	5.37	0.77165	Ankyrin repeat-containing domain (2);	0.000000	0.37761	U	0.001948	T	0.58133	0.2101	L	0.34521	1.04	0.80722	D	1	B;D	0.71674	0.373;0.998	B;P	0.57425	0.082;0.82	T	0.54370	-0.8304	9	.	.	.	.	18.0975	0.89494	0.0:0.0:1.0:0.0	.	62;62	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	N	62	ENSP00000349145:D62N;ENSP00000350160:D62N;ENSP00000251041:D62N	.	D	+	1	0	MYO16	108116456	1.000000	0.71417	0.941000	0.38009	0.021000	0.10359	8.720000	0.91442	2.506000	0.84524	0.650000	0.86243	GAC	-	superfamily_Ankyrin repeat		0.438	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	protein_coding	OTTHUMT00000045746.1	G	NM_015011		108116456	+1	no_errors	NM_015011	genbank	human	validated	54_36p	missense	SNP	0.997	A
FAM102B	284611	genome.wustl.edu	37	1	109171422	109171422	+	Silent	SNP	G	G	A	rs373715075		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:109171422G>A	ENST00000370035.3	+	9	1306	c.966G>A	c.(964-966)gcG>gcA	p.A322A	FAM102B_ENST00000405454.1_Silent_p.A322A	NM_001010883.2	NP_001010883.2	Q5T8I3	F102B_HUMAN	family with sequence similarity 102, member B	322										autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	5		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		ATTCCAGTGCGGAAGGTGTGT	0.418													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15266	0.0		0.0	False		,,,				2504	0.0															0			1											93.0	85.0	87.0					1																	109171422		2203	4300	6503	108972945	SO:0001819	synonymous_variant	284611			CR749397	CCDS30786.2	1p13.3	2012-11-05			ENSG00000162636	ENSG00000162636			27637	protein-coding gene	gene with protein product	"""sym-3 homolog B (C. elegans)"""						Standard	NM_001010883		Approved	DKFZp779B126, SYM-3B	uc010ouy.2	Q5T8I3	OTTHUMG00000010967	ENST00000370035.3:c.966G>A	1.37:g.109171422G>A		Somatic		Capture	Illumina GAIIx	4	108972945	A1L1A1|B0QZ46|B0QZ47|Q68DH7	Silent	SNP	HMMPfam_Eeig1	p.A291	ENST00000370035.3	37	c.873	CCDS30786.2	1																																																																																			-	NULL		0.418	FAM102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM102B	protein_coding	OTTHUMT00000030188.3	G	NM_001010883		108972945	+1	no_errors	NM_001010883	genbank	human	validated	54_36p	silent	SNP	0.991	A
GSTM4	2948	genome.wustl.edu	37	1	110201775	110201775	+	Intron	SNP	G	G	C	rs368655040		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:110201775G>C	ENST00000369836.4	+	7	876				GSTM4_ENST00000326729.5_Intron|GSTM4_ENST00000495742.1_Intron|GSTM4_ENST00000369833.1_Missense_Mutation_p.V163L|GSTM4_ENST00000336075.5_Intron	NM_000850.4	NP_000841.1	Q03013	GSTM4_HUMAN	glutathione S-transferase mu 4						glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0123)|Colorectal(144;0.0129)|Epithelial(280;0.0147)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.0471)|LUSC - Lung squamous cell carcinoma(189;0.227)	Glutathione(DB00143)	CCCTTGTTCCGTTACCTCCTT	0.493																																																0			1											127.0	122.0	124.0					1																	110201775		2203	4300	6503	110003298	SO:0001627	intron_variant	2948			M96234	CCDS806.1, CCDS807.1	1p13.3	2012-06-22	2008-11-26		ENSG00000168765	ENSG00000168765	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4636	protein-coding gene	gene with protein product		138333	"""glutathione S-transferase M4"""			8276420	Standard	NM_000850		Approved		uc001dyf.3	Q03013	OTTHUMG00000011642	ENST00000369836.4:c.567+43G>C	1.37:g.110201775G>C		Somatic		Capture	Illumina GAIIx	4	110003298	A8K765|Q05465|Q32NC1|Q4JNT8|Q6FH87	Missense_Mutation	SNP	superfamily_Thiordxn-like_fd,HMMPfam_GST_N,superfamily_GST_C_like,HMMPfam_GST_C	p.V163L	ENST00000369836.4	37	c.487	CCDS807.1	1	.	.	.	.	.	.	.	.	.	.	G	9.914	1.210357	0.22289	.	.	ENSG00000168765	ENST00000369833	T	0.03663	3.85	3.52	-7.03	0.01584	.	.	.	.	.	T	0.00580	0.0019	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.47623	-0.9103	5	.	.	.	.	2.5294	0.04699	0.13:0.0978:0.3694:0.4028	.	.	.	.	L	163	ENSP00000358848:V163L	.	V	+	1	0	GSTM4	110003298	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	-1.072000	0.03434	-1.495000	0.01831	-1.055000	0.02315	GTT	-	NULL		0.493	GSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTM4	protein_coding	OTTHUMT00000032187.1	G	NM_000850		110003298	+1	no_errors	ENST00000369833	ensembl	human	known	54_36p	missense	SNP	0.003	C
LRRN3	54674	genome.wustl.edu	37	7	110763525	110763525	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr7:110763525G>T	ENST00000422987.3	+	2	1528	c.697G>T	c.(697-699)Gtt>Ttt	p.V233F	IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000331762.3_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.V233F|LRRN3_ENST00000308478.5_Missense_Mutation_p.V233F|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000447215.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	233					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		TAACGCCTTGGTTGGACTGGA	0.358																																																0			7											66.0	68.0	67.0					7																	110763525		2203	4299	6502	110550761	SO:0001583	missense	54674			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.697G>T	7.37:g.110763525G>T	ENSP00000412417:p.Val233Phe	Somatic		Capture	Illumina GAIIx	4	110550761	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00013,HMMSmart_SM00365,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_fn3,superfamily_Fibronectin type III	p.V233F	ENST00000422987.3	37	c.697	CCDS5754.1	7	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669095	0.29604	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987;ENST00000421101	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.96	5.08	0.68730	.	0.509087	0.17874	N	0.159092	T	0.37705	0.1013	L	0.45422	1.42	0.24853	N	0.992391	P	0.39022	0.655	B	0.34536	0.185	T	0.23119	-1.0197	10	0.10377	T	0.69	.	9.5162	0.39106	0.0707:0.0:0.7862:0.143	.	233	Q9H3W5	LRRN3_HUMAN	F	233	ENSP00000312001:V233F;ENSP00000397312:V233F;ENSP00000412417:V233F;ENSP00000407927:V233F	ENSP00000312001:V233F	V	+	1	0	LRRN3	110550761	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.980000	0.49321	2.831000	0.97527	0.650000	0.86243	GTT	-	superfamily_L domain-like,HMMSmart_SM00369		0.358	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN3	protein_coding	OTTHUMT00000338171.2	G	NM_018334		110550761	+1	no_errors	NM_001099658	genbank	human	validated	54_36p	missense	SNP	0.998	T
LOC101927640	101927640	genome.wustl.edu	37	6	112647840	112647840	+	RNA	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr6:112647840C>A	ENST00000587816.1	+	0	111				RP11-506B6.6_ENST00000585611.1_RNA|RP11-506B6.6_ENST00000585504.1_RNA|RP11-506B6.6_ENST00000590673.1_RNA																							TTAGACCATTCCATCTTCTCT	0.448																																																0			6																																								112754533			0																															6.37:g.112647840C>A		Somatic		Capture	Illumina GAIIx	4	112754533		Nonsense_Mutation	SNP	HMMSmart_SM00443,HMMPfam_G-patch	p.E38*	ENST00000587816.1	37	c.112		6																																																																																			-	HMMSmart_SM00443,HMMPfam_G-patch		0.448	RP11-506B6.6-009	KNOWN	basic	antisense	LOC100128588	antisense	OTTHUMT00000459266.1	C			112754533	-1	no_errors	XM_001723020	genbank	human	model	54_36p	nonsense	SNP	0.916	A
CSMD3	114788	genome.wustl.edu	37	8	113275967	113275967	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr8:113275967T>C	ENST00000297405.5	-	61	10007	c.9763A>G	c.(9763-9765)Att>Gtt	p.I3255V	CSMD3_ENST00000352409.3_Missense_Mutation_p.I3185V|CSMD3_ENST00000343508.3_Missense_Mutation_p.I3215V|CSMD3_ENST00000455883.2_Missense_Mutation_p.I3086V	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3255	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATGTAGCTAATACTAAAGCCC	0.468										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						0			8											110.0	93.0	99.0					8																	113275967		2203	4300	6503	113345143	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9763A>G	8.37:g.113275967T>C	ENSP00000297405:p.Ile3255Val	Somatic		Capture	Illumina GAIIx	4	113345143	Q96PZ3	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,PatternScan_GLYCOSYL_HYDROL_F10	p.I3255V	ENST00000297405.5	37	c.9763	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	T	4.710	0.131939	0.08981	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17	5.76	4.6	0.57074	Complement control module (2);Sushi/SCR/CCP (3);	0.075518	0.56097	D	0.000040	T	0.25791	0.0628	N	0.01809	-0.71	0.41583	D	0.988756	B;B;P	0.35575	0.001;0.002;0.51	B;B;B	0.34242	0.009;0.013;0.178	T	0.36553	-0.9743	10	0.02654	T	1	.	11.9393	0.52892	0.0:0.0676:0.0:0.9324	.	3086;3255;3215	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	V	3215;3255;2525;3086;3185	ENSP00000345799:I3215V;ENSP00000297405:I3255V;ENSP00000341558:I2525V;ENSP00000412263:I3086V;ENSP00000343124:I3185V	ENSP00000297405:I3255V	I	-	1	0	CSMD3	113345143	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.156000	0.50708	1.007000	0.39238	-0.263000	0.10527	ATT	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.468	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	T	NM_052900		113345143	-1	no_errors	NM_198123	genbank	human	validated	54_36p	missense	SNP	1.000	C
