#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
STPG1	90529	broad.mit.edu	37	1	24700197	24700197	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:24700197G>A	ENST00000374409.1	-	6	820	c.566C>T	c.(565-567)cCc>cTc	p.P189L	STPG1_ENST00000003583.8_Missense_Mutation_p.P142L|STPG1_ENST00000337248.4_Missense_Mutation_p.P189L|STPG1_ENST00000468303.1_5'UTR|STPG1_ENST00000440416.1_Missense_Mutation_p.P142L	NM_001199012.1	NP_001185941.1	Q5TH74	STPG1_HUMAN	sperm-tail PG-rich repeat containing 1	189					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P142L(1)									CTTACCTGGGGGAGGTCCTTT	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											209.0	220.0	216.0					1																	24700197		2203	4300	6503	24572784	SO:0001583	missense	90529			BC047705	CCDS253.1, CCDS55581.1	1p36.11	2012-10-31	2012-07-30	2012-07-30	ENSG00000001460	ENSG00000001460			28070	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 2"""	615826	"""chromosome 1 open reading frame 201"""	C1orf201		23028632	Standard	NM_001199012		Approved	FLJ33340, MAPO2	uc001bjc.3	Q5TH74	OTTHUMG00000003297	ENST00000374409.1:c.566C>T	1.37:g.24700197G>A	ENSP00000363530:p.Pro189Leu	Somatic		Capture	Illumina GAIIx	Phase_I	24572784	Q49AP0|Q6P3R4|Q86VU9|Q8WVQ3	Missense_Mutation	SNP	ENST00000374409.1	37	CCDS55581.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725942	0.89298	.	.	ENSG00000001460	ENST00000374409;ENST00000440416;ENST00000003583;ENST00000337248;ENST00000437986;ENST00000438866;ENST00000374404	.	.	.	5.81	5.81	0.92471	.	0.345554	0.26935	N	0.021756	T	0.50990	0.1648	L	0.34521	1.04	0.35279	D	0.781202	P;B;B	0.43542	0.81;0.193;0.328	P;B;B	0.46659	0.523;0.081;0.079	T	0.62383	-0.6866	9	0.54805	T	0.06	-35.8759	15.5783	0.76410	0.0:0.0:1.0:0.0	.	156;189;142	B4DRS3;Q5TH74;Q5TH74-3	.;CA201_HUMAN;.	L	189;142;142;189;156;92;93	.	ENSP00000003583:P142L	P	-	2	0	C1orf201	24572784	0.835000	0.29415	0.975000	0.42487	0.909000	0.53808	4.891000	0.63185	2.746000	0.94184	0.655000	0.94253	CCC		0.488	STPG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009172.1	NM_178122	
SLC1A7	6512	broad.mit.edu	37	1	53555486	53555486	+	Silent	SNP	G	G	C	rs374989145		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:53555486G>C	ENST00000371494.4	-	9	1474	c.1347C>G	c.(1345-1347)gcC>gcG	p.A449A	SLC1A7_ENST00000488036.1_5'UTR	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	449				A -> G (in Ref. 1; AAB53971). {ECO:0000305}.	dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.A449A(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		CCCAGTCAACGGCAATGATGA	0.627																																					NSCLC(128;80 1811 21245 38490 51715)											1	Substitution - coding silent(1)	ovary(1)	1											102.0	91.0	95.0					1																	53555486		2203	4300	6503	53328074	SO:0001819	synonymous_variant	6512			U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.1347C>G	1.37:g.53555486G>C		Somatic		Capture	Illumina GAIIx	Phase_I	53328074	Q5VVZ0|Q969Z8|Q9BW45	Silent	SNP	ENST00000371494.4	37	CCDS574.1																																																																																				0.627	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024746.1	NM_006671	
S1PR1	1901	broad.mit.edu	37	1	101704672	101704672	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:101704672C>A	ENST00000305352.6	+	2	507	c.132C>A	c.(130-132)agC>agA	p.S44R	S1PR1_ENST00000475821.1_3'UTR|RP4-575N6.4_ENST00000432195.1_RNA	NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	44					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)	p.S44R(1)		NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						AGGAGAACAGCATTAAACTGA	0.473											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											134.0	128.0	130.0					1																	101704672		2203	4300	6503	101477260	SO:0001583	missense	1901			M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.132C>A	1.37:g.101704672C>A	ENSP00000305416:p.Ser44Arg	Somatic	1360	Capture	Illumina GAIIx	Phase_I	101477260	D3DT66|Q9BYY4|Q9NYN8	Missense_Mutation	SNP	ENST00000305352.6	37	CCDS777.1	.	.	.	.	.	.	.	.	.	.	C	3.417	-0.119065	0.06838	.	.	ENSG00000170989	ENST00000305352;ENST00000424264	T	0.37411	1.2	5.83	2.76	0.32466	.	1.192390	0.05764	N	0.605404	T	0.08626	0.0214	N	0.17082	0.46	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33343	-0.9872	10	0.72032	D	0.01	.	2.8817	0.05649	0.1398:0.3626:0.3467:0.1509	.	44	P21453	S1PR1_HUMAN	R	44	ENSP00000305416:S44R	ENSP00000305416:S44R	S	+	3	2	S1PR1	101477260	0.988000	0.35896	0.032000	0.17829	0.014000	0.08584	0.344000	0.19962	0.781000	0.33589	0.650000	0.86243	AGC		0.473	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029908.1	NM_001400	
ADAM30	11085	broad.mit.edu	37	1	120437650	120437650	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:120437650G>C	ENST00000369400.1	-	1	1468	c.1310C>G	c.(1309-1311)gCc>gGc	p.A437G		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	437	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A437G(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		GCTACAGTTGGCACCTGGTTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											183.0	163.0	170.0					1																	120437650		2203	4300	6503	120239173	SO:0001583	missense	11085			AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.1310C>G	1.37:g.120437650G>C	ENSP00000358407:p.Ala437Gly	Somatic		Capture	Illumina GAIIx	Phase_I	120239173	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	37	CCDS907.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122753	0.56613	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.14022	2.54	4.97	2.09	0.27110	Blood coagulation inhibitor, Disintegrin (5);	0.145674	0.31221	N	0.008037	T	0.17492	0.0420	M	0.88570	2.965	0.09310	N	1	P	0.45902	0.868	P	0.55087	0.768	T	0.05533	-1.0879	10	0.54805	T	0.06	.	6.491	0.22115	0.3028:0.0:0.6972:0.0	.	437	Q9UKF2	ADA30_HUMAN	G	437	ENSP00000358407:A437G	ENSP00000358407:A437G	A	-	2	0	ADAM30	120239173	0.004000	0.15560	0.108000	0.21378	0.279000	0.26890	1.331000	0.33793	0.284000	0.22305	0.563000	0.77884	GCC		0.458	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
FLG2	388698	broad.mit.edu	37	1	152323676	152323676	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:152323676G>T	ENST00000388718.5	-	3	6658	c.6586C>A	c.(6586-6588)Cat>Aat	p.H2196N	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2196					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H2196N(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCTGAATGTGTGGGTGAG	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											396.0	338.0	358.0					1																	152323676		2203	4300	6503	150590300	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6586C>A	1.37:g.152323676G>T	ENSP00000373370:p.His2196Asn	Somatic		Capture	Illumina GAIIx	Phase_I	150590300	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.435707	0.25813	.	.	ENSG00000143520	ENST00000388718	T	0.38077	1.16	4.17	3.26	0.37387	.	.	.	.	.	T	0.37019	0.0988	M	0.79258	2.445	0.09310	N	1	D	0.58620	0.983	P	0.62885	0.908	T	0.19321	-1.0309	9	0.16420	T	0.52	0.2389	9.7044	0.40207	0.0:0.0:0.7925:0.2075	.	2196	Q5D862	FILA2_HUMAN	N	2196	ENSP00000373370:H2196N	ENSP00000373370:H2196N	H	-	1	0	FLG2	150590300	0.000000	0.05858	0.002000	0.10522	0.024000	0.10985	0.519000	0.22862	1.154000	0.42482	-0.233000	0.12211	CAT		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
FAM189B	10712	broad.mit.edu	37	1	155218027	155218027	+	Silent	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:155218027C>G	ENST00000361361.2	-	11	2156	c.1647G>C	c.(1645-1647)cgG>cgC	p.R549R	FAM189B_ENST00000472550.1_5'Flank|FAM189B_ENST00000368368.3_Silent_p.R531R|FAM189B_ENST00000350210.2_Silent_p.R453R	NM_006589.2	NP_006580.2	P81408	F189B_HUMAN	family with sequence similarity 189, member B	549			R -> H (in dbSNP:rs2072648).			integral component of membrane (GO:0016021)	WW domain binding (GO:0050699)	p.R549R(1)		breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23						TCTCGGCTGACCGGGCACGTA	0.632																																																1	Substitution - coding silent(1)	ovary(1)	1											20.0	27.0	24.0					1																	155218027		2202	4299	6501	153484651	SO:0001819	synonymous_variant	10712			AF070550	CCDS1103.1, CCDS1104.1, CCDS58035.1	1q21	2009-07-09	2009-07-09	2009-07-09	ENSG00000160767	ENSG00000160767			1233	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 2"""	C1orf2		9331372	Standard	NM_006589		Approved	cote1	uc001fjm.3	P81408	OTTHUMG00000035844	ENST00000361361.2:c.1647G>C	1.37:g.155218027C>G		Somatic		Capture	Illumina GAIIx	Phase_I	153484651	B1AVS5|Q8IXL3|Q9BR66	Silent	SNP	ENST00000361361.2	37	CCDS1103.1																																																																																				0.632	FAM189B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087224.1	NM_006589	
GON4L	54856	broad.mit.edu	37	1	155735555	155735555	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:155735555C>T	ENST00000368331.1	-	21	3757	c.3709G>A	c.(3709-3711)Gat>Aat	p.D1237N	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Missense_Mutation_p.D1237N|GON4L_ENST00000361040.5_Missense_Mutation_p.D1237N|GON4L_ENST00000271883.5_Missense_Mutation_p.D1237N	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1237					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.D1237N(1)		NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TTTTCCCCATCAGCCACAGCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											78.0	81.0	80.0					1																	155735555		2203	4300	6503	154002179	SO:0001583	missense	54856			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.3709G>A	1.37:g.155735555C>T	ENSP00000357315:p.Asp1237Asn	Somatic		Capture	Illumina GAIIx	Phase_I	154002179	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	37		.	.	.	.	.	.	.	.	.	.	C	5.907	0.351433	0.11182	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000361040	T;T;T;T	0.11712	2.96;2.96;2.96;2.75	5.08	3.21	0.36854	.	0.421576	0.24518	N	0.037822	T	0.01835	0.0058	N	0.08118	0	0.09310	N	0.999998	B;B;B;B	0.11235	0.002;0.002;0.002;0.004	B;B;B;B	0.13407	0.005;0.008;0.004;0.009	T	0.45512	-0.9256	10	0.30078	T	0.28	.	12.4182	0.55506	0.0:0.843:0.0:0.157	.	1237;433;1237;1237	Q3T8J9-2;Q1ED43;Q3T8J9;Q3T8J9-3	.;.;GON4L_HUMAN;.	N	1237	ENSP00000396117:D1237N;ENSP00000357315:D1237N;ENSP00000271883:D1237N;ENSP00000354322:D1237N	ENSP00000271883:D1237N	D	-	1	0	GON4L	154002179	0.807000	0.29009	0.807000	0.32361	0.075000	0.17131	1.422000	0.34826	0.729000	0.32403	-0.911000	0.02809	GAT		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
NTRK1	4914	broad.mit.edu	37	1	156849053	156849053	+	Missense_Mutation	SNP	C	C	T	rs369353892		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:156849053C>T	ENST00000524377.1	+	15	1986	c.1945C>T	c.(1945-1947)Cgg>Tgg	p.R649W	NTRK1_ENST00000368196.3_Missense_Mutation_p.R643W|NTRK1_ENST00000358660.3_Missense_Mutation_p.R646W|NTRK1_ENST00000392302.2_Missense_Mutation_p.R613W	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	649	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> W (in CIPA; processed as wild-type but shows significantly diminished autophosphorylation in both neuronal and non-neuronal cells). {ECO:0000269|PubMed:10330344}.		activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R649W(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	TTTTGTGCACCGGGACCTGGC	0.617			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																													Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	1	Substitution - Missense(1)	ovary(1)	1	GRCh37	CM990979	NTRK1	M		C	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	62.0	56.0	58.0		1837,1927,1945	3.4	1.0	1		58	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	NTRK1	NM_001007792.1,NM_001012331.1,NM_002529.3	101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	613/761,643/791,649/797	156849053	1,13005	2203	4300	6503	155115677	SO:0001583	missense	4914			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1945C>T	1.37:g.156849053C>T	ENSP00000431418:p.Arg649Trp	Somatic		Capture	Illumina GAIIx	Phase_I	155115677	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	37	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387622	0.61956	0.0	1.16E-4	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43	4.37	3.44	0.39384	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.138776	0.32868	N	0.005546	D	0.95984	0.8692	H	0.98682	4.3	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.996;1.0;0.996	D	0.96894	0.9655	10	0.87932	D	0	.	12.7478	0.57291	0.1657:0.8343:0.0:0.0	.	646;643;649;613	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	W	613;643;649;646	ENSP00000376120:R613W;ENSP00000357179:R643W;ENSP00000431418:R649W;ENSP00000351486:R646W	ENSP00000351486:R646W	R	+	1	2	NTRK1	155115677	0.983000	0.35010	1.000000	0.80357	0.923000	0.55619	0.965000	0.29319	1.182000	0.42928	-0.310000	0.09108	CGG		0.617	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
