#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ACP1	52	genome.wustl.edu	37	2	272227	272227	+	Intron	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:272227C>T	ENST00000272065.5	+	3	324				ACP1_ENST00000272067.6_Silent_p.N51N|ACP1_ENST00000484464.1_Intron|ACP1_ENST00000407983.3_Missense_Mutation_p.T103M|ACP1_ENST00000405233.1_Missense_Mutation_p.T61M|ACP1_ENST00000439645.2_Silent_p.N51N	NM_004300.3	NP_004291.1	P24666	PPAC_HUMAN	acid phosphatase 1, soluble							cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)	Adenine(DB00173)	CTGACTGGAACGTGGGCCGGT	0.522																																																0			2											141.0	116.0	124.0					2																	272227		2203	4300	6503	262227	SO:0001627	intron_variant	52			M87546	CCDS1639.1, CCDS1640.1, CCDS46217.1	2p25	2011-06-09			ENSG00000143727	ENSG00000143727	3.1.3.2	"""Protein tyrosine phosphatases / Class II Cys-based PTPs"""	122	protein-coding gene	gene with protein product		171500					Standard	NM_001040649		Approved		uc002qwf.3	P24666	OTTHUMG00000086933	ENST00000272065.5:c.231+77C>T	2.37:g.272227C>T		Somatic		Capture	Illumina GAIIx	4	262227	A8K1L9|B5MCC7|P24667|Q16035|Q16036|Q16725|Q3KQX8|Q53RU0	Missense_Mutation	SNP	superfamily_Tyr_Pase_low_mol_wt,HMMPfam_LMWPc,HMMSmart_LMWPc	p.T103M	ENST00000272065.5	37	c.308	CCDS1639.1	2	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638079	0.47153	.	.	ENSG00000143727	ENST00000407983;ENST00000405233;ENST00000449425	T;T	0.50001	0.87;0.76	5.87	3.84	0.44239	.	.	.	.	.	T	0.30324	0.0761	.	.	.	0.25996	N	0.982183	B	0.30709	0.291	B	0.13407	0.009	T	0.18461	-1.0336	8	0.56958	D	0.05	-26.7427	5.3835	0.16204	0.0:0.6713:0.0:0.3287	.	103	B5MCC7	.	M	103;61;61	ENSP00000385404:T103M;ENSP00000384307:T61M	ENSP00000384307:T61M	T	+	2	0	ACP1	262227	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.121000	0.31283	1.487000	0.48415	0.655000	0.94253	ACG	-	HMMSmart_LMWPc		0.522	ACP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACP1	protein_coding	OTTHUMT00000195862.3	C			262227	+1	no_errors	NM_001040649	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TPPP	11076	genome.wustl.edu	37	5	666107	666107	+	Missense_Mutation	SNP	G	G	C	rs139757569		TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr5:666107G>C	ENST00000360578.5	-	3	564	c.443C>G	c.(442-444)gCg>gGg	p.A148G	AC026740.1_ENST00000594226.1_5'Flank|CEP72_ENST00000514507.1_3'UTR	NM_007030.2	NP_008961.1	O94811	TPPP_HUMAN	tubulin polymerization promoting protein	148					microtubule bundle formation (GO:0001578)|microtubule polymerization (GO:0046785)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein polymerization (GO:0032273)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		Ovarian(839;0.0563)	Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)	GBM - Glioblastoma multiforme(108;0.0191)		GATGATGGGCGCCTTGCCCTC	0.682																																																0			5											84.0	76.0	79.0					5																	666107		2203	4300	6503	719107	SO:0001583	missense	11076			AB017016	CCDS3856.1	5p15.33	2008-02-05			ENSG00000171368	ENSG00000171368			24164	protein-coding gene	gene with protein product	"""brain specific protein p25 alpha"""	608773				10083737, 12093283, 15590652, 17105200	Standard	NM_007030		Approved	p25alpha, TPPP1, p25, TPPP/p25	uc003jbh.4	O94811	OTTHUMG00000131011	ENST00000360578.5:c.443C>G	5.37:g.666107G>C	ENSP00000353785:p.Ala148Gly	Somatic		Capture	Illumina GAIIx	4	719107		Missense_Mutation	SNP	HMMPfam_p25-alpha	p.A148G	ENST00000360578.5	37	c.443	CCDS3856.1	5	.	.	.	.	.	.	.	.	.	.	g	7.978	0.750479	0.15778	.	.	ENSG00000171368	ENST00000360578	T	0.39056	1.1	4.39	4.39	0.52855	.	0.265446	0.37178	N	0.002218	T	0.15609	0.0376	N	0.02685	-0.53	0.45216	D	0.99822	B	0.02656	0.0	B	0.08055	0.003	T	0.14035	-1.0487	10	0.06494	T	0.89	-20.854	9.0135	0.36155	0.0:0.1599:0.6751:0.1649	.	148	O94811	TPPP_HUMAN	G	148	ENSP00000353785:A148G	ENSP00000353785:A148G	A	-	2	0	TPPP	719107	0.009000	0.17119	0.908000	0.35775	0.032000	0.12392	1.635000	0.37134	2.157000	0.67596	0.555000	0.69702	GCG	-	HMMPfam_p25-alpha		0.682	TPPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPPP	protein_coding	OTTHUMT00000253645.3	G	NM_007030		719107	-1	no_errors	NM_007030	genbank	human	validated	54_36p	missense	SNP	0.848	C
ADARB2	105	genome.wustl.edu	37	10	1229278	1229278	+	Missense_Mutation	SNP	G	G	A	rs367615505	byFrequency	TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr10:1229278G>A	ENST00000381312.1	-	10	2400	c.2075C>T	c.(2074-2076)aCg>aTg	p.T692M	ADARB2_ENST00000381310.3_Missense_Mutation_p.T201M|ADARB2_ENST00000381305.1_Missense_Mutation_p.T94M	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	692	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.T692M(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CATGGAGGGCGTGTCTCCAGG	0.572													G|||	2	0.000399361	0.0015	0.0	5008	,	,		17501	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	endometrium(1)	10						G	MET/THR	2,4404	4.2+/-10.8	0,2,2201	66.0	64.0	65.0		2075	3.4	0.9	10		65	0,8600		0,0,4300	no	missense	ADARB2	NM_018702.3	81	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	692/740	1229278	2,13004	2203	4300	6503	1219278	SO:0001583	missense	105			AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.2075C>T	10.37:g.1229278G>A	ENSP00000370713:p.Thr692Met	Somatic		Capture	Illumina GAIIx	4	1219278	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	superfamily_SSF54768,HMMPfam_dsrm,HMMSmart_DSRM,HMMSmart_ADEAMc,HMMPfam_A_deamin	p.T692M	ENST00000381312.1	37	c.2075	CCDS7058.1	10	.	.	.	.	.	.	.	.	.	.	G	7.474	0.647207	0.14516	4.54E-4	0.0	ENSG00000185736	ENST00000381312;ENST00000381310;ENST00000381305	D;D;D	0.93712	-3.27;-3.27;-3.27	5.32	3.41	0.39046	Adenosine deaminase/editase (3);	0.935142	0.09187	N	0.836678	D	0.88455	0.6441	L	0.39397	1.21	0.26732	N	0.970579	P;B;P	0.51240	0.483;0.371;0.943	B;B;B	0.38378	0.148;0.105;0.272	T	0.78288	-0.2262	10	0.46703	T	0.11	-20.8642	8.1269	0.31003	0.3252:0.0:0.6748:0.0	.	692;94;201	Q9NS39;Q5VW43;Q5VW42	RED2_HUMAN;.;.	M	692;201;94	ENSP00000370713:T692M;ENSP00000370711:T201M;ENSP00000370706:T94M	ENSP00000370706:T94M	T	-	2	0	ADARB2	1219278	0.451000	0.25705	0.904000	0.35570	0.048000	0.14542	0.874000	0.28065	0.579000	0.29504	0.561000	0.74099	ACG	-	HMMSmart_ADEAMc,HMMPfam_A_deamin		0.572	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	protein_coding	OTTHUMT00000046426.1	G	NM_018702		1219278	-1	no_errors	NM_018702	genbank	human	reviewed	54_36p	missense	SNP	0.335	A
RHNO1	83695	genome.wustl.edu	37	12	2997337	2997337	+	Silent	SNP	G	G	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr12:2997337G>A	ENST00000489288.2	+	3	581	c.429G>A	c.(427-429)caG>caA	p.Q143Q	RHNO1_ENST00000461997.2_Silent_p.Q129Q|TULP3_ENST00000397132.2_5'Flank|TULP3_ENST00000448120.2_5'Flank|RHNO1_ENST00000464682.2_3'UTR	NM_001252499.2|NM_001257097.1|NM_001257098.1	NP_001239428.1|NP_001244026.1|NP_001244027.1	Q9BSD3	RHNO1_HUMAN	RAD9-HUS1-RAD1 interacting nuclear orphan 1	143					cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|positive regulation of G0 to G1 transition (GO:0070318)|recombinational repair (GO:0000725)	chromosome (GO:0005694)|nucleus (GO:0005634)											TGTCAGTGCAGGCACTTCAGA	0.483																																																0			12											143.0	138.0	140.0					12																	2997337		2203	4300	6503	2867598	SO:0001819	synonymous_variant	83695			AK021945	CCDS8518.1, CCDS58199.1	12p13.33	2012-08-23	2012-08-23	2012-08-23	ENSG00000171792	ENSG00000171792			28206	protein-coding gene	gene with protein product	"""Rad9, Rad1, Hus1 interacting nuclear orphan"""	614085	"""chromosome 12 open reading frame 32"""	C12orf32		20811708, 21659603	Standard	NM_001252499		Approved	HKMT1188, MGC13204, RHINO	uc031qfq.1	Q9BSD3	OTTHUMG00000158557	ENST00000489288.2:c.429G>A	12.37:g.2997337G>A		Somatic		Capture	Illumina GAIIx	4	2867598	B7Z989	Silent	SNP	NULL	p.Q143	ENST00000489288.2	37	c.429	CCDS8518.1	12																																																																																			-	NULL		0.483	RHNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf32	protein_coding	OTTHUMT00000351286.2	G	NM_031465		2867598	+1	no_errors	ENST00000303648	ensembl	human	known	54_36p	silent	SNP	0.000	A
ITGAE	3682	genome.wustl.edu	37	17	3655137	3655137	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr17:3655137C>A	ENST00000263087.4	-	15	1798	c.1700G>T	c.(1699-1701)aGt>aTt	p.S567I		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	567					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		GGGGTGCCCACTCAGTATGCG	0.582																																					NSCLC(182;635 2928 8995 38788)											0			17											59.0	62.0	61.0					17																	3655137		2203	4300	6503	3601886	SO:0001583	missense	3682			L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.1700G>T	17.37:g.3655137C>A	ENSP00000263087:p.Ser567Ile	Somatic		Capture	Illumina GAIIx	4	3601886	Q17RS6|Q9NZU9	Missense_Mutation	SNP	superfamily_SSF69318,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,HMMSmart_Int_alpha,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_SSF69179,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.S567I	ENST00000263087.4	37	c.1700	CCDS32531.1	17	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389604	0.25118	.	.	ENSG00000083457	ENST00000263087	T	0.11385	2.78	3.89	-2.22	0.06952	.	.	.	.	.	T	0.09024	0.0223	L	0.61036	1.89	0.09310	N	1	P	0.49961	0.93	B	0.41571	0.36	T	0.17806	-1.0357	9	0.34782	T	0.22	.	0.6534	0.00830	0.1719:0.3445:0.1683:0.3153	.	567	P38570	ITAE_HUMAN	I	567	ENSP00000263087:S567I	ENSP00000263087:S567I	S	-	2	0	ITGAE	3601886	0.001000	0.12720	0.226000	0.23910	0.352000	0.29268	-0.418000	0.07080	-0.323000	0.08602	0.555000	0.69702	AGT	-	superfamily_SSF69318,HMMSmart_Int_alpha		0.582	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ITGAE	protein_coding	OTTHUMT00000438169.1	C	NM_002208		3601886	-1	no_errors	NM_002208	genbank	human	reviewed	54_36p	missense	SNP	0.007	A
FAM217A	222826	genome.wustl.edu	37	6	4069564	4069564	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr6:4069564T>A	ENST00000274673.3	-	7	1296	c.893A>T	c.(892-894)cAt>cTt	p.H298L	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	298																	AATAGTCATATGTTGTAATCG	0.433																																																0			6											119.0	118.0	119.0					6																	4069564		2203	4300	6503	4014563	SO:0001583	missense	222826			BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.893A>T	6.37:g.4069564T>A	ENSP00000274673:p.His298Leu	Somatic		Capture	Illumina GAIIx	4	4014563	Q5JYK1	Missense_Mutation	SNP	NULL	p.H298L	ENST00000274673.3	37	c.893	CCDS4489.1	6	.	.	.	.	.	.	.	.	.	.	T	15.90	2.970842	0.53614	.	.	ENSG00000145975	ENST00000274673;ENST00000538080;ENST00000470599	T	0.20200	2.09	5.29	2.85	0.33270	.	0.317286	0.31301	N	0.007890	T	0.12860	0.0312	L	0.55103	1.725	0.09310	N	0.999992	D	0.89917	1.0	D	0.87578	0.998	T	0.11251	-1.0595	10	0.02654	T	1	-15.3568	4.7309	0.12964	0.1645:0.0881:0.0:0.7473	.	298	Q8IXS0	CF146_HUMAN	L	298;145;426	ENSP00000274673:H298L	ENSP00000274673:H298L	H	-	2	0	C6orf146	4014563	0.813000	0.29090	0.017000	0.16124	0.978000	0.69477	1.066000	0.30604	0.440000	0.26502	0.528000	0.53228	CAT	-	NULL		0.433	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf146	protein_coding	OTTHUMT00000352577.2	T	NM_173563		4014563	-1	no_errors	NM_173563	genbank	human	predicted	54_36p	missense	SNP	0.137	A
OR52K2	119774	genome.wustl.edu	37	11	4471463	4471463	+	Silent	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr11:4471463C>T	ENST00000325719.4	+	1	939	c.894C>T	c.(892-894)acC>acT	p.T298T		NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGTCAAGACCAAGCAAATCC	0.502																																																0			11											108.0	102.0	104.0					11																	4471463		2201	4298	6499	4428039	SO:0001819	synonymous_variant	119774			AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.894C>T	11.37:g.4471463C>T		Somatic		Capture	Illumina GAIIx	4	4428039	A8MUY8|B2RP35|Q6IFK4	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T298	ENST00000325719.4	37	c.894	CCDS31351.1	11																																																																																			-	superfamily_Family A G protein-coupled receptor-like		0.502	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K2	protein_coding	OTTHUMT00000385844.1	C	NM_001005172		4428039	+1	no_errors	NM_001005172	genbank	human	provisional	54_36p	silent	SNP	0.964	T
FAM86A	196483	genome.wustl.edu	37	16	5139146	5139146	+	Missense_Mutation	SNP	C	C	T	rs147678499	byFrequency	TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr16:5139146C>T	ENST00000427587.4	-	7	922	c.854G>A	c.(853-855)cGc>cAc	p.R285H	FAM86A_ENST00000458008.4_Missense_Mutation_p.R251H|FAM86A_ENST00000587133.1_Missense_Mutation_p.R224H	NM_201400.2	NP_958802.1	Q96G04	FA86A_HUMAN	family with sequence similarity 86, member A	285						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	12						CTCTGGGTTGCGGACGGTAAA	0.677													c|||	11	0.00219649	0.0083	0.0	5008	,	,		16179	0.0		0.0	False		,,,				2504	0.0															0			16						T	HIS/ARG,HIS/ARG	18,2992		0,18,1487	95.0	112.0	106.0		854,752	3.1	0.9	16	dbSNP_134	106	0,5412		0,0,2706	no	missense,missense	FAM86A	NM_201400.2,NM_201598.2	29,29	0,18,4193	TT,TC,CC		0.0,0.598,0.2137	benign,benign	285/331,251/297	5139146	18,8404	1505	2706	4211	5079147	SO:0001583	missense	196483			BC010084	CCDS10529.1, CCDS10530.1, CCDS73823.1	16p13.3	2012-11-07			ENSG00000118894	ENSG00000118894			32221	protein-coding gene	gene with protein product		615263					Standard	NM_201400		Approved	SB153, MGC19636	uc002cyo.2	Q96G04	OTTHUMG00000129527	ENST00000427587.4:c.854G>A	16.37:g.5139146C>T	ENSP00000398502:p.Arg285His	Somatic		Capture	Illumina GAIIx	4	5079147	D3DUF0|Q96S85	Missense_Mutation	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_Methyltransf_16	p.R285H	ENST00000427587.4	37	c.854	CCDS10529.1	16	.	.	.	.	.	.	.	.	.	.	c	14.14	2.445111	0.43429	0.00598	0.0	ENSG00000118894	ENST00000458008;ENST00000427587	T;T	0.14022	2.54;2.54	4.05	3.1	0.35709	.	2.545180	0.01315	U	0.010754	T	0.33089	0.0851	H	0.94462	3.54	0.58432	D	0.999994	P;D	0.54964	0.931;0.969	P;P	0.50109	0.497;0.631	T	0.39860	-0.9593	10	0.62326	D	0.03	.	9.4547	0.38747	0.0:0.8972:0.0:0.1028	.	251;285	Q96G04-2;Q96G04	.;FA86A_HUMAN	H	251;285	ENSP00000389710:R251H;ENSP00000398502:R285H	ENSP00000398502:R285H	R	-	2	0	FAM86A	5079147	1.000000	0.71417	0.948000	0.38648	0.006000	0.05464	5.711000	0.68400	1.057000	0.40506	-0.405000	0.06341	CGC	-	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_Methyltransf_16		0.677	FAM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86A	protein_coding	OTTHUMT00000251713.1	C	NM_201400		5079147	-1	no_errors	NM_201400	genbank	human	validated	54_36p	missense	SNP	0.992	T
TP53	7157	genome.wustl.edu	37	17	7578492	7578492	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr17:7578492C>T	ENST00000269305.4	-	5	627	c.438G>A	c.(436-438)tgG>tgA	p.W146*	TP53_ENST00000420246.2_Nonsense_Mutation_p.W146*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Nonsense_Mutation_p.W146*|TP53_ENST00000455263.2_Nonsense_Mutation_p.W146*|TP53_ENST00000413465.2_Nonsense_Mutation_p.W146*|TP53_ENST00000359597.4_Nonsense_Mutation_p.W146*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	146	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		W -> C (in a sporadic cancer; somatic mutation).|W -> G (in sporadic cancers; somatic mutation).|W -> L (in sporadic cancers; somatic mutation).|W -> R (in sporadic cancers; somatic mutation).|W -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.W146*(39)|p.0?(8)|p.W53*(3)|p.W14*(3)|p.W146C(2)|p.Q144_G154del11(1)|p.W146_V147insXXXXXXX(1)|p.W146_S149>C(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.W146fs*1(1)|p.L137_W146del10(1)|p.W146fs*22(1)|p.W146fs*23(1)|p.V143_S149del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGAATCAACCCACAGCTGCA	0.602		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	65	Substitution - Nonsense(45)|Whole gene deletion(8)|Deletion - Frameshift(4)|Deletion - In frame(3)|Substitution - Missense(2)|Insertion - In frame(1)|Complex - frameshift(1)|Complex - deletion inframe(1)	lung(9)|liver(8)|breast(7)|large_intestine(6)|upper_aerodigestive_tract(5)|endometrium(5)|central_nervous_system(4)|oesophagus(4)|ovary(4)|bone(4)|stomach(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|soft_tissue(1)|biliary_tract(1)|pancreas(1)	17											58.0	57.0	57.0					17																	7578492		2203	4300	6503	7519217	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.438G>A	17.37:g.7578492C>T	ENSP00000269305:p.Trp146*	Somatic		Capture	Illumina GAIIx	4	7519217	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.W146*	ENST00000269305.4	37	c.438	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653238	0.47362	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	.	.	.	5.48	4.52	0.55395	.	0.722123	0.13656	N	0.371928	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-1.8394	7.2875	0.26348	0.1676:0.7467:0.0:0.0857	.	.	.	.	X	146;146;146;146;146;146;135;53;14;53;14;146	.	ENSP00000269305:W146X	W	-	3	0	TP53	7519217	0.545000	0.26449	0.478000	0.27316	0.067000	0.16453	1.174000	0.31932	1.452000	0.47756	0.655000	0.94253	TGG	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.602	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519217	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.947	T
DNAH2	146754	genome.wustl.edu	37	17	7691402	7691402	+	Splice_Site	SNP	A	A	C			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr17:7691402A>C	ENST00000572933.1	+	44	8201		c.e44-1		DNAH2_ENST00000389173.2_Splice_Site			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				ATTCAACTCCAGGCTGAGGTG	0.532																																																0			17											69.0	69.0	69.0					17																	7691402		2203	4300	6503	7632127	SO:0001630	splice_region_variant	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6742-1A>C	17.37:g.7691402A>C		Somatic		Capture	Illumina GAIIx	4	7632127	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Splice_Site	SNP	-	e43-2	ENST00000572933.1	37	c.6742-2	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	A	16.26	3.074161	0.55646	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	.	.	.	5.37	4.22	0.49857	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8597	0.41107	0.8282:0.1718:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH2	7632127	1.000000	0.71417	0.058000	0.19502	0.357000	0.29423	7.647000	0.83462	2.034000	0.60081	0.459000	0.35465	.	-	-		0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	protein_coding	OTTHUMT00000440241.1	A	NM_020877	Intron	7632127	+1	no_errors	NM_020877	genbank	human	validated	54_36p	splice_site	SNP	0.482	C