CLIP1	6249	genome.wustl.edu	37	12	122862153	122862153	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr12:122862153G>A	ENST00000540338.1	-	2	481	c.440C>T	c.(439-441)tCa>tTa	p.S147L	CLIP1_ENST00000361654.4_Missense_Mutation_p.S147L|CLIP1_ENST00000537178.1_Missense_Mutation_p.S147L|CLIP1_ENST00000358808.2_Missense_Mutation_p.S147L|CLIP1_ENST00000302528.7_Missense_Mutation_p.S147L			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	147	Ser-rich.				microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		GCACAGCGGTGAAGTAGCTCG	0.527																																																0			12											159.0	140.0	147.0					12																	122862153		2203	4300	6503	121428106	SO:0001583	missense	6249				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.440C>T	12.37:g.122862153G>A	ENSP00000439093:p.Ser147Leu	Somatic		Capture	Illumina GAIIx	4	121428106	A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1	p.S147L	ENST00000540338.1	37	c.440	CCDS58285.1	12	.	.	.	.	.	.	.	.	.	.	G	17.31	3.358405	0.61403	.	.	ENSG00000130779	ENST00000302528;ENST00000358808;ENST00000537178;ENST00000540338;ENST00000540304;ENST00000537004	T;T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;-0.82;-0.82	5.81	4.93	0.64822	Cytoskeleton-associated protein, Gly-rich domain (1);	0.063903	0.64402	N	0.000004	D	0.85141	0.5629	M	0.76002	2.32	0.58432	D	0.999999	D;D;D;P	0.76494	0.994;0.999;0.99;0.731	D;D;D;B	0.74023	0.925;0.982;0.961;0.35	D	0.86928	0.2071	10	0.72032	D	0.01	-7.1017	14.552	0.68073	0.0695:0.0:0.9305:0.0	.	147;147;147;147	F6VGP8;P30622-2;P30622-1;P30622	.;.;.;CLIP1_HUMAN	L	147	ENSP00000303585:S147L;ENSP00000351665:S147L;ENSP00000445531:S147L;ENSP00000439093:S147L;ENSP00000437786:S147L;ENSP00000441409:S147L	ENSP00000303585:S147L	S	-	2	0	CLIP1	121428106	1.000000	0.71417	0.289000	0.24876	0.270000	0.26580	9.479000	0.97929	1.462000	0.47948	0.591000	0.81541	TCA	-	NULL		0.527	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLIP1	protein_coding	OTTHUMT00000401625.1	G	NM_002956		121428106	-1	no_errors	NM_002956	genbank	human	validated	54_36p	missense	SNP	0.978	A
PTPRZ1	5803	genome.wustl.edu	37	7	121650508	121650508	+	Missense_Mutation	SNP	A	A	T	rs149926989	byFrequency	TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr7:121650508A>T	ENST00000393386.2	+	12	1819	c.1408A>T	c.(1408-1410)Ata>Tta	p.I470L	PTPRZ1_ENST00000449182.1_Missense_Mutation_p.I470L	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	470					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						CTACAATCGCATAGGGACGAA	0.428													A|||	3	0.000599042	0.0	0.0014	5008	,	,		18604	0.0		0.002	False		,,,				2504	0.0															0			7						A	LEU/ILE,LEU/ILE,LEU/ILE	2,4404	4.2+/-10.8	0,2,2201	149.0	131.0	137.0		1408,1408,1408	-3.2	0.0	7	dbSNP_134	137	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense,missense	PTPRZ1	NM_001206838.1,NM_001206839.1,NM_002851.2	5,5,5	0,6,6497	TT,TA,AA		0.0465,0.0454,0.0461	benign,benign,benign	470/1456,470/1449,470/2316	121650508	6,13000	2203	4300	6503	121437744	SO:0001583	missense	5803			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1408A>T	7.37:g.121650508A>T	ENSP00000377047:p.Ile470Leu	Somatic		Capture	Illumina GAIIx	4	121437744	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	superfamily_Carbonic anhydrase,HMMPfam_Carb_anhydrase,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.I470L	ENST00000393386.2	37	c.1408	CCDS34740.1	7	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	7.567	0.666017	0.14710	4.54E-4	4.65E-4	ENSG00000106278	ENST00000393386;ENST00000449182	T;T	0.41065	1.05;1.01	5.61	-3.2	0.05156	.	1.023730	0.07717	N	0.943075	T	0.22551	0.0544	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.22521	-1.0214	10	0.32370	T	0.25	.	12.3683	0.55240	0.7036:0.0:0.2964:0.0	.	470;470	C9JFM0;P23471	.;PTPRZ_HUMAN	L	470	ENSP00000377047:I470L;ENSP00000410000:I470L	ENSP00000377047:I470L	I	+	1	0	PTPRZ1	121437744	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.116000	0.10724	-0.604000	0.05760	-0.256000	0.11100	ATA	-	NULL		0.428	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	A	NM_002851		121437744	+1	no_errors	NM_002851	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
SPAM1	6677	genome.wustl.edu	37	7	123599782	123599782	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr7:123599782C>T	ENST00000439500.1	+	6	1902	c.1289C>T	c.(1288-1290)tCt>tTt	p.S430F	SPAM1_ENST00000402183.2_Missense_Mutation_p.S430F|SPAM1_ENST00000223028.7_Missense_Mutation_p.S430F|SPAM1_ENST00000340011.5_Missense_Mutation_p.S430F|SPAM1_ENST00000460182.1_Missense_Mutation_p.S430F	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	430					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GAGCAATTTTCTGAAAAATTT	0.393																																																0			7											98.0	98.0	98.0					7																	123599782		2203	4300	6503	123387018	SO:0001583	missense	6677			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.1289C>T	7.37:g.123599782C>T	ENSP00000402123:p.Ser430Phe	Somatic		Capture	Illumina GAIIx	4	123387018	Q8TC30	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_56,superfamily_Glyco_hydro_cat	p.S430F	ENST00000439500.1	37	c.1289	CCDS5791.1	7	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330838	0.60853	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	5.86	4.98	0.66077	.	0.695085	0.14573	N	0.311307	T	0.63141	0.2486	M	0.83692	2.655	0.24479	N	0.994351	D;D	0.54964	0.969;0.969	P;P	0.54706	0.759;0.759	T	0.59516	-0.7440	10	0.72032	D	0.01	-10.9536	9.323	0.37975	0.1472:0.7745:0.0:0.0783	.	430;430	Q8TC30;P38567	.;HYALP_HUMAN	F	430	ENSP00000386028:S430F;ENSP00000417934:S430F;ENSP00000345849:S430F;ENSP00000402123:S430F;ENSP00000223028:S430F	ENSP00000223028:S430F	S	+	2	0	SPAM1	123387018	0.082000	0.21442	0.020000	0.16555	0.006000	0.05464	1.119000	0.31258	1.611000	0.50210	-0.175000	0.13238	TCT	-	NULL		0.393	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPAM1	protein_coding	OTTHUMT00000348309.1	C			123387018	+1	no_errors	NM_003117	genbank	human	reviewed	54_36p	missense	SNP	0.373	T
DTX3L	151636	genome.wustl.edu	37	3	122287634	122287634	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr3:122287634G>C	ENST00000296161.4	+	3	887	c.698G>C	c.(697-699)aGc>aCc	p.S233T	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	233					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		GAACAAAAAAGCAACTATTTT	0.383																																																0			3											58.0	59.0	59.0					3																	122287634		2203	4300	6503	123770324	SO:0001583	missense	151636				CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.698G>C	3.37:g.122287634G>C	ENSP00000296161:p.Ser233Thr	Somatic		Capture	Illumina GAIIx	4	123770324	B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.S233T	ENST00000296161.4	37	c.698	CCDS3015.1	3	.	.	.	.	.	.	.	.	.	.	G	8.506	0.865372	0.17250	.	.	ENSG00000163840	ENST00000296161	T	0.32988	1.43	5.04	-0.256	0.12984	.	1.205510	0.05915	N	0.632431	T	0.25568	0.0622	L	0.60455	1.87	0.09310	N	1	B	0.27559	0.181	B	0.22880	0.042	T	0.33033	-0.9884	10	0.49607	T	0.09	-21.1	1.1161	0.01714	0.2706:0.3057:0.2826:0.1411	.	233	Q8TDB6	DTX3L_HUMAN	T	233	ENSP00000296161:S233T	ENSP00000296161:S233T	S	+	2	0	DTX3L	123770324	0.000000	0.05858	0.000000	0.03702	0.213000	0.24496	-0.109000	0.10840	0.031000	0.15407	0.655000	0.94253	AGC	-	NULL		0.383	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX3L	protein_coding	OTTHUMT00000355966.1	G	NM_138287		123770324	+1	no_errors	NM_138287	genbank	human	validated	54_36p	missense	SNP	0.000	C