NUAK2	81788	broad.mit.edu	37	1	205273343	205273343	+	Silent	SNP	G	G	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:205273343G>C	ENST00000367157.3	-	7	1248	c.1122C>G	c.(1120-1122)ctC>ctG	p.L374L		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2									p.L374L(1)		breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GGGACTTCTTGAGCGAATGCT	0.612																																																1	Substitution - coding silent(1)	ovary(1)	1											76.0	71.0	73.0					1																	205273343		2203	4300	6503	203539966	SO:0001819	synonymous_variant	81788			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.1122C>G	1.37:g.205273343G>C		Somatic		Capture	Illumina GAIIx	Phase_I	203539966		Silent	SNP	ENST00000367157.3	37	CCDS1453.1																																																																																				0.612	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
MIA3	375056	broad.mit.edu	37	1	222838886	222838886	+	Silent	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:222838886C>T	ENST00000344922.5	+	28	5674	c.5649C>T	c.(5647-5649)ggC>ggT	p.G1883G	MIA3_ENST00000340535.7_Silent_p.G761G|MIA3_ENST00000344507.1_Intron|AIDA_ENST00000474863.1_5'Flank|MIA3_ENST00000344441.6_Silent_p.G1883G	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1883	Pro-rich.				chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.G1883G(1)		breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		TGCCGTCAGGCTCTAGAGATG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	1											132.0	135.0	134.0					1																	222838886		1871	4118	5989	220905509	SO:0001819	synonymous_variant	375056				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.5649C>T	1.37:g.222838886C>T		Somatic		Capture	Illumina GAIIx	Phase_I	220905509	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Silent	SNP	ENST00000344922.5	37	CCDS41470.1																																																																																				0.512	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
URB2	9816	broad.mit.edu	37	1	229773223	229773223	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:229773223G>A	ENST00000258243.2	+	4	2999	c.2863G>A	c.(2863-2865)Ggg>Agg	p.G955R		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	955						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.G955R(1)		breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						CTTGCAAAAGGGGAAAAGTGC	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											290.0	278.0	282.0					1																	229773223		2203	4300	6503	227839846	SO:0001583	missense	9816			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.2863G>A	1.37:g.229773223G>A	ENSP00000258243:p.Gly955Arg	Somatic		Capture	Illumina GAIIx	Phase_I	227839846	Q5VYC9	Missense_Mutation	SNP	ENST00000258243.2	37	CCDS31052.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654148	0.47362	.	.	ENSG00000135763	ENST00000258243	T	0.41400	1.0	5.54	5.54	0.83059	.	0.105088	0.64402	D	0.000004	T	0.51346	0.1669	L	0.34521	1.04	0.54753	D	0.999987	D	0.76494	0.999	D	0.70716	0.97	T	0.38520	-0.9657	9	.	.	.	-27.2423	14.0975	0.65032	0.0723:0.0:0.9277:0.0	.	955	Q14146	URB2_HUMAN	R	955	ENSP00000258243:G955R	.	G	+	1	0	URB2	227839846	1.000000	0.71417	0.254000	0.24359	0.044000	0.14063	4.857000	0.62939	2.785000	0.95823	0.585000	0.79938	GGG		0.448	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095232.1	NM_014777	
LYST	1130	broad.mit.edu	37	1	235972337	235972337	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:235972337G>T	ENST00000389794.3	-	5	1955	c.1781C>A	c.(1780-1782)cCt>cAt	p.P594H	LYST_ENST00000389793.2_Missense_Mutation_p.P594H|LYST_ENST00000536965.1_Missense_Mutation_p.P594H			Q99698	LYST_HUMAN	lysosomal trafficking regulator	594					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.P594H(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			ATGGAGCAAAGGAATGATTAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	1											115.0	113.0	114.0					1																	235972337		2203	4300	6503	234038960	SO:0001583	missense	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.1781C>A	1.37:g.235972337G>T	ENSP00000374444:p.Pro594His	Somatic		Capture	Illumina GAIIx	Phase_I	234038960	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	37	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	G	19.74	3.883727	0.72410	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.67865	-0.29;-0.29;0.87	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.81254	0.4784	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82287	-0.0532	10	0.87932	D	0	.	19.6104	0.95604	0.0:0.0:1.0:0.0	.	594;594	Q99698-3;Q99698	.;LYST_HUMAN	H	594	ENSP00000374444:P594H;ENSP00000374443:P594H;ENSP00000438315:P594H	ENSP00000374443:P594H	P	-	2	0	LYST	234038960	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.230000	0.95299	2.634000	0.89283	0.650000	0.86243	CCT		0.398	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
PLD5	200150	broad.mit.edu	37	1	242264042	242264042	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:242264042C>G	ENST00000536534.2	-	9	1523	c.1282G>C	c.(1282-1284)Gaa>Caa	p.E428Q	PLD5_ENST00000427495.1_Missense_Mutation_p.E366Q|PLD5_ENST00000442594.2_Missense_Mutation_p.E336Q			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	428						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.E336Q(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TTCTTTTGTTCTTTTGTAGCA	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											210.0	183.0	192.0					1																	242264042		2203	4300	6503	240330665	SO:0001583	missense	200150			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1282G>C	1.37:g.242264042C>G	ENSP00000440896:p.Glu428Gln	Somatic		Capture	Illumina GAIIx	Phase_I	240330665	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	ENST00000536534.2	37	CCDS1621.2	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315509	0.60524	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.46451	0.89;0.89;0.87	5.75	5.75	0.90469	.	0.170741	0.50627	D	0.000108	T	0.38108	0.1028	L	0.39085	1.19	0.48135	D	0.999591	D;P;D	0.53151	0.958;0.93;0.958	P;B;B	0.44897	0.463;0.342;0.369	T	0.05920	-1.0856	10	0.17369	T	0.5	-16.9875	17.7292	0.88373	0.0:1.0:0.0:0.0	.	336;428;366	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	Q	366;336;428	ENSP00000401285:E366Q;ENSP00000414188:E336Q;ENSP00000440896:E428Q	ENSP00000401285:E366Q	E	-	1	0	PLD5	240330665	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.073000	0.71245	2.723000	0.93209	0.650000	0.86243	GAA		0.403	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397213.2	NM_152666	
OR2T12	127064	broad.mit.edu	37	1	248458438	248458438	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr1:248458438A>T	ENST00000317996.1	-	1	442	c.443T>A	c.(442-444)cTc>cAc	p.L148H		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	148						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L148H(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			TGCACCCAGGAGCCAGGACGA	0.612																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	67.0	64.0					1																	248458438		2176	4297	6473	246525061	SO:0001583	missense	127064			BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.443T>A	1.37:g.248458438A>T	ENSP00000324583:p.Leu148His	Somatic		Capture	Illumina GAIIx	Phase_I	246525061		Missense_Mutation	SNP	ENST00000317996.1	37	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	a	12.87	2.068665	0.36470	.	.	ENSG00000177201	ENST00000317996	T	0.45276	0.9	1.55	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.729752	0.11158	U	0.593361	T	0.68016	0.2955	M	0.93241	3.395	0.24682	N	0.993354	D	0.71674	0.998	D	0.70016	0.967	T	0.53940	-0.8367	10	0.87932	D	0	.	6.3786	0.21521	0.6446:0.3553:0.0:0.0	.	148	Q8NG77	O2T12_HUMAN	H	148	ENSP00000324583:L148H	ENSP00000324583:L148H	L	-	2	0	OR2T12	246525061	0.000000	0.05858	0.077000	0.20336	0.209000	0.24338	0.557000	0.23454	0.540000	0.28808	0.147000	0.16070	CTC		0.612	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
ZNF25	219749	broad.mit.edu	37	10	38241638	38241638	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr10:38241638C>G	ENST00000302609.7	-	6	1000	c.788G>C	c.(787-789)tGt>tCt	p.C263S	ZNF25_ENST00000374633.1_5'UTR|AL117337.1_ENST00000582458.1_RNA	NM_145011.2	NP_659448.1	P17030	ZNF25_HUMAN	zinc finger protein 25	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C263S(1)		breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				GGCTTTCCCACACTCCTTACA	0.433																																																1	Substitution - Missense(1)	ovary(1)	10											112.0	101.0	105.0					10																	38241638		2203	4300	6503	38281644	SO:0001583	missense	219749			AK056452	CCDS7195.1	10p11.2	2013-01-08	2006-05-10		ENSG00000175395	ENSG00000175395		"""Zinc fingers, C2H2-type"", ""-"""	13043	protein-coding gene	gene with protein product		194528	"""zinc finger protein 25 (KOX 19)"""			1639412, 8464732	Standard	NM_145011		Approved	KOX19, FLJ31890, Zfp9	uc001ize.1	P17030	OTTHUMG00000019344	ENST00000302609.7:c.788G>C	10.37:g.38241638C>G	ENSP00000302222:p.Cys263Ser	Somatic		Capture	Illumina GAIIx	Phase_I	38281644	A9Z1X5|Q8IYE3|Q8NDD6|Q96MU2	Missense_Mutation	SNP	ENST00000302609.7	37	CCDS7195.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.164357	0.78339	.	.	ENSG00000175395	ENST00000302609;ENST00000374633	D	0.85861	-2.04	4.86	4.86	0.63082	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.48286	D	0.000189	D	0.93887	0.8044	M	0.92077	3.27	0.48185	D	0.999609	D	0.89917	1.0	D	0.76071	0.987	D	0.94975	0.8120	10	0.87932	D	0	-20.2789	15.9339	0.79686	0.0:1.0:0.0:0.0	.	263	P17030	ZNF25_HUMAN	S	263;227	ENSP00000302222:C263S	ENSP00000302222:C263S	C	-	2	0	ZNF25	38281644	1.000000	0.71417	0.982000	0.44146	0.944000	0.59088	4.513000	0.60476	2.697000	0.92050	0.549000	0.68633	TGT		0.433	ZNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051214.1	NM_145011, NM_006966	
PRKG1	5592	broad.mit.edu	37	10	53822295	53822295	+	Splice_Site	SNP	A	A	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr10:53822295A>T	ENST00000401604.2	+	7	989		c.e7-1		PRKG1_ENST00000373980.4_Splice_Site|PRKG1_ENST00000373985.1_Splice_Site|PRKG1_ENST00000373975.2_Splice_Site			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I						actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)	p.?(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TTCTCTTTGCAGGTAAATGTC	0.393																																																1	Unknown(1)	ovary(1)	10											63.0	61.0	62.0					10																	53822295		2203	4300	6503	53492301	SO:0001630	splice_region_variant	5592				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.796-1A>T	10.37:g.53822295A>T		Somatic		Capture	Illumina GAIIx	Phase_I	53492301	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Splice_Site	SNP	ENST00000401604.2	37	CCDS44399.1	.	.	.	.	.	.	.	.	.	.	A	19.48	3.836046	0.71373	.	.	ENSG00000185532	ENST00000401604;ENST00000373985;ENST00000373980;ENST00000373976	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0391	0.64663	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRKG1	53492301	1.000000	0.71417	0.932000	0.37286	0.784000	0.44337	8.793000	0.91862	2.202000	0.70862	0.533000	0.62120	.		0.393	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Intron
EGR2	1959	broad.mit.edu	37	10	64573741	64573741	+	Silent	SNP	G	G	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr10:64573741G>C	ENST00000242480.3	-	2	982	c.657C>G	c.(655-657)ctC>ctG	p.L219L	EGR2_ENST00000439032.1_Silent_p.L219L|EGR2_ENST00000493899.2_5'Flank|EGR2_ENST00000411732.1_Silent_p.L169L	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	219					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.L219L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					TCATTGGGAAGAGACCTGGGT	0.592																																																1	Substitution - coding silent(1)	ovary(1)	10											98.0	95.0	96.0					10																	64573741		2203	4300	6503	64243747	SO:0001819	synonymous_variant	1959			BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.657C>G	10.37:g.64573741G>C		Somatic		Capture	Illumina GAIIx	Phase_I	64243747	B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Silent	SNP	ENST00000242480.3	37	CCDS7267.1																																																																																				0.592	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2	NM_000399	
