#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ATAD3C	219293	genome.wustl.edu	37	1	1391266	1391266	+	Silent	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:1391266A>G	ENST00000378785.2	+	6	1529	c.534A>G	c.(532-534)ccA>ccG	p.P178P		NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C	178							ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGTACGGGCCACCAGGCACCG	0.637																																																0			1											75.0	82.0	80.0					1																	1391266		692	1591	2283	1381129	SO:0001819	synonymous_variant	219293			AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.534A>G	1.37:g.1391266A>G		Somatic		Capture	Illumina GAIIx	4	1381129	Q8N1Z5	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA	p.P178	ENST00000378785.2	37	c.534	CCDS44039.1	1																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA		0.637	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3C	protein_coding	OTTHUMT00000001279.3	A	NM_001039211		1381129	+1	no_errors	ENST00000378774	ensembl	human	known	54_36p	silent	SNP	0.966	G
KIAA0020	9933	genome.wustl.edu	37	9	2828779	2828779	+	Splice_Site	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr9:2828779C>A	ENST00000397885.2	-	9	1059		c.e9-1		KIAA0020_ENST00000469168.1_Splice_Site	NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020							endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		GATCTGCTGACTGCAACAAAA	0.318																																																0			9											108.0	101.0	103.0					9																	2828779		2201	4300	6501	2818779	SO:0001630	splice_region_variant	9933			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.853-1G>T	9.37:g.2828779C>A		Somatic		Capture	Illumina GAIIx	4	2818779	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Splice_Site	SNP	-	e8-1	ENST00000397885.2	37	c.853-1	CCDS6448.2	9	.	.	.	.	.	.	.	.	.	.	C	14.56	2.571060	0.45798	.	.	ENSG00000080608	ENST00000397885	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2406	0.98372	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0020	2818779	1.000000	0.71417	1.000000	0.80357	0.329000	0.28539	6.942000	0.75928	2.857000	0.98124	0.650000	0.86243	.	-	-		0.318	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0020	protein_coding	OTTHUMT00000051529.3	C	NM_014878	Intron	2818779	-1	no_errors	NM_014878	genbank	human	validated	54_36p	splice_site	SNP	1.000	A
LONP1	9361	genome.wustl.edu	37	19	5713214	5713214	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:5713214G>A	ENST00000360614.3	-	3	726	c.569C>T	c.(568-570)aCg>aTg	p.T190M	LONP1_ENST00000585374.1_Missense_Mutation_p.T76M|LONP1_ENST00000593119.1_Missense_Mutation_p.T126M|LONP1_ENST00000590729.1_Missense_Mutation_p.T76M|LONP1_ENST00000540670.2_De_novo_Start_InFrame	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTGGGCAAACGTCCCCGTGTG	0.567																																																0			19											147.0	118.0	128.0					19																	5713214		2203	4300	6503	5664214	SO:0001583	missense	9361			U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.569C>T	19.37:g.5713214G>A	ENSP00000353826:p.Thr190Met	Somatic		Capture	Illumina GAIIx	4	5664214		Missense_Mutation	SNP	HMMPfam_LON,HMMSmart_LON,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA,HMMPfam_Lon_C,superfamily_Ribosomal_S5_D2-typ_fold,PatternScan_LON_SER	p.T190M	ENST00000360614.3	37	c.569	CCDS12148.1	19	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873073	0.51695	.	.	ENSG00000196365	ENST00000360614;ENST00000358403	T	0.56444	0.46	4.58	4.58	0.56647	Peptidase S16, lon N-terminal (2);PUA-like domain (1);	0.114219	0.64402	D	0.000020	T	0.77054	0.4074	M	0.90977	3.165	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71414	0.973;0.973;0.973	D	0.83408	0.0026	10	0.87932	D	0	-10.1466	14.8681	0.70434	0.0:0.0:1.0:0.0	.	190;126;190	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	M	190;154	ENSP00000353826:T190M	ENSP00000351177:T154M	T	-	2	0	LONP1	5664214	1.000000	0.71417	0.565000	0.28409	0.100000	0.18952	8.967000	0.93402	2.096000	0.63516	0.313000	0.20887	ACG	-	HMMPfam_LON,HMMSmart_LON		0.567	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONP1	protein_coding	OTTHUMT00000451662.1	G	NM_004793		5664214	-1	no_errors	NM_004793	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
TBC1D14	57533	genome.wustl.edu	37	4	6969104	6969104	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr4:6969104G>A	ENST00000409757.4	+	3	920	c.796G>A	c.(796-798)Gcg>Acg	p.A266T	TBC1D14_ENST00000448507.1_Missense_Mutation_p.A266T|TBC1D14_ENST00000410031.1_Missense_Mutation_p.A38T	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	266					negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						ATTTGGGAAAGCGCCACTCCG	0.398																																																0			4											102.0	98.0	99.0					4																	6969104		2203	4300	6503	7020005	SO:0001583	missense	57533			AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.796G>A	4.37:g.6969104G>A	ENSP00000386921:p.Ala266Thr	Somatic		Capture	Illumina GAIIx	4	7020005	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	superfamily_Ypt/Rab-GAP domain of gyp1p,HMMSmart_SM00164,HMMPfam_TBC	p.A251T	ENST00000409757.4	37	c.751	CCDS3394.2	4	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323729	0.24080	.	.	ENSG00000132405	ENST00000448507;ENST00000409757;ENST00000410031	T;T;T	0.04970	3.64;3.64;3.52	5.61	2.97	0.34412	.	0.770342	0.11821	N	0.526252	T	0.04048	0.0113	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.38478	-0.9659	10	0.45353	T	0.12	-3.6022	5.4117	0.16352	0.1668:0.0:0.673:0.1602	.	266	Q9P2M4	TBC14_HUMAN	T	266;266;38	ENSP00000404041:A266T;ENSP00000386921:A266T;ENSP00000386343:A38T	ENSP00000386921:A266T	A	+	1	0	TBC1D14	7020005	1.000000	0.71417	0.468000	0.27192	0.153000	0.21895	1.702000	0.37836	0.324000	0.23333	-0.224000	0.12420	GCG	-	NULL		0.398	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D14	protein_coding	OTTHUMT00000206981.3	G	NM_020773		7020005	+1	no_errors	NM_020773	genbank	human	validated	54_36p	missense	SNP	0.624	A
TP53	7157	genome.wustl.edu	37	17	7578404	7578404	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr17:7578404A>T	ENST00000269305.4	-	5	715	c.526T>A	c.(526-528)Tgc>Agc	p.C176S	TP53_ENST00000445888.2_Missense_Mutation_p.C176S|TP53_ENST00000359597.4_Missense_Mutation_p.C176S|TP53_ENST00000413465.2_Missense_Mutation_p.C176S|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.C176S|TP53_ENST00000420246.2_Missense_Mutation_p.C176S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176S(10)|p.C176R(8)|p.0?(8)|p.C176fs*71(7)|p.C176G(6)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C176fs*5(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.C44G(1)|p.R42fs*24(1)|p.C176fs*72(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.C83G(1)|p.C176fs*6(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGGGGGCAGCGCCTCACA	0.647		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	80	Substitution - Missense(26)|Deletion - Frameshift(25)|Deletion - In frame(13)|Whole gene deletion(8)|Insertion - Frameshift(5)|Complex - deletion inframe(3)	breast(18)|haematopoietic_and_lymphoid_tissue(13)|oesophagus(10)|upper_aerodigestive_tract(8)|large_intestine(8)|stomach(4)|lung(4)|liver(4)|bone(4)|central_nervous_system(3)|ovary(2)|biliary_tract(1)|prostate(1)	17											49.0	49.0	49.0					17																	7578404		2203	4300	6503	7519129	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.526T>A	17.37:g.7578404A>T	ENSP00000269305:p.Cys176Ser	Somatic		Capture	Illumina GAIIx	4	7519129	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.C176S	ENST00000269305.4	37	c.526	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	31	5.093655	0.94149	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61;-10.61	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	P;P;P;P;P;P;P	0.49253	0.869;0.654;0.767;0.866;0.921;0.703;0.81	D;P;P;D;P;P;P	0.67103	0.949;0.536;0.6;0.933;0.699;0.594;0.813	D	0.94964	0.8111	10	0.87932	D	0	-18.1821	14.037	0.64651	1.0:0.0:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176S;ENSP00000352610:C176S;ENSP00000269305:C176S;ENSP00000398846:C176S;ENSP00000391127:C176S;ENSP00000391478:C176S;ENSP00000425104:C44S;ENSP00000423862:C83S	ENSP00000269305:C176S	C	-	1	0	TP53	7519129	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	9.287000	0.95975	2.263000	0.75096	0.533000	0.62120	TGC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.647	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		7519129	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PLCB1	23236	genome.wustl.edu	37	20	8782734	8782734	+	Intron	SNP	C	C	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr20:8782734C>G	ENST00000338037.6	+	31	3450				PLCB1_ENST00000378641.3_Missense_Mutation_p.T1152S|PLCB1_ENST00000378637.2_Missense_Mutation_p.T1152S	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)						activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TTGTCGGAAACTTGCCATGAG	0.502																																																0			20											116.0	97.0	103.0					20																	8782734		2203	4300	6503	8730734	SO:0001627	intron_variant	23236			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.3423+11826C>G	20.37:g.8782734C>G		Somatic		Capture	Illumina GAIIx	4	8730734	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	superfamily_EF-hand,HMMPfam_efhand_like,HMMSmart_SM00148,HMMPfam_PI-PLC-X,superfamily_PLC-like phosphodiesterases,HMMPfam_PI-PLC-Y,HMMSmart_SM00149,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,HMMPfam_PLC-beta_C	p.T1152S	ENST00000338037.6	37	c.3455	CCDS13102.1	20	.	.	.	.	.	.	.	.	.	.	C	8.568	0.879373	0.17467	.	.	ENSG00000182621	ENST00000378641;ENST00000378637;ENST00000535719	T;T	0.17370	2.28;2.28	5.87	1.32	0.21799	.	.	.	.	.	T	0.12263	0.0298	N	0.22421	0.69	0.19775	N	0.999951	B	0.02656	0.0	B	0.04013	0.001	T	0.29397	-1.0013	9	0.13108	T	0.6	.	16.7332	0.85440	0.0:0.3754:0.6246:0.0	.	1152	Q9NQ66-2	.	S	1152;1152;1072	ENSP00000367908:T1152S;ENSP00000367904:T1152S	ENSP00000367904:T1152S	T	+	2	0	PLCB1	8730734	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	0.832000	0.27490	0.073000	0.16731	0.655000	0.94253	ACT	-	HMMPfam_PLC-beta_C		0.502	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCB1	protein_coding	OTTHUMT00000077938.3	C			8730734	+1	no_errors	NM_182734	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
A2ML1	144568	genome.wustl.edu	37	12	9021759	9021759	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:9021759T>C	ENST00000299698.7	+	33	4361	c.4181T>C	c.(4180-4182)gTt>gCt	p.V1394A	A2ML1_ENST00000539547.1_Missense_Mutation_p.V903A	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						GTGAAGAAGGTTGAATTTGGA	0.448																																																0			12											196.0	189.0	191.0					12																	9021759		1865	4096	5961	8913026	SO:0001583	missense	144568			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.4181T>C	12.37:g.9021759T>C	ENSP00000299698:p.Val1394Ala	Somatic		Capture	Illumina GAIIx	4	8913026		Missense_Mutation	SNP	HMMPfam_A2M_N,HMMPfam_A2M_N_2,HMMPfam_A2M,superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_Thiol-ester_cl,PatternScan_ALPHA_2_MACROGLOBULIN,HMMPfam_A2M_comp,superfamily_Alpha-macroglobulin receptor domain,HMMPfam_A2M_recep	p.V1394A	ENST00000299698.7	37	c.4181	CCDS8596.2	12	.	.	.	.	.	.	.	.	.	.	T	15.71	2.914029	0.52546	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547	T;T;T	0.24908	1.83;1.83;1.83	3.9	3.9	0.45041	Alpha-macroglobulin, receptor-binding (3);	0.519165	0.15916	N	0.238393	T	0.33381	0.0861	M	0.63428	1.95	0.24140	N	0.995732	P	0.37663	0.604	P	0.46452	0.517	T	0.15492	-1.0435	10	0.48119	T	0.1	.	7.5906	0.28019	0.0:0.0:0.2175:0.7825	.	1394	A8K2U0	A2ML1_HUMAN	A	1394;1394;944;903	ENSP00000299698:V1394A;ENSP00000443174:V944A;ENSP00000438292:V903A	ENSP00000299698:V1394A	V	+	2	0	A2ML1	8913026	0.939000	0.31865	1.000000	0.80357	0.945000	0.59286	1.096000	0.30976	1.983000	0.57843	0.533000	0.62120	GTT	-	superfamily_Alpha-macroglobulin receptor domain,HMMPfam_A2M_recep		0.448	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2ML1	protein_coding	OTTHUMT00000250304.3	T	NM_144670		8913026	+1	no_errors	NM_144670	genbank	human	validated	54_36p	missense	SNP	0.999	C
KLRG1	10219	genome.wustl.edu	37	12	9161608	9161608	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:9161608G>T	ENST00000266551.4	+	4	410	c.395G>T	c.(394-396)tGg>tTg	p.W132L	KLRG1_ENST00000538029.1_3'UTR|KLRG1_ENST00000356986.3_Missense_Mutation_p.W132L	NM_005810.3	NP_005801.3	Q96E93	KLRG1_HUMAN	killer cell lectin-like receptor subfamily G, member 1	132	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|kidney(1)|lung(3)|pancreas(1)|upper_aerodigestive_tract(1)	8						GCCTTTTGCTGGATTGGTCTG	0.448																																																0			12											94.0	93.0	93.0					12																	9161608		2203	4300	6503	9052875	SO:0001583	missense	10219			AF097358	CCDS8599.1	12p13.31	2011-08-30			ENSG00000139187	ENSG00000139187		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	6380	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member A"""	604874				9862378, 9842918, 16461340, 16140789	Standard	NM_005810		Approved	MAFA, 2F1, MAFA-L, CLEC15A	uc001qvg.3	Q96E93		ENST00000266551.4:c.395G>T	12.37:g.9161608G>T	ENSP00000266551:p.Trp132Leu	Somatic		Capture	Illumina GAIIx	4	9052875	B7ZAM2|O43198|O75613	Missense_Mutation	SNP	superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C	p.W132L	ENST00000266551.4	37	c.395		12	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062281	0.36373	.	.	ENSG00000139187	ENST00000539240;ENST00000356986;ENST00000266551;ENST00000543895	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	3.61	3.61	0.41365	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.43110	D	0.000618	T	0.78483	0.4290	H	0.96547	3.84	0.39197	D	0.963074	D;D	0.89917	1.0;0.996	D;P	0.75020	0.985;0.871	D	0.84946	0.0868	10	0.87932	D	0	-4.0638	11.0518	0.47894	0.0:0.0:1.0:0.0	.	132;132	Q96E93;Q96E93-2	KLRG1_HUMAN;.	L	53;132;132;53	ENSP00000445627:W53L;ENSP00000349477:W132L;ENSP00000266551:W132L;ENSP00000443658:W53L	ENSP00000266551:W132L	W	+	2	0	KLRG1	9052875	1.000000	0.71417	0.988000	0.46212	0.008000	0.06430	3.508000	0.53378	2.279000	0.76181	0.643000	0.83706	TGG	-	superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C		0.448	KLRG1-002	KNOWN	basic	protein_coding	KLRG1	protein_coding	OTTHUMT00000399145.1	G	NM_005810		9052875	+1	no_errors	NM_005810	genbank	human	reviewed	54_36p	missense	SNP	0.852	T
MYH8	4626	genome.wustl.edu	37	17	10293812	10293812	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr17:10293812C>G	ENST00000403437.2	-	40	5867	c.5773G>C	c.(5773-5775)Gtg>Ctg	p.V1925L	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1925					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CGGCTCTTCACTCGCAATTTG	0.473									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																							0			17											151.0	144.0	146.0					17																	10293812		2203	4300	6503	10234537	SO:0001583	missense	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.5773G>C	17.37:g.10293812C>G	ENSP00000384330:p.Val1925Leu	Somatic		Capture	Illumina GAIIx	4	10234537	Q14910	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.V1925L	ENST00000403437.2	37	c.5773	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109803	0.77096	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.77620	-1.11	5.05	5.05	0.67936	Myosin tail (1);	0.000000	0.37577	U	0.002029	T	0.72366	0.3451	L	0.39020	1.185	0.47245	D	0.999364	B	0.06786	0.001	B	0.16289	0.015	T	0.69491	-0.5131	10	0.87932	D	0	.	18.6098	0.91281	0.0:1.0:0.0:0.0	.	1925	P13535	MYH8_HUMAN	L	1925	ENSP00000384330:V1925L	ENSP00000252173:V1925L	V	-	1	0	MYH8	10234537	0.980000	0.34600	1.000000	0.80357	0.945000	0.59286	5.882000	0.69714	2.621000	0.88768	0.650000	0.86243	GTG	-	HMMPfam_Myosin_tail_1		0.473	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	protein_coding	OTTHUMT00000252724.2	C	NM_002472		10234537	-1	no_errors	NM_002472	genbank	human	validated	54_36p	missense	SNP	1.000	G
ATP2B2	491	genome.wustl.edu	37	3	10417120	10417120	+	Silent	SNP	C	C	T	rs556206364		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:10417120C>T	ENST00000352432.4	-	10	1479	c.1410G>A	c.(1408-1410)tcG>tcA	p.S470S	ATP2B2_ENST00000343816.4_Silent_p.S456S|ATP2B2_ENST00000383800.4_Silent_p.S425S|ATP2B2_ENST00000397077.1_Silent_p.S425S|ATP2B2_ENST00000360273.2_Silent_p.S470S			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	470					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						TCACCTTCACCGAATAGGCCA	0.622																																					Ovarian(125;1619 1709 15675 19819 38835)											0			3											48.0	53.0	51.0					3																	10417120		2203	4300	6503	10392120	SO:0001819	synonymous_variant	491			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1410G>A	3.37:g.10417120C>T		Somatic		Capture	Illumina GAIIx	4	10392120	O00766|Q12994|Q16818	Silent	SNP	HMMPfam_Cation_ATPase_N,superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,HMMPfam_Hydrolase,superfamily_HAD-like,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Cation_ATPase_C	p.S470	ENST00000352432.4	37	c.1410	CCDS33701.1	3																																																																																			-	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase		0.622	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	protein_coding	OTTHUMT00000250576.2	C	NM_001683		10392120	-1	no_errors	NM_001001331	genbank	human	reviewed	54_36p	silent	SNP	0.704	T
IMPA2	3613	genome.wustl.edu	37	18	12028084	12028084	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr18:12028084G>T	ENST00000269159.3	+	6	775	c.533G>T	c.(532-534)cGt>cTt	p.R178L	IMPA2_ENST00000588752.1_3'UTR|IMPA2_ENST00000588927.1_5'UTR|IMPA2_ENST00000589238.1_5'UTR	NM_014214.2	NP_055029.1	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2	178					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)|stomach(2)|urinary_tract(1)	12					Lithium(DB01356)	GGCCCCAAACGTGACCCTGCG	0.507																																																0			18											125.0	112.0	117.0					18																	12028084		2203	4300	6503	12018084	SO:0001583	missense	3613			AF014398	CCDS11855.1	18p11.2	2008-03-18			ENSG00000141401	ENSG00000141401	3.1.3.25		6051	protein-coding gene	gene with protein product		605922				9322233	Standard	NM_014214		Approved		uc002kqp.2	O14732	OTTHUMG00000131693	ENST00000269159.3:c.533G>T	18.37:g.12028084G>T	ENSP00000269159:p.Arg178Leu	Somatic		Capture	Illumina GAIIx	4	12018084	B0YJ29|Q9UJT3	Missense_Mutation	SNP	HMMPfam_Inositol_P,superfamily_Carbohydrate phosphatase,PatternScan_IMP_1,PatternScan_IMP_2	p.R178L	ENST00000269159.3	37	c.533	CCDS11855.1	18	.	.	.	.	.	.	.	.	.	.	G	15.35	2.806387	0.50421	.	.	ENSG00000141401	ENST00000269159	T	0.44083	0.93	5.84	5.84	0.93424	.	0.115998	0.56097	D	0.000028	T	0.48696	0.1514	M	0.76938	2.355	0.80722	D	1	P;B	0.43788	0.817;0.404	B;B	0.37047	0.24;0.223	T	0.58858	-0.7562	10	0.87932	D	0	-12.6218	20.1434	0.98067	0.0:0.0:1.0:0.0	.	151;178	O14732-2;O14732	.;IMPA2_HUMAN	L	178	ENSP00000269159:R178L	ENSP00000269159:R178L	R	+	2	0	IMPA2	12018084	1.000000	0.71417	0.930000	0.37139	0.316000	0.28119	5.290000	0.65661	2.769000	0.95229	0.563000	0.77884	CGT	-	HMMPfam_Inositol_P,superfamily_Carbohydrate phosphatase		0.507	IMPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPA2	protein_coding	OTTHUMT00000254601.1	G			12018084	+1	no_errors	NM_014214	genbank	human	validated	54_36p	missense	SNP	0.890	T
HOOK2	29911	genome.wustl.edu	37	19	12881807	12881807	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:12881807G>A	ENST00000397668.3	-	10	914	c.841C>T	c.(841-843)Cag>Tag	p.Q281*	HOOK2_ENST00000264827.5_Nonsense_Mutation_p.Q281*|HOOK2_ENST00000589965.1_Intron	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	281	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						GTCAGCGCCTGGTTCCGGTGC	0.667																																																0			19											32.0	38.0	36.0					19																	12881807		2060	4197	6257	12742807	SO:0001587	stop_gained	29911			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.841C>T	19.37:g.12881807G>A	ENSP00000380785:p.Gln281*	Somatic		Capture	Illumina GAIIx	4	12742807	O60562	Nonsense_Mutation	SNP	HMMPfam_HOOK	p.Q281*	ENST00000397668.3	37	c.841	CCDS42508.1	19	.	.	.	.	.	.	.	.	.	.	g	38	6.679202	0.97755	.	.	ENSG00000095066	ENST00000397668;ENST00000264827	.	.	.	4.8	4.8	0.61643	.	0.401902	0.25151	N	0.032760	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-26.8779	13.1222	0.59334	0.0:0.1624:0.8376:0.0	.	.	.	.	X	281	.	ENSP00000264827:Q281X	Q	-	1	0	HOOK2	12742807	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.630000	0.54273	2.224000	0.72417	0.454000	0.30748	CAG	-	HMMPfam_HOOK		0.667	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	protein_coding	OTTHUMT00000451008.1	G	NM_013312		12742807	-1	no_errors	NM_013312	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
PRAMEF12	390999	genome.wustl.edu	37	1	12835036	12835036	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:12835036T>A	ENST00000357726.4	+	1	53	c.26T>A	c.(25-27)cTc>cAc	p.L9H		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	9					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCACCTAGACTCCTGGAGCTG	0.547																																																0			1											47.0	55.0	52.0					1																	12835036		2193	4300	6493	12757623	SO:0001583	missense	390999				CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.26T>A	1.37:g.12835036T>A	ENSP00000350358:p.Leu9His	Somatic		Capture	Illumina GAIIx	4	12757623		Missense_Mutation	SNP	superfamily_SSF52047	p.L9H	ENST00000357726.4	37	c.26	CCDS41254.1	1	.	.	.	.	.	.	.	.	.	.	.	14.61	2.587380	0.46110	.	.	ENSG00000116726	ENST00000357726	T	0.06218	3.33	2.56	2.56	0.30785	.	0.000000	0.64402	D	0.000011	T	0.29423	0.0733	M	0.94063	3.49	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.06935	-1.0799	10	0.87932	D	0	.	8.9133	0.35565	0.0:0.0:0.0:1.0	.	9	O95522	PRA12_HUMAN	H	9	ENSP00000350358:L9H	ENSP00000350358:L9H	L	+	2	0	PRAMEF12	12757623	0.167000	0.22975	0.008000	0.14137	0.186000	0.23388	2.546000	0.45778	1.406000	0.46857	0.164000	0.16699	CTC	-	NULL		0.547	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF12	protein_coding	OTTHUMT00000005457.1	T	XM_372760		12757623	+1	no_errors	NM_001080830	genbank	human	provisional	54_36p	missense	SNP	0.197	A
ZNF355P	100505852	genome.wustl.edu	37	21	14469741	14469741	+	IGR	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr21:14469741T>A								RNU6-614P (49731 upstream) : AL050302.1 (272189 downstream)																							GAAGATTGCTTAAAGGCTTTG	0.378																																																0			21																																								13391612	SO:0001628	intergenic_variant	0																															21.37:g.14469741T>A		Somatic		Capture	Illumina GAIIx	4	13391612		Nonsense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.K78*		37	c.232		21																																																																																			-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	0	0.378					ZNF834			T			13391612	-1	no_start_codon	ENST00000305570	ensembl	human	known	54_36p	nonsense	SNP	0.023	A
NBEAP3	100418905	genome.wustl.edu	37	22	16123793	16123793	+	IGR	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr22:16123793G>A								LA16c-4G1.3 (60557 upstream) : AP000525.9 (24185 downstream)																							CGCCTTCCACGCCCTTCCGAT	0.672																																																0			22																																								14503793	SO:0001628	intergenic_variant	729057																															22.37:g.16123793G>A		Somatic		Capture	Illumina GAIIx	4	14503793		RNA	SNP	-	NULL		37	NULL		22																																																																																			-	-	0	0.672					LOC729057			G			14503793	+1	no_errors	XR_042044	genbank	human	model	54_36p	rna	SNP	0.001	A
Unknown	0	genome.wustl.edu	37	19	14975330	14975330	+	IGR	SNP	C	C	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:14975330C>G								OR7A10 (22641 upstream) : OR7A17 (15807 downstream)																							CTACGAAGGACAGGTTGGAGA	0.517																																																0			19																																								14836330	SO:0001628	intergenic_variant	0																															19.37:g.14975330C>G		Somatic		Capture	Illumina GAIIx	4	14836330		Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.L66		37	c.198		19																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	0	0.517					OR7A2P			C			14836330	-1	no_start_codon	ENST00000304105	ensembl	human	known	54_36p	silent	SNP	0.005	G
PIK3R2	5296	genome.wustl.edu	37	19	18273867	18273867	+	Silent	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:18273867C>T	ENST00000593731.1	+	10	1760	c.1200C>T	c.(1198-1200)gaC>gaT	p.D400D	PIK3R2_ENST00000222254.8_Silent_p.D400D			O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2 (beta)	400	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	phosphatidylinositol 3-kinase regulator activity (GO:0035014)|receptor tyrosine kinase binding (GO:0030971)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(3)|pancreas(1)|stomach(1)	24					Isoprenaline(DB01064)	CCGTTGTGGACCTCATCAATC	0.567																																																0			19											120.0	94.0	103.0					19																	18273867		2203	4300	6503	18134867	SO:0001819	synonymous_variant	5296				CCDS12371.1	19p13.11	2013-03-28	2008-02-04		ENSG00000105647	ENSG00000105647		"""SH2 domain containing"""	8980	protein-coding gene	gene with protein product		603157				1314371	Standard	NM_005027		Approved	P85B, p85	uc002nia.2	O00459	OTTHUMG00000183383	ENST00000593731.1:c.1200C>T	19.37:g.18273867C>T		Somatic		Capture	Illumina GAIIx	4	18134867	Q5EAT5|Q9UPH9	Silent	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP,superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2	p.D400	ENST00000593731.1	37	c.1200	CCDS12371.1	19																																																																																			-	superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2		0.567	PIK3R2-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	PIK3R2	protein_coding	OTTHUMT00000466386.2	C	NM_005027		18134867	+1	no_errors	NM_005027	genbank	human	validated	54_36p	silent	SNP	0.833	T
NAT2	10	genome.wustl.edu	37	8	18257940	18257940	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr8:18257940C>T	ENST00000286479.3	+	2	534	c.427C>T	c.(427-429)Cag>Tag	p.Q143*	NAT2_ENST00000520116.1_Nonsense_Mutation_p.Q13*	NM_000015.2	NP_000006.2	P11245	ARY2_HUMAN	N-acetyltransferase 2 (arylamine N-acetyltransferase)	143					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	arylamine N-acetyltransferase activity (GO:0004060)			kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(2)	12				Colorectal(111;0.0531)|COAD - Colon adenocarcinoma(73;0.21)	Acetaminophen(DB00316)|Clonazepam(DB01068)|Dapsone(DB00250)|Ezogabine(DB04953)|Isoniazid(DB00951)|Sulfamethoxazole(DB01015)	TGGGAAGGATCAGCCTCAGGT	0.473									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																																							0			8											62.0	65.0	64.0					8																	18257940		2203	4300	6503	18302220	SO:0001587	stop_gained	10	Familial Cancer Database	incl.: Familial Head and Neck Cancer	D90042	CCDS6008.1	8p22	2012-01-18			ENSG00000156006	ENSG00000156006	2.3.1.5		7646	protein-coding gene	gene with protein product		612182		AAC2		7773298	Standard	NM_000015		Approved		uc003wyw.1	P11245	OTTHUMG00000130826	ENST00000286479.3:c.427C>T	8.37:g.18257940C>T	ENSP00000286479:p.Gln143*	Somatic		Capture	Illumina GAIIx	4	18302220	O43637|O60654|O60655|Q13146|Q16697|Q2MLE4|Q2MLF5|Q2MLG8|Q2MLJ6|Q2MLK4|Q2MLK6|Q2MLN7|Q6LET4|Q86XS0|Q86XS1|Q96KY8|Q96T64|Q96T65|Q9H220	Nonsense_Mutation	SNP	superfamily_SSF54001,HMMPfam_Acetyltransf_2	p.Q143*	ENST00000286479.3	37	c.427	CCDS6008.1	8	.	.	.	.	.	.	.	.	.	.	C	14.87	2.665551	0.47677	.	.	ENSG00000156006	ENST00000286479;ENST00000520116	.	.	.	2.95	2.95	0.34219	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.6078	0.39643	0.0:1.0:0.0:0.0	.	.	.	.	X	143;13	.	ENSP00000286479:Q143X	Q	+	1	0	NAT2	18302220	1.000000	0.71417	0.997000	0.53966	0.264000	0.26372	4.621000	0.61233	1.947000	0.56498	0.436000	0.28706	CAG	-	superfamily_SSF54001,HMMPfam_Acetyltransf_2		0.473	NAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT2	protein_coding	OTTHUMT00000253380.1	C	NM_000015		18302220	+1	no_errors	NM_000015	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
GJA3	2700	genome.wustl.edu	37	13	20717150	20717150	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr13:20717150A>G	ENST00000241125.3	-	2	454	c.278T>C	c.(277-279)cTg>cCg	p.L93P		NM_021954.3	NP_068773.2	Q9Y6H8	CXA3_HUMAN	gap junction protein, alpha 3, 46kDa	93					cell-cell signaling (GO:0007267)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			NS(1)|endometrium(1)|kidney(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		all_cancers(29;1.4e-21)|all_epithelial(30;8.75e-19)|all_lung(29;1.28e-17)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000554)|Epithelial(112;0.000872)|OV - Ovarian serous cystadenocarcinoma(117;0.0105)|Lung(94;0.0251)|LUSC - Lung squamous cell carcinoma(192;0.0784)		CACGTGGCCCAGGTAGATGAG	0.617																																																0			13											67.0	60.0	62.0					13																	20717150		2203	4300	6503	19615150	SO:0001583	missense	2700			AF075290	CCDS9289.1	13q12.11	2008-02-05	2007-01-16		ENSG00000121743	ENSG00000121743		"""Ion channels / Gap junction proteins (connexins)"""	4277	protein-coding gene	gene with protein product	"""connexin 46"""	121015	"""gap junction protein, alpha 3, 46kD (connexin 46)"", ""gap junction protein, alpha 3, 46kDa (connexin 46)"""	CZP3		10205266, 7342922	Standard	NM_021954		Approved	CX46	uc001umx.1	Q9Y6H8	OTTHUMG00000016510	ENST00000241125.3:c.278T>C	13.37:g.20717150A>G	ENSP00000241125:p.Leu93Pro	Somatic		Capture	Illumina GAIIx	4	19615150	Q0VAB7|Q9H537	Missense_Mutation	SNP	HMMPfam_Connexin,HMMSmart_SM00037,PatternScan_CONNEXINS_1,HMMPfam_Connexin_CCC,PatternScan_CONNEXINS_2	p.L93P	ENST00000241125.3	37	c.278	CCDS9289.1	13	.	.	.	.	.	.	.	.	.	.	A	23.3	4.404148	0.83230	.	.	ENSG00000121743	ENST00000241125	D	0.99298	-5.71	5.36	5.36	0.76844	Connexin, N-terminal (1);	0.000000	0.64402	D	0.000005	D	0.99302	0.9756	M	0.83774	2.66	0.80722	D	1	D	0.59357	0.985	P	0.61328	0.887	D	0.98928	1.0786	10	0.87932	D	0	.	15.363	0.74496	1.0:0.0:0.0:0.0	.	93	Q9Y6H8	CXA3_HUMAN	P	93	ENSP00000241125:L93P	ENSP00000241125:L93P	L	-	2	0	GJA3	19615150	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.213000	0.95133	2.037000	0.60232	0.459000	0.35465	CTG	-	HMMPfam_Connexin		0.617	GJA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA3	protein_coding	OTTHUMT00000044059.3	A	NM_021954		19615150	-1	no_errors	NM_021954	genbank	human	validated	54_36p	missense	SNP	1.000	G
OR4K17	390436	genome.wustl.edu	37	14	20586395	20586395	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr14:20586395T>C	ENST00000315543.4	+	1	830	c.830T>C	c.(829-831)gTg>gCg	p.V277A		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		CACATCACAGTGGTGATTCTC	0.433																																																0			14											141.0	127.0	132.0					14																	20586395		2203	4300	6503	19656235	SO:0001583	missense	390436				CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.830T>C	14.37:g.20586395T>C	ENSP00000319197:p.Val277Ala	Somatic		Capture	Illumina GAIIx	4	19656235	Q6IF12	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V277A	ENST00000315543.4	37	c.830	CCDS32030.1	14	.	.	.	.	.	.	.	.	.	.	.	16.23	3.065165	0.55432	.	.	ENSG00000176230	ENST00000315543	T	0.00237	8.47	2.86	2.86	0.33363	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30969	U	0.008505	T	0.00328	0.0010	M	0.72479	2.2	0.22034	N	0.999406	P	0.49635	0.926	P	0.51999	0.687	T	0.41858	-0.9485	10	0.87932	D	0	.	10.2538	0.43385	0.0:0.0:0.0:1.0	.	249	Q8NGC6	OR4KH_HUMAN	A	277	ENSP00000319197:V277A	ENSP00000319197:V277A	V	+	2	0	OR4K17	19656235	0.072000	0.21174	0.968000	0.41197	0.884000	0.51177	1.446000	0.35090	1.292000	0.44672	0.332000	0.21555	GTG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.433	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K17	protein_coding	OTTHUMT00000410346.1	T			19656235	+1	no_errors	NM_001004715	genbank	human	provisional	54_36p	missense	SNP	0.250	C
RPGRIP1	57096	genome.wustl.edu	37	14	21762967	21762967	+	Splice_Site	SNP	A	A	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr14:21762967A>T	ENST00000400017.2	+	2	217	c.217A>T	c.(217-219)Agg>Tgg	p.R73W	RPGRIP1_ENST00000206660.6_Splice_Site_p.R73W|RPGRIP1_ENST00000556336.1_Splice_Site_p.R73W|RPGRIP1_ENST00000557771.1_Splice_Site_p.R73W	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	73					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)				breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		TGAGATCAAAAGGTACTTAGA	0.413																																																0			14											48.0	46.0	47.0					14																	21762967		1838	4079	5917	20832807	SO:0001630	splice_region_variant	57096			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.218+1A>T	14.37:g.21762967A>T		Somatic		Capture	Illumina GAIIx	4	20832807	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Missense_Mutation	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_C2	p.R73W	ENST00000400017.2	37	c.217	CCDS45080.1	14	.	.	.	.	.	.	.	.	.	.	A	23.1	4.378055	0.82682	.	.	ENSG00000092200	ENST00000556336;ENST00000557771;ENST00000400017;ENST00000206660	D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36	4.66	4.66	0.58398	.	0.127627	0.51477	D	0.000096	D	0.91412	0.7290	L	0.61218	1.895	0.80722	D	1	D	0.71674	0.998	P	0.60173	0.87	D	0.91793	0.5445	10	0.72032	D	0.01	-1.516	10.4191	0.44340	1.0:0.0:0.0:0.0	.	73	Q96KN7	RPGR1_HUMAN	W	73	ENSP00000450445:R73W;ENSP00000451219:R73W;ENSP00000382895:R73W;ENSP00000206660:R73W	ENSP00000206660:R73W	R	+	1	2	RPGRIP1	20832807	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.004000	0.49513	1.967000	0.57214	0.459000	0.35465	AGG	-	NULL		0.413	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPGRIP1	protein_coding	OTTHUMT00000410258.1	A	NM_020366	Missense_Mutation	20832807	+1	no_errors	NM_020366	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