OR8A1	390275	genome.wustl.edu	37	11	124440468	124440468	+	Silent	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr11:124440468C>A	ENST00000284287.3	+	1	576	c.504C>A	c.(502-504)atC>atA	p.I168I		NM_001005194.1	NP_001005194.1	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A, member 1	168					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			haematopoietic_and_lymphoid_tissue(1)|lung(16)|ovary(2)|prostate(1)|skin(2)	22		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		TCTACGCCATCGGACTCATTG	0.502																																																0			11											138.0	120.0	126.0					11																	124440468		2201	4299	6500	123945678	SO:0001819	synonymous_variant	390275			BK004495	CCDS31712.1	11q24.2	2012-08-09			ENSG00000196119	ENSG00000196119		"""GPCR / Class A : Olfactory receptors"""	8469	protein-coding gene	gene with protein product							Standard	NM_001005194		Approved	OST025	uc010san.2	Q8NGG7	OTTHUMG00000165923	ENST00000284287.3:c.504C>A	11.37:g.124440468C>A		Somatic		Capture	Illumina GAIIx	4	123945678	Q6IEW7|Q96RC6	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.I168	ENST00000284287.3	37	c.504	CCDS31712.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.502	OR8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8A1	protein_coding	OTTHUMT00000387062.1	C	NM_001005194		123945678	+1	no_errors	NM_001005194	genbank	human	provisional	54_36p	silent	SNP	0.041	A
CNTNAP5	129684	genome.wustl.edu	37	2	125367492	125367492	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr2:125367492T>A	ENST00000431078.1	+	12	2232	c.1868T>A	c.(1867-1869)aTc>aAc	p.I623N		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	623	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TACTGCAATATCACTGGTAAG	0.517																																																0			2											62.0	62.0	62.0					2																	125367492		1877	4111	5988	125083962	SO:0001583	missense	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1868T>A	2.37:g.125367492T>A	ENSP00000399013:p.Ile623Asn	Somatic		Capture	Illumina GAIIx	4	125083962	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	PatternScan_FA58C_1,PatternScan_FIBRIN_AG_C_DOMAIN,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_FA58C,superfamily_Gal_bind_like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_2,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMSmart_EGF,HMMPfam_EGF,superfamily_Fibrinogen_a/b/g_C	p.I623N	ENST00000431078.1	37	c.1868	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024359	0.54683	.	.	ENSG00000155052	ENST00000431078	T	0.11712	2.75	5.66	5.66	0.87406	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (2);	0.121499	0.34986	N	0.003527	T	0.26268	0.0641	M	0.72118	2.19	0.58432	D	0.999991	D	0.58620	0.983	P	0.54629	0.757	T	0.00742	-1.1585	10	0.59425	D	0.04	.	15.0047	0.71501	0.0:0.0:0.0:1.0	.	623	Q8WYK1	CNTP5_HUMAN	N	623	ENSP00000399013:I623N	ENSP00000399013:I623N	I	+	2	0	CNTNAP5	125083962	1.000000	0.71417	0.985000	0.45067	0.433000	0.31745	7.264000	0.78432	2.279000	0.76181	0.533000	0.62120	ATC	-	superfamily_ConA_like_lec_gl,superfamily_Fibrinogen_a/b/g_C		0.517	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	T			125083962	+1	no_errors	NM_130773	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ARHGAP36	158763	genome.wustl.edu	37	X	130218993	130218993	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chrX:130218993T>C	ENST00000276211.5	+	7	1255	c.910T>C	c.(910-912)Tct>Cct	p.S304P	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.S168P|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.S292P	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	304	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CATGAAGGATTCTCTGCTGCC	0.458																																																0			X											152.0	126.0	135.0					X																	130218993		2203	4300	6503	130046674	SO:0001583	missense	158763				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.910T>C	X.37:g.130218993T>C	ENSP00000276211:p.Ser304Pro	Somatic		Capture	Illumina GAIIx	4	130046674	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.S304P	ENST00000276211.5	37	c.910	CCDS14628.1	X	.	.	.	.	.	.	.	.	.	.	T	1.690	-0.504290	0.04261	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.3	1.52	0.23074	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.418236	0.20812	N	0.085237	T	0.04588	0.0125	N	0.00121	-2.07	0.25349	N	0.988885	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.08055	0.002;0.002;0.003	T	0.41124	-0.9526	10	0.02654	T	1	.	5.8226	0.18536	0.0:0.3601:0.0:0.6399	.	273;292;304	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	P	304;292;273;168	ENSP00000276211:S304P;ENSP00000359960:S292P;ENSP00000408515:S273P;ENSP00000359959:S168P	ENSP00000276211:S304P	S	+	1	0	ARHGAP36	130046674	0.951000	0.32395	0.990000	0.47175	0.603000	0.37013	0.993000	0.29680	0.285000	0.22329	0.417000	0.27973	TCT	-	superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP		0.458	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FLJ30058	protein_coding	OTTHUMT00000355073.1	T	NM_144967		130046674	+1	no_errors	NM_144967	genbank	human	validated	54_36p	missense	SNP	1.000	C
EPB41L2	2037	genome.wustl.edu	37	6	131222297	131222297	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr6:131222297C>G	ENST00000337057.3	-	7	1134	c.953G>C	c.(952-954)cGg>cCg	p.R318P	EPB41L2_ENST00000445890.2_Missense_Mutation_p.R318P|EPB41L2_ENST00000525271.1_Missense_Mutation_p.R318P|EPB41L2_ENST00000530148.1_5'UTR|EPB41L2_ENST00000528282.1_Missense_Mutation_p.R318P|EPB41L2_ENST00000527659.1_Missense_Mutation_p.R318P|EPB41L2_ENST00000529208.1_Missense_Mutation_p.R318P|EPB41L2_ENST00000530481.1_Missense_Mutation_p.R318P|EPB41L2_ENST00000392427.3_Missense_Mutation_p.R318P|EPB41L2_ENST00000527411.1_Missense_Mutation_p.R318P|EPB41L2_ENST00000368128.2_Missense_Mutation_p.R318P|EPB41L2_ENST00000525193.1_Missense_Mutation_p.R318P	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	318	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		AATGTCCTGCCGGAGCTGAAG	0.537																																																0			6											68.0	70.0	69.0					6																	131222297		2203	4300	6503	131263990	SO:0001583	missense	2037			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.953G>C	6.37:g.131222297C>G	ENSP00000338481:p.Arg318Pro	Somatic		Capture	Illumina GAIIx	4	131263990	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	HMMSmart_B41,superfamily_SSF54236,HMMPfam_FERM_N,PatternScan_FERM_1,superfamily_FERM_3-hlx,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_SSF50729,HMMPfam_FERM_C,HMMPfam_FA,HMMPfam_SAB,HMMPfam_4_1_CTD	p.R318P	ENST00000337057.3	37	c.953	CCDS5141.1	6	.	.	.	.	.	.	.	.	.	.	C	31	5.076732	0.94000	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000392427;ENST00000425439;ENST00000368128;ENST00000527411;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208	T;T;T;T;T;T;T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97	5.23	5.23	0.72850	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.91307	0.7259	H	0.97896	4.1	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.94191	0.7441	10	0.87932	D	0	.	19.1731	0.93588	0.0:1.0:0.0:0.0	.	318;318;318;318;318	E9PHY5;B4DHI8;E9PPD9;O43491;Q68DV2	.;.;.;E41L2_HUMAN;.	P	318	ENSP00000434308:R318P;ENSP00000434576:R318P;ENSP00000402041:R318P;ENSP00000338481:R318P;ENSP00000376222:R318P;ENSP00000357110:R318P;ENSP00000436348:R318P;ENSP00000432803:R318P;ENSP00000431988:R318P;ENSP00000431647:R318P;ENSP00000436641:R318P	ENSP00000338481:R318P	R	-	2	0	EPB41L2	131263990	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.613000	0.88420	0.655000	0.94253	CGG	-	HMMSmart_B41,superfamily_FERM_3-hlx,HMMPfam_FERM_M		0.537	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	protein_coding	OTTHUMT00000042204.3	C			131263990	-1	no_errors	NM_001431	genbank	human	validated	54_36p	missense	SNP	1.000	G