MGEA5	10724	broad.mit.edu	37	10	103550654	103550654	+	Splice_Site	SNP	T	T	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr10:103550654T>A	ENST00000361464.3	-	14	2848	c.2453A>T	c.(2452-2454)gAg>gTg	p.E818V	MGEA5_ENST00000357797.5_Splice_Site_p.E751V|MGEA5_ENST00000439817.1_Splice_Site_p.E765V|MGEA5_ENST00000482611.1_5'UTR	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	818					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)	p.E818V(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		TTGTATTACCTCAGCCTCAGA	0.313																																																1	Substitution - Missense(1)	ovary(1)	10											81.0	81.0	81.0					10																	103550654		2203	4300	6503	103540644	SO:0001630	splice_region_variant	10724			AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.2454+1A>T	10.37:g.103550654T>A		Somatic		Capture	Illumina GAIIx	Phase_I	103540644	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	ENST00000361464.3	37	CCDS7520.1	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878834	0.72294	.	.	ENSG00000198408	ENST00000439817;ENST00000361464;ENST00000357797	T;T;T	0.36157	1.29;1.3;1.27	5.67	5.67	0.87782	Acyl-CoA N-acyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.46927	0.1418	L	0.56769	1.78	0.80722	D	1	D;P;D	0.55172	0.958;0.949;0.97	P;P;P	0.50082	0.63;0.488;0.576	T	0.49428	-0.8941	10	0.72032	D	0.01	-16.6044	16.215	0.82206	0.0:0.0:0.0:1.0	.	765;751;818	E9PGF9;O60502-2;O60502	.;.;NCOAT_HUMAN	V	765;818;751	ENSP00000409973:E765V;ENSP00000354850:E818V;ENSP00000350445:E751V	ENSP00000350445:E751V	E	-	2	0	MGEA5	103540644	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.630000	0.83225	2.288000	0.76882	0.533000	0.62120	GAG		0.313	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215	Missense_Mutation
DHX32	55760	broad.mit.edu	37	10	127526878	127526878	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr10:127526878C>A	ENST00000284690.3	-	10	2450	c.1960G>T	c.(1960-1962)Ggt>Tgt	p.G654C	BCCIP_ENST00000299130.3_Intron|BCCIP_ENST00000429863.2_Intron|DHX32_ENST00000284688.6_Missense_Mutation_p.G573C|BCCIP_ENST00000368759.5_Intron|DHX32_ENST00000368721.1_Missense_Mutation_p.G278C	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	654						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.G654C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATTGAGTAACCAGACAGGGGA	0.433																																																1	Substitution - Missense(1)	ovary(1)	10											140.0	133.0	136.0					10																	127526878		2203	4300	6503	127516868	SO:0001583	missense	55760				CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1960G>T	10.37:g.127526878C>A	ENSP00000284690:p.Gly654Cys	Somatic		Capture	Illumina GAIIx	Phase_I	127516868	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	ENST00000284690.3	37	CCDS7652.1	.	.	.	.	.	.	.	.	.	.	C	4.268	0.048892	0.08243	.	.	ENSG00000089876	ENST00000368721;ENST00000284690;ENST00000284688	T;T;T	0.18174	2.23;4.02;3.74	4.94	-9.45	0.00600	Domain of unknown function DUF1605 (1);	1.019770	0.07798	N	0.956083	T	0.07908	0.0198	N	0.12182	0.205	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.46373	-0.9196	10	0.87932	D	0	-2.8159	10.1723	0.42917	0.235:0.6096:0.0:0.1554	.	654	Q7L7V1	DHX32_HUMAN	C	278;654;573	ENSP00000357710:G278C;ENSP00000284690:G654C;ENSP00000284688:G573C	ENSP00000284688:G573C	G	-	1	0	DHX32	127516868	0.000000	0.05858	0.000000	0.03702	0.300000	0.27592	-0.747000	0.04823	-1.315000	0.02297	-0.367000	0.07326	GGT		0.433	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050945.2	NM_018180	
PAX6	5080	broad.mit.edu	37	11	31816333	31816333	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr11:31816333C>A	ENST00000379132.3	-	7	807	c.527G>T	c.(526-528)gGc>gTc	p.G176V	PAX6_ENST00000419022.1_Missense_Mutation_p.G190V|PAX6_ENST00000379129.2_Missense_Mutation_p.G190V|PAX6_ENST00000379111.2_Missense_Mutation_p.G176V|PAX6_ENST00000379115.4_Missense_Mutation_p.G190V|PAX6_ENST00000379123.5_Missense_Mutation_p.G176V|PAX6_ENST00000379107.2_Missense_Mutation_p.G190V|PAX6_ENST00000241001.8_Missense_Mutation_p.G176V			P26367	PAX6_HUMAN	paired box 6	176	Gln/Gly-rich.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)	p.G190V(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					TTGCTGGCAGCCATCTGGAAC	0.463									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																																							1	Substitution - Missense(1)	ovary(1)	11											74.0	69.0	71.0					11																	31816333		2202	4299	6501	31772909	SO:0001583	missense	5080	Familial Cancer Database	WAGR syndrome	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.527G>T	11.37:g.31816333C>A	ENSP00000368427:p.Gly176Val	Somatic		Capture	Illumina GAIIx	Phase_I	31772909	Q6N006|Q99413	Missense_Mutation	SNP	ENST00000379132.3	37	CCDS31451.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.364113	0.61513	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000531633;ENST00000379107;ENST00000241001;ENST00000379115;ENST00000379111;ENST00000379123;ENST00000494377;ENST00000470027;ENST00000379109;ENST00000533333;ENST00000531910;ENST00000471303;ENST00000455099	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99176	-3.43;-3.44;-3.43;-3.16;-3.43;-3.44;-3.43;-3.44;-3.44;-2.88;-2.88;-3.44;-3.2;-2.81;-3.6;-5.52	5.76	5.76	0.90799	.	0.090880	0.85682	D	0.000000	D	0.97939	0.9322	L	0.57536	1.79	0.80722	D	1	B;B	0.21606	0.058;0.036	B;B	0.18263	0.021;0.011	D	0.95876	0.8895	10	0.39692	T	0.17	.	19.9583	0.97232	0.0:1.0:0.0:0.0	.	190;176	F1T0F8;P26367	.;PAX6_HUMAN	V	190;176;190;5;190;176;190;176;176;40;40;176;131;40;40;123	ENSP00000404100:G190V;ENSP00000368427:G176V;ENSP00000368424:G190V;ENSP00000451885:G5V;ENSP00000368401:G190V;ENSP00000241001:G176V;ENSP00000368410:G190V;ENSP00000368406:G176V;ENSP00000368418:G176V;ENSP00000451901:G40V;ENSP00000450775:G40V;ENSP00000368403:G176V;ENSP00000451372:G131V;ENSP00000452558:G40V;ENSP00000435884:G40V;ENSP00000397384:G123V	ENSP00000241001:G176V	G	-	2	0	PAX6	31772909	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.453000	0.80700	2.716000	0.92895	0.655000	0.94253	GGC		0.463	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000099293.4	NM_001604	
OR5T1	390155	broad.mit.edu	37	11	56044080	56044080	+	Silent	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr11:56044080C>T	ENST00000313033.2	+	1	1052	c.966C>T	c.(964-966)ttC>ttT	p.F322F		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	322						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F322F(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					GAAATTGGTTCATAAATAAGT	0.338																																																1	Substitution - coding silent(1)	ovary(1)	11											39.0	41.0	40.0					11																	56044080		2201	4295	6496	55800656	SO:0001819	synonymous_variant	390155			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.966C>T	11.37:g.56044080C>T		Somatic		Capture	Illumina GAIIx	Phase_I	55800656	B2RNM9	Silent	SNP	ENST00000313033.2	37	CCDS31525.1																																																																																				0.338	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391600.1	NM_001004745	
FAM111B	374393	broad.mit.edu	37	11	58893255	58893255	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr11:58893255G>A	ENST00000343597.3	+	4	1876	c.1685G>A	c.(1684-1686)tGg>tAg	p.W562*	FAM111B_ENST00000529618.1_Nonsense_Mutation_p.W532*|FAM111B_ENST00000411426.1_Nonsense_Mutation_p.W532*	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	562							catalytic activity (GO:0003824)	p.W562*(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						CCAGGACTATGGCGACAGATT	0.373																																																1	Substitution - Nonsense(1)	ovary(1)	11											111.0	103.0	106.0					11																	58893255		2201	4295	6496	58649831	SO:0001587	stop_gained	374393			BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.1685G>A	11.37:g.58893255G>A	ENSP00000341565:p.Trp562*	Somatic		Capture	Illumina GAIIx	Phase_I	58649831	B4E2G2|Q6P661	Nonsense_Mutation	SNP	ENST00000343597.3	37	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.964519	0.53507	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000343597	.	.	.	4.48	-6.86	0.01676	.	0.999489	0.08096	N	0.998554	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	2.7921	0.05391	0.541:0.0799:0.12:0.259	.	.	.	.	X	532;532;562	.	ENSP00000341565:W562X	W	+	2	0	FAM111B	58649831	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.114000	0.03293	-1.400000	0.02061	-0.262000	0.10625	TGG		0.373	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947	
MS4A5	64232	broad.mit.edu	37	11	60201280	60201280	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr11:60201280G>A	ENST00000300190.2	+	4	468	c.382G>A	c.(382-384)Gca>Aca	p.A128T	MS4A5_ENST00000534071.1_3'UTR	NM_023945.2	NP_076434.2	Q9H3V2	MS4A5_HUMAN	membrane-spanning 4-domains, subfamily A, member 5	128						integral component of membrane (GO:0016021)		p.A128T(1)		large_intestine(7)|lung(7)|ovary(1)|skin(1)	16						TGCCCTGGGAGCAATAGCTGG	0.368																																																1	Substitution - Missense(1)	ovary(1)	11											170.0	163.0	165.0					11																	60201280		2203	4300	6503	59957856	SO:0001583	missense	64232			AB013103	CCDS7987.1	11q12	2008-03-25			ENSG00000166930	ENSG00000166930			13374	protein-coding gene	gene with protein product		606499				11245982, 11401424	Standard	NM_023945		Approved	CD20L2	uc001npo.3	Q9H3V2	OTTHUMG00000167613	ENST00000300190.2:c.382G>A	11.37:g.60201280G>A	ENSP00000300190:p.Ala128Thr	Somatic		Capture	Illumina GAIIx	Phase_I	59957856	Q9BZH1	Missense_Mutation	SNP	ENST00000300190.2	37	CCDS7987.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681784	0.68042	.	.	ENSG00000166930	ENST00000300190	T	0.03635	3.86	4.08	4.08	0.47627	.	0.063677	0.64402	D	0.000010	T	0.19525	0.0469	M	0.87381	2.88	0.20074	N	0.999937	D	0.89917	1.0	D	0.91635	0.999	T	0.01781	-1.1275	10	0.72032	D	0.01	-4.9826	11.9845	0.53140	0.0:0.0:1.0:0.0	.	128	Q9H3V2	MS4A5_HUMAN	T	128	ENSP00000300190:A128T	ENSP00000300190:A128T	A	+	1	0	MS4A5	59957856	0.973000	0.33851	0.415000	0.26534	0.989000	0.77384	3.874000	0.56101	2.293000	0.77203	0.655000	0.94253	GCA		0.368	MS4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395392.1		
GANAB	23193	broad.mit.edu	37	11	62397885	62397885	+	Silent	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr11:62397885C>G	ENST00000356638.3	-	12	1495	c.1479G>C	c.(1477-1479)cgG>cgC	p.R493R	GANAB_ENST00000346178.4_Silent_p.R515R|GANAB_ENST00000534779.1_Silent_p.R401R|GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000540933.1_Silent_p.R396R	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	493					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)	p.R493R(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	CAGAGCCATCCCGGGTTTTAA	0.597																																					Melanoma(23;1005 1074 15747 18937)											1	Substitution - coding silent(1)	ovary(1)	11											52.0	50.0	51.0					11																	62397885		2202	4299	6501	62154461	SO:0001819	synonymous_variant	23193			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1479G>C	11.37:g.62397885C>G		Somatic		Capture	Illumina GAIIx	Phase_I	62154461	A6NC20|Q8WTS9|Q9P0X0	Silent	SNP	ENST00000356638.3	37	CCDS8026.1	.	.	.	.	.	.	.	.	.	.	C	6.662	0.490700	0.12702	.	.	ENSG00000089597	ENST00000540002	.	.	.	5.83	-2.23	0.06930	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35599	-0.9782	4	.	.	.	-29.1471	1.3555	0.02181	0.2222:0.3898:0.1087:0.2792	.	.	.	.	R	79	.	.	G	-	1	0	GANAB	62154461	0.034000	0.19679	0.999000	0.59377	0.919000	0.55068	-0.724000	0.04947	0.108000	0.17862	-1.101000	0.02118	GGA		0.597	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334	