IGLC7	28834	genome.wustl.edu	37	22	23264888	23264888	+	RNA	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr22:23264888T>A	ENST00000390331.2	+	0	123				IGLJ7_ENST00000390330.2_RNA			A0M8Q6	LAC7_HUMAN	immunoglobulin lambda constant 7						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										GACAGTGGCCTGGAAGGCAGA	0.582																																																0			22											74.0	79.0	78.0					22																	23264888		2202	4299	6501	21594888			0			X51755		22q11.2	2012-02-08			ENSG00000211685	ENSG00000211685		"""Immunoglobulins / IGL locus"""	5861	other	immunoglobulin gene							Standard	NG_000002		Approved			A0M8Q6	OTTHUMG00000151017		22.37:g.23264888T>A		Somatic		Capture	Illumina GAIIx	4	21594888		Silent	SNP	superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407,PatternScan_IG_MHC	p.P41	ENST00000390331.2	37	c.123		22																																																																																			-	superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407		0.582	IGLC7-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	ENSG00000211685	IG_C_gene	OTTHUMT00000320966.4	T	NG_000002		21594888	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390331	ensembl	human	known	54_36p	silent	SNP	0.998	A
ABCC9	10060	genome.wustl.edu	37	12	21968763	21968763	+	Silent	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:21968763G>A	ENST00000261201.4	-	32	3956	c.3957C>T	c.(3955-3957)gtC>gtT	p.V1319V	ABCC9_ENST00000345162.2_Silent_p.V1283V|ABCC9_ENST00000261200.4_Silent_p.V1319V	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1319	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TTTCATATCTGACACACAGAT	0.398																																																0			12											164.0	147.0	153.0					12																	21968763		2203	4300	6503	21860030	SO:0001819	synonymous_variant	10060			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.3957C>T	12.37:g.21968763G>A		Somatic		Capture	Illumina GAIIx	4	21860030	O60707	Silent	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.V1319	ENST00000261201.4	37	c.3957	CCDS8694.1	12																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.398	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	protein_coding	OTTHUMT00000402230.1	G	NM_005691		21860030	-1	no_errors	NM_005691	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
PRDM9	56979	genome.wustl.edu	37	5	23509630	23509630	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:23509630G>A	ENST00000296682.3	+	3	303	c.121G>A	c.(121-123)Gca>Aca	p.A41T		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	41	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGAAGAATGGGCAGAGATGGG	0.423										HNSCC(3;0.000094)																																						0			5											210.0	197.0	201.0					5																	23509630		1867	4116	5983	23545387	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.121G>A	5.37:g.23509630G>A	ENSP00000296682:p.Ala41Thr	Somatic		Capture	Illumina GAIIx	4	23545387	B4DX22|Q27Q50	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMSmart_KRAB,HMMPfam_KRAB,HMMPfam_SSXRD,superfamily_SSF82199,HMMSmart_SET,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667,HMMPfam_zf-C2H2	p.A41T	ENST00000296682.3	37	c.121	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975414	0.34848	.	.	ENSG00000164256	ENST00000502755;ENST00000296682	T;T	0.01821	4.62;4.62	2.76	-0.221	0.13126	Krueppel-associated box-related (1);Krueppel-associated box (3);	.	.	.	.	T	0.01730	0.0055	L	0.37561	1.115	0.23204	N	0.998127	B	0.24920	0.114	B	0.21917	0.037	T	0.44574	-0.9319	9	0.46703	T	0.11	.	5.9971	0.19499	0.3207:0.0:0.6793:0.0	.	41	Q9NQV7	PRDM9_HUMAN	T	41	ENSP00000425471:A41T;ENSP00000296682:A41T	ENSP00000296682:A41T	A	+	1	0	PRDM9	23545387	0.998000	0.40836	0.958000	0.39756	0.921000	0.55340	0.670000	0.25157	-0.070000	0.12908	0.609000	0.83330	GCA	-	superfamily_Krueppel-associated_box,HMMSmart_KRAB,HMMPfam_KRAB		0.423	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	protein_coding	OTTHUMT00000366375.1	G	NM_020227		23545387	+1	no_errors	NM_020227	genbank	human	provisional	54_36p	missense	SNP	0.713	A
PRKCB	5579	genome.wustl.edu	37	16	24202411	24202411	+	Splice_Site	SNP	C	C	T	rs201555288		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr16:24202411C>T	ENST00000321728.7	+	16	1898	c.1723C>T	c.(1723-1725)Ctg>Ttg	p.L575L	PRKCB_ENST00000303531.7_Splice_Site_p.L575L	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	575	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TCTCTCGAAGCTGATGACCAA	0.408																																																0			16											73.0	72.0	72.0					16																	24202411		2197	4300	6497	24109912	SO:0001630	splice_region_variant	5579			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1723-1C>T	16.37:g.24202411C>T		Somatic		Capture	Illumina GAIIx	4	24109912	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_SM00133,HMMPfam_Pkinase_C	p.L575	ENST00000321728.7	37	c.1723	CCDS10618.1	16																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.408	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	protein_coding	OTTHUMT00000254504.2	C	NM_212535	Silent	24109912	+1	no_errors	NM_002738	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
PDK3	5165	genome.wustl.edu	37	X	24546201	24546201	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:24546201C>A	ENST00000379162.4	+	9	1096	c.861C>A	c.(859-861)gaC>gaA	p.D287E	PDK3_ENST00000441463.2_Missense_Mutation_p.D287E	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3	287	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						AGATCAGTGACCTAGGTGGTG	0.408																																																0			X											120.0	95.0	103.0					X																	24546201		2203	4300	6503	24456122	SO:0001583	missense	5165			L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.861C>A	X.37:g.24546201C>A	ENSP00000368460:p.Asp287Glu	Somatic		Capture	Illumina GAIIx	4	24456122	B4DXG6	Missense_Mutation	SNP	superfamily_SSF69012,HMMPfam_BCDHK_Adom3,superfamily_ATP_bd_ATPase,HMMPfam_HATPase_c,HMMSmart_HATPase_c	p.D287E	ENST00000379162.4	37	c.861	CCDS14212.1	X	.	.	.	.	.	.	.	.	.	.	C	15.70	2.910586	0.52439	.	.	ENSG00000067992	ENST00000379162;ENST00000441463	D;D	0.94966	-3.57;-3.57	4.97	4.97	0.65823	Signal transduction histidine kinase, core (1);ATPase-like, ATP-binding domain (4);	0.044787	0.85682	D	0.000000	D	0.98554	0.9517	H	0.99967	5.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.97540	1.0085	10	0.87932	D	0	.	7.6734	0.28471	0.0:0.7567:0.0:0.2432	.	287;287	B4DXG6;Q15120	.;PDK3_HUMAN	E	287	ENSP00000368460:D287E;ENSP00000387536:D287E	ENSP00000368460:D287E	D	+	3	2	PDK3	24456122	0.997000	0.39634	0.995000	0.50966	0.511000	0.34104	1.642000	0.37207	2.305000	0.77605	0.513000	0.50165	GAC	-	superfamily_ATP_bd_ATPase,HMMPfam_HATPase_c,HMMSmart_HATPase_c		0.408	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK3	protein_coding	OTTHUMT00000056097.1	C	NM_005391		24456122	+1	no_errors	NM_005391	genbank	human	validated	54_36p	missense	SNP	0.991	A
CCL11	6356	genome.wustl.edu	37	17	32612890	32612890	+	Silent	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr17:32612890G>T	ENST00000305869.3	+	1	204	c.63G>T	c.(61-63)ggG>ggT	p.G21G		NM_002986.2	NP_002977.1	P51671	CCL11_HUMAN	chemokine (C-C motif) ligand 11	21					actin filament organization (GO:0007015)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|chronic inflammatory response (GO:0002544)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mammary duct terminal end bud growth (GO:0060763)|mast cell chemotaxis (GO:0002551)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of Rac GTPase activity (GO:0032855)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|response to interleukin-4 (GO:0070670)|response to radiation (GO:0009314)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			breast(1)|lung(1)|prostate(1)	3	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		GCCCCCAGGGGCTCGCTGGGC	0.562																																																0			17											103.0	104.0	104.0					17																	32612890		2203	4300	6503	29637003	SO:0001819	synonymous_variant	6356			AB063614	CCDS11279.1	17q21.1-q21.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000172156	ENSG00000172156		"""Chemokine ligands"", ""Endogenous ligands"""	10610	protein-coding gene	gene with protein product	"""eotaxin-1"""	601156	"""small inducible cytokine subfamily A (Cys-Cys), member 11 (eotaxin)"""	SCYA11		9169149	Standard	NM_002986		Approved	eotaxin, MGC22554	uc002hia.1	P51671	OTTHUMG00000132884	ENST00000305869.3:c.63G>T	17.37:g.32612890G>T		Somatic		Capture	Illumina GAIIx	4	29637003	P50877|Q92490|Q92491	Silent	SNP	superfamily_Interleukin 8-like chemokines,HMMPfam_IL8,HMMSmart_SM00199,PatternScan_SMALL_CYTOKINES_CC	p.G21	ENST00000305869.3	37	c.63	CCDS11279.1	17																																																																																			-	NULL		0.562	CCL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL11	protein_coding	OTTHUMT00000256377.2	G	NM_002986		29637003	+1	no_errors	NM_002986	genbank	human	reviewed	54_36p	silent	SNP	0.032	T
GABBR1	2550	genome.wustl.edu	37	6	29578771	29578771	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr6:29578771G>C	ENST00000377034.4	-	14	1973	c.1638C>G	c.(1636-1638)agC>agG	p.S546R	GABBR1_ENST00000355973.3_Missense_Mutation_p.S429R|GABBR1_ENST00000377016.4_Missense_Mutation_p.S484R|GABBR1_ENST00000376977.3_Missense_Mutation_p.S546R|GABBR1_ENST00000377012.4_Missense_Mutation_p.S429R	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	546					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TCTTCTTGTAGCTGCCACCTG	0.453																																																0			6											148.0	121.0	130.0					6																	29578771		1510	2709	4219	29686750	SO:0001583	missense	2550			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1638C>G	6.37:g.29578771G>C	ENSP00000366233:p.Ser546Arg	Somatic		Capture	Illumina GAIIx	4	29686750	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	superfamily_Complement control module/SCR domain,HMMSmart_SM00032,HMMPfam_Sushi,superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,HMMPfam_7tm_3	p.S546R	ENST00000377034.4	37	c.1638	CCDS4663.1	6	.	.	.	.	.	.	.	.	.	.	G	8.640	0.895659	0.17686	.	.	ENSG00000204681	ENST00000355973;ENST00000376977;ENST00000377016;ENST00000377012;ENST00000377034	T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;-0.82	5.07	3.16	0.36331	.	0.186210	0.56097	D	0.000035	T	0.41465	0.1160	L	0.35644	1.08	0.42485	D	0.992876	B;B;B;B	0.27853	0.004;0.191;0.059;0.138	B;B;B;B	0.31614	0.015;0.133;0.041;0.02	T	0.30679	-0.9970	10	0.14656	T	0.56	-16.6172	5.0898	0.14702	0.1838:0.0:0.6484:0.1678	.	546;484;546;429	Q9UBS5-5;Q9UBS5-3;Q9UBS5;Q5SUJ9	.;.;GABR1_HUMAN;.	R	429;546;484;429;546	ENSP00000348248:S429R;ENSP00000366176:S546R;ENSP00000366215:S484R;ENSP00000366211:S429R;ENSP00000366233:S546R	ENSP00000348248:S429R	S	-	3	2	GABBR1	29686750	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.771000	0.26633	1.256000	0.44068	0.563000	0.77884	AGC	-	superfamily_Periplasmic binding protein-like I		0.453	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	protein_coding	OTTHUMT00000076141.3	G			29686750	-1	no_errors	NM_001470	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
GRIK1	2897	genome.wustl.edu	37	21	30934040	30934040	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr21:30934040G>T	ENST00000399907.1	-	15	2672	c.2261C>A	c.(2260-2262)tCc>tAc	p.S754Y	GRIK1_ENST00000399909.1_Missense_Mutation_p.S739Y|GRIK1_ENST00000399913.1_Missense_Mutation_p.S754Y|GRIK1_ENST00000399914.1_Missense_Mutation_p.S739Y|GRIK1_ENST00000389124.2_Missense_Mutation_p.S754Y|GRIK1_ENST00000309434.7_Missense_Mutation_p.S756Y|GRIK1_ENST00000327783.4_Missense_Mutation_p.S754Y|GRIK1_ENST00000389125.3_Missense_Mutation_p.S739Y|GRIK1_ENST00000535441.1_Missense_Mutation_p.S756Y	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	754					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	AATGCTGGTGGACTCCATCAG	0.542																																																0			21											162.0	131.0	142.0					21																	30934040		2203	4300	6503	29855911	SO:0001583	missense	2897				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2261C>A	21.37:g.30934040G>T	ENSP00000382791:p.Ser754Tyr	Somatic		Capture	Illumina GAIIx	4	29855911	Q13001|Q86SU9	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,HMMSmart_SM00079,superfamily_Periplasmic binding protein-like II,HMMPfam_Lig_chan-Glu_bd,HMMPfam_Lig_chan	p.S754Y	ENST00000399907.1	37	c.2261	CCDS42913.1	21	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810223	0.90707	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.12361	2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69	4.96	4.96	0.65561	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.52025	0.1709	H	0.95539	3.685	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.997	T	0.67348	-0.5693	10	0.87932	D	0	.	18.367	0.90394	0.0:0.0:1.0:0.0	.	739;754;754;739	E7EPY9;E9PD61;P39086;P39086-2	.;.;GRIK1_HUMAN;.	Y	754;739;754;739;756;615;754;754;739;756	ENSP00000327687:S754Y;ENSP00000373777:S739Y;ENSP00000382797:S754Y;ENSP00000382798:S739Y;ENSP00000446326:S756Y;ENSP00000373776:S754Y;ENSP00000382791:S754Y;ENSP00000382793:S739Y;ENSP00000311646:S756Y	ENSP00000311646:S756Y	S	-	2	0	GRIK1	29855911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.554000	0.98121	2.733000	0.93635	0.655000	0.94253	TCC	-	HMMSmart_SM00079,superfamily_Periplasmic binding protein-like II,HMMPfam_Lig_chan		0.542	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIK1	protein_coding	OTTHUMT00000171979.1	G			29855911	-1	no_errors	NM_000830	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
HEATR5A	25938	genome.wustl.edu	37	14	31813215	31813215	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr14:31813215T>A	ENST00000389961.3	-	20	3096	c.3097A>T	c.(3097-3099)Atg>Ttg	p.M1033L	HEATR5A_ENST00000439727.1_Missense_Mutation_p.M746L|HEATR5A_ENST00000543095.2_Missense_Mutation_p.M1039L|HEATR5A_ENST00000404677.3_Missense_Mutation_p.M1039L|HEATR5A_ENST00000439348.1_Missense_Mutation_p.M1033L			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1033										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TTATCTTGCATTACTGCACAA	0.408																																																0			14											69.0	74.0	72.0					14																	31813215		2175	4295	6470	30882966	SO:0001583	missense	25938			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.3097A>T	14.37:g.31813215T>A	ENSP00000374611:p.Met1033Leu	Somatic		Capture	Illumina GAIIx	4	30882966	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.M746L	ENST00000389961.3	37	c.2236		14	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	17.56|17.56|17.56	3.419381|3.419381|3.419381	0.62622|0.62622|0.62622	.|.|.	.|.|.	ENSG00000129493|ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095;ENST00000404677|ENST00000550366|ENST00000538864;ENST00000549719	T;T;T;T;T|.|.	0.64618|.|.	-0.11;-0.11;-0.11;-0.11;-0.11|.|.	5.98|5.98|5.98	5.98|5.98|5.98	0.97165|0.97165|0.97165	Armadillo-type fold (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.70150|0.70150|.	0.3191|0.3191|.	L|L|L	0.54908|0.54908|0.54908	1.71|1.71|1.71	0.58432|0.58432|0.58432	D|D|D	0.999999|0.999999|0.999999	D;B;B|.|.	0.54397|.|.	0.966;0.34;0.296|.|.	D;B;B|.|.	0.68039|.|.	0.955;0.172;0.124|.|.	T|T|.	0.67604|0.67604|.	-0.5628|-0.5628|.	10|5|.	0.35671|.|.	T|.|.	0.21|.|.	.|.|.	16.4781|16.4781|16.4781	0.84144|0.84144|0.84144	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	1039;1033;1033|.|.	B5MC49;Q86XA9-2;Q86XA9|.|.	.;.;HTR5A_HUMAN|.|.	L|I|Y	1033;1033;746;1039;1039|681|666;57	ENSP00000374611:M1033L;ENSP00000405407:M1033L;ENSP00000408681:M746L;ENSP00000437968:M1039L;ENSP00000384646:M1039L|.|.	ENSP00000374611:M1033L|.|.	M|N|X	-|-|-	1|2|3	0|0|2	HEATR5A|HEATR5A|HEATR5A	30882966|30882966|30882966	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.994000|0.994000|0.994000	0.84299|0.84299|0.84299	7.981000|7.981000|7.981000	0.88123|0.88123|0.88123	2.288000|2.288000|2.288000	0.76882|0.76882|0.76882	0.528000|0.528000|0.528000	0.53228|0.53228|0.53228	ATG|AAT|TAA	-	superfamily_ARM repeat		0.408	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	protein_coding		T	NM_015473		30882966	-1	no_errors	NM_015473	genbank	human	validated	54_36p	missense	SNP	1.000	A
FRY	10129	genome.wustl.edu	37	13	32749719	32749719	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr13:32749719C>A	ENST00000380250.3	+	20	2867	c.2371C>A	c.(2371-2373)Cta>Ata	p.L791I		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	791						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CATGGATCAGCTAAGTTCTTC	0.443																																																0			13											163.0	156.0	158.0					13																	32749719		1916	4122	6038	31647719	SO:0001583	missense	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.2371C>A	13.37:g.32749719C>A	ENSP00000369600:p.Leu791Ile	Somatic		Capture	Illumina GAIIx	4	31647719	Q9Y3N6	Missense_Mutation	SNP	PatternScan_GHMP_KINASES_ATP	p.L791I	ENST00000380250.3	37	c.2371	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928540	0.73327	.	.	ENSG00000073910	ENST00000380250	T	0.24151	1.87	5.9	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.32496	0.0831	L	0.55834	1.745	0.80722	D	1	D	0.57899	0.981	P	0.53266	0.722	T	0.03121	-1.1070	10	0.36615	T	0.2	.	7.8919	0.29682	0.1327:0.7211:0.0:0.1462	.	791	Q5TBA9	FRY_HUMAN	I	791	ENSP00000369600:L791I	ENSP00000369600:L791I	L	+	1	2	FRY	31647719	1.000000	0.71417	0.986000	0.45419	0.993000	0.82548	2.292000	0.43549	0.811000	0.34303	0.650000	0.86243	CTA	-	NULL		0.443	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	protein_coding	OTTHUMT00000044405.1	C	NM_023037		31647719	+1	no_errors	NM_023037	genbank	human	validated	54_36p	missense	SNP	1.000	A
CCDC129	223075	genome.wustl.edu	37	7	31682913	31682913	+	Silent	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr7:31682913C>T	ENST00000407970.3	+	11	1967	c.1929C>T	c.(1927-1929)atC>atT	p.I643I	CCDC129_ENST00000319386.3_Silent_p.I495I|CCDC129_ENST00000409210.1_Silent_p.I551I|CCDC129_ENST00000451887.2_Silent_p.I669I	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	643										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						CACAGTGTATCCCCAAGCACA	0.498																																																0			7											131.0	113.0	119.0					7																	31682913		2203	4300	6503	31649438	SO:0001819	synonymous_variant	223075			AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1929C>T	7.37:g.31682913C>T		Somatic		Capture	Illumina GAIIx	4	31649438	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Silent	SNP	PatternScan_PA2_HIS	p.I643	ENST00000407970.3	37	c.1929	CCDS5435.2	7																																																																																			-	NULL		0.498	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC129	protein_coding	OTTHUMT00000318975.1	C	NM_194300		31649438	+1	no_errors	NM_194300	genbank	human	validated	54_36p	silent	SNP	0.001	T
SON	6651	genome.wustl.edu	37	21	34922365	34922365	+	Silent	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr21:34922365G>T	ENST00000356577.4	+	3	1303	c.828G>T	c.(826-828)ctG>ctT	p.L276L	SON_ENST00000290239.6_Silent_p.L276L|SON_ENST00000381692.2_Intron|SON_ENST00000381679.4_Silent_p.L276L|SON_ENST00000300278.4_Silent_p.L276L	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	276					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						AGTCTGTGCTGAAATCTGTGG	0.463											OREG0003564	type=REGULATORY REGION|Gene=AK074269|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			21											83.0	81.0	81.0					21																	34922365		2203	4300	6503	33844235	SO:0001819	synonymous_variant	6651			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.828G>T	21.37:g.34922365G>T		Somatic	851	Capture	Illumina GAIIx	4	33844235	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	HMMSmart_SM00443,HMMPfam_G-patch,superfamily_dsRNA-binding domain-like,HMMPfam_dsrm	p.L276	ENST00000356577.4	37	c.828	CCDS13629.1	21																																																																																			-	NULL		0.463	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	protein_coding	OTTHUMT00000140978.2	G	NM_138927		33844235	+1	no_errors	NM_138927	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
C15orf41	84529	genome.wustl.edu	37	15	36910326	36910326	+	Intron	SNP	T	T	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr15:36910326T>G	ENST00000566621.1	+	2	351				C15orf41_ENST00000437989.2_Intron|C15orf41_ENST00000567389.1_Intron|C15orf41_ENST00000562877.1_Intron|C15orf41_ENST00000569302.1_Intron	NM_001130010.1	NP_001123482.1	Q9Y2V0	CO041_HUMAN	chromosome 15 open reading frame 41											kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		CAATGGTAGTTTTGTGAATGG	0.413																																																0			15																																								34697618	SO:0001627	intron_variant	728257			BC006254	CCDS45215.1, CCDS45216.1	15q14	2012-05-31			ENSG00000186073	ENSG00000186073			26929	protein-coding gene	gene with protein product		615626					Standard	XM_005254719		Approved	HH114, MGC11326, FLJ22851	uc001zje.4	Q9Y2V0	OTTHUMG00000172659	ENST00000566621.1:c.102-26153T>G	15.37:g.36910326T>G		Somatic		Capture	Illumina GAIIx	4	34697618	B2RD87	RNA	SNP	-	NULL	ENST00000566621.1	37	NULL	CCDS45215.1	15																																																																																			-	-		0.413	C15orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC728257	protein_coding	OTTHUMT00000419741.1	T	NM_032499		34697618	+1	pseudogene	XR_015358	genbank	human	model	54_36p	rna	SNP	1.000	G
RAPGEFL1	51195	genome.wustl.edu	37	17	38347911	38347911	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr17:38347911G>C	ENST00000456989.2	+	10	1185	c.1139G>C	c.(1138-1140)cGa>cCa	p.R380P	RAPGEFL1_ENST00000264644.6_Missense_Mutation_p.R325P|RAPGEFL1_ENST00000544503.1_Missense_Mutation_p.R374P|RAPGEFL1_ENST00000436615.3_Missense_Mutation_p.R325P			Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor (GEF)-like 1	531					G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						AGCCGCCTTCGACTCACCTGG	0.687																																					Esophageal Squamous(28;274 750 6870 14218 42203)											0			17											24.0	24.0	24.0					17																	38347911		2202	4300	6502	35601437	SO:0001583	missense	51195			AF117946	CCDS11363.1	17q21.2	2006-08-01	2004-03-26		ENSG00000108352	ENSG00000108352			17428	protein-coding gene	gene with protein product	"""Link guanine nucleotide exchange factor II"""		"""RAP guanine-nucleotide-exchange factor (GEF)-like 1"""				Standard	NM_016339		Approved	Link-GEFII	uc010cwu.1	Q9UHV5	OTTHUMG00000133325	ENST00000456989.2:c.1139G>C	17.37:g.38347911G>C	ENSP00000394530:p.Arg380Pro	Somatic		Capture	Illumina GAIIx	4	35601437		Missense_Mutation	SNP	superfamily_Ras_GEF,HMMPfam_RA,HMMSmart_RasGEF,HMMPfam_RasGEF	p.R325P	ENST00000456989.2	37	c.974		17	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716221	0.89205	.	.	ENSG00000108352	ENST00000456989;ENST00000544503;ENST00000537255;ENST00000264644;ENST00000436615	T;T;T	0.32023	1.47;1.47;1.47	5.17	5.17	0.71159	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.64402	D	0.000002	T	0.56761	0.2007	M	0.78456	2.415	0.58432	D	0.999999	P;D	0.76494	0.484;0.999	P;D	0.67231	0.585;0.95	T	0.58707	-0.7589	10	0.54805	T	0.06	.	17.6129	0.88059	0.0:0.0:1.0:0.0	.	261;531	B4DGK9;Q9UHV5	.;RPGFL_HUMAN	P	380;374;325;530;325	ENSP00000394530:R380P;ENSP00000438631:R374P;ENSP00000408322:R325P	ENSP00000264644:R530P	R	+	2	0	RAPGEFL1	35601437	0.727000	0.28069	1.000000	0.80357	0.691000	0.40173	2.651000	0.46674	2.711000	0.92665	0.561000	0.74099	CGA	-	superfamily_Ras_GEF,HMMSmart_RasGEF,HMMPfam_RasGEF		0.687	RAPGEFL1-005	PUTATIVE	non_canonical_conserved|basic|exp_conf	protein_coding	RAPGEFL1	protein_coding	OTTHUMT00000397518.1	G	NM_016339		35601437	+1	no_errors	NM_016339	genbank	human	validated	54_36p	missense	SNP	0.971	C
MIPOL1	145282	genome.wustl.edu	37	14	37754635	37754635	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr14:37754635G>A	ENST00000327441.7	+	8	1072	c.606G>A	c.(604-606)atG>atA	p.M202I	MIPOL1_ENST00000536774.1_Missense_Mutation_p.M21I|MIPOL1_ENST00000396294.2_Missense_Mutation_p.M202I|MIPOL1_ENST00000545536.1_Missense_Mutation_p.M171I|MIPOL1_ENST00000537471.1_Missense_Mutation_p.M202I|MIPOL1_ENST00000556451.1_Missense_Mutation_p.M171I|MIPOL1_ENST00000539062.2_Missense_Mutation_p.M171I	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	202						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		CCAAGCATATGGAAATGTCTC	0.358																																																0			14											167.0	150.0	156.0					14																	37754635		2203	4300	6503	36824386	SO:0001583	missense	145282			AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.606G>A	14.37:g.37754635G>A	ENSP00000333539:p.Met202Ile	Somatic		Capture	Illumina GAIIx	4	36824386	D3DSA4|Q7Z3J0|Q8IV14	Missense_Mutation	SNP	NULL	p.M202I	ENST00000327441.7	37	c.606	CCDS9664.1	14	.	.	.	.	.	.	.	.	.	.	G	8.585	0.883293	0.17467	.	.	ENSG00000151338	ENST00000327441;ENST00000536774;ENST00000539062;ENST00000556451;ENST00000396294;ENST00000537471;ENST00000545536	T;T;T;T;T;T	0.40756	1.03;1.04;1.02;1.03;1.03;1.02	5.4	5.4	0.78164	.	0.338281	0.32106	N	0.006561	T	0.29684	0.0741	L	0.38531	1.155	0.32820	D	0.50265	B;B	0.23185	0.081;0.061	B;B	0.23275	0.033;0.045	T	0.32241	-0.9914	10	0.20046	T	0.44	-5.0971	8.0503	0.30575	0.0855:0.0:0.755:0.1595	.	202;171	Q8TD10;Q49AL5	MIPO1_HUMAN;.	I	202;21;171;171;202;202;171	ENSP00000333539:M202I;ENSP00000438319:M171I;ENSP00000450479:M171I;ENSP00000379589:M202I;ENSP00000444254:M202I;ENSP00000442529:M171I	ENSP00000333539:M202I	M	+	3	0	MIPOL1	36824386	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	2.010000	0.40913	2.539000	0.85634	0.561000	0.74099	ATG	-	NULL		0.358	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPOL1	protein_coding	OTTHUMT00000276734.1	G	NM_138731		36824386	+1	no_errors	NM_138731	genbank	human	validated	54_36p	missense	SNP	0.995	A
GOLGA4	2803	genome.wustl.edu	37	3	37367300	37367300	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:37367300G>C	ENST00000361924.2	+	14	4297	c.3923G>C	c.(3922-3924)aGc>aCc	p.S1308T	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.S1330T	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1308	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CAAATTAAGAGCATGAAGGCT	0.368																																																0			3											35.0	36.0	35.0					3																	37367300		2202	4298	6500	37342304	SO:0001583	missense	2803			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.3923G>C	3.37:g.37367300G>C	ENSP00000354486:p.Ser1308Thr	Somatic		Capture	Illumina GAIIx	4	37342304	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	superfamily_Prefoldin,PatternScan_PHOSPHOPANTETHEINE,HMMPfam_GRIP,HMMSmart_SM00755,superfamily_GRIP domain	p.S1308T	ENST00000361924.2	37	c.3923	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	G	10.28	1.305322	0.23736	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.26223	1.75;1.75;1.75	5.53	2.72	0.32119	.	0.357786	0.20610	N	0.088999	T	0.15176	0.0366	N	0.25426	0.745	0.27396	N	0.954991	B;B;B;B	0.24426	0.103;0.061;0.061;0.008	B;B;B;B	0.23419	0.046;0.015;0.015;0.003	T	0.21861	-1.0233	10	0.20046	T	0.44	.	7.5514	0.27800	0.1641:0.4558:0.3801:0.0	.	1308;1308;1330;1308	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	T	1308;1330;1179	ENSP00000354486:S1308T;ENSP00000349305:S1330T;ENSP00000405842:S1179T	ENSP00000349305:S1330T	S	+	2	0	GOLGA4	37342304	0.782000	0.28689	1.000000	0.80357	0.996000	0.88848	1.147000	0.31602	0.680000	0.31366	0.563000	0.77884	AGC	-	NULL		0.368	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	protein_coding	OTTHUMT00000253339.2	G	NM_002078		37342304	+1	no_errors	NM_002078	genbank	human	reviewed	54_36p	missense	SNP	0.996	C
COASY	80347	genome.wustl.edu	37	17	40717055	40717055	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr17:40717055T>G	ENST00000393818.2	+	5	1748	c.1292T>G	c.(1291-1293)tTt>tGt	p.F431C	COASY_ENST00000420359.1_Missense_Mutation_p.F431C|MLX_ENST00000346833.4_5'Flank|MLX_ENST00000435881.2_5'Flank|RP11-400F19.8_ENST00000585572.1_RNA|COASY_ENST00000590958.1_Missense_Mutation_p.F460C|COASY_ENST00000449624.1_Missense_Mutation_p.F136C|MLX_ENST00000246912.4_5'Flank|COASY_ENST00000421097.2_Missense_Mutation_p.F431C	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	431	DPCK.				cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		AGCCGGGTGTTTGGGAATAAG	0.527																																																0			17											108.0	108.0	108.0					17																	40717055		2203	4300	6503	37970581	SO:0001583	missense	80347			AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.1292T>G	17.37:g.40717055T>G	ENSP00000377406:p.Phe431Cys	Somatic		Capture	Illumina GAIIx	4	37970581	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	superfamily_Nucleotidylyl transferase,HMMPfam_CTP_transf_2,HMMPfam_CoaE,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.F431C	ENST00000393818.2	37	c.1292	CCDS11429.1	17	.	.	.	.	.	.	.	.	.	.	T	21.2	4.112494	0.77210	.	.	ENSG00000068120	ENST00000421097;ENST00000449624;ENST00000420359;ENST00000393818	T;T;T	0.68903	-0.36;-0.36;-0.36	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.87334	0.6151	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91287	0.5056	10	0.87932	D	0	-12.9102	13.8075	0.63243	0.0:0.0:0.0:1.0	.	460;431	Q13057-2;Q13057	.;COASY_HUMAN	C	460;136;431;431	ENSP00000407740:F136C;ENSP00000413338:F431C;ENSP00000377406:F431C	ENSP00000377406:F431C	F	+	2	0	COASY	37970581	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.640000	0.61368	2.143000	0.66587	0.459000	0.35465	TTT	-	HMMPfam_CoaE,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.527	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COASY	protein_coding	OTTHUMT00000450409.1	T	NM_025233		37970581	+1	no_errors	NM_001042529	genbank	human	validated	54_36p	missense	SNP	1.000	G
BCOR	54880	genome.wustl.edu	37	X	39923122	39923122	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:39923122C>G	ENST00000378444.4	-	8	3814	c.3586G>C	c.(3586-3588)Gtg>Ctg	p.V1196L	BCOR_ENST00000378455.4_Intron|BCOR_ENST00000378463.1_Intron|BCOR_ENST00000342274.4_Intron|BCOR_ENST00000397354.3_Intron	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1196					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						TCAATGCACACCTTCAGGTTG	0.473			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0			X											64.0	61.0	62.0					X																	39923122		2202	4300	6502	39808066	SO:0001583	missense	54880			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.3586G>C	X.37:g.39923122C>G	ENSP00000367705:p.Val1196Leu	Somatic		Capture	Illumina GAIIx	4	39808066	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.V1196L	ENST00000378444.4	37	c.3586	CCDS48093.1	X	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362645	0.82353	.	.	ENSG00000183337	ENST00000378444	T	0.10192	2.9	5.52	5.52	0.82312	.	.	.	.	.	T	0.23649	0.0572	L	0.32530	0.975	0.80722	D	1	D	0.64830	0.994	D	0.70716	0.97	T	0.01256	-1.1404	8	.	.	.	-18.4407	18.5259	0.90973	0.0:1.0:0.0:0.0	.	1196	Q6W2J9	BCOR_HUMAN	L	1196	ENSP00000367705:V1196L	.	V	-	1	0	BCOR	39808066	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.691000	0.74573	2.317000	0.78254	0.529000	0.55759	GTG	-	NULL		0.473	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	protein_coding	OTTHUMT00000060666.2	C	NM_017745		39808066	-1	no_errors	ENST00000378444	ensembl	human	known	54_36p	missense	SNP	1.000	G
PRDM15	63977	genome.wustl.edu	37	21	43259738	43259738	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr21:43259738G>C	ENST00000269844.3	-	14	2073	c.1963C>G	c.(1963-1965)Ccc>Gcc	p.P655A	PRDM15_ENST00000538201.1_Missense_Mutation_p.P289A|PRDM15_ENST00000398548.1_Missense_Mutation_p.P326A|PRDM15_ENST00000447207.2_Missense_Mutation_p.P289A|PRDM15_ENST00000422911.1_Missense_Mutation_p.P326A	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	655					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						TCACCTGTGGGTTCCTTGTCT	0.637																																																0			21											144.0	140.0	141.0					21																	43259738		2203	4300	6503	42132807	SO:0001583	missense	63977			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.1963C>G	21.37:g.43259738G>C	ENSP00000269844:p.Pro655Ala	Somatic		Capture	Illumina GAIIx	4	42132807	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	HMMSmart_SET,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667,HMMPfam_zf-C2H2	p.P655A	ENST00000269844.3	37	c.1963	CCDS13676.1	21	.	.	.	.	.	.	.	.	.	.	G	8.074	0.770944	0.15983	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844;ENST00000380489	T;T;T;T;T	0.07567	3.24;3.22;3.25;3.22;3.18	4.67	3.73	0.42828	.	.	.	.	.	T	0.06142	0.0159	L	0.31294	0.92	0.42793	D	0.993902	B;B;B	0.14012	0.009;0.0;0.001	B;B;B	0.15052	0.012;0.001;0.002	T	0.30592	-0.9973	9	0.19590	T	0.45	-5.1576	8.7957	0.34878	0.1278:0.1399:0.7324:0.0	.	655;326;326	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	A	326;326;289;289;655;289	ENSP00000408592:P326A;ENSP00000381556:P326A;ENSP00000444044:P289A;ENSP00000390245:P289A;ENSP00000269844:P655A	ENSP00000269844:P655A	P	-	1	0	PRDM15	42132807	0.996000	0.38824	0.980000	0.43619	0.049000	0.14656	0.785000	0.26830	2.312000	0.78011	0.591000	0.81541	CCC	-	NULL		0.637	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	protein_coding		G	NM_022115		42132807	-1	no_errors	NM_022115	genbank	human	validated	54_36p	missense	SNP	0.879	C
ZC3H13	23091	genome.wustl.edu	37	13	46563095	46563095	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr13:46563095C>T	ENST00000242848.4	-	9	1430	c.1082G>A	c.(1081-1083)cGg>cAg	p.R361Q	ZC3H13_ENST00000282007.3_Missense_Mutation_p.R361Q			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	361	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		AGTTAGTGTCCGCTGATAAGA	0.463																																					Esophageal Squamous(187;747 2077 11056 31291 44172)											0			13											183.0	161.0	168.0					13																	46563095		2203	4300	6503	45461096	SO:0001583	missense	23091			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1082G>A	13.37:g.46563095C>T	ENSP00000242848:p.Arg361Gln	Somatic		Capture	Illumina GAIIx	4	45461096	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	superfamily_SSF90229,HMMSmart_ZnF_C3H1,HMMPfam_zf-CCCH	p.R361Q	ENST00000242848.4	37	c.1082		13	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604912	0.66445	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	T;T	0.35789	2.23;1.29	5.99	5.99	0.97316	.	0.000000	0.64402	D	0.000003	T	0.52549	0.1741	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	T	0.41034	-0.9531	10	0.41790	T	0.15	.	20.5471	0.99284	0.0:1.0:0.0:0.0	.	361;361	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	Q	361;361;177	ENSP00000242848:R361Q;ENSP00000282007:R361Q	ENSP00000242848:R361Q	R	-	2	0	ZC3H13	45461096	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.941000	0.70195	2.850000	0.98022	0.650000	0.86243	CGG	-	NULL		0.463	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	protein_coding	OTTHUMT00000044789.1	C	NM_015070		45461096	-1	no_errors	NM_015070	genbank	human	validated	54_36p	missense	SNP	1.000	T