ASTE1	28990	genome.wustl.edu	37	3	130743962	130743962	+	Missense_Mutation	SNP	G	G	T	rs200808262		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr3:130743962G>T	ENST00000264992.3	-	3	630	c.189C>A	c.(187-189)ttC>ttA	p.F63L	NEK11_ENST00000383366.4_5'Flank|NEK11_ENST00000511262.1_5'Flank|NEK11_ENST00000356918.4_5'Flank|ASTE1_ENST00000514044.1_Missense_Mutation_p.F63L|NEK11_ENST00000412440.2_5'Flank|NEK11_ENST00000510769.1_5'Flank|NEK11_ENST00000429253.2_5'Flank|NEK11_ENST00000507910.1_5'Flank|NEK11_ENST00000510688.1_5'Flank	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	63					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						GTGATTCAAAGAATTTTTGTA	0.363																																																0			3											90.0	83.0	85.0					3																	130743962		2203	4300	6503	132226652	SO:0001583	missense	28990			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.189C>A	3.37:g.130743962G>T	ENSP00000264992:p.Phe63Leu	Somatic		Capture	Illumina GAIIx	4	132226652	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	HMMPfam_XPG_N,superfamily_SSF88723	p.F63L	ENST00000264992.3	37	c.189	CCDS3068.1	3	.	.	.	.	.	.	.	.	.	.	G	13.71	2.317860	0.40996	.	.	ENSG00000034533	ENST00000514044;ENST00000264992;ENST00000446270	T;T	0.62498	0.02;0.02	5.44	2.56	0.30785	XPG N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77890	0.4198	M	0.86953	2.85	0.44181	D	0.996995	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.76377	-0.2981	10	0.48119	T	0.1	-24.158	8.3714	0.32417	0.3474:0.0:0.6526:0.0	.	63;63	D6RG30;Q2TB18	.;ASTE1_HUMAN	L	63	ENSP00000426421:F63L;ENSP00000264992:F63L	ENSP00000264992:F63L	F	-	3	2	ASTE1	132226652	0.999000	0.42202	0.994000	0.49952	0.118000	0.20060	0.496000	0.22499	0.602000	0.29896	-0.145000	0.13849	TTC	-	HMMPfam_XPG_N,superfamily_SSF88723		0.363	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	protein_coding	OTTHUMT00000356659.1	G	NM_014065		132226652	-1	no_errors	NM_014065	genbank	human	validated	54_36p	missense	SNP	1.000	T
PCDHA13	56136	genome.wustl.edu	37	5	140263296	140263296	+	Silent	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr5:140263296C>T	ENST00000289272.2	+	1	1443	c.1443C>T	c.(1441-1443)gaC>gaT	p.D481D	PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA13_ENST00000409494.1_Silent_p.D481D|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA11_ENST00000398640.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	481	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCTCAGGACGCGGACGCAC	0.662																																					Melanoma(147;1739 1852 5500 27947 37288)											0			5											72.0	73.0	72.0					5																	140263296		2203	4300	6503	140243480	SO:0001819	synonymous_variant	56136			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1443C>T	5.37:g.140263296C>T		Somatic		Capture	Illumina GAIIx	4	140243480	O75277	Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.D481	ENST00000289272.2	37	c.1443	CCDS4240.1	5																																																																																			-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.662	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	protein_coding	OTTHUMT00000335000.1	C	NM_018904		140243480	+1	no_errors	NM_018904	genbank	human	reviewed	54_36p	silent	SNP	0.962	T
SLITRK4	139065	genome.wustl.edu	37	X	142717782	142717782	+	Silent	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chrX:142717782C>T	ENST00000381779.4	-	2	1368	c.1143G>A	c.(1141-1143)aaG>aaA	p.K381K	SLITRK4_ENST00000356928.1_Silent_p.K381K|SLITRK4_ENST00000338017.4_Silent_p.K381K	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	381						integral component of membrane (GO:0016021)		p.K381N(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TGACGTGCAGCTTCTTCGCAT	0.413																																																1	Substitution - Missense(1)	lung(1)	X											223.0	179.0	194.0					X																	142717782		2203	4300	6503	142545448	SO:0001819	synonymous_variant	139065			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1143G>A	X.37:g.142717782C>T		Somatic		Capture	Illumina GAIIx	4	142545448	Q5JXG3|Q8TCM8|Q96DL3	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00365,HMMSmart_SM00082,HMMPfam_LRRNT	p.K381	ENST00000381779.4	37	c.1143	CCDS14679.1	X																																																																																			-	superfamily_L domain-like		0.413	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	protein_coding	OTTHUMT00000058617.1	C	NM_173078		142545448	-1	no_errors	NM_173078	genbank	human	validated	54_36p	silent	SNP	1.000	T
TM4SF1	4071	genome.wustl.edu	37	3	149093268	149093268	+	Silent	SNP	G	G	A	rs147261725		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr3:149093268G>A	ENST00000305366.3	-	3	692	c.375C>T	c.(373-375)ctC>ctT	p.L125L	TM4SF1_ENST00000472441.1_Silent_p.L36L|TM4SF1-AS1_ENST00000484046.1_RNA|TM4SF1-AS1_ENST00000496491.1_RNA	NM_014220.2	NP_055035.1	P30408	T4S1_HUMAN	transmembrane 4 L six family member 1	125						integral component of plasma membrane (GO:0005887)				endometrium(3)|large_intestine(1)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TCCACTGGCCGAGGGAATCAA	0.478																																																0			3						G		0,4406		0,0,2203	98.0	88.0	91.0		375	-11.5	0.0	3	dbSNP_134	91	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	TM4SF1	NM_014220.2		0,3,6500	AA,AG,GG		0.0349,0.0,0.0231		125/203	149093268	3,13003	2203	4300	6503	150575958	SO:0001819	synonymous_variant	4071			M90657	CCDS3143.1	3q21-q25	2005-03-21	2005-03-21		ENSG00000169908	ENSG00000169908			11853	protein-coding gene	gene with protein product		191155	"""transmembrane 4 superfamily member 1"""	M3S1		1565644	Standard	NM_014220		Approved	L6	uc003exb.1	P30408	OTTHUMG00000159597	ENST00000305366.3:c.375C>T	3.37:g.149093268G>A		Somatic		Capture	Illumina GAIIx	4	150575958	Q6IB51	Silent	SNP	HMMPfam_L6_membrane	p.L125	ENST00000305366.3	37	c.375	CCDS3143.1	3																																																																																			-	HMMPfam_L6_membrane		0.478	TM4SF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF1	protein_coding	OTTHUMT00000356368.1	G			150575958	-1	no_errors	NM_014220	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
FAT2	2196	genome.wustl.edu	37	5	150931114	150931114	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr5:150931114T>G	ENST00000261800.5	-	6	4222	c.4210A>C	c.(4210-4212)Att>Ctt	p.I1404L		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1404	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCCTGGCAATGACGATGCTG	0.522																																																0			5											194.0	163.0	173.0					5																	150931114		2203	4300	6503	150911307	SO:0001583	missense	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.4210A>C	5.37:g.150931114T>G	ENSP00000261800:p.Ile1404Leu	Somatic		Capture	Illumina GAIIx	4	150911307	O75091|Q9NSR7	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2	p.I1404L	ENST00000261800.5	37	c.4210	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	T	21.5	4.161176	0.78226	.	.	ENSG00000086570	ENST00000261800	T	0.47177	0.85	5.43	5.43	0.79202	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000009	T	0.47581	0.1453	L	0.28740	0.885	0.37921	D	0.931709	D	0.61697	0.99	D	0.63877	0.919	T	0.46331	-0.9199	10	0.07644	T	0.81	.	9.915	0.41427	0.0:0.0759:0.0:0.9241	.	1404	Q9NYQ8	FAT2_HUMAN	L	1404	ENSP00000261800:I1404L	ENSP00000261800:I1404L	I	-	1	0	FAT2	150911307	1.000000	0.71417	0.886000	0.34754	0.881000	0.50899	3.065000	0.49994	2.053000	0.61076	0.459000	0.35465	ATT	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.522	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	T	NM_001447		150911307	-1	no_errors	NM_001447	genbank	human	reviewed	54_36p	missense	SNP	0.972	G
SPRR2F	6705	genome.wustl.edu	37	1	153085076	153085076	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:153085076C>A	ENST00000468739.1	-	2	194	c.134G>T	c.(133-135)tGc>tTc	p.C45F	SPRR2B_ENST00000368752.4_Intron	NM_001014450.1	NP_001014450.1	Q96RM1	SPR2F_HUMAN	small proline-rich protein 2F	45	3 X 9 AA tandem repeats of [PS]-K-C-P- [EQ]-[PS]-C-P-P.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)				large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	4	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGAGGTGGGCAGGACTGTGG	0.607																																																0			1											244.0	216.0	225.0					1																	153085076		2203	4300	6503	151351700	SO:0001583	missense	6705			AF333956	CCDS30867.1	1q21-q22	2008-02-05			ENSG00000244094	ENSG00000244094			11266	protein-coding gene	gene with protein product						8325635, 11279051	Standard	NM_001014450		Approved		uc001fbi.3	Q96RM1	OTTHUMG00000014398	ENST00000468739.1:c.134G>T	1.37:g.153085076C>A	ENSP00000418193:p.Cys45Phe	Somatic		Capture	Illumina GAIIx	4	151351700	Q5T9T3	Missense_Mutation	SNP	NULL	p.C45F	ENST00000468739.1	37	c.134	CCDS30867.1	1	.	.	.	.	.	.	.	.	.	.	C	0.032	-1.326598	0.01309	.	.	ENSG00000244094	ENST00000468739	T	0.50548	0.74	3.76	0.774	0.18521	.	0.514112	0.14978	N	0.287427	T	0.15565	0.0375	.	.	.	0.09310	N	1	B	0.18863	0.031	B	0.24006	0.05	T	0.27938	-1.0059	9	0.87932	D	0	.	4.0744	0.09897	0.0:0.5792:0.194:0.2267	.	45	Q96RM1	SPR2F_HUMAN	F	45	ENSP00000418193:C45F	ENSP00000418193:C45F	C	-	2	0	SPRR2F	151351700	0.918000	0.31147	0.000000	0.03702	0.079000	0.17450	3.100000	0.50275	-0.014000	0.14175	-0.675000	0.03792	TGC	-	NULL		0.607	SPRR2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRR2F	protein_coding	OTTHUMT00000040056.1	C			151351700	-1	no_errors	NM_001014450	genbank	human	provisional	54_36p	missense	SNP	0.821	A