PZP	5858	genome.wustl.edu	37	12	9311110	9311110	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr12:9311110G>T	ENST00000261336.2	-	26	3228	c.3200C>A	c.(3199-3201)gCa>gAa	p.A1067E	PZP_ENST00000381997.2_Missense_Mutation_p.A853E|PZP_ENST00000539983.1_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1067					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GGTAATGTGTGCTTCATCAAT	0.493																																					Melanoma(125;1402 1695 4685 34487 38571)											0			12											182.0	166.0	171.0					12																	9311110		2203	4300	6503	9202377	SO:0001583	missense	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3200C>A	12.37:g.9311110G>T	ENSP00000261336:p.Ala1067Glu	Somatic		Capture	Illumina GAIIx	4	9202377	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	PatternScan_TONB_DEPENDENT_REC_1,HMMPfam_A2M_N,HMMPfam_A2M_N_2,HMMPfam_A2M,superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_Thiol-ester_cl,PatternScan_ALPHA_2_MACROGLOBULIN,HMMPfam_A2M_comp,superfamily_Alpha-macroglobulin receptor domain,HMMPfam_A2M_recep	p.A1067E	ENST00000261336.2	37	c.3200	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	G	0.559	-0.846130	0.02671	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.35605	1.3;1.3	4.44	1.23	0.21249	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.520640	0.16323	U	0.219453	T	0.23094	0.0558	L	0.27053	0.805	0.09310	N	1	B;B	0.23249	0.082;0.072	B;B	0.29353	0.053;0.101	T	0.19811	-1.0294	10	0.31617	T	0.26	.	6.4468	0.21882	0.0952:0.0:0.3741:0.5307	.	853;1067	P20742-2;P20742	.;PZP_HUMAN	E	1067;853	ENSP00000261336:A1067E;ENSP00000371427:A853E	ENSP00000261336:A1067E	A	-	2	0	PZP	9202377	0.000000	0.05858	0.006000	0.13384	0.020000	0.10135	0.277000	0.18734	0.539000	0.28788	-0.244000	0.11960	GCA	-	superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_A2M_comp		0.493	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	protein_coding	OTTHUMT00000337624.1	G	NM_002864		9202377	-1	no_errors	NM_002864	genbank	human	validated	54_36p	missense	SNP	0.085	T
MYOCD	93649	genome.wustl.edu	37	17	12656467	12656467	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr17:12656467C>G	ENST00000343344.4	+	10	1862	c.1862C>G	c.(1861-1863)aCc>aGc	p.T621S	MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Missense_Mutation_p.T621S|AC005358.1_ENST00000609971.1_Missense_Mutation_p.T525S			Q8IZQ8	MYCD_HUMAN	myocardin	621					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TCAGATCAAACCAATGTACTT	0.522																																																0			17											148.0	156.0	153.0					17																	12656467		2203	4300	6503	12597192	SO:0001583	missense	93649			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1862C>G	17.37:g.12656467C>G	ENSP00000341835:p.Thr621Ser	Somatic		Capture	Illumina GAIIx	4	12597192	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	HMMSmart_SM00707,superfamily_SAP domain,HMMPfam_SAP,HMMSmart_SM00513	p.T621S	ENST00000343344.4	37	c.1862	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.869579	0.00547	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.39592	1.07;1.11	5.6	2.26	0.28386	.	0.380726	0.30419	N	0.009670	T	0.18635	0.0447	N	0.11560	0.145	0.09310	N	1	B;B;B;B	0.12013	0.003;0.003;0.005;0.003	B;B;B;B	0.12156	0.003;0.007;0.007;0.003	T	0.25398	-1.0133	10	0.07030	T	0.85	-7.991	8.9697	0.35899	0.2476:0.3666:0.3857:0.0	.	340;525;621;621	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	S	340;621;621;525;326	ENSP00000341835:T621S;ENSP00000400148:T326S	ENSP00000341835:T621S	T	+	2	0	MYOCD	12597192	0.004000	0.15560	0.053000	0.19242	0.008000	0.06430	0.905000	0.28504	0.679000	0.31345	0.655000	0.94253	ACC	-	NULL		0.522	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	protein_coding	OTTHUMT00000129950.1	C	NM_153604		12597192	+1	no_errors	NM_153604	genbank	human	provisional	54_36p	missense	SNP	0.002	G
NBAS	51594	genome.wustl.edu	37	2	15601357	15601357	+	Silent	SNP	T	T	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:15601357T>G	ENST00000281513.5	-	21	2332	c.2307A>C	c.(2305-2307)ccA>ccC	p.P769P	NBAS_ENST00000441750.1_Silent_p.P769P	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	769					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						AATATTCATGTGGAGAAGTGG	0.388																																																0			2											96.0	98.0	97.0					2																	15601357		2203	4300	6503	15518808	SO:0001819	synonymous_variant	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2307A>C	2.37:g.15601357T>G		Somatic		Capture	Illumina GAIIx	4	15518808	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	superfamily_WD40 repeat-like,HMMPfam_Sec39,PatternScan_RIBOSOMAL_S14	p.P769	ENST00000281513.5	37	c.2307	CCDS1685.1	2																																																																																			-	HMMPfam_Sec39		0.388	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	protein_coding	OTTHUMT00000241638.1	T	NM_015909		15518808	-1	no_errors	NM_015909	genbank	human	validated	54_36p	silent	SNP	0.840	G
ITGA8	8516	genome.wustl.edu	37	10	15701025	15701025	+	Silent	SNP	C	C	T	rs75923248	byFrequency	TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr10:15701025C>T	ENST00000378076.3	-	10	1274	c.921G>A	c.(919-921)acG>acA	p.T307T		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	307					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TCTGAATAAACGTCATATCCG	0.318													C|||	54	0.0107827	0.0393	0.0029	5008	,	,		16487	0.0		0.0	False		,,,				2504	0.0															0			10						C		143,4261	99.4+/-138.0	1,141,2060	52.0	55.0	54.0		921	-0.8	1.0	10	dbSNP_131	54	0,8596		0,0,4298	no	coding-synonymous	ITGA8	NM_003638.1		1,141,6358	TT,TC,CC		0.0,3.247,1.1		307/1064	15701025	143,12857	2202	4298	6500	15741031	SO:0001819	synonymous_variant	8516			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.921G>A	10.37:g.15701025C>T		Somatic		Capture	Illumina GAIIx	4	15741031	B0YJ31|Q5VX94	Silent	SNP	superfamily_SSF69318,HMMSmart_Int_alpha,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_SSF69179,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.T307	ENST00000378076.3	37	c.921	CCDS31155.1	10																																																																																			-	superfamily_SSF69318,HMMSmart_Int_alpha		0.318	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	protein_coding	OTTHUMT00000046987.1	C	NM_003638		15741031	-1	no_errors	NM_003638	genbank	human	provisional	54_36p	silent	SNP	0.997	T
MARCH11	441061	genome.wustl.edu	37	5	16067758	16067758	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr5:16067758A>G	ENST00000332432.8	-	4	1230	c.1031T>C	c.(1030-1032)tTg>tCg	p.L344S		NM_001102562.1	NP_001096032.1	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11	344					protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)|urinary_tract(1)	20						TGGCAACCACAAAGTCCTACT	0.488																																																0			5											107.0	105.0	106.0					5																	16067758		1934	4141	6075	16120758	SO:0001583	missense	441061			BC150513	CCDS47192.1	5p15.1	2013-01-09			ENSG00000183654	ENSG00000183654		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	33609	protein-coding gene	gene with protein product		613338				17604280	Standard	NM_001102562		Approved	MARCH-XI	uc003jfo.2	A6NNE9	OTTHUMG00000161789	ENST00000332432.8:c.1031T>C	5.37:g.16067758A>G	ENSP00000333181:p.Leu344Ser	Somatic		Capture	Illumina GAIIx	4	16120758	A7E2S6	Missense_Mutation	SNP	HMMSmart_SM00744,HMMPfam_zf-C3HC4	p.L344S	ENST00000332432.8	37	c.1031	CCDS47192.1	5	.	.	.	.	.	.	.	.	.	.	A	14.25	2.478064	0.44044	.	.	ENSG00000183654	ENST00000332432	T	0.19105	2.17	5.43	5.43	0.79202	.	0.000000	0.39909	N	0.001222	T	0.10981	0.0268	N	0.05078	-0.115	0.58432	D	0.999999	B	0.19935	0.04	B	0.22152	0.038	T	0.13415	-1.0510	10	0.08381	T	0.77	-13.0224	15.7733	0.78190	1.0:0.0:0.0:0.0	.	344	A6NNE9	MARHB_HUMAN	S	344	ENSP00000333181:L344S	ENSP00000333181:L344S	L	-	2	0	MARCH11	16120758	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.385000	0.66231	2.174000	0.68829	0.528000	0.53228	TTG	-	NULL		0.488	MARCH11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MARCH11	protein_coding	OTTHUMT00000366096.2	A	NM_001102562		16120758	-1	no_errors	NM_001102562	genbank	human	provisional	54_36p	missense	SNP	1.000	G
EPS15L1	58513	genome.wustl.edu	37	19	16552784	16552784	+	Silent	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr19:16552784C>T	ENST00000248070.6	-	3	223	c.84G>A	c.(82-84)ccG>ccA	p.P28P	CTD-2013N17.4_ENST00000587343.1_RNA|EPS15L1_ENST00000594975.1_Silent_p.P28P|EPS15L1_ENST00000597937.1_Silent_p.P28P|EPS15L1_ENST00000455140.2_Silent_p.P28P|EPS15L1_ENST00000535753.2_Silent_p.P28P	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	28	EH 1. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						CTGTGTATGCCGGATCGACCT	0.512											OREG0025335	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			19											84.0	88.0	87.0					19																	16552784		2203	4300	6503	16413784	SO:0001819	synonymous_variant	58513			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.84G>A	19.37:g.16552784C>T		Somatic	711	Capture	Illumina GAIIx	4	16413784	A2RRF3|A5PL29|B4DKA3	Silent	SNP	superfamily_SSF47473,HMMSmart_EH,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1	p.P28	ENST00000248070.6	37	c.84	CCDS32944.1	19																																																																																			-	superfamily_SSF47473,HMMSmart_EH		0.512	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	protein_coding	OTTHUMT00000461040.1	C	NM_021235		16413784	-1	no_errors	NM_021235	genbank	human	provisional	54_36p	silent	SNP	0.141	T
OR4K14	122740	genome.wustl.edu	37	14	20482852	20482852	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr14:20482852C>G	ENST00000305045.2	-	1	500	c.501G>C	c.(499-501)ttG>ttC	p.L167F		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		CACAGTAAGGCAAATTTACAG	0.478																																																0			14											78.0	76.0	77.0					14																	20482852		2203	4300	6503	19552692	SO:0001583	missense	122740				CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.501G>C	14.37:g.20482852C>G	ENSP00000305011:p.Leu167Phe	Somatic		Capture	Illumina GAIIx	4	19552692	Q6IEU1|Q96R71	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L167F	ENST00000305045.2	37	c.501	CCDS32027.1	14	.	.	.	.	.	.	.	.	.	.	.	9.599	1.128215	0.21041	.	.	ENSG00000169484	ENST00000305045	T	0.00253	8.43	4.04	-1.45	0.08828	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34828	N	0.003657	T	0.00496	0.0016	M	0.84846	2.72	0.20873	N	0.99984	D	0.89917	1.0	D	0.87578	0.998	T	0.34850	-0.9812	10	0.87932	D	0	.	9.1309	0.36843	0.0:0.5069:0.0:0.4931	.	167	Q8NGD5	OR4KE_HUMAN	F	167	ENSP00000305011:L167F	ENSP00000305011:L167F	L	-	3	2	OR4K14	19552692	0.000000	0.05858	0.984000	0.44739	0.168000	0.22595	-1.357000	0.02607	-0.104000	0.12154	-1.499000	0.00960	TTG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.478	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K14	protein_coding	OTTHUMT00000410343.1	C			19552692	-1	no_errors	NM_001004712	genbank	human	provisional	54_36p	missense	SNP	0.990	G
FOCAD	54914	genome.wustl.edu	37	9	20988332	20988332	+	Splice_Site	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr9:20988332C>T	ENST00000380249.1	+	43	5272	c.4908C>T	c.(4906-4908)ggC>ggT	p.G1636G	FOCAD_ENST00000338382.6_Splice_Site_p.G1636G|FOCAD_ENST00000605086.1_Splice_Site_p.G1072G	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1636						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											TCATTTCAGGCGTTTTGAAGA	0.383																																																0			9											141.0	131.0	134.0					9																	20988332		2203	4300	6503	20978332	SO:0001630	splice_region_variant	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.4907-1C>T	9.37:g.20988332C>T		Somatic		Capture	Illumina GAIIx	4	20978332	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Silent	SNP	superfamily_ARM-type_fold	p.G1636	ENST00000380249.1	37	c.4908	CCDS34993.1	9																																																																																			-	NULL		0.383	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1797	protein_coding	OTTHUMT00000143442.1	C	NM_017794	Silent	20978332	+1	no_errors	NM_017794	genbank	human	validated	54_36p	silent	SNP	0.816	T
HMGB1P5	10354	genome.wustl.edu	37	3	22423626	22423626	+	RNA	SNP	G	G	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr3:22423626G>T	ENST00000451497.1	+	0	191									high mobility group box 1 pseudogene 5																		TTCCTCTTCTGCTCTGAGTAT	0.468																																																0			3																																								22398630			0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22423626G>T		Somatic		Capture	Illumina GAIIx	4	22398630		Missense_Mutation	SNP	superfamily_HMG-box,HMMPfam_HMG_box,HMMSmart_SM00398,PatternScan_HMG_BOX_1	p.C106F	ENST00000451497.1	37	c.317		3																																																																																			-	superfamily_HMG-box,HMMSmart_SM00398,HMMPfam_HMG_box		0.468	HMGB1P5-002	KNOWN	basic	processed_transcript	ENSG00000132967	pseudogene	OTTHUMT00000340803.1	G	NG_000897		22398630	+1	no_stop_codon	ENST00000399439	ensembl	human	known	54_36p	missense	SNP	1.000	T
C22orf15	150248	genome.wustl.edu	37	22	24106768	24106768	+	Intron	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr22:24106768C>T	ENST00000402217.3	+	4	503				C22orf15_ENST00000305199.5_Intron|C22orf15_ENST00000382821.3_Intron	NM_182520.2	NP_872326.2	Q8WYQ4	CV015_HUMAN	chromosome 22 open reading frame 15											breast(1)|pancreas(1)	2		Medulloblastoma(6;6.27e-05)|all_neural(6;0.00518)				GAGTGAGAGGCAGAGTAGGGA	0.587																																																0			22											87.0	80.0	83.0					22																	24106768		2203	4300	6503	22436768	SO:0001627	intron_variant	150248			AB050773	CCDS13814.2	22q11.23	2012-11-13			ENSG00000169314	ENSG00000169314			15558	protein-coding gene	gene with protein product							Standard	NM_182520		Approved	FLJ36561, N27C7-3	uc011aja.2	Q8WYQ4	OTTHUMG00000150740	ENST00000402217.3:c.251-58C>T	22.37:g.24106768C>T		Somatic		Capture	Illumina GAIIx	4	22436768	Q6ICJ7	Silent	SNP	NULL	p.G16	ENST00000402217.3	37	c.48	CCDS13814.2	22																																																																																			-	NULL		0.587	C22orf15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf15	protein_coding	OTTHUMT00000319887.2	C	NM_182520		22436768	+1	no_errors	NM_182520	genbank	human	validated	54_36p	silent	SNP	0.000	T
MYH7	4625	genome.wustl.edu	37	14	23900815	23900815	+	Silent	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr14:23900815C>T	ENST00000355349.3	-	8	873	c.711G>A	c.(709-711)cgG>cgA	p.R237R		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	237	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		AGTTGTCGTTCCGGACGGTCT	0.597																																																0			14											180.0	167.0	172.0					14																	23900815		2203	4300	6503	22970655	SO:0001819	synonymous_variant	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.711G>A	14.37:g.23900815C>T		Somatic		Capture	Illumina GAIIx	4	22970655	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	HMMPfam_Myosin_N,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,superfamily_Prefoldin,HMMPfam_Myosin_tail_1	p.R237	ENST00000355349.3	37	c.711	CCDS9601.1	14																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	protein_coding	OTTHUMT00000071798.3	C	NM_000257		22970655	-1	no_errors	NM_000257	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
CHEK2	11200	genome.wustl.edu	37	22	29130576	29130576	+	Missense_Mutation	SNP	G	G	A	rs558321010		TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr22:29130576G>A	ENST00000405598.1	-	3	325	c.134C>T	c.(133-135)aCg>aTg	p.T45M	CHEK2_ENST00000544772.1_De_novo_Start_InFrame|CHEK2_ENST00000382580.2_Missense_Mutation_p.T45M|CHEK2_ENST00000404276.1_Missense_Mutation_p.T45M|CHEK2_ENST00000382566.1_Missense_Mutation_p.T45M|CHEK2_ENST00000348295.3_Missense_Mutation_p.T45M|CHEK2_ENST00000382578.1_Missense_Mutation_p.T45M|CHEK2_ENST00000403642.1_Missense_Mutation_p.T45M|CHEK2_ENST00000328354.6_Missense_Mutation_p.T45M|CHEK2_ENST00000402731.1_Missense_Mutation_p.T45M|CHEK2_ENST00000382565.1_Missense_Mutation_p.T45M			O96017	CHK2_HUMAN	checkpoint kinase 2	45					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						GTTTGGCATCGTGCTGGTAGA	0.562			F			breast		Direct reversal of damage;Other conserved DNA damage response genes					G|||	1	0.000199681	0.0	0.0014	5008	,	,		16359	0.0		0.0	False		,,,				2504	0.0					yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	0			22											149.0	131.0	137.0					22																	29130576		2203	4300	6503	27460576	SO:0001583	missense	11200			AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.134C>T	22.37:g.29130576G>A	ENSP00000386087:p.Thr45Met	Somatic		Capture	Illumina GAIIx	4	27460576	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	superfamily_SMAD/FHA domain,HMMSmart_SM00240,HMMPfam_FHA,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST	p.T45M	ENST00000405598.1	37	c.134	CCDS13843.1	22	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377850	0.61735	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000382565;ENST00000382563;ENST00000382566;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731;ENST00000447421;ENST00000439200;ENST00000398017	T;T;T;D;T;T;T;T;T;T;T;T;D	0.94092	0.72;-0.29;-0.35;-3.35;-0.28;-0.28;-0.28;2.28;-0.29;0.72;0.18;2.28;-2.39	4.87	4.87	0.63330	.	0.425641	0.29515	N	0.011922	D	0.92018	0.7471	N	0.19112	0.55	0.25355	N	0.988833	D;D;D;D;D;D	0.71674	0.998;0.998;0.997;0.998;0.997;0.998	P;P;P;P;P;P	0.56916	0.809;0.809;0.649;0.809;0.649;0.809	D	0.86616	0.1876	10	0.59425	D	0.04	-5.3586	15.1354	0.72562	0.0:0.1419:0.8581:0.0	.	45;45;45;45;45;45	O96017-7;O96017-4;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;.;CHK2_HUMAN;.	M	45;45;45;45;45;45;45;45;45;45;45;45;45;55	ENSP00000329012:T45M;ENSP00000372021:T45M;ENSP00000372006:T45M;ENSP00000372007:T45M;ENSP00000329178:T45M;ENSP00000385747:T45M;ENSP00000386087:T45M;ENSP00000372023:T45M;ENSP00000384919:T45M;ENSP00000384835:T45M;ENSP00000397478:T45M;ENSP00000408065:T45M;ENSP00000381099:T55M	ENSP00000329178:T45M	T	-	2	0	CHEK2	27460576	0.978000	0.34361	0.367000	0.25926	0.024000	0.10985	2.370000	0.44240	2.643000	0.89663	0.655000	0.94253	ACG	-	NULL		0.562	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHEK2	protein_coding	OTTHUMT00000321150.1	G	NM_001005735		27460576	-1	no_errors	NM_001005735	genbank	human	reviewed	54_36p	missense	SNP	0.113	A