LRRC41	10489	genome.wustl.edu	37	1	46752173	46752173	+	Splice_Site	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:46752173T>A	ENST00000343304.6	-	4	643		c.e4-2		LRRC41_ENST00000472710.1_Splice_Site	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41						protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TGTCACACTCTGAAACGCAGA	0.448																																																0			1											48.0	44.0	45.0					1																	46752173		2203	4300	6503	46524760	SO:0001630	splice_region_variant	10489			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.358-2A>T	1.37:g.46752173T>A		Somatic		Capture	Illumina GAIIx	4	46524760	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Splice_Site	SNP	-	e4-2	ENST00000343304.6	37	c.358-2	CCDS533.1	1	.	.	.	.	.	.	.	.	.	.	t	15.05	2.717193	0.48622	.	.	ENSG00000132128	ENST00000343304;ENST00000371972	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1036	0.72303	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRRC41	46524760	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	5.138000	0.64795	1.974000	0.57490	0.353000	0.21931	.	-	-		0.448	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC41	protein_coding	OTTHUMT00000021438.1	T	NM_006369	Intron	46524760	-1	no_errors	NM_006369	genbank	human	validated	54_36p	splice_site	SNP	1.000	A
TNS3	64759	genome.wustl.edu	37	7	47408795	47408795	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr7:47408795G>T	ENST00000398879.1	-	17	1814	c.1448C>A	c.(1447-1449)cCc>cAc	p.P483H	TNS3_ENST00000355730.3_Missense_Mutation_p.P243H|TNS3_ENST00000311160.9_Missense_Mutation_p.P483H			Q68CZ2	TENS3_HUMAN	tensin 3	483					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GTCGTGGTGGGGCATCTCGTC	0.622																																																0			7											59.0	64.0	62.0					7																	47408795		2151	4248	6399	47375320	SO:0001583	missense	64759			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.1448C>A	7.37:g.47408795G>T	ENSP00000381854:p.Pro483His	Somatic		Capture	Illumina GAIIx	4	47375320	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00404,HMMPfam_PTEN_C2,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2,superfamily_PH domain-like,HMMSmart_SM00462,HMMPfam_PTB	p.P483H	ENST00000398879.1	37	c.1448	CCDS5506.2	7	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028270	0.75390	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000457718	D;D;D;D	0.95171	-3.48;-3.48;-1.89;-3.63	5.45	5.45	0.79879	.	0.465144	0.23181	N	0.051010	D	0.96803	0.8956	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	D	0.97204	0.9866	10	0.87932	D	0	-33.8915	16.7473	0.85476	0.0:0.0:1.0:0.0	.	483	Q68CZ2	TENS3_HUMAN	H	483;593;483;243;586	ENSP00000312143:P483H;ENSP00000381854:P483H;ENSP00000347968:P243H;ENSP00000414358:P586H	ENSP00000312143:P483H	P	-	2	0	TNS3	47375320	1.000000	0.71417	0.975000	0.42487	0.985000	0.73830	6.247000	0.72411	2.544000	0.85801	0.655000	0.94253	CCC	-	NULL		0.622	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	protein_coding	OTTHUMT00000157253.1	G	NM_022748		47375320	-1	no_errors	NM_022748	genbank	human	validated	54_36p	missense	SNP	0.999	T
MEGF8	1954	genome.wustl.edu	37	19	42867283	42867283	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:42867283C>T	ENST00000251268.6	+	35	6142	c.6142C>T	c.(6142-6144)Ccg>Tcg	p.P2048S	MEGF8_ENST00000334370.4_Missense_Mutation_p.P1981S	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2048					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GTCCCCCATGCCGGTGGAATC	0.647																																																0			19											124.0	106.0	112.0					19																	42867283		2203	4298	6501	47559123	SO:0001583	missense	1954			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6142C>T	19.37:g.42867283C>T	ENSP00000251268:p.Pro2048Ser	Somatic		Capture	Illumina GAIIx	4	47559123	A8KAY0|O75097	Missense_Mutation	SNP	superfamily_CUB,HMMSmart_CUB,HMMPfam_CUB,HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_2,superfamily_Gal_oxid_central,HMMPfam_Kelch_1,HMMSmart_PSI,PatternScan_C_TYPE_LECTIN_1,HMMPfam_PSI,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,superfamily_SSF57196,PatternScan_ASX_HYDROXYL,HMMPfam_Laminin_EGF,PatternScan_EGF_LAM_1,HMMSmart_EGF_Lam	p.P1981S	ENST00000251268.6	37	c.5941		19	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293472	0.23564	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.19532	2.14;2.14	5.11	5.11	0.69529	.	0.078555	0.52532	D	0.000074	T	0.12135	0.0295	N	0.08118	0	0.58432	D	0.999997	B;P	0.42518	0.02;0.782	B;B	0.40256	0.024;0.324	T	0.15983	-1.0418	10	0.10902	T	0.67	-19.0304	17.701	0.88294	0.0:1.0:0.0:0.0	.	2048;1981	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	S	1981;2048	ENSP00000334219:P1981S;ENSP00000251268:P2048S	ENSP00000251268:P2048S	P	+	1	0	MEGF8	47559123	1.000000	0.71417	0.995000	0.50966	0.859000	0.49053	7.044000	0.76578	2.556000	0.86216	0.508000	0.49915	CCG	-	NULL		0.647	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	protein_coding	OTTHUMT00000463854.1	C	NM_001410		47559123	+1	no_errors	NM_001410	genbank	human	validated	54_36p	missense	SNP	1.000	T
PSG3	5671	genome.wustl.edu	37	19	43244527	43244527	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:43244527G>A	ENST00000327495.5	-	1	194	c.10C>T	c.(10-12)Ctc>Ttc	p.L4F	PSG3_ENST00000490592.1_5'Flank|PSG3_ENST00000595140.1_Missense_Mutation_p.L4F	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	4					defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				GGGGCTGAGAGGGGCCCCATG	0.602																																																0			19											143.0	153.0	149.0					19																	43244527		1511	2709	4220	47936367	SO:0001583	missense	5671				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.10C>T	19.37:g.43244527G>A	ENSP00000332215:p.Leu4Phe	Somatic		Capture	Illumina GAIIx	4	47936367	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig,HMMSmart_IGc2	p.L4F	ENST00000327495.5	37	c.10	CCDS12611.1	19	.	.	.	.	.	.	.	.	.	.	N	4.866	0.161027	0.09287	.	.	ENSG00000221826	ENST00000327495	T	0.20598	2.06	1.21	-0.166	0.13351	.	.	.	.	.	T	0.16471	0.0396	L	0.46157	1.445	0.09310	N	1	B	0.24043	0.096	B	0.25614	0.062	T	0.28332	-1.0047	9	0.42905	T	0.14	.	4.8445	0.13507	0.0:0.3975:0.6025:0.0	.	4	Q16557	PSG3_HUMAN	F	4	ENSP00000332215:L4F	ENSP00000332215:L4F	L	-	1	0	PSG3	47936367	0.006000	0.16342	0.039000	0.18376	0.179000	0.23085	2.197000	0.42696	0.030000	0.15379	0.121000	0.15741	CTC	-	HMMPfam_V-set		0.602	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	protein_coding	OTTHUMT00000321423.2	G	NM_021016		47936367	-1	no_errors	NM_021016	genbank	human	validated	54_36p	missense	SNP	0.004	A
WDR6	11180	genome.wustl.edu	37	3	49052115	49052115	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:49052115G>C	ENST00000608424.1	+	5	2905	c.2866G>C	c.(2866-2868)Gtc>Ctc	p.V956L	WDR6_ENST00000448293.1_Missense_Mutation_p.V905L|WDR6_ENST00000415265.2_Missense_Mutation_p.V404L|WDR6_ENST00000395474.3_Missense_Mutation_p.V986L|DALRD3_ENST00000496568.1_5'Flank			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	956					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		TGACTCCACTGTCCTGGAGCC	0.572											OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			3											120.0	111.0	114.0					3																	49052115		2203	4300	6503	49027119	SO:0001583	missense	11180			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.2866G>C	3.37:g.49052115G>C	ENSP00000477389:p.Val956Leu	Somatic	959	Capture	Illumina GAIIx	4	49027119	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.V956L	ENST00000608424.1	37	c.2866		3	.	.	.	.	.	.	.	.	.	.	G	3.380	-0.126557	0.06795	.	.	ENSG00000178252	ENST00000395474;ENST00000415265;ENST00000448293	T;T	0.59638	0.25;0.26	4.84	1.94	0.25998	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.739386	0.13857	N	0.357934	T	0.42607	0.1210	L	0.43152	1.355	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.21895	-1.0232	10	0.23891	T	0.37	-2.1526	4.7366	0.12991	0.2627:0.1664:0.5709:0.0	.	404;956;905	E9PBK6;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	L	986;404;905	ENSP00000378857:V986L;ENSP00000413432:V905L	ENSP00000378857:V986L	V	+	1	0	WDR6	49027119	0.030000	0.19436	0.025000	0.17156	0.032000	0.12392	0.982000	0.29539	0.674000	0.31244	0.561000	0.74099	GTC	-	superfamily_WD40_like		0.572	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	protein_coding	OTTHUMT00000471652.1	G			49027119	+1	no_errors	NM_018031	genbank	human	reviewed	54_36p	missense	SNP	0.076	C
DAG1	1605	genome.wustl.edu	37	3	49568773	49568773	+	Missense_Mutation	SNP	G	G	T	rs375892170		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:49568773G>T	ENST00000539901.1	+	3	1387	c.829G>T	c.(829-831)Gta>Tta	p.V277L	DAG1_ENST00000541308.1_Missense_Mutation_p.V277L|DAG1_ENST00000538711.1_Missense_Mutation_p.V277L|DAG1_ENST00000308775.2_Missense_Mutation_p.V277L|DAG1_ENST00000515359.2_Missense_Mutation_p.V277L|DAG1_ENST00000545947.1_Missense_Mutation_p.V277L	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	277	Required for laminin recognition.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CATTCATGGTGTAGAGGCCCC	0.587																																																0			3											77.0	75.0	76.0					3																	49568773		2203	4300	6503	49543777	SO:0001583	missense	1605			L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.829G>T	3.37:g.49568773G>T	ENSP00000439334:p.Val277Leu	Somatic		Capture	Illumina GAIIx	4	49543777	A8K6M7|Q969J9	Missense_Mutation	SNP	HMMPfam_DAG1,superfamily_Cadherin,HMMSmart_CADG,superfamily_SSF111006	p.V277L	ENST00000539901.1	37	c.829	CCDS2799.1	3	.	.	.	.	.	.	.	.	.	.	G	10.36	1.328601	0.24167	.	.	ENSG00000173402	ENST00000515359;ENST00000308775;ENST00000545947;ENST00000541308;ENST00000539901;ENST00000538711;ENST00000415315	T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	5.9	5.03	0.67393	.	0.053499	0.64402	D	0.000001	T	0.73552	0.3601	L	0.42245	1.32	0.51233	D	0.999916	D	0.55800	0.973	P	0.47430	0.547	T	0.69917	-0.5015	10	0.15066	T	0.55	-9.5489	14.2	0.65696	0.073:0.0:0.927:0.0	.	277	Q14118	DAG1_HUMAN	L	277;277;277;277;277;277;76	ENSP00000440705:V277L;ENSP00000312435:V277L;ENSP00000442600:V277L;ENSP00000440590:V277L;ENSP00000439334:V277L;ENSP00000438421:V277L	ENSP00000312435:V277L	V	+	1	0	DAG1	49543777	1.000000	0.71417	0.963000	0.40424	0.885000	0.51271	7.914000	0.87478	1.501000	0.48654	0.643000	0.83706	GTA	-	HMMPfam_DAG1,superfamily_SSF111006		0.587	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	DAG1	protein_coding	OTTHUMT00000346326.1	G			49543777	+1	no_errors	NM_004393	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
DYNAP	284254	genome.wustl.edu	37	18	52258469	52258469	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr18:52258469G>T	ENST00000321600.1	+	1	80	c.34G>T	c.(34-36)Gaa>Taa	p.E12*	DYNAP_ENST00000585973.1_Nonsense_Mutation_p.E15*	NM_173629.1	NP_775900.1	Q8N1N2	DYNAP_HUMAN	dynactin associated protein	12					activation of protein kinase B activity (GO:0032148)|cellular response to ergosterol (GO:1901625)|positive regulation of cell proliferation (GO:0008284)|regulation of apoptotic process (GO:0042981)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TGAACAAATTGAAAAATATTC	0.368																																																0			18											111.0	114.0	113.0					18																	52258469		2203	4300	6503	50409467	SO:0001587	stop_gained	284254			AK096425	CCDS11957.1	18q21.2	2012-10-24	2012-10-24	2012-10-24	ENSG00000178690	ENSG00000178690			26808	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 26"""	C18orf26		20978158	Standard	NM_173629		Approved	FLJ39106	uc002lfq.1	Q8N1N2	OTTHUMG00000132709	ENST00000321600.1:c.34G>T	18.37:g.52258469G>T	ENSP00000315265:p.Glu12*	Somatic		Capture	Illumina GAIIx	4	50409467		Nonsense_Mutation	SNP	NULL	p.E12*	ENST00000321600.1	37	c.34	CCDS11957.1	18	.	.	.	.	.	.	.	.	.	.	.	15.46	2.839973	0.51057	.	.	ENSG00000178690	ENST00000321600	.	.	.	5.21	3.42	0.39159	.	0.708385	0.12243	N	0.486281	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-2.0826	8.2208	0.31541	0.1849:0.0:0.8151:0.0	.	.	.	.	X	12	.	ENSP00000315265:E12X	E	+	1	0	C18orf26	50409467	0.001000	0.12720	0.001000	0.08648	0.062000	0.15995	0.847000	0.27696	0.701000	0.31803	0.609000	0.83330	GAA	-	NULL		0.368	DYNAP-001	KNOWN	basic|CCDS	protein_coding	C18orf26	protein_coding	OTTHUMT00000256007.1	G	NM_173629		50409467	+1	no_errors	NM_173629	genbank	human	predicted	54_36p	nonsense	SNP	0.149	T
SCN8A	6334	genome.wustl.edu	37	12	52162857	52162857	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:52162857T>G	ENST00000354534.6	+	17	3288	c.3110T>G	c.(3109-3111)tTg>tGg	p.L1037W	SCN8A_ENST00000545061.1_Missense_Mutation_p.L1037W	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1037					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CTGGATGAGTTGTATGAAAAG	0.522																																																0			12											68.0	71.0	70.0					12																	52162857		2101	4234	6335	50449124	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.3110T>G	12.37:g.52162857T>G	ENSP00000346534:p.Leu1037Trp	Somatic		Capture	Illumina GAIIx	4	50449124	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,PatternScan_ODR_DC_2_1,HMMSmart_SM00015,HMMPfam_IQ	p.L1037W	ENST00000354534.6	37	c.3110	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	T	24.6	4.547286	0.86022	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D	0.84589	-1.87;-1.87;-1.87	4.55	4.55	0.56014	Sodium ion transport-associated (1);	0.452253	0.21641	N	0.071334	D	0.91865	0.7425	M	0.77486	2.375	0.47276	D	0.999375	D;D	0.89917	1.0;0.992	D;D	0.76071	0.987;0.928	D	0.92735	0.6203	10	0.72032	D	0.01	.	14.9638	0.71176	0.0:0.0:0.0:1.0	.	1037;1037	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	W	1037;1037;1037;950	ENSP00000346534:L1037W;ENSP00000440360:L1037W;ENSP00000347255:L1037W	ENSP00000346534:L1037W	L	+	2	0	SCN8A	50449124	1.000000	0.71417	0.978000	0.43139	0.981000	0.71138	7.649000	0.83500	2.272000	0.75746	0.460000	0.39030	TTG	-	HMMPfam_Na_trans_assoc		0.522	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	protein_coding	OTTHUMT00000404372.3	T	NM_014191		50449124	+1	no_errors	NM_014191	genbank	human	validated	54_36p	missense	SNP	1.000	G
NUDT11	55190	genome.wustl.edu	37	X	51239216	51239216	+	Silent	SNP	G	G	A	rs200589562		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:51239216G>A	ENST00000375992.3	-	1	232	c.81C>T	c.(79-81)agC>agT	p.S27S		NM_018159.3	NP_060629.2	Q96G61	NUD11_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 11	27	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	9	Ovarian(276;0.236)					CCTCGCGTTCGCTCCGGAAGC	0.682										HNSCC(48;0.14)																											GBM(38;198 791 1498 11752 13599)											0			X						G		1,3833		0,1,1631,570	25.0	24.0	24.0		81	2.0	1.0	X		24	0,6727		0,0,2428,1871	no	coding-synonymous	NUDT11	NM_018159.3		0,1,4059,2441	AA,AG,GG,G		0.0,0.0261,0.0095		27/165	51239216	1,10560	2202	4299	6501	51255956	SO:0001819	synonymous_variant	55190			AK001490	CCDS43952.1	Xp11.22-p11.1	2014-05-20			ENSG00000196368	ENSG00000196368		"""Nudix motif containing"""	18011	protein-coding gene	gene with protein product						12105228	Standard	NM_018159		Approved	DIPP3b, FLJ10628, hDIPP3beta	uc010njt.3	Q96G61	OTTHUMG00000021531	ENST00000375992.3:c.81C>T	X.37:g.51239216G>A		Somatic		Capture	Illumina GAIIx	4	51255956	Q9NVN0	Silent	SNP	superfamily_NUDIX_hydrolase,HMMPfam_NUDIX,PatternScan_NUDIX	p.S27	ENST00000375992.3	37	c.81	CCDS43952.1	X																																																																																			-	superfamily_NUDIX_hydrolase,HMMPfam_NUDIX		0.682	NUDT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT11	protein_coding	OTTHUMT00000056579.1	G			51255956	-1	no_errors	NM_018159	genbank	human	validated	54_36p	silent	SNP	1.000	A
LRRC66	339977	genome.wustl.edu	37	4	52861381	52861381	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr4:52861381T>C	ENST00000343457.3	-	4	1813	c.1807A>G	c.(1807-1809)Agt>Ggt	p.S603G		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	603						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						CTTTCCTTACTATCTCCAGTC	0.448																																																0			4											78.0	80.0	79.0					4																	52861381		1975	4185	6160	52556138	SO:0001583	missense	339977			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1807A>G	4.37:g.52861381T>C	ENSP00000341944:p.Ser603Gly	Somatic		Capture	Illumina GAIIx	4	52556138		Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1	p.S603G	ENST00000343457.3	37	c.1807	CCDS43229.1	4	.	.	.	.	.	.	.	.	.	.	T	5.606	0.296531	0.10622	.	.	ENSG00000188993	ENST00000343457	T	0.30981	1.51	4.12	1.52	0.23074	.	0.964518	0.08535	N	0.931479	T	0.17152	0.0412	N	0.24115	0.695	0.09310	N	1	P	0.39480	0.675	B	0.26094	0.066	T	0.11397	-1.0589	10	0.48119	T	0.1	1.0511	9.1004	0.36664	0.0:0.0:0.3484:0.6516	.	603	Q68CR7	LRC66_HUMAN	G	603	ENSP00000341944:S603G	ENSP00000341944:S603G	S	-	1	0	LRRC66	52556138	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.662000	0.25038	0.212000	0.20703	0.482000	0.46254	AGT	-	NULL		0.448	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	protein_coding	OTTHUMT00000361473.1	T	NM_001024611		52556138	-1	no_errors	NM_001024611	genbank	human	provisional	54_36p	missense	SNP	0.000	C
ECHDC2	55268	genome.wustl.edu	37	1	53364861	53364861	+	Missense_Mutation	SNP	A	A	C	rs200777537		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:53364861A>C	ENST00000371522.4	-	8	831	c.738T>G	c.(736-738)atT>atG	p.I246M	ECHDC2_ENST00000536120.1_Missense_Mutation_p.I200M|ECHDC2_ENST00000358358.5_Missense_Mutation_p.I215M	NM_001198961.1	NP_001185890.1	Q86YB7	ECHD2_HUMAN	enoyl CoA hydratase domain containing 2	246					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	lyase activity (GO:0016829)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	12						TTCCTCGGTCAATGGCTACTT	0.562																																																0			1											90.0	76.0	81.0					1																	53364861		2203	4300	6503	53137449	SO:0001583	missense	55268			AF258590	CCDS571.1, CCDS55600.1, CCDS72794.1	1p32.3	2010-04-30	2010-04-30		ENSG00000121310	ENSG00000121310			23408	protein-coding gene	gene with protein product			"""enoyl Coenzyme A hydratase domain containing 2"""				Standard	NM_018281		Approved	FLJ10948	uc001cup.4	Q86YB7	OTTHUMG00000008927	ENST00000371522.4:c.738T>G	1.37:g.53364861A>C	ENSP00000360577:p.Ile246Met	Somatic		Capture	Illumina GAIIx	4	53137449	D3DQ36|Q9NV38	Missense_Mutation	SNP	superfamily_SSF52096,HMMPfam_ECH	p.I215M	ENST00000371522.4	37	c.645	CCDS55600.1	1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.693245	0.48202	.	.	ENSG00000121310	ENST00000371522;ENST00000358358;ENST00000536120	T;T;T	0.65364	-0.15;-0.15;-0.15	5.18	0.375	0.16188	Crontonase, C-terminal (1);	0.096119	0.64402	D	0.000001	T	0.56124	0.1964	M	0.77820	2.39	0.80722	D	1	B;B	0.25235	0.035;0.121	B;B	0.25987	0.063;0.065	T	0.49495	-0.8934	10	0.59425	D	0.04	.	4.1565	0.10263	0.4823:0.0:0.359:0.1587	.	246;215	Q86YB7;Q86YB7-2	ECHD2_HUMAN;.	M	246;215;200	ENSP00000360577:I246M;ENSP00000351125:I215M;ENSP00000439264:I200M	ENSP00000351125:I215M	I	-	3	3	ECHDC2	53137449	0.984000	0.35163	0.997000	0.53966	0.963000	0.63663	0.058000	0.14301	-0.088000	0.12506	0.402000	0.26972	ATT	-	superfamily_SSF52096		0.562	ECHDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ECHDC2	protein_coding	OTTHUMT00000024712.3	A	NM_018281		53137449	-1	no_errors	NM_018281	genbank	human	validated	54_36p	missense	SNP	0.998	C
ERC2	26059	genome.wustl.edu	37	3	56041292	56041292	+	Silent	SNP	T	T	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:56041292T>G	ENST00000288221.6	-	10	2233	c.1978A>C	c.(1978-1980)Agg>Cgg	p.R660R		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	660						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TTGGAATCCCTTTTCAGCCCC	0.353																																																0			3											91.0	75.0	80.0					3																	56041292		1806	4076	5882	56016332	SO:0001819	synonymous_variant	26059			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1978A>C	3.37:g.56041292T>G		Somatic		Capture	Illumina GAIIx	4	56016332	Q2T9F6|Q86TK4	Silent	SNP	HMMPfam_Cast,superfamily_Prefoldin	p.R660	ENST00000288221.6	37	c.1978	CCDS46851.1	3	.	.	.	.	.	.	.	.	.	.	T	7.658	0.684394	0.14907	.	.	ENSG00000187672	ENST00000492584	T	0.66460	-0.21	5.81	4.6	0.57074	.	.	.	.	.	T	0.73552	0.3601	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74112	-0.3770	6	0.44086	T	0.13	-19.2841	13.3642	0.60674	0.0:0.0:0.2249:0.7751	.	.	.	.	N	298	ENSP00000417280:K298N	ENSP00000417280:K298N	K	-	3	2	ERC2	56016332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.078000	0.64425	2.216000	0.71823	0.533000	0.62120	AAA	-	HMMPfam_Cast		0.353	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	protein_coding	OTTHUMT00000350884.2	T	NM_015576		56016332	-1	no_errors	NM_015576	genbank	human	validated	54_36p	silent	SNP	1.000	G
ZNF614	80110	genome.wustl.edu	37	19	52520484	52520484	+	Missense_Mutation	SNP	T	T	C	rs376806596		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:52520484T>C	ENST00000270649.6	-	5	911	c.367A>G	c.(367-369)Ata>Gta	p.I123V	ZNF614_ENST00000356322.6_Missense_Mutation_p.I123V	NM_025040.3	NP_079316.2	Q8N883	ZN614_HUMAN	zinc finger protein 614	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TTTTGCACTATAGGAAAATGT	0.348																																																0			19											88.0	84.0	85.0					19																	52520484		2203	4300	6503	57212296	SO:0001583	missense	80110			BC022246	CCDS12847.1	19q13.41	2013-01-08				ENSG00000142556		"""Zinc fingers, C2H2-type"", ""-"""	24722	protein-coding gene	gene with protein product						12477932	Standard	NM_025040		Approved	FLJ21941	uc002pyj.3	Q8N883		ENST00000270649.6:c.367A>G	19.37:g.52520484T>C	ENSP00000270649:p.Ile123Val	Somatic		Capture	Illumina GAIIx	4	57212296	Q494T8|Q8TCF4|Q9BSN8	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMSmart_ZnF_C2H2,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.I123V	ENST00000270649.6	37	c.367	CCDS12847.1	19	.	.	.	.	.	.	.	.	.	.	T	1.835	-0.468758	0.04445	.	.	ENSG00000142556	ENST00000356322;ENST00000270649	T;T	0.06528	5.92;3.29	2.75	-4.61	0.03380	.	.	.	.	.	T	0.02767	0.0083	N	0.12182	0.205	0.09310	N	1	B;B	0.18863	0.031;0.013	B;B	0.11329	0.006;0.004	T	0.47812	-0.9088	9	0.16896	T	0.51	.	5.9083	0.19014	0.1144:0.0:0.2304:0.6552	.	123;123	Q8N883;Q9BSN8	ZN614_HUMAN;.	V	123	ENSP00000348674:I123V;ENSP00000270649:I123V	ENSP00000270649:I123V	I	-	1	0	ZNF614	57212296	0.000000	0.05858	0.000000	0.03702	0.274000	0.26718	-1.365000	0.02587	-0.866000	0.04068	-0.254000	0.11334	ATA	-	NULL		0.348	ZNF614-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF614	protein_coding	OTTHUMT00000462407.1	T	NM_025040		57212296	-1	no_errors	NM_025040	genbank	human	validated	54_36p	missense	SNP	0.001	C
ZNF665	79788	genome.wustl.edu	37	19	53668185	53668185	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:53668185C>G	ENST00000600412.1	-	2	1478	c.1363G>C	c.(1363-1365)Ggc>Cgc	p.G455R	CTD-2245F17.2_ENST00000600257.1_RNA|ZNF665_ENST00000396424.3_Missense_Mutation_p.G520R			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		AAGGCTTTGCCACACTCATTA	0.393																																																0			19											135.0	143.0	140.0					19																	53668185		2203	4300	6503	58359997	SO:0001583	missense	79788				CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1363G>C	19.37:g.53668185C>G	ENSP00000469154:p.Gly455Arg	Somatic		Capture	Illumina GAIIx	4	58359997	A8K5T8	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.G520R	ENST00000600412.1	37	c.1558		19	.	.	.	.	.	.	.	.	.	.	C	16.98	3.271194	0.59649	.	.	ENSG00000197497	ENST00000396424	T	0.58506	0.33	2.55	-3.3	0.05003	.	.	.	.	.	T	0.70395	0.3219	M	0.78285	2.405	0.18873	N	0.999982	D	0.89917	1.0	D	0.97110	1.0	T	0.62534	-0.6834	9	0.59425	D	0.04	.	8.0585	0.30619	0.0:0.6084:0.0:0.3916	.	520	Q9H7R5-2	.	R	520	ENSP00000379702:G520R	ENSP00000379702:G520R	G	-	1	0	ZNF665	58359997	0.000000	0.05858	0.000000	0.03702	0.626000	0.37791	0.143000	0.16115	-0.794000	0.04468	-0.300000	0.09419	GGC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.393	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	ZNF665	protein_coding	OTTHUMT00000464179.1	C	NM_024733		58359997	-1	no_errors	NM_024733	genbank	human	provisional	54_36p	missense	SNP	0.956	G
LILRA4	23547	genome.wustl.edu	37	19	54848239	54848239	+	Silent	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:54848239G>A	ENST00000291759.4	-	6	1184	c.1128C>T	c.(1126-1128)taC>taT	p.Y376Y	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	376	Ig-like C2-type 4.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		ATTCAGCCTGGTACTTATGAG	0.587																																																0			19											175.0	157.0	163.0					19																	54848239		2203	4300	6503	59540051	SO:0001819	synonymous_variant	23547			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.1128C>T	19.37:g.54848239G>A		Somatic		Capture	Illumina GAIIx	4	59540051	Q32MC4	Silent	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig	p.Y376	ENST00000291759.4	37	c.1128	CCDS12890.1	19																																																																																			-	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig		0.587	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA4	protein_coding	OTTHUMT00000140229.2	G	NM_012276		59540051	-1	no_errors	NM_012276	genbank	human	reviewed	54_36p	silent	SNP	0.054	A
NLRP7	199713	genome.wustl.edu	37	19	55450536	55450536	+	Silent	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:55450536G>A	ENST00000590030.1	-	3	1691	c.1651C>T	c.(1651-1653)Ctg>Ttg	p.L551L	NLRP7_ENST00000592784.1_Silent_p.L551L|NLRP7_ENST00000588756.1_Silent_p.L551L|NLRP7_ENST00000448121.2_Silent_p.L551L|NLRP7_ENST00000446217.1_Silent_p.L579L|NLRP7_ENST00000340844.2_Silent_p.L551L|NLRP7_ENST00000328092.5_Silent_p.L551L			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	551							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TTGCATTGCAGCAATTCCTGT	0.527																																																0			19											86.0	86.0	86.0					19																	55450536		2203	4300	6503	60142348	SO:0001819	synonymous_variant	199713			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1651C>T	19.37:g.55450536G>A		Somatic		Capture	Illumina GAIIx	4	60142348	E9PE16|Q32MH8|Q7RTR1	Silent	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,superfamily_SSF52540,HMMPfam_NACHT,superfamily_SSF52047	p.L551	ENST00000590030.1	37	c.1651	CCDS33109.1	19																																																																																			-	NULL		0.527	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	protein_coding	OTTHUMT00000451396.1	G	NM_139176		60142348	-1	no_errors	NM_139176	genbank	human	reviewed	54_36p	silent	SNP	0.029	A
USP34	9736	genome.wustl.edu	37	2	61415362	61415362	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr2:61415362G>A	ENST00000398571.2	-	80	10592	c.10516C>T	c.(10516-10518)Cat>Tat	p.H3506Y	AHSA2_ENST00000394457.3_3'UTR	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	3506					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			CCTCTGGAATGGCCACAACTG	0.463																																																0			2											75.0	72.0	73.0					2																	61415362		1889	4118	6007	61268866	SO:0001583	missense	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.10516C>T	2.37:g.61415362G>A	ENSP00000381577:p.His3506Tyr	Somatic		Capture	Illumina GAIIx	4	61268866	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.H3506Y	ENST00000398571.2	37	c.10516	CCDS42686.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	16.05|16.05	3.013118|3.013118	0.54468|0.54468	.|.	.|.	ENSG00000115464|ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000436269|ENST00000411912	T|.	0.03663|.	3.85|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56601|0.56601	0.1996|0.1996	N|N	0.24115|0.24115	0.695|0.695	0.58432|0.58432	D|D	0.999997|0.999997	P|.	0.39282|.	0.666|.	B|.	0.26310|.	0.068|.	T|T	0.49447|0.49447	-0.8939|-0.8939	10|5	0.87932|.	D|.	0|.	.|.	19.8041|19.8041	0.96521|0.96521	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3506|.	Q70CQ2|.	UBP34_HUMAN|.	Y|L	3354;3271;3506;384|1182	ENSP00000381577:H3506Y|.	ENSP00000263989:H3354Y|.	H|P	-|-	1|2	0|0	USP34|USP34	61268866|61268866	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.783000|6.783000	0.75078|0.75078	2.748000|2.748000	0.94277|0.94277	0.591000|0.591000	0.81541|0.81541	CAT|CCA	-	NULL		0.463	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	protein_coding	OTTHUMT00000325650.4	G			61268866	-1	no_errors	NM_014709	genbank	human	validated	54_36p	missense	SNP	1.000	A
INADL	10207	genome.wustl.edu	37	1	62455950	62455950	+	Missense_Mutation	SNP	C	C	T	rs182582824	byFrequency	TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:62455950C>T	ENST00000371158.2	+	28	3895	c.3781C>T	c.(3781-3783)Cgc>Tgc	p.R1261C	INADL_ENST00000545929.1_5'UTR|INADL_ENST00000543708.1_Missense_Mutation_p.R45C|INADL_ENST00000316485.6_Missense_Mutation_p.R1261C	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1261	PDZ 7. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						AGACCGATCACGCATGAGCAT	0.453													C|||	2	0.000399361	0.0	0.0	5008	,	,		16564	0.001		0.0	False		,,,				2504	0.001															0			1											107.0	98.0	101.0					1																	62455950		2203	4300	6503	62228538	SO:0001583	missense	10207			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3781C>T	1.37:g.62455950C>T	ENSP00000360200:p.Arg1261Cys	Somatic		Capture	Illumina GAIIx	4	62228538	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	HMMPfam_L27_2,HMMSmart_SM00569,superfamily_L27 domain,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.R1261C	ENST00000371158.2	37	c.3781	CCDS617.2	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	23.3	4.401623	0.83120	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000307297;ENST00000543708	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	5.84	5.84	0.93424	PDZ/DHR/GLGF (4);	0.073201	0.56097	D	0.000039	T	0.53449	0.1797	L	0.37507	1.11	0.80722	D	1	B;B;B;D;P	0.63046	0.008;0.188;0.403;0.992;0.534	B;B;B;D;B	0.63793	0.017;0.096;0.106;0.918;0.118	T	0.49826	-0.8898	10	0.51188	T	0.08	.	16.4097	0.83704	0.132:0.868:0.0:0.0	.	45;720;1261;1261;1261	B4DE90;Q8NI35-5;F8W8T2;Q8NI35;Q8NI35-4	.;.;.;INADL_HUMAN;.	C	1261;1261;1261;1261;45;45	ENSP00000360200:R1261C;ENSP00000326199:R1261C;ENSP00000307496:R45C;ENSP00000445790:R45C	ENSP00000307496:R45C	R	+	1	0	INADL	62228538	0.997000	0.39634	1.000000	0.80357	0.980000	0.70556	2.574000	0.46016	2.760000	0.94817	0.655000	0.94253	CGC	-	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228		0.453	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	protein_coding	OTTHUMT00000023639.2	C	NM_170605		62228538	+1	no_errors	NM_176877	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PRKCA	5578	genome.wustl.edu	37	17	64800030	64800030	+	Nonsense_Mutation	SNP	C	C	T	rs561355502		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr17:64800030C>T	ENST00000413366.3	+	17	1920	c.1894C>T	c.(1894-1896)Cga>Tga	p.R632*		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	632	AGC-kinase C-terminal.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GTTCTTCACACGAGGACAGCC	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		20340	0.0		0.001	False		,,,				2504	0.0															0			17											141.0	120.0	127.0					17																	64800030		2203	4300	6503	62230492	SO:0001587	stop_gained	5578				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1894C>T	17.37:g.64800030C>T	ENSP00000408695:p.Arg632*	Somatic		Capture	Illumina GAIIx	4	62230492	B5BU22|Q15137|Q32M72|Q96RE4	Nonsense_Mutation	SNP	superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_SM00133,HMMPfam_Pkinase_C	p.R632*	ENST00000413366.3	37	c.1894	CCDS11664.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.189770	0.94923	.	.	ENSG00000154229	ENST00000413366	.	.	.	5.57	4.58	0.56647	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	14.1235	0.65205	0.2729:0.7271:0.0:0.0	.	.	.	.	X	632	.	ENSP00000408695:R632X	R	+	1	2	PRKCA	62230492	0.997000	0.39634	0.830000	0.32933	0.496000	0.33645	3.627000	0.54252	1.310000	0.45006	0.655000	0.94253	CGA	-	HMMSmart_SM00133,HMMPfam_Pkinase_C		0.468	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCA	protein_coding	OTTHUMT00000446976.1	C			62230492	+1	no_errors	NM_002737	genbank	human	reviewed	54_36p	nonsense	SNP	0.999	T
ZNF587	84914	genome.wustl.edu	37	19	58361424	58361424	+	Silent	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr19:58361424G>A	ENST00000339656.5	+	1	200	c.18G>A	c.(16-18)ccG>ccA	p.P6P	ZNF587_ENST00000423137.1_Silent_p.P6P|ZNF587B_ENST00000316462.4_Intron|CTD-2583A14.10_ENST00000598031.1_Intron|ZNF814_ENST00000597652.1_5'UTR	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	6					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		CGGCTGTGCCGAGGCGCCCAA	0.667																																					Pancreas(59;641 1233 1885 20055 50741)											0			19											53.0	52.0	52.0					19																	58361424		2203	4300	6503	63053236	SO:0001819	synonymous_variant	84914			AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.18G>A	19.37:g.58361424G>A		Somatic		Capture	Illumina GAIIx	4	63053236	A0AV72|G3V0H5|Q6ZMK8	Silent	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.P6	ENST00000339656.5	37	c.18	CCDS12964.1	19																																																																																			-	NULL		0.667	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF587	protein_coding	OTTHUMT00000337594.2	G	NM_032828		63053236	+1	no_errors	NM_032828	genbank	human	provisional	54_36p	silent	SNP	0.004	A