NEB	4703	genome.wustl.edu	37	2	152423804	152423804	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr2:152423804C>T	ENST00000172853.10	-	86	13078	c.12931G>A	c.(12931-12933)Gcc>Acc	p.A4311T	NEB_ENST00000397345.3_Missense_Mutation_p.A6012T|NEB_ENST00000427231.2_Missense_Mutation_p.A6012T|NEB_ENST00000604864.1_Missense_Mutation_p.A6012T|NEB_ENST00000603639.1_Missense_Mutation_p.A6012T|NEB_ENST00000409198.1_Missense_Mutation_p.A4311T			P20929	NEBU_HUMAN	nebulin	4311					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CCCTGCTTGGCGGCCAAGACT	0.438																																																0			2											170.0	159.0	163.0					2																	152423804		1954	4154	6108	152132050	SO:0001583	missense	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.12931G>A	2.37:g.152423804C>T	ENSP00000172853:p.Ala4311Thr	Somatic		Capture	Illumina GAIIx	4	152132050	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	HMMSmart_SM00227,HMMPfam_Nebulin,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.A4311T	ENST00000172853.10	37	c.12931		2	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829260	0.90955	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.76176	0.3951	M	0.88570	2.965	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.993	T	0.79137	-0.1927	10	0.87932	D	0	.	20.5471	0.99284	0.0:1.0:0.0:0.0	.	4311;742	P20929;Q14215	NEBU_HUMAN;.	T	4311;6012;6012;360;742;4311	ENSP00000386259:A4311T;ENSP00000380505:A6012T;ENSP00000416578:A6012T;ENSP00000410961:A742T;ENSP00000172853:A4311T	ENSP00000172853:A4311T	A	-	1	0	NEB	152132050	1.000000	0.71417	0.970000	0.41538	0.475000	0.33008	5.947000	0.70242	2.850000	0.98022	0.650000	0.86243	GCC	-	HMMSmart_SM00227		0.438	NEB-201	KNOWN	basic	protein_coding	NEB	protein_coding		C	NM_004543		152132050	-1	no_errors	NM_004543	genbank	human	reviewed	54_36p	missense	SNP	0.990	T
SPTA1	6708	genome.wustl.edu	37	1	158614986	158614986	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:158614986C>T	ENST00000368147.4	-	29	4366	c.4186G>A	c.(4186-4188)Gag>Aag	p.E1396K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1396					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					ACCTGCAACTCCAGGCACTGG	0.428																																																0			1											168.0	152.0	157.0					1																	158614986		1919	4130	6049	156881610	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4186G>A	1.37:g.158614986C>T	ENSP00000357129:p.Glu1396Lys	Somatic		Capture	Illumina GAIIx	4	156881610	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_EF-hand,HMMPfam_efhand_Ca_insen	p.E1396K	ENST00000368147.4	37	c.4186	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976159	0.34848	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.34667	1.35;1.35	5.03	0.957	0.19613	.	0.529435	0.14090	N	0.342117	T	0.18551	0.0445	M	0.81112	2.525	0.38779	D	0.954716	B	0.23806	0.091	B	0.27608	0.081	T	0.07927	-1.0747	10	0.17832	T	0.49	.	6.7433	0.23449	0.0:0.6532:0.1268:0.22	.	1396	P02549	SPTA1_HUMAN	K	1396	ENSP00000357130:E1396K;ENSP00000357129:E1396K	ENSP00000357129:E1396K	E	-	1	0	SPTA1	156881610	0.967000	0.33354	0.012000	0.15200	0.373000	0.29922	1.340000	0.33896	0.093000	0.17368	0.650000	0.86243	GAG	-	superfamily_Spectrin repeat,HMMPfam_Spectrin		0.428	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	C	NM_003126		156881610	-1	no_errors	NM_003126	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ACKR1	2532	genome.wustl.edu	37	1	159175738	159175738	+	Missense_Mutation	SNP	C	C	T	rs200287093	byFrequency	TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:159175738C>T	ENST00000368122.2	+	2	1188	c.509C>T	c.(508-510)aCt>aTt	p.T170I	DARC_ENST00000537147.1_Missense_Mutation_p.T170I|DARC_ENST00000368121.2_Missense_Mutation_p.T172I|CTA-134P22.2_ENST00000609696.1_RNA	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		170					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					CTGGGGCTCACTGTGGGAATT	0.627													C|||	2	0.000399361	0.0	0.0	5008	,	,		20497	0.002		0.0	False		,,,				2504	0.0															0			1											38.0	32.0	34.0					1																	159175738		2203	4300	6503	157442362	SO:0001583	missense	2532																														ENST00000368122.2:c.509C>T	1.37:g.159175738C>T	ENSP00000357104:p.Thr170Ile	Somatic		Capture	Illumina GAIIx	4	157442362	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	NULL	p.T170I	ENST00000368122.2	37	c.509	CCDS1183.1	1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	8.424	0.847122	0.17034	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.30714	1.52;1.52;1.52	5.23	1.14	0.20703	.	1.437920	0.05370	U	0.535262	T	0.17365	0.0417	L	0.39898	1.24	0.09310	N	1	P;B	0.39535	0.677;0.367	P;B	0.47827	0.558;0.429	T	0.37174	-0.9717	10	0.33940	T	0.23	-15.3394	9.0183	0.36184	0.0:0.4944:0.4251:0.0805	.	172;170	Q5Y7A1;Q16570	.;DUFFY_HUMAN	I	170;170;170;172	ENSP00000357104:T170I;ENSP00000441985:T170I;ENSP00000357103:T172I	ENSP00000352341:T170I	T	+	2	0	DARC	157442362	0.000000	0.05858	0.026000	0.17262	0.014000	0.08584	0.255000	0.18333	0.021000	0.15133	0.561000	0.74099	ACT	-	NULL		0.627	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARC	protein_coding	OTTHUMT00000090338.2	C			157442362	+1	no_errors	NM_002036	genbank	human	reviewed	54_36p	missense	SNP	0.118	T
GFM1	85476	genome.wustl.edu	37	3	158364654	158364654	+	Missense_Mutation	SNP	C	C	T	rs182569165		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr3:158364654C>T	ENST00000486715.1	+	4	847	c.490C>T	c.(490-492)Cgc>Tgc	p.R164C	GFM1_ENST00000478576.1_Missense_Mutation_p.R164C|GFM1_ENST00000264263.5_Missense_Mutation_p.R164C	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			TCAGATGAAGCGCTACAACGT	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		16618	0.001		0.0	False		,,,				2504	0.0															0			3						C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	174.0	150.0	158.0		490	5.9	1.0	3		158	2,8598	2.2+/-6.3	0,2,4298	yes	missense	GFM1	NM_024996.5	180	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	probably-damaging	164/752	158364654	3,13003	2203	4300	6503	159847348	SO:0001583	missense	85476			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.490C>T	3.37:g.158364654C>T	ENSP00000419038:p.Arg164Cys	Somatic		Capture	Illumina GAIIx	4	159847348		Missense_Mutation	SNP	superfamily_SSF52540,HMMPfam_GTP_EFTU,PatternScan_EFACTOR_GTP,superfamily_Translat_factor,HMMPfam_GTP_EFTU_D2,superfamily_EFG_III_V,superfamily_Ribosomal_S5_D2-typ_fold,HMMPfam_EFG_IV,HMMPfam_EFG_C	p.R164C	ENST00000486715.1	37	c.490	CCDS33885.1	3	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	25.7	4.667346	0.88348	2.27E-4	2.33E-4	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263	T;T;T	0.71579	-0.58;-0.58;-0.58	5.86	5.86	0.93980	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	D	0.91479	0.7310	H	0.99659	4.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94568	0.7768	10	0.87932	D	0	-11.2891	15.027	0.71677	0.1421:0.8579:0.0:0.0	.	164;164;164	Q96RP9-2;Q96RP9;C9IZ01	.;EFGM_HUMAN;.	C	164	ENSP00000419038:R164C;ENSP00000418755:R164C;ENSP00000264263:R164C	ENSP00000264263:R164C	R	+	1	0	GFM1	159847348	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	5.561000	0.67339	2.784000	0.95788	0.644000	0.83932	CGC	-	superfamily_SSF52540,HMMPfam_GTP_EFTU		0.498	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM1	protein_coding	OTTHUMT00000352271.1	C	NM_024996		159847348	+1	no_errors	NM_024996	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LPA	4018	genome.wustl.edu	37	6	161012006	161012006	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr6:161012006G>T	ENST00000316300.5	-	23	3801	c.3757C>A	c.(3757-3759)Ctt>Att	p.L1253I	LPA_ENST00000447678.1_Missense_Mutation_p.L1253I			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3761	Kringle 11. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	GACGTCGCAAGGACACTTGAT	0.468																																																0			6											111.0	112.0	112.0					6																	161012006		2185	4296	6481	160931996	SO:0001583	missense	4018			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3757C>A	6.37:g.161012006G>T	ENSP00000321334:p.Leu1253Ile	Somatic		Capture	Illumina GAIIx	4	160931996	Q5VTD7|Q9UD88	Missense_Mutation	SNP	superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle,PatternScan_KRINGLE_1,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.L1253I	ENST00000316300.5	37	c.3757	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	g	7.665	0.685815	0.14973	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62941	-0.01;-0.01	1.25	-2.49	0.06403	Kringle-like fold (1);	.	.	.	.	T	0.49098	0.1537	L	0.49350	1.555	0.09310	N	1	B	0.22146	0.065	P	0.55303	0.773	T	0.66240	-0.5973	9	0.16420	T	0.52	.	3.3099	0.07014	0.27:0.4424:0.2876:0.0	.	3761	P08519	APOA_HUMAN	I	1253	ENSP00000321334:L1253I;ENSP00000395608:L1253I	ENSP00000321334:L1253I	L	-	1	0	LPA	160931996	0.000000	0.05858	0.001000	0.08648	0.106000	0.19336	-0.153000	0.10144	-0.557000	0.06126	0.205000	0.17691	CTT	-	superfamily_Kringle-like		0.468	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	protein_coding	OTTHUMT00000042957.1	G	NM_005577		160931996	-1	no_errors	NM_005577	genbank	human	validated	54_36p	missense	SNP	0.000	T