LGALS12	85329	broad.mit.edu	37	11	63276301	63276301	+	Silent	SNP	C	C	A	rs12289952	byFrequency	TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr11:63276301C>A	ENST00000394618.3	+	3	567	c.276C>A	c.(274-276)atC>atA	p.I92I	LGALS12_ENST00000255684.5_Silent_p.I92I|LGALS12_ENST00000415491.2_Silent_p.I31I|LGALS12_ENST00000425950.2_Silent_p.I31I|LGALS12_ENST00000340246.5_Silent_p.I93I	NM_001142535.1|NM_033101.3	NP_001136007.1|NP_149092.2	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12	92	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)	p.I92I(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	16						GGCCAGATATCGCCTTCCACT	0.607																																																1	Substitution - coding silent(1)	ovary(1)	11											82.0	80.0	80.0					11																	63276301		2201	4298	6499	63032877	SO:0001819	synonymous_variant	85329			AF222695	CCDS8045.1, CCDS44633.1, CCDS44634.1, CCDS44635.1, CCDS53648.1	11q13	2011-08-04	2008-07-25		ENSG00000133317	ENSG00000133317		"""Lectins, galactoside-binding"""	15788	protein-coding gene	gene with protein product	"""galectin 12"""	606096				11283015, 11435439	Standard	NM_033101		Approved	GRIP1	uc001nxc.2	Q96DT0	OTTHUMG00000167807	ENST00000394618.3:c.276C>A	11.37:g.63276301C>A		Somatic		Capture	Illumina GAIIx	Phase_I	63032877	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Silent	SNP	ENST00000394618.3	37	CCDS8045.1																																																																																				0.607	LGALS12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396378.1	NM_033101	
SF3B2	10992	broad.mit.edu	37	11	65828098	65828098	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr11:65828098C>T	ENST00000322535.6	+	14	1724	c.1675C>T	c.(1675-1677)Cct>Tct	p.P559S	SF3B2_ENST00000528302.1_Missense_Mutation_p.P542S	NM_006842.2	NP_006833.2	Q13435	SF3B2_HUMAN	splicing factor 3b, subunit 2, 145kDa	559					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	poly(A) RNA binding (GO:0044822)	p.P559S(1)		breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(2)|lung(14)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	41						GAAAGTTCGGCCTAAGATGGG	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											140.0	124.0	129.0					11																	65828098		2201	4295	6496	65584674	SO:0001583	missense	10992			U41371	CCDS31612.1	11q13	2010-07-21	2002-08-29		ENSG00000087365	ENSG00000087365			10769	protein-coding gene	gene with protein product		605591	"""splicing factor 3b, subunit 2, 145kD"""			8566756	Standard	XM_005273726		Approved	SAP145, SF3b1, Cus1, SF3b145	uc001ogy.1	Q13435	OTTHUMG00000166751	ENST00000322535.6:c.1675C>T	11.37:g.65828098C>T	ENSP00000318861:p.Pro559Ser	Somatic		Capture	Illumina GAIIx	Phase_I	65584674	A8K485|B4DT19|Q7L4T5|Q7Z627|Q969K1|Q96CM6|Q9BWD2	Missense_Mutation	SNP	ENST00000322535.6	37	CCDS31612.1	.	.	.	.	.	.	.	.	.	.	C	32	5.164379	0.94727	.	.	ENSG00000087365	ENST00000528302;ENST00000322535;ENST00000355456	.	.	.	5.82	5.82	0.92795	Domain of unknown function DUF382 (1);	0.000000	0.85682	D	0.000000	D	0.87692	0.6241	H	0.96398	3.815	0.80722	D	1	D	0.65815	0.995	D	0.70935	0.971	D	0.90990	0.4834	9	0.87932	D	0	-12.9624	17.5904	0.87994	0.0:1.0:0.0:0.0	.	559	Q13435	SF3B2_HUMAN	S	542;559;463	.	ENSP00000318861:P559S	P	+	1	0	SF3B2	65584674	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.962000	0.76048	2.751000	0.94390	0.650000	0.86243	CCT		0.453	SF3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391352.2		
DYNC2H1	79659	broad.mit.edu	37	11	103070169	103070169	+	Silent	SNP	A	A	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr11:103070169A>G	ENST00000375735.2	+	49	8196	c.8052A>G	c.(8050-8052)ggA>ggG	p.G2684G	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Silent_p.G2684G	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2684	AAA 4. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.G117G(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TTTCCAGAGGATATGAACTGA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	11											86.0	78.0	81.0					11																	103070169		1880	4127	6007	102575379	SO:0001819	synonymous_variant	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.8052A>G	11.37:g.103070169A>G		Somatic		Capture	Illumina GAIIx	Phase_I	102575379	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	ENST00000375735.2	37	CCDS53701.1																																																																																				0.398	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
NCAPD2	9918	broad.mit.edu	37	12	6635333	6635333	+	Silent	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr12:6635333C>T	ENST00000315579.5	+	19	3247	c.2448C>T	c.(2446-2448)tgC>tgT	p.C816C	NCAPD2_ENST00000545962.1_Silent_p.C771C|NCAPD2_ENST00000542492.1_3'UTR	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	816					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)	p.C816C(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						AGCAGGTGTGCCATGCCATTG	0.527																																																1	Substitution - coding silent(1)	ovary(1)	12											79.0	77.0	77.0					12																	6635333		2203	4300	6503	6505594	SO:0001819	synonymous_variant	9918			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.2448C>T	12.37:g.6635333C>T		Somatic		Capture	Illumina GAIIx	Phase_I	6505594	D3DUR4|Q8N6U3	Silent	SNP	ENST00000315579.5	37	CCDS8548.1																																																																																				0.527	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
APOLD1	81575	broad.mit.edu	37	12	12940262	12940262	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr12:12940262C>G	ENST00000326765.6	+	2	586	c.516C>G	c.(514-516)ttC>ttG	p.F172L	APOLD1_ENST00000356591.4_Missense_Mutation_p.F141L	NM_001130415.1	NP_001123887.1	Q96LR9	APLD1_HUMAN	apolipoprotein L domain containing 1	172					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|endothelial cell activation (GO:0042118)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|regulation of endothelial cell differentiation (GO:0045601)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.F141L(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	5		Prostate(47;0.0632)		BRCA - Breast invasive adenocarcinoma(232;0.0338)|GBM - Glioblastoma multiforme(207;0.149)		TCGAGTTTTTCTGCCGCTGGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	12											81.0	92.0	89.0					12																	12940262		2203	4300	6503	12831529	SO:0001583	missense	81575			AL136783	CCDS8654.1, CCDS44833.1	12p13.2	2006-02-03	2006-01-23		ENSG00000178878	ENSG00000178878			25268	protein-coding gene	gene with protein product		612456				11230166	Standard	NM_030817		Approved	FLJ25138, DKFZP434F0318	uc001rau.4	Q96LR9	OTTHUMG00000153561	ENST00000326765.6:c.516C>G	12.37:g.12940262C>G	ENSP00000324277:p.Phe172Leu	Somatic		Capture	Illumina GAIIx	Phase_I	12831529	Q8IVR2|Q9H0I5	Missense_Mutation	SNP	ENST00000326765.6	37	CCDS44833.1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599008	0.46318	.	.	ENSG00000178878	ENST00000326765;ENST00000356591	T;T	0.01397	4.94;4.94	4.52	2.67	0.31697	.	0.358035	0.27048	U	0.021195	T	0.00906	0.0030	N	0.12182	0.205	0.35151	D	0.7698	B;B	0.24132	0.012;0.098	B;B	0.29077	0.012;0.098	T	0.48811	-0.9002	10	0.11794	T	0.64	-19.4443	4.8157	0.13365	0.162:0.5951:0.0:0.2429	.	141;172	A0AVN6;Q96LR9	.;APLD1_HUMAN	L	172;141	ENSP00000324277:F172L;ENSP00000348998:F141L	ENSP00000324277:F172L	F	+	3	2	APOLD1	12831529	0.999000	0.42202	1.000000	0.80357	0.947000	0.59692	0.419000	0.21247	1.254000	0.44035	0.579000	0.79373	TTC		0.622	APOLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331627.1	NM_030817	
PIK3C2G	5288	broad.mit.edu	37	12	18658246	18658246	+	Silent	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr12:18658246C>T	ENST00000266497.5	+	22	3089	c.3051C>T	c.(3049-3051)taC>taT	p.Y1017Y	PIK3C2G_ENST00000433979.1_Silent_p.Y1017Y|PIK3C2G_ENST00000538779.1_Silent_p.Y1058Y			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1017	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)	p.Y1017Y(1)		breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				ACTTTTTCTACTCCTGTGCTG	0.378																																																1	Substitution - coding silent(1)	ovary(1)	12											127.0	106.0	113.0					12																	18658246		1930	4154	6084	18549513	SO:0001819	synonymous_variant	5288			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3051C>T	12.37:g.18658246C>T		Somatic		Capture	Illumina GAIIx	Phase_I	18549513	A1L3U0	Silent	SNP	ENST00000266497.5	37	CCDS44839.1																																																																																				0.378	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
IRAK4	51135	broad.mit.edu	37	12	44162071	44162071	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr12:44162071A>G	ENST00000448290.2	+	2	228	c.157A>G	c.(157-159)Ata>Gta	p.I53V	IRAK4_ENST00000431837.1_5'UTR|IRAK4_ENST00000551736.1_Missense_Mutation_p.I53V|IRAK4_ENST00000440781.2_Intron	NM_016123.3	NP_057207.2	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4	53	Death.				cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.I53V(1)				all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		TCAGTTTCACATAAGGTAACA	0.308																																																1	Substitution - Missense(1)	ovary(1)	12											48.0	49.0	49.0					12																	44162071		2203	4300	6503	42448338	SO:0001583	missense	51135			AF155118	CCDS8744.1, CCDS44862.1	12q12	2014-09-17				ENSG00000198001			17967	protein-coding gene	gene with protein product		606883				3772297, 10508479	Standard	NM_001114182		Approved	NY-REN-64	uc001rnt.3	Q9NWZ3		ENST00000448290.2:c.157A>G	12.37:g.44162071A>G	ENSP00000390651:p.Ile53Val	Somatic		Capture	Illumina GAIIx	Phase_I	42448338	Q69FE1|Q8TDF7|Q9Y589	Missense_Mutation	SNP	ENST00000448290.2	37	CCDS8744.1	.	.	.	.	.	.	.	.	.	.	A	9.365	1.069105	0.20147	.	.	ENSG00000198001	ENST00000550616;ENST00000448290;ENST00000551736;ENST00000356669	T;T;T	0.68903	-0.36;-0.36;-0.36	5.5	5.5	0.81552	DEATH-like (2);	0.084306	0.85682	D	0.000000	T	0.53642	0.1809	L	0.35341	1.055	0.80722	D	1	B	0.09022	0.002	B	0.12837	0.008	T	0.49163	-0.8968	10	0.23891	T	0.37	-29.4209	11.3724	0.49708	0.8643:0.0:0.0:0.1357	.	53	Q9NWZ3	IRAK4_HUMAN	V	53	ENSP00000446571:I53V;ENSP00000390651:I53V;ENSP00000446490:I53V	ENSP00000349096:I53V	I	+	1	0	IRAK4	42448338	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	2.911000	0.48774	2.221000	0.72209	0.528000	0.53228	ATA		0.308	IRAK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403947.1		
TBX5	6910	broad.mit.edu	37	12	114793771	114793771	+	Missense_Mutation	SNP	G	G	A	rs377532269		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr12:114793771G>A	ENST00000310346.4	-	9	1789	c.1123C>T	c.(1123-1125)Cgg>Tgg	p.R375W	TBX5_ENST00000349716.5_Missense_Mutation_p.R325W|TBX5_ENST00000405440.2_Missense_Mutation_p.R375W	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	375					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R375W(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CAAGCTTGCCGCTGTGCCGAC	0.592																																					NSCLC(152;1358 1980 4050 23898 40356)											2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	12						G	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	96.0	84.0	88.0		1123,973,1123	5.3	1.0	12		88	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	TBX5	NM_000192.3,NM_080717.2,NM_181486.1	101,101,101	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	375/519,325/469,375/519	114793771	2,13004	2203	4300	6503	113278154	SO:0001583	missense	6910			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1123C>T	12.37:g.114793771G>A	ENSP00000309913:p.Arg375Trp	Somatic		Capture	Illumina GAIIx	Phase_I	113278154	A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	ENST00000310346.4	37	CCDS9173.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979138	0.92982	0.0	2.33E-4	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440	T;T;T	0.53206	0.63;0.63;0.63	5.27	5.27	0.74061	.	0.059422	0.64402	D	0.000001	T	0.71134	0.3304	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	T	0.75758	-0.3205	10	0.87932	D	0	.	18.8889	0.92391	0.0:0.0:1.0:0.0	.	375	Q99593	TBX5_HUMAN	W	325;375;272;375	ENSP00000337723:R325W;ENSP00000309913:R375W;ENSP00000384152:R375W	ENSP00000309913:R375W	R	-	1	2	TBX5	113278154	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.648000	0.83479	2.463000	0.83235	0.655000	0.94253	CGG		0.592	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717	