ZNF679	168417	genome.wustl.edu	37	7	63720617	63720617	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr7:63720617G>T	ENST00000421025.1	+	3	327	c.58G>T	c.(58-60)Gat>Tat	p.D20Y	ZNF679_ENST00000255746.4_Missense_Mutation_p.D20Y	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	20	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						GACATTCAGAGATGTAGTCAT	0.388																																																0			7											58.0	51.0	53.0					7																	63720617		692	1591	2283	63358052	SO:0001583	missense	168417			BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.58G>T	7.37:g.63720617G>T	ENSP00000416809:p.Asp20Tyr	Somatic		Capture	Illumina GAIIx	4	63358052		Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.D20Y	ENST00000421025.1	37	c.58	CCDS47592.1	7	.	.	.	.	.	.	.	.	.	.	g	10.71	1.426753	0.25726	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.12039	2.72;2.72	0.195	0.195	0.15151	Krueppel-associated box (4);	.	.	.	.	T	0.54319	0.1851	H	0.99929	4.97	0.25993	N	0.982216	D	0.89917	1.0	D	0.91635	0.999	T	0.44937	-0.9295	9	0.87932	D	0	.	6.2336	0.20750	3.0E-4:0.0:0.9997:0.0	.	20	Q8IYX0	ZN679_HUMAN	Y	20	ENSP00000416809:D20Y;ENSP00000255746:D20Y	ENSP00000255746:D20Y	D	+	1	0	ZNF679	63358052	0.776000	0.28616	0.086000	0.20670	0.086000	0.17979	1.751000	0.38339	0.300000	0.22699	0.306000	0.20318	GAT	-	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349		0.388	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF679	protein_coding	OTTHUMT00000344317.2	G	NM_153363		63358052	+1	no_errors	ENST00000255746	ensembl	human	known	54_36p	missense	SNP	0.024	T
SYNE2	23224	genome.wustl.edu	37	14	64518400	64518400	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr14:64518400A>G	ENST00000344113.4	+	48	7981	c.7769A>G	c.(7768-7770)gAc>gGc	p.D2590G	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.D2623G|SYNE2_ENST00000358025.3_Missense_Mutation_p.D2590G	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2590					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CACGTGACTGACATGGATAAG	0.358																																																0			14											90.0	83.0	85.0					14																	64518400		1855	4102	5957	63588153	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.7769A>G	14.37:g.64518400A>G	ENSP00000341781:p.Asp2590Gly	Somatic		Capture	Illumina GAIIx	4	63588153	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,superfamily_Spectrin,HMMSmart_SPEC,HMMPfam_Spectrin,superfamily_4_helix_cytokine,HMMPfam_KASH	p.D2590G	ENST00000344113.4	37	c.7769	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	A	1.982	-0.433851	0.04669	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.56776	1.37;1.37;0.44	5.9	-0.784	0.10954	.	0.789283	0.11617	N	0.546151	T	0.31796	0.0808	N	0.24115	0.695	0.19575	N	0.999969	B;B	0.09022	0.001;0.002	B;B	0.11329	0.003;0.006	T	0.18272	-1.0342	10	0.23302	T	0.38	.	5.6696	0.17715	0.4439:0.2605:0.2956:0.0	.	2590;2590	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	G	2590;2590;2623;2623	ENSP00000350719:D2590G;ENSP00000341781:D2590G;ENSP00000452570:D2623G	ENSP00000261678:D2623G	D	+	2	0	SYNE2	63588153	0.951000	0.32395	0.172000	0.22920	0.272000	0.26649	1.301000	0.33447	-0.363000	0.08101	0.528000	0.53228	GAC	-	NULL		0.358	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	protein_coding	OTTHUMT00000276994.2	A	NM_182914		63588153	+1	no_errors	NM_182914	genbank	human	validated	54_36p	missense	SNP	0.044	G
NRBF2	29982	genome.wustl.edu	37	10	64913962	64913962	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr10:64913962G>T	ENST00000277746.6	+	4	1029	c.848G>T	c.(847-849)gGa>gTa	p.G283V	NRBF2_ENST00000435510.2_Missense_Mutation_p.G273V	NM_030759.3	NP_110386.2	Q96F24	NRBF2_HUMAN	nuclear receptor binding factor 2	283					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)				large_intestine(2)|lung(3)|skin(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					ATTCTGAAAGGATTTATGAAT	0.393																																																0			10											29.0	33.0	32.0					10																	64913962		1922	3635	5557	64583968	SO:0001583	missense	29982			D82519	CCDS7268.1, CCDS60537.1	10q22.1	2012-11-01			ENSG00000148572	ENSG00000148572			19692	protein-coding gene	gene with protein product	"""comodulator of PPAR and RXR 1"", ""comodulator of PPAR and RXR 2"""					10786636	Standard	NM_001282405		Approved	DKFZp564C1664, FLJ30395, COPR1, COPR2	uc001jmj.4	Q96F24	OTTHUMG00000018309	ENST00000277746.6:c.848G>T	10.37:g.64913962G>T	ENSP00000277746:p.Gly283Val	Somatic		Capture	Illumina GAIIx	4	64583968	A6PW36|B4DWS0|Q86UR2|Q96NP6|Q9H0S9|Q9H2I2	Missense_Mutation	SNP	HMMPfam_DUF1875	p.G283V	ENST00000277746.6	37	c.848	CCDS7268.1	10	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890139	0.52014	.	.	ENSG00000148572	ENST00000277746;ENST00000395241;ENST00000435510	.	.	.	5.95	5.05	0.67936	.	0.093389	0.85682	D	0.000000	T	0.75591	0.3870	M	0.62723	1.935	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.67900	0.954;0.936	T	0.78518	-0.2173	9	0.72032	D	0.01	-22.3963	15.0667	0.72002	0.0678:0.0:0.9322:0.0	.	273;283	B4DWS0;Q96F24	.;NRBF2_HUMAN	V	283;233;273	.	ENSP00000277746:G283V	G	+	2	0	NRBF2	64583968	1.000000	0.71417	0.996000	0.52242	0.928000	0.56348	4.817000	0.62650	1.534000	0.49203	0.563000	0.77884	GGA	-	HMMPfam_DUF1875		0.393	NRBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRBF2	protein_coding	OTTHUMT00000048247.1	G	NM_030759		64583968	+1	no_errors	NM_030759	genbank	human	validated	54_36p	missense	SNP	1.000	T
EIF4BP9	100129692	genome.wustl.edu	37	X	65295270	65295270	+	IGR	SNP	T	T	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:65295270T>C								VSIG4 (35303 upstream) : HEPH (87120 downstream)																							AGTAATCATCTCTGGAGCTCC	0.493																																																0			X																																								65211995	SO:0001628	intergenic_variant	645430																															X.37:g.65295270T>C		Somatic		Capture	Illumina GAIIx	4	65211995		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.493					LOC645430			T			65211995	-1	pseudogene	XR_016872	genbank	human	model	54_36p	rna	SNP	0.248	C
YTHDC1	91746	genome.wustl.edu	37	4	69195973	69195973	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr4:69195973G>C	ENST00000344157.4	-	8	1513	c.1178C>G	c.(1177-1179)tCt>tGt	p.S393C	YTHDC1_ENST00000355665.3_Missense_Mutation_p.S375C|YTHDC1_ENST00000579690.1_Missense_Mutation_p.S393C	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	393	YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						ACTCCTTGCAGATCTAAATGC	0.294																																																0			4											32.0	33.0	32.0					4																	69195973		2197	4283	6480	68878568	SO:0001583	missense	91746			AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.1178C>G	4.37:g.69195973G>C	ENSP00000339245:p.Ser393Cys	Somatic		Capture	Illumina GAIIx	4	68878568	Q4W5Q3|Q7Z622|Q8TF35	Missense_Mutation	SNP	HMMPfam_YTH	p.S393C	ENST00000344157.4	37	c.1178	CCDS33992.1	4	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633781	0.67130	.	.	ENSG00000083896	ENST00000344157;ENST00000355665	T;T	0.32988	1.43;1.43	5.44	5.44	0.79542	YTH domain (2);	0.115897	0.64402	D	0.000011	T	0.56108	0.1963	M	0.70595	2.14	0.80722	D	1	D;D	0.69078	0.976;0.997	P;D	0.66196	0.863;0.942	T	0.59193	-0.7500	10	0.87932	D	0	.	19.2624	0.93973	0.0:0.0:1.0:0.0	.	375;393	Q96MU7-2;Q96MU7	.;YTDC1_HUMAN	C	393;375	ENSP00000339245:S393C;ENSP00000347888:S375C	ENSP00000339245:S393C	S	-	2	0	YTHDC1	68878568	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.414000	0.97362	2.565000	0.86533	0.591000	0.81541	TCT	-	NULL		0.294	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YTHDC1	protein_coding	OTTHUMT00000251437.1	G	NM_133370		68878568	-1	no_errors	NM_001031732	genbank	human	validated	54_36p	missense	SNP	1.000	C
AKR1B10P1	340888	genome.wustl.edu	37	10	69510294	69510294	+	IGR	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr10:69510294G>A								CTNNA3 (54367 upstream) : DNAJC12 (46132 downstream)																							CACTTTCTTTGAGAGACCCCT	0.473																																																0			10																																								69180300	SO:0001628	intergenic_variant	340888																															10.37:g.69510294G>A		Somatic		Capture	Illumina GAIIx	4	69180300		RNA	SNP	-	NULL		37	NULL		10																																																																																			-	-	0	0.473					LOC340888			G			69180300	+1	pseudogene	XR_016984	genbank	human	model	54_36p	rna	SNP	1.000	A
ARR3	407	genome.wustl.edu	37	X	69497353	69497353	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:69497353C>A	ENST00000307959.8	+	9	634	c.583C>A	c.(583-585)Caa>Aaa	p.Q195K	ARR3_ENST00000374495.3_Missense_Mutation_p.Q195K	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	195					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)				endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						TCAGCCCCTACAACTCCAGGC	0.597																																																0			X											51.0	46.0	48.0					X																	69497353		2203	4300	6503	69414078	SO:0001583	missense	407				CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.583C>A	X.37:g.69497353C>A	ENSP00000311538:p.Gln195Lys	Somatic		Capture	Illumina GAIIx	4	69414078	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Missense_Mutation	SNP	superfamily_E set domains,HMMPfam_Arrestin_N,PatternScan_ARRESTINS,HMMPfam_Arrestin_C	p.Q195K	ENST00000307959.8	37	c.583	CCDS14399.1	X	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729576	0.48833	.	.	ENSG00000120500	ENST00000374495;ENST00000374480;ENST00000307959	T;T	0.16897	2.31;2.31	4.69	2.78	0.32641	Immunoglobulin E-set (1);Arrestin, C-terminal (1);Arrestin-like, C-terminal (1);	0.421459	0.28052	N	0.016788	T	0.12092	0.0294	L	0.31294	0.92	0.35966	D	0.834931	B;B	0.09022	0.001;0.002	B;B	0.15052	0.012;0.006	T	0.08973	-1.0696	10	0.54805	T	0.06	.	8.4273	0.32735	0.1517:0.7601:0.0:0.0882	.	195;195	P36575;P36575-2	ARRC_HUMAN;.	K	195	ENSP00000363619:Q195K;ENSP00000311538:Q195K	ENSP00000311538:Q195K	Q	+	1	0	ARR3	69414078	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	3.199000	0.51043	0.893000	0.36288	0.513000	0.50165	CAA	-	superfamily_E set domains,HMMPfam_Arrestin_C		0.597	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARR3	protein_coding	OTTHUMT00000057055.2	C	NM_004312		69414078	+1	no_errors	NM_004312	genbank	human	validated	54_36p	missense	SNP	1.000	A
HYDIN	54768	genome.wustl.edu	37	16	70900208	70900208	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr16:70900208C>T	ENST00000393567.2	-	67	11485	c.11335G>A	c.(11335-11337)Gct>Act	p.A3779T	SNORD112_ENST00000515891.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3779					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ACTGAGTGAGCAGGTTCCGGA	0.458																																																0			16											14.0	13.0	13.0					16																	70900208		1776	4022	5798	69457709	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11335G>A	16.37:g.70900208C>T	ENSP00000377197:p.Ala3779Thr	Somatic		Capture	Illumina GAIIx	4	69457709	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.A3778T	ENST00000393567.2	37	c.11332	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	11.03	1.519381	0.27211	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00922	5.54	5.09	4.12	0.48240	.	0.000000	0.32736	U	0.005714	T	0.00967	0.0032	L	0.35288	1.05	0.80722	D	1	B	0.26002	0.139	B	0.24541	0.054	T	0.67154	-0.5742	10	0.20519	T	0.43	.	11.293	0.49261	0.0:0.9135:0.0:0.0865	.	3778	F8WD23	.	T	3779;3778	ENSP00000377197:A3779T	ENSP00000313052:A3778T	A	-	1	0	HYDIN	69457709	0.000000	0.05858	0.977000	0.42913	0.552000	0.35366	0.658000	0.24979	2.546000	0.85860	0.436000	0.28706	GCT	-	NULL		0.458	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	C			69457709	-1	no_errors	NM_032821	genbank	human	validated	54_36p	missense	SNP	0.494	T
ZNF407	55628	genome.wustl.edu	37	18	72343936	72343936	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr18:72343936C>T	ENST00000299687.5	+	1	961	c.961C>T	c.(961-963)Cga>Tga	p.R321*	ZNF407_ENST00000309902.6_Nonsense_Mutation_p.R321*|ZNF407_ENST00000582337.1_Nonsense_Mutation_p.R321*|ZNF407_ENST00000577538.1_Nonsense_Mutation_p.R321*	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AAAAGGATTACGAAATGTGGG	0.343																																																0			18											120.0	122.0	122.0					18																	72343936		1836	4092	5928	70472924	SO:0001587	stop_gained	55628			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.961C>T	18.37:g.72343936C>T	ENSP00000299687:p.Arg321*	Somatic		Capture	Illumina GAIIx	4	70472924	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Nonsense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00451,superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.R321*	ENST00000299687.5	37	c.961	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	C	28.3	4.912628	0.92178	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	.	.	.	5.03	-1.63	0.08345	.	1.065480	0.07772	U	0.951879	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	1.9003	0.03266	0.4893:0.225:0.1177:0.168	.	.	.	.	X	321	.	ENSP00000299687:R321X	R	+	1	2	ZNF407	70472924	0.001000	0.12720	0.000000	0.03702	0.082000	0.17680	0.904000	0.28491	-0.565000	0.06061	-0.136000	0.14681	CGA	-	NULL		0.343	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	protein_coding	OTTHUMT00000444903.1	C	NM_017757		70472924	+1	no_errors	NM_017757	genbank	human	provisional	54_36p	nonsense	SNP	0.000	T
PHKA1	5255	genome.wustl.edu	37	X	71813121	71813121	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:71813121G>T	ENST00000373542.4	-	29	3235	c.3076C>A	c.(3076-3078)Cct>Act	p.P1026T	PHKA1_ENST00000541944.1_Missense_Mutation_p.P954T|PHKA1_ENST00000339490.3_Missense_Mutation_p.P1013T|PHKA1_ENST00000373539.3_Missense_Mutation_p.P1043T|PHKA1_ENST00000373545.3_Missense_Mutation_p.P984T	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	1026					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GAGGTTCCAGGTGACTTGGAA	0.408																																																0			X											64.0	56.0	59.0					X																	71813121		2203	4300	6503	71729846	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.3076C>A	X.37:g.71813121G>T	ENSP00000362643:p.Pro1026Thr	Somatic		Capture	Illumina GAIIx	4	71729846	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	HMMPfam_PHK_AB,superfamily_Six-hairpin glycosidases	p.P1026T	ENST00000373542.4	37	c.3076	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423101	0.25639	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.90504	-2.64;-2.68;-2.64;-2.67;-2.63	5.05	4.19	0.49359	.	0.298224	0.32055	N	0.006645	D	0.83857	0.5345	L	0.45228	1.405	0.35458	D	0.796287	B;B;B;B	0.30763	0.294;0.215;0.106;0.138	B;B;B;B	0.25987	0.039;0.065;0.048;0.065	T	0.80162	-0.1497	10	0.12430	T	0.62	-6.04	10.524	0.44936	0.0979:0.0:0.9021:0.0	.	954;984;1013;1026	B7ZL07;A6NIT2;P46020-2;P46020	.;.;.;KPB1_HUMAN	T	984;1026;954;1013;1043	ENSP00000362646:P984T;ENSP00000362643:P1026T;ENSP00000441251:P954T;ENSP00000342469:P1013T;ENSP00000362640:P1043T	ENSP00000342469:P1013T	P	-	1	0	PHKA1	71729846	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	2.980000	0.49321	0.914000	0.36822	0.594000	0.82650	CCT	-	HMMPfam_PHK_AB		0.408	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	protein_coding	OTTHUMT00000058896.1	G			71729846	-1	no_errors	NM_002637	genbank	human	validated	54_36p	missense	SNP	1.000	T
LRRC20	55222	genome.wustl.edu	37	10	72083641	72083641	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr10:72083641G>C	ENST00000355790.4	-	4	855	c.378C>G	c.(376-378)aaC>aaG	p.N126K	LRRC20_ENST00000373224.1_Missense_Mutation_p.N126K|LRRC20_ENST00000395011.1_Missense_Mutation_p.N76K|LRRC20_ENST00000395010.1_Intron|LRRC20_ENST00000358141.2_Missense_Mutation_p.N76K	NM_001278212.1|NM_001278214.1|NM_207119.1	NP_001265141.1|NP_001265143.1|NP_997002.1	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20	126										endometrium(2)|large_intestine(4)|lung(2)|urinary_tract(1)	9						TCTCCTCCAGGTTGATGGTCT	0.642																																																0			10											70.0	65.0	67.0					10																	72083641		2203	4300	6503	71753647	SO:0001583	missense	55222			BC024001	CCDS7300.1, CCDS7301.1, CCDS7302.1, CCDS73145.1	10q22.2	2004-04-15			ENSG00000172731	ENSG00000172731			23421	protein-coding gene	gene with protein product							Standard	NM_207119		Approved	FLJ10751, FLJ10844	uc031pvr.1	Q8TCA0	OTTHUMG00000018407	ENST00000355790.4:c.378C>G	10.37:g.72083641G>C	ENSP00000348043:p.Asn126Lys	Somatic		Capture	Illumina GAIIx	4	71753647	Q5T6D4|Q5T6D6|Q9NVA6|Q9NVG3	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1	p.N126K	ENST00000355790.4	37	c.378	CCDS7302.1	10	.	.	.	.	.	.	.	.	.	.	G	12.75	2.030744	0.35797	.	.	ENSG00000172731	ENST00000373224;ENST00000355790;ENST00000395011;ENST00000358141;ENST00000446961	T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28	5.37	2.2	0.27929	.	0.091715	0.64402	D	0.000001	T	0.52008	0.1708	L	0.56280	1.765	0.80722	D	1	B;B	0.28760	0.221;0.089	B;B	0.34931	0.121;0.192	T	0.38265	-0.9669	10	0.28530	T	0.3	-18.7842	10.8437	0.46730	0.2031:0.0:0.7969:0.0	.	76;126	Q8TCA0-2;Q8TCA0	.;LRC20_HUMAN	K	126;126;76;76;126	ENSP00000362321:N126K;ENSP00000348043:N126K;ENSP00000378458:N76K;ENSP00000350860:N76K;ENSP00000413745:N126K	ENSP00000348043:N126K	N	-	3	2	LRRC20	71753647	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	1.427000	0.34881	0.122000	0.18314	0.563000	0.77884	AAC	-	superfamily_L domain-like,HMMSmart_SM00369		0.642	LRRC20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC20	protein_coding	OTTHUMT00000048510.1	G	NM_018239		71753647	-1	no_errors	NM_207119	genbank	human	validated	54_36p	missense	SNP	0.996	C
PDE2A	5138	genome.wustl.edu	37	11	72288541	72288541	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr11:72288541G>A	ENST00000334456.5	-	31	2958	c.2713C>T	c.(2713-2715)Cgc>Tgc	p.R905C	PDE2A_ENST00000540345.1_Missense_Mutation_p.R896C|PDE2A_ENST00000544570.1_Missense_Mutation_p.R898C|PDE2A_ENST00000418754.2_Missense_Mutation_p.R790C|PDE2A_ENST00000376450.3_Missense_Mutation_p.R649C|PDE2A_ENST00000444035.2_Missense_Mutation_p.R896C	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	905					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	GGGAGGCCGCGGATGGTGAAC	0.607																																																0			11											132.0	103.0	113.0					11																	72288541		2200	4293	6493	71966189	SO:0001583	missense	5138			U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.2713C>T	11.37:g.72288541G>A	ENSP00000334910:p.Arg905Cys	Somatic		Capture	Illumina GAIIx	4	71966189	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	superfamily_GAF domain-like,HMMPfam_GAF,HMMSmart_SM00065,superfamily_HD-domain/PDEase-like,HMMSmart_SM00471,HMMPfam_PDEase_I,PatternScan_PDEASE_I	p.R905C	ENST00000334456.5	37	c.2713	CCDS8216.1	11	.	.	.	.	.	.	.	.	.	.	G	30	5.054306	0.93793	.	.	ENSG00000186642	ENST00000334456;ENST00000376450;ENST00000444035;ENST00000544570;ENST00000418754;ENST00000540345	T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	5.47	5.47	0.80525	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.667620	0.13877	N	0.356570	T	0.81307	0.4795	L	0.27053	0.805	0.80722	D	1	D;D;D;D;D;D	0.89917	0.995;1.0;1.0;1.0;0.999;0.999	P;P;D;D;P;P	0.73380	0.507;0.827;0.941;0.98;0.827;0.69	T	0.80921	-0.1166	10	0.87932	D	0	.	13.269	0.60150	0.0:0.0:0.8414:0.1586	.	790;905;896;898;905;649	E9PEF1;O00408;E9PGI1;F6W5Z0;B2R646;Q6ZMR1	.;PDE2A_HUMAN;.;.;.;.	C	905;649;896;898;790;896	ENSP00000334910:R905C;ENSP00000365633:R649C;ENSP00000411657:R896C;ENSP00000442256:R898C;ENSP00000410310:R790C;ENSP00000446399:R896C	ENSP00000334910:R905C	R	-	1	0	PDE2A	71966189	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.082000	0.64450	2.723000	0.93209	0.655000	0.94253	CGC	-	superfamily_HD-domain/PDEase-like		0.607	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE2A	protein_coding	OTTHUMT00000219839.2	G	NM_002599		71966189	-1	no_errors	NM_002599	genbank	human	validated	54_36p	missense	SNP	1.000	A
XIST	7503	genome.wustl.edu	37	X	73068899	73068899	+	lincRNA	SNP	A	A	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:73068899A>T	ENST00000429829.1	-	0	3689					NR_001564.2				X inactive specific transcript (non-protein coding)																		ACTATGGATAATTGGGATTTT	0.403																																																0			X											61.0	61.0	61.0					X																	73068899		876	1991	2867	72985624			7503			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73068899A>T		Somatic		Capture	Illumina GAIIx	4	72985624		RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			-	-		0.403	XIST-001	KNOWN	basic	lincRNA	XIST	lincRNA	OTTHUMT00000057239.1	A	NR_001564		72985624	-1	no_errors	NR_001564	genbank	human	reviewed	54_36p	rna	SNP	0.115	T
DCTN1	1639	genome.wustl.edu	37	2	74593618	74593618	+	Missense_Mutation	SNP	G	G	T	rs527389133		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr2:74593618G>T	ENST00000361874.3	-	22	2913	c.2596C>A	c.(2596-2598)Ctg>Atg	p.L866M	DCTN1_ENST00000394003.3_Missense_Mutation_p.L859M|DCTN1_ENST00000409868.1_Missense_Mutation_p.L849M|DCTN1_ENST00000407639.2_Missense_Mutation_p.L732M|DCTN1_ENST00000409438.1_Missense_Mutation_p.L732M|DCTN1_ENST00000409240.1_Missense_Mutation_p.L829M|DCTN1_ENST00000409567.3_Missense_Mutation_p.L846M|DCTN1_ENST00000495643.1_Intron	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	866					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						AGTTCCTCCAGAGCAGCCACA	0.592																																																0			2											88.0	87.0	87.0					2																	74593618		2203	4300	6503	74447126	SO:0001583	missense	1639				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2596C>A	2.37:g.74593618G>T	ENSP00000354791:p.Leu866Met	Somatic		Capture	Illumina GAIIx	4	74447126	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1,superfamily_Spectrin repeat	p.L866M	ENST00000361874.3	37	c.2596	CCDS1939.1	2	.	.	.	.	.	.	.	.	.	.	G	10.54	1.378769	0.24944	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	T;T;T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45;-1.45;-1.45	5.22	2.42	0.29668	.	0.000000	0.31438	N	0.007643	T	0.68723	0.3032	L	0.40543	1.245	0.40894	D	0.984095	P;B;B;P;P;B	0.47409	0.693;0.172;0.016;0.556;0.895;0.028	B;B;B;B;B;B	0.38921	0.161;0.045;0.006;0.285;0.221;0.014	T	0.67067	-0.5764	10	0.39692	T	0.17	-5.9273	9.8339	0.40958	0.2333:0.0:0.7667:0.0	.	846;829;866;859;732;732	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	M	866;859;849;732;732;829;849;846	ENSP00000354791:L866M;ENSP00000377571:L859M;ENSP00000384844:L732M;ENSP00000387270:L732M;ENSP00000386406:L829M;ENSP00000387327:L849M;ENSP00000386843:L846M	ENSP00000354791:L866M	L	-	1	2	DCTN1	74447126	0.999000	0.42202	1.000000	0.80357	0.894000	0.52154	2.051000	0.41307	0.790000	0.33803	-0.251000	0.11542	CTG	-	NULL		0.592	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	protein_coding	OTTHUMT00000252227.3	G	NM_004082		74447126	-1	no_errors	NM_004082	genbank	human	reviewed	54_36p	missense	SNP	0.971	T
HIP1	3092	genome.wustl.edu	37	7	75174028	75174028	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr7:75174028C>A	ENST00000336926.6	-	27	2757	c.2731G>T	c.(2731-2733)Gct>Tct	p.A911S	HIP1_ENST00000434438.2_Missense_Mutation_p.A860S	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	911	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.|Important for actin binding. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GTGCTAGCAGCAATTTCATGA	0.517			T	PDGFRB	CMML																																		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0			7											113.0	103.0	106.0					7																	75174028		2203	4300	6503	75011964	SO:0001583	missense	3092			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2731G>T	7.37:g.75174028C>A	ENSP00000336747:p.Ala911Ser	Somatic		Capture	Illumina GAIIx	4	75011964	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	HMMPfam_ANTH,superfamily_ENTH/VHS domain,HMMSmart_SM00273,superfamily_ARM repeat,superfamily_I/LWEQ domain (Pfam 01608),HMMSmart_SM00307,HMMPfam_I_LWEQ	p.A911S	ENST00000336926.6	37	c.2731	CCDS34669.1	7	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439467	0.83885	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.47528	0.84;0.84	5.6	4.72	0.59763	I/LWEQ (4);	0.048853	0.85682	D	0.000000	T	0.61324	0.2338	L	0.58354	1.805	0.58432	D	0.999998	D;D	0.55605	0.972;0.966	P;D	0.64042	0.896;0.921	T	0.61431	-0.7064	10	0.45353	T	0.12	-10.9107	12.7825	0.57485	0.0:0.9209:0.0:0.0791	.	860;911	E7ES17;O00291	.;HIP1_HUMAN	S	911;860	ENSP00000336747:A911S;ENSP00000410300:A860S	ENSP00000336747:A911S	A	-	1	0	HIP1	75011964	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.781000	0.68964	1.372000	0.46190	0.655000	0.94253	GCT	-	superfamily_I/LWEQ domain (Pfam 01608),HMMSmart_SM00307,HMMPfam_I_LWEQ		0.517	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	protein_coding	OTTHUMT00000342863.2	C	NM_005338		75011964	-1	no_errors	NM_005338	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
ROBO2	6092	genome.wustl.edu	37	3	77612450	77612450	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:77612450C>T	ENST00000461745.1	+	11	2552	c.1652C>T	c.(1651-1653)cCa>cTa	p.P551L	ROBO2_ENST00000487694.3_Missense_Mutation_p.P567L|ROBO2_ENST00000332191.8_Missense_Mutation_p.P551L	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	551	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GGAACCCTTCCAGCAAGTGCA	0.478																																																0			3											100.0	98.0	99.0					3																	77612450		1910	4113	6023	77695140	SO:0001583	missense	6092			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1652C>T	3.37:g.77612450C>T	ENSP00000417164:p.Pro551Leu	Somatic		Capture	Illumina GAIIx	4	77695140	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.P551L	ENST00000461745.1	37	c.1652	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173824	0.78452	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.60171	0.21;0.21;0.21	6.07	6.07	0.98685	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.45606	D	0.000345	T	0.74989	0.3789	M	0.80982	2.52	0.48901	D	0.999727	P;P;P	0.48350	0.909;0.814;0.845	P;P;P	0.54312	0.718;0.748;0.718	T	0.76044	-0.3103	9	0.66056	D	0.02	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	567;551;551	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	L	567;567;571;551;551;272	ENSP00000417335:P567L;ENSP00000417164:P551L;ENSP00000327536:P551L	ENSP00000327536:P551L	P	+	2	0	ROBO2	77695140	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.037000	0.70956	2.885000	0.99019	0.655000	0.94253	CCA	-	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3		0.478	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	protein_coding	OTTHUMT00000352600.2	C	XM_031246		77695140	+1	no_errors	NM_002942	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BHMT	635	genome.wustl.edu	37	5	78416291	78416291	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:78416291C>A	ENST00000274353.5	+	4	511	c.404C>A	c.(403-405)aCt>aAt	p.T135N	BHMT_ENST00000524080.1_Intron|DMGDH_ENST00000520388.1_Intron	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	135	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	AAGAGTGAAACTGAAGTCAAA	0.443																																																0			5											77.0	68.0	71.0					5																	78416291		2203	4300	6503	78452047	SO:0001583	missense	635			BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.404C>A	5.37:g.78416291C>A	ENSP00000274353:p.Thr135Asn	Somatic		Capture	Illumina GAIIx	4	78452047	Q9UNI9	Missense_Mutation	SNP	superfamily_S_methyl_trans,HMMPfam_S-methyl_trans	p.T135N	ENST00000274353.5	37	c.404	CCDS4046.1	5	.	.	.	.	.	.	.	.	.	.	c	0.135	-1.108897	0.01813	.	.	ENSG00000145692	ENST00000274353	T	0.28895	1.59	5.22	1.3	0.21679	Homocysteine S-methyltransferase (4);	0.873904	0.10635	N	0.651679	T	0.24736	0.0600	L	0.43152	1.355	0.09310	N	0.999999	B	0.09022	0.002	B	0.14023	0.01	T	0.27502	-1.0072	10	0.59425	D	0.04	-24.3335	6.1488	0.20301	0.0:0.6018:0.1234:0.2748	.	135	Q93088	BHMT1_HUMAN	N	135	ENSP00000274353:T135N	ENSP00000274353:T135N	T	+	2	0	BHMT	78452047	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.048000	0.14078	0.018000	0.15052	-1.000000	0.02509	ACT	-	superfamily_S_methyl_trans,HMMPfam_S-methyl_trans		0.443	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHMT	protein_coding	OTTHUMT00000226961.1	C	NM_001713		78452047	+1	no_errors	NM_001713	genbank	human	reviewed	54_36p	missense	SNP	0.002	A
PAPD4	167153	genome.wustl.edu	37	5	78940990	78940990	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:78940990A>G	ENST00000296783.3	+	9	1095	c.796A>G	c.(796-798)Att>Gtt	p.I266V	PAPD4_ENST00000504233.1_Missense_Mutation_p.I266V|PAPD4_ENST00000423041.2_Missense_Mutation_p.I262V|PAPD4_ENST00000453514.1_Missense_Mutation_p.I266V|PAPD4_ENST00000428308.2_Missense_Mutation_p.I266V			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	266					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)			biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		AAAAGTGCCAATTGTGAAGTT	0.333																																																0			5											99.0	101.0	100.0					5																	78940990		2203	4300	6503	78976746	SO:0001583	missense	167153			AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.796A>G	5.37:g.78940990A>G	ENSP00000296783:p.Ile266Val	Somatic		Capture	Illumina GAIIx	4	78976746	Q86WZ2|Q8N927	Missense_Mutation	SNP	superfamily_Nucleotidyltransferase,superfamily_PAP/OAS1 substrate-binding domain,HMMPfam_PAP_assoc	p.I266V	ENST00000296783.3	37	c.796	CCDS4048.1	5	.	.	.	.	.	.	.	.	.	.	A	25.5	4.647503	0.87958	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000504233;ENST00000428308;ENST00000296783	T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.70544	0.3236	M	0.64170	1.965	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.994	D;D;D	0.91635	0.968;0.999;0.987	T	0.73344	-0.4012	10	0.72032	D	0.01	-14.6921	15.9846	0.80142	1.0:0.0:0.0:0.0	.	266;262;266	Q6PIY7;Q6PIY7-2;D6RAF2	GLD2_HUMAN;.;.	V	266;262;266;266;266	ENSP00000397563:I266V;ENSP00000393412:I262V;ENSP00000421966:I266V;ENSP00000396861:I266V;ENSP00000296783:I266V	ENSP00000296783:I266V	I	+	1	0	PAPD4	78976746	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.874000	0.92363	2.172000	0.68678	0.467000	0.42956	ATT	-	superfamily_Nucleotidyltransferase		0.333	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD4	protein_coding	OTTHUMT00000226967.1	A	NM_173797		78976746	+1	no_errors	NM_173797	genbank	human	validated	54_36p	missense	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	X	79816462	79816462	+	IGR	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:79816462G>T								FAM46D (115652 upstream) : BRWD3 (109890 downstream)																							ACTGATGACAGTGACACCAAC	0.443																																																0			X																																								79703118	SO:0001628	intergenic_variant	727874																															X.37:g.79816462G>T		Somatic		Capture	Illumina GAIIx	4	79703118		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.443					LOC727874			G			79703118	+1	pseudogene	XR_042356	genbank	human	model	54_36p	rna	SNP	1.000	T
BRWD3	254065	genome.wustl.edu	37	X	79943572	79943572	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:79943572C>T	ENST00000373275.4	-	34	4076	c.3860G>A	c.(3859-3861)aGa>aAa	p.R1287K	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1287					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						ACTCACCTTTCTTCCAGATGA	0.383																																																0			X											125.0	114.0	117.0					X																	79943572		2203	4300	6503	79830228	SO:0001583	missense	254065				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.3860G>A	X.37:g.79943572C>T	ENSP00000362372:p.Arg1287Lys	Somatic		Capture	Illumina GAIIx	4	79830228	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	HMMSmart_SM00320,HMMPfam_WD40,superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase,PatternScan_WD_REPEATS_1,superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain	p.R1287K	ENST00000373275.4	37	c.3860	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	C	9.847	1.192629	0.21954	.	.	ENSG00000165288	ENST00000373275	T	0.17854	2.25	5.0	4.07	0.47477	Bromodomain (1);	0.332014	0.36628	N	0.002487	T	0.11965	0.0291	L	0.28649	0.875	0.28122	N	0.93058	B	0.14805	0.011	B	0.16722	0.016	T	0.12066	-1.0562	9	.	.	.	-16.6442	10.403	0.44241	0.1454:0.7714:0.0:0.0832	.	1287	Q6RI45	BRWD3_HUMAN	K	1287	ENSP00000362372:R1287K	.	R	-	2	0	BRWD3	79830228	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	2.789000	0.47813	2.299000	0.77371	0.594000	0.82650	AGA	-	superfamily_Bromodomain		0.383	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	protein_coding	OTTHUMT00000057344.1	C	NM_153252		79830228	-1	no_errors	NM_153252	genbank	human	validated	54_36p	missense	SNP	0.834	T
SCD5	79966	genome.wustl.edu	37	4	83557769	83557769	+	Silent	SNP	G	G	A	rs145735011		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr4:83557769G>A	ENST00000319540.4	-	4	1096	c.777C>T	c.(775-777)aaC>aaT	p.N259N		NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	259					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				CGACGAGTGGGTTCTGCCGAG	0.562																																																0			4						G		1,4405	2.1+/-5.4	0,1,2202	106.0	94.0	98.0		777	5.1	1.0	4	dbSNP_134	98	0,8600		0,0,4300	no	coding-synonymous	SCD5	NM_001037582.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		259/331	83557769	1,13005	2203	4300	6503	83776793	SO:0001819	synonymous_variant	79966			AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.777C>T	4.37:g.83557769G>A		Somatic		Capture	Illumina GAIIx	4	83776793	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Silent	SNP	HMMPfam_FA_desaturase,PatternScan_FATTY_ACID_DESATUR_1	p.N259	ENST00000319540.4	37	c.777	CCDS34024.1	4																																																																																			-	HMMPfam_FA_desaturase		0.562	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCD5	protein_coding	OTTHUMT00000252635.1	G	NM_024906		83776793	-1	no_errors	NM_001037582	genbank	human	validated	54_36p	silent	SNP	0.257	A
Unknown	0	genome.wustl.edu	37	5	84845460	84845460	+	IGR	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:84845460G>A								AC026700.1 (21508 upstream) : AC010595.1 (84769 downstream)																							CAAAGGCGTCGAAGGGCTCAG	0.527																																																0			5																																								84881216	SO:0001628	intergenic_variant	645181																															5.37:g.84845460G>A		Somatic		Capture	Illumina GAIIx	4	84881216		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.527					LOC645181			G			84881216	+1	pseudogene	XR_017382	genbank	human	model	54_36p	rna	SNP	1.000	A