ZKSCAN4	387032	genome.wustl.edu	37	6	28213601	28213601	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr6:28213601G>A	ENST00000377294.2	-	5	1174	c.931C>T	c.(931-933)Cag>Tag	p.Q311*	ZKSCAN4_ENST00000423974.2_Nonsense_Mutation_p.Q156*	NM_019110.3	NP_061983.2	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	311	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q311*(1)		endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						GCATTTTTCTGCTTTCTTTGT	0.468																																																1	Substitution - Nonsense(1)	lung(1)	6											106.0	91.0	96.0					6																	28213601		2203	4300	6503	28321580	SO:0001587	stop_gained	387032			AK056698	CCDS4647.1	6p21	2013-01-09	2007-02-20	2007-02-20	ENSG00000187626	ENSG00000187626		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13854	protein-coding gene	gene with protein product		611643	"""zinc finger protein 307"", ""zinc finger protein 427"""	ZNF307, ZNF427		12477932	Standard	NM_019110		Approved	p373c6.1, P1P373C6, FLJ32136, ZSCAN36	uc003nks.1	Q969J2	OTTHUMG00000014511	ENST00000377294.2:c.931C>T	6.37:g.28213601G>A	ENSP00000366509:p.Gln311*	Somatic		Capture	Illumina GAIIx	4	28321580	B2RE32|Q5U7L4	Nonsense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SCAN,superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.Q311*	ENST00000377294.2	37	c.931	CCDS4647.1	6	.	.	.	.	.	.	.	.	.	.	G	19.57	3.853287	0.71719	.	.	ENSG00000187626	ENST00000377294;ENST00000423974;ENST00000449813;ENST00000356796	.	.	.	4.95	3.04	0.35103	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	8.7448	0.34580	0.0858:0.0:0.7605:0.1537	.	.	.	.	X	311;156;17;187	.	ENSP00000349249:Q187X	Q	-	1	0	ZKSCAN4	28321580	0.858000	0.29795	0.998000	0.56505	0.902000	0.53008	2.822000	0.48073	2.447000	0.82792	0.655000	0.94253	CAG	-	superfamily_SSF57667		0.468	ZKSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN4	protein_coding	OTTHUMT00000040179.1	G	NM_019110		28321580	-1	no_errors	NM_019110	genbank	human	provisional	54_36p	nonsense	SNP	0.832	A
LSP1P3	729862	genome.wustl.edu	37	5	28927411	28927411	+	IGR	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr5:28927411C>G								CTD-2134P3.1 (118055 upstream) : SNORA18 (143191 downstream)																							ATAACGTGAACAGAAGGTAGT	0.438																																																0			5																																								28963168	SO:0001628	intergenic_variant	729862																															5.37:g.28927411C>G		Somatic		Capture	Illumina GAIIx	4	28963168		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.438					LOC729862			C			28963168	+1	no_errors	XR_040872	genbank	human	model	54_36p	rna	SNP	0.038	G
KIAA1462	57608	genome.wustl.edu	37	10	30318362	30318362	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr10:30318362C>T	ENST00000375377.1	-	3	816	c.715G>A	c.(715-717)Gag>Aag	p.E239K		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	239					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						CTCAGGCTCTCGGGGGAAAGA	0.458																																																0			10											141.0	143.0	142.0					10																	30318362		1963	4148	6111	30358368	SO:0001583	missense	57608			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.715G>A	10.37:g.30318362C>T	ENSP00000364526:p.Glu239Lys	Somatic		Capture	Illumina GAIIx	4	30358368	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	NULL	p.E239K	ENST00000375377.1	37	c.715	CCDS41500.1	10	.	.	.	.	.	.	.	.	.	.	C	10.97	1.500928	0.26861	.	.	ENSG00000165757	ENST00000375377	T	0.15256	2.44	5.35	3.48	0.39840	.	0.227382	0.38005	N	0.001855	T	0.13670	0.0331	L	0.46157	1.445	0.47511	D	0.999448	P	0.51351	0.944	B	0.37198	0.243	T	0.03068	-1.1076	10	0.44086	T	0.13	-22.694	10.9913	0.47551	0.0:0.8464:0.0:0.1536	.	239	Q9P266	K1462_HUMAN	K	239	ENSP00000364526:E239K	ENSP00000364526:E239K	E	-	1	0	KIAA1462	30358368	0.996000	0.38824	0.409000	0.26459	0.025000	0.11179	3.516000	0.53436	0.615000	0.30124	0.655000	0.94253	GAG	-	NULL		0.458	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	protein_coding	OTTHUMT00000047409.1	C	NM_020848		30358368	-1	no_errors	NM_020848	genbank	human	validated	54_36p	missense	SNP	0.986	T
IFNAR1	3454	genome.wustl.edu	37	21	34727745	34727745	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr21:34727745G>A	ENST00000270139.3	+	11	1716	c.1564G>A	c.(1564-1566)Gaa>Aaa	p.E522K	IFNAR1_ENST00000442357.2_Missense_Mutation_p.E461K|IFNAR1_ENST00000416947.2_Missense_Mutation_p.E453K	NM_000629.2	NP_000620.2	P17181	INAR1_HUMAN	interferon (alpha, beta and omega) receptor 1	522					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to virus (GO:0009615)|T cell activation (GO:0042110)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	type I interferon receptor activity (GO:0004905)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|skin(2)	14					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Natural alpha interferon(DB05258)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	TCAAACTGATGAAGATCATAA	0.318																																					Esophageal Squamous(73;817 1211 32990 35667 42746)											0			21											86.0	93.0	91.0					21																	34727745		2203	4300	6503	33649615	SO:0001583	missense	3454				CCDS13624.1	21q22.1	2008-05-02			ENSG00000142166	ENSG00000142166		"""Interferons"""	5432	protein-coding gene	gene with protein product		107450		IFNAR		8181059	Standard	NM_000629		Approved	IFRC	uc002yrn.3	P17181	OTTHUMG00000065126	ENST00000270139.3:c.1564G>A	21.37:g.34727745G>A	ENSP00000270139:p.Glu522Lys	Somatic		Capture	Illumina GAIIx	4	33649615	B2R6L9|B4DNT3|D3DSF0|Q53GW9|Q53H11|Q6PKD7|Q7M4L2|Q8WTZ2	Missense_Mutation	SNP	superfamily_Fibronectin type III	p.E522K	ENST00000270139.3	37	c.1564	CCDS13624.1	21	.	.	.	.	.	.	.	.	.	.	G	13.74	2.327745	0.41197	.	.	ENSG00000142166	ENST00000416947;ENST00000270139;ENST00000442357	T;T;T	0.44482	0.92;1.05;1.63	5.89	4.91	0.64330	.	1.032650	0.07646	N	0.931180	T	0.33089	0.0851	L	0.48642	1.525	0.09310	N	1	B	0.26902	0.163	B	0.22880	0.042	T	0.33701	-0.9858	10	0.10902	T	0.67	-16.5148	6.8729	0.24131	0.141:0.0:0.859:0.0	.	522	P17181	INAR1_HUMAN	K	453;522;461	ENSP00000395606:E453K;ENSP00000270139:E522K;ENSP00000407406:E461K	ENSP00000270139:E522K	E	+	1	0	IFNAR1	33649615	0.011000	0.17503	0.016000	0.15963	0.173000	0.22820	2.070000	0.41491	2.783000	0.95769	0.655000	0.94253	GAA	-	NULL		0.318	IFNAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNAR1	protein_coding	OTTHUMT00000139823.4	G			33649615	+1	no_errors	NM_000629	genbank	human	reviewed	54_36p	missense	SNP	0.002	A
RAPGEFL1	51195	genome.wustl.edu	37	17	38345176	38345176	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr17:38345176C>T	ENST00000456989.2	+	5	485	c.439C>T	c.(439-441)Cgc>Tgc	p.R147C	RAPGEFL1_ENST00000436615.3_Missense_Mutation_p.R92C|RAPGEFL1_ENST00000544503.1_Missense_Mutation_p.R141C|RAPGEFL1_ENST00000264644.6_Missense_Mutation_p.R92C|RAPGEFL1_ENST00000540388.1_3'UTR			Q9UHV5	RPGFL_HUMAN	Rap guanine nucleotide exchange factor (GEF)-like 1	298					G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)	15						CCGCCACTTCCGCCGGATAGA	0.632																																					Esophageal Squamous(28;274 750 6870 14218 42203)											0			17											53.0	54.0	54.0					17																	38345176		2203	4300	6503	35598702	SO:0001583	missense	51195			AF117946	CCDS11363.1	17q21.2	2006-08-01	2004-03-26		ENSG00000108352	ENSG00000108352			17428	protein-coding gene	gene with protein product	"""Link guanine nucleotide exchange factor II"""		"""RAP guanine-nucleotide-exchange factor (GEF)-like 1"""				Standard	NM_016339		Approved	Link-GEFII	uc010cwu.1	Q9UHV5	OTTHUMG00000133325	ENST00000456989.2:c.439C>T	17.37:g.38345176C>T	ENSP00000394530:p.Arg147Cys	Somatic		Capture	Illumina GAIIx	4	35598702		Missense_Mutation	SNP	superfamily_Ras_GEF,HMMPfam_RA,HMMSmart_RasGEF,HMMPfam_RasGEF	p.R92C	ENST00000456989.2	37	c.274		17	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684381	0.88639	.	.	ENSG00000108352	ENST00000456989;ENST00000543876;ENST00000544503;ENST00000537255;ENST00000264644;ENST00000436615;ENST00000538981	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.73	5.73	0.89815	Ras guanine nucleotide exchange factor, domain (1);	0.210293	0.40064	N	0.001200	T	0.57198	0.2037	L	0.36672	1.1	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	P;P	0.58266	0.836;0.719	T	0.58595	-0.7609	10	0.72032	D	0.01	.	18.65	0.91427	0.0:1.0:0.0:0.0	.	28;298	B4DGK9;Q9UHV5	.;RPGFL_HUMAN	C	147;92;141;92;297;92;92	ENSP00000394530:R147C;ENSP00000440226:R92C;ENSP00000438631:R141C;ENSP00000408322:R92C;ENSP00000441059:R92C	ENSP00000264644:R297C	R	+	1	0	RAPGEFL1	35598702	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.863000	0.62983	2.695000	0.91970	0.655000	0.94253	CGC	-	superfamily_Ras_GEF		0.632	RAPGEFL1-005	PUTATIVE	non_canonical_conserved|basic|exp_conf	protein_coding	RAPGEFL1	protein_coding	OTTHUMT00000397518.1	C	NM_016339		35598702	+1	no_errors	NM_016339	genbank	human	validated	54_36p	missense	SNP	1.000	T
NUP155	9631	genome.wustl.edu	37	5	37327817	37327817	+	Silent	SNP	G	G	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr5:37327817G>A	ENST00000231498.3	-	18	2141	c.1938C>T	c.(1936-1938)gcC>gcT	p.A646A	NUP155_ENST00000513532.1_Silent_p.A646A|RNU7-75P_ENST00000516071.1_RNA|NUP155_ENST00000381843.2_Silent_p.A587A	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	646	Pro-rich.				atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCATATTTGTGGCCTGAGTTG	0.418																																																0			5											100.0	84.0	89.0					5																	37327817		2203	4300	6503	37363574	SO:0001819	synonymous_variant	9631			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.1938C>T	5.37:g.37327817G>A		Somatic		Capture	Illumina GAIIx	4	37363574	Q9UBE9|Q9UFL5	Silent	SNP	HMMPfam_Nucleoporin	p.A646	ENST00000231498.3	37	c.1938	CCDS3921.1	5																																																																																			-	HMMPfam_Nucleoporin		0.418	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP155	protein_coding	OTTHUMT00000207593.2	G	NM_153485, NM_004298		37363574	-1	no_errors	NM_153485	genbank	human	reviewed	54_36p	silent	SNP	0.807	A
ATL2	64225	genome.wustl.edu	37	2	38523698	38523698	+	Intron	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:38523698C>G	ENST00000378954.4	-	13	1634				ATL2_ENST00000539122.1_Intron|ATL2_ENST00000452935.2_Intron|ATL2_ENST00000332337.4_Missense_Mutation_p.R543P|ATL2_ENST00000546051.1_Missense_Mutation_p.R390P|ATL2_ENST00000406122.1_Missense_Mutation_p.R390P|ATL2_ENST00000419554.2_Missense_Mutation_p.R556P|ATL2_ENST00000402054.1_Intron	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2						endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						GTGAACCATTCGACGTCTAGT	0.373																																																0			2											86.0	78.0	81.0					2																	38523698		2203	4300	6503	38377202	SO:0001627	intron_variant	64225				CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.1633-443G>C	2.37:g.38523698C>G		Somatic		Capture	Illumina GAIIx	4	38377202	B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	superfamily_SSF52540,HMMPfam_GBP,superfamily_GBP	p.R556P	ENST00000378954.4	37	c.1667	CCDS46260.1	2	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069160	0.36470	.	.	ENSG00000119787	ENST00000406122;ENST00000332337;ENST00000419554;ENST00000546051	D;D;D;D	0.94280	-3.39;-1.59;-2.88;-3.39	5.23	5.23	0.72850	.	.	.	.	.	D	0.91751	0.7391	L	0.50333	1.59	0.30695	N	0.750951	P;B;B	0.47409	0.895;0.305;0.451	B;B;B	0.41271	0.352;0.333;0.124	D	0.90869	0.4744	9	0.51188	T	0.08	.	18.1463	0.89656	0.0:1.0:0.0:0.0	.	390;543;556	B5MCN0;Q8NHH9-4;Q8NHH9-2	.;.;.	P	390;543;556;390	ENSP00000385446:R390P;ENSP00000333393:R543P;ENSP00000415336:R556P;ENSP00000438938:R390P	ENSP00000333393:R543P	R	-	2	0	ATL2	38377202	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.166000	0.58203	2.591000	0.87537	0.563000	0.77884	CGA	-	NULL		0.373	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATL2	protein_coding	OTTHUMT00000219886.2	C	NM_022374		38377202	-1	no_errors	NM_022374	genbank	human	validated	54_36p	missense	SNP	1.000	G
SLC8A1	6546	genome.wustl.edu	37	2	40656977	40656977	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:40656977C>A	ENST00000403092.1	-	2	477	c.444G>T	c.(442-444)gaG>gaT	p.E148D	SLC8A1_ENST00000402441.1_Missense_Mutation_p.E148D|SLC8A1_ENST00000542024.1_Missense_Mutation_p.E148D|SLC8A1_ENST00000405269.1_Missense_Mutation_p.E148D|SLC8A1_ENST00000406785.2_Missense_Mutation_p.E148D|SLC8A1_ENST00000408028.2_Missense_Mutation_p.E148D|SLC8A1_ENST00000332839.4_Missense_Mutation_p.E148D|SLC8A1_ENST00000406391.2_Missense_Mutation_p.E148D|SLC8A1_ENST00000542756.1_Missense_Mutation_p.E148D|SLC8A1_ENST00000405901.3_Missense_Mutation_p.E148D			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	148					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AAAGGAGAATCTCAGGAGCAG	0.468																																																0			2											127.0	117.0	120.0					2																	40656977		2203	4300	6503	40510481	SO:0001583	missense	6546				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.444G>T	2.37:g.40656977C>A	ENSP00000384763:p.Glu148Asp	Somatic		Capture	Illumina GAIIx	4	40510481	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	HMMPfam_Na_Ca_ex,HMMPfam_Calx-beta,HMMSmart_SM00237	p.E148D	ENST00000403092.1	37	c.444	CCDS1806.1	2	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756586	0.49362	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49;-0.49	5.59	3.8	0.43715	Sodium/calcium exchanger membrane region (1);	0.048392	0.85682	D	0.000000	D	0.84795	0.5551	M	0.91510	3.215	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.988;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.992;1.0;1.0;1.0	D	0.84502	0.0617	10	0.87932	D	0	.	7.5544	0.27817	0.0:0.7416:0.0:0.2584	.	148;148;148;148;148	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	D	148	ENSP00000383886:E148D;ENSP00000440727:E148D;ENSP00000384763:E148D;ENSP00000385678:E148D;ENSP00000385188:E148D;ENSP00000385535:E148D;ENSP00000332931:E148D;ENSP00000384908:E148D;ENSP00000385811:E148D;ENSP00000443515:E148D	ENSP00000332931:E148D	E	-	3	2	SLC8A1	40510481	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	0.814000	0.27239	0.734000	0.32515	0.563000	0.77884	GAG	-	HMMPfam_Na_Ca_ex		0.468	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	protein_coding	OTTHUMT00000326065.1	C	NM_021097		40510481	-1	no_errors	NM_021097	genbank	human	validated	54_36p	missense	SNP	1.000	A
KAT6A	7994	genome.wustl.edu	37	8	41814762	41814762	+	Intron	SNP	G	G	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr8:41814762G>A	ENST00000396930.3	-	10	2026				KAT6A_ENST00000406337.1_Intron|KAT6A_ENST00000485568.1_Intron|KAT6A_ENST00000265713.2_Intron	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A						aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										CCTTTGCACCGTGAAACGTTC	0.557																																																0			8											142.0	130.0	134.0					8																	41814762		876	1991	2867	41933919	SO:0001627	intron_variant	7994			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.1483-1833C>T	8.37:g.41814762G>A		Somatic		Capture	Illumina GAIIx	4	41933919	Q76L81	Silent	SNP	superfamily_Acyl-CoA N-acyltransferases (Nat),HMMPfam_MOZ_SAS	p.H9	ENST00000396930.3	37	c.27	CCDS6124.1	8																																																																																			-	NULL		0.557	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYST3	protein_coding	OTTHUMT00000318163.1	G	NM_006766		41933919	-1	no_stop_codon	ENST00000396930	ensembl	human	known	54_36p	silent	SNP	0.000	A
NNT	23530	genome.wustl.edu	37	5	43656873	43656873	+	Silent	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr5:43656873C>T	ENST00000264663.5	+	16	2633	c.2412C>T	c.(2410-2412)ggC>ggT	p.G804G	NNT_ENST00000512996.2_Silent_p.G673G|NNT_ENST00000344920.4_Silent_p.G804G	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	804					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					TTACTACTGGCATCACCTGTC	0.468																																																0			5											201.0	175.0	184.0					5																	43656873		2203	4300	6503	43692630	SO:0001819	synonymous_variant	23530			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2412C>T	5.37:g.43656873C>T		Somatic		Capture	Illumina GAIIx	4	43692630	Q16796|Q2TB60|Q8N3V4	Silent	SNP	superfamily_SSF52283,PatternScan_ALADH_PNT_1,HMMPfam_AlaDh_PNT_N,superfamily_NAD(P)-bd,HMMPfam_AlaDh_PNT_C,PatternScan_ALADH_PNT_2,HMMPfam_PNTB,superfamily_SSF52467	p.G804	ENST00000264663.5	37	c.2412	CCDS3949.1	5																																																																																			-	HMMPfam_PNTB		0.468	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNT	protein_coding	OTTHUMT00000214026.1	C	NM_182977		43692630	+1	no_errors	NM_012343	genbank	human	reviewed	54_36p	silent	SNP	0.797	T