SMOC2	64094	genome.wustl.edu	37	6	168949821	168949821	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr6:168949821G>A	ENST00000356284.2	+	7	795	c.575G>A	c.(574-576)cGt>cAt	p.R192H	SMOC2_ENST00000354536.5_Missense_Mutation_p.R203H	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	192					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		ATTGCATCACGTTACCCTACC	0.398																																																0			6											184.0	155.0	165.0					6																	168949821		2203	4300	6503	168692670	SO:0001583	missense	64094			AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.575G>A	6.37:g.168949821G>A	ENSP00000348630:p.Arg192His	Somatic		Capture	Illumina GAIIx	4	168692670	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Missense_Mutation	SNP	superfamily_Thyroglobulin_1,HMMSmart_KAZAL,HMMPfam_Kazal_1,HMMPfam_Thyroglobulin_1,PatternScan_THYROGLOBULIN_1_1,HMMSmart_TY,superfamily_SSF47473,HMMSmart_EFh,PatternScan_EF_HAND_1,HMMPfam_SPARC_Ca_bdg	p.R203H	ENST00000356284.2	37	c.608	CCDS55076.1	6	.	.	.	.	.	.	.	.	.	.	.	13.38	2.219582	0.39201	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793	T;T	0.36699	1.24;1.28	5.02	5.02	0.67125	.	0.070353	0.64402	D	0.000020	T	0.15912	0.0383	N	0.08118	0	0.36204	D	0.850894	D;D	0.64830	0.98;0.994	B;P	0.48454	0.443;0.578	T	0.04579	-1.0941	10	0.34782	T	0.22	-20.4308	15.5789	0.76418	0.0:0.0:1.0:0.0	.	192;203	Q9H3U7;Q9H3U7-2	SMOC2_HUMAN;.	H	192;203;192	ENSP00000348630:R192H;ENSP00000346537:R203H	ENSP00000346537:R203H	R	+	2	0	SMOC2	168692670	1.000000	0.71417	0.496000	0.27539	0.015000	0.08874	4.978000	0.63799	2.327000	0.79052	0.650000	0.86243	CGT	-	superfamily_Thyroglobulin_1		0.398	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMOC2	protein_coding	OTTHUMT00000043201.1	G			168692670	+1	no_errors	NM_022138	genbank	human	provisional	54_36p	missense	SNP	0.994	A
DDX60L	91351	genome.wustl.edu	37	4	169337873	169337873	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr4:169337873C>A	ENST00000511577.1	-	20	2933	c.2686G>T	c.(2686-2688)Gtt>Ttt	p.V896F	DDX60L_ENST00000260184.7_Missense_Mutation_p.V896F|DDX60L_ENST00000505890.1_Missense_Mutation_p.V896F			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	896	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		GCTGAAAGAACCAAAAAGGGA	0.353																																																0			4											99.0	97.0	97.0					4																	169337873		1849	4128	5977	169574448	SO:0001583	missense	91351			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.2686G>T	4.37:g.169337873C>A	ENSP00000422423:p.Val896Phe	Somatic		Capture	Illumina GAIIx	4	169574448	Q96ND6	Missense_Mutation	SNP	HMMSmart_SM00487,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_DEAD,HMMSmart_SM00490,HMMPfam_Helicase_C	p.V896F	ENST00000511577.1	37	c.2686		4	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465588	0.43839	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.34859	2.21;2.21;1.34;1.34	3.23	0.212	0.15240	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.206637	0.22655	U	0.057267	T	0.23965	0.0580	N	0.02751	-0.505	0.23101	N	0.998295	D;D;D	0.64830	0.99;0.994;0.99	P;P;P	0.61658	0.761;0.892;0.761	T	0.13229	-1.0517	10	0.87932	D	0	.	3.2604	0.06846	0.175:0.554:0.1699:0.1011	.	896;896;896	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	F	896;896;896;592	ENSP00000260184:V896F;ENSP00000422423:V896F;ENSP00000422202:V896F;ENSP00000421026:V592F	ENSP00000260184:V896F	V	-	1	0	DDX60L	169574448	0.998000	0.40836	0.034000	0.17996	0.803000	0.45373	2.058000	0.41374	-0.299000	0.08909	-0.464000	0.05259	GTT	-	HMMSmart_SM00487,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_DEAD		0.353	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	DDX60L	protein_coding	OTTHUMT00000364839.1	C	NM_001012967		169574448	-1	no_errors	NM_001012967	genbank	human	validated	54_36p	missense	SNP	1.000	A
CEP350	9857	genome.wustl.edu	37	1	180062112	180062112	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:180062112A>T	ENST00000367607.3	+	34	7290	c.6872A>T	c.(6871-6873)cAg>cTg	p.Q2291L	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2291					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						GTCCTAGAACAGGGAGATTCA	0.303																																																0			1											16.0	17.0	17.0					1																	180062112		2192	4290	6482	178328735	SO:0001583	missense	9857			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.6872A>T	1.37:g.180062112A>T	ENSP00000356579:p.Gln2291Leu	Somatic		Capture	Illumina GAIIx	4	178328735	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1	p.Q2290L	ENST00000367607.3	37	c.6869	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	A	10.60	1.396626	0.25205	.	.	ENSG00000135837	ENST00000367607	T	0.57595	0.39	5.6	4.44	0.53790	.	0.152597	0.30392	N	0.009737	T	0.36991	0.0987	L	0.29908	0.895	0.25039	N	0.991214	B;B	0.27559	0.001;0.181	B;B	0.24155	0.001;0.051	T	0.17806	-1.0357	9	.	.	.	.	9.6836	0.40085	0.7241:0.0:0.0:0.2758	.	2291;2291	E7EU22;Q5VT06	.;CE350_HUMAN	L	2291	ENSP00000356579:Q2291L	.	Q	+	2	0	CEP350	178328735	1.000000	0.71417	0.997000	0.53966	0.657000	0.38888	1.606000	0.36826	0.892000	0.36259	0.460000	0.39030	CAG	-	NULL		0.303	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	protein_coding	OTTHUMT00000085315.2	A	NM_014810		178328735	+1	no_errors	NM_014810	genbank	human	reviewed	54_36p	missense	SNP	0.434	T
TTN	7273	genome.wustl.edu	37	2	179611945	179611945	+	Intron	SNP	C	C	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr2:179611945C>G	ENST00000591111.1	-	46	10585				TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.R5061T|TTN_ENST00000589042.1_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTGGAGTATCTCTCTAGTGT	0.507																																																0			2											68.0	71.0	70.0					2																	179611945		2203	4300	6503	179320190	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-5297G>C	2.37:g.179611945C>G		Somatic		Capture	Illumina GAIIx	4	179320190	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_Titin_Z,HMMPfam_ig,PatternScan_IG_MHC,PatternScan_THIOL_PROTEASE_HIS	p.R5061T	ENST00000591111.1	37	c.15182		2	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971940	0.53614	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.59224	0.28	5.91	5.91	0.95273	.	.	.	.	.	T	0.66915	0.2838	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.66351	0.943	T	0.61367	-0.7077	9	0.12766	T	0.61	.	10.5225	0.44927	0.0:0.909:0.0:0.091	.	5061	Q8WZ42-6	.	T	5061;375	ENSP00000354117:R5061T	ENSP00000304714:R375T	R	-	2	0	TTN	179320190	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	2.347000	0.44036	2.809000	0.96659	0.555000	0.69702	AGA	-	NULL		0.507	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179320190	-1	no_errors	NM_133379	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HECW2	57520	genome.wustl.edu	37	2	197081766	197081766	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr2:197081766C>G	ENST00000260983.3	-	27	4642	c.4460G>C	c.(4459-4461)aGa>aCa	p.R1487T	HECW2_ENST00000409111.1_Missense_Mutation_p.R1131T|snoU13_ENST00000459047.1_RNA	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1487	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						ATTGTTGAATCTTTCCACTGC	0.328																																																0			2											186.0	173.0	178.0					2																	197081766		2203	4300	6503	196790011	SO:0001583	missense	57520			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4460G>C	2.37:g.197081766C>G	ENSP00000260983:p.Arg1487Thr	Somatic		Capture	Illumina GAIIx	4	196790011	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	HMMSmart_SM00239,HMMPfam_C2,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT	p.R1487T	ENST00000260983.3	37	c.4460	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	C	27.9	4.870734	0.91587	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.41758	0.99;0.99	5.36	5.36	0.76844	HECT (4);	0.148919	0.64402	D	0.000010	T	0.48447	0.1500	N	0.11789	0.175	0.80722	D	1	D	0.69078	0.997	D	0.70016	0.967	T	0.54662	-0.8260	10	0.52906	T	0.07	.	19.2924	0.94105	0.0:1.0:0.0:0.0	.	1487	Q9P2P5	HECW2_HUMAN	T	1131;1487	ENSP00000386775:R1131T;ENSP00000260983:R1487T	ENSP00000260983:R1487T	R	-	2	0	HECW2	196790011	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.320000	0.79064	2.783000	0.95769	0.655000	0.94253	AGA	-	superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT		0.328	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	protein_coding	OTTHUMT00000335199.3	C	NM_020760		196790011	-1	no_errors	NM_020760	genbank	human	provisional	54_36p	missense	SNP	1.000	G