POLR1A	25885	genome.wustl.edu	37	2	86270117	86270117	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr2:86270117G>A	ENST00000263857.6	-	23	3715	c.3337C>T	c.(3337-3339)Cgc>Tgc	p.R1113C	POLR1A_ENST00000409681.1_Missense_Mutation_p.R1113C			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1113					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CCAGGGCTGCGGCCATTGCGG	0.547																																																0			2											92.0	98.0	96.0					2																	86270117		1996	4171	6167	86123628	SO:0001583	missense	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.3337C>T	2.37:g.86270117G>A	ENSP00000263857:p.Arg1113Cys	Somatic		Capture	Illumina GAIIx	4	86123628	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	superfamily_beta and beta-prime subunits of DNA dependent RNA-polymerase,HMMPfam_RNA_pol_Rpb1_1,HMMSmart_SM00663,HMMPfam_RNA_pol_Rpb1_2,HMMPfam_RNA_pol_Rpb1_3,HMMPfam_RNA_pol_Rpb1_4,HMMPfam_RNA_pol_Rpb1_5	p.R1113C	ENST00000263857.6	37	c.3337	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	G	11.60	1.687092	0.29962	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.67171	-0.25;-0.25	5.6	5.6	0.85130	RNA polymerase Rpb1, domain 5 (1);	0.050705	0.64402	D	0.000001	D	0.83248	0.5213	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.85335	0.1092	10	0.62326	D	0.03	-24.3733	13.5945	0.61982	0.0:0.0:0.7405:0.2594	.	479;1113	B7Z8X7;O95602	.;RPA1_HUMAN	C	1113	ENSP00000263857:R1113C;ENSP00000386300:R1113C	ENSP00000263857:R1113C	R	-	1	0	POLR1A	86123628	1.000000	0.71417	1.000000	0.80357	0.057000	0.15508	3.420000	0.52735	2.653000	0.90120	0.561000	0.74099	CGC	-	superfamily_beta and beta-prime subunits of DNA dependent RNA-polymerase,HMMPfam_RNA_pol_Rpb1_5		0.547	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	protein_coding	OTTHUMT00000329830.2	G	NM_015425		86123628	-1	no_errors	NM_015425	genbank	human	validated	54_36p	missense	SNP	0.997	A
DUSP6	1848	genome.wustl.edu	37	12	89743205	89743205	+	Silent	SNP	T	T	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:89743205T>C	ENST00000279488.7	-	3	2203	c.972A>G	c.(970-972)aaA>aaG	p.K324K	DUSP6_ENST00000308385.6_Silent_p.K178K|DUSP6_ENST00000547291.1_Silent_p.K199K|DUSP6_ENST00000547140.1_5'Flank	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	324	Tyrosine-protein phosphatase.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						ATTTTTTCATTTTGACAATGT	0.488																																					Colon(132;3456 5224)											0			12											145.0	134.0	138.0					12																	89743205		2203	4300	6503	88267336	SO:0001819	synonymous_variant	1848			BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.972A>G	12.37:g.89743205T>C		Somatic		Capture	Illumina GAIIx	4	88267336	O75109|Q53Y75|Q9BSH6	Silent	SNP	superfamily_Rhodanese/Cell cycle control phosphatase,HMMPfam_Rhodanese,HMMSmart_SM00450,superfamily_(Phosphotyrosine protein) phosphatases II,HMMPfam_DSPc,HMMSmart_SM00195	p.K324	ENST00000279488.7	37	c.972	CCDS9033.1	12																																																																																			-	superfamily_(Phosphotyrosine protein) phosphatases II,HMMPfam_DSPc,HMMSmart_SM00195		0.488	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP6	protein_coding	OTTHUMT00000406534.2	T	NM_001946, NM_022652		88267336	-1	no_errors	NM_001946	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
AGAP11	119385	genome.wustl.edu	37	10	88769594	88769594	+	RNA	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr10:88769594C>T	ENST00000444431.1	+	0	4194				RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.10_ENST00000451760.1_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										GACCTACGCCCGGCAGGCCTC	0.612																																																0			10											2.0	3.0	3.0					10																	88769594		947	2294	3241	88759574			119385					10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88769594C>T		Somatic		Capture	Illumina GAIIx	4	88759574	B9EIP7|D3DWE4	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,superfamily_ArfGAP,HMMPfam_ArfGap,HMMSmart_ArfGap,superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.R529W	ENST00000444431.1	37	c.1585		10																																																																																			-	superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK		0.612	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	AGAP11	processed_transcript	OTTHUMT00000049193.1	C	NM_133447		88759574	+1	no_errors	NM_133447	genbank	human	validated	54_36p	missense	SNP	0.999	T
RPS6KA5	9252	genome.wustl.edu	37	14	91386637	91386637	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr14:91386637C>T	ENST00000261991.3	-	7	892	c.719G>A	c.(718-720)aGt>aAt	p.S240N	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.S161N|RPS6KA5_ENST00000418736.2_Missense_Mutation_p.S240N	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	240	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		AACACCCAAACTCCACCAGTC	0.294																																																0			14											93.0	100.0	98.0					14																	91386637		2203	4299	6502	90456390	SO:0001583	missense	9252			AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.719G>A	14.37:g.91386637C>T	ENSP00000261991:p.Ser240Asn	Somatic		Capture	Illumina GAIIx	4	90456390	O95316|Q96AF7	Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_S_TK_X,HMMPfam_Pkinase_C	p.S240N	ENST00000261991.3	37	c.719	CCDS9893.1	14	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749552	0.89753	.	.	ENSG00000100784	ENST00000261991;ENST00000536315;ENST00000418736	T;T;T	0.52754	0.65;0.65;0.65	5.31	5.31	0.75309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79131	0.4394	H	0.95365	3.66	0.80722	D	1	D;D	0.89917	0.967;1.0	P;D	0.75484	0.828;0.986	D	0.85839	0.1396	10	0.87932	D	0	.	18.9634	0.92685	0.0:1.0:0.0:0.0	.	240;240	O75582-2;O75582	.;KS6A5_HUMAN	N	240;161;240	ENSP00000261991:S240N;ENSP00000442803:S161N;ENSP00000402787:S240N	ENSP00000261991:S240N	S	-	2	0	RPS6KA5	90456390	1.000000	0.71417	0.999000	0.59377	0.936000	0.57629	7.099000	0.76981	2.469000	0.83416	0.650000	0.86243	AGT	-	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase		0.294	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA5	protein_coding	OTTHUMT00000411442.2	C	NM_004755		90456390	-1	no_errors	NM_004755	genbank	human	validated	54_36p	missense	SNP	1.000	T
PABPC5	140886	genome.wustl.edu	37	X	90691049	90691049	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:90691049C>A	ENST00000312600.3	+	2	687	c.473C>A	c.(472-474)gCc>gAc	p.A158D	PABPC5_ENST00000373105.1_5'UTR|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	158	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						CTGGCCGCTGCCAATAGAGCC	0.507																																																0			X											53.0	47.0	49.0					X																	90691049		2203	4300	6503	90577705	SO:0001583	missense	140886			AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.473C>A	X.37:g.90691049C>A	ENSP00000308012:p.Ala158Asp	Somatic		Capture	Illumina GAIIx	4	90577705	A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	HMMSmart_SM00360,HMMPfam_RRM_1,superfamily_RNA-binding domain RBD,HMMSmart_SM00361	p.A158D	ENST00000312600.3	37	c.473	CCDS14460.1	X	.	.	.	.	.	.	.	.	.	.	C	20.2	3.945365	0.73672	.	.	ENSG00000174740	ENST00000312600;ENST00000402906	T	0.32272	1.46	4.43	4.43	0.53597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.71187	0.3310	H	0.98883	4.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83041	-0.0157	10	0.87932	D	0	.	13.8904	0.63736	0.0:1.0:0.0:0.0	.	158	Q96DU9	PABP5_HUMAN	D	158;126	ENSP00000308012:A158D	ENSP00000308012:A158D	A	+	2	0	PABPC5	90577705	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.621000	0.67743	2.450000	0.82876	0.600000	0.82982	GCC	-	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMSmart_SM00361,HMMPfam_RRM_1		0.507	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC5	protein_coding	OTTHUMT00000057429.1	C	NM_080832		90577705	+1	no_errors	NM_080832	genbank	human	validated	54_36p	missense	SNP	1.000	A
ARRDC3	57561	genome.wustl.edu	37	5	90670857	90670857	+	Missense_Mutation	SNP	C	C	T	rs371971226		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:90670857C>T	ENST00000265138.3	-	5	1018	c.752G>A	c.(751-753)cGt>cAt	p.R251H	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	251					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		GGATTCCCCACGCAAGTTAGC	0.468																																																0			5						C	HIS/ARG	0,4406		0,0,2203	130.0	111.0	118.0		752	6.0	1.0	5		118	1,8599	1.2+/-3.3	0,1,4299	no	missense	ARRDC3	NM_020801.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	251/415	90670857	1,13005	2203	4300	6503	90706613	SO:0001583	missense	57561			AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.752G>A	5.37:g.90670857C>T	ENSP00000265138:p.Arg251His	Somatic		Capture	Illumina GAIIx	4	90706613	A8K6T8|Q9P2H1	Missense_Mutation	SNP	HMMPfam_Arrestin_N,superfamily_Ig_E-set,HMMPfam_Arrestin_C	p.R251H	ENST00000265138.3	37	c.752	CCDS34202.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.550814	0.96501	0.0	1.16E-4	ENSG00000113369	ENST00000265138	T	0.07021	3.23	5.98	5.98	0.97165	Immunoglobulin E-set (1);Arrestin-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.27900	0.0687	L	0.56340	1.77	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00024	-1.2326	10	0.51188	T	0.08	-42.548	20.452	0.99131	0.0:1.0:0.0:0.0	.	251	Q96B67	ARRD3_HUMAN	H	251	ENSP00000265138:R251H	ENSP00000265138:R251H	R	-	2	0	ARRDC3	90706613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.786000	0.85741	2.838000	0.97847	0.591000	0.81541	CGT	-	superfamily_Ig_E-set,HMMPfam_Arrestin_C		0.468	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC3	protein_coding	OTTHUMT00000369763.2	C	NM_020801		90706613	-1	no_errors	NM_020801	genbank	human	validated	54_36p	missense	SNP	1.000	T
PCDH11X	27328	genome.wustl.edu	37	X	91237855	91237855	+	Intron	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:91237855G>T	ENST00000373094.1	+	2	3878				PCDH11X_ENST00000406881.1_Intron|PCDH11X_ENST00000373088.1_Intron|PCDH11X_ENST00000298274.8_Intron|PCDH11X_ENST00000373097.1_Intron|PCDH11X_ENST00000361655.2_Intron|PCDH11X_ENST00000504220.2_Intron	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked						homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CGAAACGCGTGTTACTGTTTC	0.458																																					NSCLC(38;925 1092 2571 38200 45895)											0			X																																								91124511	SO:0001627	intron_variant	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3033+103583G>T	X.37:g.91237855G>T		Somatic		Capture	Illumina GAIIx	4	91124511	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	RNA	SNP	-	NULL	ENST00000373094.1	37	NULL	CCDS14461.1	X																																																																																			-	-		0.458	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC100132302	protein_coding	OTTHUMT00000057436.1	G	NM_032969		91124511	-1	pseudogene	XR_038899	genbank	human	model	54_36p	rna	SNP	1.000	T
PCDH11X	27328	genome.wustl.edu	37	X	91238120	91238120	+	Intron	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:91238120T>A	ENST00000373094.1	+	2	3878				PCDH11X_ENST00000406881.1_Intron|PCDH11X_ENST00000373088.1_Intron|PCDH11X_ENST00000298274.8_Intron|PCDH11X_ENST00000373097.1_Intron|PCDH11X_ENST00000361655.2_Intron|PCDH11X_ENST00000504220.2_Intron	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked						homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GAAATCTATGTTGCAGTCCAG	0.502																																					NSCLC(38;925 1092 2571 38200 45895)											0			X																																								91124776	SO:0001627	intron_variant	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3033+103848T>A	X.37:g.91238120T>A		Somatic		Capture	Illumina GAIIx	4	91124776	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	RNA	SNP	-	NULL	ENST00000373094.1	37	NULL	CCDS14461.1	X																																																																																			-	-		0.502	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC100132302	protein_coding	OTTHUMT00000057436.1	T	NM_032969		91124776	-1	pseudogene	XR_038899	genbank	human	model	54_36p	rna	SNP	1.000	A
C11orf54	28970	genome.wustl.edu	37	11	93486874	93486874	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr11:93486874G>T	ENST00000331239.4	+	4	360	c.181G>T	c.(181-183)Gaa>Taa	p.E61*	C11orf54_ENST00000528288.1_Nonsense_Mutation_p.E61*|C11orf54_ENST00000354421.3_Nonsense_Mutation_p.E61*|C11orf54_ENST00000540113.1_Nonsense_Mutation_p.E42*|C11orf54_ENST00000528099.1_Nonsense_Mutation_p.E61*			Q9H0W9	CK054_HUMAN	chromosome 11 open reading frame 54	61					metabolic process (GO:0008152)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)	8		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TAGAATTGCAGAAGTTGGAGG	0.333																																																0			11											103.0	102.0	102.0					11																	93486874		2201	4298	6499	93126522	SO:0001587	stop_gained	28970			AF092133	CCDS8294.1, CCDS66204.1, CCDS73365.1, CCDS73366.1	11q21	2012-08-09			ENSG00000182919	ENSG00000182919			30204	protein-coding gene	gene with protein product		615810				16522806	Standard	NM_014039		Approved	PTD012	uc001pef.3	Q9H0W9	OTTHUMG00000167452	ENST00000331239.4:c.181G>T	11.37:g.93486874G>T	ENSP00000331209:p.Glu61*	Somatic		Capture	Illumina GAIIx	4	93126522	A8K850|Q6FI88|Q6XYB0|Q96EI3|Q96IX1|Q9Y6B4	Nonsense_Mutation	SNP	HMMPfam_DUF1907	p.E61*	ENST00000331239.4	37	c.181		11	.	.	.	.	.	.	.	.	.	.	G	43	10.104306	0.99337	.	.	ENSG00000182919	ENST00000528288;ENST00000331239;ENST00000533585;ENST00000528099;ENST00000354421;ENST00000540113;ENST00000530620;ENST00000527003;ENST00000531650;ENST00000530279;ENST00000524485;ENST00000527363;ENST00000526335	.	.	.	5.32	4.41	0.53225	.	0.046079	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-11.4875	13.9249	0.63958	0.0733:0.0:0.9267:0.0	.	.	.	.	X	61;61;61;61;61;42;42;61;61;61;42;61;61	.	ENSP00000331209:E61X	E	+	1	0	C11orf54	93126522	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.836000	0.92105	1.257000	0.44085	-0.229000	0.12294	GAA	-	HMMPfam_DUF1907		0.333	C11orf54-002	KNOWN	basic|appris_principal	protein_coding	C11orf54	protein_coding	OTTHUMT00000394671.1	G	NM_014039		93126522	+1	no_errors	NM_014039	genbank	human	predicted	54_36p	nonsense	SNP	1.000	T
CEP83	51134	genome.wustl.edu	37	12	94797029	94797029	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:94797029G>C	ENST00000397809.5	-	5	883	c.334C>G	c.(334-336)Cca>Gca	p.P112A	CCDC41_ENST00000547575.1_Missense_Mutation_p.P112A|CCDC41_ENST00000339839.5_Missense_Mutation_p.P112A|CCDC41_ENST00000549352.1_5'UTR|CCDC41_ENST00000397807.2_Missense_Mutation_p.P79A	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		104					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						AATTTTTGTGGAGTTAATATC	0.303																																																0			12											125.0	118.0	120.0					12																	94797029		1805	4062	5867	93321160	SO:0001583	missense	51134																														ENST00000397809.5:c.334C>G	12.37:g.94797029G>C	ENSP00000380911:p.Pro112Ala	Somatic		Capture	Illumina GAIIx	4	93321160	A4FVB1|Q08AP1	Missense_Mutation	SNP	NULL	p.P112A	ENST00000397809.5	37	c.334	CCDS41820.1	12	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889777	0.72524	.	.	ENSG00000173588	ENST00000339839;ENST00000397809;ENST00000397807;ENST00000547575	T;T;T;T	0.62788	0.27;0.27;0.26;-0.0	5.24	5.24	0.73138	.	.	.	.	.	T	0.68997	0.3062	M	0.66939	2.045	0.46078	D	0.998855	D;D;P	0.55385	0.971;0.971;0.911	P;P;P	0.55749	0.783;0.71;0.475	T	0.66073	-0.6014	9	0.06236	T	0.91	-3.4615	16.5899	0.84762	0.0:0.0:1.0:0.0	.	112;79;104	F8VYN8;Q9Y592-2;Q9Y592	.;.;CCD41_HUMAN	A	112;112;79;112	ENSP00000344655:P112A;ENSP00000380911:P112A;ENSP00000380909:P79A;ENSP00000448913:P112A	ENSP00000344655:P112A	P	-	1	0	CCDC41	93321160	1.000000	0.71417	0.996000	0.52242	0.871000	0.50021	4.713000	0.61895	2.456000	0.83038	0.585000	0.79938	CCA	-	NULL		0.303	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCDC41	protein_coding	OTTHUMT00000408147.3	G			93321160	-1	no_errors	NM_001042399	genbank	human	validated	54_36p	missense	SNP	1.000	C
GAS2L3	283431	genome.wustl.edu	37	12	101018624	101018624	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:101018624G>A	ENST00000539410.1	+	9	2427	c.2041G>A	c.(2041-2043)Gac>Aac	p.D681N	GAS2L3_ENST00000547754.1_Missense_Mutation_p.D681N|GAS2L3_ENST00000537247.1_Missense_Mutation_p.D577N|GAS2L3_ENST00000266754.5_Missense_Mutation_p.D681N			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	681					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						GGAAGATGATGACCATTATTT	0.348																																																0			12											47.0	55.0	52.0					12																	101018624		2203	4300	6503	99542755	SO:0001583	missense	283431			AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.2041G>A	12.37:g.101018624G>A	ENSP00000439672:p.Asp681Asn	Somatic		Capture	Illumina GAIIx	4	99542755	B2RCN2	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033,HMMPfam_GAS2,HMMSmart_SM00243	p.D681N	ENST00000539410.1	37	c.2041	CCDS9079.1	12	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490295	0.84962	.	.	ENSG00000139354	ENST00000266754;ENST00000547754;ENST00000537247;ENST00000539410	T;T;T;T	0.41758	1.09;1.09;0.99;1.09	6.02	6.02	0.97574	.	0.206615	0.43919	D	0.000508	T	0.64918	0.2642	M	0.63843	1.955	0.36933	D	0.892006	D	0.89917	1.0	D	0.74674	0.984	T	0.67639	-0.5619	10	0.66056	D	0.02	-20.2503	20.5407	0.99260	0.0:0.0:1.0:0.0	.	681	Q86XJ1	GA2L3_HUMAN	N	681;681;577;681	ENSP00000266754:D681N;ENSP00000448955:D681N;ENSP00000442406:D577N;ENSP00000439672:D681N	ENSP00000266754:D681N	D	+	1	0	GAS2L3	99542755	1.000000	0.71417	0.983000	0.44433	0.832000	0.47134	4.806000	0.62569	2.865000	0.98341	0.655000	0.94253	GAC	-	NULL		0.348	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L3	protein_coding	OTTHUMT00000409143.1	G	NM_174942		99542755	+1	no_errors	NM_174942	genbank	human	provisional	54_36p	missense	SNP	1.000	A
UTP20	27340	genome.wustl.edu	37	12	101685569	101685569	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:101685569A>G	ENST00000261637.4	+	9	1115	c.941A>G	c.(940-942)gAa>gGa	p.E314G		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	314					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						AACTGTTGTGAAAGTTCTGAA	0.363																																																0			12											61.0	60.0	60.0					12																	101685569		2203	4300	6503	100209700	SO:0001583	missense	27340			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.941A>G	12.37:g.101685569A>G	ENSP00000261637:p.Glu314Gly	Somatic		Capture	Illumina GAIIx	4	100209700	Q9H3H4	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_DRIM	p.E314G	ENST00000261637.4	37	c.941	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	A	12.05	1.821436	0.32237	.	.	ENSG00000120800	ENST00000261637	T	0.67345	-0.26	5.79	4.64	0.57946	Armadillo-type fold (1);	0.371601	0.30428	N	0.009651	T	0.48484	0.1502	L	0.28740	0.885	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.19289	-1.0310	10	0.21540	T	0.41	-14.4068	6.5773	0.22573	0.7876:0.0:0.0757:0.1367	.	314	O75691	UTP20_HUMAN	G	314	ENSP00000261637:E314G	ENSP00000261637:E314G	E	+	2	0	UTP20	100209700	0.969000	0.33509	0.534000	0.28014	0.864000	0.49448	1.752000	0.38349	2.207000	0.71202	0.533000	0.62120	GAA	-	superfamily_ARM repeat		0.363	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	protein_coding	OTTHUMT00000408242.1	A	NM_014503		100209700	+1	no_errors	NM_014503	genbank	human	validated	54_36p	missense	SNP	0.967	G
ADH5	128	genome.wustl.edu	37	4	99997898	99997898	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr4:99997898C>A	ENST00000296412.8	-	5	571	c.521G>T	c.(520-522)tGt>tTt	p.C174F	ADH5_ENST00000512991.1_5'UTR	NM_000671.3	NP_000662.3			alcohol dehydrogenase 5 (class III), chi polypeptide									p.C174Y(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)		TGAAATGCCACAACCTAGAAG	0.413																																																1	Substitution - Missense(1)	large_intestine(1)	4											72.0	66.0	68.0					4																	99997898		1897	4128	6025	100216921	SO:0001583	missense	128			M29872	CCDS47111.1	4q23	2012-07-13	2003-06-19		ENSG00000197894	ENSG00000197894	1.1.1.284	"""Alcohol dehydrogenases"""	253	protein-coding gene	gene with protein product		103710	"""formaldehyde dehydrogenase"""	FDH		1446828, 6424546	Standard	NM_000671		Approved	ADH-3, ADHX	uc003hui.3	P11766	OTTHUMG00000161230	ENST00000296412.8:c.521G>T	4.37:g.99997898C>A	ENSP00000296412:p.Cys174Phe	Somatic		Capture	Illumina GAIIx	4	100216921		Missense_Mutation	SNP	superfamily_GroES-like,HMMPfam_ADH_N,PatternScan_ADH_ZINC,superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_ADH_zinc_N	p.C174F	ENST00000296412.8	37	c.521	CCDS47111.1	4	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607987	0.87258	.	.	ENSG00000197894	ENST00000296412;ENST00000503130	T;T	0.25085	1.82;1.82	5.1	5.1	0.69264	GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.75110	0.3805	H	0.99959	5.06	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87894	0.2686	9	.	.	.	-28.9543	19.0691	0.93125	0.0:1.0:0.0:0.0	.	174;174;174	Q5U043;Q6IRT1;P11766	.;.;ADHX_HUMAN	F	174;161	ENSP00000296412:C174F;ENSP00000427049:C161F	.	C	-	2	0	ADH5	100216921	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.802000	0.75175	2.822000	0.97130	0.650000	0.86243	TGT	-	superfamily_GroES-like		0.413	ADH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH5	protein_coding	OTTHUMT00000364224.1	C	NM_000671		100216921	-1	no_errors	NM_000671	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SNX31	169166	genome.wustl.edu	37	8	101601147	101601147	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr8:101601147A>T	ENST00000311812.2	-	11	1189	c.1039T>A	c.(1039-1041)Ttt>Att	p.F347I	SNX31_ENST00000519521.1_5'UTR|SNX31_ENST00000428383.2_Missense_Mutation_p.F248I	NM_152628.3	NP_689841.3	Q8N9S9	SNX31_HUMAN	sorting nexin 31	347					protein transport (GO:0015031)	protein complex (GO:0043234)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|skin(3)|urinary_tract(1)	26	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			CTGTATTGAAATCTGAGCTCT	0.418																																																0			8											117.0	109.0	112.0					8																	101601147		2203	4300	6503	101670323	SO:0001583	missense	169166				CCDS6288.1	8q22.3	2011-05-03			ENSG00000174226	ENSG00000174226		"""Sorting nexins"""	28605	protein-coding gene	gene with protein product						16782399	Standard	NM_152628		Approved	MGC39715	uc003yjr.3	Q8N9S9	OTTHUMG00000164725	ENST00000311812.2:c.1039T>A	8.37:g.101601147A>T	ENSP00000312368:p.Phe347Ile	Somatic		Capture	Illumina GAIIx	4	101670323	C9J6L9|Q8N0U9	Missense_Mutation	SNP	HMMSmart_SM00312,superfamily_PX domain,HMMPfam_PX	p.F347I	ENST00000311812.2	37	c.1039	CCDS6288.1	8	.	.	.	.	.	.	.	.	.	.	A	18.67	3.674485	0.67928	.	.	ENSG00000174226	ENST00000311812;ENST00000428383	T;T	0.54675	1.15;0.56	5.79	4.63	0.57726	.	0.078383	0.53938	D	0.000052	T	0.54902	0.1887	M	0.72353	2.195	0.52501	D	0.999959	D;P	0.56968	0.978;0.505	P;B	0.44477	0.451;0.189	T	0.61048	-0.7141	10	0.87932	D	0	-8.3511	12.2528	0.54608	0.8575:0.1425:0.0:0.0	.	248;347	Q8N9S9-2;Q8N9S9	.;SNX31_HUMAN	I	347;248	ENSP00000312368:F347I;ENSP00000405024:F248I	ENSP00000312368:F347I	F	-	1	0	SNX31	101670323	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.192000	0.50989	0.996000	0.38943	0.533000	0.62120	TTT	-	NULL		0.418	SNX31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX31	protein_coding	OTTHUMT00000379910.1	A	NM_152628		101670323	-1	no_errors	NM_152628	genbank	human	validated	54_36p	missense	SNP	1.000	T
MMP1	4312	genome.wustl.edu	37	11	102667463	102667463	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr11:102667463T>G	ENST00000315274.6	-	4	624	c.557A>C	c.(556-558)cAa>cCa	p.Q186P	WTAPP1_ENST00000525739.2_RNA	NM_001145938.1|NM_002421.3	NP_001139410.1|NP_002412.1	P03956	MMP1_HUMAN	matrix metallopeptidase 1 (interstitial collagenase)	186	Metalloprotease.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|proteolysis (GO:0006508)|viral process (GO:0016032)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)	Marimastat(DB00786)	TGGGCCTGGTTGAAAAGCATG	0.418																																																0			11											121.0	107.0	112.0					11																	102667463		2203	4299	6502	102172673	SO:0001583	missense	4312			X54925	CCDS8322.1	11q21-q22	2014-01-30	2005-08-08		ENSG00000196611	ENSG00000196611	3.4.24.7	"""Endogenous ligands"""	7155	protein-coding gene	gene with protein product		120353	"""matrix metalloproteinase 1 (interstitial collagenase)"""	CLG			Standard	NM_002421		Approved		uc001phi.2	P03956	OTTHUMG00000048192	ENST00000315274.6:c.557A>C	11.37:g.102667463T>G	ENSP00000322788:p.Gln186Pro	Somatic		Capture	Illumina GAIIx	4	102172673	P08156	Missense_Mutation	SNP	HMMPfam_PG_binding_1,superfamily_PGBD_like,PatternScan_CYSTEINE_SWITCH,HMMSmart_ZnMc,superfamily_SSF55486,HMMPfam_Peptidase_M10,PatternScan_ZINC_PROTEASE,superfamily_Hemopexin,HMMPfam_Hemopexin,HMMSmart_HX,PatternScan_HEMOPEXIN	p.Q186P	ENST00000315274.6	37	c.557	CCDS8322.1	11	.	.	.	.	.	.	.	.	.	.	t	1.070	-0.670319	0.03403	.	.	ENSG00000196611	ENST00000315274	T	0.20881	2.04	5.87	-1.01	0.10169	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.524063	0.18752	N	0.132144	T	0.07773	0.0195	N	0.11341	0.13	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.40572	-0.9556	10	0.02654	T	1	.	9.1393	0.36894	0.0:0.143:0.5486:0.3083	.	186	P03956	MMP1_HUMAN	P	186	ENSP00000322788:Q186P	ENSP00000322788:Q186P	Q	-	2	0	MMP1	102172673	0.000000	0.05858	0.001000	0.08648	0.870000	0.49936	-0.829000	0.04415	-0.040000	0.13580	0.533000	0.62120	CAA	-	HMMSmart_ZnMc,superfamily_SSF55486,HMMPfam_Peptidase_M10		0.418	MMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP1	protein_coding	OTTHUMT00000109632.1	T	NM_002421		102172673	-1	no_errors	NM_002421	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
NACAP1	83955	genome.wustl.edu	37	8	102381653	102381653	+	RNA	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr8:102381653A>G	ENST00000419462.1	+	0	1065					NR_002182.1		Q9BZK3	NACP1_HUMAN	nascent-polypeptide-associated complex alpha polypeptide pseudogene 1																		GGTCGATGAAACAGGTGTAGA	0.418																																																0			8																																								102450829			83955			AF315951		8q22.3	2007-04-20				ENSG00000228224			24688	pseudogene	pseudogene							Standard	NR_002182		Approved	FKSG17	uc003ykc.1	Q9BZK3			8.37:g.102381653A>G		Somatic		Capture	Illumina GAIIx	4	102450829		RNA	SNP	-	NULL	ENST00000419462.1	37	NULL		8																																																																																			-	-		0.418	NACAP1-001	KNOWN	basic	processed_transcript	NACAP1	pseudogene	OTTHUMT00000380521.1	A	NR_002182		102450829	+1	pseudogene	NR_002182	genbank	human	provisional	54_36p	rna	SNP	1.000	G
PDGFD	80310	genome.wustl.edu	37	11	103797846	103797846	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr11:103797846C>T	ENST00000393158.2	-	6	960	c.781G>A	c.(781-783)Gat>Aat	p.D261N	PDGFD_ENST00000302251.5_Missense_Mutation_p.D255N			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	261					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		TTGAGCCTATCCAGGTCAACT	0.438																																																0			11											139.0	120.0	126.0					11																	103797846		2202	4299	6501	103303056	SO:0001583	missense	80310			AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.781G>A	11.37:g.103797846C>T	ENSP00000376865:p.Asp261Asn	Somatic		Capture	Illumina GAIIx	4	103303056	A8K9T6|Q9BWV5	Missense_Mutation	SNP	PatternScan_TONB_DEPENDENT_REC_1,HMMSmart_SM00042,superfamily_Spermadhesin CUB domain,HMMPfam_CUB,superfamily_Cystine-knot cytokines,HMMPfam_PDGF	p.D261N	ENST00000393158.2	37	c.781	CCDS41703.1	11	.	.	.	.	.	.	.	.	.	.	C	8.738	0.918357	0.17982	.	.	ENSG00000170962	ENST00000393158;ENST00000302251	T;T	0.25414	1.8;1.8	5.87	5.87	0.94306	Platelet-derived growth factor (PDGF) (1);	0.046072	0.85682	D	0.000000	T	0.32224	0.0822	N	0.15975	0.35	0.58432	D	0.999992	B;D	0.89917	0.402;1.0	B;D	0.87578	0.1;0.998	T	0.02437	-1.1159	10	0.02654	T	1	-30.8886	20.2084	0.98285	0.0:1.0:0.0:0.0	.	261;255	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	N	261;255	ENSP00000376865:D261N;ENSP00000302193:D255N	ENSP00000302193:D255N	D	-	1	0	PDGFD	103303056	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	5.674000	0.68117	2.774000	0.95407	0.650000	0.86243	GAT	-	superfamily_Cystine-knot cytokines		0.438	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDGFD	protein_coding	OTTHUMT00000387231.2	C	NM_025208		103303056	-1	no_errors	NM_025208	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
DKK2	27123	genome.wustl.edu	37	4	107845203	107845203	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr4:107845203G>A	ENST00000285311.3	-	4	1393	c.688C>T	c.(688-690)Cgt>Tgt	p.R230C	DKK2_ENST00000513208.1_Missense_Mutation_p.R130C|DKK2_ENST00000510463.1_Missense_Mutation_p.R184C	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	230	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.R230C(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CAGTCGCAACGCTGGAAAATT	0.483																																																1	Substitution - Missense(1)	large_intestine(1)	4											158.0	145.0	149.0					4																	107845203		2203	4300	6503	108064652	SO:0001583	missense	27123			AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.688C>T	4.37:g.107845203G>A	ENSP00000285311:p.Arg230Cys	Somatic		Capture	Illumina GAIIx	4	108064652	A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	HMMPfam_Dickkopf_N	p.R230C	ENST00000285311.3	37	c.688	CCDS3675.1	4	.	.	.	.	.	.	.	.	.	.	G	19.01	3.742934	0.69418	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.57907	0.37;0.5;0.52	5.64	3.79	0.43588	.	0.000000	0.85682	D	0.000000	T	0.71945	0.3400	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.77040	-0.2735	10	0.87932	D	0	-11.8314	13.5124	0.61519	0.0:0.0:0.5801:0.4199	.	230	Q9UBU2	DKK2_HUMAN	C	230;130;184	ENSP00000285311:R230C;ENSP00000421255:R130C;ENSP00000423797:R184C	ENSP00000285311:R230C	R	-	1	0	DKK2	108064652	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	4.419000	0.59835	1.320000	0.45209	0.585000	0.79938	CGT	-	NULL		0.483	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DKK2	protein_coding	OTTHUMT00000253959.4	G			108064652	-1	no_errors	NM_014421	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
COL4A1	1282	genome.wustl.edu	37	13	110804761	110804761	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr13:110804761A>T	ENST00000375820.4	-	51	4969	c.4848T>A	c.(4846-4848)tgT>tgA	p.C1616*		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1616	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CACGGCCGTGACACTCGATGA	0.577																																																0			13											81.0	67.0	72.0					13																	110804761		2203	4300	6503	109602762	SO:0001587	stop_gained	1282			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.4848T>A	13.37:g.110804761A>T	ENSP00000364979:p.Cys1616*	Somatic		Capture	Illumina GAIIx	4	109602762	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Nonsense_Mutation	SNP	HMMPfam_Collagen,superfamily_C-type lectin-like,HMMPfam_C4,HMMSmart_SM00111	p.C1616*	ENST00000375820.4	37	c.4848	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	A	44	10.834545	0.99475	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	.	.	.	5.51	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5878	0.61942	0.0757:0.0:0.9243:0.0	.	.	.	.	X	1259;1616;1265	.	ENSP00000364973:C1259X	C	-	3	2	COL4A1	109602762	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.461000	0.45040	1.304000	0.44892	-0.248000	0.11899	TGT	-	HMMPfam_C4,HMMSmart_SM00111,superfamily_C-type lectin-like		0.577	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	protein_coding	OTTHUMT00000045759.3	A			109602762	-1	no_errors	NM_001845	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
PPP1R3A	5506	genome.wustl.edu	37	7	113517849	113517849	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr7:113517849A>G	ENST00000284601.3	-	4	3366	c.3298T>C	c.(3298-3300)Ttc>Ctc	p.F1100L		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1100					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						AAAACGTAGAATGTCAAGCCA	0.333																																																0			7											88.0	89.0	89.0					7																	113517849		2203	4299	6502	113305085	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3298T>C	7.37:g.113517849A>G	ENSP00000284601:p.Phe1100Leu	Somatic		Capture	Illumina GAIIx	4	113305085	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	HMMPfam_CBM_21	p.F1100L	ENST00000284601.3	37	c.3298	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	A	11.27	1.590094	0.28357	.	.	ENSG00000154415	ENST00000284601	T	0.13196	2.61	5.85	4.66	0.58398	.	0.211367	0.34314	N	0.004071	T	0.10208	0.0250	L	0.58669	1.825	0.29409	N	0.861352	P	0.37636	0.603	B	0.32762	0.152	T	0.08638	-1.0712	10	0.14656	T	0.56	-3.6175	4.1811	0.10376	0.6434:0.1865:0.1701:0.0	.	1100	Q16821	PPR3A_HUMAN	L	1100	ENSP00000284601:F1100L	ENSP00000284601:F1100L	F	-	1	0	PPP1R3A	113305085	0.996000	0.38824	0.998000	0.56505	0.853000	0.48598	1.878000	0.39608	2.228000	0.72767	0.528000	0.53228	TTC	-	NULL		0.333	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	protein_coding	OTTHUMT00000346724.1	A	NM_002711		113305085	-1	no_errors	NM_002711	genbank	human	reviewed	54_36p	missense	SNP	0.998	G