UBAC2	337867	broad.mit.edu	37	13	99966370	99966370	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr13:99966370C>G	ENST00000403766.3	+	5	544	c.409C>G	c.(409-411)Ctg>Gtg	p.L137V	UBAC2_ENST00000460562.1_3'UTR|UBAC2_ENST00000376440.2_Missense_Mutation_p.L102V	NM_001144072.1	NP_001137544.1	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2	137					protein localization to endoplasmic reticulum (GO:0070972)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.L102V(1)		breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)	10	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGTGTTTGCTCTGTTTGTACC	0.368																																																1	Substitution - Missense(1)	ovary(1)	13											164.0	154.0	158.0					13																	99966370		2203	4300	6503	98764371	SO:0001583	missense	337867			AK055110	CCDS9490.1, CCDS45064.1	13q32.3	2012-02-01	2007-04-20	2007-04-20	ENSG00000134882	ENSG00000134882			20486	protein-coding gene	gene with protein product			"""phosphoglycerate dehydrogenase like 1"""	PHGDHL1			Standard	NM_177967		Approved	FLJ30548, RP11-178C10.1	uc001voa.4	Q8NBM4	OTTHUMG00000017267	ENST00000403766.3:c.409C>G	13.37:g.99966370C>G	ENSP00000383911:p.Leu137Val	Somatic		Capture	Illumina GAIIx	Phase_I	98764371	B3KNV7|Q0VAB5|Q5W0W6|Q5W0W9|Q6GQR2|Q6P4B0|Q8N2E8|Q96NW2	Missense_Mutation	SNP	ENST00000403766.3	37	CCDS45064.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.405211	0.83230	.	.	ENSG00000134882	ENST00000403766;ENST00000376440	T	0.16196	2.36	5.91	5.91	0.95273	.	0.075119	0.56097	D	0.000033	T	0.46444	0.1393	M	0.81239	2.535	0.80722	D	1	D;D;D;P	0.71674	0.998;0.997;0.997;0.953	D;D;D;P	0.66847	0.947;0.921;0.917;0.631	T	0.29941	-0.9995	9	.	.	.	-14.6142	20.3053	0.98627	0.0:1.0:0.0:0.0	.	67;102;137;137	B7Z6T7;Q8NBM4-2;A8K2S7;Q8NBM4	.;.;.;UBAC2_HUMAN	V	137;102	ENSP00000383911:L137V	.	L	+	1	2	UBAC2	98764371	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.840000	0.55843	2.808000	0.96608	0.655000	0.94253	CTG		0.368	UBAC2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045588.1	NM_177967	
G2E3	55632	broad.mit.edu	37	14	31081515	31081515	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr14:31081515G>A	ENST00000206595.6	+	13	1757	c.1603G>A	c.(1603-1605)Gat>Aat	p.D535N	G2E3_ENST00000553504.1_Missense_Mutation_p.D565N|G2E3_ENST00000438909.2_Missense_Mutation_p.D489N	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	535	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D535N(1)		endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GACATTAAGTGATAAATATAT	0.318																																																1	Substitution - Missense(1)	ovary(1)	14											91.0	95.0	93.0					14																	31081515		2203	4295	6498	30151266	SO:0001583	missense	55632			AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.1603G>A	14.37:g.31081515G>A	ENSP00000206595:p.Asp535Asn	Somatic		Capture	Illumina GAIIx	Phase_I	30151266	Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	ENST00000206595.6	37	CCDS9638.1	.	.	.	.	.	.	.	.	.	.	G	33	5.213278	0.95069	.	.	ENSG00000092140	ENST00000206595;ENST00000438909;ENST00000553504	T;T;T	0.37584	1.19;1.19;1.19	5.47	5.47	0.80525	HECT (3);	0.139939	0.64402	D	0.000005	T	0.61413	0.2345	M	0.69823	2.125	0.53005	D	0.999965	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.57021	-0.7882	10	0.37606	T	0.19	-25.9718	19.6892	0.95991	0.0:0.0:1.0:0.0	.	47;535	Q49AD9;Q7L622	.;G2E3_HUMAN	N	535;489;565	ENSP00000206595:D535N;ENSP00000391068:D489N;ENSP00000451653:D565N	ENSP00000206595:D535N	D	+	1	0	G2E3	30151266	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	8.196000	0.89725	2.717000	0.92951	0.555000	0.69702	GAT		0.318	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276613.2	NM_017769	
EVL	51466	broad.mit.edu	37	14	100603941	100603941	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr14:100603941A>T	ENST00000402714.2	+	10	1589	c.985A>T	c.(985-987)Agc>Tgc	p.S329C	EVL_ENST00000544450.2_Missense_Mutation_p.S335C|EVL_ENST00000392920.3_Missense_Mutation_p.S331C			Q9UI08	EVL_HUMAN	Enah/Vasp-like	329	EVH2.			S -> N (in Ref. 2; AAP97156). {ECO:0000305}.	actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)	p.S331C(1)		cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				CTGGGAGCGGAGCAACTCGGT	0.622																																																1	Substitution - Missense(1)	ovary(1)	14											68.0	79.0	76.0					14																	100603941		2203	4300	6503	99673694	SO:0001583	missense	51466			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.985A>T	14.37:g.100603941A>T	ENSP00000384720:p.Ser329Cys	Somatic		Capture	Illumina GAIIx	Phase_I	99673694	A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	ENST00000402714.2	37		.	.	.	.	.	.	.	.	.	.	A	25.3	4.619907	0.87460	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470;ENST00000554695	T;T;T;T	0.73575	-0.65;-0.76;-0.67;-0.03	4.73	4.73	0.59995	.	0.226336	0.37623	N	0.002005	D	0.83151	0.5192	L	0.56769	1.78	0.54753	D	0.999983	D;D;D	0.76494	0.999;0.996;0.991	D;P;P	0.77557	0.99;0.855;0.862	D	0.85066	0.0937	10	0.72032	D	0.01	-4.7394	14.2074	0.65744	1.0:0.0:0.0:0.0	.	335;331;329	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	C	329;335;331;294;146	ENSP00000384720:S329C;ENSP00000437904:S335C;ENSP00000376652:S331C;ENSP00000451821:S146C	ENSP00000376652:S331C	S	+	1	0	EVL	99673694	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.978000	0.56881	1.756000	0.51951	0.459000	0.35465	AGC		0.622	EVL-006	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000413958.1		
PLA2G4F	255189	broad.mit.edu	37	15	42442046	42442046	+	Splice_Site	SNP	G	G	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr15:42442046G>T	ENST00000382396.4	-	11	1010	c.924C>A	c.(922-924)agC>agA	p.S308R	PLA2G4F_ENST00000397272.3_Splice_Site_p.S308R			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	308	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)	p.S308R(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		GGTCCCCGGAGCTGCCTCAAG	0.632																																																1	Substitution - Missense(1)	ovary(1)	15											59.0	61.0	60.0					15																	42442046		2203	4299	6502	40229338	SO:0001630	splice_region_variant	255189				CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.924-1C>A	15.37:g.42442046G>T		Somatic		Capture	Illumina GAIIx	Phase_I	40229338	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	37	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	G	7.137	0.580977	0.13686	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000357924;ENST00000443825	T;T	0.01505	4.82;4.86	4.72	3.79	0.43588	Lysophospholipase, catalytic domain (2);	0.273852	0.30639	N	0.009197	T	0.01800	0.0057	L	0.31752	0.955	0.32154	N	0.583844	B;B	0.18461	0.028;0.028	B;B	0.17433	0.018;0.018	T	0.21655	-1.0239	10	0.22109	T	0.4	.	12.2165	0.54410	0.0:0.1713:0.8287:0.0	.	95;308	A2RRC4;Q68DD2	.;PA24F_HUMAN	R	304;308;308;308;308	ENSP00000380442:S308R;ENSP00000371833:S308R	ENSP00000290497:S304R	S	-	3	2	PLA2G4F	40229338	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	2.003000	0.40844	1.188000	0.43014	0.655000	0.94253	AGC		0.632	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	Missense_Mutation
UBE2Q2	92912	broad.mit.edu	37	15	76191783	76191783	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr15:76191783C>G	ENST00000267938.4	+	13	1494	c.1112C>G	c.(1111-1113)cCa>cGa	p.P371R	UBE2Q2_ENST00000338677.4_Silent_p.S300S|UBE2Q2_ENST00000569423.1_Missense_Mutation_p.P336R|UBE2Q2_ENST00000561851.1_Missense_Mutation_p.P355R	NM_173469.2	NP_775740.1	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q family member 2	371					protein K48-linked ubiquitination (GO:0070936)	cytoplasm (GO:0005737)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.P371R(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	12						TACACCCCTCCAAAGGAAGAT	0.338																																																1	Substitution - Missense(1)	ovary(1)	15											109.0	100.0	103.0					15																	76191783		2197	4294	6491	73978838	SO:0001583	missense	92912			BC017708	CCDS10286.1, CCDS45309.1, CCDS66839.1	15q24.2	2010-05-12	2008-05-02		ENSG00000140367	ENSG00000140367		"""Ubiquitin-conjugating enzymes E2"""	19248	protein-coding gene	gene with protein product		612501	"""ubiquitin-conjugating enzyme E2Q (putative) 2"""			16300736	Standard	NM_001145335		Approved	DKFZp762C143	uc002bbg.2	Q8WVN8	OTTHUMG00000142839	ENST00000267938.4:c.1112C>G	15.37:g.76191783C>G	ENSP00000267938:p.Pro371Arg	Somatic		Capture	Illumina GAIIx	Phase_I	73978838	B7Z3Q2|H3BRG2|Q8N4G6|Q96J08	Missense_Mutation	SNP	ENST00000267938.4	37	CCDS10286.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125302	0.77436	.	.	ENSG00000140367	ENST00000267938;ENST00000426727	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.76407	0.3983	M	0.80508	2.5	0.80722	D	1	P;P;D	0.53462	0.894;0.93;0.96	B;P;B	0.52881	0.403;0.712;0.403	T	0.79137	-0.1927	9	0.87932	D	0	.	19.4072	0.94653	0.0:1.0:0.0:0.0	.	355;355;371	E9PHD0;B7Z3Q2;Q8WVN8	.;.;UB2Q2_HUMAN	R	371;355	.	ENSP00000267938:P371R	P	+	2	0	UBE2Q2	73978838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.215000	0.65241	2.832000	0.97577	0.650000	0.86243	CCA		0.338	UBE2Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286475.1	NM_173469	
UNC45A	55898	broad.mit.edu	37	15	91492645	91492645	+	Missense_Mutation	SNP	A	A	G	rs371695364		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr15:91492645A>G	ENST00000418476.2	+	14	2018	c.1978A>G	c.(1978-1980)Acc>Gcc	p.T660A	UNC45A_ENST00000394275.2_Missense_Mutation_p.T645A|AC068831.6_ENST00000553321.1_RNA	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	660					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.T660A(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CCCTGTGCTGACCAGTTCCTG	0.622																																																1	Substitution - Missense(1)	ovary(1)	15											67.0	50.0	56.0					15																	91492645		2198	4298	6496	89293649	SO:0001583	missense	55898				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.1978A>G	15.37:g.91492645A>G	ENSP00000407487:p.Thr660Ala	Somatic		Capture	Illumina GAIIx	Phase_I	89293649	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	ENST00000418476.2	37	CCDS10367.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.127152	0.77549	.	.	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.69040	-0.37;-0.37	5.28	5.28	0.74379	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67297	0.2878	M	0.68952	2.095	0.58432	D	0.999998	P;P	0.49253	0.921;0.921	B;B	0.42882	0.401;0.401	T	0.71981	-0.4428	10	0.51188	T	0.08	-35.3869	15.4317	0.75105	1.0:0.0:0.0:0.0	.	660;645	Q9H3U1;A8K6F7	UN45A_HUMAN;.	A	645;660	ENSP00000377816:T645A;ENSP00000407487:T660A	ENSP00000377816:T645A	T	+	1	0	UNC45A	89293649	1.000000	0.71417	0.992000	0.48379	0.974000	0.67602	9.042000	0.93793	2.230000	0.72887	0.529000	0.55759	ACC		0.622	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280406.2	NM_018671	
KIFC3	3801	broad.mit.edu	37	16	57799531	57799531	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr16:57799531C>T	ENST00000379655.4	-	11	1609	c.1352G>A	c.(1351-1353)cGt>cAt	p.R451H	KIFC3_ENST00000421376.2_Missense_Mutation_p.R312H|KIFC3_ENST00000539578.1_Missense_Mutation_p.R393H|KIFC3_ENST00000540079.2_Missense_Mutation_p.R349H|KIFC3_ENST00000543930.1_Missense_Mutation_p.R312H|KIFC3_ENST00000562903.1_Missense_Mutation_p.R312H|KIFC3_ENST00000465878.2_Missense_Mutation_p.R312H|KIFC3_ENST00000541240.1_Missense_Mutation_p.R473H|KIFC3_ENST00000445690.2_Missense_Mutation_p.R451H	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	451	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R451H(1)		breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				TGGCCGGACACGAGCAATCAC	0.577																																																1	Substitution - Missense(1)	ovary(1)	16											119.0	76.0	91.0					16																	57799531		2198	4300	6498	56357032	SO:0001583	missense	3801			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.1352G>A	16.37:g.57799531C>T	ENSP00000368976:p.Arg451His	Somatic		Capture	Illumina GAIIx	Phase_I	56357032	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	ENST00000379655.4	37	CCDS10789.2	.	.	.	.	.	.	.	.	.	.	C	17.78	3.474732	0.63737	.	.	ENSG00000140859	ENST00000379655;ENST00000445690;ENST00000421376;ENST00000541240;ENST00000540079;ENST00000543930;ENST00000539578	T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.4	4.44	0.53790	Kinesin, motor domain (4);	0.112377	0.64402	D	0.000008	D	0.89093	0.6617	H	0.96720	3.87	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.92507	0.6013	10	0.87932	D	0	.	14.5796	0.68278	0.1471:0.8529:0.0:0.0	.	473;393;312;349;156;451;312	B7Z484;F5H4I9;B7Z896;F5H3M2;B7Z3I6;Q9BVG8;A8K6S2	.;.;.;.;.;KIFC3_HUMAN;.	H	451;451;312;473;349;312;393	ENSP00000368976:R451H;ENSP00000401696:R451H;ENSP00000396399:R312H;ENSP00000442008:R473H;ENSP00000438805:R349H;ENSP00000444012:R312H;ENSP00000444884:R393H	ENSP00000368976:R451H	R	-	2	0	KIFC3	56357032	1.000000	0.71417	0.980000	0.43619	0.021000	0.10359	7.616000	0.83018	1.271000	0.44313	-0.182000	0.12963	CGT		0.577	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257329.2	NM_005550	
