#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MACF1	23499	broad.mit.edu	37	1	39853854	39853854	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr1:39853854A>T	ENST00000372915.3	+	57	15442	c.15355A>T	c.(15355-15357)Atg>Ttg	p.M5119L	MACF1_ENST00000317713.7_Missense_Mutation_p.M3052L|MACF1_ENST00000289893.4_Missense_Mutation_p.M3554L|MACF1_ENST00000545844.1_Missense_Mutation_p.M3052L|MACF1_ENST00000539005.1_Missense_Mutation_p.M3031L|MACF1_ENST00000564288.1_Missense_Mutation_p.M5114L|MACF1_ENST00000361689.2_Missense_Mutation_p.M3052L|MACF1_ENST00000567887.1_Missense_Mutation_p.M5151L			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5119					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.M3554L(1)|p.M3052L(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTGTGTGATGATGGAAAACAA	0.517																																																2	Substitution - Missense(2)	ovary(2)	1											110.0	97.0	101.0					1																	39853854		2203	4300	6503	39626441	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.15355A>T	1.37:g.39853854A>T	ENSP00000362006:p.Met5119Leu	Somatic		Capture	Illumina GAIIx	Phase_I	39626441	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.418|0.418	-0.909816|-0.909816	0.02434|0.02434	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.|T;T;T;T;T;T	.|0.12569	.|2.67;2.67;2.67;2.67;2.67;2.67	5.9|5.9	5.9|5.9	0.94986|0.94986	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.09555|0.09555	0.0235|0.0235	N|N	0.12887|0.12887	0.27|0.27	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.23316	.|0.083;0.024;0.003	.|B;B;B	.|0.34038	.|0.174;0.012;0.012	T|T	0.06643|0.06643	-1.0815|-1.0815	5|10	.|0.02654	.|T	.|1	.|.	16.3245|16.3245	0.82970|0.82970	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|5119;3052;2996	.|Q9UPN3;F8W8Q1;Q9UPN3-3	.|MACF1_HUMAN;.;.	V|L	2164|3052;5119;3052;3052;3031;3554	.|ENSP00000439537:M3052L;ENSP00000362006:M5119L;ENSP00000354573:M3052L;ENSP00000313438:M3052L;ENSP00000444364:M3031L;ENSP00000289893:M3554L	.|ENSP00000289893:M3554L	D|M	+|+	2|1	0|0	MACF1|MACF1	39626441|39626441	0.987000|0.987000	0.35691|0.35691	0.932000|0.932000	0.37286|0.37286	0.990000|0.990000	0.78478|0.78478	2.737000|2.737000	0.47393|0.47393	2.254000|2.254000	0.74563|0.74563	0.460000|0.460000	0.39030|0.39030	GAT|ATG		0.517	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
ACP6	51205	broad.mit.edu	37	1	147126383	147126383	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr1:147126383T>C	ENST00000369238.6	-	6	1153	c.706A>G	c.(706-708)Aag>Gag	p.K236E	ACP6_ENST00000392988.2_Missense_Mutation_p.K236E	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	236					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)	p.K236E(1)		breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					ATCCTGTCCTTCACCTTTTTC	0.483																																																1	Substitution - Missense(1)	ovary(1)	1											148.0	124.0	132.0					1																	147126383		2203	4300	6503	145593007	SO:0001583	missense	51205			BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.706A>G	1.37:g.147126383T>C	ENSP00000358241:p.Lys236Glu	Somatic		Capture	Illumina GAIIx	Phase_I	145593007	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Missense_Mutation	SNP	ENST00000369238.6	37	CCDS928.1	.	.	.	.	.	.	.	.	.	.	T	16.46	3.128935	0.56721	.	.	ENSG00000162836	ENST00000369238;ENST00000392988	T;T	0.28666	1.6;1.6	5.59	4.49	0.54785	.	0.259495	0.46442	D	0.000290	T	0.12178	0.0296	L	0.55743	1.74	0.33261	D	0.559738	P;P	0.38078	0.617;0.58	B;B	0.35182	0.124;0.197	T	0.06127	-1.0844	10	0.09843	T	0.71	.	12.4653	0.55755	0.0:0.0:0.2286:0.7714	.	236;236	Q9NPH0-2;Q9NPH0	.;PPA6_HUMAN	E	236	ENSP00000358241:K236E;ENSP00000376714:K236E	ENSP00000358241:K236E	K	-	1	0	ACP6	145593007	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	2.800000	0.47900	2.117000	0.64856	0.533000	0.62120	AAG		0.483	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039420.2	NM_016361	
INTS3	65123	broad.mit.edu	37	1	153724880	153724880	+	Silent	SNP	C	C	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr1:153724880C>T	ENST00000318967.2	+	8	1423	c.855C>T	c.(853-855)ttC>ttT	p.F285F	INTS3_ENST00000512605.1_Silent_p.F79F|INTS3_ENST00000456435.1_Silent_p.F79F|snoU13_ENST00000458994.1_RNA|INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000435409.2_Silent_p.F285F|RP11-216N14.8_ENST00000453778.1_RNA|RP11-216N14.9_ENST00000434575.1_RNA	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	286					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)		p.F285F(1)		breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GTCCTCAGTTCACAGGTAAGT	0.448																																																1	Substitution - coding silent(1)	ovary(1)	1											242.0	222.0	229.0					1																	153724880		2203	4300	6503	151991504	SO:0001819	synonymous_variant	65123			BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.855C>T	1.37:g.153724880C>T		Somatic		Capture	Illumina GAIIx	Phase_I	151991504	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Silent	SNP	ENST00000318967.2	37	CCDS1052.1																																																																																				0.448	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
RUSC1	23623	broad.mit.edu	37	1	155294895	155294895	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr1:155294895C>G	ENST00000368352.5	+	4	1610	c.1459C>G	c.(1459-1461)Ctt>Gtt	p.L487V	RUSC1_ENST00000368354.3_Missense_Mutation_p.L487V|RUSC1_ENST00000462780.1_3'UTR|RUSC1_ENST00000292254.4_Missense_Mutation_p.L18V|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368349.4_Missense_Mutation_p.L18V|RUSC1_ENST00000368347.4_Missense_Mutation_p.L77V	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	487	Interaction with TRAF6.				positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)	p.L18V(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CCTCCCAGGTCTTCTGATAGC	0.622											OREG0013860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											99.0	114.0	109.0					1																	155294895		2203	4300	6503	153561519	SO:0001583	missense	23623			AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1459C>G	1.37:g.155294895C>G	ENSP00000357336:p.Leu487Val	Somatic	1769	Capture	Illumina GAIIx	Phase_I	153561519	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	ENST00000368352.5	37	CCDS41410.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.597544	0.46318	.	.	ENSG00000160753	ENST00000368354;ENST00000368352;ENST00000368347;ENST00000368349;ENST00000292254	T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77	4.67	3.75	0.43078	.	0.000000	0.43579	D	0.000550	T	0.36110	0.0955	M	0.72118	2.19	0.43489	D	0.995723	D;D;D;D;D	0.76494	0.999;0.999;0.997;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.991;0.983;0.991;0.977	T	0.28038	-1.0056	10	0.87932	D	0	-25.8491	9.3961	0.38404	0.0:0.8248:0.0:0.1752	.	18;18;77;92;487	B4DQB8;B3KWM9;Q5T9V0;Q9BT86;Q9BVN2	.;.;.;.;RUSC1_HUMAN	V	487;487;77;18;18	ENSP00000357338:L487V;ENSP00000357336:L487V;ENSP00000357331:L77V;ENSP00000357333:L18V;ENSP00000292254:L18V	ENSP00000292254:L18V	L	+	1	0	RUSC1	153561519	0.999000	0.42202	1.000000	0.80357	0.053000	0.15095	2.053000	0.41326	1.309000	0.44985	0.655000	0.94253	CTT		0.622	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
HKDC1	80201	broad.mit.edu	37	10	71025400	71025400	+	Missense_Mutation	SNP	C	C	G	rs556646884	byFrequency	TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr10:71025400C>G	ENST00000354624.5	+	17	2565	c.2432C>G	c.(2431-2433)aCg>aGg	p.T811R	RP11-227H15.5_ENST00000413220.1_RNA	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	811	Hexokinase type-2 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)	p.T811R(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CTGGACAGCACGTGTGAGGAC	0.647																																																1	Substitution - Missense(1)	ovary(1)	10											69.0	65.0	66.0					10																	71025400		2203	4300	6503	70695406	SO:0001583	missense	80201				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.2432C>G	10.37:g.71025400C>G	ENSP00000346643:p.Thr811Arg	Somatic		Capture	Illumina GAIIx	Phase_I	70695406	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948515	0.73787	.	.	ENSG00000156510	ENST00000354624	D	0.97620	-4.46	4.76	4.76	0.60689	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99039	0.9671	H	0.96662	3.86	0.80722	D	1	D	0.54964	0.969	D	0.74023	0.982	D	0.99164	1.0862	10	0.87932	D	0	-15.7186	18.3181	0.90227	0.0:1.0:0.0:0.0	.	811	Q2TB90	HKDC1_HUMAN	R	811	ENSP00000346643:T811R	ENSP00000346643:T811R	T	+	2	0	HKDC1	70695406	1.000000	0.71417	0.957000	0.39632	0.684000	0.39900	5.883000	0.69721	2.626000	0.88956	0.563000	0.77884	ACG		0.647	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
TIAL1	7073	broad.mit.edu	37	10	121341479	121341479	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr10:121341479G>A	ENST00000436547.2	-	5	370	c.326C>T	c.(325-327)aCa>aTa	p.T109I	TIAL1_ENST00000369093.2_Missense_Mutation_p.T126I|TIAL1_ENST00000369092.4_5'UTR	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	109	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.T126I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		ATCTTCTGTTGTAATTTCTGG	0.348																																																1	Substitution - Missense(1)	ovary(1)	10											90.0	91.0	91.0					10																	121341479		2203	4300	6503	121331469	SO:0001583	missense	7073			AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.326C>T	10.37:g.121341479G>A	ENSP00000394902:p.Thr109Ile	Somatic		Capture	Illumina GAIIx	Phase_I	121331469	A8K3T0|A8K4L9	Missense_Mutation	SNP	ENST00000436547.2	37	CCDS7613.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499884	0.64298	.	.	ENSG00000151923	ENST00000369093;ENST00000436547;ENST00000412524;ENST00000369086	T;T;T;T	0.80393	1.79;-1.37;1.79;1.79	6.06	6.06	0.98353	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.044877	0.85682	D	0.000000	D	0.91808	0.7408	M	0.88906	2.99	0.80722	D	1	P;D	0.58970	0.879;0.984	P;D	0.70227	0.886;0.968	D	0.91852	0.5492	10	0.66056	D	0.02	-17.9068	20.6397	0.99537	0.0:0.0:1.0:0.0	.	126;109	A8K4L9;Q01085	.;TIAR_HUMAN	I	126;109;70;70	ENSP00000358089:T126I;ENSP00000394902:T109I;ENSP00000403573:T70I;ENSP00000358082:T70I	ENSP00000358082:T70I	T	-	2	0	TIAL1	121331469	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.737000	0.98831	2.880000	0.98712	0.650000	0.86243	ACA		0.348	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050672.2	NM_022333, NM_003252	
NEU3	10825	broad.mit.edu	37	11	74717460	74717460	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr11:74717460C>T	ENST00000544263.1	+	4	1380	c.1210C>T	c.(1210-1212)Cac>Tac	p.H404Y	NEU3_ENST00000294064.4_Missense_Mutation_p.H437Y|NEU3_ENST00000532963.1_3'UTR|NEU3_ENST00000529024.1_Intron|NEU3_ENST00000545272.1_Missense_Mutation_p.H328Y|NEU3_ENST00000531509.1_Missense_Mutation_p.H437Y			Q9UQ49	NEUR3_HUMAN	sialidase 3 (membrane sialidase)	404					carbohydrate metabolic process (GO:0005975)|ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha-sialidase activity (GO:0016997)|exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)	p.H437Y(1)		kidney(2)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						CCTGTTTACACACCGGGAGAT	0.522																																																1	Substitution - Missense(1)	ovary(1)	11											97.0	103.0	101.0					11																	74717460		2024	4179	6203	74395108	SO:0001583	missense	10825			AB008185	CCDS44682.1	11q13.5	2008-02-05				ENSG00000162139			7760	protein-coding gene	gene with protein product		604617				10405317	Standard	NM_006656		Approved		uc001ovw.3	Q9UQ49		ENST00000544263.1:c.1210C>T	11.37:g.74717460C>T	ENSP00000445591:p.His404Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	74395108	A8K327|Q9NQE1	Missense_Mutation	SNP	ENST00000544263.1	37		.	.	.	.	.	.	.	.	.	.	C	2.278	-0.365485	0.05069	.	.	ENSG00000162139	ENST00000294064;ENST00000531509;ENST00000544263;ENST00000545272	D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72	5.16	-1.33	0.09172	Neuraminidase (2);	0.701145	0.14810	N	0.297088	T	0.58807	0.2148	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.01281	0.0;0.0	T	0.43327	-0.9398	10	0.35671	T	0.21	-2.9756	2.2115	0.03949	0.2244:0.3802:0.2675:0.1279	.	404;437	Q9UQ49;A8K327	NEUR3_HUMAN;.	Y	437;437;404;328	ENSP00000294064:H437Y;ENSP00000432097:H437Y;ENSP00000445591:H404Y;ENSP00000439908:H328Y	ENSP00000294064:H437Y	H	+	1	0	NEU3	74395108	0.004000	0.15560	0.060000	0.19600	0.120000	0.20174	-0.142000	0.10311	-0.417000	0.07461	-2.232000	0.00291	CAC		0.522	NEU3-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_006656	