LARP7	51574	genome.wustl.edu	37	4	113568369	113568369	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr4:113568369A>G	ENST00000344442.5	+	7	939	c.661A>G	c.(661-663)Aaa>Gaa	p.K221E	LARP7_ENST00000509061.1_Missense_Mutation_p.K228E|MIR302A_ENST00000385192.1_RNA|MIR302B_ENST00000509938.1_RNA|MIR302C_ENST00000362232.1_RNA|LARP7_ENST00000324052.6_Missense_Mutation_p.K221E|MIR302B_ENST00000362188.1_RNA|MIR367_ENST00000362299.1_RNA|MIR302B_ENST00000505215.1_RNA|MIR302B_ENST00000510655.1_RNA|MIR302D_ENST00000362275.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	221	Lys-rich.				RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		gaagaaaaagaaaaagaagaa	0.338																																																0			4											68.0	66.0	67.0					4																	113568369		1839	4086	5925	113787818	SO:0001583	missense	51574			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.661A>G	4.37:g.113568369A>G	ENSP00000344950:p.Lys221Glu	Somatic		Capture	Illumina GAIIx	4	113787818	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	Missense_Mutation	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00715,HMMPfam_La,superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1,HMMPfam_RRM_3"	p.K221E	ENST00000344442.5	37	c.661	CCDS3701.2	4	.	.	.	.	.	.	.	.	.	.	A	12.73	2.024876	0.35701	.	.	ENSG00000174720	ENST00000344442;ENST00000509061;ENST00000505034;ENST00000324052	T;T;T;T	0.19669	2.13;2.13;2.14;2.13	5.86	5.86	0.93980	.	0.327863	0.37623	N	0.002013	T	0.25754	0.0627	M	0.71581	2.175	0.51233	D	0.999918	P;B	0.40250	0.709;0.434	B;B	0.39617	0.305;0.099	T	0.05402	-1.0887	10	0.15952	T	0.53	-18.9839	14.4606	0.67445	1.0:0.0:0.0:0.0	.	221;221	D6RFF0;Q4G0J3	.;LARP7_HUMAN	E	221;228;221;221	ENSP00000344950:K221E;ENSP00000422626:K228E;ENSP00000421541:K221E;ENSP00000314311:K221E	ENSP00000314311:K221E	K	+	1	0	LARP7	113787818	1.000000	0.71417	0.988000	0.46212	0.911000	0.54048	2.268000	0.43338	2.238000	0.73509	0.460000	0.39030	AAA	-	NULL		0.338	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP7	protein_coding	OTTHUMT00000256417.2	A	NM_016648		113787818	+1	no_errors	NM_015454	genbank	human	validated	54_36p	missense	SNP	1.000	G
HTR2C	3358	genome.wustl.edu	37	X	113965731	113965731	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:113965731C>A	ENST00000276198.1	+	4	792	c.64C>A	c.(64-66)Caa>Aaa	p.Q22K	HTR2C_ENST00000371950.3_Missense_Mutation_p.Q22K|HTR2C_ENST00000371951.1_Missense_Mutation_p.Q22K	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	22					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ATTGGTTTGGCAATGTGATAT	0.378																																																0			X											98.0	93.0	95.0					X																	113965731		2203	4300	6503	113871987	SO:0001583	missense	3358				CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.64C>A	X.37:g.113965731C>A	ENSP00000276198:p.Gln22Lys	Somatic		Capture	Illumina GAIIx	4	113871987	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.Q22K	ENST00000276198.1	37	c.64	CCDS14564.1	X	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972488	0.53614	.	.	ENSG00000147246	ENST00000276198;ENST00000371951;ENST00000371950	T;T;T	0.56611	0.45;0.45;0.67	4.57	4.57	0.56435	.	0.174472	0.36740	N	0.002428	T	0.33585	0.0868	N	0.14661	0.345	0.30677	N	0.752756	P;P	0.42409	0.779;0.462	B;B	0.41236	0.351;0.084	T	0.18745	-1.0327	10	0.07325	T	0.83	.	14.1718	0.65514	0.0:1.0:0.0:0.0	.	22;22	B1AMW4;P28335	.;5HT2C_HUMAN	K	22	ENSP00000276198:Q22K;ENSP00000361019:Q22K;ENSP00000361018:Q22K	ENSP00000276198:Q22K	Q	+	1	0	HTR2C	113871987	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.136000	0.42121	2.520000	0.84964	0.594000	0.82650	CAA	-	NULL		0.378	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2C	protein_coding	OTTHUMT00000057962.1	C	NM_000868		113871987	+1	no_errors	NM_000868	genbank	human	reviewed	54_36p	missense	SNP	0.996	A
SLC31A1	1317	genome.wustl.edu	37	9	116021012	116021012	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr9:116021012A>G	ENST00000374212.4	+	4	393	c.241A>G	c.(241-243)Atg>Gtg	p.M81V	CDC26_ENST00000490408.1_Intron|SLC31A1_ENST00000374210.6_Missense_Mutation_p.M81V	NM_001859.3	NP_001850.1	O15431	COPT1_HUMAN	solute carrier family 31 (copper transporter), member 1	81					cellular copper ion homeostasis (GO:0006878)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	copper ion transmembrane transporter activity (GO:0005375)|copper uptake transmembrane transporter activity (GO:0015088)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7					Bortezomib(DB00188)|Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TTTACTAGCAATGTTCTATGA	0.443																																					Ovarian(135;1049 1799 4519 17564 28677)											0			9											151.0	145.0	147.0					9																	116021012		2203	4300	6503	115060833	SO:0001583	missense	1317			U83460	CCDS6789.1	9q32	2013-07-17	2013-07-17		ENSG00000136868	ENSG00000136868		"""Solute carriers"""	11016	protein-coding gene	gene with protein product	copper transport 1 homolog (S. cerevisiae)	603085		COPT1		9207117	Standard	NM_001859		Approved	hCTR1, CTR1	uc004bgu.3	O15431	OTTHUMG00000020519	ENST00000374212.4:c.241A>G	9.37:g.116021012A>G	ENSP00000363329:p.Met81Val	Somatic		Capture	Illumina GAIIx	4	115060833	A8K8Z6|Q53GR5|Q5T1M4	Missense_Mutation	SNP	HMMPfam_Ctr	p.M81V	ENST00000374212.4	37	c.241	CCDS6789.1	9	.	.	.	.	.	.	.	.	.	.	A	3.603	-0.081204	0.07141	.	.	ENSG00000136868	ENST00000374212;ENST00000374210	T;T	0.74209	-0.82;-0.82	6.03	4.9	0.64082	.	0.216760	0.56097	N	0.000022	T	0.38558	0.1045	N	0.00599	-1.345	0.80722	D	1	B;B	0.14438	0.01;0.0	B;B	0.11329	0.006;0.001	T	0.19976	-1.0289	10	0.19590	T	0.45	-0.2501	7.4437	0.27198	0.7854:0.143:0.0716:0.0	.	81;81	Q5T1M3;O15431	.;COPT1_HUMAN	V	81	ENSP00000363329:M81V;ENSP00000363327:M81V	ENSP00000363327:M81V	M	+	1	0	SLC31A1	115060833	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.054000	0.49908	1.104000	0.41587	0.533000	0.62120	ATG	-	HMMPfam_Ctr		0.443	SLC31A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC31A1	protein_coding	OTTHUMT00000053715.1	A	NM_001859		115060833	+1	no_errors	NM_001859	genbank	human	validated	54_36p	missense	SNP	1.000	G
AKNA	80709	genome.wustl.edu	37	9	117103866	117103866	+	Silent	SNP	T	T	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr9:117103866T>G	ENST00000307564.4	-	21	4175	c.4014A>C	c.(4012-4014)ccA>ccC	p.P1338P	AKNA_ENST00000374088.3_Silent_p.P1338P|AKNA_ENST00000374079.4_Silent_p.P283P|AKNA_ENST00000223791.3_Silent_p.P798P|AKNA_ENST00000492875.1_5'UTR|AKNA_ENST00000374075.5_Silent_p.P1257P	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	1338					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						AGGCAAAGGCTGGAGGGGCTG	0.612																																																0			9											52.0	59.0	57.0					9																	117103866		2203	4300	6503	116143687	SO:0001819	synonymous_variant	80709			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.4014A>C	9.37:g.117103866T>G		Somatic		Capture	Illumina GAIIx	4	116143687	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	NULL	p.Q584P	ENST00000307564.4	37	c.1751	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	C	9.566	1.119629	0.20877	.	.	ENSG00000106948	ENST00000320310	.	.	.	5.5	-10.3	0.00346	.	.	.	.	.	T	0.22936	0.0554	.	.	.	0.19945	N	0.999941	.	.	.	.	.	.	T	0.13791	-1.0496	4	.	.	.	-10.6908	7.0856	0.25255	0.0962:0.1053:0.0979:0.7006	.	.	.	.	P	349	.	.	Q	-	2	0	AKNA	116143687	0.000000	0.05858	0.001000	0.08648	0.838000	0.47535	-3.045000	0.00631	-2.765000	0.00368	-0.119000	0.15052	CAG	-	NULL		0.612	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	protein_coding	OTTHUMT00000053767.2	T	NM_030767		116143687	-1	no_errors	ENST00000374075	ensembl	human	known	54_36p	missense	SNP	0.057	G
FAM26F	441168	genome.wustl.edu	37	6	116784809	116784809	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr6:116784809G>T	ENST00000368605.1	+	3	984	c.889G>T	c.(889-891)Gtg>Ttg	p.V297L	FAM26F_ENST00000368606.3_Missense_Mutation_p.V125L|RP1-93H18.6_ENST00000476099.1_RNA	NM_001010919.1	NP_001010919.1	Q5R3K3	FA26F_HUMAN	family with sequence similarity 26, member F	297					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)	3				GBM - Glioblastoma multiforme(226;0.0402)|all cancers(137;0.0627)|OV - Ovarian serous cystadenocarcinoma(136;0.0655)|Epithelial(106;0.231)		AGGAGATACGGTGATTCCTGT	0.373																																																0			6											168.0	180.0	176.0					6																	116784809		2203	4300	6503	116891502	SO:0001583	missense	441168			AF086130	CCDS34519.1, CCDS64506.1	6q22.1	2007-06-20			ENSG00000188820	ENSG00000188820			33391	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 187"""	C6orf187			Standard	NM_001010919		Approved	RP1-93H18.5, OTTHUMP00000017061, OTTHUMP00000017062, dJ93H18.5	uc003pwv.4	Q5R3K3	OTTHUMG00000015438	ENST00000368605.1:c.889G>T	6.37:g.116784809G>T	ENSP00000357594:p.Val297Leu	Somatic		Capture	Illumina GAIIx	4	116891502	B9EJB0|Q5R3K4	Missense_Mutation	SNP	NULL	p.V297L	ENST00000368605.1	37	c.889	CCDS34519.1	6	.	.	.	.	.	.	.	.	.	.	G	4.976	0.181211	0.09495	.	.	ENSG00000188820	ENST00000368606;ENST00000368605;ENST00000368604	T;T;T	0.30981	1.53;2.55;1.51	4.79	0.864	0.19068	.	1.512470	0.03667	N	0.243446	T	0.11580	0.0282	L	0.59436	1.845	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.19289	-1.0310	10	0.38643	T	0.18	-9.2987	3.815	0.08812	0.3119:0.0:0.3957:0.2924	.	297	Q5R3K3	FA26F_HUMAN	L	125;297;140	ENSP00000357595:V125L;ENSP00000357594:V297L;ENSP00000357593:V140L	ENSP00000357593:V140L	V	+	1	0	FAM26F	116891502	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.805000	0.04530	-0.035000	0.13691	-0.150000	0.13652	GTG	-	NULL		0.373	FAM26F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM26F	protein_coding	OTTHUMT00000041946.1	G	NM_001010919		116891502	+1	no_errors	NM_001010919	genbank	human	predicted	54_36p	missense	SNP	0.000	T
ATRNL1	26033	genome.wustl.edu	37	10	117154172	117154172	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr10:117154172G>C	ENST00000355044.3	+	20	3305	c.3179G>C	c.(3178-3180)tGt>tCt	p.C1060S	ATRNL1_ENST00000423111.2_Missense_Mutation_p.C111S|ATRNL1_ENST00000303745.7_5'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1060	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CTTACAGCTTGTACATGCAGT	0.333																																																0			10											138.0	125.0	129.0					10																	117154172		2203	4300	6503	117144162	SO:0001583	missense	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3179G>C	10.37:g.117154172G>C	ENSP00000347152:p.Cys1060Ser	Somatic		Capture	Illumina GAIIx	4	117144162	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,HMMPfam_EGF_2,superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMPfam_Kelch_2,superfamily_Plexin repeat,HMMSmart_SM00423,HMMPfam_PSI,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,HMMPfam_Laminin_EGF,HMMSmart_SM00180,PatternScan_EGF_LAM_1	p.C1060S	ENST00000355044.3	37	c.3179	CCDS7592.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.147241|4.147241	0.77888|0.77888	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000355044;ENST00000423111|ENST00000526373	T;T|.	0.68903|.	-0.36;1.2|.	5.61|5.61	5.61|5.61	0.85477|0.85477	EGF-like, laminin (2);|.	0.061993|.	0.85682|.	D|.	0.000000|.	D|D	0.86531|0.86531	0.5955|0.5955	H|H	0.94222|0.94222	3.51|3.51	0.80722|0.80722	D|D	1|1	D;D|.	0.63880|.	0.993;0.993|.	D;D|.	0.72338|.	0.977;0.977|.	D|D	0.89807|0.89807	0.3979|0.3979	10|5	0.87932|.	D|.	0|.	-18.9996|-18.9996	15.1377|15.1377	0.72583|0.72583	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	111;1060|.	B4DH41;Q5VV63|.	.;ATRN1_HUMAN|.	S|F	1060;111|143	ENSP00000347152:C1060S;ENSP00000409624:C111S|.	ENSP00000347152:C1060S|.	C|L	+|+	2|3	0|2	ATRNL1|ATRNL1	117144162|117144162	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.632000|7.632000	0.83247|0.83247	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	TGT|TTG	-	superfamily_EGF/Laminin,PatternScan_EGF_LAM_1,HMMPfam_Laminin_EGF,HMMSmart_SM00180		0.333	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	protein_coding	OTTHUMT00000050507.3	G	XM_049349		117144162	+1	no_errors	NM_207303	genbank	human	validated	54_36p	missense	SNP	1.000	C
KMT2A	4297	genome.wustl.edu	37	11	118350953	118350953	+	Splice_Site	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr11:118350953G>C	ENST00000389506.5	+	6	3634	c.3634G>C	c.(3634-3636)Gct>Cct	p.A1212P	KMT2A_ENST00000534358.1_Splice_Site_p.A1212P|KMT2A_ENST00000354520.4_Splice_Site_p.A1212P			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1212					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GCAAGCTAAAGGTAGTGTTGT	0.358																																																0			11											128.0	112.0	118.0					11																	118350953		2200	4296	6496	117856163	SO:0001630	splice_region_variant	4297			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3634+1G>C	11.37:g.118350953G>C		Somatic		Capture	Illumina GAIIx	4	117856163	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	PatternScan_HMGI_Y,HMMPfam_AT_hook,HMMPfam_zf-CXXC,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,PatternScan_RECR,HMMSmart_SM00297,superfamily_Bromodomain,HMMPfam_FYRN,HMMSmart_SM00541,PatternScan_EF_HAND_1,HMMPfam_FYRC,HMMSmart_SM00542,superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00508	p.A1212P	ENST00000389506.5	37	c.3634	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655205	0.67472	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000359313	D;T;D;D	0.82344	-1.6;0.94;-1.6;-1.58	5.81	5.81	0.92471	.	0.190744	0.46145	D	0.000307	D	0.89322	0.6682	L	0.50333	1.59	0.54753	D	0.999981	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.87775	0.2608	10	0.42905	T	0.14	.	19.7029	0.96062	0.0:0.0:1.0:0.0	.	1212;1212	E9PQG7;Q03164	.;MLL1_HUMAN	P	1212;1245;1212;1212;122	ENSP00000436786:A1212P;ENSP00000432391:A1245P;ENSP00000374157:A1212P;ENSP00000346516:A1212P	ENSP00000346516:A1212P	A	+	1	0	MLL	117856163	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.818000	0.62657	2.756000	0.94617	0.557000	0.71058	GCT	-	NULL		0.358	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL	protein_coding	OTTHUMT00000399085.2	G	NM_005933	Missense_Mutation	117856163	+1	no_errors	NM_005933	genbank	human	validated	54_36p	missense	SNP	1.000	C
SLC13A1	6561	genome.wustl.edu	37	7	122763290	122763290	+	Splice_Site	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr7:122763290C>T	ENST00000194130.2	-	12	1280		c.e12-1		SLC13A1_ENST00000539873.1_Splice_Site	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TCAAAAGCAACTGCAAAACAA	0.383																																																0			7											83.0	84.0	84.0					7																	122763290		2203	4300	6503	122550526	SO:0001630	splice_region_variant	6561				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.1241-1G>A	7.37:g.122763290C>T		Somatic		Capture	Illumina GAIIx	4	122550526	Q9H5Z0	Splice_Site	SNP	-	e12-1	ENST00000194130.2	37	c.1241-1	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456649	0.63401	.	.	ENSG00000081800	ENST00000194130	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3725	0.87382	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC13A1	122550526	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	4.552000	0.60747	2.787000	0.95880	0.585000	0.79938	.	-	-		0.383	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	protein_coding	OTTHUMT00000347404.1	C	NM_022444	Intron	122550526	-1	no_errors	NM_022444	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
OR10S1	219873	genome.wustl.edu	37	11	123847860	123847860	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr11:123847860A>T	ENST00000531945.1	-	1	628	c.539T>A	c.(538-540)cTg>cAg	p.L180Q		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ACAGTAGAGCAGGCGGAAGGT	0.552																																																0			11											103.0	89.0	94.0					11																	123847860		2202	4299	6501	123353070	SO:0001583	missense	219873			BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.539T>A	11.37:g.123847860A>T	ENSP00000431914:p.Leu180Gln	Somatic		Capture	Illumina GAIIx	4	123353070	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.L180Q	ENST00000531945.1	37	c.539	CCDS31701.1	11	.	.	.	.	.	.	.	.	.	.	A	18.35	3.604961	0.66445	.	.	ENSG00000196248	ENST00000531945	T	0.00299	8.22	4.89	4.89	0.63831	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32884	U	0.005540	T	0.01124	0.0037	H	0.96080	3.765	0.32995	D	0.525417	D	0.89917	1.0	D	0.85130	0.997	T	0.05099	-1.0906	10	0.87932	D	0	-7.8981	14.4615	0.67453	1.0:0.0:0.0:0.0	.	180	Q8NGN2	O10S1_HUMAN	Q	180	ENSP00000431914:L180Q	ENSP00000431914:L180Q	L	-	2	0	OR10S1	123353070	0.519000	0.26242	0.808000	0.32385	0.870000	0.49936	3.810000	0.55613	2.082000	0.62665	0.467000	0.42956	CTG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.552	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10S1	protein_coding	OTTHUMT00000387265.2	A	NM_001004474		123353070	-1	no_errors	NM_001004474	genbank	human	provisional	54_36p	missense	SNP	0.997	T
NCOR2	9612	genome.wustl.edu	37	12	124812127	124812127	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:124812127C>T	ENST00000405201.1	-	45	7011	c.7011G>A	c.(7009-7011)atG>atA	p.M2337I	NCOR2_ENST00000429285.2_Missense_Mutation_p.M2327I|NCOR2_ENST00000397355.1_Missense_Mutation_p.M2328I|NCOR2_ENST00000404121.2_Missense_Mutation_p.M1898I|NCOR2_ENST00000356219.3_Missense_Mutation_p.M2344I|NCOR2_ENST00000404621.1_Missense_Mutation_p.M2327I			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2348					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CCTCCAGCCCCATGTTGGTGC	0.557																																																0			12											65.0	67.0	66.0					12																	124812127		1935	4147	6082	123378080	SO:0001583	missense	9612			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.7011G>A	12.37:g.124812127C>T	ENSP00000384018:p.Met2337Ile	Somatic		Capture	Illumina GAIIx	4	123378080	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00717,HMMPfam_Myb_DNA-binding	p.M2344I	ENST00000405201.1	37	c.7032	CCDS41858.2	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.60|14.60	2.585231|2.585231	0.46110|0.46110	.|.	.|.	ENSG00000196498|ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000447675;ENST00000429285|ENST00000418829;ENST00000413172	T;T;T;T;T;T|.	0.16196|.	2.36;2.62;2.36;2.62;2.36;2.62|.	5.18|5.18	4.29|4.29	0.51040|0.51040	.|.	0.158618|.	0.56097|.	D|.	0.000030|.	T|.	0.55226|.	0.1907|.	L|L	0.36672|0.36672	1.1|1.1	0.39806|0.39806	D|D	0.972639|0.972639	P;P|.	0.51933|.	0.949;0.936|.	D;P|.	0.63381|.	0.914;0.901|.	T|.	0.53634|.	-0.8411|.	10|.	0.33940|.	T|.	0.23|.	-23.9286|-23.9286	13.2765|13.2765	0.60189|0.60189	0.0:0.9234:0.0:0.0766|0.0:0.9234:0.0:0.0766	.|.	2328;2337|.	C9J239;C9JFD3|.	.;.|.	I|X	2337;2327;2344;2328;2336;1898;429;2327|45;2	ENSP00000384018:M2337I;ENSP00000384202:M2327I;ENSP00000348551:M2344I;ENSP00000380513:M2328I;ENSP00000385618:M1898I;ENSP00000400281:M2327I|.	ENSP00000348551:M2344I|.	M|W	-|-	3|2	0|0	NCOR2|NCOR2	123378080|123378080	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.456000|1.456000	0.35201|0.35201	1.164000|1.164000	0.42652|0.42652	0.491000|0.491000	0.48974|0.48974	ATG|TGG	-	NULL		0.557	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	C	NM_006312		123378080	-1	no_errors	NM_006312	genbank	human	validated	54_36p	missense	SNP	1.000	T
DMBT1	1755	genome.wustl.edu	37	10	124402751	124402751	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr10:124402751G>C	ENST00000338354.3	+	53	7185	c.7079G>C	c.(7078-7080)tGt>tCt	p.C2360S	DMBT1_ENST00000368956.2_Missense_Mutation_p.C1732S|DMBT1_ENST00000359586.6_Missense_Mutation_p.C1080S|DMBT1_ENST00000344338.3_Missense_Mutation_p.C2350S|DMBT1_ENST00000368909.3_Missense_Mutation_p.C2360S|DMBT1_ENST00000368955.3_Missense_Mutation_p.C2350S|DMBT1_ENST00000330163.4_Missense_Mutation_p.C1732S			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	2360	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TACCTGCGTTGTAAAATGGTG	0.587																																					Ovarian(182;93 2026 18125 22222 38972)											0			10											139.0	142.0	141.0					10																	124402751		2076	4213	6289	124392741	SO:0001583	missense	1755				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.7079G>C	10.37:g.124402751G>C	ENSP00000342210:p.Cys2360Ser	Somatic		Capture	Illumina GAIIx	4	124392741	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR,PatternScan_SRCR_1,superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,HMMPfam_Zona_pellucida,HMMSmart_SM00241,PatternScan_ZP_1	p.C2360S	ENST00000338354.3	37	c.7079		10	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300183	0.60195	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000344467;ENST00000359586	D;D;D;D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31;-3.31;-3.31;-3.31	5.28	5.28	0.74379	Zona pellucida sperm-binding protein (3);	0.526148	0.15782	U	0.244880	D	0.97601	0.9214	M	0.91663	3.23	0.58432	D	0.999995	D;P;D;D;D;D;D	0.89917	1.0;0.844;1.0;1.0;1.0;1.0;1.0	D;B;D;D;D;D;D	0.91635	0.999;0.308;0.999;0.999;0.999;0.999;0.999	D	0.98285	1.0510	10	0.87932	D	0	.	18.9486	0.92632	0.0:0.0:1.0:0.0	.	1080;2340;1609;2489;1732;2350;2360	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	S	2360;2489;2360;2360;2360;2359;1732;2350;1732;1732;2360;2350;1732;506;1080	ENSP00000342210:C2360S;ENSP00000343175:C2350S;ENSP00000327747:C1732S;ENSP00000357905:C2360S;ENSP00000357951:C2350S;ENSP00000357952:C1732S;ENSP00000352593:C1080S	ENSP00000331522:C1732S	C	+	2	0	DMBT1	124392741	1.000000	0.71417	0.218000	0.23776	0.181000	0.23173	5.983000	0.70540	2.479000	0.83701	0.655000	0.94253	TGT	-	HMMPfam_Zona_pellucida,HMMSmart_SM00241		0.587	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	protein_coding	OTTHUMT00000050792.2	G	NM_004406		124392741	+1	no_errors	NM_007329	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FSCN3	29999	genome.wustl.edu	37	7	127235907	127235907	+	Nonsense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr7:127235907G>T	ENST00000265825.5	+	2	910	c.691G>T	c.(691-693)Gaa>Taa	p.E231*	GCC1_ENST00000497650.1_5'Flank|FSCN3_ENST00000420086.2_Nonsense_Mutation_p.E97*	NM_020369.2	NP_065102.1	Q9NQT6	FSCN3_HUMAN	fascin actin-bundling protein 3, testicular	231						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30						GTGTGATGGAGAAGGAGGCAT	0.562																																																0			7											133.0	104.0	114.0					7																	127235907		2203	4300	6503	127023143	SO:0001587	stop_gained	29999				CCDS34746.1	7q31.3	2014-02-03	2014-02-03		ENSG00000106328	ENSG00000106328		"""Fascins"""	3961	protein-coding gene	gene with protein product		615800	"""fascin (Strongylocentrotus purpuratus) homolog 3 (actin-bundling protein, testicular)"", ""fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)"""			11925108	Standard	NM_020369		Approved		uc003vmd.2	Q9NQT6	OTTHUMG00000022935	ENST00000265825.5:c.691G>T	7.37:g.127235907G>T	ENSP00000265825:p.Glu231*	Somatic		Capture	Illumina GAIIx	4	127023143	A4D0Z2|A6NLL7|B2RA62|B4DU68	Nonsense_Mutation	SNP	superfamily_Actin_crosslink,HMMPfam_Fascin	p.E231*	ENST00000265825.5	37	c.691	CCDS34746.1	7	.	.	.	.	.	.	.	.	.	.	G	37	6.156494	0.97334	.	.	ENSG00000106328	ENST00000265825;ENST00000420086	.	.	.	5.44	4.51	0.55191	.	0.090787	0.47852	D	0.000217	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-28.8501	12.7475	0.57289	0.0:0.1656:0.8344:0.0	.	.	.	.	X	231;97	.	ENSP00000265825:E231X	E	+	1	0	FSCN3	127023143	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.452000	0.44961	2.708000	0.92522	0.650000	0.86243	GAA	-	superfamily_Actin_crosslink		0.562	FSCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCN3	protein_coding	OTTHUMT00000059256.2	G	NM_020369		127023143	+1	no_errors	NM_020369	genbank	human	provisional	54_36p	nonsense	SNP	1.000	T
ARHGAP32	9743	genome.wustl.edu	37	11	128848810	128848810	+	Splice_Site	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr11:128848810T>A	ENST00000310343.9	-	18	1934	c.1935A>T	c.(1933-1935)agA>agT	p.R645S	ARHGAP32_ENST00000392657.3_Splice_Site_p.R296S|ARHGAP32_ENST00000527272.1_Splice_Site_p.R296S|ARHGAP32_ENST00000524655.1_Splice_Site_p.R571S	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	645					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						GAGGCCTCTTTCTATGAAAGA	0.388																																																0			11											52.0	55.0	54.0					11																	128848810		2201	4297	6498	128354020	SO:0001630	splice_region_variant	9743			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.1935-1A>T	11.37:g.128848810T>A		Somatic		Capture	Illumina GAIIx	4	128354020	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP	p.R296S	ENST00000310343.9	37	c.888	CCDS44769.1	11	.	.	.	.	.	.	.	.	.	.	T	19.34	3.809411	0.70797	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000524655;ENST00000457677;ENST00000527272	T;T;T;T	0.12879	2.64;2.68;2.69;2.68	5.98	2.85	0.33270	.	0.086238	0.85682	D	0.000000	T	0.23054	0.0557	M	0.72118	2.19	0.51767	D	0.999933	P;P	0.51057	0.64;0.941	B;P	0.49226	0.263;0.603	T	0.01259	-1.1403	10	0.66056	D	0.02	.	11.2314	0.48914	0.0:0.6918:0.0:0.3082	.	579;645	Q86T64;A7KAX9	.;RHG32_HUMAN	S	645;296;571;579;296	ENSP00000310561:R645S;ENSP00000376425:R296S;ENSP00000432468:R571S;ENSP00000432862:R296S	ENSP00000310561:R645S	R	-	3	2	ARHGAP32	128354020	1.000000	0.71417	0.995000	0.50966	0.892000	0.51952	1.095000	0.30964	0.279000	0.22186	0.482000	0.46254	AGA	-	NULL		0.388	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICS	protein_coding	OTTHUMT00000386151.3	T	NM_014715	Missense_Mutation	128354020	-1	no_errors	NM_014715	genbank	human	validated	54_36p	missense	SNP	1.000	A
ADAMTS19	171019	genome.wustl.edu	37	5	128977612	128977612	+	Silent	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:128977612C>T	ENST00000274487.4	+	11	1958	c.1813C>T	c.(1813-1815)Cta>Tta	p.L605L	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	605	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CAGAACCAAGCTAGACCCACC	0.398																																																0			5											236.0	192.0	207.0					5																	128977612		2203	4300	6503	129005511	SO:0001819	synonymous_variant	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1813C>T	5.37:g.128977612C>T		Somatic		Capture	Illumina GAIIx	4	129005511		Silent	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMSmart_SM00608,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_PLAC"	p.L605	ENST00000274487.4	37	c.1813	CCDS4146.1	5																																																																																			-	HMMSmart_SM00608		0.398	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	protein_coding	OTTHUMT00000250979.2	C	NM_133638		129005511	+1	no_errors	NM_133638	genbank	human	reviewed	54_36p	silent	SNP	0.987	T
CPA2	1358	genome.wustl.edu	37	7	129919397	129919397	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr7:129919397G>T	ENST00000222481.4	+	9	937	c.882G>T	c.(880-882)aaG>aaT	p.K294N		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	294					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					ACTTCATCAAGAGTCATGGAA	0.488																																																0			7											119.0	108.0	112.0					7																	129919397		2203	4300	6503	129706633	SO:0001583	missense	1358			U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.882G>T	7.37:g.129919397G>T	ENSP00000222481:p.Lys294Asn	Somatic		Capture	Illumina GAIIx	4	129706633	A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Missense_Mutation	SNP	superfamily_Prot_inh_propept,HMMPfam_Propep_M14,superfamily_SSF53187,HMMSmart_Zn_pept,HMMPfam_Peptidase_M14,PatternScan_CARBOXYPEPT_ZN_1,PatternScan_CARBOXYPEPT_ZN_2	p.K292N	ENST00000222481.4	37	c.876	CCDS5817.2	7	.	.	.	.	.	.	.	.	.	.	G	11.65	1.702753	0.30232	.	.	ENSG00000158516	ENST00000222481	T	0.10382	2.88	5.97	5.1	0.69264	Peptidase M14, carboxypeptidase A (2);	0.249324	0.39341	N	0.001382	T	0.13756	0.0333	L	0.61036	1.89	0.54753	D	0.999988	B	0.02656	0.0	B	0.14578	0.011	T	0.02150	-1.1205	10	0.66056	D	0.02	.	10.4247	0.44371	0.1468:0.0:0.8532:0.0	.	294	P48052	CBPA2_HUMAN	N	294	ENSP00000222481:K294N	ENSP00000222481:K294N	K	+	3	2	CPA2	129706633	0.638000	0.27225	0.999000	0.59377	0.187000	0.23431	2.036000	0.41165	1.545000	0.49373	-0.136000	0.14681	AAG	-	superfamily_SSF53187,HMMSmart_Zn_pept,HMMPfam_Peptidase_M14		0.488	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA2	protein_coding	OTTHUMT00000347124.2	G	NM_001869		129706633	+1	no_errors	NM_001869	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ADAMTS8	11095	genome.wustl.edu	37	11	130284468	130284468	+	Silent	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr11:130284468T>A	ENST00000257359.6	-	5	2230	c.1524A>T	c.(1522-1524)tcA>tcT	p.S508S		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	508	Disintegrin.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		AGCTGCCTTCTGAGCAGAGGT	0.627																																																0			11											45.0	50.0	48.0					11																	130284468		2007	4159	6166	129789678	SO:0001819	synonymous_variant	11095			AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.1524A>T	11.37:g.130284468T>A		Somatic		Capture	Illumina GAIIx	4	129789678	Q9NZS0	Silent	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMSmart_SM00608,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.S508	ENST00000257359.6	37	c.1524	CCDS41732.1	11																																																																																			-	HMMSmart_SM00608		0.627	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS8	protein_coding	OTTHUMT00000385636.1	T	NM_007037		129789678	-1	no_errors	NM_007037	genbank	human	reviewed	54_36p	silent	SNP	0.952	A
KLHL3	26249	genome.wustl.edu	37	5	136961542	136961542	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:136961542A>T	ENST00000309755.4	-	14	2078	c.1635T>A	c.(1633-1635)gaT>gaA	p.D545E	KLHL3_ENST00000506491.1_Missense_Mutation_p.D463E|KLHL3_ENST00000508657.1_Missense_Mutation_p.D513E|KLHL3_ENST00000506873.1_5'UTR|KLHL3_ENST00000541417.1_3'UTR	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3	545					distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		AGGATCCATCATCCCCTCCAA	0.522																																																0			5											220.0	178.0	192.0					5																	136961542		2203	4300	6503	136989441	SO:0001583	missense	26249			AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.1635T>A	5.37:g.136961542A>T	ENSP00000312397:p.Asp545Glu	Somatic		Capture	Illumina GAIIx	4	136989441	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612	p.D545E	ENST00000309755.4	37	c.1635	CCDS4192.1	5	.	.	.	.	.	.	.	.	.	.	A	19.19	3.779330	0.70107	.	.	ENSG00000146021	ENST00000506491;ENST00000508657;ENST00000309755	T;T;T	0.77620	-1.11;-1.11;-1.11	4.59	-0.494	0.12034	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.72020	0.3409	N	0.12920	0.275	0.80722	D	1	D;D	0.59767	0.986;0.958	P;D	0.66979	0.85;0.948	T	0.65932	-0.6048	10	0.30078	T	0.28	.	9.5128	0.39087	0.6327:0.0:0.3673:0.0	.	280;545	B7Z6E2;Q9UH77	.;KLHL3_HUMAN	E	463;513;545	ENSP00000424828:D463E;ENSP00000422099:D513E;ENSP00000312397:D545E	ENSP00000312397:D545E	D	-	3	2	KLHL3	136989441	1.000000	0.71417	0.995000	0.50966	0.902000	0.53008	0.859000	0.27858	-0.227000	0.09884	-0.441000	0.05720	GAT	-	superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612		0.522	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL3	protein_coding	OTTHUMT00000251220.2	A			136989441	-1	no_errors	NM_017415	genbank	human	validated	54_36p	missense	SNP	1.000	T
BRD8	10902	genome.wustl.edu	37	5	137495282	137495282	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:137495282C>G	ENST00000254900.5	-	20	2910	c.2539G>C	c.(2539-2541)Gtc>Ctc	p.V847L	BRD8_ENST00000515014.1_5'Flank|BRD8_ENST00000402931.1_Missense_Mutation_p.V847L|BRD8_ENST00000455658.2_Missense_Mutation_p.V806L|BRD8_ENST00000230901.5_Missense_Mutation_p.V920L|BRD8_ENST00000411594.2_Intron	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	847					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CCCATTGGGACACTGTCCTGT	0.502																																																0			5											104.0	91.0	95.0					5																	137495282		2203	4300	6503	137523181	SO:0001583	missense	10902			AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.2539G>C	5.37:g.137495282C>G	ENSP00000254900:p.Val847Leu	Somatic		Capture	Illumina GAIIx	4	137523181	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain	p.V847L	ENST00000254900.5	37	c.2539	CCDS4198.1	5	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097350	0.76870	.	.	ENSG00000112983	ENST00000254900;ENST00000230901;ENST00000402931;ENST00000455658	T;T;T;T	0.31247	1.64;1.52;1.51;1.5	5.14	5.14	0.70334	.	0.199523	0.42964	D	0.000621	T	0.22898	0.0553	L	0.27053	0.805	0.80722	D	1	P;P;B;B;P	0.43750	0.663;0.473;0.134;0.234;0.816	B;B;B;B;B	0.36244	0.22;0.1;0.018;0.087;0.142	T	0.03545	-1.1026	10	0.46703	T	0.11	-7.3853	17.3518	0.87327	0.0:1.0:0.0:0.0	.	806;831;626;920;847	F8W820;B4DN43;B4DMS9;Q9H0E9-2;Q9H0E9	.;.;.;.;BRD8_HUMAN	L	847;920;847;806	ENSP00000254900:V847L;ENSP00000230901:V920L;ENSP00000384845:V847L;ENSP00000408396:V806L	ENSP00000230901:V920L	V	-	1	0	BRD8	137523181	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.971000	0.63749	2.671000	0.90904	0.655000	0.94253	GTC	-	NULL		0.502	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD8	protein_coding	OTTHUMT00000251282.3	C	NM_006696		137523181	-1	no_errors	NM_139199	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
EGR1	1958	genome.wustl.edu	37	5	137801523	137801523	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:137801523C>G	ENST00000239938.4	+	1	345	c.73C>G	c.(73-75)Cac>Gac	p.H25D		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	25					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			ATCCTTTCCTCACTCGCCCAC	0.657																																																0			5											84.0	75.0	78.0					5																	137801523		2203	4300	6503	137829422	SO:0001583	missense	1958			M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.73C>G	5.37:g.137801523C>G	ENSP00000239938:p.His25Asp	Somatic		Capture	Illumina GAIIx	4	137829422		Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.H25D	ENST00000239938.4	37	c.73	CCDS4206.1	5	.	.	.	.	.	.	.	.	.	.	c	19.21	3.782949	0.70222	.	.	ENSG00000120738	ENST00000535792;ENST00000411801;ENST00000239938	T	0.14766	2.48	5.0	5.0	0.66597	.	0.053619	0.85682	D	0.000000	T	0.33876	0.0878	L	0.54323	1.7	0.80722	D	1	D;D	0.71674	0.998;0.963	D;P	0.68621	0.959;0.715	T	0.03259	-1.1055	10	0.87932	D	0	-12.9225	18.4687	0.90765	0.0:1.0:0.0:0.0	.	25;25	B4DNX4;P18146	.;EGR1_HUMAN	D	25	ENSP00000239938:H25D	ENSP00000239938:H25D	H	+	1	0	EGR1	137829422	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.073000	0.76784	2.601000	0.87937	0.486000	0.48141	CAC	-	NULL		0.657	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGR1	protein_coding	OTTHUMT00000251274.1	C	NM_001964		137829422	+1	no_errors	NM_001964	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PCDHGA6	56109	genome.wustl.edu	37	5	140755037	140755037	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:140755037G>A	ENST00000517434.1	+	1	1387	c.1387G>A	c.(1387-1389)Gaa>Aaa	p.E463K	PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	463	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTATGTCCTTGAAAACAACCC	0.527																																																0			5											138.0	151.0	147.0					5																	140755037		2038	4213	6251	140735221	SO:0001583	missense	56109			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1387G>A	5.37:g.140755037G>A	ENSP00000429601:p.Glu463Lys	Somatic		Capture	Illumina GAIIx	4	140735221	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.E463K	ENST00000517434.1	37	c.1387	CCDS54926.1	5	.	.	.	.	.	.	.	.	.	.	.	17.51	3.406921	0.62399	.	.	ENSG00000253731	ENST00000517434	T	0.76316	-1.01	5.13	5.13	0.70059	Cadherin (4);Cadherin-like (1);	0.000000	0.31301	U	0.007895	D	0.93458	0.7913	H	0.98965	4.385	0.44194	D	0.997015	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95691	0.8740	10	0.87932	D	0	.	19.1356	0.93426	0.0:0.0:1.0:0.0	.	463;463	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	K	463	ENSP00000429601:E463K	ENSP00000429601:E463K	E	+	1	0	PCDHGA6	140735221	1.000000	0.71417	1.000000	0.80357	0.065000	0.16274	7.831000	0.86748	2.826000	0.97356	0.655000	0.94253	GAA	-	superfamily_Cadherin-like,HMMPfam_Cadherin		0.527	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	protein_coding	OTTHUMT00000374743.1	G	NM_018919		140735221	+1	no_errors	NM_018919	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