GCK	2645	genome.wustl.edu	37	7	44192981	44192981	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr7:44192981G>A	ENST00000403799.3	-	2	596	c.127C>T	c.(127-129)Cgc>Tgc	p.R43C	GCK_ENST00000476008.1_5'Flank|GCK_ENST00000395796.3_Missense_Mutation_p.R42C|GCK_ENST00000345378.2_Missense_Mutation_p.R44C|GCK_ENST00000437084.1_Missense_Mutation_p.R43C	NM_000162.3	NP_000153.1	P35557	HXK4_HUMAN	glucokinase (hexokinase 4)	43	Hexokinase type-1.				calcium ion import (GO:0070509)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|cellular response to glucose starvation (GO:0042149)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|NADP metabolic process (GO:0006739)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gluconeogenesis (GO:0045721)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphorylation (GO:0042327)|regulation of glucose transport (GO:0010827)|regulation of glycolytic process (GO:0006110)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transport (GO:0043266)|second-messenger-mediated signaling (GO:0019932)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|secretory granule (GO:0030141)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|magnesium ion binding (GO:0000287)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	37						CTCAGGCCGCGGTCCATCTCC	0.607																																																0			7	GRCh37	CM074225	GCK	M							243.0	209.0	221.0					7																	44192981		2203	4300	6503	44159506	SO:0001583	missense	2645			AF041014	CCDS5479.1, CCDS5480.1, CCDS5481.1	7p15.3-p15.1	2008-02-07	2008-02-07		ENSG00000106633	ENSG00000106633	2.7.1.2, 2.7.1.1		4195	protein-coding gene	gene with protein product		138079	"""maturity onset diabetes of the young 2"""	MODY2		1740341, 1502186	Standard	NM_033507		Approved	HK4	uc003tkk.1	P35557	OTTHUMG00000022903	ENST00000403799.3:c.127C>T	7.37:g.44192981G>A	ENSP00000384247:p.Arg43Cys	Somatic		Capture	Illumina GAIIx	4	44159506	A4D2J2|A4D2J3|Q05810	Missense_Mutation	SNP	HMMPfam_Hexokinase_1,superfamily_SSF53067,PatternScan_HEXOKINASES,HMMPfam_Hexokinase_2	p.R44C	ENST00000403799.3	37	c.130	CCDS5479.1	7	.	.	.	.	.	.	.	.	.	.	G	22.2	4.262865	0.80358	.	.	ENSG00000106633	ENST00000403799;ENST00000395796;ENST00000345378;ENST00000437084	D;D;D;D	0.98419	-4.92;-4.92;-4.92;-4.92	5.08	5.08	0.68730	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98773	0.9587	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.976;0.999	D	0.99222	1.0879	10	0.72032	D	0.01	-3.6723	13.4303	0.61051	0.0:0.0:0.843:0.157	.	43;44;42	P35557;P35557-2;P35557-3	HXK4_HUMAN;.;.	C	43;42;44;43	ENSP00000384247:R43C;ENSP00000379142:R42C;ENSP00000223366:R44C;ENSP00000402840:R43C	ENSP00000223366:R44C	R	-	1	0	GCK	44159506	1.000000	0.71417	0.995000	0.50966	0.942000	0.58702	1.818000	0.39012	2.517000	0.84864	0.655000	0.94253	CGC	-	HMMPfam_Hexokinase_1,superfamily_SSF53067		0.607	GCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCK	protein_coding	OTTHUMT00000251069.2	G			44159506	-1	no_errors	NM_033507	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
CADM4	199731	genome.wustl.edu	37	19	44129321	44129321	+	Silent	SNP	C	C	T	rs145789919		TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr19:44129321C>T	ENST00000222374.2	-	7	885	c.837G>A	c.(835-837)ccG>ccA	p.P279P	CADM4_ENST00000593506.1_5'UTR	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	279	Ig-like C2-type 2.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				ATACCAGACCCGGCAGCGTGA	0.612																																																0			19											54.0	45.0	48.0					19																	44129321		2203	4300	6503	48821161	SO:0001819	synonymous_variant	199731			AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.837G>A	19.37:g.44129321C>T		Somatic		Capture	Illumina GAIIx	4	48821161	B2R7L5|Q9Y4A4	Silent	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG,HMMPfam_C2-set_2,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_4.1m	p.P279	ENST00000222374.2	37	c.837	CCDS12627.1	19																																																																																			-	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2		0.612	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM4	protein_coding	OTTHUMT00000463352.1	C	NM_145296		48821161	-1	no_errors	NM_145296	genbank	human	validated	54_36p	silent	SNP	0.742	T
FOLH1	2346	genome.wustl.edu	37	11	49178312	49178312	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr11:49178312C>T	ENST00000256999.2	-	15	1840	c.1580G>A	c.(1579-1581)cGa>cAa	p.R527Q	FOLH1_ENST00000533034.1_Missense_Mutation_p.R512Q|FOLH1_ENST00000343844.4_Missense_Mutation_p.R219Q|FOLH1_ENST00000356696.3_Missense_Mutation_p.R527Q|FOLH1_ENST00000340334.7_Missense_Mutation_p.R512Q	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	527	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	AATTCCAAGTCGTTGGAAGAA	0.303																																																0			11											64.0	70.0	68.0					11																	49178312		2201	4290	6491	49134888	SO:0001583	missense	2346			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.1580G>A	11.37:g.49178312C>T	ENSP00000256999:p.Arg527Gln	Somatic		Capture	Illumina GAIIx	4	49134888	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA,superfamily_Zn-dependent exopeptidases,HMMPfam_Peptidase_M28,superfamily_Transferrin receptor ectodomain C-terminal domain,HMMPfam_TFR_dimer	p.R527Q	ENST00000256999.2	37	c.1580	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	18.78	3.695908	0.68386	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000343844;ENST00000533034;ENST00000389724	T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06	3.78	3.78	0.43462	.	0.000000	0.56097	D	0.000026	T	0.60869	0.2302	M	0.74389	2.26	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;0.995;0.995	D;D;P;P	0.70935	0.939;0.971;0.866;0.608	T	0.61217	-0.7107	10	0.34782	T	0.22	.	13.4691	0.61271	0.0:1.0:0.0:0.0	.	512;512;527;527	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	Q	527;527;512;219;512;530	ENSP00000256999:R527Q;ENSP00000349129:R527Q;ENSP00000344131:R512Q;ENSP00000344086:R219Q;ENSP00000431463:R512Q	ENSP00000256999:R527Q	R	-	2	0	FOLH1	49134888	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.446000	0.73460	2.120000	0.65058	0.411000	0.27672	CGA	-	superfamily_Zn-dependent exopeptidases		0.303	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	protein_coding	OTTHUMT00000390896.1	C	NM_004476		49134888	-1	no_errors	NM_004476	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
NFATC2	4773	genome.wustl.edu	37	20	50091995	50091995	+	Splice_Site	SNP	G	G	A	rs375019669		TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr20:50091995G>A	ENST00000396009.3	-	4	1754	c.1535C>T	c.(1534-1536)aCc>aTc	p.T512I	NFATC2_ENST00000609943.1_Splice_Site_p.T492I|NFATC2_ENST00000371564.3_Splice_Site_p.T512I|NFATC2_ENST00000609507.1_Splice_Site_p.T293I|NFATC2_ENST00000414705.1_Splice_Site_p.T492I|NFATC2_ENST00000610033.1_Splice_Site_p.T293I	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	512	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					CAGCCCTTACGTTGCCCTCAT	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15126	0.0		0.0	False		,,,				2504	0.0															0			20											156.0	160.0	159.0					20																	50091995		2203	4300	6503	49525402	SO:0001630	splice_region_variant	4773			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1535+1C>T	20.37:g.50091995G>A		Somatic		Capture	Illumina GAIIx	4	49525402	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	superfamily_p53-like transcription factors,HMMPfam_RHD,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG	p.T512I	ENST00000396009.3	37	c.1535	CCDS13437.1	20	.	.	.	.	.	.	.	.	.	.	G	8.531	0.870919	0.17322	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.42131	0.98;0.98;0.98	5.26	5.26	0.73747	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.109664	0.64402	D	0.000007	T	0.24084	0.0583	N	0.08118	0	0.52501	D	0.999959	P;P;P;P	0.51147	0.689;0.942;0.89;0.737	B;B;B;B	0.42555	0.085;0.391;0.24;0.24	T	0.04053	-1.0981	9	.	.	.	-30.6823	12.262	0.54655	0.0777:0.0:0.9223:0.0	.	492;492;512;512	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	I	512;512;492	ENSP00000360619:T512I;ENSP00000379330:T512I;ENSP00000396471:T492I	.	T	-	2	0	NFATC2	49525402	1.000000	0.71417	0.998000	0.56505	0.818000	0.46254	6.169000	0.71913	2.448000	0.82819	0.585000	0.79938	ACC	-	superfamily_p53-like transcription factors,HMMPfam_RHD		0.562	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	protein_coding	OTTHUMT00000079730.2	G	NM_012340	Missense_Mutation	49525402	-1	no_errors	NM_173091	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
LOC441601	441601	genome.wustl.edu	37	11	50252712	50252712	+	IGR	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr11:50252712C>T								OR4C12 (248641 upstream) : RP11-347H15.4 (5037 downstream)																							AACACTGCACCCTGTTATCAG	0.403																																																0			11																																								50209288	SO:0001628	intergenic_variant	0																															11.37:g.50252712C>T		Somatic		Capture	Illumina GAIIx	4	50209288		Silent	SNP	HMMPfam_Septin	p.R5		37	c.15		11																																																																																			-	HMMPfam_Septin	0	0.403					ENSG00000164740			C			50209288	-1	no_errors	ENST00000338231	ensembl	human	known	54_36p	silent	SNP	0.999	T
PKHD1	5314	genome.wustl.edu	37	6	51882330	51882330	+	Silent	SNP	C	C	T	rs137925439	byFrequency	TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr6:51882330C>T	ENST00000371117.3	-	34	5753	c.5478G>A	c.(5476-5478)gcG>gcA	p.A1826A	PKHD1_ENST00000340994.4_Silent_p.A1826A	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1826					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GTTGCTCTGTCGCCATGGCAA	0.522													C|||	4	0.000798722	0.0	0.0029	5008	,	,		20791	0.0		0.002	False		,,,				2504	0.0															0			6						C	,	3,4403	6.2+/-15.9	0,3,2200	194.0	167.0	176.0		5478,5478	1.9	0.2	6	dbSNP_134	176	8,8592	6.4+/-24.3	0,8,4292	no	coding-synonymous,coding-synonymous	PKHD1	NM_138694.3,NM_170724.2	,	0,11,6492	TT,TC,CC		0.093,0.0681,0.0846	,	1826/4075,1826/3397	51882330	11,12995	2203	4300	6503	51990289	SO:0001819	synonymous_variant	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.5478G>A	6.37:g.51882330C>T		Somatic		Capture	Illumina GAIIx	4	51990289	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG,HMMSmart_SM00710,HMMPfam_G8,superfamily_Pectin lyase-like	p.A1826	ENST00000371117.3	37	c.5478	CCDS4935.1	6																																																																																			-	NULL		0.522	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	protein_coding	OTTHUMT00000040893.1	C	NM_138694		51990289	-1	no_errors	NM_138694	genbank	human	reviewed	54_36p	silent	SNP	0.181	T
DYX1C1	161582	genome.wustl.edu	37	15	55734958	55734958	+	Intron	SNP	G	G	C			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr15:55734958G>C	ENST00000321149.3	-	7	1151				DYX1C1_ENST00000457155.2_Intron|DYX1C1_ENST00000380679.1_Intron|DYX1C1_ENST00000448430.2_Intron|DYX1C1_ENST00000348518.3_Intron|DYX1C1-CCPG1_ENST00000565113.1_RNA	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1						cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		TTATCAAGTTGGCTATTTATC	0.378																																																0			15																																								53522250	SO:0001627	intron_variant	729120				CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.784-3179C>G	15.37:g.55734958G>C		Somatic		Capture	Illumina GAIIx	4	53522250	Q6P5Y9|Q8N1S6	Missense_Mutation	SNP	superfamily_Thioesterase/thiol ester dehydrase-isomerase,HMMPfam_4HBT	p.Q200E	ENST00000321149.3	37	c.598	CCDS10154.1	15																																																																																			-	superfamily_Thioesterase/thiol ester dehydrase-isomerase,HMMPfam_4HBT		0.378	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729120	protein_coding	OTTHUMT00000254976.1	G	NM_130810		53522250	-1	no_errors	XM_001133204	genbank	human	model	54_36p	missense	SNP	0.986	C
EGFR	1956	genome.wustl.edu	37	7	55221739	55221739	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr7:55221739G>T	ENST00000275493.2	+	7	960	c.783G>T	c.(781-783)aaG>aaT	p.K261N	EGFR_ENST00000442591.1_Missense_Mutation_p.K261N|EGFR_ENST00000420316.2_Missense_Mutation_p.K261N|EGFR_ENST00000455089.1_Missense_Mutation_p.K216N|EGFR_ENST00000344576.2_Missense_Mutation_p.K261N|EGFR_ENST00000342916.3_Missense_Mutation_p.K261N|EGFR_ENST00000454757.2_Missense_Mutation_p.K208N	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	261			Missing (variant EGFR vIII; found in a lung cancer sample; somatic mutation; induces lung cancer when exogenously expressed). {ECO:0000269|PubMed:16672372}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CCACGTGCAAGGACACCTGCC	0.572		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	0			7											216.0	168.0	185.0					7																	55221739		2203	4300	6503	55189233	SO:0001583	missense	1956	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.783G>T	7.37:g.55221739G>T	ENSP00000275493:p.Lys261Asn	Somatic		Capture	Illumina GAIIx	4	55189233	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	superfamily_L domain-like,HMMPfam_Recep_L_domain,HMMPfam_Furin-like,superfamily_Growth factor receptor domain,HMMSmart_SM00261,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.K261N	ENST00000275493.2	37	c.783	CCDS5514.1	7	.	.	.	.	.	.	.	.	.	.	G	18.82	3.706068	0.68615	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;-0.03;-0.03	5.94	3.8	0.43715	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.79082	0.4386	M	0.89214	3.015	0.54753	D	0.999988	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.985;0.988;1.0;0.997;0.984	T	0.79310	-0.1856	10	0.38643	T	0.18	.	9.4778	0.38882	0.2561:0.0:0.7439:0.0	.	216;261;261;261;261	Q504U8;P00533;P00533-3;P00533-4;P00533-2	.;EGFR_HUMAN;.;.;.	N	216;261;131;261;261;261;261;208;55	ENSP00000415559:K216N;ENSP00000342376:K261N;ENSP00000345973:K261N;ENSP00000413843:K261N;ENSP00000275493:K261N;ENSP00000410031:K261N;ENSP00000395243:K208N	ENSP00000275493:K261N	K	+	3	2	EGFR	55189233	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	2.923000	0.48868	1.490000	0.48466	0.563000	0.77884	AAG	-	HMMPfam_Furin-like,superfamily_Growth factor receptor domain,HMMSmart_SM00261		0.572	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFR	protein_coding	OTTHUMT00000251456.2	G	NM_005228		55189233	+1	no_errors	NM_005228	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
RAE1	8480	genome.wustl.edu	37	20	55942077	55942077	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr20:55942077G>T	ENST00000395841.2	+	7	896	c.476G>T	c.(475-477)cGa>cTa	p.R159L	RAE1_ENST00000371242.2_Missense_Mutation_p.R159L|RAE1_ENST00000527947.1_Missense_Mutation_p.R159L|RAE1_ENST00000395840.2_Missense_Mutation_p.R159L	NM_003610.3	NP_003601.1	P78406	RAE1L_HUMAN	ribonucleic acid export 1	159					carbohydrate metabolic process (GO:0005975)|cellular response to organic cyclic compound (GO:0071407)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|large_intestine(4)|lung(6)|prostate(3)|skin(2)	21	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			TGGGATACTCGATCGTCAAAT	0.378																																																0			20											177.0	168.0	171.0					20																	55942077		2203	4300	6503	55375484	SO:0001583	missense	8480			U84720	CCDS13458.1	20q13.31	2013-08-28	2013-08-28		ENSG00000101146	ENSG00000101146		"""WD repeat domain containing"""	9828	protein-coding gene	gene with protein product		603343	"""RAE1 (RNA export 1, S.pombe) homolog"", ""RAE1 RNA export 1 homolog (S. pombe)"""			9370289, 9256445	Standard	XM_005260582		Approved	Mnrp41	uc002xyi.3	P78406	OTTHUMG00000032819	ENST00000395841.2:c.476G>T	20.37:g.55942077G>T	ENSP00000379182:p.Arg159Leu	Somatic		Capture	Illumina GAIIx	4	55375484	A8K882|O15306|Q3SYL7|Q5TCH8|Q6V708|Q9H100|Q9NQM6	Missense_Mutation	SNP	HMMSmart_SM00320,HMMPfam_WD40,superfamily_WD40 repeat-like,PatternScan_WD_REPEATS_1	p.R159L	ENST00000395841.2	37	c.476	CCDS13458.1	20	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003222	0.93287	.	.	ENSG00000101146	ENST00000395841;ENST00000371242;ENST00000527947;ENST00000395840	T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7	5.96	5.96	0.96718	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87877	0.6288	H	0.94658	3.565	0.80722	D	1	P;D;D	0.76494	0.681;0.999;0.999	B;D;D	0.70487	0.068;0.969;0.969	D	0.90286	0.4319	10	0.72032	D	0.01	-11.8278	14.5539	0.68086	0.0693:0.0:0.9307:0.0	.	159;159;159	E9PQ57;A8K882;P78406	.;.;RAE1L_HUMAN	L	159	ENSP00000379182:R159L;ENSP00000360286:R159L;ENSP00000432609:R159L;ENSP00000379181:R159L	ENSP00000360286:R159L	R	+	2	0	RAE1	55375484	1.000000	0.71417	0.744000	0.31058	0.988000	0.76386	9.177000	0.94849	2.832000	0.97577	0.655000	0.94253	CGA	-	superfamily_WD40 repeat-like		0.378	RAE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAE1	protein_coding	OTTHUMT00000079842.2	G			55375484	+1	no_errors	NM_001015885	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
CFAP36	112942	genome.wustl.edu	37	2	55750902	55750902	+	Missense_Mutation	SNP	G	G	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:55750902G>A	ENST00000349456.4	+	3	374	c.226G>A	c.(226-228)Gaa>Aaa	p.E76K	CCDC104_ENST00000407816.3_Missense_Mutation_p.E76K|CCDC104_ENST00000403007.3_Missense_Mutation_p.E76K|CCDC104_ENST00000339012.3_Missense_Mutation_p.E101K|CCDC104_ENST00000406691.3_Missense_Mutation_p.E76K			Q96G28	CFA36_HUMAN		76										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TGGAATTAATGAAGATCAATT	0.303																																																0			2											98.0	93.0	95.0					2																	55750902		2203	4300	6503	55604406	SO:0001583	missense	112942																														ENST00000349456.4:c.226G>A	2.37:g.55750902G>A	ENSP00000295117:p.Glu76Lys	Somatic		Capture	Illumina GAIIx	4	55604406	Q53SF0|Q53ST9|Q6UY34	Missense_Mutation	SNP	NULL	p.E76K	ENST00000349456.4	37	c.226	CCDS1854.2	2	.	.	.	.	.	.	.	.	.	.	G	33	5.211386	0.95069	.	.	ENSG00000163001	ENST00000339012;ENST00000406691;ENST00000349456;ENST00000407816;ENST00000403007	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	5.7	5.7	0.88788	ADP-ribosylation factor-like 2-binding protein, domain (2);	0.044386	0.85682	D	0.000000	T	0.64538	0.2607	M	0.62723	1.935	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.80764	0.983;0.994	T	0.64050	-0.6498	10	0.59425	D	0.04	.	19.8389	0.96675	0.0:0.0:1.0:0.0	.	76;101	Q96G28;Q96G28-2	CC104_HUMAN;.	K	101;76;76;76;76	ENSP00000342699:E101K;ENSP00000385400:E76K;ENSP00000295117:E76K;ENSP00000385376:E76K;ENSP00000385972:E76K	ENSP00000342699:E101K	E	+	1	0	CCDC104	55604406	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.711000	0.84669	2.703000	0.92315	0.655000	0.94253	GAA	-	NULL		0.303	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC104	protein_coding	OTTHUMT00000319610.2	G			55604406	+1	no_errors	NM_080667	genbank	human	validated	54_36p	missense	SNP	1.000	A