NPAT	4863	broad.mit.edu	37	11	108044483	108044483	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr11:108044483G>C	ENST00000278612.8	-	13	1333	c.1228C>G	c.(1228-1230)Caa>Gaa	p.Q410E	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	410					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.Q410E(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TGGTCTTCTTGTCTAAGCACA	0.403																																																1	Substitution - Missense(1)	ovary(1)	11											135.0	122.0	126.0					11																	108044483		1861	4099	5960	107549693	SO:0001583	missense	4863			X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.1228C>G	11.37:g.108044483G>C	ENSP00000278612:p.Gln410Glu	Somatic		Capture	Illumina GAIIx	Phase_I	107549693	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	ENST00000278612.8	37	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	G	5.844	0.339890	0.11069	.	.	ENSG00000149308	ENST00000278612	T	0.04049	3.72	5.54	5.54	0.83059	.	0.640477	0.15914	N	0.238480	T	0.06645	0.0170	L	0.60455	1.87	0.09310	N	1	B;B	0.22683	0.073;0.073	B;B	0.23852	0.049;0.049	T	0.41395	-0.9511	10	0.09338	T	0.73	-0.1733	12.4896	0.55893	0.0:0.0:0.8223:0.1777	.	410;410	B9EG70;Q14207	.;NPAT_HUMAN	E	410	ENSP00000278612:Q410E	ENSP00000278612:Q410E	Q	-	1	0	NPAT	107549693	0.374000	0.25081	0.083000	0.20561	0.287000	0.27160	3.113000	0.50376	2.765000	0.95021	0.557000	0.71058	CAA		0.403	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
Unknown	0	broad.mit.edu	37	11	124096009	124096009	+	IGR	SNP	C	C	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr11:124096009C>A								OR10D3 (39057 upstream) : OR8G1 (24413 downstream)																							CCTGCTCCAGCACCTACATCA	0.428																																																0			11											141.0	147.0	145.0					11																	124096009		1988	4196	6184	123601219	SO:0001628	intergenic_variant	26492																															11.37:g.124096009C>A		Somatic		Capture	Illumina GAIIx	Phase_I	123601219		Missense_Mutation	SNP		37																																																																																				0	0.428								
ALG10B	144245	broad.mit.edu	37	12	38714340	38714340	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr12:38714340G>A	ENST00000308742.4	+	3	1063	c.747G>A	c.(745-747)atG>atA	p.M249I	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	249					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)	p.M249I(2)		breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				ACTTGAGTATGCTTTTCTGTT	0.378																																																2	Substitution - Missense(2)	ovary(1)|kidney(1)	12											258.0	255.0	256.0					12																	38714340		2203	4300	6503	37000607	SO:0001583	missense	144245			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.747G>A	12.37:g.38714340G>A	ENSP00000310120:p.Met249Ile	Somatic		Capture	Illumina GAIIx	Phase_I	37000607	B2RPF4	Missense_Mutation	SNP	ENST00000308742.4	37	CCDS31772.1	.	.	.	.	.	.	.	.	.	.	N	0.012	-1.652365	0.00785	.	.	ENSG00000175548	ENST00000308742	T	0.54479	0.57	3.23	3.23	0.37069	.	0.484707	0.25402	N	0.030926	T	0.32882	0.0844	N	0.12182	0.205	0.25942	N	0.982857	B	0.02656	0.0	B	0.01281	0.0	T	0.18461	-1.0336	10	0.33141	T	0.24	.	12.7261	0.57173	0.0:0.0:1.0:0.0	.	249	Q5I7T1	AG10B_HUMAN	I	249	ENSP00000310120:M249I	ENSP00000310120:M249I	M	+	3	0	ALG10B	37000607	0.003000	0.15002	0.100000	0.21137	0.020000	0.10135	-0.108000	0.10857	2.103000	0.63969	0.643000	0.83706	ATG		0.378	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403349.1	NM_001013620	
KRT4	3851	broad.mit.edu	37	12	53201603	53201603	+	Nonsense_Mutation	SNP	C	C	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr12:53201603C>A	ENST00000551956.1	-	7	1663	c.1171G>T	c.(1171-1173)Gag>Tag	p.E391*	KRT4_ENST00000293774.4_Nonsense_Mutation_p.E465*|KRT4_ENST00000458244.2_Nonsense_Mutation_p.E371*			P19013	K2C4_HUMAN	keratin 4	405	Coil 2.|Rod.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.E465*(1)		endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						AGGGCATTCTCACCTCGCTGC	0.572																																					Pancreas(190;284 2995 41444 45903)											1	Substitution - Nonsense(1)	ovary(1)	12											77.0	74.0	75.0					12																	53201603		2203	4300	6503	51487870	SO:0001587	stop_gained	3851				CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.1171G>T	12.37:g.53201603C>A	ENSP00000448220:p.Glu391*	Somatic		Capture	Illumina GAIIx	Phase_I	51487870	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Nonsense_Mutation	SNP	ENST00000551956.1	37	CCDS41787.2	.	.	.	.	.	.	.	.	.	.	C	36	5.670897	0.96754	.	.	ENSG00000170477	ENST00000551956;ENST00000293774;ENST00000458244	.	.	.	5.47	5.47	0.80525	.	0.136887	0.33792	N	0.004542	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.7084	0.96083	0.0:1.0:0.0:0.0	.	.	.	.	X	391;465;371	.	ENSP00000293774:E465X	E	-	1	0	KRT4	51487870	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	6.086000	0.71352	2.746000	0.94184	0.561000	0.74099	GAG		0.572	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405931.1	NM_002272	
DCTN2	10540	broad.mit.edu	37	12	57926548	57926548	+	Missense_Mutation	SNP	C	C	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr12:57926548C>T	ENST00000548249.1	-	10	1087	c.820G>A	c.(820-822)Gca>Aca	p.A274T	DCTN2_ENST00000537439.1_Missense_Mutation_p.A251T|DCTN2_ENST00000434715.3_Missense_Mutation_p.A279T|DCTN2_ENST00000543672.1_Missense_Mutation_p.A279T|DCTN2_ENST00000551400.1_5'Flank	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)	274					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.A279T(1)		endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						TCCAAAACTGCAAGGTCTAGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	12											85.0	81.0	83.0					12																	57926548		1913	4134	6047	56212815	SO:0001583	missense	10540			U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.820G>A	12.37:g.57926548C>T	ENSP00000447824:p.Ala274Thr	Somatic		Capture	Illumina GAIIx	Phase_I	56212815	B2RBK5|Q86YN2|Q9BW17	Missense_Mutation	SNP	ENST00000548249.1	37	CCDS58245.1	.	.	.	.	.	.	.	.	.	.	C	10.75	1.438617	0.25900	.	.	ENSG00000175203	ENST00000548249;ENST00000434715;ENST00000543672;ENST00000537439;ENST00000354743;ENST00000543105;ENST00000550086	.	.	.	5.18	4.29	0.51040	.	0.106857	0.64402	N	0.000008	T	0.49966	0.1588	L	0.41824	1.3	0.54753	D	0.99998	B;B;B	0.17465	0.018;0.018;0.022	B;B;B	0.19946	0.016;0.016;0.027	T	0.41342	-0.9514	9	0.10636	T	0.68	-0.6016	12.8375	0.57782	0.0:0.9201:0.0:0.0799	.	274;279;274	F8WAG8;F5H2S7;Q13561	.;.;DCTN2_HUMAN	T	274;279;279;251;274;187;115	.	ENSP00000346785:A274T	A	-	1	0	DCTN2	56212815	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.297000	0.59061	1.557000	0.49525	0.557000	0.71058	GCA		0.488	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407393.2	NM_006400	
LPAR6	10161	broad.mit.edu	37	13	48986285	48986285	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr13:48986285G>A	ENST00000378434.4	-	7	1899	c.275C>T	c.(274-276)tCt>tTt	p.S92F	RB1_ENST00000267163.4_Intron|LPAR6_ENST00000345941.2_Missense_Mutation_p.S92F	NM_005767.5	NP_005758.2	P43657	LPAR6_HUMAN	lysophosphatidic acid receptor 6	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.0?(15)|p.?(4)|p.S92F(1)		NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	14						CAGCATCACAGAAATCTTACA	0.358																																																20	Whole gene deletion(15)|Unknown(4)|Substitution - Missense(1)	bone(10)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|ovary(1)	13											50.0	45.0	47.0					13																	48986285		2203	4300	6503	47884286	SO:0001583	missense	10161			AF000546	CCDS9410.1	13q14	2012-08-08	2009-06-23	2009-06-23	ENSG00000139679	ENSG00000139679		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	15520	protein-coding gene	gene with protein product		609239	"""purinergic receptor P2Y, G-protein coupled, 5"""	P2RY5		11004484, 9755289, 19386608	Standard	NM_005767		Approved	P2Y5	uc010acu.3	P43657	OTTHUMG00000016895	ENST00000378434.4:c.275C>T	13.37:g.48986285G>A	ENSP00000367691:p.Ser92Phe	Somatic		Capture	Illumina GAIIx	Phase_I	47884286	A4FTW9|B3KVF2|F2YGU4|O15133|Q3KPF5|Q53FA0|Q5VW44|Q7Z3S0|Q7Z3S6	Missense_Mutation	SNP	ENST00000378434.4	37	CCDS9410.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952547	0.73787	.	.	ENSG00000139679	ENST00000378434;ENST00000345941	T;T	0.36520	1.25;1.25	6.17	6.17	0.99709	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.58991	0.2161	L	0.53561	1.675	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.49303	-0.8954	10	0.42905	T	0.14	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	92	P43657	LPAR6_HUMAN	F	92	ENSP00000367691:S92F;ENSP00000344353:S92F	ENSP00000344353:S92F	S	-	2	0	LPAR6	47884286	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.876000	0.87215	2.941000	0.99782	0.655000	0.94253	TCT		0.358	LPAR6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276280.2	NM_005767	
HERC1	8925	broad.mit.edu	37	15	64005761	64005761	+	Silent	SNP	A	A	G	rs201470593		TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr15:64005761A>G	ENST00000443617.2	-	23	4341	c.4254T>C	c.(4252-4254)ccT>ccC	p.P1418P	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1418					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.P1418P(1)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GAGACTGAGGAGGTGGATCAT	0.562													A|||	1	0.000199681	0.0	0.0014	5008	,	,		17874	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	15											63.0	64.0	64.0					15																	64005761		2060	4217	6277	61792814	SO:0001819	synonymous_variant	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4254T>C	15.37:g.64005761A>G		Somatic		Capture	Illumina GAIIx	Phase_I	61792814	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1																																																																																				0.562	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
NUBP1	4682	broad.mit.edu	37	16	10850620	10850620	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr16:10850620G>C	ENST00000283027.5	+	6	453	c.434G>C	c.(433-435)aGg>aCg	p.R145T	NUBP1_ENST00000433392.2_Missense_Mutation_p.R134T|NUBP1_ENST00000571790.1_3'UTR	NM_002484.2	NP_002475.2			nucleotide binding protein 1									p.R145T(1)		large_intestine(2)|lung(3)|ovary(1)|skin(4)	10						GTTATCTGGAGGGGACCCAAG	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											158.0	136.0	143.0					16																	10850620		2197	4300	6497	10758121	SO:0001583	missense	4682			U01833	CCDS10543.1, CCDS61839.1	16p13.13	2014-01-13	2011-05-19		ENSG00000103274	ENSG00000103274			8041	protein-coding gene	gene with protein product		600280	"""nucleotide binding protein 1 (E.coli MinD like)"", ""nucleotide binding protein 1 (MinD homolog, E. coli)"""	NBP1		7926816	Standard	NM_002484		Approved	NBP35	uc002daa.1	P53384	OTTHUMG00000129751	ENST00000283027.5:c.434G>C	16.37:g.10850620G>C	ENSP00000283027:p.Arg145Thr	Somatic		Capture	Illumina GAIIx	Phase_I	10758121		Missense_Mutation	SNP	ENST00000283027.5	37	CCDS10543.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.844283	0.91197	.	.	ENSG00000103274	ENST00000283027;ENST00000433392	T;T	0.48836	0.8;0.8	5.39	5.39	0.77823	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.82157	0.4976	H	0.98936	4.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.991;0.992	D	0.89706	0.3908	10	0.87932	D	0	-24.1508	18.162	0.89710	0.0:0.0:1.0:0.0	.	134;145	P53384-2;P53384	.;NUBP1_HUMAN	T	145;134	ENSP00000283027:R145T;ENSP00000409654:R134T	ENSP00000283027:R145T	R	+	2	0	NUBP1	10758121	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.611000	0.98342	2.512000	0.84698	0.563000	0.77884	AGG		0.537	NUBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251964.2	NM_002484	
HS3ST3A1	9955	broad.mit.edu	37	17	13400029	13400029	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr17:13400029T>G	ENST00000284110.1	-	2	1503	c.706A>C	c.(706-708)Acc>Ccc	p.T236P	HS3ST3A1_ENST00000578576.1_Missense_Mutation_p.T34P	NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	236					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)	p.T236P(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ATGAGCTTGGTGTCCTTGGAC	0.647																																																1	Substitution - Missense(1)	ovary(1)	17											55.0	71.0	66.0					17																	13400029		2203	4300	6503	13340754	SO:0001583	missense	9955			AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.706A>C	17.37:g.13400029T>G	ENSP00000284110:p.Thr236Pro	Somatic		Capture	Illumina GAIIx	Phase_I	13340754	A8K7N2	Missense_Mutation	SNP	ENST00000284110.1	37	CCDS11165.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.325393	0.81580	.	.	ENSG00000153976	ENST00000284110	D	0.82619	-1.63	5.32	5.32	0.75619	Sulfotransferase domain (1);	0.064282	0.64402	U	0.000009	D	0.89584	0.6757	M	0.79343	2.45	0.80722	D	1	D	0.61697	0.99	D	0.70935	0.971	D	0.90248	0.4291	10	0.72032	D	0.01	.	10.1141	0.42581	0.0:0.0768:0.0:0.9232	.	236	Q9Y663	HS3SA_HUMAN	P	236	ENSP00000284110:T236P	ENSP00000284110:T236P	T	-	1	0	HS3ST3A1	13340754	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.176000	0.71955	2.317000	0.78254	0.460000	0.39030	ACC		0.647	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129952.1	NM_006042	