TFRC	7037	genome.wustl.edu	37	3	195779029	195779029	+	Silent	SNP	G	G	A	rs199652297		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr3:195779029G>A	ENST00000360110.4	-	19	2236	c.2067C>T	c.(2065-2067)taC>taT	p.Y689Y	TFRC_ENST00000540528.1_3'UTR|TFRC_ENST00000535031.1_Silent_p.Y407Y|TFRC_ENST00000392396.3_Silent_p.Y689Y|TFRC_ENST00000420415.1_Silent_p.Y608Y	NM_001128148.1	NP_001121620.1	P02786	TFR1_HUMAN	transferrin receptor	689	Ligand-binding.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|osteoclast differentiation (GO:0030316)|positive regulation of bone resorption (GO:0045780)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transferrin receptor activity (GO:0004998)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)	Gallium nitrate(DB05260)	TTGGAGATACGTAGGGAGAGA	0.448			T	BCL6	NHL																																		Dom	yes		3	3q29	7037	"""transferrin receptor (p90, CD71)"""		L	0			3											55.0	58.0	57.0					3																	195779029		2203	4300	6503	197263426	SO:0001819	synonymous_variant	7037			X01060	CCDS3312.1	3q29	2013-09-19	2013-09-19		ENSG00000072274	ENSG00000072274		"""CD molecules"""	11763	protein-coding gene	gene with protein product		190010	"""transferrin receptor (p90, CD71)"""				Standard	NM_003234		Approved	CD71, TFR1, p90	uc003fwa.4	P02786	OTTHUMG00000155714	ENST00000360110.4:c.2067C>T	3.37:g.195779029G>A		Somatic		Capture	Illumina GAIIx	4	197263426	D3DXB0|Q1HE24|Q59G55|Q9UCN0|Q9UCU5|Q9UDF9|Q9UK21	Silent	SNP	superfamily_Zn-dependent exopeptidases,superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA,superfamily_Transferrin receptor ectodomain C-terminal domain,HMMPfam_TFR_dimer	p.Y689	ENST00000360110.4	37	c.2067	CCDS3312.1	3																																																																																			-	superfamily_Transferrin receptor ectodomain C-terminal domain,HMMPfam_TFR_dimer		0.448	TFRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFRC	protein_coding	OTTHUMT00000341346.1	G			197263426	-1	no_errors	NM_003234	genbank	human	validated	54_36p	silent	SNP	0.999	A
RABIF	5877	genome.wustl.edu	37	1	202850283	202850283	+	Silent	SNP	G	G	A	rs373688472		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:202850283G>A	ENST00000367262.3	-	2	231	c.195C>T	c.(193-195)ctC>ctT	p.L65L		NM_002871.4	NP_002862.2	P47224	MSS4_HUMAN	RAB interacting factor	65					membrane fusion (GO:0061025)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(2)|ovary(1)	4			BRCA - Breast invasive adenocarcinoma(75;0.166)			AGTGTTCCTGGAGGAGATCGC	0.502																																																0			1						G		0,4406		0,0,2203	73.0	67.0	69.0		195	-2.1	1.0	1		69	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RABIF	NM_002871.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		65/124	202850283	1,13005	2203	4300	6503	201116906	SO:0001819	synonymous_variant	5877			S78873	CCDS1428.1	1q32.1	2008-05-14			ENSG00000183155	ENSG00000183155			9797	protein-coding gene	gene with protein product		603417		RASGRF3		9441742, 7619808	Standard	NM_002871		Approved	mss4	uc001gyl.3	P47224	OTTHUMG00000041400	ENST00000367262.3:c.195C>T	1.37:g.202850283G>A		Somatic		Capture	Illumina GAIIx	4	201116906	B2R4P4|Q92992	Silent	SNP	superfamily_Mss4-like,HMMPfam_Mss4	p.L65	ENST00000367262.3	37	c.195	CCDS1428.1	1																																																																																			-	superfamily_Mss4-like,HMMPfam_Mss4		0.502	RABIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABIF	protein_coding	OTTHUMT00000099183.1	G			201116906	-1	no_errors	NM_002871	genbank	human	provisional	54_36p	silent	SNP	0.877	A
DTL	51514	genome.wustl.edu	37	1	212274368	212274368	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:212274368G>C	ENST00000366991.4	+	14	2350	c.2036G>C	c.(2035-2037)aGt>aCt	p.S679T	RN7SKP98_ENST00000517070.1_RNA|DTL_ENST00000475419.1_3'UTR|DTL_ENST00000542077.1_Missense_Mutation_p.S637T	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	679					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		TCTCCACGAAGTCCGTCATCC	0.483																																																0			1											44.0	44.0	44.0					1																	212274368		2203	4300	6503	210340991	SO:0001583	missense	51514			AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.2036G>C	1.37:g.212274368G>C	ENSP00000355958:p.Ser679Thr	Somatic		Capture	Illumina GAIIx	4	210340991	A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.S679T	ENST00000366991.4	37	c.2036	CCDS1502.1	1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227621	0.39399	.	.	ENSG00000143476	ENST00000366991;ENST00000542077;ENST00000420235	T;T	0.77098	-1.0;-1.07	5.71	4.79	0.61399	.	0.206627	0.56097	D	0.000023	T	0.65606	0.2707	L	0.27053	0.805	0.09310	N	1	P;P;P	0.49253	0.921;0.872;0.872	B;B;B	0.42625	0.393;0.237;0.22	T	0.61426	-0.7065	10	0.59425	D	0.04	-10.3273	8.6992	0.34316	0.078:0.3138:0.6082:0.0	.	637;679;637	F5GZ90;Q9NZJ0;B4E0E6	.;DTL_HUMAN;.	T	679;637;358	ENSP00000355958:S679T;ENSP00000443870:S637T	ENSP00000355958:S679T	S	+	2	0	DTL	210340991	0.900000	0.30661	0.987000	0.45799	0.985000	0.73830	2.681000	0.46926	1.404000	0.46819	0.655000	0.94253	AGT	-	NULL		0.483	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTL	protein_coding	OTTHUMT00000090182.1	G	NM_016448		210340991	+1	no_errors	NM_016448	genbank	human	validated	54_36p	missense	SNP	0.043	C
USH2A	7399	genome.wustl.edu	37	1	215914791	215914791	+	Silent	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:215914791C>A	ENST00000307340.3	-	60	12023	c.11637G>T	c.(11635-11637)ggG>ggT	p.G3879G	USH2A_ENST00000366943.2_Silent_p.G3879G	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3879	Fibronectin type-III 24. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGCAAGCTGACCCCAGTGCCT	0.383										HNSCC(13;0.011)																																						0			1											136.0	137.0	137.0					1																	215914791		2203	4300	6503	213981414	SO:0001819	synonymous_variant	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11637G>T	1.37:g.215914791C>A		Somatic		Capture	Illumina GAIIx	4	213981414	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00560,HMMSmart_SM00136,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_LAM_1,PatternScan_EGF_1,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMSmart_SM00282,HMMPfam_Laminin_G_2	p.G3879	ENST00000307340.3	37	c.11637	CCDS31025.1	1																																																																																			-	superfamily_Fibronectin type III,HMMSmart_SM00060		0.383	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	C	NM_007123		213981414	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	silent	SNP	0.044	A