ZFP1	162239	broad.mit.edu	37	16	75203858	75203858	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr16:75203858A>T	ENST00000393430.2	+	4	974	c.850A>T	c.(850-852)Acc>Tcc	p.T284S	ZFP1_ENST00000570010.1_Missense_Mutation_p.T284S|ZFP1_ENST00000568079.1_3'UTR|ZFP1_ENST00000332307.4_Missense_Mutation_p.T251S|ZFP1_ENST00000464850.1_3'UTR			Q6P2D0	ZFP1_HUMAN	ZFP1 zinc finger protein	284					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T284S(1)		endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	12						GTTTGAACTCACCACACACCA	0.423																																					NSCLC(187;1429 2122 10143 20357 42217)											1	Substitution - Missense(1)	ovary(1)	16											72.0	72.0	72.0					16																	75203858		2198	4300	6498	73761359	SO:0001583	missense	162239			AK094761	CCDS10914.2	16q22.3	2013-01-08	2012-11-27		ENSG00000184517	ENSG00000184517		"""Zinc fingers, C2H2-type"", ""-"""	23328	protein-coding gene	gene with protein product			"""zinc finger protein 1 homolog (mouse)"", ""zinc finger protein 1"""			2574853	Standard	NM_153688		Approved	FLJ34243, ZNF475	uc002fdo.3	Q6P2D0	OTTHUMG00000137602	ENST00000393430.2:c.850A>T	16.37:g.75203858A>T	ENSP00000377080:p.Thr284Ser	Somatic		Capture	Illumina GAIIx	Phase_I	73761359	A8K5Q7|B4DKG9|Q8N188|Q8N9F9	Missense_Mutation	SNP	ENST00000393430.2	37	CCDS10914.2	.	.	.	.	.	.	.	.	.	.	A	12.89	2.073111	0.36566	.	.	ENSG00000184517	ENST00000332307;ENST00000393430	T	0.07216	3.21	4.64	3.52	0.40303	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000134	T	0.05181	0.0138	N	0.13168	0.305	0.80722	D	1	B	0.31125	0.309	B	0.30943	0.122	T	0.48375	-0.9041	10	0.32370	T	0.25	-19.09	9.961	0.41697	0.8292:0.1708:0.0:0.0	.	284	Q6P2D0	ZFP1_HUMAN	S	284	ENSP00000377080:T284S	ENSP00000333192:T284S	T	+	1	0	ZFP1	73761359	0.003000	0.15002	1.000000	0.80357	0.989000	0.77384	2.227000	0.42972	1.067000	0.40740	0.533000	0.62120	ACC		0.423	ZFP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269013.2	NM_153688	
TP53	7157	broad.mit.edu	37	17	7578496	7578496	+	Missense_Mutation	SNP	A	A	C	rs587782197		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr17:7578496A>C	ENST00000269305.4	-	5	623	c.434T>G	c.(433-435)cTg>cGg	p.L145R	TP53_ENST00000413465.2_Missense_Mutation_p.L145R|TP53_ENST00000445888.2_Missense_Mutation_p.L145R|TP53_ENST00000359597.4_Missense_Mutation_p.L145R|TP53_ENST00000455263.2_Missense_Mutation_p.L145R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.L145R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	145	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> M (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> Q (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L145Q(17)|p.L145P(17)|p.0?(8)|p.L145R(7)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.W146fs*25(1)|p.W146fs*22(1)|p.L145del(1)|p.V143_S149del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATCAACCCACAGCTGCACAGG	0.602		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	57	Substitution - Missense(41)|Whole gene deletion(8)|Deletion - In frame(4)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	breast(11)|ovary(9)|large_intestine(7)|central_nervous_system(5)|oesophagus(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|lung(3)|stomach(2)|urinary_tract(2)|liver(2)|prostate(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	17											57.0	57.0	57.0					17																	7578496		2203	4300	6503	7519221	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.434T>G	17.37:g.7578496A>C	ENSP00000269305:p.Leu145Arg	Somatic		Capture	Illumina GAIIx	Phase_I	7519221	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	16.01	3.002053	0.54254	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99816	-6.91;-6.91;-6.91;-6.91;-6.91;-6.91;-6.91;-6.91;-6.91	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.153372	0.45361	D	0.000370	D	0.99736	0.9896	M	0.71581	2.175	0.51767	D	0.999938	D;P;D;D;P;D;D	0.89917	1.0;0.903;0.996;1.0;0.933;0.979;1.0	D;P;D;D;D;D;D	0.85130	0.997;0.858;0.955;0.997;0.935;0.935;0.996	D	0.97018	0.9741	10	0.87932	D	0	-1.0943	13.8301	0.63375	1.0:0.0:0.0:0.0	.	106;145;145;52;145;145;145	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	145;145;145;145;145;145;134;52;13;52;13;145	ENSP00000410739:L145R;ENSP00000352610:L145R;ENSP00000269305:L145R;ENSP00000398846:L145R;ENSP00000391127:L145R;ENSP00000391478:L145R;ENSP00000425104:L13R;ENSP00000423862:L52R;ENSP00000424104:L145R	ENSP00000269305:L145R	L	-	2	0	TP53	7519221	1.000000	0.71417	0.420000	0.26596	0.013000	0.08279	9.283000	0.95860	2.206000	0.71126	0.533000	0.62120	CTG		0.602	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
GLP2R	9340	broad.mit.edu	37	17	9791266	9791266	+	Silent	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr17:9791266G>A	ENST00000262441.5	+	12	1815	c.1302G>A	c.(1300-1302)ttG>ttA	p.L434L	GLP2R_ENST00000574745.1_Silent_p.L254L	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	434					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)	p.L434L(1)		endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	TGGTGGCCTTGCAGTATGGTT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	17											333.0	281.0	299.0					17																	9791266		2203	4300	6503	9731991	SO:0001819	synonymous_variant	9340			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.1302G>A	17.37:g.9791266G>A		Somatic		Capture	Illumina GAIIx	Phase_I	9731991	Q4VAT3	Silent	SNP	ENST00000262441.5	37	CCDS11150.1																																																																																				0.507	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4		
KIAA0100	9703	broad.mit.edu	37	17	26962195	26962195	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr17:26962195T>A	ENST00000528896.2	-	16	2484	c.2410A>T	c.(2410-2412)Aac>Tac	p.N804Y	KIAA0100_ENST00000389003.3_Missense_Mutation_p.N661Y|RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.N661Y|RP11-192H23.7_ENST00000583787.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	804						extracellular region (GO:0005576)		p.N804Y(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GGGAAGGGGTTCCGGTGGAGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											98.0	114.0	108.0					17																	26962195		2203	4300	6503	23986322	SO:0001583	missense	9703			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2410A>T	17.37:g.26962195T>A	ENSP00000436773:p.Asn804Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	23986322	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	T	12.94	2.088497	0.36855	.	.	ENSG00000007202	ENST00000005905;ENST00000528896;ENST00000544884	T;T	0.24151	1.87;1.88	5.89	5.89	0.94794	.	0.272591	0.44285	D	0.000467	T	0.18425	0.0442	L	0.60455	1.87	0.33063	D	0.534406	P	0.46277	0.875	B	0.31751	0.135	T	0.41945	-0.9480	10	0.37606	T	0.19	.	5.71	0.17929	0.1413:0.1083:0.0:0.7505	.	804	Q14667	K0100_HUMAN	Y	804;804;661	ENSP00000436773:N804Y;ENSP00000446443:N661Y	ENSP00000005905:N804Y	N	-	1	0	KIAA0100	23986322	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.069000	0.41481	2.252000	0.74401	0.455000	0.32223	AAC		0.542	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
EPB41L3	23136	broad.mit.edu	37	18	5406870	5406870	+	Missense_Mutation	SNP	G	G	A	rs139317911	byFrequency	TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr18:5406870G>A	ENST00000341928.2	-	16	2595	c.2255C>T	c.(2254-2256)aCg>aTg	p.T752M	EPB41L3_ENST00000427684.2_Missense_Mutation_p.T24M|EPB41L3_ENST00000544123.1_Missense_Mutation_p.T583M|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000542146.1_Missense_Mutation_p.T24M|EPB41L3_ENST00000400111.3_Missense_Mutation_p.T571M|EPB41L3_ENST00000342933.3_Missense_Mutation_p.T752M|EPB41L3_ENST00000540638.2_Missense_Mutation_p.T571M	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	752	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.T752M(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CCATTCATTCGTTACGGCAGT	0.502																																																1	Substitution - Missense(1)	ovary(1)	18						G	MET/THR	3,4403	6.2+/-15.9	0,3,2200	202.0	161.0	175.0		2255	4.8	0.1	18	dbSNP_134	175	0,8600		0,0,4300	yes	missense	EPB41L3	NM_012307.2	81	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	possibly-damaging	752/1088	5406870	3,13003	2203	4300	6503	5396870	SO:0001583	missense	23136			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2255C>T	18.37:g.5406870G>A	ENSP00000343158:p.Thr752Met	Somatic		Capture	Illumina GAIIx	Phase_I	5396870	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	G	4.523	0.097121	0.08681	6.81E-4	0.0	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;D;T;T;T;D	0.82526	-1.43;-1.59;-0.05;-0.07;-1.43;-1.62	5.78	4.85	0.62838	SAB (1);	0.456856	0.26987	N	0.021490	D	0.85375	0.5682	L	0.36672	1.1	0.09310	N	1	D;B;P;B;B;D;B;D	0.89917	1.0;0.213;0.579;0.437;0.016;0.993;0.075;0.999	D;B;B;B;B;P;B;D	0.85130	0.997;0.081;0.14;0.15;0.016;0.817;0.066;0.912	T	0.76669	-0.2874	10	0.59425	D	0.04	.	9.2809	0.37727	0.0815:0.1408:0.7777:0.0	.	583;24;24;144;462;571;752;24	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	M	752;462;583;462;24;24;752;571	ENSP00000343158:T752M;ENSP00000441174:T583M;ENSP00000392195:T24M;ENSP00000442233:T24M;ENSP00000341138:T752M;ENSP00000382981:T571M	ENSP00000343158:T752M	T	-	2	0	EPB41L3	5396870	0.199000	0.23386	0.064000	0.19789	0.118000	0.20060	2.907000	0.48743	1.328000	0.45358	0.655000	0.94253	ACG		0.502	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
TRAPPC8	22878	broad.mit.edu	37	18	29435655	29435655	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr18:29435655G>C	ENST00000283351.4	-	21	3639	c.3304C>G	c.(3304-3306)Cta>Gta	p.L1102V	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.L1048V	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	1102					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.L1102V(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ACAAAGACTAGCATATTGCCT	0.358																																																1	Substitution - Missense(1)	ovary(1)	18											109.0	107.0	108.0					18																	29435655		2203	4300	6503	27689653	SO:0001583	missense	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.3304C>G	18.37:g.29435655G>C	ENSP00000283351:p.Leu1102Val	Somatic		Capture	Illumina GAIIx	Phase_I	27689653	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	ENST00000283351.4	37	CCDS11901.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.274608	0.23307	.	.	ENSG00000153339	ENST00000283351	T	0.18338	2.22	5.61	3.58	0.41010	.	0.153050	0.45606	D	0.000358	T	0.11665	0.0284	L	0.38175	1.15	0.80722	D	1	B	0.16802	0.019	B	0.24848	0.056	T	0.16837	-1.0389	10	0.26408	T	0.33	.	3.3714	0.07222	0.1663:0.1315:0.5672:0.135	.	1102	Q9Y2L5	TPPC8_HUMAN	V	1102	ENSP00000283351:L1102V	ENSP00000283351:L1102V	L	-	1	2	TRAPPC8	27689653	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.893000	0.39758	0.661000	0.30985	0.585000	0.79938	CTA		0.358	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
HPN	3249	broad.mit.edu	37	19	35556531	35556531	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr19:35556531C>G	ENST00000262626.2	+	11	1821	c.996C>G	c.(994-996)atC>atG	p.I332M	HPN_ENST00000597419.1_Missense_Mutation_p.I174M|HPN_ENST00000392226.1_Missense_Mutation_p.I332M|HPN-AS1_ENST00000392227.2_RNA	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	332	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)	p.I332M(1)		central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	GAAACCAGATCAAGCCCAAGA	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											74.0	73.0	74.0					19																	35556531		2203	4300	6503	40248371	SO:0001583	missense	3249				CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.996C>G	19.37:g.35556531C>G	ENSP00000262626:p.Ile332Met	Somatic		Capture	Illumina GAIIx	Phase_I	40248371	B2RDS4	Missense_Mutation	SNP	ENST00000262626.2	37	CCDS32993.1	.	.	.	.	.	.	.	.	.	.	c	20.9	4.059998	0.76074	.	.	ENSG00000105707	ENST00000262626;ENST00000392226;ENST00000541345	D;D	0.90069	-2.61;-2.61	5.36	5.36	0.76844	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.054494	0.64402	D	0.000001	D	0.93210	0.7837	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	0.995;1.0;1.0	D;D;D	0.87578	0.966;0.989;0.998	D	0.93267	0.6648	10	0.72032	D	0.01	.	10.0916	0.42449	0.0:0.9085:0.0:0.0915	.	304;332;332	B7Z1L4;B2ZDQ2;P05981	.;.;HEPS_HUMAN	M	332;332;304	ENSP00000262626:I332M;ENSP00000376060:I332M	ENSP00000262626:I332M	I	+	3	3	HPN	40248371	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.109000	0.50345	2.525000	0.85131	0.556000	0.70494	ATC		0.612	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151	