SGSH	6448	broad.mit.edu	37	17	78184775	78184775	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr17:78184775G>A	ENST00000326317.6	-	8	1071	c.985C>T	c.(985-987)Ccg>Tcg	p.P329S	SGSH_ENST00000534910.1_Missense_Mutation_p.P126S|SGSH_ENST00000572208.1_5'Flank	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase	329					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)	p.P329S(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTGGGGTACGGGATCGAGAAC	0.652																																																1	Substitution - Missense(1)	ovary(1)	17											67.0	49.0	55.0					17																	78184775		2203	4299	6502	75799370	SO:0001583	missense	6448			BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688		ENST00000326317.6:c.985C>T	17.37:g.78184775G>A	ENSP00000314606:p.Pro329Ser	Somatic		Capture	Illumina GAIIx	Phase_I	75799370	A8K5E2	Missense_Mutation	SNP	ENST00000326317.6	37	CCDS11770.1	.	.	.	.	.	.	.	.	.	.	g	16.06	3.015302	0.54468	.	.	ENSG00000181523	ENST00000326317;ENST00000534910	D;D	0.96396	-4.0;-4.0	4.74	4.74	0.60224	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.93331	0.7874	L	0.37850	1.14	0.80722	D	1	B	0.10296	0.003	B	0.16722	0.016	D	0.90365	0.4376	10	0.23302	T	0.38	-36.0987	17.3187	0.87230	0.0:0.0:1.0:0.0	.	329	P51688	SPHM_HUMAN	S	329;126	ENSP00000314606:P329S;ENSP00000437778:P126S	ENSP00000314606:P329S	P	-	1	0	SGSH	75799370	1.000000	0.71417	0.988000	0.46212	0.916000	0.54674	4.693000	0.61753	2.159000	0.67721	0.556000	0.70494	CCG		0.652	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437695.1	NM_000199	
TJP3	27134	broad.mit.edu	37	19	3735866	3735866	+	Splice_Site	SNP	G	G	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr19:3735866G>T	ENST00000541714.2	+	10	1522		c.e10-1		TJP3_ENST00000262968.9_Splice_Site|TJP3_ENST00000539908.2_Splice_Site|TJP3_ENST00000382008.3_Splice_Site|TJP3_ENST00000589378.1_Splice_Site|TJP3_ENST00000587686.1_Splice_Site	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3						regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)		p.?(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		TTCCCTTTCAGAGTTGCCCAG	0.527																																																1	Unknown(1)	ovary(1)	19											137.0	133.0	134.0					19																	3735866		2203	4300	6503	3686866	SO:0001630	splice_region_variant	27134			AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.1061-1G>T	19.37:g.3735866G>T		Somatic		Capture	Illumina GAIIx	Phase_I	3686866	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Splice_Site	SNP	ENST00000541714.2	37	CCDS32873.2	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974054	0.34848	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3869	0.55336	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TJP3	3686866	0.875000	0.30112	0.610000	0.28997	0.102000	0.19082	2.919000	0.48836	2.291000	0.77112	0.511000	0.50034	.		0.527	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453434.1		Intron
MUC16	94025	broad.mit.edu	37	19	9086617	9086617	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr19:9086617G>T	ENST00000397910.4	-	1	5401	c.5198C>A	c.(5197-5199)tCc>tAc	p.S1733Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1733	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S1733Y(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCAAGAGAGGAGGAGAGAGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	19											142.0	134.0	137.0					19																	9086617		1987	4184	6171	8947617	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5198C>A	19.37:g.9086617G>T	ENSP00000381008:p.Ser1733Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	8947617	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	1.108	-0.659123	0.03454	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.33	-2.65	0.06095	.	.	.	.	.	T	0.01189	0.0039	N	0.08118	0	.	.	.	P	0.40282	0.711	B	0.29716	0.106	T	0.44034	-0.9354	8	0.87932	D	0	.	2.6703	0.05065	0.4059:0.2618:0.3322:0.0	.	1733	B5ME49	.	Y	1733	ENSP00000381008:S1733Y	ENSP00000381008:S1733Y	S	-	2	0	MUC16	8947617	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	0.047000	0.14056	-0.876000	0.04017	0.313000	0.20887	TCC		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF560	147741	broad.mit.edu	37	19	9581068	9581068	+	Splice_Site	SNP	C	C	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr19:9581068C>A	ENST00000301480.4	-	7	661	c.448G>T	c.(448-450)Ggt>Tgt	p.G150C		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	150	KRAB 2. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G150C(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						CCAGACTTACCTACTGAGGAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	19											176.0	148.0	158.0					19																	9581068		2203	4300	6503	9442068	SO:0001630	splice_region_variant	147741			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.448+1G>T	19.37:g.9581068C>A		Somatic		Capture	Illumina GAIIx	Phase_I	9442068	Q495S9|Q495T1	Missense_Mutation	SNP	ENST00000301480.4	37	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.278074	0.40294	.	.	ENSG00000198028	ENST00000301480	T	0.03004	4.08	2.09	2.09	0.27110	Krueppel-associated box (4);	.	.	.	.	T	0.22820	0.0551	M	0.93150	3.385	0.23162	N	0.998195	D	0.89917	1.0	D	0.81914	0.995	T	0.02713	-1.1120	8	.	.	.	.	10.2296	0.43247	0.0:1.0:0.0:0.0	.	150	Q96MR9	ZN560_HUMAN	C	150	ENSP00000301480:G150C	.	G	-	1	0	ZNF560	9442068	0.990000	0.36364	0.096000	0.21009	0.025000	0.11179	3.045000	0.49838	1.466000	0.48025	0.557000	0.71058	GGT		0.433	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	Missense_Mutation
DNMT1	1786	broad.mit.edu	37	19	10265610	10265610	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr19:10265610T>C	ENST00000340748.4	-	19	1802	c.1567A>G	c.(1567-1569)Acc>Gcc	p.T523A	DNMT1_ENST00000540357.1_Missense_Mutation_p.T523A|DNMT1_ENST00000359526.4_Missense_Mutation_p.T539A			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	523	DNA replication foci-targeting sequence. {ECO:0000250}.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.T523A(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	TCCTCATAGGTCGAGTCGGAA	0.522																																																1	Substitution - Missense(1)	ovary(1)	19											132.0	110.0	117.0					19																	10265610		2203	4300	6503	10126610	SO:0001583	missense	1786			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.1567A>G	19.37:g.10265610T>C	ENSP00000345739:p.Thr523Ala	Somatic		Capture	Illumina GAIIx	Phase_I	10126610	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	T	10.12	1.262020	0.23051	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	T;T;T	0.76839	-1.05;-1.05;-1.05	5.61	3.52	0.40303	DNA (cytosine-5)-methyltransferase 1, replication foci domain (1);	0.330844	0.33854	N	0.004495	T	0.68007	0.2954	L	0.38175	1.15	0.31869	N	0.620029	B;B;B	0.19583	0.03;0.03;0.037	B;B;B	0.28305	0.036;0.036;0.088	T	0.66122	-0.6002	10	0.44086	T	0.13	.	8.6762	0.34181	0.0:0.1605:0.0:0.8395	.	523;539;523	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	A	539;523;523;391	ENSP00000352516:T539A;ENSP00000440457:T523A;ENSP00000345739:T523A	ENSP00000345739:T523A	T	-	1	0	DNMT1	10126610	0.997000	0.39634	0.346000	0.25655	0.013000	0.08279	2.686000	0.46968	0.520000	0.28426	0.533000	0.62120	ACC		0.522	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
KEAP1	9817	broad.mit.edu	37	19	10610575	10610575	+	Silent	SNP	G	G	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr19:10610575G>T	ENST00000171111.5	-	2	682	c.135C>A	c.(133-135)tcC>tcA	p.S45S	KEAP1_ENST00000393623.2_Silent_p.S45S|KEAP1_ENST00000588024.1_5'Flank	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	45					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.S45S(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TGCCATGCTGGGAGGGCGTCA	0.637																																																1	Substitution - coding silent(1)	ovary(1)	19											132.0	105.0	114.0					19																	10610575		2203	4300	6503	10471575	SO:0001819	synonymous_variant	9817			AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.135C>A	19.37:g.10610575G>T		Somatic		Capture	Illumina GAIIx	Phase_I	10471575	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Silent	SNP	ENST00000171111.5	37	CCDS12239.1																																																																																				0.637	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
POU2F2	5452	broad.mit.edu	37	19	42599765	42599765	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr19:42599765G>A	ENST00000526816.2	-	10	901	c.886C>T	c.(886-888)Cgg>Tgg	p.R296W	POU2F2_ENST00000389341.5_Missense_Mutation_p.R280W|POU2F2_ENST00000560398.1_Missense_Mutation_p.R302W|POU2F2_ENST00000533720.1_Missense_Mutation_p.R280W|POU2F2_ENST00000560558.1_Missense_Mutation_p.R241W|POU2F2_ENST00000529952.1_Missense_Mutation_p.R296W|POU2F2_ENST00000342301.4_Missense_Mutation_p.R296W|POU2F2_ENST00000529067.1_Missense_Mutation_p.R280W			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	296					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R280W(1)		kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	TTGCGTCTCCGGCCGGGCAGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	19											27.0	29.0	29.0					19																	42599765		2203	4300	6503	47291605	SO:0001583	missense	5452				CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.886C>T	19.37:g.42599765G>A	ENSP00000431603:p.Arg296Trp	Somatic		Capture	Illumina GAIIx	Phase_I	47291605	Q16648|Q7M4M8|Q9BRS4	Missense_Mutation	SNP	ENST00000526816.2	37	CCDS56095.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.613172	0.87359	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952	D;D;D;D;D	0.96073	-3.9;-3.9;-3.9;-3.9;-3.9	4.09	3.03	0.35002	Homeodomain-related (1);Homeobox (1);POU (1);Homeodomain-like (1);	0.069562	0.56097	D	0.000031	D	0.98388	0.9464	H	0.97540	4.025	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.95;0.994	D	0.98725	1.0710	10	0.87932	D	0	.	12.3579	0.55186	0.0:0.0:0.8294:0.1706	.	280;296;280	P09086-4;P09086;P09086-3	.;PO2F2_HUMAN;.	W	280;296;296;280;295;280;296	ENSP00000373992:R280W;ENSP00000339369:R296W;ENSP00000437221:R280W;ENSP00000437224:R280W;ENSP00000436988:R296W	ENSP00000292077:R296W	R	-	1	2	POU2F2	47291605	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.744000	0.85034	1.050000	0.40346	0.655000	0.94253	CGG		0.642	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
ZNF135	7694	broad.mit.edu	37	19	58579392	58579392	+	Nonsense_Mutation	SNP	C	C	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr19:58579392C>T	ENST00000313434.5	+	5	1641	c.1540C>T	c.(1540-1542)Cga>Tga	p.R514*	RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000439855.2_Nonsense_Mutation_p.R514*|ZNF135_ENST00000359978.6_Intron|ZNF135_ENST00000506786.1_Nonsense_Mutation_p.R472*|ZNF135_ENST00000401053.4_Nonsense_Mutation_p.R538*|ZNF135_ENST00000511556.1_Nonsense_Mutation_p.R526*	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	514					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R514*(1)		breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CAAACATCAGCGAATCCACAC	0.557																																																1	Substitution - Nonsense(1)	ovary(1)	19											82.0	76.0	78.0					19																	58579392		2203	4300	6503	63271204	SO:0001587	stop_gained	7694			U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.1540C>T	19.37:g.58579392C>T	ENSP00000321406:p.Arg514*	Somatic		Capture	Illumina GAIIx	Phase_I	63271204	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Nonsense_Mutation	SNP	ENST00000313434.5	37		.	.	.	.	.	.	.	.	.	.	C	14.23	2.473751	0.43942	.	.	ENSG00000176293	ENST00000401053;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786	.	.	.	3.26	0.772	0.18510	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.0123	0.36148	0.6198:0.3802:0.0:0.0	.	.	.	.	X	538;514;514;526;472	.	ENSP00000321406:R514X	R	+	1	2	ZNF135	63271204	0.000000	0.05858	0.469000	0.27204	0.004000	0.04260	-0.510000	0.06328	0.691000	0.31592	-0.321000	0.08615	CGA		0.557	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
CLHC1	130162	broad.mit.edu	37	2	55439841	55439841	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr2:55439841G>C	ENST00000401408.1	-	5	812	c.467C>G	c.(466-468)aCt>aGt	p.T156S	CLHC1_ENST00000407122.1_Missense_Mutation_p.T156S|CLHC1_ENST00000406076.1_Missense_Mutation_p.T34S|CLHC1_ENST00000494539.1_Intron|AC012358.7_ENST00000366153.2_RNA|CLHC1_ENST00000406437.2_Intron	NM_152385.2	NP_689598.2	Q8NHS4	CLHC1_HUMAN	clathrin heavy chain linker domain containing 1	156								p.T156S(2)									TTTGGAGAAAGTACAATATTT	0.323																																																2	Substitution - Missense(2)	ovary(2)	2											129.0	123.0	125.0					2																	55439841		2201	4300	6501	55293345	SO:0001583	missense	130162				CCDS33201.1, CCDS46287.1	2p16.1	2012-08-03	2012-08-03	2012-08-03	ENSG00000162994	ENSG00000162994			26453	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 63"""	C2orf63			Standard	NM_152385		Approved	FLJ31438	uc002ryi.2	Q8NHS4	OTTHUMG00000151918	ENST00000401408.1:c.467C>G	2.37:g.55439841G>C	ENSP00000384869:p.Thr156Ser	Somatic		Capture	Illumina GAIIx	Phase_I	55293345	B2RDV1|Q53R93|Q8N403	Missense_Mutation	SNP	ENST00000401408.1	37	CCDS33201.1	.	.	.	.	.	.	.	.	.	.	G	0.019	-1.458218	0.01071	.	.	ENSG00000162994	ENST00000407122;ENST00000401408;ENST00000406076	T;T;T	0.16324	2.35;2.35;2.36	4.85	1.84	0.25277	.	0.702749	0.13455	N	0.386570	T	0.13157	0.0319	L	0.60455	1.87	0.09310	N	1	B	0.30406	0.278	B	0.24974	0.057	T	0.25293	-1.0136	10	0.21014	T	0.42	-2.472	3.9143	0.09216	0.2023:0.0:0.6097:0.188	.	156	Q8NHS4	CB063_HUMAN	S	156;156;34	ENSP00000385778:T156S;ENSP00000384869:T156S;ENSP00000385512:T34S	ENSP00000384869:T156S	T	-	2	0	C2orf63	55293345	0.007000	0.16637	0.030000	0.17652	0.283000	0.27025	0.814000	0.27239	0.571000	0.29365	0.555000	0.69702	ACT		0.323	CLHC1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324412.4	NM_152385	