COL6A3	1293	genome.wustl.edu	37	2	238275651	238275651	+	Missense_Mutation	SNP	G	G	A	rs143074017		TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr2:238275651G>A	ENST00000295550.4	-	11	5631	c.5179C>T	c.(5179-5181)Cgg>Tgg	p.R1727W	COL6A3_ENST00000346358.4_Missense_Mutation_p.R1527W|COL6A3_ENST00000347401.3_Missense_Mutation_p.R1526W|COL6A3_ENST00000353578.4_Missense_Mutation_p.R1521W|COL6A3_ENST00000409809.1_Missense_Mutation_p.R1521W|COL6A3_ENST00000472056.1_Missense_Mutation_p.R1120W	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1727	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGGTTTACCCGCAGGTGCTCA	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19992	0.0		0.0	False		,,,				2504	0.0															0			2						G	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	77.0	68.0	71.0		5179,3358,4561	-0.1	0.3	2	dbSNP_134	71	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense,missense	COL6A3	NM_004369.3,NM_057166.4,NM_057167.3	101,101,101	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	probably-damaging,probably-damaging,probably-damaging	1727/3178,1120/2571,1521/2972	238275651	4,13002	2203	4300	6503	237940390	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5179C>T	2.37:g.238275651G>A	ENSP00000295550:p.Arg1727Trp	Somatic		Capture	Illumina GAIIx	4	237940390	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	HMMSmart_SM00327,superfamily_vWA-like,HMMPfam_VWA,HMMPfam_Collagen,superfamily_Fibronectin type III,superfamily_BPTI-like,HMMSmart_SM00131,HMMPfam_Kunitz_BPTI,PatternScan_BPTI_KUNITZ_1	p.R1727W	ENST00000295550.4	37	c.5179	CCDS33412.1	2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	10.27	1.302823	0.23736	0.0	4.65E-4	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78;-1.78	5.56	-0.141	0.13452	von Willebrand factor, type A (3);	0.819529	0.10316	N	0.689400	D	0.89210	0.6650	M	0.64404	1.975	0.09310	N	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;P	0.75484	0.986;0.982;0.761	T	0.82123	-0.0613	10	0.40728	T	0.16	.	16.7926	0.85593	0.0:0.0:0.361:0.639	.	1120;1521;1727	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	W	1727;1526;1521;1120;1521;1527	ENSP00000295550:R1727W;ENSP00000315609:R1526W;ENSP00000315873:R1521W;ENSP00000418285:R1120W;ENSP00000386844:R1521W;ENSP00000295546:R1527W	ENSP00000295550:R1727W	R	-	1	2	COL6A3	237940390	0.970000	0.33590	0.340000	0.25575	0.317000	0.28152	1.684000	0.37649	0.257000	0.21650	0.650000	0.86243	CGG	-	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA		0.552	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	protein_coding	OTTHUMT00000315790.2	G	NM_004369		237940390	-1	no_errors	NM_004369	genbank	human	reviewed	54_36p	missense	SNP	0.125	A
OR2G6	391211	genome.wustl.edu	37	1	248685005	248685005	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr1:248685005C>A	ENST00000343414.4	+	1	90	c.58C>A	c.(58-60)Cag>Aag	p.Q20K		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATTTTCAGATCAGCCTCAGCT	0.443																																																0			1											173.0	160.0	164.0					1																	248685005		2203	4300	6503	246751628	SO:0001583	missense	391211				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.58C>A	1.37:g.248685005C>A	ENSP00000341291:p.Gln20Lys	Somatic		Capture	Illumina GAIIx	4	246751628	B2RP33	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.Q20K	ENST00000343414.4	37	c.58	CCDS31119.1	1	.	.	.	.	.	.	.	.	.	.	-	10.25	1.297440	0.23650	.	.	ENSG00000188558	ENST00000343414	T	0.00321	8.11	3.83	1.77	0.24775	.	0.774806	0.10862	U	0.625961	T	0.00210	0.0006	L	0.46567	1.45	0.21147	N	0.999771	B	0.02656	0.0	B	0.04013	0.001	T	0.21793	-1.0235	10	0.38643	T	0.18	.	7.4561	0.27268	0.1797:0.6239:0.1963:0.0	.	20	Q5TZ20	OR2G6_HUMAN	K	20	ENSP00000341291:Q20K	ENSP00000341291:Q20K	Q	+	1	0	OR2G6	246751628	0.000000	0.05858	0.917000	0.36280	0.778000	0.44026	-1.071000	0.03437	0.794000	0.33899	0.400000	0.26472	CAG	-	superfamily_Family A G protein-coupled receptor-like		0.443	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G6	protein_coding	OTTHUMT00000097358.1	C	XM_372842		246751628	+1	no_errors	NM_001013355	genbank	human	validated	54_36p	missense	SNP	0.007	A
TMEM52B	120939	genome.wustl.edu	37	12	10332215	10332215	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr12:10332215delG	ENST00000381923.2	+	2	446	c.42delG	c.(40-42)ctgfs	p.L14fs	TMEM52B_ENST00000298530.3_Frame_Shift_Del_p.C9fs|TMEM52B_ENST00000536952.1_Frame_Shift_Del_p.L14fs			Q4KMG9	TM52B_HUMAN	transmembrane protein 52B	14						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CAGCCCTGCTGTATTTCATCC	0.493																																																0			12											167.0	157.0	160.0					12																	10332215		2203	4300	6503	10223482	SO:0001589	frameshift_variant	120939			AY358845	CCDS8619.1, CCDS66314.1	12p13.2	2012-08-15	2012-08-15	2012-08-15	ENSG00000165685	ENSG00000165685			26438	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 59"""	C12orf59		12975309	Standard	XM_005253299		Approved	FLJ31166	uc001qxq.3	Q4KMG9	OTTHUMG00000168410	ENST00000381923.2:c.42delG	12.37:g.10332215delG	ENSP00000371348:p.Leu14fs	Somatic		Capture	Illumina GAIIx	4	10223482	Q96NA7	Frame_Shift_Del	DEL	NULL	p.C9fs	ENST00000381923.2	37	c.26		12																																																																																			(deletion:cds_exon[10223457,10223494])	NULL		0.493	TMEM52B-002	KNOWN	basic|appris_candidate_longest	protein_coding	C12orf59	protein_coding	OTTHUMT00000399645.1	G	NM_153022		10223482	+1	no_errors	NM_153022	genbank	human	validated	54_36p	frame_shift_del	DEL	0.001	-
KRTAP4-7	100132476	genome.wustl.edu	37	17	39240782	39240796	+	In_Frame_Del	DEL	CTGCTGCCGCCCCAG	CTGCTGCCGCCCCAG	-	rs9894966|rs9894106|rs199957151|rs11650261|rs541163988|rs553572799	byFrequency	TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	CTGCTGCCGCCCCAG	CTGCTGCCGCCCCAG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chr17:39240782_39240796delCTGCTGCCGCCCCAG	ENST00000391417.4	+	1	324_338	c.324_338delCTGCTGCCGCCCCAG	c.(322-339)acctgctgccgccccagc>acc	p.CCRPS109del		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	134	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.S113C(1)|p.P112P(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						gccagcccacctgctgccgccccagctgctgccgc	0.67														169	0.033746	0.0061	0.0375	5008	,	,		15885	0.0238		0.0775	False		,,,				2504	0.0337															4	Substitution - Missense(1)|Unknown(1)|Substitution - coding silent(1)|Deletion - In frame(1)	NS(2)|prostate(2)	17								120,3626		16,88,1769						1.0	0.3		dbSNP_126	14	690,6608		77,536,3036	no	coding	KRTAP4-7	NM_033061.3		93,624,4805	A1A1,A1R,RR		9.4546,3.2034,7.3343				810,10234				36494322	SO:0001651	inframe_deletion	0			AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.324_338delCTGCTGCCGCCCCAG	17.37:g.39240782_39240796delCTGCTGCCGCCCCAG	ENSP00000375236:p.Cys109_Ser113del	Somatic		Capture	Illumina GAIIx	4	36494308	A0AVM6|A8MQ08|A8MTL4	In_Frame_Del	DEL	HMMPfam_Keratin_B2	p.PSCCR112in_frame_del	ENST00000391417.4	37	c.324_338	CCDS45673.1	17																																																																																			(deletion:cds_exon[36493985,36494452])	HMMPfam_Keratin_B2		0.670	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-8	protein_coding	OTTHUMT00000257686.1	CTGCTGCCGCCCCAG			36494322	+1	no_errors	ENST00000391417	ensembl	human	known	54_36p	in_frame_del	DEL	0.808:0.872:0.863:0.838:0.614:0.280:0.041:0.000:0.000:0.000:0.003:0.010:0.495:0.494:0.565	-
KDM5C	8242	genome.wustl.edu	37	X	53222396	53222396	+	Frame_Shift_Del	DEL	G	G	-			TCGA-24-1843-01A-01W-0639-09	TCGA-24-1843-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22cd9936-9f48-447f-99b3-619f703e15c7	ed14c55e-68c3-4245-ab35-6401a92781ef	g.chrX:53222396delG	ENST00000375401.3	-	26	4968	c.4436delC	c.(4435-4437)ccafs	p.P1479fs	KDM5C_ENST00000375379.3_Frame_Shift_Del_p.P1476fs|KDM5C_ENST00000452825.3_Intron|KDM5C_ENST00000404049.3_Frame_Shift_Del_p.P1478fs|KDM5C_ENST00000375383.3_Frame_Shift_Del_p.P1435fs	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1479					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TACCCTCTTTGGCTCTAGCTC	0.716			"""N, F, S"""		clear cell renal carcinoma																																		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0			X											62.0	39.0	47.0					X																	53222396		2203	4300	6503	53239121	SO:0001589	frameshift_variant	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.4436delC	X.37:g.53222396delG	ENSP00000364550:p.Pro1479fs	Somatic		Capture	Illumina GAIIx	4	53239121	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Frame_Shift_Del	DEL	HMMSmart_SM00545,HMMPfam_JmjN,superfamily_ARID-like,HMMPfam_ARID,HMMSmart_SM00501,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,HMMSmart_SM00558,HMMPfam_JmjC,HMMPfam_zf-C5HC2,HMMPfam_PLU-1	p.P1479fs	ENST00000375401.3	37	c.4436	CCDS14351.1	X																																																																																			(deletion:cds_exon[53238874,53239239])	NULL		0.716	KDM5C-005	KNOWN	basic|CCDS	protein_coding	JARID1C	protein_coding	OTTHUMT00000056737.2	G	NM_004187		53239121	-1	no_errors	NM_004187	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.998	-