SPTBN4	57731	broad.mit.edu	37	19	41003432	41003432	+	Silent	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr19:41003432C>T	ENST00000352632.3	+	7	791	c.705C>T	c.(703-705)tcC>tcT	p.S235S	SPTBN4_ENST00000595535.1_Silent_p.S235S|SPTBN4_ENST00000344104.3_Silent_p.S235S|SPTBN4_ENST00000338932.3_Silent_p.S235S|SPTBN4_ENST00000598249.1_Silent_p.S235S			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	235	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.S235S(1)		breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCACCAAGTCCAATGCCAACT	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19											107.0	89.0	95.0					19																	41003432		2203	4300	6503	45695272	SO:0001819	synonymous_variant	57731			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.705C>T	19.37:g.41003432C>T		Somatic		Capture	Illumina GAIIx	Phase_I	45695272	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	37	CCDS12559.1																																																																																				0.652	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
VSNL1	7447	broad.mit.edu	37	2	17773383	17773383	+	Missense_Mutation	SNP	G	G	T	rs201755586		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr2:17773383G>T	ENST00000406397.1	+	2	567	c.42G>T	c.(40-42)gaG>gaT	p.E14D	VSNL1_ENST00000295156.4_Missense_Mutation_p.E14D|VSNL1_ENST00000404666.2_Missense_Mutation_p.E14D			P62760	VISL1_HUMAN	visinin-like 1	14					calcium-mediated signaling (GO:0019722)		calcium ion binding (GO:0005509)	p.E14D(1)		NS(1)|breast(1)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AAGTGATGGAGGACCTGGTGA	0.453																																																1	Substitution - Missense(1)	ovary(1)	2											147.0	143.0	145.0					2																	17773383		2203	4300	6503	17636864	SO:0001583	missense	7447				CCDS1689.1	2p24.3	2013-01-10			ENSG00000163032	ENSG00000163032		"""EF-hand domain containing"""	12722	protein-coding gene	gene with protein product	"""hippocalcin-like protein 3"""	600817				8530085, 2202488	Standard	NM_003385		Approved	VILIP, HPCAL3, HUVISL1, HLP3, VILIP-1	uc002rcm.3	P62760	OTTHUMG00000090645	ENST00000406397.1:c.42G>T	2.37:g.17773383G>T	ENSP00000384719:p.Glu14Asp	Somatic		Capture	Illumina GAIIx	Phase_I	17636864	D6W515|P28677|P29103|P42323|Q9UM20	Missense_Mutation	SNP	ENST00000406397.1	37	CCDS1689.1	.	.	.	.	.	.	.	.	.	.	G	9.015	0.983374	0.18889	.	.	ENSG00000163032	ENST00000404666;ENST00000457525;ENST00000295156;ENST00000451533;ENST00000406397	T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88	5.44	3.66	0.41972	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.16128	0.0388	N	0.21194	0.64	0.53688	D	0.99997	B	0.02656	0.0	B	0.01281	0.0	T	0.06023	-1.0850	10	0.25106	T	0.35	.	10.4937	0.44764	0.2184:0.0:0.7816:0.0	.	14	P62760	VISL1_HUMAN	D	14	ENSP00000384014:E14D;ENSP00000405511:E14D;ENSP00000295156:E14D;ENSP00000390124:E14D;ENSP00000384719:E14D	ENSP00000295156:E14D	E	+	3	2	VSNL1	17636864	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.877000	0.48506	0.801000	0.34066	-0.145000	0.13849	GAG		0.453	VSNL1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323803.1	NM_003385	
LAPTM4A	9741	broad.mit.edu	37	2	20240751	20240751	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr2:20240751T>G	ENST00000175091.4	-	2	640	c.133A>C	c.(133-135)Att>Ctt	p.I45L		NM_014713.4	NP_055528.1	Q15012	LAP4A_HUMAN	lysosomal protein transmembrane 4 alpha	45					transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.I45L(1)		endometrium(3)|kidney(1)|large_intestine(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCAGCAAAATTGCCATCAAT	0.403																																					Ovarian(90;1240 1386 7711 14384 46863)											1	Substitution - Missense(1)	ovary(1)	2											129.0	118.0	122.0					2																	20240751		2203	4300	6503	20104232	SO:0001583	missense	9741			D14696	CCDS1696.1	2p24.1	2008-08-11	2008-08-11		ENSG00000068697	ENSG00000068697			6924	protein-coding gene	gene with protein product			"""lysosomal-associated protein transmembrane 4 alpha"""	MBNT		8621662, 7788527	Standard	NM_014713		Approved	HUMORF13, KIAA0108, Mtrp, LAPTM4	uc002rdm.3	Q15012	OTTHUMG00000090750	ENST00000175091.4:c.133A>C	2.37:g.20240751T>G	ENSP00000175091:p.Ile45Leu	Somatic		Capture	Illumina GAIIx	Phase_I	20104232	Q6UW22	Missense_Mutation	SNP	ENST00000175091.4	37	CCDS1696.1	.	.	.	.	.	.	.	.	.	.	T	10.20	1.284743	0.23392	.	.	ENSG00000068697	ENST00000175091	T	0.55930	0.49	5.99	5.99	0.97316	.	0.064020	0.64402	D	0.000001	T	0.30916	0.0780	N	0.05230	-0.09	0.80722	D	1	B;B	0.13145	0.007;0.005	B;B	0.15484	0.007;0.013	T	0.21381	-1.0247	10	0.13108	T	0.6	-16.3786	14.2352	0.65922	0.0:0.0:0.0:1.0	.	45;45	B4E2U6;Q15012	.;LAP4A_HUMAN	L	45	ENSP00000175091:I45L	ENSP00000175091:I45L	I	-	1	0	LAPTM4A	20104232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.951000	0.70273	2.291000	0.77112	0.533000	0.62120	ATT		0.403	LAPTM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207494.1	NM_014713	
DPYSL5	56896	broad.mit.edu	37	2	27150301	27150301	+	Splice_Site	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr2:27150301G>A	ENST00000288699.6	+	4	758		c.e4+1		DPYSL5_ENST00000401478.1_Splice_Site	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5						axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.?(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTGGCCGAGGCAAGTCTGCA	0.547																																																1	Unknown(1)	ovary(1)	2											59.0	51.0	54.0					2																	27150301		2203	4300	6503	27003805	SO:0001630	splice_region_variant	56896			AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.600+1G>A	2.37:g.27150301G>A		Somatic		Capture	Illumina GAIIx	Phase_I	27003805	Q8TCL6|Q9NQC4|Q9NRY9	Splice_Site	SNP	ENST00000288699.6	37	CCDS1730.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465185	0.84425	.	.	ENSG00000157851	ENST00000288699;ENST00000401478	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.569	0.91128	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DPYSL5	27003805	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	9.303000	0.96183	2.767000	0.95098	0.655000	0.94253	.		0.547	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	Intron
USP34	9736	broad.mit.edu	37	2	61538678	61538678	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr2:61538678G>A	ENST00000398571.2	-	27	3890	c.3814C>T	c.(3814-3816)Cct>Tct	p.P1272S		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1272					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.P1272S(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GGCTTACCAGGAAACTCTCCT	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											64.0	63.0	63.0					2																	61538678		1814	4068	5882	61392182	SO:0001583	missense	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.3814C>T	2.37:g.61538678G>A	ENSP00000381577:p.Pro1272Ser	Somatic		Capture	Illumina GAIIx	Phase_I	61392182	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295342	0.60086	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.03689	3.84	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.02807	0.0084	N	0.08118	0	0.80722	D	1	P	0.47762	0.9	B	0.38264	0.269	T	0.63651	-0.6589	10	0.39692	T	0.17	.	18.9757	0.92735	0.0:0.0:1.0:0.0	.	1272	Q70CQ2	UBP34_HUMAN	S	1120;1120;1272	ENSP00000381577:P1272S	ENSP00000263989:P1120S	P	-	1	0	USP34	61392182	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.927000	0.87577	2.548000	0.85928	0.585000	0.79938	CCT		0.348	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
CSRNP3	80034	broad.mit.edu	37	2	166514412	166514412	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr2:166514412G>A	ENST00000342316.4	+	3	562	c.290G>A	c.(289-291)cGc>cAc	p.R97H	CSRNP3_ENST00000409420.1_Missense_Mutation_p.R129H|CSRNP3_ENST00000314499.7_Missense_Mutation_p.R97H	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	97					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R97H(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						ATGTCCAGCCGCCATAACAGC	0.547																																																1	Substitution - Missense(1)	ovary(1)	2											55.0	48.0	50.0					2																	166514412		2203	4300	6503	166222658	SO:0001583	missense	80034			AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.290G>A	2.37:g.166514412G>A	ENSP00000344042:p.Arg97His	Somatic		Capture	Illumina GAIIx	Phase_I	166222658	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	ENST00000342316.4	37	CCDS2225.1	.	.	.	.	.	.	.	.	.	.	G	33	5.276723	0.95459	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000409664;ENST00000342316;ENST00000409420	T;T;T;T;T	0.15256	2.44;2.44;2.44;2.44;2.44	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.28499	0.0705	N	0.16790	0.44	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.08785	-1.0705	10	0.40728	T	0.16	-18.4594	19.2061	0.93730	0.0:0.0:1.0:0.0	.	97	Q8WYN3	CSRN3_HUMAN	H	97;104;97;97;97;129	ENSP00000412081:R97H;ENSP00000318258:R97H;ENSP00000386278:R97H;ENSP00000344042:R97H;ENSP00000387195:R129H	ENSP00000318258:R97H	R	+	2	0	CSRNP3	166222658	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.620000	0.74224	2.604000	0.88044	0.563000	0.77884	CGC		0.547	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255191.2	NM_024969	
TTN	7273	broad.mit.edu	37	2	179612538	179612538	+	Intron	SNP	A	A	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr2:179612538A>T	ENST00000591111.1	-	45	10585				TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000360870.5_Silent_p.V4863V|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V4863V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGAACTTGAACTTCTTCAT	0.358																																																1	Substitution - coding silent(1)	ovary(1)	2											49.0	49.0	49.0					2																	179612538		2203	4299	6502	179320783	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+5312T>A	2.37:g.179612538A>T		Somatic		Capture	Illumina GAIIx	Phase_I	179320783	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.358	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NBEAL1	65065	broad.mit.edu	37	2	204000786	204000786	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr2:204000786G>C	ENST00000449802.1	+	27	4446	c.4113G>C	c.(4111-4113)ttG>ttC	p.L1371F		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1371								p.L1371F(1)|p.L81F(1)		NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CTTCACATTTGAGTTTAGACC	0.423																																																2	Substitution - Missense(2)	ovary(2)	2											83.0	77.0	79.0					2																	204000786		1891	4121	6012	203709031	SO:0001583	missense	65065			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.4113G>C	2.37:g.204000786G>C	ENSP00000399903:p.Leu1371Phe	Somatic		Capture	Illumina GAIIx	Phase_I	203709031	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401812	0.25291	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.56776	0.44	5.47	3.65	0.41850	.	0.566697	0.19125	N	0.122080	T	0.46541	0.1398	L	0.58101	1.795	0.46356	D	0.999005	B;B	0.20052	0.041;0.041	B;B	0.20184	0.028;0.028	T	0.49093	-0.8975	10	0.62326	D	0.03	.	7.4157	0.27042	0.1364:0.2593:0.6043:0.0	.	1371;1360	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	F	1371	ENSP00000399903:L1371F	ENSP00000344985:L1371F	L	+	3	2	NBEAL1	203709031	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.542000	0.45744	1.326000	0.45319	-0.150000	0.13652	TTG		0.423	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