MAP3K19	80122	broad.mit.edu	37	2	135745384	135745384	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr2:135745384C>A	ENST00000375845.3	-	7	1088	c.1058G>T	c.(1057-1059)gGt>gTt	p.G353V	MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392915.1_Missense_Mutation_p.G370V|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000358371.4_Missense_Mutation_p.G240V|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	353							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G353V(1)									CGTTTTACTACCATGGCAGTC	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											62.0	59.0	60.0					2																	135745384		2203	4300	6503	135461854	SO:0001583	missense	80122			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.1058G>T	2.37:g.135745384C>A	ENSP00000365005:p.Gly353Val	Somatic		Capture	Illumina GAIIx	Phase_I	135461854	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	C	2.570	-0.299862	0.05532	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915	T;T;T	0.69806	-0.43;-0.43;1.93	4.67	-0.781	0.10965	.	0.000000	0.40908	D	0.000989	T	0.42720	0.1215	L	0.34521	1.04	0.09310	N	0.999998	B;B;B	0.24368	0.091;0.102;0.055	B;B;B	0.23852	0.018;0.049;0.008	T	0.27468	-1.0073	10	0.06625	T	0.88	.	4.9059	0.13799	0.1474:0.4295:0.0:0.4231	.	240;370;353	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	V	353;240;370	ENSP00000365005:G353V;ENSP00000351140:G240V;ENSP00000376647:G370V	ENSP00000351140:G240V	G	-	2	0	YSK4	135461854	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-0.356000	0.07661	-0.049000	0.13379	0.637000	0.83480	GGT		0.378	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
PPP1R7	5510	broad.mit.edu	37	2	242099843	242099843	+	Silent	SNP	T	T	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr2:242099843T>C	ENST00000234038.6	+	6	1005	c.531T>C	c.(529-531)agT>agC	p.S177S	PPP1R7_ENST00000401987.1_Silent_p.S134S|PPP1R7_ENST00000407025.1_Silent_p.S177S|PPP1R7_ENST00000402734.1_Silent_p.S118S|PPP1R7_ENST00000404405.3_Silent_p.S171S|PPP1R7_ENST00000406106.3_Silent_p.S177S|PPP1R7_ENST00000272983.8_Silent_p.S134S|PPP1R7_ENST00000485630.1_3'UTR	NM_001282412.1|NM_001282413.1|NM_002712.1	NP_001269341.1|NP_001269342.1|NP_002703.1	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7	177					positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	enzyme regulator activity (GO:0030234)|protein phosphatase type 1 regulator activity (GO:0008599)	p.S177S(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)	23		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		ATAAAATCAGTAAAATTGAGA	0.403																																					NSCLC(62;446 1299 5417 11238 27640)											1	Substitution - coding silent(1)	ovary(1)	2											67.0	66.0	66.0					2																	242099843		2203	4300	6503	241748516	SO:0001819	synonymous_variant	5510			AF067136	CCDS2546.1, CCDS63190.1, CCDS63192.1, CCDS63193.1, CCDS63194.1	2q37.3	2012-04-17	2011-10-04		ENSG00000115685	ENSG00000115685		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9295	protein-coding gene	gene with protein product		602877	"""protein phosphatase 1, regulatory (inhibitor) subunit 7"""			7498485, 7670491, 10231361	Standard	NM_001282413		Approved	sds22	uc002wat.1	Q15435	OTTHUMG00000133390	ENST00000234038.6:c.531T>C	2.37:g.242099843T>C		Somatic		Capture	Illumina GAIIx	Phase_I	241748516	B4DFD4|B5MCY6|Q9UQE5|Q9UQE6|Q9Y6K4	Silent	SNP	ENST00000234038.6	37	CCDS2546.1	.	.	.	.	.	.	.	.	.	.	T	9.220	1.033038	0.19590	.	.	ENSG00000115685	ENST00000450367	.	.	.	5.52	-1.14	0.09741	.	.	.	.	.	T	0.57844	0.2081	.	.	.	0.52501	D	0.999954	.	.	.	.	.	.	T	0.54430	-0.8295	4	.	.	.	-5.0568	11.1087	0.48218	0.0:0.6984:0.0:0.3016	.	.	.	.	A	152	.	.	V	+	2	0	PPP1R7	241748516	0.240000	0.23847	0.427000	0.26684	0.822000	0.46500	0.722000	0.25925	-0.148000	0.11234	-1.151000	0.01829	GTA		0.403	PPP1R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257244.4	NM_002712	
TAF4	6874	broad.mit.edu	37	20	60551331	60551331	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr20:60551331T>C	ENST00000252996.4	-	15	3150	c.3151A>G	c.(3151-3153)Acg>Gcg	p.T1051A		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	1051					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.T1051A(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CTTTGTCGCGTGAACTGTCTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	20											102.0	111.0	108.0					20																	60551331		2203	4300	6503	59984726	SO:0001583	missense	6874			Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.3151A>G	20.37:g.60551331T>C	ENSP00000252996:p.Thr1051Ala	Somatic		Capture	Illumina GAIIx	Phase_I	59984726	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Missense_Mutation	SNP	ENST00000252996.4	37	CCDS33500.1	.	.	.	.	.	.	.	.	.	.	T	8.590	0.884422	0.17467	.	.	ENSG00000130699	ENST00000252996;ENST00000436129	T;T	0.24350	1.86;1.86	5.35	3.08	0.35506	Transcription initiation factor TFIID component TAF4 (1);	0.150930	0.64402	N	0.000020	T	0.15003	0.0362	N	0.21448	0.665	0.49582	D	0.999802	B	0.33171	0.4	B	0.34873	0.191	T	0.07046	-1.0793	10	0.10636	T	0.68	-7.1837	9.4903	0.38955	0.0:0.145:0.0:0.855	.	1051	O00268	TAF4_HUMAN	A	1051;915	ENSP00000252996:T1051A;ENSP00000399091:T915A	ENSP00000252996:T1051A	T	-	1	0	TAF4	59984726	1.000000	0.71417	0.983000	0.44433	0.121000	0.20230	3.625000	0.54238	0.343000	0.23821	-0.290000	0.09829	ACG		0.537	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185	
ZNF512B	57473	broad.mit.edu	37	20	62632582	62632582	+	Intron	SNP	T	T	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr20:62632582T>A	ENST00000450537.1	-	2	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Silent_p.V392V			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V392V(1)		NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					AGAAGCGGGTTCTTCGGAAAG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	20											91.0	78.0	82.0					20																	62632582		2203	4300	6503	62103026	SO:0001627	intron_variant	24148			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-33274A>T	20.37:g.62632582T>A		Somatic		Capture	Illumina GAIIx	Phase_I	62103026	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	CCDS13548.1																																																																																				0.582	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
C21orf91	54149	broad.mit.edu	37	21	19169163	19169163	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr21:19169163G>C	ENST00000400558.3	-	3	490	c.400C>G	c.(400-402)Cag>Gag	p.Q134E	C21orf91_ENST00000493464.1_5'UTR|AL109761.5_ENST00000428689.1_RNA|C21orf91_ENST00000284881.4_Missense_Mutation_p.Q134E|C21orf91_ENST00000400559.3_Missense_Mutation_p.Q134E	NM_001100421.1	NP_001093891.1			chromosome 21 open reading frame 91									p.Q134E(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9				Epithelial(23;8.76e-05)|all cancers(11;0.000422)|OV - Ovarian serous cystadenocarcinoma(11;0.0107)|Lung(58;0.0129)|COAD - Colon adenocarcinoma(22;0.0303)|LUSC - Lung squamous cell carcinoma(23;0.0381)|Colorectal(24;0.0929)		GAGTCAAACTGTGGGAGTAAT	0.388																																																1	Substitution - Missense(1)	ovary(1)	21											134.0	120.0	125.0					21																	19169163		1820	4092	5912	18091034	SO:0001583	missense	54149			AF239726	CCDS42907.1, CCDS42908.1, CCDS42909.1	21q21.1	2011-12-12	2003-07-22		ENSG00000154642	ENSG00000154642			16459	protein-coding gene	gene with protein product	"""cold sore susceptibility gene 1"", ""early undifferentiated retina and lens"""		"""chromosome 21 open reading frame 38"""	C21orf38, C21orf14		22039568	Standard	NM_001100421		Approved	YG81, EURL, CSSG1	uc002yko.4	Q9NYK6	OTTHUMG00000074509	ENST00000400558.3:c.400C>G	21.37:g.19169163G>C	ENSP00000383403:p.Gln134Glu	Somatic		Capture	Illumina GAIIx	Phase_I	18091034		Missense_Mutation	SNP	ENST00000400558.3	37	CCDS42909.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020896	0.75275	.	.	ENSG00000154642	ENST00000284881;ENST00000400559;ENST00000400558;ENST00000405964	T;T;T;T	0.15952	2.38;2.38;2.38;2.38	6.16	6.16	0.99307	.	0.050059	0.85682	D	0.000000	T	0.24624	0.0597	M	0.66939	2.045	0.80722	D	1	B;P	0.39044	0.417;0.656	B;B	0.37550	0.085;0.253	T	0.00797	-1.1562	9	.	.	.	-12.5603	19.848	0.96722	0.0:0.0:1.0:0.0	.	134;134	Q9NYK6-3;Q9NYK6	.;EURL_HUMAN	E	134	ENSP00000284881:Q134E;ENSP00000383404:Q134E;ENSP00000383403:Q134E;ENSP00000385566:Q134E	.	Q	-	1	0	C21orf91	18091034	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	8.321000	0.89997	2.937000	0.99478	0.650000	0.86243	CAG		0.388	C21orf91-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000158214.1	NM_017447	
UBASH3A	53347	broad.mit.edu	37	21	43863427	43863427	+	Missense_Mutation	SNP	C	C	T	rs143166994	byFrequency	TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr21:43863427C>T	ENST00000319294.6	+	13	1668	c.1637C>T	c.(1636-1638)gCg>gTg	p.A546V	UBASH3A_ENST00000398367.1_Intron|UBASH3A_ENST00000291535.6_Missense_Mutation_p.A508V	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	546	Phosphatase-like.				negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.A546V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						TCCAGGCCCGCGTTTCCCCTG	0.597																																																1	Substitution - Missense(1)	ovary(1)	21						C	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	62.0	47.0	52.0		1523,1637	1.7	0.2	21	dbSNP_134	52	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense	UBASH3A	NM_001001895.2,NM_018961.3	64,64	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	benign,benign	508/624,546/662	43863427	5,13001	2203	4300	6503	42736496	SO:0001583	missense	53347			AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.1637C>T	21.37:g.43863427C>T	ENSP00000317327:p.Ala546Val	Somatic		Capture	Illumina GAIIx	Phase_I	42736496	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Missense_Mutation	SNP	ENST00000319294.6	37	CCDS13687.1	.	.	.	.	.	.	.	.	.	.	C	0.056	-1.237301	0.01493	2.27E-4	4.65E-4	ENSG00000160185	ENST00000291535;ENST00000319294	T;T	0.72615	-0.67;-0.67	3.54	1.73	0.24493	Histidine phosphatase superfamily, clade-1 (1);	0.625714	0.15600	N	0.253949	T	0.43122	0.1233	N	0.10707	0.03	0.20074	N	0.999932	B;B	0.20459	0.021;0.045	B;B	0.10450	0.002;0.005	T	0.21143	-1.0254	10	0.15952	T	0.53	-16.3997	5.9067	0.19004	0.0:0.7601:0.0:0.2399	.	508;546	P57075-2;P57075	.;UBS3A_HUMAN	V	508;546	ENSP00000291535:A508V;ENSP00000317327:A546V	ENSP00000291535:A508V	A	+	2	0	UBASH3A	42736496	0.156000	0.22821	0.185000	0.23176	0.003000	0.03518	0.812000	0.27211	0.506000	0.28125	0.650000	0.86243	GCG		0.597	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195382.1	NM_001001895	
EDEM1	9695	broad.mit.edu	37	3	5249779	5249779	+	Splice_Site	SNP	T	T	G			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr3:5249779T>G	ENST00000256497.4	+	8	1473	c.1340T>G	c.(1339-1341)gTg>gGg	p.V447G	EDEM1_ENST00000445686.1_Splice_Site_p.V252G	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	447					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)	p.V447G(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		TCTCCTTAGGTGCTGATAGGA	0.527																																																1	Substitution - Missense(1)	ovary(1)	3											220.0	184.0	196.0					3																	5249779		2203	4300	6503	5224779	SO:0001630	splice_region_variant	9695			D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.1339-1T>G	3.37:g.5249779T>G		Somatic		Capture	Illumina GAIIx	Phase_I	5224779	A8K9C8|B4DXP3	Missense_Mutation	SNP	ENST00000256497.4	37	CCDS33686.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370386	0.82573	.	.	ENSG00000134109	ENST00000256497;ENST00000445686	T;T	0.72505	-0.66;-0.66	5.11	5.11	0.69529	.	0.054502	0.64402	D	0.000001	T	0.80486	0.4632	L	0.55743	1.74	0.80722	D	1	D;D	0.67145	0.973;0.996	P;D	0.70227	0.898;0.968	T	0.82378	-0.0487	10	0.66056	D	0.02	-22.6385	15.2074	0.73190	0.0:0.0:0.0:1.0	.	252;447	B4DXP3;Q92611	.;EDEM1_HUMAN	G	447;252	ENSP00000256497:V447G;ENSP00000394099:V252G	ENSP00000256497:V447G	V	+	2	0	EDEM1	5224779	1.000000	0.71417	0.990000	0.47175	0.955000	0.61496	7.619000	0.83057	2.035000	0.60131	0.533000	0.62120	GTG		0.527	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337566.2	NM_014674	Missense_Mutation