OR10Q1	219960	genome.wustl.edu	37	11	57995510	57995510	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr11:57995510C>T	ENST00000316770.2	-	1	880	c.838G>A	c.(838-840)Gcg>Acg	p.A280T		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A280T(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				TAGACCAACGCGATTTGGCTG	0.547																																																1	Substitution - Missense(1)	lung(1)	11											125.0	111.0	116.0					11																	57995510		2201	4295	6496	57752086	SO:0001583	missense	219960			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.838G>A	11.37:g.57995510C>T	ENSP00000314324:p.Ala280Thr	Somatic		Capture	Illumina GAIIx	4	57752086	Q6IFG4	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A280T	ENST00000316770.2	37	c.838	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	C	11.84	1.759408	0.31137	.	.	ENSG00000180475	ENST00000316770	T	0.00152	8.66	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42420	D	0.000716	T	0.00271	0.0008	L	0.35723	1.085	0.09310	N	1	D	0.71674	0.998	D	0.66351	0.943	T	0.68864	-0.5296	10	0.31617	T	0.26	.	10.9225	0.47174	0.2833:0.7167:0.0:0.0	.	280	Q8NGQ4	O10Q1_HUMAN	T	280	ENSP00000314324:A280T	ENSP00000314324:A280T	A	-	1	0	OR10Q1	57752086	0.062000	0.20869	0.502000	0.27614	0.235000	0.25334	0.467000	0.22035	2.638000	0.89438	0.650000	0.86243	GCG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.547	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	protein_coding	OTTHUMT00000394706.1	C	NM_001004471		57752086	-1	no_errors	NM_001004471	genbank	human	provisional	54_36p	missense	SNP	0.175	T
KCNH5	27133	genome.wustl.edu	37	14	63174939	63174939	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr14:63174939C>T	ENST00000322893.7	-	11	2522	c.2254G>A	c.(2254-2256)Gtg>Atg	p.V752M	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	752					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		ACAGTCACCACGCTGGTTCCG	0.532																																																0			14											111.0	97.0	102.0					14																	63174939		2203	4300	6503	62244692	SO:0001583	missense	27133			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2254G>A	14.37:g.63174939C>T	ENSP00000321427:p.Val752Met	Somatic		Capture	Illumina GAIIx	4	62244692	C9JP98	Missense_Mutation	SNP	superfamily_PYP-like sensor domain (PAS domain),HMMPfam_PAS,HMMSmart_SM00086,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding	p.V752M	ENST00000322893.7	37	c.2254	CCDS9756.1	14	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123065	0.56613	.	.	ENSG00000140015	ENST00000322893	D	0.99113	-5.44	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000001	D	0.98071	0.9364	L	0.50333	1.59	0.80722	D	1	D	0.58620	0.983	P	0.46208	0.507	D	0.98012	1.0366	10	0.36615	T	0.2	.	19.4558	0.94889	0.0:1.0:0.0:0.0	.	752	Q8NCM2	KCNH5_HUMAN	M	752	ENSP00000321427:V752M	ENSP00000321427:V752M	V	-	1	0	KCNH5	62244692	1.000000	0.71417	0.996000	0.52242	0.941000	0.58515	3.495000	0.53280	2.611000	0.88343	0.655000	0.94253	GTG	-	NULL		0.532	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	protein_coding	OTTHUMT00000411747.1	C	NM_139318		62244692	-1	no_errors	NM_139318	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CACNG4	27092	genome.wustl.edu	37	17	65027052	65027052	+	Missense_Mutation	SNP	T	T	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr17:65027052T>A	ENST00000262138.3	+	4	918	c.916T>A	c.(916-918)Ttt>Att	p.F306I	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	306					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			GGTGCATGACTTTTTCCAGCA	0.622																																																0			17											49.0	48.0	48.0					17																	65027052		2203	4300	6503	62457514	SO:0001583	missense	27092			AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.916T>A	17.37:g.65027052T>A	ENSP00000262138:p.Phe306Ile	Somatic		Capture	Illumina GAIIx	4	62457514	B2RCK0	Missense_Mutation	SNP	HMMPfam_PMP22_Claudin,PatternScan_CLAUDIN	p.F306I	ENST00000262138.3	37	c.916	CCDS11667.1	17	.	.	.	.	.	.	.	.	.	.	T	15.67	2.903125	0.52227	.	.	ENSG00000075461	ENST00000262138	T	0.54071	0.59	5.19	4.11	0.48088	.	0.102976	0.64402	D	0.000003	T	0.36413	0.0966	L	0.36672	1.1	0.41121	D	0.985815	P	0.34462	0.454	B	0.24394	0.053	T	0.11446	-1.0587	10	0.23302	T	0.38	-18.0027	10.9506	0.47327	0.0:0.0736:0.0:0.9263	.	306	Q9UBN1	CCG4_HUMAN	I	306	ENSP00000262138:F306I	ENSP00000262138:F306I	F	+	1	0	CACNG4	62457514	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.872000	0.69636	0.820000	0.34516	0.533000	0.62120	TTT	-	NULL		0.622	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG4	protein_coding	OTTHUMT00000447036.1	T	NM_014405		62457514	+1	no_errors	NM_014405	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
AC012322.1	0	genome.wustl.edu	37	16	64294509	64294509	+	lincRNA	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr16:64294509C>T	ENST00000561657.1	-	0	584																											CTTTCGGATGCATTTTCTTGA	0.398																																																0			16																																								62852010			729217																															16.37:g.64294509C>T		Somatic		Capture	Illumina GAIIx	4	62852010		RNA	SNP	-	NULL	ENST00000561657.1	37	NULL		16																																																																																			-	-		0.398	AC012322.1-001	KNOWN	basic	lincRNA	LOC729217	lincRNA	OTTHUMT00000420578.1	C			62852010	-1	pseudogene	XR_015483	genbank	human	model	54_36p	rna	SNP	0.968	T
ZSCAN1	284312	genome.wustl.edu	37	19	58564850	58564850	+	Missense_Mutation	SNP	C	C	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr19:58564850C>A	ENST00000282326.1	+	6	905	c.658C>A	c.(658-660)Ctt>Att	p.L220I		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	220					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GCCTGAGGACCTTCTCGCAGG	0.627																																																0			19											51.0	54.0	53.0					19																	58564850		2203	4300	6503	63256662	SO:0001583	missense	284312			AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.658C>A	19.37:g.58564850C>A	ENSP00000282326:p.Leu220Ile	Somatic		Capture	Illumina GAIIx	4	63256662	Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.L220I	ENST00000282326.1	37	c.658	CCDS12969.1	19	.	.	.	.	.	.	.	.	.	.	C	2.392	-0.339562	0.05243	.	.	ENSG00000152467	ENST00000282326	T	0.04406	3.63	1.04	-1.57	0.08506	.	.	.	.	.	T	0.01800	0.0057	N	0.03608	-0.345	0.09310	N	0.999993	B	0.10296	0.003	B	0.06405	0.002	T	0.45760	-0.9239	9	0.30854	T	0.27	.	1.8275	0.03124	0.319:0.4415:0.0:0.2395	.	220	Q8NBB4	ZSCA1_HUMAN	I	220	ENSP00000282326:L220I	ENSP00000282326:L220I	L	+	1	0	ZSCAN1	63256662	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.170000	0.03118	-0.472000	0.06881	-1.337000	0.01257	CTT	-	NULL		0.627	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN1	protein_coding	OTTHUMT00000466427.1	C	NM_182572		63256662	+1	no_errors	NM_182572	genbank	human	validated	54_36p	missense	SNP	0.010	A
DYRK2	8445	genome.wustl.edu	37	12	68051843	68051843	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr12:68051843C>T	ENST00000344096.3	+	3	1569	c.1156C>T	c.(1156-1158)Cgt>Tgt	p.R386C	DYRK2_ENST00000393555.3_Missense_Mutation_p.R313C|RP11-335O4.3_ENST00000425371.2_RNA	NM_006482.2	NP_006473.2	Q92630	DYRK2_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2	386	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of NFAT protein import into nucleus (GO:0051534)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein phosphorylation (GO:0006468)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30			Lung(24;6.81e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(7;0.000573)		CATCCAGTCGCGTTTTTACCG	0.488																																																0			12											92.0	87.0	89.0					12																	68051843		2203	4300	6503	66338110	SO:0001583	missense	8445			Y09216	CCDS8978.1, CCDS8979.1	12q15	2008-07-03				ENSG00000127334			3093	protein-coding gene	gene with protein product		603496				9748265	Standard	NM_003583		Approved		uc001str.4	Q92630		ENST00000344096.3:c.1156C>T	12.37:g.68051843C>T	ENSP00000342105:p.Arg386Cys	Somatic		Capture	Illumina GAIIx	4	66338110	B2R9V9|Q9BRB5	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Pkinase,HMMSmart_SM00219,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.R386C	ENST00000344096.3	37	c.1156	CCDS8978.1	12	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289264	0.59976	.	.	ENSG00000127334	ENST00000344096;ENST00000393555	T;T	0.22336	1.96;1.96	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.53690	0.1812	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56372	-0.7990	9	.	.	.	.	19.6624	0.95878	0.0:1.0:0.0:0.0	.	386	Q92630	DYRK2_HUMAN	C	386;313	ENSP00000342105:R386C;ENSP00000377186:R313C	.	R	+	1	0	DYRK2	66338110	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	5.000000	0.63940	2.736000	0.93811	0.305000	0.20034	CGT	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Pkinase,HMMSmart_SM00219		0.488	DYRK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK2	protein_coding	OTTHUMT00000402218.1	C			66338110	+1	no_errors	NM_006482	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZFP36L1	677	genome.wustl.edu	37	14	69259626	69259626	+	Silent	SNP	G	G	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr14:69259626G>A	ENST00000439696.2	-	1	331	c.30C>T	c.(28-30)atC>atT	p.I10I	ZFP36L1_ENST00000555997.1_5'Flank|ZFP36L1_ENST00000336440.3_Silent_p.I10I	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	10					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TCAAGTCGAAGATGGTGGCAG	0.542																																																0			14											145.0	146.0	146.0					14																	69259626		2203	4300	6503	68329379	SO:0001819	synonymous_variant	677			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.30C>T	14.37:g.69259626G>A		Somatic		Capture	Illumina GAIIx	4	68329379	Q13851	Silent	SNP	HMMPfam_Tis11B_N,superfamily_SSF90229,HMMSmart_ZnF_C3H1,HMMPfam_zf-CCCH	p.I10	ENST00000439696.2	37	c.30	CCDS9791.1	14																																																																																			-	HMMPfam_Tis11B_N		0.542	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L1	protein_coding	OTTHUMT00000413227.1	G			68329379	-1	no_errors	NM_004926	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
PDXDC2P	283970	genome.wustl.edu	37	16	70016275	70016275	+	RNA	SNP	T	T	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr16:70016275T>A	ENST00000531894.1	-	0	2496				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										GTCTTCCTCTTTCCATTGATT	0.383																																																0			16																																								68573776			283970					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70016275T>A		Somatic		Capture	Illumina GAIIx	4	68573776	A8K9Z5	RNA	SNP	-	NULL	ENST00000531894.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	.	50	16.210444	0.99857	.	.	ENSG00000226232	ENST00000532298;ENST00000325845	.	.	.	0.659	0.659	0.17861	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	175;143	.	ENSP00000449128:K143X	K	-	1	0	RP11-419C5.2	68573776	0.005000	0.15991	0.002000	0.10522	0.001000	0.01503	-0.398000	0.07259	-0.127000	0.11661	-1.834000	0.00590	AAG	-	-		0.383	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	PDXDC2	processed_transcript	OTTHUMT00000395258.1	T			68573776	-1	pseudogene	NR_003610	genbank	human	provisional	54_36p	rna	SNP	0.001	A
C2orf78	388960	genome.wustl.edu	37	2	74042741	74042741	+	Missense_Mutation	SNP	A	A	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:74042741A>G	ENST00000409561.1	+	3	1512	c.1391A>G	c.(1390-1392)gAc>gGc	p.D464G		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	464										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						CAAGATCTTGACCAACCTGAA	0.448																																																0			2											70.0	68.0	69.0					2																	74042741		1937	4126	6063	73896249	SO:0001583	missense	388960			AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1391A>G	2.37:g.74042741A>G	ENSP00000387124:p.Asp464Gly	Somatic		Capture	Illumina GAIIx	4	73896249		Missense_Mutation	SNP	NULL	p.D464G	ENST00000409561.1	37	c.1391	CCDS46338.1	2	.	.	.	.	.	.	.	.	.	.	A	16.66	3.185582	0.57909	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	.	.	.	5.48	4.25	0.50352	.	0.568880	0.15732	N	0.247398	T	0.66406	0.2786	M	0.79258	2.445	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56733	-0.7930	9	0.72032	D	0.01	-17.8971	9.0884	0.36596	0.8152:0.1848:0.0:0.0	.	464	A6NCI8	CB078_HUMAN	G	464;454	.	ENSP00000340692:D454G	D	+	2	0	C2orf78	73896249	0.005000	0.15991	0.130000	0.21974	0.025000	0.11179	1.490000	0.35573	2.216000	0.71823	0.533000	0.62120	GAC	-	NULL		0.448	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf78	protein_coding	OTTHUMT00000328083.1	A	NM_001080474		73896249	+1	no_errors	NM_001080474	genbank	human	predicted	54_36p	missense	SNP	0.008	G
STAMBP	10617	genome.wustl.edu	37	2	74058187	74058187	+	Splice_Site	SNP	G	G	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:74058187G>T	ENST00000394070.2	+	2	706		c.e2+1		STAMBP_ENST00000409707.1_Splice_Site|STAMBP_ENST00000339566.3_Splice_Site|STAMBP_ENST00000394073.1_Splice_Site|STAMBP_ENST00000536064.1_Splice_Site	NM_213622.2	NP_998787.1	O95630	STABP_HUMAN	STAM binding protein						JAK-STAT cascade (GO:0007259)|mitotic cytokinesis (GO:0000281)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of cell proliferation (GO:0008284)|protein deubiquitination (GO:0016579)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	18						AGTATATCACGTAAGACACCT	0.423																																																0			2											103.0	90.0	94.0					2																	74058187		2203	4300	6503	73911695	SO:0001630	splice_region_variant	10617			BC007682	CCDS1929.1	2p24.3-p24.1	2008-02-05			ENSG00000124356	ENSG00000124356			16950	protein-coding gene	gene with protein product		606247				10383417	Standard	NM_006463		Approved	AMSH	uc002sjs.3	O95630	OTTHUMG00000129817	ENST00000394070.2:c.203+1G>T	2.37:g.74058187G>T		Somatic		Capture	Illumina GAIIx	4	73911695	B5M0B6|D6W5H7|Q3MJE7	Splice_Site	SNP	-	e1+1	ENST00000394070.2	37	c.203+1	CCDS1929.1	2	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598872	0.66332	.	.	ENSG00000124356	ENST00000339566;ENST00000539933;ENST00000409707;ENST00000452725;ENST00000432295;ENST00000424659;ENST00000394073;ENST00000394070;ENST00000536064	.	.	.	4.67	3.76	0.43208	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8472	0.63474	0.0:0.1548:0.8452:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAMBP	73911695	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.968000	0.93407	1.259000	0.44117	0.655000	0.94253	.	-	-		0.423	STAMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBP	protein_coding	OTTHUMT00000252048.2	G	NM_006463	Intron	73911695	+1	no_errors	NM_006463	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
ROBO1	6091	genome.wustl.edu	37	3	78666809	78666809	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr3:78666809G>A	ENST00000464233.1	-	27	4371	c.4258C>T	c.(4258-4260)Cga>Tga	p.R1420*	ROBO1_ENST00000495273.1_Nonsense_Mutation_p.R1375*|ROBO1_ENST00000436010.2_Nonsense_Mutation_p.R1381*|ROBO1_ENST00000467549.1_Nonsense_Mutation_p.R1320*	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1420					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ATTTGCCGTCGTGCTACTTTC	0.488																																																0			3											71.0	72.0	72.0					3																	78666809		1978	4153	6131	78749499	SO:0001587	stop_gained	6091			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4258C>T	3.37:g.78666809G>A	ENSP00000420321:p.Arg1420*	Somatic		Capture	Illumina GAIIx	4	78749499	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Nonsense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.R1420*	ENST00000464233.1	37	c.4258	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	G	39	7.751224	0.98468	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	.	.	.	5.67	2.09	0.27110	.	0.045124	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1398	0.65313	0.0:0.0:0.2647:0.7353	.	.	.	.	X	1381;1375;1420;1375;1320;1424	.	.	R	-	1	2	ROBO1	78749499	0.025000	0.19082	0.014000	0.15608	0.003000	0.03518	0.478000	0.22212	0.683000	0.31428	0.585000	0.79938	CGA	-	NULL		0.488	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	protein_coding	OTTHUMT00000352610.1	G	NM_002941		78749499	-1	no_errors	NM_002941	genbank	human	reviewed	54_36p	nonsense	SNP	0.208	A
RBM26	64062	genome.wustl.edu	37	13	79927297	79927297	+	Silent	SNP	T	T	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr13:79927297T>G	ENST00000438737.2	-	14	2489	c.2049A>C	c.(2047-2049)gcA>gcC	p.A683A	RBM26_ENST00000267229.7_Intron|RBM26_ENST00000438724.1_Intron			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	683					mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		CCTTTTCAGTTGCTGAAACAG	0.318																																																0			13											17.0	17.0	17.0					13																	79927297		872	1991	2863	78825298	SO:0001819	synonymous_variant	64062			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.2049A>C	13.37:g.79927297T>G		Somatic		Capture	Illumina GAIIx	4	78825298	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Silent	SNP	superfamily_PWI domain,HMMPfam_DUF1777,HMMPfam_zf-CCCH,HMMSmart_SM00356,superfamily_RNA-binding domain RBD,HMMSmart_SM00360	p.A684	ENST00000438737.2	37	c.2052		13																																																																																			-	superfamily_RNA-binding domain RBD		0.318	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	RBM26	protein_coding	OTTHUMT00000045373.4	T	NM_022118		78825298	-1	no_errors	ENST00000327303	ensembl	human	known	54_36p	silent	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	4	78908924	78908924	+	IGR	SNP	C	C	T	rs550854688		TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr4:78908924C>T								MRPL1 (34980 upstream) : FRAS1 (69799 downstream)																							CTGCCACCACCGTGCTTGGCT	0.433													C|||	1	0.000199681	0.0	0.0	5008	,	,		19331	0.001		0.0	False		,,,				2504	0.0															0			4																																								79127948	SO:0001628	intergenic_variant	391670																															4.37:g.78908924C>T		Somatic		Capture	Illumina GAIIx	4	79127948		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.433					LOC391670			C			79127948	-1	pseudogene	XR_016388	genbank	human	model	54_36p	rna	SNP	0.998	T