PCDHGA8	9708	genome.wustl.edu	37	5	140774126	140774126	+	Silent	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:140774126A>G	ENST00000398604.2	+	1	1746	c.1746A>G	c.(1744-1746)gcA>gcG	p.A582A	PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	582	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGCTCCGCAGAGCGTGGCT	0.682																																																0			5											74.0	86.0	82.0					5																	140774126		2201	4299	6500	140754310	SO:0001819	synonymous_variant	9708			AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1746A>G	5.37:g.140774126A>G		Somatic		Capture	Illumina GAIIx	4	140754310	A7MCZ4|O15039	Silent	SNP	HMMSmart_SM00112,superfamily_Cadherin-like,HMMPfam_Cadherin_2,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.A582	ENST00000398604.2	37	c.1746	CCDS47291.1	5																																																																																			-	superfamily_Cadherin-like,HMMPfam_Cadherin		0.682	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA8	protein_coding	OTTHUMT00000376972.1	A	NM_032088		140754310	+1	no_errors	NM_032088	genbank	human	reviewed	54_36p	silent	SNP	0.978	G
SPINK14	408187	genome.wustl.edu	37	5	147549315	147549315	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:147549315T>A	ENST00000356972.1	+	1	20	c.20T>A	c.(19-21)gTa>gAa	p.V7E	SPINK14_ENST00000562793.1_Missense_Mutation_p.V7E	NM_001001325.1	NP_001001325.1	Q6IE38	ISK14_HUMAN	serine peptidase inhibitor, Kazal type 14 (putative)	7						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|large_intestine(1)|lung(1)	3						TCTTTCCCAGTATTCTCACTT	0.393																																																0			5											222.0	200.0	207.0					5																	147549315		2203	4300	6503	147529508	SO:0001583	missense	408187				CCDS4288.1	5q32	2011-08-31			ENSG00000196800	ENSG00000196800		"""Serine peptidase inhibitors, Kazal type"""	33825	protein-coding gene	gene with protein product							Standard	NM_001001325		Approved	SPINK5L2	uc031sls.1	Q6IE38	OTTHUMG00000129732	ENST00000356972.1:c.20T>A	5.37:g.147549315T>A	ENSP00000349459:p.Val7Glu	Somatic		Capture	Illumina GAIIx	4	147529508		Missense_Mutation	SNP	superfamily_SSF100895,HMMSmart_KAZAL,HMMPfam_Kazal_1,PatternScan_KAZAL	p.V7E	ENST00000356972.1	37	c.20	CCDS4288.1	5	.	.	.	.	.	.	.	.	.	.	T	8.950	0.967947	0.18659	.	.	ENSG00000196800	ENST00000356972	D	0.88586	-2.4	3.5	1.02	0.19986	.	2.775880	0.02616	N	0.102687	D	0.82838	0.5124	.	.	.	0.09310	N	1	B	0.30021	0.265	B	0.28139	0.086	T	0.70096	-0.4966	9	0.72032	D	0.01	-0.0046	3.7232	0.08465	0.0:0.1201:0.2237:0.6562	.	7	Q6IE38	ISK14_HUMAN	E	7	ENSP00000349459:V7E	ENSP00000349459:V7E	V	+	2	0	SPINK14	147529508	0.002000	0.14202	0.001000	0.08648	0.000000	0.00434	0.717000	0.25851	0.219000	0.20840	-0.387000	0.06579	GTA	-	NULL		0.393	SPINK14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPINK5L2	protein_coding	OTTHUMT00000251943.2	T	NM_001001325		147529508	+1	no_errors	NM_001001325	genbank	human	provisional	54_36p	missense	SNP	0.006	A
ARSI	340075	genome.wustl.edu	37	5	149677244	149677244	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:149677244C>T	ENST00000328668.7	-	2	1822	c.1243G>A	c.(1243-1245)Gtg>Atg	p.V415M		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	415					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.V415L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCAGCCTGCACGGCGGTGTTC	0.637																																																1	Substitution - Missense(1)	lung(1)	5											34.0	38.0	37.0					5																	149677244		2203	4299	6502	149657437	SO:0001583	missense	340075			AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1243G>A	5.37:g.149677244C>T	ENSP00000333395:p.Val415Met	Somatic		Capture	Illumina GAIIx	4	149657437	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	HMMPfam_Sulfatase,superfamily_Alkaline phosphatase-like,PatternScan_SULFATASE_1,PatternScan_SULFATASE_2	p.V415M	ENST00000328668.7	37	c.1243	CCDS34275.1	5	.	.	.	.	.	.	.	.	.	.	C	15.09	2.730768	0.48939	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.97731	-4.51;-4.51	4.59	4.59	0.56863	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.97626	0.9222	L	0.46741	1.465	0.58432	D	0.999999	D	0.59767	0.986	P	0.60886	0.88	D	0.97256	0.9901	10	0.35671	T	0.21	.	17.5928	0.88001	0.0:1.0:0.0:0.0	.	415	Q5FYB1	ARSI_HUMAN	M	415;272	ENSP00000333395:V415M;ENSP00000426879:V272M	ENSP00000333395:V415M	V	-	1	0	ARSI	149657437	0.574000	0.26684	0.939000	0.37840	0.661000	0.39034	1.281000	0.33214	2.377000	0.81083	0.561000	0.74099	GTG	-	HMMPfam_Sulfatase,superfamily_Alkaline phosphatase-like		0.637	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSI	protein_coding	OTTHUMT00000373681.1	C	NM_001012301		149657437	-1	no_errors	NM_001012301	genbank	human	validated	54_36p	missense	SNP	0.980	T
FLG	2312	genome.wustl.edu	37	1	152283753	152283753	+	Missense_Mutation	SNP	C	C	A	rs141677205	byFrequency	TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:152283753C>A	ENST00000368799.1	-	3	3644	c.3609G>T	c.(3607-3609)agG>agT	p.R1203S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1203	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGGCATCAGACCTTCCCTGGG	0.562									Ichthyosis				C|||	9	0.00179712	0.0	0.0029	5008	,	,		22015	0.0		0.006	False		,,,				2504	0.001															0			1						C	SER/ARG	7,4399	12.9+/-30.5	0,7,2196	327.0	333.0	331.0		3609	-6.3	0.0	1	dbSNP_134	331	49,8545	30.7+/-82.3	0,49,4248	no	missense	FLG	NM_002016.1	110	0,56,6444	AA,AC,CC		0.5702,0.1589,0.4308	benign	1203/4062	152283753	56,12944	2203	4297	6500	150550377	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3609G>T	1.37:g.152283753C>A	ENSP00000357789:p.Arg1203Ser	Somatic		Capture	Illumina GAIIx	4	150550377	Q01720|Q5T583|Q9UC71	Splice_Site	SNP	-	e3+1	ENST00000368799.1	37	c.1661+1	CCDS30860.1	1	7	0.003205128205128205	0	0.0	1	0.0027624309392265192	0	0.0	6	0.0079155672823219	C	6.001	0.368515	0.11352	0.001589	0.005702	ENSG00000143631	ENST00000368799	T	0.01705	4.68	3.13	-6.27	0.02026	.	.	.	.	.	T	0.00524	0.0017	M	0.73962	2.25	0.09310	N	1	B	0.29212	0.237	B	0.28305	0.088	T	0.49263	-0.8958	9	0.09590	T	0.72	.	0.5498	0.00661	0.2772:0.1784:0.1375:0.4069	.	1203	P20930	FILA_HUMAN	S	1203	ENSP00000357789:R1203S	ENSP00000357789:R1203S	R	-	3	2	FLG	150550377	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-3.029000	0.00638	-1.136000	0.02892	0.425000	0.28330	AGG	-	-		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	C	NM_002016		150550377	-1	no_stop_codon	ENST00000271820	ensembl	human	known	54_36p	splice_site	SNP	0.001	A
FLG	2312	genome.wustl.edu	37	1	152284255	152284255	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:152284255C>T	ENST00000368799.1	-	3	3142	c.3107G>A	c.(3106-3108)cGc>cAc	p.R1036H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1036	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTGGTGGCGGGATCCGTG	0.562									Ichthyosis																																							0			1											361.0	360.0	361.0					1																	152284255		2203	4300	6503	150550879	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3107G>A	1.37:g.152284255C>T	ENSP00000357789:p.Arg1036His	Somatic		Capture	Illumina GAIIx	4	150550879	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	PatternScan_S100_CABP,HMMPfam_Filaggrin,HMMPfam_S_100,PatternScan_EF_HAND_1,superfamily_SSF47473	p.R1036H	ENST00000368799.1	37	c.3107	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.281695	0.23392	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.04015	3.73	3.61	-6.3	0.02007	.	.	.	.	.	T	0.00754	0.0025	N	0.21448	0.665	0.09310	N	1	P	0.34800	0.469	B	0.24155	0.051	T	0.44251	-0.9340	9	0.37606	T	0.19	.	6.8932	0.24241	0.0:0.6347:0.1383:0.227	.	1036	P20930	FILA_HUMAN	H	1036;243	ENSP00000357789:R1036H	ENSP00000357789:R1036H	R	-	2	0	FLG	150550879	0.000000	0.05858	0.000000	0.03702	0.218000	0.24690	-6.084000	0.00082	-1.268000	0.02439	0.299000	0.19835	CGC	-	HMMPfam_Filaggrin		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	C	NM_002016		150550879	-1	no_errors	NM_002016	genbank	human	provisional	54_36p	missense	SNP	0.003	T
C6orf211	79624	genome.wustl.edu	37	6	151775692	151775692	+	Silent	SNP	A	A	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr6:151775692A>C	ENST00000367294.3	+	2	310	c.51A>C	c.(49-51)gcA>gcC	p.A17A	C6orf211_ENST00000483931.1_3'UTR|C6orf211_ENST00000545879.1_Intron|RMND1_ENST00000367303.4_5'Flank	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	17										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		GATCATTTGCATATCTTACAA	0.318																																																0			6											98.0	97.0	97.0					6																	151775692		2203	4289	6492	151817385	SO:0001819	synonymous_variant	79624			AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.51A>C	6.37:g.151775692A>C		Somatic		Capture	Illumina GAIIx	4	151817385	Q96FC6|Q9UFY5	Silent	SNP	HMMPfam_DUF89,superfamily_DUF89	p.A17	ENST00000367294.3	37	c.51	CCDS5233.1	6																																																																																			-	NULL		0.318	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf211	protein_coding	OTTHUMT00000042724.1	A	NM_024573		151817385	+1	no_errors	NM_024573	genbank	human	predicted	54_36p	silent	SNP	0.984	C
ATP8B2	57198	genome.wustl.edu	37	1	154309855	154309855	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:154309855T>C	ENST00000368489.3	+	12	968	c.968T>C	c.(967-969)aTc>aCc	p.I323T	RNU7-57P_ENST00000459540.1_RNA|ATP8B2_ENST00000368487.3_Missense_Mutation_p.I290T|ATP8B2_ENST00000426445.1_3'UTR|ATP8B2_ENST00000341822.2_Missense_Mutation_p.I309T	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	309					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			ATGGGGGTGATCCTGGCCATT	0.557																																																0			1											222.0	196.0	205.0					1																	154309855		2203	4300	6503	152576479	SO:0001583	missense	57198			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.968T>C	1.37:g.154309855T>C	ENSP00000357475:p.Ile323Thr	Somatic		Capture	Illumina GAIIx	4	152576479	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	superfamily_SSF81665,superfamily_SSF81653,HMMPfam_E1-E2_ATPase,superfamily_SSF56784,PatternScan_ATPASE_E1_E2,superfamily_SSF81660,HMMPfam_Hydrolase_3	p.I323T	ENST00000368489.3	37	c.968	CCDS1066.1	1	.	.	.	.	.	.	.	.	.	.	T	16.33	3.093873	0.56075	.	.	ENSG00000143515	ENST00000368487;ENST00000368489;ENST00000341822	D;D;D	0.90324	-2.65;-2.65;-2.65	5.51	5.51	0.81932	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.93844	0.8031	M	0.79805	2.47	0.50632	D	0.999889	D;D;B	0.60575	0.988;0.986;0.168	D;P;B	0.62955	0.909;0.885;0.085	D	0.94569	0.7769	10	0.72032	D	0.01	.	14.6072	0.68489	0.0:0.0:0.0:1.0	.	309;323;290	P98198;P98198-3;P98198-4	AT8B2_HUMAN;.;.	T	290;323;309	ENSP00000357472:I290T;ENSP00000357475:I323T;ENSP00000340448:I309T	ENSP00000340448:I309T	I	+	2	0	ATP8B2	152576479	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.961000	0.56759	2.317000	0.78254	0.459000	0.35465	ATC	-	superfamily_SSF81665,HMMPfam_E1-E2_ATPase		0.557	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	protein_coding	OTTHUMT00000087658.2	T	NM_020452		152576479	+1	no_errors	NM_020452	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ISG20L2	81875	genome.wustl.edu	37	1	156697329	156697329	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:156697329C>T	ENST00000313146.6	-	1	898	c.116G>A	c.(115-117)gGc>gAc	p.G39D	RRNAD1_ENST00000368216.4_5'Flank|RRNAD1_ENST00000524343.1_5'Flank|ISG20L2_ENST00000368219.1_Missense_Mutation_p.G39D|ISG20L2_ENST00000472824.2_5'Flank|RRNAD1_ENST00000368218.4_5'Flank	NM_030980.1	NP_112242.1	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene 20kDa-like 2	39					ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ACTCAGAAAGCCTCTCCGTTC	0.483																																																0			1											73.0	83.0	79.0					1																	156697329		2203	4300	6503	154963953	SO:0001583	missense	81875			AK095697	CCDS1153.1	1q23.1	2013-10-11			ENSG00000143319	ENSG00000143319			25745	protein-coding gene	gene with protein product		611930				18065403	Standard	NM_030980		Approved	FLJ12671	uc001fps.1	Q9H9L3	OTTHUMG00000041301	ENST00000313146.6:c.116G>A	1.37:g.156697329C>T	ENSP00000323424:p.Gly39Asp	Somatic		Capture	Illumina GAIIx	4	154963953	D3DVC6|Q64KA2	Missense_Mutation	SNP	superfamily_RNaseH_fold,HMMSmart_EXOIII,HMMPfam_Exonuc_X-T	p.G39D	ENST00000313146.6	37	c.116	CCDS1153.1	1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901218	0.72754	.	.	ENSG00000143319	ENST00000313146;ENST00000368219	T;T	0.25414	1.8;1.8	5.17	4.18	0.49190	.	1.353990	0.04544	N	0.388757	T	0.19127	0.0459	L	0.34521	1.04	0.28102	N	0.931363	D	0.65815	0.995	P	0.55999	0.789	T	0.04454	-1.0950	10	0.35671	T	0.21	.	7.7708	0.29008	0.0:0.8866:0.0:0.1134	.	39	Q9H9L3	I20L2_HUMAN	D	39	ENSP00000323424:G39D;ENSP00000357202:G39D	ENSP00000323424:G39D	G	-	2	0	ISG20L2	154963953	0.812000	0.29077	0.891000	0.34965	0.993000	0.82548	2.781000	0.47750	2.692000	0.91855	0.655000	0.94253	GGC	-	NULL		0.483	ISG20L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISG20L2	protein_coding	OTTHUMT00000098969.1	C	NM_030980		154963953	-1	no_errors	NM_030980	genbank	human	provisional	54_36p	missense	SNP	0.647	T
GPR149	344758	genome.wustl.edu	37	3	154147153	154147153	+	Silent	SNP	C	C	T	rs372519523		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:154147153C>T	ENST00000389740.2	-	1	351	c.252G>A	c.(250-252)tcG>tcA	p.S84S		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	84					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AGATGGTCACCGACAGGACGC	0.478																																																0			3						C		0,4106		0,0,2053	93.0	97.0	96.0		252	-2.7	1.0	3		96	1,8417		0,1,4208	no	coding-synonymous	GPR149	NM_001038705.1		0,1,6261	TT,TC,CC		0.0119,0.0,0.0080		84/732	154147153	1,12523	2053	4209	6262	155629847	SO:0001819	synonymous_variant	344758			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.252G>A	3.37:g.154147153C>T		Somatic		Capture	Illumina GAIIx	4	155629847		Silent	SNP	NULL	p.S84	ENST00000389740.2	37	c.252	CCDS43162.1	3																																																																																			-	NULL		0.478	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	protein_coding	OTTHUMT00000353430.1	C	XM_293580		155629847	-1	no_errors	NM_001038705	genbank	human	provisional	54_36p	silent	SNP	0.630	T
GMPS	8833	genome.wustl.edu	37	3	155643134	155643134	+	Silent	SNP	A	A	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:155643134A>G	ENST00000496455.2	+	12	1874	c.1539A>G	c.(1537-1539)ccA>ccG	p.P513P	GMPS_ENST00000295920.7_Silent_p.P414P	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	513					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	TCTTGCTGCCAATTAAAACTG	0.408			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)		Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	0			3											99.0	97.0	98.0					3																	155643134		1901	4125	6026	157125828	SO:0001819	synonymous_variant	8833			U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1539A>G	3.37:g.155643134A>G		Somatic		Capture	Illumina GAIIx	4	157125828	A8K639|B4DXV7|F8W720	Silent	SNP	superfamily_Class I glutamine amidotransferase-like,HMMPfam_GATase,superfamily_Adenine nucleotide alpha hydrolases-like,HMMPfam_ExsB,HMMPfam_GMP_synt_C,superfamily_GMP synthetase C-terminal dimerisation domain	p.P513	ENST00000496455.2	37	c.1539	CCDS46941.1	3																																																																																			-	superfamily_Adenine nucleotide alpha hydrolases-like,HMMPfam_GMP_synt_C		0.408	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPS	protein_coding	OTTHUMT00000351260.2	A			157125828	+1	no_errors	NM_003875	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
GFM1	85476	genome.wustl.edu	37	3	158372415	158372415	+	Missense_Mutation	SNP	C	C	G	rs377068967		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:158372415C>G	ENST00000486715.1	+	8	1435	c.1078C>G	c.(1078-1080)Ctg>Gtg	p.L360V	GFM1_ENST00000478576.1_Missense_Mutation_p.L360V|GFM1_ENST00000264263.5_Missense_Mutation_p.L379V	NM_024996.5	NP_079272.4			G elongation factor, mitochondrial 1											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|urinary_tract(2)	22			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GGCTTTTAAACTGGAGGTAAG	0.323																																																0			3											73.0	76.0	75.0					3																	158372415		2203	4299	6502	159855109	SO:0001583	missense	85476			AF309777	CCDS33885.1	3q25	2008-02-05			ENSG00000168827	ENSG00000168827			13780	protein-coding gene	gene with protein product		606639	"""G translation elongation factor, mitochondrial"""			11374907, 11735030	Standard	NM_024996		Approved	EFGM, GFM, EGF1	uc003fce.3	Q96RP9	OTTHUMG00000158804	ENST00000486715.1:c.1078C>G	3.37:g.158372415C>G	ENSP00000419038:p.Leu360Val	Somatic		Capture	Illumina GAIIx	4	159855109		Missense_Mutation	SNP	superfamily_SSF52540,HMMPfam_GTP_EFTU,PatternScan_EFACTOR_GTP,superfamily_Translat_factor,HMMPfam_GTP_EFTU_D2,superfamily_EFG_III_V,superfamily_Ribosomal_S5_D2-typ_fold,HMMPfam_EFG_IV,HMMPfam_EFG_C	p.L360V	ENST00000486715.1	37	c.1078	CCDS33885.1	3	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591979	0.66219	.	.	ENSG00000168827	ENST00000486715;ENST00000478576;ENST00000264263;ENST00000312756	T;T;T	0.80824	-1.42;-1.42;-1.42	5.66	1.9	0.25705	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.64402	D	0.000001	D	0.85173	0.5636	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.998;0.998	T	0.82930	-0.0213	10	0.59425	D	0.04	-0.1238	10.5645	0.45165	0.0:0.7382:0.0:0.2618	.	379;360;360	Q96RP9-2;Q96RP9;C9IZ01	.;EFGM_HUMAN;.	V	360;360;379;94	ENSP00000419038:L360V;ENSP00000418755:L360V;ENSP00000264263:L379V	ENSP00000264263:L379V	L	+	1	2	GFM1	159855109	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	1.179000	0.31993	0.056000	0.16144	-0.137000	0.14449	CTG	-	superfamily_Translat_factor		0.323	GFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM1	protein_coding	OTTHUMT00000352271.1	C	NM_024996		159855109	+1	no_errors	NM_024996	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
LPA	4018	genome.wustl.edu	37	6	161007564	161007564	+	Missense_Mutation	SNP	G	G	A	rs201200716		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr6:161007564G>A	ENST00000316300.5	-	25	4090	c.4046C>T	c.(4045-4047)aCg>aTg	p.T1349M	LPA_ENST00000447678.1_Missense_Mutation_p.T1349M			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3857	Kringle 12. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TGGACATTGCGTCAGGTTGCA	0.522																																																0			6											134.0	135.0	135.0					6																	161007564		2168	4284	6452	160927554	SO:0001583	missense	4018			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4046C>T	6.37:g.161007564G>A	ENSP00000321334:p.Thr1349Met	Somatic		Capture	Illumina GAIIx	4	160927554	Q5VTD7|Q9UD88	Missense_Mutation	SNP	superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle,PatternScan_KRINGLE_1,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.T1349M	ENST00000316300.5	37	c.4046	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	g	13.44	2.236416	0.39498	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62941	-0.01;-0.01	2.39	-4.03	0.04021	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.50463	0.1617	L	0.46670	1.46	0.09310	N	0.999999	D	0.71674	0.998	D	0.79784	0.993	T	0.46020	-0.9221	9	0.54805	T	0.06	.	5.0802	0.14653	0.0:0.1932:0.2003:0.6065	.	3857	P08519	APOA_HUMAN	M	1349	ENSP00000321334:T1349M;ENSP00000395608:T1349M	ENSP00000321334:T1349M	T	-	2	0	LPA	160927554	0.002000	0.14202	0.316000	0.25252	0.413000	0.31143	-0.365000	0.07573	-1.024000	0.03338	0.436000	0.28706	ACG	-	superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle		0.522	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	protein_coding	OTTHUMT00000042957.1	G	NM_005577		160927554	-1	no_errors	NM_005577	genbank	human	validated	54_36p	missense	SNP	0.022	A
RGS4	5999	genome.wustl.edu	37	1	163043320	163043320	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:163043320G>A	ENST00000367909.6	+	4	626	c.286G>A	c.(286-288)Gaa>Aaa	p.E96K	RGS4_ENST00000367908.4_Intron|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000531057.1_Missense_Mutation_p.E96K|RGS4_ENST00000527809.1_Missense_Mutation_p.E78K|RGS4_ENST00000367906.3_Missense_Mutation_p.E78K|RGS4_ENST00000421743.2_Missense_Mutation_p.E193K	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	96	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						GATCAGCTGTGAAGAGTACAA	0.408																																					Ovarian(76;1257 1738 3039 6086)											0			1											124.0	115.0	118.0					1																	163043320		2203	4300	6503	161309944	SO:0001583	missense	5999			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.286G>A	1.37:g.163043320G>A	ENSP00000356885:p.Glu96Lys	Somatic		Capture	Illumina GAIIx	4	161309944	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	superfamily_Regulat_G_prot_signal_superfam,HMMPfam_RGS,HMMSmart_RGS	p.E193K	ENST00000367909.6	37	c.577	CCDS1243.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.327712	0.95733	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000531057;ENST00000527809;ENST00000367906;ENST00000528938	T;T;T;T;T;T	0.68765	-0.35;-0.35;4.37;-0.35;-0.35;4.37	4.79	4.79	0.61399	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	D	0.82273	0.5001	M	0.90145	3.09	0.47153	D	0.999330	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.86237	0.1641	9	0.87932	D	0	.	15.377	0.74615	0.0:0.0:1.0:0.0	.	96;193	P49798;A7XA59	RGS4_HUMAN;.	K	193;96;96;78;78;78	ENSP00000397181:E193K;ENSP00000356885:E96K;ENSP00000436106:E96K;ENSP00000433261:E78K;ENSP00000356882:E78K;ENSP00000432194:E78K	ENSP00000356882:E78K	E	+	1	0	RGS4	161309944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.658000	0.83755	2.469000	0.83416	0.650000	0.86243	GAA	-	superfamily_Regulat_G_prot_signal_superfam,HMMPfam_RGS,HMMSmart_RGS		0.408	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	protein_coding	OTTHUMT00000083197.2	G	NM_005613		161309944	+1	no_errors	NM_001102445	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SI	6476	genome.wustl.edu	37	3	164754198	164754198	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:164754198A>C	ENST00000264382.3	-	22	2556	c.2494T>G	c.(2494-2496)Tgg>Ggg	p.W832G		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	832	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	CCATCATCCCAGAAAAAGTCT	0.353										HNSCC(35;0.089)																																						0			3											115.0	118.0	117.0					3																	164754198		2203	4300	6503	166236892	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.2494T>G	3.37:g.164754198A>C	ENSP00000264382:p.Trp832Gly	Somatic		Capture	Illumina GAIIx	4	166236892	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	HMMSmart_SM00018,superfamily_Trefoil,HMMPfam_Trefoil,PatternScan_P_TREFOIL,HMMPfam_Glyco_hydro_31,superfamily_(Trans)glycosidases,PatternScan_GLYCOSYL_HYDROL_F31_1,PatternScan_GLYCOSYL_HYDROL_F31_2	p.W832G	ENST00000264382.3	37	c.2494	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	A	18.93	3.727144	0.69074	.	.	ENSG00000090402	ENST00000264382	D	0.89746	-2.56	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	D	0.95373	0.8498	M	0.92880	3.355	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.96231	0.9168	10	0.87932	D	0	.	13.2365	0.59972	1.0:0.0:0.0:0.0	.	832	P14410	SUIS_HUMAN	G	832	ENSP00000264382:W832G	ENSP00000264382:W832G	W	-	1	0	SI	166236892	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.916000	0.87491	2.010000	0.58986	0.528000	0.53228	TGG	-	NULL		0.353	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	protein_coding	OTTHUMT00000350116.1	A	NM_001041		166236892	-1	no_errors	NM_001041	genbank	human	validated	54_36p	missense	SNP	1.000	C
DOCK2	1794	genome.wustl.edu	37	5	169454921	169454921	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:169454921G>A	ENST00000256935.8	+	34	3516	c.3436G>A	c.(3436-3438)Gac>Aac	p.D1146N	DOCK2_ENST00000520908.1_Missense_Mutation_p.D638N|MIR378E_ENST00000581976.1_RNA|DOCK2_ENST00000540750.1_Missense_Mutation_p.D207N|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1146	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGGCCGAGGCGACGAGCAGTA	0.512																																																0			5											117.0	106.0	109.0					5																	169454921		2203	4300	6503	169387499	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3436G>A	5.37:g.169454921G>A	ENSP00000256935:p.Asp1146Asn	Somatic		Capture	Illumina GAIIx	4	169387499	Q2M3I0|Q96AK7	Missense_Mutation	SNP	superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_Cytochrome c	p.D1146N	ENST00000256935.8	37	c.3436	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.378441	0.95945	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.58797	0.31;0.31;0.31	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.79718	0.4494	M	0.86953	2.85	0.58432	D	0.999993	D;D	0.89917	1.0;0.999	D;D	0.75020	0.982;0.985	T	0.81974	-0.0687	10	0.49607	T	0.09	.	18.8352	0.92159	0.0:0.0:1.0:0.0	.	638;1146	E7ERW7;Q92608	.;DOCK2_HUMAN	N	1146;638;207	ENSP00000256935:D1146N;ENSP00000429283:D638N;ENSP00000438827:D207N	ENSP00000256935:D1146N	D	+	1	0	DOCK2	169387499	1.000000	0.71417	0.194000	0.23346	0.656000	0.38851	9.438000	0.97539	2.455000	0.83008	0.555000	0.69702	GAC	-	NULL		0.512	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	G	NM_004946		169387499	+1	no_errors	NM_004946	genbank	human	validated	54_36p	missense	SNP	0.999	A
DOCK2	1794	genome.wustl.edu	37	5	169494658	169494658	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr5:169494658G>T	ENST00000256935.8	+	45	4692	c.4612G>T	c.(4612-4614)Gct>Tct	p.A1538S	DOCK2_ENST00000520908.1_Missense_Mutation_p.A1030S|DOCK2_ENST00000540750.1_Missense_Mutation_p.A599S|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1538	DHR-2.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGTGGACCCTGCTGTCATGGG	0.552																																																0			5											151.0	142.0	145.0					5																	169494658		2203	4300	6503	169427236	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4612G>T	5.37:g.169494658G>T	ENSP00000256935:p.Ala1538Ser	Somatic		Capture	Illumina GAIIx	4	169427236	Q2M3I0|Q96AK7	Missense_Mutation	SNP	HMMSmart_SM00326,superfamily_SH3-domain,superfamily_Cytochrome c,HMMPfam_SH3_2	p.A1538S	ENST00000256935.8	37	c.4612	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170110	0.78452	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.16743	2.32;2.32;2.32	4.83	4.83	0.62350	Cytochrome c domain (1);	0.000000	0.85682	D	0.000000	T	0.45316	0.1336	M	0.81614	2.55	0.80722	D	1	D;P;D	0.76494	0.999;0.948;0.997	D;D;D	0.85130	0.997;0.979;0.984	T	0.39165	-0.9627	10	0.34782	T	0.22	.	18.2848	0.90111	0.0:0.0:1.0:0.0	.	1030;94;1538	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	S	1538;1030;599	ENSP00000256935:A1538S;ENSP00000429283:A1030S;ENSP00000438827:A599S	ENSP00000256935:A1538S	A	+	1	0	DOCK2	169427236	1.000000	0.71417	0.949000	0.38748	0.304000	0.27724	9.809000	0.99208	2.387000	0.81309	0.563000	0.77884	GCT	-	superfamily_Cytochrome c		0.552	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	G	NM_004946		169427236	+1	no_errors	NM_004946	genbank	human	validated	54_36p	missense	SNP	1.000	T
TLK1	9874	genome.wustl.edu	37	2	171906457	171906457	+	Missense_Mutation	SNP	T	T	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr2:171906457T>C	ENST00000431350.2	-	10	1251	c.847A>G	c.(847-849)Aca>Gca	p.T283A	TLK1_ENST00000521943.1_Missense_Mutation_p.T235A|TLK1_ENST00000442919.2_Missense_Mutation_p.T235A|TLK1_ENST00000434911.2_Missense_Mutation_p.T187A|TLK1_ENST00000360843.3_Missense_Mutation_p.T304A			Q9UKI8	TLK1_HUMAN	tousled-like kinase 1	283					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|liver(3)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TTTTCTTGTGTACTCTGAAAA	0.368																																																0			2											124.0	118.0	120.0					2																	171906457		2203	4300	6503	171614703	SO:0001583	missense	9874			AB004885	CCDS2241.1, CCDS46447.1, CCDS46448.1	2q31.1	2010-04-19			ENSG00000198586	ENSG00000198586			11841	protein-coding gene	gene with protein product		608438				9427565, 12660173	Standard	NM_012290		Approved	KIAA0137, PKU-BETA	uc002ugp.2	Q9UKI8	OTTHUMG00000132243	ENST00000431350.2:c.847A>G	2.37:g.171906457T>C	ENSP00000411099:p.Thr283Ala	Somatic		Capture	Illumina GAIIx	4	171614703	B3KR15|B4DX87|Q14150|Q8N591|Q9NYH2|Q9Y4F6	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.T283A	ENST00000431350.2	37	c.847	CCDS2241.1	2	.	.	.	.	.	.	.	.	.	.	T	15.35	2.808077	0.50421	.	.	ENSG00000198586	ENST00000442919;ENST00000431350;ENST00000360843;ENST00000521943;ENST00000434911	T;T;T;T;T	0.62105	0.07;0.05;0.05;0.07;0.07	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.54398	0.1856	L	0.37630	1.12	0.58432	D	0.999995	B;B;B	0.32731	0.004;0.01;0.382	B;B;B	0.32465	0.005;0.022;0.146	T	0.52087	-0.8622	10	0.32370	T	0.25	-2.9647	16.5655	0.84588	0.0:0.0:0.0:1.0	.	187;304;283	B4DX87;Q9UKI8-2;Q9UKI8	.;.;TLK1_HUMAN	A	235;283;304;235;187	ENSP00000402165:T235A;ENSP00000411099:T283A;ENSP00000354089:T304A;ENSP00000428113:T235A;ENSP00000409222:T187A	ENSP00000354089:T304A	T	-	1	0	TLK1	171614703	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.289000	0.72696	2.302000	0.77476	0.533000	0.62120	ACA	-	NULL		0.368	TLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLK1	protein_coding	OTTHUMT00000255314.1	T	NM_012290		171614703	-1	no_errors	NM_012290	genbank	human	validated	54_36p	missense	SNP	1.000	C
TNR	7143	genome.wustl.edu	37	1	175328794	175328794	+	Silent	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:175328794T>A	ENST00000367674.2	-	15	3636	c.2928A>T	c.(2926-2928)ccA>ccT	p.P976P	TNR_ENST00000263525.2_Silent_p.P976P			Q92752	TENR_HUMAN	tenascin R	976	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CCTCACCCACTGGTGCCTTCC	0.507																																																0			1											130.0	112.0	118.0					1																	175328794		2203	4300	6503	173595417	SO:0001819	synonymous_variant	7143			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.2928A>T	1.37:g.175328794T>A		Somatic		Capture	Illumina GAIIx	4	173595417	C9J563|Q15568|Q5R3G0	Silent	SNP	PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00181,HMMPfam_EGF_2,superfamily_EGF/Laminin,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,HMMSmart_SM00186,HMMPfam_Fibrinogen_C,superfamily_Fibrinogen C-terminal domain-like	p.P976	ENST00000367674.2	37	c.2928	CCDS1318.1	1																																																																																			-	HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III		0.507	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	protein_coding	OTTHUMT00000084414.4	T	NM_003285		173595417	-1	no_errors	NM_003285	genbank	human	validated	54_36p	silent	SNP	0.000	A
NDUFB5	4711	genome.wustl.edu	37	3	179333775	179333775	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:179333775T>A	ENST00000259037.3	+	3	332	c.218T>A	c.(217-219)tTc>tAc	p.F73Y	NDUFB5_ENST00000472629.1_Missense_Mutation_p.F61Y|NDUFB5_ENST00000473500.1_Intron|snoU13_ENST00000459278.1_RNA|NDUFB5_ENST00000493866.1_Intron	NM_002492.3	NP_002483.1	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa	73					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|lung(6)|skin(1)	8	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			TCTTAGAGATTCTACATTGCA	0.373																																																0			3											76.0	73.0	74.0					3																	179333775		2203	4300	6503	180816469	SO:0001583	missense	4711			AF047181	CCDS3234.1, CCDS56297.1, CCDS75054.1	3q27.1	2011-07-04	2002-08-29		ENSG00000136521	ENSG00000136521		"""Mitochondrial respiratory chain complex / Complex I"""	7700	protein-coding gene	gene with protein product	"""complex I SGDH subunit"""	603841	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5 (16kD, SGDH)"""			9425316	Standard	NM_002492		Approved	SGDH, CI-SGDH, MGC12314	uc003fkc.3	O43674	OTTHUMG00000157480	ENST00000259037.3:c.218T>A	3.37:g.179333775T>A	ENSP00000259037:p.Phe73Tyr	Somatic		Capture	Illumina GAIIx	4	180816469	Q561V6	Missense_Mutation	SNP	HMMPfam_NDUF_B5	p.F73Y	ENST00000259037.3	37	c.218	CCDS3234.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.76|19.76	3.887634|3.887634	0.72410|0.72410	.|.	.|.	ENSG00000136521|ENSG00000136521	ENST00000259037;ENST00000472629|ENST00000482604	T;T|.	0.50548|.	0.74;0.74|.	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	0.095927|.	0.64402|.	D|.	0.000001|.	T|T	0.69459|0.69459	0.3113|0.3113	M|M	0.62723|0.62723	1.935|1.935	0.58432|0.58432	D|D	0.999996|0.999996	B|.	0.31485|.	0.325|.	B|.	0.38264|.	0.269|.	T|T	0.69038|0.69038	-0.5251|-0.5251	10|5	0.41790|.	T|.	0.15|.	-12.3586|-12.3586	12.9542|12.9542	0.58416|0.58416	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	73|.	O43674|.	NDUB5_HUMAN|.	Y|T	73;61|90	ENSP00000259037:F73Y;ENSP00000419248:F61Y|.	ENSP00000259037:F73Y|.	F|S	+|+	2|1	0|0	NDUFB5|NDUFB5	180816469|180816469	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.933000|0.933000	0.57130|0.57130	2.194000|2.194000	0.42668|0.42668	2.009000|2.009000	0.58944|0.58944	0.459000|0.459000	0.35465|0.35465	TTC|TCT	-	HMMPfam_NDUF_B5		0.373	NDUFB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFB5	protein_coding	OTTHUMT00000348937.2	T	NM_002492		180816469	+1	no_errors	NM_002492	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