MYRIP	25924	broad.mit.edu	37	3	40085601	40085601	+	Missense_Mutation	SNP	G	G	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr3:40085601G>T	ENST00000302541.6	+	3	513	c.171G>T	c.(169-171)caG>caT	p.Q57H	MYRIP_ENST00000396217.3_Missense_Mutation_p.S14I|MYRIP_ENST00000444716.1_Missense_Mutation_p.Q57H|MYRIP_ENST00000425621.1_Missense_Mutation_p.Q57H	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	57	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)	p.Q57H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CGAAGCACCAGCAGTTTGTGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	3											94.0	74.0	81.0					3																	40085601		2203	4300	6503	40060605	SO:0001583	missense	25924			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.171G>T	3.37:g.40085601G>T	ENSP00000301972:p.Gln57His	Somatic		Capture	Illumina GAIIx	Phase_I	40060605	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	ENST00000302541.6	37	CCDS2689.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.65|14.65	2.598715|2.598715	0.46318|0.46318	.|.	.|.	ENSG00000170011|ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621|ENST00000396217	T;T;T|T	0.76448|0.23552	-1.02;-1.02;-1.02|1.9	5.65|5.65	4.77|4.77	0.60923|0.60923	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);|.	0.359478|.	0.29159|.	N|.	0.012979|.	T|T	0.17916|0.17916	0.0430|0.0430	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	P;P;P|B	0.44309|0.31730	0.626;0.742;0.832|0.337	B;P;B|B	0.49276|0.28011	0.401;0.605;0.429|0.085	T|T	0.04593|0.04593	-1.0940|-1.0940	9|8	.|.	.|.	.|.	.|.	12.7419|12.7419	0.57257|0.57257	0.0816:0.0:0.9184:0.0|0.0816:0.0:0.9184:0.0	.|.	57;57;57|14	B3KWW4;G3XAI8;Q8NFW9|Q32M42	.;.;MYRIP_HUMAN|.	H|I	57|14	ENSP00000398665:Q57H;ENSP00000301972:Q57H;ENSP00000389323:Q57H|ENSP00000379519:S14I	.|.	Q|S	+|+	3|2	2|0	MYRIP|MYRIP	40060605|40060605	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.364000|2.364000	0.44187|0.44187	2.669000|2.669000	0.90835|0.90835	0.563000|0.563000	0.77884|0.77884	CAG|AGC		0.542	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460	
DNAH12	201625	broad.mit.edu	37	3	57509542	57509542	+	Silent	SNP	A	A	G			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr3:57509542A>G	ENST00000351747.2	-	3	420	c.240T>C	c.(238-240)gaT>gaC	p.D80D	DNAH12_ENST00000389536.4_Silent_p.D80D|DNAH12_ENST00000311202.6_Silent_p.D80D	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	80	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.D80D(1)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TTTGAGGATAATCAGGTGGTG	0.289																																																1	Substitution - coding silent(1)	ovary(1)	3											105.0	106.0	105.0					3																	57509542		2203	4290	6493	57484582	SO:0001819	synonymous_variant	201625			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.240T>C	3.37:g.57509542A>G		Somatic		Capture	Illumina GAIIx	Phase_I	57484582	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	ENST00000351747.2	37																																																																																					0.289	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
LRIG1	26018	broad.mit.edu	37	3	66431105	66431105	+	Missense_Mutation	SNP	G	G	T	rs139738729		TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr3:66431105G>T	ENST00000273261.3	-	18	3475	c.2951C>A	c.(2950-2952)gCc>gAc	p.A984D	LRIG1_ENST00000383703.3_Missense_Mutation_p.A961D|SLC25A26_ENST00000536651.1_3'UTR|LRIG1_ENST00000496559.2_5'UTR	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	984					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)		p.A984D(1)		NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GGACCCAGCGGCAGTCCTGCT	0.597																																																1	Substitution - Missense(1)	ovary(1)	3											96.0	101.0	99.0					3																	66431105		2203	4300	6503	66513795	SO:0001583	missense	26018			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.2951C>A	3.37:g.66431105G>T	ENSP00000273261:p.Ala984Asp	Somatic		Capture	Illumina GAIIx	Phase_I	66513795	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.626045	0.28978	.	.	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.64438	-0.1;-0.07	5.64	-8.88	0.00789	.	2.258740	0.01906	N	0.039501	T	0.45736	0.1357	L	0.29908	0.895	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.09377	0.004;0.002;0.001	T	0.22800	-1.0206	10	0.29301	T	0.29	.	10.4063	0.44258	0.26:0.1913:0.5486:0.0	.	961;984;984	Q96JA1-2;Q5XWD3;Q96JA1	.;.;LRIG1_HUMAN	D	984;961;887	ENSP00000273261:A984D;ENSP00000373208:A961D	ENSP00000273261:A984D	A	-	2	0	LRIG1	66513795	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.970000	0.03810	-1.479000	0.01867	-1.246000	0.01523	GCC		0.597	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LMOD3	56203	broad.mit.edu	37	3	69158249	69158249	+	Silent	SNP	C	C	T	rs377046368		TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr3:69158249C>T	ENST00000420581.2	-	3	1859	c.1680G>A	c.(1678-1680)gcG>gcA	p.A560A	LMOD3_ENST00000489031.1_Silent_p.A560A|LMOD3_ENST00000475434.1_Silent_p.A560A	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	560			A -> V (in dbSNP:rs17005363).			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.A560A(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		TTGCCTCTTACGCCAGTTCTT	0.408																																																1	Substitution - coding silent(1)	ovary(1)	3						C		0,3802		0,0,1901	139.0	119.0	125.0		1680	-5.9	0.0	3		125	1,8233		0,1,4116	no	coding-synonymous	LMOD3	NM_198271.3		0,1,6017	TT,TC,CC		0.0121,0.0,0.0083		560/561	69158249	1,12035	1901	4117	6018	69240939	SO:0001819	synonymous_variant	56203			AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.1680G>A	3.37:g.69158249C>T		Somatic		Capture	Illumina GAIIx	Phase_I	69240939	B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Silent	SNP	ENST00000420581.2	37	CCDS46862.1																																																																																				0.408	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352138.1	XM_067529	
NXPE3	91775	broad.mit.edu	37	3	101540352	101540352	+	Missense_Mutation	SNP	A	A	G			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr3:101540352A>G	ENST00000491511.2	+	8	2190	c.1234A>G	c.(1234-1236)Atc>Gtc	p.I412V	NXPE3_ENST00000477909.1_Missense_Mutation_p.I412V|RP11-49I4.3_ENST00000490324.2_RNA|NXPE3_ENST00000422132.1_Missense_Mutation_p.I412V|NXPE3_ENST00000273347.5_Missense_Mutation_p.I412V	NM_001134456.1	NP_001127928.1	Q969Y0	NXPE3_HUMAN	neurexophilin and PC-esterase domain family, member 3	412						extracellular region (GO:0005576)		p.I412V(1)									TGGTCCACCCATCCGCTTCAC	0.507																																																1	Substitution - Missense(1)	ovary(1)	3											133.0	101.0	112.0					3																	101540352		2203	4300	6503	103023042	SO:0001583	missense	91775			AK054664	CCDS2945.1	3q12.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000144815	ENSG00000144815			28238	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member C"""	FAM55C		12975309	Standard	NM_001134456		Approved	MGC15606	uc003dvn.3	Q969Y0	OTTHUMG00000159179	ENST00000491511.2:c.1234A>G	3.37:g.101540352A>G	ENSP00000417485:p.Ile412Val	Somatic		Capture	Illumina GAIIx	Phase_I	103023042	A8K0X4|D3DN53|Q7Z2S8	Missense_Mutation	SNP	ENST00000491511.2	37	CCDS2945.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.457508	0.84317	.	.	ENSG00000144815	ENST00000273347;ENST00000491511;ENST00000477909;ENST00000422132	T;T;T;T	0.16897	2.31;2.31;2.31;2.31	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.25457	0.0619	L	0.41492	1.28	0.80722	D	1	D	0.63046	0.992	P	0.53549	0.729	T	0.00981	-1.1492	10	0.27082	T	0.32	-18.0929	16.1968	0.82036	1.0:0.0:0.0:0.0	.	412	Q969Y0	FA55C_HUMAN	V	412	ENSP00000273347:I412V;ENSP00000417485:I412V;ENSP00000418369:I412V;ENSP00000396421:I412V	ENSP00000273347:I412V	I	+	1	0	FAM55C	103023042	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.232000	0.95325	2.225000	0.72522	0.533000	0.62120	ATC		0.507	NXPE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353711.2	NM_145037	
PIK3CA	5290	broad.mit.edu	37	3	178917653	178917653	+	Silent	SNP	A	A	G			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr3:178917653A>G	ENST00000263967.3	+	3	685	c.528A>G	c.(526-528)gaA>gaG	p.E176E		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	176					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E176E(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CTTCACCAGAATTGCCAAAGC	0.343		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1	Substitution - coding silent(1)	ovary(1)	3											97.0	96.0	97.0					3																	178917653		1823	4072	5895	180400347	SO:0001819	synonymous_variant	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.528A>G	3.37:g.178917653A>G		Somatic		Capture	Illumina GAIIx	Phase_I	180400347	Q14CW1|Q99762	Silent	SNP	ENST00000263967.3	37	CCDS43171.1																																																																																				0.343	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
SULT1E1	6783	broad.mit.edu	37	4	70713415	70713415	+	Splice_Site	SNP	C	C	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr4:70713415C>T	ENST00000226444.3	-	6	704		c.e6+1			NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)	p.?(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	CAGTTCCTCACCTCTTTCAGG	0.348																																																1	Unknown(1)	ovary(1)	4											81.0	82.0	81.0					4																	70713415		2203	4299	6502	70748004	SO:0001630	splice_region_variant	6783			BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.591+1G>A	4.37:g.70713415C>T		Somatic		Capture	Illumina GAIIx	Phase_I	70748004	Q8N6X5	Splice_Site	SNP	ENST00000226444.3	37	CCDS3531.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.667705	0.29604	.	.	ENSG00000109193	ENST00000226444	.	.	.	4.21	4.21	0.49690	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8747	0.70485	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SULT1E1	70748004	1.000000	0.71417	0.993000	0.49108	0.359000	0.29487	4.164000	0.58190	2.631000	0.89168	0.650000	0.86243	.		0.348	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251559.1	NM_005420	Intron
PCDHA9	9752	broad.mit.edu	37	5	140389306	140389306	+	Silent	SNP	C	C	T	rs199624636		TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr5:140389306C>T	ENST00000532602.1	+	4	3670	c.2637C>T	c.(2635-2637)tcC>tcT	p.S879S	PCDHA8_ENST00000531613.1_Silent_p.S879S|PCDHA12_ENST00000398631.2_Silent_p.S870S|PCDHA7_ENST00000525929.1_Silent_p.S866S|PCDHA6_ENST00000529310.1_Silent_p.S879S|PCDHA2_ENST00000526136.1_Silent_p.S877S|PCDHA3_ENST00000522353.2_Silent_p.S879S|PCDHA5_ENST00000529619.1_Silent_p.S865S|PCDHA4_ENST00000512229.2_Silent_p.S876S|PCDHA1_ENST00000394633.3_Silent_p.S615S|PCDHAC1_ENST00000253807.2_Silent_p.S892S|PCDHA10_ENST00000307360.5_Silent_p.S877S|PCDHA11_ENST00000398640.2_Silent_p.S878S|PCDHAC2_ENST00000289269.5_Silent_p.S936S|PCDHA5_ENST00000529859.1_Silent_p.S865S|PCDHA13_ENST00000289272.2_Silent_p.S879S|PCDHA4_ENST00000530339.1_Silent_p.S876S|PCDHA13_ENST00000409494.1_Silent_p.S879S|PCDHA6_ENST00000527624.1_Silent_p.S615S|PCDHA10_ENST00000506939.2_Silent_p.S614S|PCDHA1_ENST00000504120.2_Silent_p.S879S	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	879	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S892S(1)|p.S879S(1)|p.S614S(1)|p.S936S(1)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAAACAATCCGGTCCCGGTG	0.522																																					Melanoma(55;1800 1972 14909)											4	Substitution - coding silent(4)	ovary(4)	5											66.0	70.0	68.0					5																	140389306		2203	4300	6503	140369490	SO:0001819	synonymous_variant	56147			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2637C>T	5.37:g.140389306C>T		Somatic		Capture	Illumina GAIIx	Phase_I	140369490	O15053|Q2M3S5	Silent	SNP	ENST00000532602.1	37	CCDS54920.1																																																																																				0.522	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
CLINT1	9685	broad.mit.edu	37	5	157233043	157233043	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr5:157233043G>A	ENST00000411809.2	-	7	977	c.773C>T	c.(772-774)aCg>aTg	p.T258M	CLINT1_ENST00000523094.1_Missense_Mutation_p.T240M|CLINT1_ENST00000523908.1_Missense_Mutation_p.T258M|CLINT1_ENST00000530742.1_Missense_Mutation_p.T240M|CLINT1_ENST00000296951.5_Missense_Mutation_p.T240M	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	258					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)	p.T240M(1)		breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATGCTTTGTCGTCACAGTCTC	0.448																																					Colon(22;427 587 2170 6147 14291)											1	Substitution - Missense(1)	ovary(1)	5											229.0	224.0	226.0					5																	157233043		2100	4220	6320	157165621	SO:0001583	missense	9685			AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.773C>T	5.37:g.157233043G>A	ENSP00000388340:p.Thr258Met	Somatic		Capture	Illumina GAIIx	Phase_I	157165621	B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Missense_Mutation	SNP	ENST00000411809.2	37	CCDS47330.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.758259	0.89843	.	.	ENSG00000113282	ENST00000523094;ENST00000530742;ENST00000411809;ENST00000296951;ENST00000523908	T;T;T;T;T	0.51325	0.72;0.72;0.72;0.72;0.71	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.67785	0.2930	M	0.64404	1.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.989	T	0.65656	-0.6115	10	0.45353	T	0.12	-4.9873	19.6668	0.95895	0.0:0.0:1.0:0.0	.	258;258	B7Z6F8;Q14677	.;EPN4_HUMAN	M	240;240;258;240;258	ENSP00000429345:T240M;ENSP00000433419:T240M;ENSP00000388340:T258M;ENSP00000296951:T240M;ENSP00000429824:T258M	ENSP00000296951:T240M	T	-	2	0	CLINT1	157165621	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.824000	0.99380	2.652000	0.90054	0.552000	0.68991	ACG		0.448	CLINT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374001.1	NM_014666	