LPHN2	23266	genome.wustl.edu	37	1	82372824	82372824	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr1:82372824C>G	ENST00000370728.1	+	6	841	c.196C>G	c.(196-198)Cgg>Ggg	p.R66G	LPHN2_ENST00000370730.1_Missense_Mutation_p.R66G|LPHN2_ENST00000370713.1_Missense_Mutation_p.R66G|LPHN2_ENST00000359929.3_Missense_Mutation_p.R66G|LPHN2_ENST00000370721.1_Missense_Mutation_p.R66G|LPHN2_ENST00000370727.1_Missense_Mutation_p.R66G|LPHN2_ENST00000370715.1_Missense_Mutation_p.R66G|LPHN2_ENST00000394879.1_Missense_Mutation_p.R66G|LPHN2_ENST00000271029.4_Missense_Mutation_p.R66G|LPHN2_ENST00000370725.1_Missense_Mutation_p.R66G|LPHN2_ENST00000335786.5_Missense_Mutation_p.R66G|LPHN2_ENST00000319517.6_Missense_Mutation_p.R66G|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370723.1_Missense_Mutation_p.R66G|LPHN2_ENST00000370717.2_Missense_Mutation_p.R66G			O95490	LPHN2_HUMAN	latrophilin 2	66	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TAACTATGGTCGGACGGATGA	0.448																																																0			1											166.0	152.0	157.0					1																	82372824		2203	4300	6503	82145412	SO:0001583	missense	23266			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.196C>G	1.37:g.82372824C>G	ENSP00000359763:p.Arg66Gly	Somatic		Capture	Illumina GAIIx	4	82145412	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	HMMPfam_Gal_Lectin,HMMPfam_OLF,HMMSmart_SM00284,HMMSmart_SM00008,HMMPfam_HRM,HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2,HMMPfam_Latrophilin	p.R66G	ENST00000370728.1	37	c.196		1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205925	0.79127	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96	5.1	3.06	0.35304	.	0.000000	0.64402	D	0.000001	T	0.52451	0.1735	H	0.97291	3.975	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.71856	-0.4466	10	0.87932	D	0	.	13.7013	0.62611	0.2805:0.7195:0.0:0.0	.	66;66;66;66	O95490-3;O95490-4;O95490-2;B3KVU1	.;.;.;.	G	66	ENSP00000359756:R66G;ENSP00000359763:R66G;ENSP00000359765:R66G;ENSP00000359762:R66G;ENSP00000359760:R66G;ENSP00000359758:R66G;ENSP00000353006:R66G;ENSP00000359750:R66G;ENSP00000359748:R66G;ENSP00000322270:R66G;ENSP00000359752:R66G;ENSP00000378344:R66G;ENSP00000271029:R66G;ENSP00000337306:R66G	ENSP00000271029:R66G	R	+	1	2	LPHN2	82145412	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	1.506000	0.35747	1.249000	0.43950	0.557000	0.71058	CGG	-	HMMPfam_Gal_Lectin		0.448	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	protein_coding	OTTHUMT00000027188.1	C	NM_012302		82145412	+1	no_errors	NM_012302	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
LOC101928978	101928978	genome.wustl.edu	37	4	85165900	85165900	+	IGR	SNP	A	A	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr4:85165900A>G								RNU6-774P (10984 upstream) : RP11-42A4.1 (126645 downstream)																							CTCAAGATCAAGACAGAGCCC	0.572																																																0			4																																								85384924	SO:0001628	intergenic_variant	152845																															4.37:g.85165900A>G		Somatic		Capture	Illumina GAIIx	4	85384924		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.572					LOC152845			A			85384924	+1	pseudogene	XR_038721	genbank	human	model	54_36p	rna	SNP	1.000	G
MAT2A	4144	genome.wustl.edu	37	2	85769075	85769075	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:85769075C>T	ENST00000306434.3	+	5	652	c.529C>T	c.(529-531)Cgc>Tgc	p.R177C	MAT2A_ENST00000409017.1_Missense_Mutation_p.R114C|MAT2A_ENST00000490878.1_3'UTR	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	177					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	GCCTTGGTTACGCCCTGATTC	0.398																																																0			2											90.0	76.0	80.0					2																	85769075		2203	4300	6503	85622586	SO:0001583	missense	4144				CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.529C>T	2.37:g.85769075C>T	ENSP00000303147:p.Arg177Cys	Somatic		Capture	Illumina GAIIx	4	85622586	A8K511|B4DN45|D6W5L1|Q53SP5	Missense_Mutation	SNP	HMMPfam_S-AdoMet_synt_N,superfamily_S-adenosylmethionine synthetase,HMMPfam_S-AdoMet_synt_M,PatternScan_ADOMET_SYNTHETASE_1,HMMPfam_S-AdoMet_synt_C,PatternScan_ADOMET_SYNTHETASE_2	p.R177C	ENST00000306434.3	37	c.529	CCDS1977.1	2	.	.	.	.	.	.	.	.	.	.	C	16.53	3.148058	0.57151	.	.	ENSG00000168906	ENST00000306434;ENST00000409017	D;D	0.84589	-1.87;-1.87	5.89	5.02	0.67125	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.048242	0.85682	N	0.000000	D	0.90985	0.7165	H	0.96691	3.865	0.80722	D	1	P;P	0.42827	0.791;0.791	B;B	0.43052	0.406;0.406	D	0.92624	0.6110	10	0.72032	D	0.01	-26.539	12.8694	0.57957	0.0:0.9216:0.0:0.0784	.	177;177	B4DEX8;P31153	.;METK2_HUMAN	C	177;114	ENSP00000303147:R177C;ENSP00000386353:R114C	ENSP00000303147:R177C	R	+	1	0	MAT2A	85622586	0.883000	0.30277	1.000000	0.80357	0.862000	0.49288	0.522000	0.22909	1.513000	0.48852	0.563000	0.77884	CGC	-	HMMPfam_S-AdoMet_synt_M,superfamily_S-adenosylmethionine synthetase		0.398	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT2A	protein_coding	OTTHUMT00000252491.2	C	NM_005911		85622586	+1	no_errors	NM_005911	genbank	human	validated	54_36p	missense	SNP	0.997	T
GPR98	84059	genome.wustl.edu	37	5	89953945	89953945	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr5:89953945C>G	ENST00000405460.2	+	21	4698	c.4602C>G	c.(4600-4602)gaC>gaG	p.D1534E		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1534	Calx-beta 10. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATGACAATGACGAGGAAGGAG	0.353																																																0			5											111.0	112.0	112.0					5																	89953945		1837	4090	5927	89989701	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4602C>G	5.37:g.89953945C>G	ENSP00000384582:p.Asp1534Glu	Somatic		Capture	Illumina GAIIx	4	89989701	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	HMMSmart_SM00237,HMMPfam_Calx-beta,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_EPTP,PatternScan_A_DEAMINASE,PatternScan_LIPOYL,HMMPfam_GPS	p.D1534E	ENST00000405460.2	37	c.4602	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.730812	0.00687	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.25579	1.79	5.86	0.54	0.17163	.	0.142677	0.64402	N	0.000006	T	0.05227	0.0139	N	0.01352	-0.895	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37361	-0.9709	10	0.02654	T	1	.	2.5057	0.04645	0.5274:0.2307:0.1315:0.1103	.	1534	Q8WXG9	GPR98_HUMAN	E	1534	ENSP00000384582:D1534E	ENSP00000296619:D1534E	D	+	3	2	GPR98	89989701	1.000000	0.71417	0.998000	0.56505	0.171000	0.22731	1.258000	0.32944	-0.105000	0.12132	-2.261000	0.00279	GAC	-	NULL		0.353	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	C	NM_032119		89989701	+1	no_errors	NM_032119	genbank	human	reviewed	54_36p	missense	SNP	0.998	G
SAMD9	54809	genome.wustl.edu	37	7	92731857	92731857	+	Nonsense_Mutation	SNP	G	G	C			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr7:92731857G>C	ENST00000379958.2	-	3	3823	c.3554C>G	c.(3553-3555)tCa>tGa	p.S1185*		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1185						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CCGCCTTTTTGACTTCGGATA	0.373																																																0			7											196.0	198.0	197.0					7																	92731857		2203	4300	6503	92569793	SO:0001587	stop_gained	54809			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.3554C>G	7.37:g.92731857G>C	ENSP00000369292:p.Ser1185*	Somatic		Capture	Illumina GAIIx	4	92569793	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Nonsense_Mutation	SNP	superfamily_SAM_homology,HMMSmart_SAM,HMMPfam_SAM_1	p.S1185*	ENST00000379958.2	37	c.3554	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	G	26.5	4.742625	0.89573	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	.	.	.	4.54	1.52	0.23074	.	0.461102	0.17311	N	0.178883	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-5.5032	5.1563	0.15036	0.1326:0.0:0.5293:0.3381	.	.	.	.	X	1185	.	ENSP00000369292:S1185X	S	-	2	0	SAMD9	92569793	0.035000	0.19736	0.957000	0.39632	0.016000	0.09150	1.196000	0.32198	1.100000	0.41517	0.511000	0.50034	TCA	-	NULL		0.373	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	protein_coding	OTTHUMT00000341761.1	G	NM_017654		92569793	-1	no_errors	NM_017654	genbank	human	validated	54_36p	nonsense	SNP	0.477	C
SAMD9L	219285	genome.wustl.edu	37	7	92763843	92763843	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr7:92763843C>G	ENST00000318238.4	-	5	2658	c.1442G>C	c.(1441-1443)tGg>tCg	p.W481S	SAMD9L_ENST00000437805.1_Missense_Mutation_p.W481S|SAMD9L_ENST00000411955.1_Missense_Mutation_p.W481S	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	481					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.W481L(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			AATCTTCTCCCACATGTTAGT	0.413																																																1	Substitution - Missense(1)	lung(1)	7											98.0	96.0	97.0					7																	92763843		2203	4300	6503	92601779	SO:0001583	missense	219285			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.1442G>C	7.37:g.92763843C>G	ENSP00000326247:p.Trp481Ser	Somatic		Capture	Illumina GAIIx	4	92601779	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/Pointed domain	p.W481S	ENST00000318238.4	37	c.1442	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	C	0	-2.853179	0.00066	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.38401	1.14;1.14;1.14	4.1	-1.74	0.08056	.	1.266840	0.05457	N	0.550425	T	0.15912	0.0383	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26224	-1.0109	10	0.05721	T	0.95	0.0776	8.4072	0.32622	0.0:0.3672:0.4587:0.1741	.	481	Q8IVG5	SAM9L_HUMAN	S	481	ENSP00000326247:W481S;ENSP00000405760:W481S;ENSP00000408796:W481S	ENSP00000326247:W481S	W	-	2	0	SAMD9L	92601779	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-1.546000	0.02188	-0.120000	0.11809	0.460000	0.39030	TGG	-	NULL		0.413	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	protein_coding	OTTHUMT00000341730.1	C	NM_152703		92601779	-1	no_errors	NM_152703	genbank	human	validated	54_36p	missense	SNP	0.001	G
PLXNC1	10154	genome.wustl.edu	37	12	94631531	94631531	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr12:94631531C>T	ENST00000258526.4	+	10	2321	c.2072C>T	c.(2071-2073)tCg>tTg	p.S691L		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	691					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						ACCCGGGCATCGAACATCACA	0.418																																																0			12											91.0	77.0	82.0					12																	94631531		2203	4300	6503	93155662	SO:0001583	missense	10154			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.2072C>T	12.37:g.94631531C>T	ENSP00000258526:p.Ser691Leu	Somatic		Capture	Illumina GAIIx	4	93155662	Q59H25	Missense_Mutation	SNP	superfamily_Sema,HMMPfam_PSI,HMMSmart_PSI,superfamily_Plexin-like_fold,HMMPfam_TIG,HMMSmart_IPT,HMMPfam_Plexin_cytopl,superfamily_Rho_GAP	p.S691L	ENST00000258526.4	37	c.2072	CCDS9049.1	12	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395926	0.42512	.	.	ENSG00000136040	ENST00000258526	T	0.78126	-1.15	5.99	5.05	0.67936	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.475621	0.21484	N	0.073782	T	0.72843	0.3511	L	0.27053	0.805	0.58432	D	0.999995	D	0.57571	0.98	P	0.48704	0.587	T	0.76124	-0.3074	10	0.72032	D	0.01	.	14.069	0.64849	0.1503:0.8497:0.0:0.0	.	691	O60486	PLXC1_HUMAN	L	691	ENSP00000258526:S691L	ENSP00000258526:S691L	S	+	2	0	PLXNC1	93155662	0.991000	0.36638	0.372000	0.25991	0.116000	0.19942	2.846000	0.48262	2.840000	0.97914	0.655000	0.94253	TCG	-	HMMPfam_TIG		0.418	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNC1	protein_coding	OTTHUMT00000408126.2	C			93155662	+1	no_errors	NM_005761	genbank	human	provisional	54_36p	missense	SNP	0.565	T
SERPINA1	5265	genome.wustl.edu	37	14	94849404	94849404	+	Silent	SNP	G	G	A	rs150784949	byFrequency	TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr14:94849404G>A	ENST00000448921.1	-	4	743	c.171C>T	c.(169-171)ttC>ttT	p.F57F	SERPINA1_ENST00000355814.4_Silent_p.F57F|SERPINA1_ENST00000393087.4_Silent_p.F57F|SERPINA1_ENST00000437397.1_Silent_p.F57F|SERPINA1_ENST00000402629.1_Silent_p.F57F|SERPINA1_ENST00000404814.4_Silent_p.F57F|SERPINA1_ENST00000555289.1_5'Flank|SERPINA1_ENST00000393088.4_Silent_p.F57F|SERPINA1_ENST00000440909.1_Silent_p.F57F|SERPINA1_ENST00000449399.3_Silent_p.F57F	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	57					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GGCTGAAGGCGAACTCAGCCA	0.552													G|||	4	0.000798722	0.0	0.0	5008	,	,		18609	0.0		0.001	False		,,,				2504	0.0031															0			14						G	,,,,,,,,,,	2,4404	4.2+/-10.8	0,2,2201	161.0	134.0	143.0		171,171,171,171,171,171,171,171,171,171,171	-3.0	0.0	14	dbSNP_134	143	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SERPINA1	NM_000295.4,NM_001002235.2,NM_001002236.2,NM_001127700.1,NM_001127701.1,NM_001127702.1,NM_001127703.1,NM_001127704.1,NM_001127705.1,NM_001127706.1,NM_001127707.1	,,,,,,,,,,	0,5,6498	AA,AG,GG		0.0349,0.0454,0.0384	,,,,,,,,,,	57/419,57/419,57/419,57/419,57/419,57/419,57/419,57/419,57/419,57/419,57/419	94849404	5,13001	2203	4300	6503	93919157	SO:0001819	synonymous_variant	5265			X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.171C>T	14.37:g.94849404G>A		Somatic		Capture	Illumina GAIIx	4	93919157	A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Silent	SNP	superfamily_Serpins,HMMPfam_Serpin,HMMSmart_SM00093,PatternScan_SERPIN	p.F57	ENST00000448921.1	37	c.171	CCDS9925.1	14																																																																																			-	superfamily_Serpins,HMMPfam_Serpin		0.552	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA1	protein_coding	OTTHUMT00000317768.2	G	NM_001002235		93919157	-1	no_errors	NM_000295	genbank	human	reviewed	54_36p	silent	SNP	0.133	A
NR2C1	7181	genome.wustl.edu	37	12	95445633	95445633	+	Silent	SNP	T	T	C			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr12:95445633T>C	ENST00000333003.5	-	8	1200	c.870A>G	c.(868-870)caA>caG	p.Q290Q	NR2C1_ENST00000330677.7_Silent_p.Q290Q|NR2C1_ENST00000393101.3_Silent_p.Q290Q|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	290					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						CATTACTATTTTGAGAAAGAT	0.343																																																0			12											90.0	83.0	86.0					12																	95445633		2203	4297	6500	93969764	SO:0001819	synonymous_variant	7181			M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.870A>G	12.37:g.95445633T>C		Somatic		Capture	Illumina GAIIx	4	93969764	A8K5K4|Q15625|Q15626	Silent	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,PatternScan_SUBTILASE_ASP,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.Q290	ENST00000333003.5	37	c.870	CCDS9051.1	12																																																																																			-	superfamily_Nuclear receptor ligand-binding domain		0.343	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2C1	protein_coding	OTTHUMT00000407565.2	T	NM_003297		93969764	-1	no_errors	NM_003297	genbank	human	reviewed	54_36p	silent	SNP	0.150	C
MRPL30	51263	genome.wustl.edu	37	2	99811269	99811269	+	Missense_Mutation	SNP	C	C	A	rs527425645		TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:99811269C>A	ENST00000338148.3	+	4	386	c.188C>A	c.(187-189)cCt>cAt	p.P63H	MRPL30_ENST00000465432.1_3'UTR|C2orf15_ENST00000512183.2_Missense_Mutation_p.P63H|MRPL30_ENST00000410042.1_Missense_Mutation_p.P63H|MRPL30_ENST00000409145.1_Missense_Mutation_p.P63H	NM_145212.3	NP_660213.1	Q8TCC3	RM30_HUMAN	mitochondrial ribosomal protein L30	63						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						CCACAGAACCCTCATAAACTG	0.348																																																0			2											72.0	74.0	73.0					2																	99811269		2203	4300	6503	99177701	SO:0001583	missense	51263			AB051342	CCDS2041.1	2q11.2	2012-09-13			ENSG00000185414	ENSG00000185414		"""Mitochondrial ribosomal proteins / large subunits"""	14036	protein-coding gene	gene with protein product		611838					Standard	NM_145212		Approved	MRP-L28, RPML28	uc002szv.3	Q8TCC3	OTTHUMG00000130642	ENST00000338148.3:c.188C>A	2.37:g.99811269C>A	ENSP00000338057:p.Pro63His	Somatic		Capture	Illumina GAIIx	4	99177701	A6NIC6|D3DVI0|D3DVI3|Q0D2Q7|Q6ZTP4|Q96Q69|Q9P0N0	Missense_Mutation	SNP	superfamily_Ribosomal protein L30p/L7e	p.P63H	ENST00000338148.3	37	c.188	CCDS2041.1	2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273444	0.80580	.	.	ENSG00000241962;ENSG00000241962;ENSG00000185414;ENSG00000185414;ENSG00000185414;ENSG00000185414	ENST00000512183;ENST00000308644;ENST00000410042;ENST00000338148;ENST00000409145;ENST00000409841	T;T;T	0.61627	0.09;0.09;0.09	4.1	4.1	0.47936	.	0.060502	0.64402	D	0.000002	T	0.74527	0.3728	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.78580	-0.2149	10	0.87932	D	0	-13.6963	14.2417	0.65961	0.0:1.0:0.0:0.0	.	63;63	Q8TCC3;Q8TCC3-3	RM30_HUMAN;.	H	63;76;63;63;63;63	ENSP00000420959:P63H;ENSP00000338057:P63H;ENSP00000386752:P63H	ENSP00000312464:P76H	P	+	2	0	C2orf15;MRPL30	99177701	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	6.723000	0.74742	2.270000	0.75569	0.655000	0.94253	CCT	-	NULL		0.348	MRPL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL30	protein_coding	OTTHUMT00000253130.2	C			99177701	+1	no_errors	NM_145212	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