HTR3C	170572	genome.wustl.edu	37	3	183774688	183774688	+	Missense_Mutation	SNP	G	G	A	rs201628957		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr3:183774688G>A	ENST00000318351.1	+	5	449	c.415G>A	c.(415-417)Ggt>Agt	p.G139S		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	139					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	GACGCCTTCCGGTCTCACTGC	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		18506	0.001		0.0	False		,,,				2504	0.0															0			3											159.0	139.0	146.0					3																	183774688		2203	4300	6503	185257382	SO:0001583	missense	170572			AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	ENST00000318351.1:c.415G>A	3.37:g.183774688G>A	ENSP00000322617:p.Gly139Ser	Somatic		Capture	Illumina GAIIx	4	185257382	A2RRR5	Missense_Mutation	SNP	superfamily_Neur_chan_LBD,HMMPfam_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL,superfamily_Neu_channel_TM,HMMPfam_Neur_chan_memb	p.G139S	ENST00000318351.1	37	c.415	CCDS3250.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	.	10.90	1.482187	0.26598	.	.	ENSG00000178084	ENST00000318351	T	0.77489	-1.1	4.79	3.89	0.44902	Neurotransmitter-gated ion-channel ligand-binding (3);	0.786148	0.12335	N	0.477992	T	0.73575	0.3604	L	0.55743	1.74	0.09310	N	1	P	0.45672	0.864	B	0.43018	0.405	T	0.60094	-0.7330	10	0.21540	T	0.41	-2.0299	11.2641	0.49099	0.0:0.3588:0.6412:0.0	.	139	Q8WXA8	5HT3C_HUMAN	S	139	ENSP00000322617:G139S	ENSP00000322617:G139S	G	+	1	0	HTR3C	185257382	0.000000	0.05858	0.011000	0.14972	0.304000	0.27724	0.211000	0.17474	1.206000	0.43276	0.561000	0.74099	GGT	-	superfamily_Neur_chan_LBD,HMMPfam_Neur_chan_LBD		0.502	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3C	protein_coding	OTTHUMT00000346296.1	G	NM_130770		185257382	+1	no_errors	NM_130770	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
ZNF804A	91752	genome.wustl.edu	37	2	185803352	185803352	+	Missense_Mutation	SNP	C	C	A	rs141397832		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr2:185803352C>A	ENST00000302277.6	+	4	3823	c.3229C>A	c.(3229-3231)Cct>Act	p.P1077T		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1077							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CCTCCCACCCCCTAGCACACC	0.502																																																0			2											91.0	87.0	88.0					2																	185803352		2203	4300	6503	185511597	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3229C>A	2.37:g.185803352C>A	ENSP00000303252:p.Pro1077Thr	Somatic		Capture	Illumina GAIIx	4	185511597	A7E253|Q6ZN26	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.P1077T	ENST00000302277.6	37	c.3229	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	C	7.726	0.698156	0.15106	.	.	ENSG00000170396	ENST00000302277	T	0.08807	3.05	4.54	3.62	0.41486	.	0.387124	0.19091	N	0.122962	T	0.11153	0.0272	L	0.58101	1.795	0.09310	N	1	P	0.39480	0.675	B	0.42282	0.382	T	0.09400	-1.0676	10	0.52906	T	0.07	-13.0708	8.0471	0.30555	0.0:0.726:0.1769:0.097	.	1077	Q7Z570	Z804A_HUMAN	T	1077	ENSP00000303252:P1077T	ENSP00000303252:P1077T	P	+	1	0	ZNF804A	185511597	0.008000	0.16893	0.094000	0.20943	0.269000	0.26545	0.546000	0.23284	2.344000	0.79699	0.313000	0.20887	CCT	-	NULL		0.502	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	protein_coding	OTTHUMT00000255871.1	C	NM_194250		185511597	+1	no_errors	NM_194250	genbank	human	provisional	54_36p	missense	SNP	0.001	A
NBEAL1	65065	genome.wustl.edu	37	2	204075812	204075812	+	Silent	SNP	T	T	G			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr2:204075812T>G	ENST00000449802.1	+	53	8163	c.7830T>G	c.(7828-7830)tcT>tcG	p.S2610S		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2610										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GATTCCTGTCTATAAGAGATC	0.363																																																0			2											82.0	77.0	78.0					2																	204075812		1819	4081	5900	203784057	SO:0001819	synonymous_variant	65065			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.7830T>G	2.37:g.204075812T>G		Somatic		Capture	Illumina GAIIx	4	203784057	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Silent	SNP	superfamily_PH domain-like,superfamily_BEACH domain,HMMPfam_Beach,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.S1320	ENST00000449802.1	37	c.3960	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	T	8.055	0.766835	0.15983	.	.	ENSG00000144426	ENST00000434469	.	.	.	5.19	1.76	0.24704	.	.	.	.	.	T	0.57021	0.2025	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47182	-0.9137	4	.	.	.	.	8.3427	0.32254	0.0:0.6577:0.0:0.3423	.	.	.	.	R	138	.	.	L	+	2	0	NBEAL1	203784057	0.997000	0.39634	0.991000	0.47740	0.865000	0.49528	0.544000	0.23253	0.004000	0.14682	0.402000	0.26972	CTA	-	superfamily_WD40 repeat-like,HMMSmart_SM00320		0.363	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	protein_coding	OTTHUMT00000333982.4	T			203784057	+1	no_errors	NM_001099273	genbank	human	validated	54_36p	silent	SNP	1.000	G
IL24	11009	genome.wustl.edu	37	1	207072707	207072707	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:207072707G>T	ENST00000294984.2	+	3	361	c.87G>T	c.(85-87)caG>caT	p.Q29H	IL24_ENST00000367093.3_Missense_Mutation_p.Q30H|IL24_ENST00000391929.3_Missense_Mutation_p.Q30H|IL24_ENST00000491169.1_Intron	NM_001185156.1|NM_006850.3	NP_001172085.1|NP_006841.1	Q13007	IL24_HUMAN	interleukin 24	29					apoptotic process (GO:0006915)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|serine phosphorylation of STAT3 protein (GO:0033136)|wound healing (GO:0042060)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12	Breast(84;0.201)					CTCAAATGCAGATGGTTGTGC	0.587																																																0			1											63.0	63.0	63.0					1																	207072707		2203	4300	6503	205139330	SO:0001583	missense	11009			U16261	CCDS1471.1, CCDS53465.1, CCDS53466.1, CCDS73021.1	1q32	2011-07-15		2001-06-29	ENSG00000162892	ENSG00000162892		"""Interleukins and interleukin receptors"""	11346	protein-coding gene	gene with protein product	"""melanoma differentiation association protein 7"", ""suppression of tumorigenicity 16 (melanoma differentiation)"", ""IL-4-induced secreted protein"""	604136		ST16		8545104, 8799171	Standard	NM_001185156		Approved	mda-7, IL10B, Mob-5, C49A, FISP, IL-24	uc001heu.2	Q13007	OTTHUMG00000036459	ENST00000294984.2:c.87G>T	1.37:g.207072707G>T	ENSP00000294984:p.Gln29His	Somatic		Capture	Illumina GAIIx	4	205139330	Q2YHE5|Q53XZ7|Q5YLN8|Q96DB0|Q96KG4	Missense_Mutation	SNP	superfamily_4_helix_cytokine,PatternScan_INTERLEUKIN_10	p.Q29H	ENST00000294984.2	37	c.87	CCDS1471.1	1	.	.	.	.	.	.	.	.	.	.	G	9.185	1.024538	0.19433	.	.	ENSG00000162892	ENST00000391929;ENST00000294984;ENST00000367093	T;T	0.20069	2.1;2.1	4.33	2.41	0.29592	.	2.826840	0.00979	N	0.003346	T	0.18215	0.0437	N	0.21448	0.665	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.12156	0.007;0.007;0.007	T	0.28427	-1.0044	10	0.25751	T	0.34	.	10.8901	0.46990	0.0:0.4032:0.5968:0.0	.	30;30;29	Q2YHE5;Q53XZ7;Q13007	.;.;IL24_HUMAN	H	30;29;30	ENSP00000375795:Q30H;ENSP00000294984:Q29H	ENSP00000294984:Q29H	Q	+	3	2	IL24	205139330	0.001000	0.12720	0.002000	0.10522	0.035000	0.12851	0.236000	0.17967	0.548000	0.28955	0.467000	0.42956	CAG	-	NULL		0.587	IL24-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IL24	protein_coding	OTTHUMT00000088680.2	G	NM_006850		205139330	+1	no_errors	NM_006850	genbank	human	reviewed	54_36p	missense	SNP	0.003	T
CR1	1378	genome.wustl.edu	37	1	207697090	207697090	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:207697090G>T	ENST00000367049.4	+	5	622	c.622G>T	c.(622-624)Gtg>Ttg	p.V208L	CR1_ENST00000367053.1_Missense_Mutation_p.V208L|CR1_ENST00000400960.2_Missense_Mutation_p.V208L|CR1_ENST00000367051.1_Intron|CR1_ENST00000367050.4_3'UTR|CR1_ENST00000367052.1_Missense_Mutation_p.V208L	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	208	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GTTTGAGCTTGTGGGTGAGCC	0.522																																																0			1											22.0	20.0	21.0					1																	207697090		1773	4029	5802	205763713	SO:0001583	missense	1378			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.622G>T	1.37:g.207697090G>T	ENSP00000356016:p.Val208Leu	Somatic		Capture	Illumina GAIIx	4	205763713	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.V208L	ENST00000367049.4	37	c.622	CCDS44308.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.69|11.69	1.715040|1.715040	0.30413|0.30413	.|.	.|.	ENSG00000203710|ENSG00000203710	ENST00000529814|ENST00000367052;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T|T;T;T;T;T	0.70749|0.66099	-0.51|-0.19;-0.19;-0.19;-0.19;-0.19	4.23|4.23	-0.00714|-0.00714	0.14010|0.14010	.|Complement control module (2);Sushi/SCR/CCP (3);	.|.	.|.	.|.	.|.	T|T	0.53351|0.53351	0.1791|0.1791	L|L	0.46741|0.46741	1.465|1.465	0.09310|0.09310	N|N	1|1	.|P;P;P;P;P	.|0.43477	.|0.506;0.808;0.455;0.506;0.506	.|B;P;B;B;B	.|0.45998	.|0.136;0.5;0.424;0.245;0.245	T|T	0.42932|0.42932	-0.9422|-0.9422	7|9	0.87932|0.16420	D|T	0|0.52	.|.	6.5588|6.5588	0.22476|0.22476	0.4678:0.0:0.5322:0.0|0.4678:0.0:0.5322:0.0	.|.	.|658;208;183;208;208	.|Q5SR44;E9PQN4;Q5SR42;P17927;E9PDY4	.|.;.;.;CR1_HUMAN;.	F|L	183|208	ENSP00000434718:L183F|ENSP00000356019:V208L;ENSP00000356020:V208L;ENSP00000383744:V208L;ENSP00000436139:V208L;ENSP00000356016:V208L	ENSP00000434718:L183F|ENSP00000356016:V208L	L|V	+|+	3|1	2|0	CR1|CR1	205763713|205763713	0.001000|0.001000	0.12720|0.12720	0.006000|0.006000	0.13384|0.13384	0.092000|0.092000	0.18411|0.18411	0.154000|0.154000	0.16343|0.16343	-0.085000|-0.085000	0.12573|0.12573	0.467000|0.467000	0.42956|0.42956	TTG|GTG	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.522	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	protein_coding	OTTHUMT00000382527.1	G	NM_000573		205763713	+1	no_errors	NM_000651	genbank	human	reviewed	54_36p	missense	SNP	0.075	T
PLXNA2	5362	genome.wustl.edu	37	1	208206678	208206678	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:208206678G>T	ENST00000367033.3	-	28	5798	c.5041C>A	c.(5041-5043)Cta>Ata	p.L1681I		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1681					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GTGGCCAGTAGCCGGGTCAGG	0.582																																																0			1											125.0	112.0	116.0					1																	208206678		2203	4300	6503	206273301	SO:0001583	missense	5362			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.5041C>A	1.37:g.208206678G>T	ENSP00000356000:p.Leu1681Ile	Somatic		Capture	Illumina GAIIx	4	206273301	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP	p.L1681I	ENST00000367033.3	37	c.5041	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.248883	0.95305	.	.	ENSG00000076356	ENST00000367033	T	0.25749	1.78	5.53	5.53	0.82687	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.141593	0.49916	D	0.000140	T	0.64394	0.2594	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74396	-0.3679	10	0.87932	D	0	.	19.4936	0.95062	0.0:0.0:1.0:0.0	.	1681	O75051	PLXA2_HUMAN	I	1681	ENSP00000356000:L1681I	ENSP00000356000:L1681I	L	-	1	2	PLXNA2	206273301	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	7.659000	0.83766	2.605000	0.88082	0.655000	0.94253	CTA	-	HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP		0.582	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	protein_coding	OTTHUMT00000088932.6	G	NM_025179		206273301	-1	no_errors	NM_025179	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PIKFYVE	200576	genome.wustl.edu	37	2	209163382	209163382	+	Missense_Mutation	SNP	A	A	C	rs377371097		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr2:209163382A>C	ENST00000264380.4	+	8	1087	c.929A>C	c.(928-930)aAc>aCc	p.N310T	PIKFYVE_ENST00000392202.3_Missense_Mutation_p.N213T|PIKFYVE_ENST00000308862.6_Missense_Mutation_p.N224T|PIKFYVE_ENST00000407449.1_Missense_Mutation_p.N310T	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	310					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AGCATTACTAACCTGTCACTG	0.378																																																0			2						A	THR/ASN,THR/ASN,THR/ASN	1,4405	2.1+/-5.4	0,1,2202	116.0	103.0	107.0		638,929,929	5.5	1.0	2		107	0,8600		0,0,4300	no	missense,missense,missense	PIKFYVE	NM_152671.3,NM_015040.3,NM_001178000.1	65,65,65	0,1,6502	CC,CA,AA		0.0,0.0227,0.0077	benign,benign,benign	213/452,310/2099,310/549	209163382	1,13005	2203	4300	6503	208871627	SO:0001583	missense	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.929A>C	2.37:g.209163382A>C	ENSP00000264380:p.Asn310Thr	Somatic		Capture	Illumina GAIIx	4	208871627	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	"superfamily_FYVE/PHD zinc finger,HMMSmart_SM00064,HMMPfam_FYVE,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_DEP,HMMSmart_SM00049,superfamily_GroEL-intermediate domain like,HMMPfam_Cpn60_TCP1,superfamily_GroEL apical domain-like,superfamily_SAICAR synthase-like,HMMSmart_SM00330,HMMPfam_PIP5K"	p.N310T	ENST00000264380.4	37	c.929	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	A	19.61	3.859959	0.71834	2.27E-4	0.0	ENSG00000115020	ENST00000392202;ENST00000264380;ENST00000407449;ENST00000308862;ENST00000452564	T;T;T	0.64803	1.62;-0.12;1.78	5.53	5.53	0.82687	.	0.053822	0.64402	D	0.000001	T	0.48677	0.1513	N	0.24115	0.695	0.48395	D	0.999642	B;B;B;B;B	0.23540	0.024;0.087;0.003;0.009;0.02	B;B;B;B;B	0.18871	0.01;0.018;0.007;0.004;0.023	T	0.40979	-0.9534	10	0.26408	T	0.33	-23.8581	15.9435	0.79776	1.0:0.0:0.0:0.0	.	310;310;224;310;213	Q9Y2I7;E9PDH4;Q9Y2I7-3;Q08AR7;Q9Y2I7-2	FYV1_HUMAN;.;.;.;.	T	213;310;310;224;310	ENSP00000264380:N310T;ENSP00000384356:N310T;ENSP00000405736:N310T	ENSP00000264380:N310T	N	+	2	0	PIKFYVE	208871627	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.202000	0.65169	2.217000	0.71921	0.528000	0.53228	AAC	-	NULL		0.378	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP5K3	protein_coding	OTTHUMT00000256477.2	A	NM_015040		208871627	+1	no_errors	NM_015040	genbank	human	validated	54_36p	missense	SNP	1.000	C
USH2A	7399	genome.wustl.edu	37	1	215844479	215844479	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:215844479C>A	ENST00000307340.3	-	64	14354	c.13968G>T	c.(13966-13968)ttG>ttT	p.L4656F	USH2A_ENST00000366943.2_Missense_Mutation_p.L4656F	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4656	Fibronectin type-III 32. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTCCTGTCCACAAAAGAGAAA	0.448										HNSCC(13;0.011)																																						0			1											117.0	116.0	116.0					1																	215844479		2203	4300	6503	213911102	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.13968G>T	1.37:g.215844479C>A	ENSP00000305941:p.Leu4656Phe	Somatic		Capture	Illumina GAIIx	4	213911102	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00560,HMMSmart_SM00136,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_LAM_1,PatternScan_EGF_1,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMSmart_SM00282,HMMPfam_Laminin_G_2	p.L4656F	ENST00000307340.3	37	c.13968	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	8.571	0.880105	0.17467	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.57595	0.39;0.39	5.09	1.91	0.25777	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.965884	0.08353	U	0.959001	T	0.37652	0.1011	L	0.42686	1.345	0.27278	N	0.958179	B	0.11235	0.004	B	0.12837	0.008	T	0.32052	-0.9921	10	0.10111	T	0.7	.	3.1734	0.06560	0.1516:0.566:0.1331:0.1494	.	4656	O75445	USH2A_HUMAN	F	4656	ENSP00000305941:L4656F;ENSP00000355910:L4656F	ENSP00000305941:L4656F	L	-	3	2	USH2A	213911102	0.004000	0.15560	0.521000	0.27850	0.493000	0.33554	-0.008000	0.12788	0.611000	0.30052	0.557000	0.71058	TTG	-	HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III		0.448	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	C	NM_007123		213911102	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	missense	SNP	0.294	A
SLC23A3	151295	genome.wustl.edu	37	2	220034273	220034273	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr2:220034273G>C	ENST00000409878.3	-	2	322	c.290C>G	c.(289-291)tCt>tGt	p.S97C	SLC23A3_ENST00000455516.2_Missense_Mutation_p.S97C|SLC23A3_ENST00000295738.7_Missense_Mutation_p.S97C|SLC23A3_ENST00000396775.3_Missense_Mutation_p.S39C	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	97					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGGATGGTAGACATACCACA	0.577																																																0			2											131.0	138.0	136.0					2																	220034273		1959	4149	6108	219742517	SO:0001583	missense	151295			BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.290C>G	2.37:g.220034273G>C	ENSP00000386473:p.Ser97Cys	Somatic		Capture	Illumina GAIIx	4	219742517	B7Z512|Q2PYN6|Q96NA6	Missense_Mutation	SNP	HMMPfam_Xan_ur_permease	p.S97C	ENST00000409878.3	37	c.290	CCDS46518.1	2	.	.	.	.	.	.	.	.	.	.	G	13.78	2.340110	0.41398	.	.	ENSG00000213901	ENST00000396775;ENST00000295738;ENST00000409878;ENST00000455516;ENST00000409370	T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2	5.18	4.31	0.51392	.	0.197516	0.36519	N	0.002557	T	0.32615	0.0835	L	0.32530	0.975	0.42098	D	0.991321	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.77004	0.989;0.989;0.929	T	0.03403	-1.1040	9	.	.	.	.	12.5567	0.56257	0.0812:0.0:0.9188:0.0	.	97;97;97	Q6PIS1;B7Z512;Q6PIS1-2	S23A3_HUMAN;.;.	C	39;97;97;97;97	ENSP00000379996:S39C;ENSP00000295738:S97C;ENSP00000386473:S97C;ENSP00000406546:S97C;ENSP00000386989:S97C	.	S	-	2	0	SLC23A3	219742517	1.000000	0.71417	0.683000	0.30040	0.966000	0.64601	4.414000	0.59802	1.431000	0.47355	0.655000	0.94253	TCT	-	HMMPfam_Xan_ur_permease		0.577	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC23A3	protein_coding	OTTHUMT00000336331.2	G	NM_144712		219742517	-1	no_errors	NM_144712	genbank	human	validated	54_36p	missense	SNP	0.845	C
UGT1A9	54600	genome.wustl.edu	37	2	234580974	234580974	+	Nonsense_Mutation	SNP	A	A	T			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr2:234580974A>T	ENST00000354728.4	+	1	476	c.394A>T	c.(394-396)Aaa>Taa	p.K132*	UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A1_ENST00000609637.1_Nonsense_Mutation_p.K132*|UGT1A10_ENST00000344644.5_Intron			O60656	UD19_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A9	132					cellular glucuronidation (GO:0052695)|cellular lipid metabolic process (GO:0044255)|drug metabolic process (GO:0017144)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of fatty acid metabolic process (GO:0045922)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)			breast(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	37		Breast(86;0.000766)|all_lung(227;0.00269)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0331)|Lung NSC(271;0.0459)|Lung SC(224;0.128)		Epithelial(121;1.26e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000436)|Lung(119;0.00347)|LUSC - Lung squamous cell carcinoma(224;0.00757)	Acetaminophen(DB00316)|Buprenorphine(DB00921)|Canagliflozin(DB08907)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Entacapone(DB00494)|Etodolac(DB00749)|Ezogabine(DB04953)|Flurbiprofen(DB00712)|Haloperidol(DB00502)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ketobemidone(DB06738)|Lumiracoxib(DB01283)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Nateglinide(DB00731)|Niflumic Acid(DB04552)|Oxazepam(DB00842)|Propofol(DB00818)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sulfamethoxazole(DB01015)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zileuton(DB00744)	TAAAGACAAAAAATTAGTAGA	0.323																																																0			2											99.0	101.0	100.0					2																	234580974		2203	4300	6503	234245713	SO:0001587	stop_gained	54600			AF056188	CCDS2505.1	2q37	2010-03-05	2005-07-20		ENSG00000241119	ENSG00000241119		"""UDP glucuronosyltransferases"""	12541	other	complex locus constituent		606434	"""UDP glycosyltransferase 1 family, polypeptide A9"""			9295054, 1910331	Standard	NM_021027		Approved	HLUGP4, LUGP4, UGT1AI		O60656	OTTHUMG00000059124	ENST00000354728.4:c.394A>T	2.37:g.234580974A>T	ENSP00000346768:p.Lys132*	Somatic		Capture	Illumina GAIIx	4	234245713	B8K285|P36509|Q9HAX0	Nonsense_Mutation	SNP	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_UDPGT,PatternScan_UDPGT	p.K132*	ENST00000354728.4	37	c.394	CCDS2505.1	2	.	.	.	.	.	.	.	.	.	.	A	21.7	4.192679	0.78902	.	.	ENSG00000241119	ENST00000354728	.	.	.	3.41	1.04	0.20106	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.0927	0.06299	0.3641:0.2541:0.3818:0.0	.	.	.	.	X	132	.	ENSP00000346768:K132X	K	+	1	0	UGT1A9	234245713	0.559000	0.26562	0.015000	0.15790	0.509000	0.34042	1.805000	0.38883	0.503000	0.28060	0.362000	0.22060	AAA	-	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_UDPGT		0.323	UGT1A9-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A9	protein_coding	OTTHUMT00000130995.1	A	NM_021027		234245713	+1	no_errors	NM_021027	genbank	human	reviewed	54_36p	nonsense	SNP	0.001	T
PLEKHA7	144100	genome.wustl.edu	37	11	16811338	16811344	+	Frame_Shift_Del	DEL	CTGCTTT	CTGCTTT	-			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	CTGCTTT	CTGCTTT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr11:16811338_16811344delCTGCTTT	ENST00000355661.3	-	22	3144_3150	c.3134_3140delAAAGCAG	c.(3133-3141)gaaagcagcfs	p.ESS1045fs	PLEKHA7_ENST00000531066.1_Frame_Shift_Del_p.ESS1045fs|PLEKHA7_ENST00000448080.2_Frame_Shift_Del_p.ESS1046fs|PLEKHA7_ENST00000532079.1_Frame_Shift_Del_p.KAA52fs|PLEKHA7_ENST00000332954.4_5'UTR			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	1045					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						GGTCGCCTTGCTGCTTTCGGCATTGAG	0.604																																																0			11																																								16767920	SO:0001589	frameshift_variant	144100			BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.3134_3140delAAAGCAG	11.37:g.16811338_16811344delCTGCTTT	ENSP00000347883:p.Glu1045fs	Somatic		Capture	Illumina GAIIx	4	16767914	B4DK33|B4DWC3|Q86VZ7	Frame_Shift_Del	DEL	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.E1045fs	ENST00000355661.3	37	c.3140_3134	CCDS31434.1	11																																																																																			(deletion:cds_exon[16767898,16768001])	NULL		0.604	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA7	protein_coding	OTTHUMT00000387242.2	CTGCTTT	NM_175058		16767920	-1	no_errors	NM_175058	genbank	human	provisional	54_36p	frame_shift_del	DEL	0.974:0.972:0.982:0.976:0.961:0.929:0.939	-
SMG1	23049	genome.wustl.edu	37	16	18846266	18846268	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	CTT	CTT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr16:18846266_18846268delCTT	ENST00000446231.2	-	49	8688_8690	c.8276_8278delAAG	c.(8275-8280)gaagga>gga	p.E2759del	SMG1_ENST00000389467.3_In_Frame_Del_p.E2759del			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2759					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CTCAAAGATCCTTCTTCTCCATT	0.379																																																0			16																																								18753769	SO:0001651	inframe_deletion	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8276_8278delAAG	16.37:g.18846269_18846271delCTT	ENSP00000402515:p.Glu2759del	Somatic		Capture	Illumina GAIIx	4	18753767	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	In_Frame_Del	DEL	superfamily_ARM repeat,HMMPfam_HEAT,superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,PatternScan_PI3_4_KINASE_2,HMMPfam_FATC	p.E2759in_frame_del	ENST00000446231.2	37	c.8278_8276	CCDS45430.1	16																																																																																			(deletion:cds_exon[18753715,18753987])	NULL		0.379	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	protein_coding	OTTHUMT00000391817.1	CTT	NM_015092		18753769	-1	no_errors	NM_015092	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:1.000	-
HLA-W	352966	genome.wustl.edu	37	6	29926301	29926315	+	IGR	DEL	GGGACAGTACCCAGG	GGGACAGTACCCAGG	-	rs11267511|rs35102653|rs375927576	byFrequency	TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	GGGACAGTACCCAGG	GGGACAGTACCCAGG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr6:29926301_29926315delGGGACAGTACCCAGG								HLA-A (12640 upstream) : HCG9 (16573 downstream)																							ACCCGAAACAGGGACAGTACCCAGGGCTCTGATGT	0.521														1413	0.282149	0.2678	0.3588	5008	,	,		21400	0.3115		0.341	False		,,,				2504	0.1564															0			6																																								30034294	SO:0001628	intergenic_variant	0																															6.37:g.29926301_29926315delGGGACAGTACCCAGG		Somatic		Capture	Illumina GAIIx	4	30034280		Splice_Site	DEL	-	NULL		37	c.NULL		6																																																																																			(deletion:intron[30034132,30034280], utr_exon[30034281,30034326])	-	0	0.521					HLA-80			GGGACAGTACCCAGG			30034294	+1	no_coding_region:pseudogene	ENST00000407786	ensembl	human	known	54_36p	splice_site_del	DEL	0.051:0.152:0.703:0.880:0.949:0.974:0.984:0.987:0.986:0.987:0.984:0.975:0.951:0.934:0.879	-
NKX2-8	26257	genome.wustl.edu	37	14	37047026	37047026	+	IGR	DEL	G	G	-			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr14:37047026delG	ENST00000258829.5	-	0	1261					NM_014360.2	NP_055175.2	O15522	NKX28_HUMAN	NK2 homeobox 8						axonogenesis (GO:0007409)|liver development (GO:0001889)|lung development (GO:0030324)|negative regulation of epithelial cell proliferation (GO:0050680)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			upper_aerodigestive_tract(1)	1	Breast(36;0.143)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.0113)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0171)		TCACAGCCTTGGCATTGCTGG	0.498																																																0			14																																								36116777	SO:0001628	intergenic_variant	729042				CCDS9660.1	14q13.3	2012-03-09	2007-07-09	2002-10-04	ENSG00000136327	ENSG00000136327		"""Homeoboxes / ANTP class : NKL subclass"""	16364	protein-coding gene	gene with protein product		603245	"""NK-2 homolog H (Drosophila)"", ""NK2 transcription factor related, locus 8 (Drosophila)"""	NKX2H		9446603	Standard	NM_014360		Approved	NKX2.8, Nkx2-9	uc001wtx.3	O15522	OTTHUMG00000028772		14.37:g.37047026delG		Somatic		Capture	Illumina GAIIx	4	36116777	Q8IUT7	RNA	DEL	-	NULL	ENST00000258829.5	37	NULL	CCDS9660.1	14																																																																																			(deletion:rna[36116372,36116979])	-		0.498	NKX2-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729042	protein_coding	OTTHUMT00000071844.6	G			36116777	-1	pseudogene	XR_015435	genbank	human	model	54_36p	rna	DEL	0.907	-
CASK	8573	genome.wustl.edu	37	X	41390328	41390341	+	Frame_Shift_Del	DEL	TCCCATACATCGCA	TCCCATACATCGCA	-	rs141158465		TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	TCCCATACATCGCA	TCCCATACATCGCA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:41390328_41390341delTCCCATACATCGCA	ENST00000378163.1	-	25	2913_2926	c.2439_2452delTGCGATGTATGGGA	c.(2437-2454)gatgcgatgtatgggacafs	p.AMYGT814fs	CASK_ENST00000378158.1_Frame_Shift_Del_p.AMYGT797fs|CASK_ENST00000421587.2_Frame_Shift_Del_p.AMYGT785fs|CASK_ENST00000361962.4_Frame_Shift_Del_p.AMYGT797fs|CASK_ENST00000378166.4_Frame_Shift_Del_p.AMYGT809fs|CASK_ENST00000442742.2_Frame_Shift_Del_p.AMYGT786fs|CASK_ENST00000318588.9_Frame_Shift_Del_p.AMYGT809fs			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	814	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						TCCAGTTTTGTCCCATACATCGCATCCTCGTGGC	0.477																																					NSCLC(42;104 1086 3090 27189 35040)											0			X																																								41275285	SO:0001589	frameshift_variant	8573			AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.2439_2452delTGCGATGTATGGGA	X.37:g.41390328_41390341delTCCCATACATCGCA	ENSP00000367405:p.Ala814fs	Somatic		Capture	Illumina GAIIx	4	41275272	A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Frame_Shift_Del	DEL	HMMSmart_S_TKc,HMMPfam_Pkinase,superfamily_Kinase_like,superfamily_SSF101288,HMMSmart_L27,HMMPfam_L27,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,superfamily_SH3,HMMSmart_SH3,HMMPfam_SH3_2,superfamily_SSF52540,HMMSmart_GuKc,PatternScan_GUANYLATE_KINASE_1,HMMPfam_Guanylate_kin	p.A809fs	ENST00000378163.1	37	c.2437_2424		X																																																																																			(deletion:cds_exon[41275204,41275406])	superfamily_SSF52540,HMMSmart_GuKc,HMMPfam_Guanylate_kin		0.477	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	CASK	protein_coding	OTTHUMT00000056285.1	TCCCATACATCGCA	NM_003688		41275285	-1	no_errors	NM_003688	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:0.997:1.000:1.000:1.000:1.000:0.999:0.896:1.000:1.000:1.000	-
SPATA31A6	389730	genome.wustl.edu	37	9	43627922	43627926	+	Frame_Shift_Del	DEL	AGACA	AGACA	-			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	AGACA	AGACA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr9:43627922_43627926delAGACA	ENST00000332857.6	-	4	789_793	c.761_765delTGTCT	c.(760-765)ttgtctfs	p.LS254fs	SPATA31A6_ENST00000496386.1_5'UTR	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	254					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCTCATGTGGAGACAAGCTTTGAGG	0.566																																																0			9																																								43567922	SO:0001589	frameshift_variant	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.761_765delTGTCT	9.37:g.43627922_43627926delAGACA	ENSP00000329825:p.Leu254fs	Somatic		Capture	Illumina GAIIx	4	43567918		Frame_Shift_Del	DEL	NULL	p.L254fs	ENST00000332857.6	37	c.765_761	CCDS47973.1	9																																																																																			(deletion:cds_exon[43564651,43568374])	NULL		0.566	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A6	protein_coding	OTTHUMT00000036987.1	AGACA	NM_001145196		43567922	-1	no_errors	ENST00000332857	ensembl	human	known	54_36p	frame_shift_del	DEL	0.000:0.000:0.001:0.000:0.000	-
KDM5C	8242	genome.wustl.edu	37	X	53239909	53239917	+	In_Frame_Del	DEL	AAGGCTGAG	AAGGCTGAG	-			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	AAGGCTGAG	AAGGCTGAG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chrX:53239909_53239917delAAGGCTGAG	ENST00000375401.3	-	11	2056_2064	c.1524_1532delCTCAGCCTT	c.(1522-1533)ttctcagccttt>ttt	p.508_511FSAF>F	KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000404049.3_In_Frame_Del_p.507_510FSAF>F|KDM5C_ENST00000375379.3_In_Frame_Del_p.508_511FSAF>F|KDM5C_ENST00000375383.3_In_Frame_Del_p.467_470FSAF>F|KDM5C_ENST00000452825.3_In_Frame_Del_p.441_444FSAF>F|KDM5C_ENST00000465402.1_5'Flank	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	508	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						ATGCCAGCAAAAGGCTGAGAAGACCATGC	0.526			"""N, F, S"""		clear cell renal carcinoma																																		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0			X																																								53256642	SO:0001651	inframe_deletion	8242			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1524_1532delCTCAGCCTT	X.37:g.53239909_53239917delAAGGCTGAG	ENSP00000364550:p.Phe508_Ala510del	Somatic		Capture	Illumina GAIIx	4	53256634	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	In_Frame_Del	DEL	HMMSmart_SM00545,HMMPfam_JmjN,superfamily_ARID-like,HMMPfam_ARID,HMMSmart_SM00501,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,HMMSmart_SM00558,HMMPfam_JmjC,HMMPfam_zf-C5HC2,HMMPfam_PLU-1	p.SAF509in_frame_del	ENST00000375401.3	37	c.1532_1524	CCDS14351.1	X																																																																																			(deletion:cds_exon[53256583,53256764])	HMMSmart_SM00558,HMMPfam_JmjC		0.526	KDM5C-005	KNOWN	basic|CCDS	protein_coding	JARID1C	protein_coding	OTTHUMT00000056737.2	AAGGCTGAG	NM_004187		53256642	-1	no_errors	NM_004187	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:0.946:1.000:1.000:0.983:1.000:1.000:1.000	-
OR6C2	341416	genome.wustl.edu	37	12	55846284	55846284	+	Frame_Shift_Del	DEL	C	C	-			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr12:55846284delC	ENST00000322678.1	+	1	287	c.287delC	c.(286-288)gccfs	p.A96fs	RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	96					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						AATGCTTGTGCCAGTCAAATA	0.388																																																0			12											147.0	146.0	146.0					12																	55846284		2203	4299	6502	54132551	SO:0001589	frameshift_variant	341416			AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.287delC	12.37:g.55846284delC	ENSP00000323606:p.Ala96fs	Somatic		Capture	Illumina GAIIx	4	54132551		Frame_Shift_Del	DEL	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S97fs	ENST00000322678.1	37	c.287	CCDS31824.1	12																																																																																			(deletion:cds_exon[54132265,54133203])	superfamily_SSF81321,HMMPfam_7tm_1		0.388	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C2	protein_coding	OTTHUMT00000406676.1	C	NM_054105		54132551	+1	no_errors	NM_054105	genbank	human	provisional	54_36p	frame_shift_del	DEL	0.001	-
LPAR3	23566	genome.wustl.edu	37	1	85279714	85279715	+	In_Frame_Ins	INS	-	-	GAT			TCGA-24-1844-01A-01W-0639-09	TCGA-24-1844-10A-01W-0639-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	8ac8f7f3-99ca-438c-be13-1f05dec3b794	5a84bd05-0cd8-41bd-bfef-017a0c61c573	g.chr1:85279714_85279715insGAT	ENST00000440886.1	-	2	914_915	c.876_877insATC	c.(874-879)atctac>atcATCtac	p.292_293insI	LPAR3_ENST00000491034.1_5'UTR|LPAR3_ENST00000370611.3_In_Frame_Ins_p.292_293insI			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	292					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						TTGTAGGAGTAGATGATGGGGT	0.574																																																0			1																																								85052303	SO:0001652	inframe_insertion	23566			AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.874_876dupATC	1.37:g.85279718_85279720dupGAT	ENSP00000395389:p.Ile292_Ile292dup	Somatic		Capture	Illumina GAIIx	4	85052302	A0AVA3	In_Frame_Ins	INS	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.292in_frame_insI	ENST00000440886.1	37	c.877_876	CCDS700.1	1																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.574	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR3	protein_coding	OTTHUMT00000027467.1	-	NM_012152		85052303	-1	no_errors	NM_012152	genbank	human	reviewed	54_36p	in_frame_ins	INS	1.000:1.000	GAT