EXOC2	55770	broad.mit.edu	37	6	572577	572577	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr6:572577C>A	ENST00000230449.4	-	13	1521	c.1386G>T	c.(1384-1386)caG>caT	p.Q462H	EXOC2_ENST00000448181.3_Missense_Mutation_p.Q57H	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	462					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.Q462H(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		AGTTAGGCAGCTGGCTCAAGA	0.468																																																1	Substitution - Missense(1)	ovary(1)	6											105.0	97.0	99.0					6																	572577		2203	4300	6503	517577	SO:0001583	missense	55770			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.1386G>T	6.37:g.572577C>A	ENSP00000230449:p.Gln462His	Somatic		Capture	Illumina GAIIx	Phase_I	517577	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	ENST00000230449.4	37	CCDS34327.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.516971	0.64634	.	.	ENSG00000112685	ENST00000230449;ENST00000448181	T	0.41758	0.99	4.85	3.03	0.35002	.	0.000000	0.85682	D	0.000000	T	0.17280	0.0415	L	0.58810	1.83	0.80722	D	1	B	0.30973	0.302	B	0.23275	0.045	T	0.05402	-1.0887	10	0.12430	T	0.62	-10.612	11.8535	0.52425	0.0:0.8508:0.0:0.1492	.	462	Q96KP1	EXOC2_HUMAN	H	462;57	ENSP00000230449:Q462H	ENSP00000230449:Q462H	Q	-	3	2	EXOC2	517577	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.943000	0.40253	1.159000	0.42565	0.563000	0.77884	CAG		0.468	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039627.1	NM_018303	
TFAP2D	83741	broad.mit.edu	37	6	50697018	50697018	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr6:50697018G>C	ENST00000008391.3	+	5	1104	c.876G>C	c.(874-876)ttG>ttC	p.L292F	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.L292F(2)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					TTACTTCCTTGGTTGAAGGTA	0.423																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	6											150.0	134.0	139.0					6																	50697018		2203	4300	6503	50804977	SO:0001583	missense	83741			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.876G>C	6.37:g.50697018G>C	ENSP00000008391:p.Leu292Phe	Somatic		Capture	Illumina GAIIx	Phase_I	50804977		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306203	0.60305	.	.	ENSG00000008197	ENST00000008391	D	0.98192	-4.78	6.08	2.49	0.30216	Transcription factor AP-2, C-terminal (2);	0.000000	0.64402	D	0.000001	D	0.98479	0.9493	M	0.90595	3.13	0.80722	D	1	D	0.64830	0.994	D	0.66847	0.947	D	0.98298	1.0517	10	0.87932	D	0	-23.4602	8.5385	0.33377	0.5468:0.0:0.4532:0.0	.	292	Q7Z6R9	AP2D_HUMAN	F	292	ENSP00000008391:L292F	ENSP00000008391:L292F	L	+	3	2	TFAP2D	50804977	1.000000	0.71417	0.991000	0.47740	0.824000	0.46624	1.379000	0.34340	0.201000	0.20466	-0.469000	0.05056	TTG		0.423	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
TINAG	27283	broad.mit.edu	37	6	54214665	54214665	+	Missense_Mutation	SNP	T	T	G			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr6:54214665T>G	ENST00000259782.4	+	7	1147	c.1051T>G	c.(1051-1053)Tgt>Ggt	p.C351G		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	351					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.C351G(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			GATCTATCAATGTTCTCCTCC	0.423																																																1	Substitution - Missense(1)	ovary(1)	6											119.0	113.0	115.0					6																	54214665		2203	4300	6503	54322624	SO:0001583	missense	27283			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.1051T>G	6.37:g.54214665T>G	ENSP00000259782:p.Cys351Gly	Somatic		Capture	Illumina GAIIx	Phase_I	54322624	Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	37	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.983490	0.74474	.	.	ENSG00000137251	ENST00000339741;ENST00000259782;ENST00000370865	D	0.86694	-2.16	5.87	5.87	0.94306	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.75895	0.3912	N	0.03999	-0.3	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77043	-0.2734	10	0.05833	T	0.94	.	14.2294	0.65882	0.0:0.0:0.0:1.0	.	351	Q9UJW2	TINAG_HUMAN	G	210;351;30	ENSP00000259782:C351G	ENSP00000259782:C351G	C	+	1	0	TINAG	54322624	1.000000	0.71417	0.919000	0.36401	0.923000	0.55619	6.594000	0.74104	2.247000	0.74100	0.482000	0.46254	TGT		0.423	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464	
DGKB	1607	broad.mit.edu	37	7	14647109	14647109	+	Silent	SNP	T	T	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr7:14647109T>C	ENST00000403951.2	-	17	1805	c.1386A>G	c.(1384-1386)ctA>ctG	p.L462L	DGKB_ENST00000399322.3_Silent_p.L462L|DGKB_ENST00000444700.2_Silent_p.L443L|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000407950.1_Silent_p.L454L|DGKB_ENST00000406247.3_Silent_p.L462L|DGKB_ENST00000402815.1_Silent_p.L461L|DGKB_ENST00000258767.5_Silent_p.L462L			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	462	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.L462L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						GAGGATTTAATAGATACTGGA	0.289																																																1	Substitution - coding silent(1)	ovary(1)	7											48.0	46.0	47.0					7																	14647109		1783	4048	5831	14613634	SO:0001819	synonymous_variant	1607			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.1386A>G	7.37:g.14647109T>C		Somatic		Capture	Illumina GAIIx	Phase_I	14613634	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Silent	SNP	ENST00000403951.2	37	CCDS47547.1																																																																																				0.289	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
MUC17	140453	broad.mit.edu	37	7	100680242	100680242	+	Missense_Mutation	SNP	C	C	G			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr7:100680242C>G	ENST00000306151.4	+	3	5609	c.5545C>G	c.(5545-5547)Cct>Gct	p.P1849A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1849	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.P1849A(1)|p.P1849S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGTTCATCTCCTACACCTGC	0.507																																																2	Substitution - Missense(2)	ovary(1)|endometrium(1)	7											187.0	195.0	192.0					7																	100680242		2203	4300	6503	100466962	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5545C>G	7.37:g.100680242C>G	ENSP00000302716:p.Pro1849Ala	Somatic		Capture	Illumina GAIIx	Phase_I	100466962	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	c	0.209	-1.038003	0.02013	.	.	ENSG00000169876	ENST00000306151	T	0.03124	4.04	0.824	-0.342	0.12635	.	.	.	.	.	T	0.01661	0.0053	N	0.19112	0.55	0.09310	N	1	B	0.31837	0.342	B	0.22601	0.04	T	0.43491	-0.9388	9	0.07482	T	0.82	.	1.9183	0.03302	0.3058:0.4521:0.0:0.2421	.	1849	Q685J3	MUC17_HUMAN	A	1849	ENSP00000302716:P1849A	ENSP00000302716:P1849A	P	+	1	0	MUC17	100466962	0.000000	0.05858	0.005000	0.12908	0.041000	0.13682	-5.003000	0.00161	-0.081000	0.12662	0.134000	0.15878	CCT		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
SRPK2	6733	broad.mit.edu	37	7	104783613	104783613	+	Missense_Mutation	SNP	C	C	G	rs372166705		TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr7:104783613C>G	ENST00000393651.3	-	10	1065	c.978G>C	c.(976-978)caG>caC	p.Q326H	SRPK2_ENST00000357311.3_Missense_Mutation_p.Q315H|SRPK2_ENST00000489828.1_Missense_Mutation_p.Q315H	NM_182692.1	NP_872634.1			SRSF protein kinase 2									p.Q315H(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						ATTCGCCATCCTGGTCATTGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	7						C	HIS/GLN,HIS/GLN	0,4406		0,0,2203	138.0	125.0	129.0		945,978	-3.1	0.9	7		129	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SRPK2	NM_182691.1,NM_182692.1	24,24	0,1,6502	GG,GC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	315/689,326/700	104783613	1,13005	2203	4300	6503	104570849	SO:0001583	missense	6733			U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.978G>C	7.37:g.104783613C>G	ENSP00000377262:p.Gln326His	Somatic		Capture	Illumina GAIIx	Phase_I	104570849		Missense_Mutation	SNP	ENST00000393651.3	37	CCDS34724.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478522	0.63849	0.0	1.16E-4	ENSG00000135250	ENST00000393651;ENST00000357311;ENST00000489828	T;T;T	0.22134	1.97;1.97;1.97	5.68	-3.08	0.05347	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.376195	0.27966	N	0.017138	T	0.30510	0.0767	L	0.38175	1.15	0.51482	D	0.999921	D;D	0.60575	0.988;0.98	D;D	0.74674	0.984;0.948	T	0.01301	-1.1391	10	0.52906	T	0.07	-19.1206	14.1006	0.65051	0.0:0.5983:0.0:0.4017	.	326;315	P78362-2;P78362	.;SRPK2_HUMAN	H	326;315;315	ENSP00000377262:Q326H;ENSP00000349863:Q315H;ENSP00000419791:Q315H	ENSP00000349863:Q315H	Q	-	3	2	SRPK2	104570849	0.063000	0.20901	0.867000	0.34043	0.857000	0.48899	-0.901000	0.04093	-0.497000	0.06641	0.555000	0.69702	CAG		0.488	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348723.1	NM_182691	
TUSC3	7991	broad.mit.edu	37	8	15588173	15588173	+	Splice_Site	SNP	A	A	G			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr8:15588173A>G	ENST00000503731.1	+	7	946		c.e7-1		TUSC3_ENST00000509380.1_Splice_Site|TUSC3_ENST00000382020.4_Splice_Site|TUSC3_ENST00000506802.1_Splice_Site	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3						cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		CTTCTTTTATAGAGCTACATT	0.353																																																1	Unknown(1)	ovary(1)	8											77.0	75.0	76.0					8																	15588173		2203	4299	6502	15632544	SO:0001630	splice_region_variant	7991			AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.799-1A>G	8.37:g.15588173A>G		Somatic		Capture	Illumina GAIIx	Phase_I	15632544	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Splice_Site	SNP	ENST00000503731.1	37	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	A	16.62	3.174857	0.57692	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0696	0.64852	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TUSC3	15632544	1.000000	0.71417	0.915000	0.36163	0.658000	0.38924	8.025000	0.88777	2.085000	0.62840	0.482000	0.46254	.		0.353	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	Intron
SNTG1	54212	broad.mit.edu	37	8	51363273	51363273	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr8:51363273G>A	ENST00000522124.1	+	8	1008	c.347G>A	c.(346-348)tGt>tAt	p.C116Y	SNTG1_ENST00000517473.1_Missense_Mutation_p.C116Y|SNTG1_ENST00000518864.1_Missense_Mutation_p.C116Y|SNTG1_ENST00000276467.5_Missense_Mutation_p.C116Y	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	116	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.C116Y(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GTGAGAAAATGTAGACATGAA	0.333																																																1	Substitution - Missense(1)	ovary(1)	8											142.0	134.0	137.0					8																	51363273		2203	4299	6502	51525826	SO:0001583	missense	54212			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.347G>A	8.37:g.51363273G>A	ENSP00000429842:p.Cys116Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	51525826	Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.435937	0.43224	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.62	5.62	0.85841	PDZ/DHR/GLGF (4);	0.044653	0.85682	D	0.000000	T	0.17619	0.0423	N	0.11201	0.11	0.58432	D	0.999995	B;B	0.09022	0.002;0.001	B;B	0.16289	0.015;0.005	T	0.04737	-1.0930	10	0.59425	D	0.04	.	17.1564	0.86792	0.0:0.0:1.0:0.0	.	116;116	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	Y	116	ENSP00000429276:C116Y;ENSP00000429842:C116Y;ENSP00000431123:C116Y;ENSP00000276467:C116Y	ENSP00000276467:C116Y	C	+	2	0	SNTG1	51525826	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.465000	0.60141	2.643000	0.89663	0.655000	0.94253	TGT		0.333	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1		
CSMD3	114788	broad.mit.edu	37	8	113418909	113418909	+	Nonsense_Mutation	SNP	T	T	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr8:113418909T>A	ENST00000297405.5	-	35	5897	c.5653A>T	c.(5653-5655)Aga>Tga	p.R1885*	CSMD3_ENST00000343508.3_Nonsense_Mutation_p.R1845*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.R1815*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.R1781*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1885	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R1885*(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTTCCGAATCTTGGTTCAGGC	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Nonsense(1)	ovary(1)	8											101.0	97.0	98.0					8																	113418909		2203	4300	6503	113488085	SO:0001587	stop_gained	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5653A>T	8.37:g.113418909T>A	ENSP00000297405:p.Arg1885*	Somatic		Capture	Illumina GAIIx	Phase_I	113488085	Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	47	13.206879	0.99727	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.64	4.64	0.57946	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	11.2483	0.49010	0.0:0.0:0.1528:0.8472	.	.	.	.	X	1845;1885;1155;1781;1815	.	ENSP00000297405:R1885X	R	-	1	2	CSMD3	113488085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.203000	0.58453	2.081000	0.62600	0.533000	0.62120	AGA		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