LYG1	129530	genome.wustl.edu	37	2	99900951	99900951	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:99900951C>G	ENST00000409448.1	-	8	806	c.490G>C	c.(490-492)Ggt>Cgt	p.G164R	LYG1_ENST00000308528.4_Missense_Mutation_p.G164R			Q8N1E2	LYG1_HUMAN	lysozyme G-like 1	164					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						TAGCCAGCACCCCCACTGTAG	0.483																																																0			2											102.0	86.0	91.0					2																	99900951		2203	4300	6503	99267383	SO:0001583	missense	129530			BC029126	CCDS2043.1	2q11.2	2008-02-05			ENSG00000144214	ENSG00000144214			27014	protein-coding gene	gene with protein product						12574869	Standard	NM_174898		Approved	SALW1939	uc002szy.3	Q8N1E2	OTTHUMG00000130639	ENST00000409448.1:c.490G>C	2.37:g.99900951C>G	ENSP00000386923:p.Gly164Arg	Somatic		Capture	Illumina GAIIx	4	99267383	Q53RV9	Missense_Mutation	SNP	superfamily_Lysozyme-like	p.G164R	ENST00000409448.1	37	c.490	CCDS2043.1	2	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795289	0.70452	.	.	ENSG00000144214	ENST00000308528;ENST00000409448	.	.	.	4.68	4.68	0.58851	Lysozyme-like domain (1);	0.114863	0.38897	N	0.001521	T	0.65903	0.2736	M	0.83774	2.66	0.19575	N	0.999965	P	0.46706	0.883	P	0.57620	0.824	T	0.61019	-0.7147	8	.	.	.	-13.3208	12.9574	0.58438	0.0:1.0:0.0:0.0	.	164	Q8N1E2	LYG1_HUMAN	R	164	.	.	G	-	1	0	LYG1	99267383	0.010000	0.17322	0.031000	0.17742	0.966000	0.64601	2.397000	0.44477	2.457000	0.83068	0.561000	0.74099	GGT	-	superfamily_Lysozyme-like		0.483	LYG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LYG1	protein_coding	OTTHUMT00000330315.1	C	NM_174898		99267383	-1	no_errors	NM_174898	genbank	human	validated	54_36p	missense	SNP	0.164	G
CLCC1	23155	genome.wustl.edu	37	1	109490286	109490286	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr1:109490286C>T	ENST00000369971.2	-	4	415	c.286G>A	c.(286-288)Gtt>Att	p.V96I	CLCC1_ENST00000302500.4_Missense_Mutation_p.V96I|CLCC1_ENST00000348264.2_Missense_Mutation_p.V96I|CLCC1_ENST00000415331.1_Missense_Mutation_p.V96I|CLCC1_ENST00000369969.2_Missense_Mutation_p.V96I|CLCC1_ENST00000356970.2_Missense_Mutation_p.V96I|CLCC1_ENST00000369976.1_Missense_Mutation_p.V96I|AKNAD1_ENST00000357393.4_Intron|CLCC1_ENST00000369968.2_Missense_Mutation_p.V96I|CLCC1_ENST00000369970.3_Missense_Mutation_p.V96I	NM_001048210.1	NP_001041675.1	Q96S66	CLCC1_HUMAN	chloride channel CLIC-like 1	96						chloride channel complex (GO:0034707)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|liver(1)|skin(1)	14		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		CTCCTAAAAACAGGATTGCTT	0.303																																																0			1											95.0	94.0	94.0					1																	109490286		2202	4298	6500	109291809	SO:0001583	missense	23155			AB018304	CCDS793.1, CCDS41362.1, CCDS60214.1, CCDS60215.1	1p13.3	2008-02-05			ENSG00000121940	ENSG00000121940			29675	protein-coding gene	gene with protein product	"""Mid1-related chloride channel (yeast)"""					9872452, 11279057	Standard	NM_001048210		Approved	MCLC	uc001dwf.2	Q96S66	OTTHUMG00000011732	ENST00000369971.2:c.286G>A	1.37:g.109490286C>T	ENSP00000358988:p.Val96Ile	Somatic		Capture	Illumina GAIIx	4	109291809	O94861|Q8WYP8|Q8WYP9|Q9BU25	Missense_Mutation	SNP	HMMPfam_MCLC	p.V96I	ENST00000369971.2	37	c.286	CCDS41362.1	1	.	.	.	.	.	.	.	.	.	.	C	14.04	2.418241	0.42918	.	.	ENSG00000121940	ENST00000356970;ENST00000369971;ENST00000415331;ENST00000369969;ENST00000369968;ENST00000369976;ENST00000369970;ENST00000348264;ENST00000302500	T;T;T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.61	5.61	0.85477	.	0.289830	0.32640	N	0.005832	T	0.25382	0.0617	L	0.42581	1.335	0.19575	N	0.999961	B;P;P;P	0.46784	0.0;0.884;0.68;0.549	B;P;B;B	0.45610	0.002;0.487;0.136;0.161	T	0.11616	-1.0580	10	0.48119	T	0.1	-29.3265	10.1583	0.42836	0.0:0.8475:0.0:0.1525	.	96;96;96;96	Q96S66-4;Q96S66-3;Q96S66-2;Q96S66	.;.;.;CLCC1_HUMAN	I	96	ENSP00000349456:V96I;ENSP00000358988:V96I;ENSP00000411591:V96I;ENSP00000358986:V96I;ENSP00000358985:V96I;ENSP00000358993:V96I;ENSP00000358987:V96I;ENSP00000337243:V96I;ENSP00000306552:V96I	ENSP00000306552:V96I	V	-	1	0	CLCC1	109291809	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.247000	0.51422	2.793000	0.96121	0.655000	0.94253	GTT	-	HMMPfam_MCLC		0.303	CLCC1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCC1	protein_coding	OTTHUMT00000032405.1	C	NM_015127		109291809	-1	no_errors	NM_001048210	genbank	human	validated	54_36p	missense	SNP	1.000	T
SOWAHC	65124	genome.wustl.edu	37	2	110373389	110373389	+	Missense_Mutation	SNP	T	T	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:110373389T>G	ENST00000356454.3	+	1	1479	c.1323T>G	c.(1321-1323)caT>caG	p.H441Q	SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000545389.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	441	Poly-His.																ATCACCACCATCACCACTCGG	0.587																																																0			2											50.0	52.0	51.0					2																	110373389		2203	4300	6503	109730678	SO:0001583	missense	65124			AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.1323T>G	2.37:g.110373389T>G	ENSP00000365830:p.His441Gln	Somatic		Capture	Illumina GAIIx	4	109730678	Q8NE15|Q9H6U1	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.H441Q	ENST00000356454.3	37	c.1323	CCDS33270.1	2	.	.	.	.	.	.	.	.	.	.	T	11.77	1.736440	0.30774	.	.	ENSG00000198142	ENST00000356454	T	0.46451	0.87	3.94	-3.92	0.04155	.	.	.	.	.	T	0.18718	0.0449	N	0.19112	0.55	0.09310	N	1	B	0.34290	0.447	B	0.27262	0.078	T	0.22417	-1.0217	9	0.13853	T	0.58	.	6.8107	0.23802	0.0:0.2794:0.1301:0.5904	.	441	Q53LP3	ANR57_HUMAN	Q	441	ENSP00000365830:H441Q	ENSP00000365830:H441Q	H	+	3	2	ANKRD57	109730678	0.584000	0.26766	0.183000	0.23137	0.550000	0.35303	-0.033000	0.12246	-1.162000	0.02797	0.454000	0.30748	CAT	-	NULL		0.587	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD57	protein_coding	OTTHUMT00000330168.1	T	NM_023016		109730678	+1	no_errors	NM_023016	genbank	human	validated	54_36p	missense	SNP	0.339	G
PALM2	114299	genome.wustl.edu	37	9	112642906	112642906	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr9:112642906C>T	ENST00000374531.2	+	4	282	c.208C>T	c.(208-210)Cgg>Tgg	p.R70W	AKAP2_ENST00000510514.5_Missense_Mutation_p.R68W|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.R68W|PALM2_ENST00000448454.2_Missense_Mutation_p.R70W|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.R68W|AKAP2_ENST00000555236.1_Missense_Mutation_p.R68W|PALM2_ENST00000314527.4_Missense_Mutation_p.R68W|PALM2_ENST00000483909.1_Missense_Mutation_p.R68W	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	70				Missing (in Ref. 2; BAC04472). {ECO:0000305}.	regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						AGCCAGGAGGCGGCAGTCTGA	0.532																																																0			9											98.0	92.0	94.0					9																	112642906		2203	4300	6503	111682727	SO:0001583	missense	445815			AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.208C>T	9.37:g.112642906C>T	ENSP00000363656:p.Arg70Trp	Somatic		Capture	Illumina GAIIx	4	111682727	A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	HMMPfam_RII_binding_1	p.R68W	ENST00000374531.2	37	c.202	CCDS35099.1	9	.	.	.	.	.	.	.	.	.	.	C	18.78	3.696073	0.68386	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654;ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000497711;ENST00000374530;ENST00000413420;ENST00000302798;ENST00000555236;ENST00000510514	T;T;T;T;T;T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08;2.08	5.36	2.4	0.29515	.	1.101910	0.06975	N	0.818864	T	0.44808	0.1311	L	0.60455	1.87	0.26503	N	0.974746	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;P;D	0.76071	0.987;0.987;0.877;0.914	T	0.37776	-0.9691	10	0.87932	D	0	-21.832	12.8117	0.57643	0.5524:0.4476:0.0:0.0	.	68;68;70;70	Q9Y2D5-6;Q9Y2D5-4;Q8IXS6;D3YTA4	.;.;PALM2_HUMAN;.	W	70;70;68;68;54;68;68;68;68;68	ENSP00000363656:R70W;ENSP00000400206:R70W;ENSP00000417525:R68W;ENSP00000323805:R68W;ENSP00000419747:R54W;ENSP00000363654:R68W;ENSP00000397839:R68W;ENSP00000305861:R68W;ENSP00000451476:R68W;ENSP00000421522:R68W	ENSP00000305861:R68W	R	+	1	2	PALM2-AKAP2;PALM2;AKAP2	111682727	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	0.827000	0.27421	0.299000	0.22661	0.650000	0.86243	CGG	-	NULL		0.532	PALM2-002	KNOWN	basic|CCDS	protein_coding	PALM2-AKAP2	protein_coding	OTTHUMT00000053604.1	C	NM_001037293		111682727	+1	no_errors	NM_007203	genbank	human	validated	54_36p	missense	SNP	0.999	T
KIAA2018	205717	genome.wustl.edu	37	3	113374557	113374557	+	Missense_Mutation	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr3:113374557C>T	ENST00000478658.1	-	5	5989	c.5972G>A	c.(5971-5973)cGt>cAt	p.R1991H	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.R1991H			Q68DE3	K2018_HUMAN	KIAA2018	1991						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TTCAGGCTGACGAATTTTGGA	0.478																																																0			3											60.0	58.0	59.0					3																	113374557		1991	4169	6160	114857247	SO:0001583	missense	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.5972G>A	3.37:g.113374557C>T	ENSP00000420721:p.Arg1991His	Somatic		Capture	Illumina GAIIx	4	114857247	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_HLH,HMMSmart_SM00353	p.R1991H	ENST00000478658.1	37	c.5972	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	c	16.14	3.039889	0.55003	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.35048	1.33;1.33	5.93	5.06	0.68205	.	0.057854	0.64402	D	0.000002	T	0.52208	0.1720	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.56390	-0.7987	10	0.72032	D	0.01	-6.3731	17.3774	0.87396	0.0:0.8751:0.1249:0.0	.	1991	Q68DE3	K2018_HUMAN	H	1991	ENSP00000320794:R1991H;ENSP00000420721:R1991H	ENSP00000320794:R1991H	R	-	2	0	KIAA2018	114857247	1.000000	0.71417	0.993000	0.49108	0.627000	0.37826	5.364000	0.66110	1.533000	0.49186	-0.215000	0.12644	CGT	-	NULL		0.478	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	protein_coding	OTTHUMT00000354591.1	C	NM_001009899		114857247	-1	no_errors	NM_001009899	genbank	human	validated	54_36p	missense	SNP	1.000	T
IMPDH1	3614	genome.wustl.edu	37	7	128035056	128035056	+	Silent	SNP	C	C	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr7:128035056C>T	ENST00000480861.1	-	11	1244	c.1167G>A	c.(1165-1167)acG>acA	p.T389T	IMPDH1_ENST00000338791.6_Silent_p.T479T|IMPDH1_ENST00000348127.6_Silent_p.T443T|IMPDH1_ENST00000470772.1_Silent_p.T393T|IMPDH1_ENST00000496200.1_Silent_p.T369T|IMPDH1_ENST00000378717.4_Silent_p.T410T|IMPDH1_ENST00000419067.2_Silent_p.T446T|IMPDH1_ENST00000354269.5_Silent_p.T469T|IMPDH1_ENST00000343214.4_Silent_p.T369T	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						CAGGGGCCTCCGTAGTGGCGG	0.637																																																0			7											46.0	56.0	53.0					7																	128035056		2203	4300	6503	127822292	SO:0001819	synonymous_variant	3614				CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.1167G>A	7.37:g.128035056C>T		Somatic		Capture	Illumina GAIIx	4	127822292		Silent	SNP	superfamily_SSF51412,HMMPfam_IMPDH,superfamily_SSF54631,HMMPfam_CBS,HMMSmart_CBS,PatternScan_IMP_DH_GMP_RED	p.T479	ENST00000480861.1	37	c.1437	CCDS55161.1	7																																																																																			-	superfamily_SSF51412,HMMPfam_IMPDH		0.637	IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	IMPDH1	protein_coding	OTTHUMT00000349462.1	C	NM_000883		127822292	-1	no_errors	NM_000883	genbank	human	reviewed	54_36p	silent	SNP	0.962	T
PTPRK	5796	genome.wustl.edu	37	6	128388770	128388770	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr6:128388770G>C	ENST00000368215.3	-	12	2050	c.2051C>G	c.(2050-2052)cCg>cGg	p.P684R	PTPRK_ENST00000368226.4_Missense_Mutation_p.P684R|PTPRK_ENST00000368210.3_Missense_Mutation_p.P684R|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368207.3_Missense_Mutation_p.P684R|PTPRK_ENST00000368213.5_Missense_Mutation_p.P684R|PTPRK_ENST00000532331.1_Missense_Mutation_p.P684R|RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000368227.3_Missense_Mutation_p.P684R			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	684					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CACAGTGAACGGGGCAGGCTC	0.542																																																0			6											104.0	102.0	102.0					6																	128388770		2203	4300	6503	128430463	SO:0001583	missense	5796			L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.2051C>G	6.37:g.128388770G>C	ENSP00000357198:p.Pro684Arg	Somatic		Capture	Illumina GAIIx	4	128430463	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	HMMSmart_SM00137,HMMPfam_MAM,PatternScan_MAM_1,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.P684R	ENST00000368215.3	37	c.2051		6	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403885	0.83230	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676	T;T;T;T;T;T;T	0.08193	3.12;3.13;3.14;3.12;3.12;3.15;3.14	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.19846	0.0477	L	0.56340	1.77	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.962;0.999;1.0	D;D;D;D;D;D	0.97110	0.998;1.0;1.0;0.936;0.995;0.998	T	0.00385	-1.1773	10	0.59425	D	0.04	.	19.9002	0.96983	0.0:0.0:1.0:0.0	.	684;684;684;541;684;684	B4DHC3;B7ZMG0;Q15262-3;F5GWP2;Q15262;Q15262-2	.;.;.;.;PTPRK_HUMAN;.	R	684;684;684;684;684;684;684;541	ENSP00000357209:P684R;ENSP00000357210:P684R;ENSP00000432973:P684R;ENSP00000357196:P684R;ENSP00000357193:P684R;ENSP00000357198:P684R;ENSP00000357190:P684R	ENSP00000357190:P684R	P	-	2	0	PTPRK	128430463	1.000000	0.71417	0.954000	0.39281	0.909000	0.53808	7.876000	0.87215	2.709000	0.92574	0.655000	0.94253	CCG	-	NULL		0.542	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	PTPRK	protein_coding	OTTHUMT00000042163.1	G			128430463	-1	no_errors	NM_002844	genbank	human	validated	54_36p	missense	SNP	0.997	C
MED22	6837	genome.wustl.edu	37	9	136211030	136211030	+	Silent	SNP	G	G	A	rs146119308		TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr9:136211030G>A	ENST00000491289.1	-	4	944	c.363C>T	c.(361-363)gaC>gaT	p.D121D	MED22_ENST00000471524.1_5'UTR|MED22_ENST00000476080.1_Silent_p.D121D|MED22_ENST00000371999.1_Silent_p.D115D|MED22_ENST00000344469.5_Silent_p.D121D|MED22_ENST00000343730.5_Silent_p.D121D			Q15528	MED22_HUMAN	mediator complex subunit 22	121						cytoplasm (GO:0005737)|mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|large_intestine(1)|ovary(1)|urinary_tract(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.14e-06)|Epithelial(140;8.2e-06)|all cancers(34;6.94e-05)		TGGAGATCTCGTCTCGCAGCG	0.587																																																0			9						G	,	1,4405	2.1+/-5.4	0,1,2202	116.0	101.0	106.0		363,363	-10.2	0.0	9	dbSNP_134	106	3,8597	3.0+/-9.4	0,3,4297	yes	coding-synonymous,coding-synonymous	MED22	NM_133640.3,NM_181491.1	,	0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308	,	121/201,121/141	136211030	4,13002	2203	4300	6503	135200851	SO:0001819	synonymous_variant	6837				CCDS6963.1, CCDS6964.1	9q34.1	2008-02-05	2007-07-30	2007-07-30	ENSG00000148297	ENSG00000148297			11477	protein-coding gene	gene with protein product		185641	"""surfeit 5"""	SURF5		8499913, 15175163	Standard	NM_133640		Approved	Med24	uc004cdc.3	Q15528	OTTHUMG00000020869	ENST00000491289.1:c.363C>T	9.37:g.136211030G>A		Somatic		Capture	Illumina GAIIx	4	135200851	B3KW83|B3KWX4|O76072|Q5T8U0	Silent	SNP	HMMPfam_SURF5	p.D121	ENST00000491289.1	37	c.363	CCDS6963.1	9																																																																																			-	HMMPfam_SURF5		0.587	MED22-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MED22	protein_coding	OTTHUMT00000054898.2	G	NM_133640		135200851	-1	no_errors	NM_133640	genbank	human	reviewed	54_36p	silent	SNP	0.771	A
PRR23C	389152	genome.wustl.edu	37	3	138762806	138762806	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr3:138762806G>T	ENST00000413199.1	-	1	928	c.657C>A	c.(655-657)ttC>ttA	p.F219L	PRR23C_ENST00000502927.2_Missense_Mutation_p.F219L|MRPS22_ENST00000495075.1_Intron	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	219	Pro-rich.									breast(2)|lung(7)|skin(2)	11						CCAGAAGATGGAATTCCAGGT	0.672																																																0			3											52.0	60.0	57.0					3																	138762806		692	1591	2283	140245496	SO:0001583	missense	0				CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.657C>A	3.37:g.138762806G>T	ENSP00000396648:p.Phe219Leu	Somatic		Capture	Illumina GAIIx	4	140245496		Missense_Mutation	SNP	HMMPfam_DUF2476	p.F219L	ENST00000413199.1	37	c.657	CCDS46924.1	3	.	.	.	.	.	.	.	.	.	.	G	9.560	1.118319	0.20877	.	.	ENSG00000233701	ENST00000413199;ENST00000502927	.	.	.	3.26	-1.04	0.10068	.	3.001240	0.00883	N	0.002155	T	0.31575	0.0801	L	0.39898	1.24	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.12142	-1.0559	9	0.07990	T	0.79	.	7.123	0.25456	0.1142:0.5531:0.3328:0.0	.	219	Q6ZRP0	PR23C_HUMAN	L	219	.	ENSP00000396648:F219L	F	-	3	2	PRR23C	140245496	0.000000	0.05858	0.000000	0.03702	0.256000	0.26092	0.049000	0.14099	-0.225000	0.09913	0.455000	0.32223	TTC	-	HMMPfam_DUF2476		0.672	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000206260	protein_coding	OTTHUMT00000361502.1	G	NM_001134657		140245496	-1	no_errors	ENST00000383163	ensembl	human	known	54_36p	missense	SNP	0.000	T