COLEC10	10584	broad.mit.edu	37	8	120118245	120118245	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr8:120118245G>C	ENST00000332843.2	+	6	690	c.649G>C	c.(649-651)Gag>Cag	p.E217Q		NM_006438.3	NP_006429.2	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 (C-type lectin)	217	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	mannose binding (GO:0005537)	p.E217Q(1)		endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			CCTTGAAAGGGAGGGACAGTA	0.517																																																1	Substitution - Missense(1)	ovary(1)	8											124.0	109.0	114.0					8																	120118245		2203	4300	6503	120187426	SO:0001583	missense	10584			AB002631	CCDS6327.1	8q23-q24.1	2007-12-19				ENSG00000184374		"""Collectins"""	2220	protein-coding gene	gene with protein product		607620				10224141	Standard	NM_006438		Approved	CL-L1	uc003yoo.3	Q9Y6Z7		ENST00000332843.2:c.649G>C	8.37:g.120118245G>C	ENSP00000332723:p.Glu217Gln	Somatic		Capture	Illumina GAIIx	Phase_I	120187426	Q3SYH6|Q6UW19	Missense_Mutation	SNP	ENST00000332843.2	37	CCDS6327.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369735	0.82573	.	.	ENSG00000184374	ENST00000332843	T	0.20200	2.09	5.21	5.21	0.72293	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.224064	0.41938	D	0.000796	T	0.56514	0.1990	M	0.91510	3.215	0.52501	D	0.999953	D	0.71674	0.998	D	0.69307	0.963	T	0.67393	-0.5682	10	0.87932	D	0	-30.7506	19.1165	0.93343	0.0:0.0:1.0:0.0	.	217	Q9Y6Z7	COL10_HUMAN	Q	217	ENSP00000332723:E217Q	ENSP00000332723:E217Q	E	+	1	0	COLEC10	120187426	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.427000	0.97472	2.590000	0.87494	0.555000	0.69702	GAG		0.517	COLEC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381225.1		
COL14A1	7373	broad.mit.edu	37	8	121243733	121243733	+	Missense_Mutation	SNP	T	T	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr8:121243733T>C	ENST00000297848.3	+	19	2495	c.2225T>C	c.(2224-2226)gTt>gCt	p.V742A	COL14A1_ENST00000309791.4_Missense_Mutation_p.V742A|COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000247781.3_Missense_Mutation_p.V647A	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.V742A(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AGAAACCTAGTTGTAGGTGAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	8											110.0	102.0	105.0					8																	121243733		2203	4300	6503	121312914	SO:0001583	missense	7373				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2225T>C	8.37:g.121243733T>C	ENSP00000297848:p.Val742Ala	Somatic		Capture	Illumina GAIIx	Phase_I	121312914		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	T	12.20	1.866210	0.32977	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.55	4.39	0.52855	Fibronectin, type III (4);	0.432569	0.24431	N	0.038597	T	0.40862	0.1134	L	0.46947	1.48	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.17410	-1.0370	10	0.07990	T	0.79	.	10.5058	0.44832	0.0:0.0774:0.0:0.9226	.	742;742	Q05707-2;Q05707	.;COEA1_HUMAN	A	742;742;647;555	ENSP00000311809:V742A;ENSP00000297848:V742A;ENSP00000247781:V647A;ENSP00000409461:V555A	ENSP00000247781:V647A	V	+	2	0	COL14A1	121312914	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	2.490000	0.45294	0.949000	0.37715	0.459000	0.35465	GTT		0.418	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
ZHX2	22882	broad.mit.edu	37	8	123965552	123965552	+	Missense_Mutation	SNP	G	G	C			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr8:123965552G>C	ENST00000314393.4	+	3	2637	c.1802G>C	c.(1801-1803)gGc>gCc	p.G601A		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	601					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.G601A(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GGCAAAAAAGGCCAAGATGTG	0.567																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)											1	Substitution - Missense(1)	ovary(1)	8											63.0	63.0	63.0					8																	123965552		2203	4300	6503	124034733	SO:0001583	missense	22882			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.1802G>C	8.37:g.123965552G>C	ENSP00000314709:p.Gly601Ala	Somatic		Capture	Illumina GAIIx	Phase_I	124034733		Missense_Mutation	SNP	ENST00000314393.4	37	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.411282	0.01145	.	.	ENSG00000178764	ENST00000314393	T	0.16324	2.35	5.41	2.52	0.30459	Homeodomain-like (1);	0.566874	0.18740	N	0.132473	T	0.07863	0.0197	N	0.24115	0.695	0.09310	N	0.999992	B	0.02656	0.0	B	0.06405	0.002	T	0.34775	-0.9815	10	0.10636	T	0.68	-14.9022	2.0877	0.03650	0.1397:0.1326:0.4224:0.3054	.	601	Q9Y6X8	ZHX2_HUMAN	A	601	ENSP00000314709:G601A	ENSP00000314709:G601A	G	+	2	0	ZHX2	124034733	0.004000	0.15560	0.804000	0.32291	0.173000	0.22820	0.400000	0.20932	0.801000	0.34066	0.561000	0.74099	GGC		0.567	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
PTK2	5747	broad.mit.edu	37	8	141771320	141771320	+	Nonsense_Mutation	SNP	G	G	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr8:141771320G>A	ENST00000522684.1	-	16	1505	c.1276C>T	c.(1276-1278)Cga>Tga	p.R426*	PTK2_ENST00000519465.1_Nonsense_Mutation_p.R54*|PTK2_ENST00000538769.1_Nonsense_Mutation_p.R94*|PTK2_ENST00000519419.1_Nonsense_Mutation_p.R470*|PTK2_ENST00000535192.1_Nonsense_Mutation_p.R426*|PTK2_ENST00000521059.1_Nonsense_Mutation_p.R426*|PTK2_ENST00000395218.2_Nonsense_Mutation_p.R426*|PTK2_ENST00000340930.3_Nonsense_Mutation_p.R426*|PTK2_ENST00000517887.1_Nonsense_Mutation_p.R470*|PTK2_ENST00000520151.1_Nonsense_Mutation_p.R54*	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	426	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)	p.R448*(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CCAATACATCGTCCAAGTTCT	0.323																																																1	Substitution - Nonsense(1)	ovary(1)	8											242.0	221.0	228.0					8																	141771320		2203	4299	6502	141840502	SO:0001587	stop_gained	5747			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1276C>T	8.37:g.141771320G>A	ENSP00000429911:p.Arg426*	Somatic		Capture	Illumina GAIIx	Phase_I	141840502	B4E2N6|F5H4S4|Q14291|Q9UD85	Nonsense_Mutation	SNP	ENST00000522684.1	37	CCDS6381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.805395|5.805395	0.96967|0.96967	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000521986;ENST00000342207;ENST00000519024|ENST00000519654	.|.	.|.	.|.	5.33|5.33	4.45|4.45	0.53987|0.53987	.|.	0.082096|.	0.64402|.	D|.	0.000001|.	.|T	.|0.71307	.|0.3324	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.75127	.|-0.3427	.|3	0.05620|.	T|.	0.96|.	.|.	16.2487|16.2487	0.82472|0.82472	0.0:0.0:0.866:0.134|0.0:0.0:0.866:0.134	.|.	.|.	.|.	.|.	X|M	426;426;54;470;426;378;426;347;121;98;426;94;470;124;244;61|436	.|.	ENSP00000341189:R426X|.	R|T	-|-	1|2	2|0	PTK2|PTK2	141840502|141840502	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.998000|0.998000	0.95712|0.95712	8.669000|8.669000	0.91163|0.91163	1.554000|1.554000	0.49487|0.49487	0.655000|0.655000	0.94253|0.94253	CGA|ACG		0.323	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
CNTFR	1271	broad.mit.edu	37	9	34557627	34557627	+	Silent	SNP	G	G	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr9:34557627G>T	ENST00000378980.3	-	6	794	c.501C>A	c.(499-501)cgC>cgA	p.R167R	CNTFR_ENST00000351266.4_Silent_p.R167R	NM_001207011.1|NM_147164.2	NP_001193940.1|NP_671693.1	P26992	CNTFR_HUMAN	ciliary neurotrophic factor receptor	167	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brainstem development (GO:0003360)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|skeletal muscle organ development (GO:0060538)|suckling behavior (GO:0001967)	anchored component of membrane (GO:0031225)|CNTFR-CLCF1 complex (GO:0097059)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|cytokine binding (GO:0019955)|receptor binding (GO:0005102)	p.R167R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(4)|skin(1)	15	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.00494)		GGTGCATGTAGCGAATGTGGC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	9											181.0	147.0	158.0					9																	34557627		2203	4300	6503	34547627	SO:0001819	synonymous_variant	1271			M73238	CCDS6558.1	9p13	2013-02-11			ENSG00000122756	ENSG00000122756		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2170	protein-coding gene	gene with protein product		118946				1648265	Standard	NM_001842		Approved		uc003zuq.2	P26992	OTTHUMG00000019821	ENST00000378980.3:c.501C>A	9.37:g.34557627G>T		Somatic		Capture	Illumina GAIIx	Phase_I	34547627	Q5U050	Silent	SNP	ENST00000378980.3	37	CCDS6558.1																																																																																				0.527	CNTFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052176.1		
SUSD3	203328	broad.mit.edu	37	9	95838102	95838102	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr9:95838102C>A	ENST00000375472.3	+	2	161	c.125C>A	c.(124-126)aCc>aAc	p.T42N	SUSD3_ENST00000375469.1_Missense_Mutation_p.T29N	NM_145006.2	NP_659443.1	Q96L08	SUSD3_HUMAN	sushi domain containing 3	42	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.T42N(1)		NS(1)|autonomic_ganglia(1)|breast(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	13						CCGCAAGCAACCTTCCAAGTC	0.677																																																1	Substitution - Missense(1)	ovary(1)	9											81.0	64.0	69.0					9																	95838102		2203	4300	6503	94877923	SO:0001583	missense	203328			AK128289	CCDS6701.1, CCDS69620.1, CCDS75857.1	9q22.32	2004-01-29			ENSG00000157303	ENSG00000157303			28391	protein-coding gene	gene with protein product						12975309	Standard	NM_001287007		Approved	MGC26847	uc004atb.3	Q96L08	OTTHUMG00000020241	ENST00000375472.3:c.125C>A	9.37:g.95838102C>A	ENSP00000364621:p.Thr42Asn	Somatic		Capture	Illumina GAIIx	Phase_I	94877923	Q49AA6|Q6UXV7	Missense_Mutation	SNP	ENST00000375472.3	37	CCDS6701.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911080	0.72983	.	.	ENSG00000157303	ENST00000375472;ENST00000375469	T;T	0.64260	-0.09;-0.09	5.25	5.25	0.73442	Complement control module (2);Sushi/SCR/CCP (3);	0.286347	0.38837	N	0.001558	T	0.78130	0.4235	M	0.71581	2.175	0.54753	D	0.999988	D;D	0.76494	0.999;0.999	D;D	0.73708	0.967;0.981	T	0.79885	-0.1614	10	0.66056	D	0.02	-30.2645	16.7144	0.85394	0.0:1.0:0.0:0.0	.	29;42	Q96L08-2;Q96L08	.;SUSD3_HUMAN	N	42;29	ENSP00000364621:T42N;ENSP00000364618:T29N	ENSP00000364618:T29N	T	+	2	0	SUSD3	94877923	0.061000	0.20836	0.099000	0.21106	0.537000	0.34900	1.644000	0.37228	2.628000	0.89032	0.561000	0.74099	ACC		0.677	SUSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053120.1	NM_145006	
LAMC3	10319	broad.mit.edu	37	9	133954633	133954633	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr9:133954633C>A	ENST00000361069.4	+	23	4008	c.3875C>A	c.(3874-3876)aCc>aAc	p.T1292N	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1292	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.T1292N(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GCTGCCCGAACCCTCCAGACT	0.612																																																1	Substitution - Missense(1)	ovary(1)	9											52.0	45.0	47.0					9																	133954633		2203	4300	6503	132944454	SO:0001583	missense	10319			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3875C>A	9.37:g.133954633C>A	ENSP00000354360:p.Thr1292Asn	Somatic		Capture	Illumina GAIIx	Phase_I	132944454	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.02|11.02	1.517272|1.517272	0.27123|0.27123	.|.	.|.	ENSG00000050555|ENSG00000050555	ENST00000355452|ENST00000361069;ENST00000355048	.|T	.|0.27104	.|1.69	4.24|4.24	1.88|1.88	0.25563|0.25563	.|.	.|0.787541	.|0.11663	.|N	.|0.541593	T|T	0.16428|0.16428	0.0395|0.0395	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	.|B;B	.|0.29037	.|0.231;0.001	.|B;B	.|0.22601	.|0.04;0.003	T|T	0.20273|0.20273	-1.0280|-1.0280	5|10	.|0.35671	.|T	.|0.21	.|.	4.5409|4.5409	0.12056|0.12056	0.3341:0.5555:0.0:0.1104|0.3341:0.5555:0.0:0.1104	.|.	.|1;1292	.|Q9UF61;Q9Y6N6	.|.;LAMC3_HUMAN	T|N	2|1292	.|ENSP00000354360:T1292N	.|ENSP00000347156:T1292N	P|T	+|+	1|2	0|0	LAMC3|LAMC3	132944454|132944454	0.004000|0.004000	0.15560|0.15560	0.082000|0.082000	0.20525|0.20525	0.006000|0.006000	0.05464|0.05464	0.390000|0.390000	0.20768|0.20768	0.533000|0.533000	0.28675|0.28675	0.561000|0.561000	0.74099|0.74099	CCC|ACC		0.612	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
C9orf171	389799	broad.mit.edu	37	9	135418390	135418390	+	Missense_Mutation	SNP	C	C	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr9:135418390C>A	ENST00000343036.2	+	6	844	c.796C>A	c.(796-798)Ccc>Acc	p.P266T	C9orf171_ENST00000393216.2_Missense_Mutation_p.P230T	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	266								p.P266T(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						GTACAAGCCGCCCGTGAAGCT	0.597																																																1	Substitution - Missense(1)	ovary(1)	9											156.0	137.0	143.0					9																	135418390		2203	4300	6503	134408211	SO:0001583	missense	389799			AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.796C>A	9.37:g.135418390C>A	ENSP00000343290:p.Pro266Thr	Somatic		Capture	Illumina GAIIx	Phase_I	134408211	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600374	0.28534	.	.	ENSG00000188523	ENST00000343036;ENST00000393216	T;T	0.22743	1.94;1.94	4.96	4.96	0.65561	.	0.170785	0.39834	N	0.001258	T	0.21761	0.0524	L	0.59436	1.845	0.36806	D	0.885629	B;P	0.35793	0.328;0.521	B;B	0.30105	0.085;0.111	T	0.17440	-1.0369	10	0.40728	T	0.16	.	15.3703	0.74557	0.0:1.0:0.0:0.0	.	230;266	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	T	266;230	ENSP00000343290:P266T;ENSP00000376909:P230T	ENSP00000343290:P266T	P	+	1	0	C9orf171	134408211	0.192000	0.23301	0.859000	0.33776	0.177000	0.22998	2.185000	0.42584	2.292000	0.77174	0.655000	0.94253	CCC		0.597	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417	
CAMSAP1	157922	broad.mit.edu	37	9	138713707	138713707	+	Missense_Mutation	SNP	G	G	A			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr9:138713707G>A	ENST00000389532.4	-	11	2864	c.2800C>T	c.(2800-2802)Cac>Tac	p.H934Y	CAMSAP1_ENST00000409386.3_Missense_Mutation_p.H945Y|CAMSAP1_ENST00000312405.6_Missense_Mutation_p.H656Y|CAMSAP1_ENST00000483991.1_5'UTR	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	934					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)	p.H934Y(1)		breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		TTTGCAAAGTGCTCCGGCCTG	0.607																																																1	Substitution - Missense(1)	ovary(1)	9											92.0	101.0	98.0					9																	138713707		2203	4300	6503	137853528	SO:0001583	missense	157922			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.2800C>T	9.37:g.138713707G>A	ENSP00000374183:p.His934Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	137853528	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	ENST00000389532.4	37	CCDS35176.2	.	.	.	.	.	.	.	.	.	.	G	0.192	-1.052555	0.01981	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.15256	2.44;2.44;2.44	5.11	3.27	0.37495	.	0.100935	0.43747	D	0.000528	T	0.17577	0.0422	M	0.67953	2.075	0.09310	N	1	P;B	0.50528	0.936;0.264	B;B	0.37943	0.261;0.142	T	0.14811	-1.0459	10	0.87932	D	0	-3.5873	10.7895	0.46424	0.0713:0.1318:0.7969:0.0	.	934;945	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	Y	934;656;945	ENSP00000374183:H934Y;ENSP00000312463:H656Y;ENSP00000386420:H945Y	ENSP00000312463:H656Y	H	-	1	0	CAMSAP1	137853528	0.214000	0.23563	0.000000	0.03702	0.001000	0.01503	1.653000	0.37323	0.674000	0.31244	0.655000	0.94253	CAC		0.607	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055024.2	XM_351857	
RS1	6247	broad.mit.edu	37	X	18660213	18660213	+	Missense_Mutation	SNP	A	A	C	rs199469701		TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chrX:18660213A>C	ENST00000379984.3	-	6	626	c.586T>G	c.(586-588)Tcc>Gcc	p.S196A	CDKL5_ENST00000379996.3_Intron|RS1_ENST00000476595.1_5'UTR|CDKL5_ENST00000379989.3_Intron	NM_000330.3	NP_000321.1	O15537	XLRS1_HUMAN	retinoschisin 1	196	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adaptation of rhodopsin mediated signaling (GO:0016062)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|retina layer formation (GO:0010842)|visual perception (GO:0007601)	extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)	p.S196A(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(2)|ovary(2)|skin(1)	15	Hepatocellular(33;0.183)					ATGAAGCGGGAGATGATGGGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	X											76.0	68.0	71.0					X																	18660213		2203	4300	6503	18570134	SO:0001583	missense	6247			AF014459	CCDS14187.1	Xp22.2-p22.1	2014-09-17	2008-07-29		ENSG00000102104	ENSG00000102104			10457	protein-coding gene	gene with protein product		300839	"""retinoschisis (X-linked, juvenile) 1"""	RS		9326935, 17804407	Standard	NM_000330		Approved	XLRS1	uc004cyo.3	O15537	OTTHUMG00000021216	ENST00000379984.3:c.586T>G	X.37:g.18660213A>C	ENSP00000369320:p.Ser196Ala	Somatic		Capture	Illumina GAIIx	Phase_I	18570134	Q0QD39	Missense_Mutation	SNP	ENST00000379984.3	37	CCDS14187.1	.	.	.	.	.	.	.	.	.	.	A	5.669	0.308055	0.10733	.	.	ENSG00000102104	ENST00000379984	D	0.95690	-3.78	5.63	4.43	0.53597	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.096208	0.64402	N	0.000001	T	0.78381	0.4274	N	0.00182	-1.905	0.30355	N	0.784434	B	0.09022	0.002	B	0.06405	0.002	T	0.71227	-0.4655	10	0.02654	T	1	.	11.7841	0.52032	0.5705:0.4295:0.0:0.0	.	196	O15537	XLRS1_HUMAN	A	196	ENSP00000369320:S196A	ENSP00000369320:S196A	S	-	1	0	RS1	18570134	0.995000	0.38212	0.965000	0.40720	0.996000	0.88848	3.277000	0.51654	0.718000	0.32166	0.481000	0.45027	TCC		0.602	RS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055949.1		
RLIM	51132	broad.mit.edu	37	X	73811648	73811648	+	Missense_Mutation	SNP	G	G	A	rs200629905		TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chrX:73811648G>A	ENST00000332687.6	-	4	1720	c.1502C>T	c.(1501-1503)tCa>tTa	p.S501L	RLIM_ENST00000349225.2_Missense_Mutation_p.S501L	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	501	Poly-Ser.|Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S501L(3)		breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCCTGATGATGAGCTTCCTTC	0.488																																					Esophageal Squamous(169;1899 1923 14997 18818 32118)											3	Substitution - Missense(3)	prostate(2)|ovary(1)	X											45.0	38.0	40.0					X																	73811648		2203	4300	6503	73728373	SO:0001583	missense	51132			AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1502C>T	X.37:g.73811648G>A	ENSP00000328059:p.Ser501Leu	Somatic		Capture	Illumina GAIIx	Phase_I	73728373	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	G	7.117	0.577275	0.13686	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.08984	3.03;3.03	5.41	4.55	0.56014	.	0.666655	0.15400	N	0.264373	T	0.10121	0.0248	L	0.49126	1.545	0.38573	D	0.949983	B	0.02656	0.0	B	0.01281	0.0	T	0.08764	-1.0706	10	0.23891	T	0.37	-0.2985	13.4694	0.61273	0.0772:0.0:0.9228:0.0	.	501	Q9NVW2	RNF12_HUMAN	L	501	ENSP00000328059:S501L;ENSP00000253571:S501L	ENSP00000328059:S501L	S	-	2	0	RLIM	73728373	0.997000	0.39634	0.969000	0.41365	0.831000	0.47069	2.664000	0.46783	1.072000	0.40860	-0.192000	0.12808	TCA		0.488	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
NRK	203447	broad.mit.edu	37	X	105153288	105153288	+	Missense_Mutation	SNP	A	A	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chrX:105153288A>T	ENST00000243300.9	+	13	1958	c.1655A>T	c.(1654-1656)cAg>cTg	p.Q552L	NRK_ENST00000428173.2_Missense_Mutation_p.Q553L	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	552	Gln-rich.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.Q552L(1)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						GAGCTGGAGCAGAACCAGGCA	0.562										HNSCC(51;0.14)																																						1	Substitution - Missense(1)	ovary(1)	X											39.0	39.0	39.0					X																	105153288		2016	4153	6169	105039944	SO:0001583	missense	203447			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1655A>T	X.37:g.105153288A>T	ENSP00000434830:p.Gln552Leu	Somatic		Capture	Illumina GAIIx	Phase_I	105039944	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37		.	.	.	.	.	.	.	.	.	.	A	3.939	-0.014693	0.07681	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.24723	1.84;1.84	4.49	1.96	0.26148	.	0.480497	0.17763	N	0.162823	T	0.14614	0.0353	L	0.31752	0.955	0.50313	D	0.999862	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.10800	-1.0614	10	0.21014	T	0.42	.	5.0169	0.14341	0.447:0.3706:0.0:0.1824	.	220;552	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	L	552;553	ENSP00000434830:Q552L;ENSP00000438378:Q553L	ENSP00000434830:Q552L	Q	+	2	0	NRK	105039944	0.977000	0.34250	0.037000	0.18230	0.016000	0.09150	0.454000	0.21827	0.278000	0.22164	0.486000	0.48141	CAG		0.562	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
COL4A6	1288	broad.mit.edu	37	X	107403784	107403784	+	Silent	SNP	C	C	T			TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chrX:107403784C>T	ENST00000372216.4	-	43	4537	c.4437G>A	c.(4435-4437)gtG>gtA	p.V1479V	COL4A6_ENST00000394872.2_Silent_p.V1479V|COL4A6_ENST00000418180.1_5'Flank|COL4A6_ENST00000545689.1_Silent_p.V1454V|COL4A6_ENST00000334504.7_Silent_p.V1478V|COL4A6_ENST00000538570.1_Silent_p.V1421V	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1479	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.V1478V(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GACACGGGGGCACCTGTTCCG	0.612									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											1	Substitution - coding silent(1)	ovary(1)	X											144.0	113.0	123.0					X																	107403784		2203	4300	6503	107290440	SO:0001819	synonymous_variant	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.4437G>A	X.37:g.107403784C>T		Somatic		Capture	Illumina GAIIx	Phase_I	107290440	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	37	CCDS14541.1																																																																																				0.612	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
OR52N2	390077	broad.mit.edu	37	11	5841721	5841756	+	In_Frame_Del	DEL	CCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	CCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	-	rs371684747|rs369345504|rs73394373|rs541807315	byFrequency	TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	CCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	CCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	-	-	CCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	CCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	Unknown	Valid	Somatic	Phase_I	WXS	Illumina_Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr11:5841721_5841756delCCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	ENST00000317037.2	+	1	178_213	c.156_191delCCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	c.(154-192)agccatgaggaggccctgcaccggcccatgtactacttc>agc	p.HEEALHRPMYYF53del	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A56T(1)|p.R59R(1)|p.H53_F64del(1)|p.R59G(1)|p.L57L(1)|p.A56V(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCCTCATCAGCCATGAGGAGGCCCTGCACCGGCCCATGTACTACTTCCTGGCCCTG	0.521																																																6	Substitution - Missense(3)|Substitution - coding silent(2)|Deletion - In frame(1)	large_intestine(1)|stomach(1)|lung(1)|skin(1)|ovary(1)|kidney(1)	11																																								5798332	SO:0001651	inframe_deletion	390077			AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.156_191delCCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	11.37:g.5841721_5841756delCCATGAGGAGGCCCTGCACCGGCCCATGTACTACTT	ENSP00000322801:p.His53_Phe64del	Somatic		Capture	Illumina GAIIx	Phase_I	5798297	Q6IFF9	In_Frame_Del	DEL	ENST00000317037.2	37	CCDS31399.1																																																																																				0.521	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401143.1	NM_001005174	
BRCA1	672	broad.mit.edu	37	17	41215914	41215914	+	Frame_Shift_Del	DEL	C	C	-	rs398122691		TCGA-24-2035-01A-01W-0722-08	TCGA-24-2035-10A-01W-0722-08	C	C	-	-	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Illumina_Capture			Illumina GAIIx	6845bf86-6f88-48f2-a93a-681506a3deaf	319c823f-31c2-48c6-b91a-4f980023063f	g.chr17:41215914delC	ENST00000357654.3	-	17	5247	c.5129delG	c.(5128-5130)ggafs	p.G1710fs	BRCA1_ENST00000468300.1_Frame_Shift_Del_p.G606fs|BRCA1_ENST00000352993.3_Frame_Shift_Del_p.G568fs|BRCA1_ENST00000471181.2_Frame_Shift_Del_p.G1731fs|BRCA1_ENST00000586385.1_Frame_Shift_Del_p.G20fs|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000493795.1_Frame_Shift_Del_p.G1663fs|BRCA1_ENST00000309486.4_Frame_Shift_Del_p.G1414fs|BRCA1_ENST00000491747.2_Frame_Shift_Del_p.G606fs|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000591534.1_Frame_Shift_Del_p.G201fs|BRCA1_ENST00000346315.3_Frame_Shift_Del_p.G1471fs|BRCA1_ENST00000351666.3_Frame_Shift_Del_p.G527fs	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1710	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G1710fs*4(1)		NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TACCCATTTTCCTCCCGCAAT	0.363			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	1	Deletion - Frameshift(1)	ovary(1)	17											82.0	79.0	80.0					17																	41215914		2203	4300	6503	38469440	SO:0001589	frameshift_variant	672	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.5129delG	17.37:g.41215914delC	ENSP00000350283:p.Gly1710fs	Somatic		Capture	Illumina GAIIx	Phase_I	38469440	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Frame_Shift_Del	DEL	ENST00000357654.3	37	CCDS11453.1																																																																																				0.363	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