ZNF862	643641	genome.wustl.edu	37	7	149558583	149558583	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr7:149558583C>G	ENST00000223210.4	+	7	2579	c.2334C>G	c.(2332-2334)atC>atG	p.I778M	RP4-751H13.7_ENST00000608963.1_RNA	NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	778					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						AGCAGGAGATCATCCGCCTGA	0.637																																																0			7											24.0	28.0	27.0					7																	149558583		2057	4197	6254	149189516	SO:0001583	missense	0			AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.2334C>G	7.37:g.149558583C>G	ENSP00000223210:p.Ile778Met	Somatic		Capture	Illumina GAIIx	4	149189516	A0AUL8	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,HMMSmart_SM00597,HMMPfam_hATC	p.I778M	ENST00000223210.4	37	c.2334	CCDS47741.1	7	.	.	.	.	.	.	.	.	.	.	C	1.218	-0.627787	0.03610	.	.	ENSG00000106479	ENST00000223210	T	0.01133	5.29	5.18	0.729	0.18266	Ribonuclease H-like (1);	0.126263	0.35555	N	0.003126	T	0.00754	0.0025	N	0.14661	0.345	0.09310	N	0.999999	B	0.19200	0.034	B	0.16289	0.015	T	0.48822	-0.9001	10	0.30854	T	0.27	-24.0446	5.2926	0.15735	0.0:0.5573:0.1545:0.2882	.	778	O60290	ZN862_HUMAN	M	778	ENSP00000223210:I778M	ENSP00000223210:I778M	I	+	3	3	ZNF862	149189516	0.076000	0.21285	0.172000	0.22920	0.417000	0.31264	0.073000	0.14640	0.211000	0.20683	0.585000	0.79938	ATC	-	NULL		0.637	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF862	protein_coding	OTTHUMT00000350165.1	C	NM_001099220		149189516	+1	no_errors	NM_001099220	genbank	human	provisional	54_36p	missense	SNP	0.570	G
GINM1	116254	genome.wustl.edu	37	6	149900056	149900056	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr6:149900056A>T	ENST00000367419.5	+	4	497	c.376A>T	c.(376-378)Agt>Tgt	p.S126C	RP1-12G14.6_ENST00000435273.2_RNA	NM_138785.3	NP_620140.1	Q9NU53	GINM1_HUMAN	glycoprotein integral membrane 1	126						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											ATCTGGTTCCAGTTTGCAACT	0.303																																																0			6											92.0	93.0	92.0					6																	149900056		2203	4300	6503	149941749	SO:0001583	missense	116254			BC014320	CCDS5216.1	6q24.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000055211	ENSG00000055211			21074	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 72"""	C6orf72			Standard	NM_138785		Approved	dJ12G14.2	uc003qmq.1	Q9NU53	OTTHUMG00000015789	ENST00000367419.5:c.376A>T	6.37:g.149900056A>T	ENSP00000356389:p.Ser126Cys	Somatic		Capture	Illumina GAIIx	4	149941749	B2RDY7|E1P5A2	Missense_Mutation	SNP	NULL	p.S126C	ENST00000367419.5	37	c.376	CCDS5216.1	6	.	.	.	.	.	.	.	.	.	.	A	20.1	3.931578	0.73442	.	.	ENSG00000055211	ENST00000367423;ENST00000367419	.	.	.	5.82	3.46	0.39613	.	0.431594	0.27787	N	0.017860	T	0.38665	0.1049	L	0.60455	1.87	0.31388	N	0.678147	D;D	0.67145	0.996;0.996	P;P	0.56216	0.794;0.794	T	0.30650	-0.9971	8	.	.	.	-7.188	6.9125	0.24342	0.7287:0.0:0.2713:0.0	.	126;126	A8K037;Q9NU53	.;CF072_HUMAN	C	6;126	.	.	S	+	1	0	C6orf72	149941749	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.536000	0.36072	1.022000	0.39626	0.459000	0.35465	AGT	-	NULL		0.303	GINM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf72	protein_coding	OTTHUMT00000042644.1	A	NM_138785		149941749	+1	no_errors	NM_138785	genbank	human	predicted	54_36p	missense	SNP	0.988	T
HRNR	388697	genome.wustl.edu	37	1	152191308	152191308	+	Missense_Mutation	SNP	C	C	G			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr1:152191308C>G	ENST00000368801.2	-	3	2872	c.2797G>C	c.(2797-2799)Ggt>Cgt	p.G933R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	933					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACTTGTGACCAAAGCCAGAA	0.592																																																0			1											221.0	229.0	227.0					1																	152191308		2203	4300	6503	150457932	SO:0001583	missense	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2797G>C	1.37:g.152191308C>G	ENSP00000357791:p.Gly933Arg	Somatic		Capture	Illumina GAIIx	4	150457932	Q5DT20|Q5U1F4	Missense_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,PatternScan_S100_CABP,PatternScan_EF_HAND_1,HMMPfam_SVS_QK	p.G933R	ENST00000368801.2	37	c.2797	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	5.570	0.289952	0.10567	.	.	ENSG00000197915	ENST00000368801	T	0.01613	4.73	3.07	0.992	0.19819	.	.	.	.	.	T	0.00608	0.0020	L	0.48642	1.525	0.09310	N	1	B	0.23490	0.086	B	0.25759	0.063	T	0.45175	-0.9279	9	0.20519	T	0.43	.	5.2928	0.15737	0.0:0.6591:0.2109:0.13	.	933	Q86YZ3	HORN_HUMAN	R	933	ENSP00000357791:G933R	ENSP00000357791:G933R	G	-	1	0	HRNR	150457932	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.685000	0.05167	0.021000	0.15133	0.505000	0.49811	GGT	-	NULL		0.592	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	protein_coding	OTTHUMT00000034016.1	C	XM_373868		150457932	-1	no_errors	NM_001009931	genbank	human	validated	54_36p	missense	SNP	0.000	G
FLG	2312	genome.wustl.edu	37	1	152282587	152282587	+	Missense_Mutation	SNP	G	G	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr1:152282587G>T	ENST00000368799.1	-	3	4810	c.4775C>A	c.(4774-4776)tCc>tAc	p.S1592Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1592	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACTAACACTGGATCCCTGGCG	0.587									Ichthyosis																																							0			1											154.0	165.0	161.0					1																	152282587		2203	4300	6503	150549211	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4775C>A	1.37:g.152282587G>T	ENSP00000357789:p.Ser1592Tyr	Somatic		Capture	Illumina GAIIx	4	150549211	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,PatternScan_S100_CABP,PatternScan_EF_HAND_1,HMMPfam_Filaggrin	p.S1592Y	ENST00000368799.1	37	c.4775	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	9.387	1.074595	0.20227	.	.	ENSG00000143631	ENST00000368799	T	0.09073	3.02	3.15	1.19	0.21007	.	.	.	.	.	T	0.04998	0.0134	M	0.83312	2.635	0.09310	N	1	B	0.18610	0.029	B	0.17098	0.017	T	0.30119	-0.9989	9	0.66056	D	0.02	.	7.9654	0.30095	0.0:0.0:0.5572:0.4428	.	1592	P20930	FILA_HUMAN	Y	1592	ENSP00000357789:S1592Y	ENSP00000357789:S1592Y	S	-	2	0	FLG	150549211	0.034000	0.19679	0.001000	0.08648	0.005000	0.04900	1.059000	0.30517	0.179000	0.19938	-0.346000	0.07831	TCC	-	HMMPfam_Filaggrin		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	G	NM_002016		150549211	-1	no_errors	NM_002016	genbank	human	provisional	54_36p	missense	SNP	0.001	T
ARHGEF11	9826	genome.wustl.edu	37	1	156911714	156911714	+	Missense_Mutation	SNP	C	C	T	rs143001729	byFrequency	TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr1:156911714C>T	ENST00000361409.2	-	33	4016	c.3274G>A	c.(3274-3276)Gtc>Atc	p.V1092I	ARHGEF11_ENST00000315174.8_Missense_Mutation_p.V508I|ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000368194.3_Missense_Mutation_p.V1132I	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1092					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGAGGATGGACGGGCATTGGG	0.652																																																0			1						C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	50.0	59.0	56.0		3274,3394	-9.2	0.0	1	dbSNP_134	56	4,8596	3.7+/-12.6	0,4,4296	no	missense,missense	ARHGEF11	NM_014784.2,NM_198236.1	29,29	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	benign,benign	1092/1523,1132/1563	156911714	4,13002	2203	4300	6503	155178338	SO:0001583	missense	9826			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3274G>A	1.37:g.156911714C>T	ENSP00000354644:p.Val1092Ile	Somatic		Capture	Illumina GAIIx	4	155178338	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,HMMPfam_RGS-like,superfamily_Regulat_G_prot_signal_superfam,HMMSmart_RGS,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,superfamily_SSF50729,HMMSmart_PH	p.V1132I	ENST00000361409.2	37	c.3394	CCDS1162.1	1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530478	0.27387	0.0	4.65E-4	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.65732	-0.17;-0.17;-0.07	4.58	-9.17	0.00691	.	2.099760	0.02053	N	0.050176	T	0.19366	0.0465	N	0.08118	0	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.002	B;B;B	0.04013	0.001;0.001;0.001	T	0.06826	-1.0805	10	0.34782	T	0.22	0.4135	15.2843	0.73816	0.0:0.5903:0.0:0.4097	.	508;1092;1132	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	I	1132;1092;508	ENSP00000357177:V1132I;ENSP00000354644:V1092I;ENSP00000313470:V508I	ENSP00000313470:V508I	V	-	1	0	ARHGEF11	155178338	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.222000	0.00551	-1.650000	0.01506	-1.587000	0.00848	GTC	-	NULL		0.652	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	protein_coding	OTTHUMT00000098931.1	C	NM_198236		155178338	-1	no_errors	NM_198236	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
ETFDH	2110	genome.wustl.edu	37	4	159618808	159618808	+	Missense_Mutation	SNP	A	A	C			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr4:159618808A>C	ENST00000511912.1	+	8	1261	c.929A>C	c.(928-930)tAt>tCt	p.Y310S	ETFDH_ENST00000307738.5_Missense_Mutation_p.Y263S	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	310					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		TCTTTCCTCTATCATTTGAAT	0.413																																																0			4											154.0	150.0	151.0					4																	159618808		2203	4300	6503	159838258	SO:0001583	missense	2110			S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.929A>C	4.37:g.159618808A>C	ENSP00000426638:p.Tyr310Ser	Somatic		Capture	Illumina GAIIx	4	159838258	B4E3R9|J3KND9|Q7Z347	Missense_Mutation	SNP	superfamily_FAD/NAD(P)-binding domain,HMMPfam_Pyr_redox_2,HMMPfam_ETF_QO	p.Y310S	ENST00000511912.1	37	c.929	CCDS3800.1	4	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615045	0.87359	.	.	ENSG00000171503	ENST00000511912;ENST00000507475;ENST00000307738	D;D;D	0.98192	-4.45;-4.78;-4.45	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.99417	0.9794	H	0.98426	4.23	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98223	1.0479	10	0.87932	D	0	-18.6412	15.6957	0.77494	1.0:0.0:0.0:0.0	.	263;249;310	B4E3R9;B4DEQ0;Q16134	.;.;ETFD_HUMAN	S	310;145;263	ENSP00000426638:Y310S;ENSP00000422735:Y145S;ENSP00000303552:Y263S	ENSP00000303552:Y263S	Y	+	2	0	ETFDH	159838258	1.000000	0.71417	0.922000	0.36590	0.938000	0.57974	9.339000	0.96797	2.104000	0.64026	0.533000	0.62120	TAT	-	superfamily_FAD/NAD(P)-binding domain		0.413	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETFDH	protein_coding	OTTHUMT00000365718.2	A			159838258	+1	no_errors	NM_004453	genbank	human	reviewed	54_36p	missense	SNP	0.997	C
PSMD14	10213	genome.wustl.edu	37	2	162197594	162197594	+	Intron	SNP	C	C	A			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr2:162197594C>A	ENST00000409682.3	+	3	752					NM_005805.5	NP_005796.1	O00487	PSDE_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 14						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K63-linked deubiquitination (GO:0070536)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, lid subcomplex (GO:0008541)	endopeptidase activator activity (GO:0061133)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|proteasome binding (GO:0070628)|ubiquitin thiolesterase activity (GO:0004221)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	12						TCCCCGAGCTCCCCCAGCCCC	0.836																																																0			2																																								161905840	SO:0001627	intron_variant	0			U86782	CCDS46437.1	2q14.3	2008-05-22			ENSG00000115233	ENSG00000115233		"""Proteasome (prosome, macropain) subunits"""	16889	protein-coding gene	gene with protein product		607173				9374539	Standard	NM_005805		Approved	POH1, pad1, Rpn11	uc002ubu.3	O00487	OTTHUMG00000153882	ENST00000409682.3:c.48+22210C>A	2.37:g.162197594C>A		Somatic		Capture	Illumina GAIIx	4	161905840	B3KNW2|O00176	Nonsense_Mutation	SNP	NULL	p.E82*	ENST00000409682.3	37	c.244	CCDS46437.1	2																																																																																			-	NULL		0.836	PSMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132060	protein_coding	OTTHUMT00000332833.1	C	NM_005805		161905840	-1	no_errors	XM_001720144	genbank	human	model	54_36p	nonsense	SNP	0.354	A
ERMARD	55780	genome.wustl.edu	37	6	170155405	170155405	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr6:170155405G>C	ENST00000366773.3	+	3	235	c.202G>C	c.(202-204)Gtg>Ctg	p.V68L	ERMARD_ENST00000366772.2_Missense_Mutation_p.V68L|ERMARD_ENST00000392095.4_5'UTR|ERMARD_ENST00000418781.3_Missense_Mutation_p.V68L|ERMARD_ENST00000588451.1_5'UTR	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	68					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											CTGGGGAAGCGTGAGGCTGCT	0.443																																																0			6											161.0	161.0	161.0					6																	170155405		2203	4300	6503	169897330	SO:0001583	missense	55780			AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.202G>C	6.37:g.170155405G>C	ENSP00000355735:p.Val68Leu	Somatic		Capture	Illumina GAIIx	4	169897330	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	NULL	p.V68L	ENST00000366773.3	37	c.202	CCDS34576.1	6	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582454	0.46006	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781	T	0.59364	0.27	5.93	4.13	0.48395	.	0.233616	0.30219	N	0.010140	T	0.42966	0.1226	M	0.69823	2.125	0.80722	D	1	P;P	0.48589	0.728;0.912	B;B	0.41723	0.283;0.365	T	0.48625	-0.9019	10	0.59425	D	0.04	.	10.7472	0.46187	0.0719:0.1326:0.7955:0.0	.	68;68	Q5T6L9-2;Q5T6L9	.;CF070_HUMAN	L	68	ENSP00000355735:V68L	ENSP00000355734:V68L	V	+	1	0	C6orf70	169897330	0.986000	0.35501	0.088000	0.20740	0.106000	0.19336	2.503000	0.45407	0.823000	0.34589	0.557000	0.71058	GTG	-	NULL		0.443	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf70	protein_coding	OTTHUMT00000043238.2	G	NM_018341		169897330	+1	no_errors	NM_018341	genbank	human	validated	54_36p	missense	SNP	0.233	C
LAMC1	3915	genome.wustl.edu	37	1	183072551	183072551	+	Missense_Mutation	SNP	C	C	G	rs144662217	byFrequency	TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr1:183072551C>G	ENST00000258341.4	+	2	764	c.507C>G	c.(505-507)gaC>gaG	p.D169E		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	169	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						CACGGGAAGACGGGCCCTGGA	0.552																																																0			1											93.0	92.0	93.0					1																	183072551		2203	4300	6503	181339174	SO:0001583	missense	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.507C>G	1.37:g.183072551C>G	ENSP00000258341:p.Asp169Glu	Somatic		Capture	Illumina GAIIx	4	181339174	Q5VYE7	Missense_Mutation	SNP	HMMSmart_LamNT,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_SSF57196,PatternScan_EGF_1,PatternScan_EGF_LAM_1,superfamily_Grow_fac_recept,HMMSmart_LamB,HMMPfam_Laminin_B,PatternScan_EGF_2	p.D169E	ENST00000258341.4	37	c.507	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	c	13.85	2.359640	0.41801	.	.	ENSG00000135862	ENST00000258341	T	0.81078	-1.45	5.34	-10.7	0.00240	Laminin, N-terminal (3);	0.155161	0.56097	N	0.000035	T	0.72661	0.3488	M	0.72894	2.215	0.37272	D	0.907442	B;B	0.27498	0.002;0.18	B;B	0.32211	0.013;0.142	T	0.65368	-0.6185	10	0.54805	T	0.06	.	10.9769	0.47472	0.0:0.3679:0.1445:0.4876	.	169;169	P11047;Q6NVY8	LAMC1_HUMAN;.	E	169	ENSP00000258341:D169E	ENSP00000258341:D169E	D	+	3	2	LAMC1	181339174	0.000000	0.05858	0.043000	0.18650	0.367000	0.29736	-3.752000	0.00375	-3.519000	0.00148	-2.513000	0.00187	GAC	-	HMMSmart_LamNT,HMMPfam_Laminin_N		0.552	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	protein_coding	OTTHUMT00000085954.2	C	NM_002293		181339174	+1	no_errors	NM_002293	genbank	human	reviewed	54_36p	missense	SNP	0.988	G
CACNA1S	779	genome.wustl.edu	37	1	201022697	201022697	+	Missense_Mutation	SNP	G	G	C			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr1:201022697G>C	ENST00000362061.3	-	30	3911	c.3685C>G	c.(3685-3687)Cgc>Ggc	p.R1229G	CACNA1S_ENST00000367338.3_Missense_Mutation_p.R1210G	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1229					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CTGGAGATGCGGGCACTCTCA	0.642																																																0			1											45.0	46.0	46.0					1																	201022697		2203	4300	6503	199289320	SO:0001583	missense	779			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3685C>G	1.37:g.201022697G>C	ENSP00000355192:p.Arg1229Gly	Somatic		Capture	Illumina GAIIx	4	199289320	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ	p.R1229G	ENST00000362061.3	37	c.3685	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	.	13.19	2.162088	0.38217	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.98280	-4.84;-4.23	4.05	4.05	0.47172	Ion transport (1);	0.301529	0.33023	N	0.005376	D	0.97461	0.9169	L	0.39085	1.19	0.42100	D	0.991336	P	0.47545	0.897	P	0.54210	0.745	D	0.98188	1.0461	10	0.54805	T	0.06	.	16.8345	0.85953	0.0:0.0:1.0:0.0	.	1229	Q13698	CAC1S_HUMAN	G	1229;1210	ENSP00000355192:R1229G;ENSP00000356307:R1210G	ENSP00000355192:R1229G	R	-	1	0	CACNA1S	199289320	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.292000	0.51772	2.265000	0.75225	0.586000	0.80456	CGC	-	superfamily_SSF81324,HMMPfam_Ion_trans		0.642	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	protein_coding	OTTHUMT00000087049.1	G	NM_000069		199289320	-1	no_errors	NM_000069	genbank	human	reviewed	54_36p	missense	SNP	0.994	C
OR2T2	401992	genome.wustl.edu	37	1	248617010	248617010	+	Missense_Mutation	SNP	A	A	T			TCGA-24-1850-01A-01W-0639-09	TCGA-24-1850-10A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	3162c0d3-7e11-454d-ad20-8b4bb8c70181	2169c00c-6d8c-4ede-90c3-0e3650291be7	g.chr1:248617010A>T	ENST00000342927.3	+	1	934	c.912A>T	c.(910-912)aaA>aaT	p.K304N		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTCTGAGGAAAGTACTAGGGA	0.527																																																0			1											24.0	26.0	25.0					1																	248617010		2187	4264	6451	246683633	SO:0001583	missense	401992			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.912A>T	1.37:g.248617010A>T	ENSP00000343062:p.Lys304Asn	Somatic		Capture	Illumina GAIIx	4	246683633	B2RNM1|B9EH01	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.K304N	ENST00000342927.3	37	c.912	CCDS31116.1	1	.	.	.	.	.	.	.	.	.	.	a	10.97	1.500384	0.26861	.	.	ENSG00000196240	ENST00000342927	T	0.41065	1.01	3.33	-1.98	0.07480	.	0.136004	0.33180	N	0.005192	T	0.35335	0.0928	L	0.42686	1.345	0.09310	N	1	P	0.48089	0.905	P	0.46758	0.526	T	0.36866	-0.9730	10	0.87932	D	0	.	8.9139	0.35570	0.4177:0.0:0.5823:0.0	.	304	Q6IF00	OR2T2_HUMAN	N	304	ENSP00000343062:K304N	ENSP00000343062:K304N	K	+	3	2	OR2T2	246683633	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.320000	0.08028	-0.317000	0.08677	0.369000	0.22263	AAA	-	superfamily_Family A G protein-coupled receptor-like		0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	protein_coding	OTTHUMT00000097421.1	A	NM_001004136		246683633	+1	no_errors	NM_001004136	genbank	human	provisional	54_36p	missense	SNP	0.003	T