KANSL1L	151050	broad.mit.edu	37	2	210893680	210893680	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr2:210893680C>T	ENST00000281772.9	-	11	2548	c.2285G>A	c.(2284-2286)cGg>cAg	p.R762Q	KANSL1L_ENST00000418791.1_Missense_Mutation_p.R720Q|AC007038.7_ENST00000452057.1_RNA|RP11-260M2.1_ENST00000608095.1_RNA	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	762						histone acetyltransferase complex (GO:0000123)		p.R762Q(1)									TCTCAATCTCCGTCGTGCAGT	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											125.0	118.0	120.0					2																	210893680		2203	4300	6503	210601925	SO:0001583	missense	151050			AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.2285G>A	2.37:g.210893680C>T	ENSP00000281772:p.Arg762Gln	Somatic		Capture	Illumina GAIIx	Phase_I	210601925	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	ENST00000281772.9	37	CCDS33370.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.982744	0.93044	.	.	ENSG00000144445	ENST00000281772;ENST00000418791	.	.	.	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000012	T	0.79040	0.4379	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.81306	-0.0992	9	0.72032	D	0.01	.	18.3132	0.90208	0.0:1.0:0.0:0.0	.	720;762	A0AUZ9-2;A0AUZ9	.;CB067_HUMAN	Q	762;720	.	ENSP00000281772:R762Q	R	-	2	0	C2orf67	210601925	1.000000	0.71417	0.978000	0.43139	0.916000	0.54674	6.283000	0.72646	2.422000	0.82143	0.563000	0.77884	CGG		0.368	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3	NM_152519	
PROKR2	128674	broad.mit.edu	37	20	5294763	5294763	+	Missense_Mutation	SNP	G	G	A	rs141090506	byFrequency	TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr20:5294763G>A	ENST00000217270.3	-	1	252	c.253C>T	c.(253-255)Cgc>Tgc	p.R85C	PROKR2_ENST00000546004.1_Missense_Mutation_p.R85C	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	85			R -> C (in HH3; uncertain pathological significance). {ECO:0000269|PubMed:17054399}.|R -> H (in HH3; phenotype consistent with Kallmann syndrome; dbSNP:rs74315418). {ECO:0000269|PubMed:17054399}.		circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)	p.R85C(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						GTGAGGTTGCGCAACTTCTTA	0.547										HNSCC(71;0.22)			G|||	3	0.000599042	0.0008	0.0014	5008	,	,		22073	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	20	GRCh37	CM083840	PROKR2	M	rs141090506						191.0	149.0	163.0					20																	5294763		2203	4300	6503	5242763	SO:0001583	missense	128674			AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.253C>T	20.37:g.5294763G>A	ENSP00000217270:p.Arg85Cys	Somatic		Capture	Illumina GAIIx	Phase_I	5242763	A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Missense_Mutation	SNP	ENST00000217270.3	37	CCDS13089.1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809204	0.70797	.	.	ENSG00000101292	ENST00000546004;ENST00000217270	T;T	0.46063	0.88;0.88	4.76	4.76	0.60689	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.72993	0.3530	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80455	-0.1375	10	0.87932	D	0	.	10.8357	0.46685	0.0:0.0:0.8114:0.1886	.	85	Q8NFJ6	PKR2_HUMAN	C	85	ENSP00000440790:R85C;ENSP00000217270:R85C	ENSP00000217270:R85C	R	-	1	0	PROKR2	5242763	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.002000	0.49496	2.347000	0.79759	0.655000	0.94253	CGC		0.547	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077854.1	NM_144773	
PLCB1	23236	broad.mit.edu	37	20	8705336	8705336	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr20:8705336G>A	ENST00000338037.6	+	16	1642	c.1615G>A	c.(1615-1617)Gaa>Aaa	p.E539K	PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378641.3_Missense_Mutation_p.E539K|PLCB1_ENST00000378637.2_Missense_Mutation_p.E539K	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	539					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.E539K(1)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						GGCCACAGAAGAAATGTCTAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	20											73.0	78.0	76.0					20																	8705336		2203	4300	6503	8653336	SO:0001583	missense	23236			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1615G>A	20.37:g.8705336G>A	ENSP00000338185:p.Glu539Lys	Somatic		Capture	Illumina GAIIx	Phase_I	8653336	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	34	5.315316	0.95655	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.69175	-0.38;-0.38;-0.38	5.29	5.29	0.74685	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (1);	0.000000	0.85682	D	0.000000	D	0.85431	0.5695	M	0.93375	3.41	0.80722	D	1	P;D	0.59767	0.856;0.986	P;P	0.60236	0.53;0.871	D	0.89090	0.3482	10	0.72032	D	0.01	.	19.2977	0.94129	0.0:0.0:1.0:0.0	.	539;539	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	K	539;539;539;459;459	ENSP00000367908:E539K;ENSP00000338185:E539K;ENSP00000367904:E539K	ENSP00000338185:E539K	E	+	1	0	PLCB1	8653336	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.869000	0.99810	2.627000	0.88993	0.563000	0.77884	GAA		0.388	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
TMPRSS15	5651	broad.mit.edu	37	21	19725330	19725330	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr21:19725330C>A	ENST00000284885.3	-	10	1094	c.1061G>T	c.(1060-1062)tGt>tTt	p.C354F		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	354	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)	p.C354F(1)		NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						GACCCAGAAACAAAAGCCATC	0.333																																																1	Substitution - Missense(1)	ovary(1)	21											80.0	84.0	83.0					21																	19725330		2203	4300	6503	18647201	SO:0001583	missense	5651				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1061G>T	21.37:g.19725330C>A	ENSP00000284885:p.Cys354Phe	Somatic		Capture	Illumina GAIIx	Phase_I	18647201	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911554	0.72983	.	.	ENSG00000154646	ENST00000284885	T	0.13538	2.58	5.2	5.2	0.72013	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.85682	D	0.000000	T	0.56140	0.1965	H	0.97874	4.095	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.74432	-0.3667	9	.	.	.	.	18.0723	0.89413	0.0:1.0:0.0:0.0	.	354	P98073	ENTK_HUMAN	F	354	ENSP00000284885:C354F	.	C	-	2	0	TMPRSS15	18647201	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.162000	0.71874	2.572000	0.86782	0.655000	0.94253	TGT		0.333	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
MORC3	23515	broad.mit.edu	37	21	37736535	37736535	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr21:37736535C>G	ENST00000400485.1	+	14	1673	c.1597C>G	c.(1597-1599)Cag>Gag	p.Q533E	AP000692.9_ENST00000397184.2_RNA|MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	533					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)	p.Q533E(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						AGTTCCACCTCAGTCTGAACC	0.393																																																1	Substitution - Missense(1)	ovary(1)	21											69.0	61.0	63.0					21																	37736535		1858	4104	5962	36658405	SO:0001583	missense	23515			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.1597C>G	21.37:g.37736535C>G	ENSP00000383333:p.Gln533Glu	Somatic		Capture	Illumina GAIIx	Phase_I	36658405	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	C	1.387	-0.581959	0.03827	.	.	ENSG00000159256	ENST00000400485	T	0.13089	2.62	5.38	4.49	0.54785	.	0.619622	0.16181	N	0.225824	T	0.11922	0.0290	L	0.44542	1.39	0.22213	N	0.999283	B	0.15473	0.013	B	0.15052	0.012	T	0.32955	-0.9887	10	0.06757	T	0.87	-1.1926	13.7461	0.62876	0.0:0.8465:0.1535:0.0	.	533	Q14149	MORC3_HUMAN	E	533	ENSP00000383333:Q533E	ENSP00000383333:Q533E	Q	+	1	0	MORC3	36658405	0.999000	0.42202	0.654000	0.29608	0.036000	0.12997	2.646000	0.46630	1.378000	0.46305	0.561000	0.74099	CAG		0.393	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
GAB4	128954	broad.mit.edu	37	22	17445730	17445730	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr22:17445730A>T	ENST00000400588.1	-	8	1509	c.1402T>A	c.(1402-1404)Tcc>Acc	p.S468T	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	468								p.S468T(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GGGTGTTGGGAGGAGCTGGAG	0.587																																																1	Substitution - Missense(1)	ovary(1)	22											138.0	148.0	145.0					22																	17445730		2187	4293	6480	15825730	SO:0001583	missense	128954			AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.1402T>A	22.37:g.17445730A>T	ENSP00000383431:p.Ser468Thr	Somatic		Capture	Illumina GAIIx	Phase_I	15825730		Missense_Mutation	SNP	ENST00000400588.1	37	CCDS42976.1	.	.	.	.	.	.	.	.	.	.	A	12.36	1.913963	0.33815	.	.	ENSG00000215568	ENST00000400588	T	0.25085	1.82	1.96	1.96	0.26148	.	0.254391	0.40302	N	0.001138	T	0.34395	0.0896	L	0.46157	1.445	0.42629	D	0.993376	D	0.63880	0.993	D	0.68192	0.956	T	0.08932	-1.0698	10	0.20519	T	0.43	.	7.8586	0.29497	1.0:0.0:0.0:0.0	.	468	Q2WGN9	GAB4_HUMAN	T	468	ENSP00000383431:S468T	ENSP00000383431:S468T	S	-	1	0	GAB4	15825730	1.000000	0.71417	0.988000	0.46212	0.047000	0.14425	3.516000	0.53436	1.144000	0.42321	0.332000	0.21555	TCC		0.587	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315426.1	XM_372882	
RAB36	9609	broad.mit.edu	37	22	23492252	23492252	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr22:23492252G>A	ENST00000263116.2	+	3	310	c.270G>A	c.(268-270)tgG>tgA	p.W90*	RAB36_ENST00000341989.4_Nonsense_Mutation_p.W90*	NM_004914.2	NP_004905.2	O95755	RAB36_HUMAN	RAB36, member RAS oncogene family	90					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)	p.W90*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.155)		CTTTGCAGTGGTACACGCCGG	0.607																																																1	Substitution - Nonsense(1)	ovary(1)	22											80.0	68.0	72.0					22																	23492252		2202	4300	6502	21822252	SO:0001587	stop_gained	9609			AB023061	CCDS13805.1	22q11.22	2008-06-11			ENSG00000100228	ENSG00000100228		"""RAB, member RAS oncogene"""	9775	protein-coding gene	gene with protein product		605662				9920784, 10591208	Standard	NM_004914		Approved		uc002zwv.1	O95755	OTTHUMG00000150601	ENST00000263116.2:c.270G>A	22.37:g.23492252G>A	ENSP00000263116:p.Trp90*	Somatic		Capture	Illumina GAIIx	Phase_I	21822252	Q2M390|Q7Z4A9|Q9UHP5	Nonsense_Mutation	SNP	ENST00000263116.2	37	CCDS13805.1	.	.	.	.	.	.	.	.	.	.	G	37	6.008742	0.97195	.	.	ENSG00000100228	ENST00000263116;ENST00000341989;ENST00000418881	.	.	.	5.16	4.13	0.48395	.	0.131189	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-12.5406	7.5424	0.27746	0.0885:0.1693:0.7421:0.0	.	.	.	.	X	90;90;51	.	ENSP00000263116:W90X	W	+	3	0	RAB36	21822252	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	0.977000	0.29475	1.311000	0.45024	0.561000	0.74099	TGG		0.607	RAB36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319046.1	NM_004914	
GRAMD1C	54762	broad.mit.edu	37	3	113634568	113634568	+	Missense_Mutation	SNP	C	C	G	rs199895173		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr3:113634568C>G	ENST00000358160.4	+	10	1465	c.973C>G	c.(973-975)Ctt>Gtt	p.L325V	GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000440446.2_Missense_Mutation_p.L120V|GRAMD1C_ENST00000472026.1_Missense_Mutation_p.L158V|GRAMD1C_ENST00000452134.2_Missense_Mutation_p.L54V	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	325						integral component of membrane (GO:0016021)		p.L325V(1)		NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						TGAGAAAGATCTTCATGGAAG	0.358													C|||	1	0.000199681	0.0	0.0	5008	,	,		17107	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3											79.0	80.0	80.0					3																	113634568		2203	4296	6499	115117258	SO:0001583	missense	54762				CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.973C>G	3.37:g.113634568C>G	ENSP00000350881:p.Leu325Val	Somatic		Capture	Illumina GAIIx	Phase_I	115117258	A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	ENST00000358160.4	37	CCDS33826.1	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0017482517482517483|0.0017482517482517483	0|0	0.0|0.0	C|C	15.45|15.45	2.837792|2.837792	0.50951|0.50951	.|.	.|.	ENSG00000178075|ENSG00000178075	ENST00000488680|ENST00000358160;ENST00000452134;ENST00000472026;ENST00000462838;ENST00000440446	.|T;T;T;T	.|0.55930	.|1.05;0.55;0.49;0.49	5.98|5.98	5.98|5.98	0.97165|0.97165	.|.	.|0.199004	.|0.44483	.|D	.|0.000452	T|T	0.44829|0.44829	0.1312|0.1312	L|L	0.43152|0.43152	1.355|1.355	0.35050|0.35050	D|D	0.760565|0.760565	.|B;B	.|0.33857	.|0.062;0.429	.|B;B	.|0.27608	.|0.028;0.081	T|T	0.53265|0.53265	-0.8463|-0.8463	6|10	0.87932|0.27785	D|T	0|0.31	.|.	17.3601|17.3601	0.87347|0.87347	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|158;325	.|E9PHT3;Q8IYS0	.|.;GRM1C_HUMAN	M|V	24|325;54;158;120;120	.|ENSP00000350881:L325V;ENSP00000399844:L54V;ENSP00000419132:L158V;ENSP00000408135:L120V	ENSP00000419571:I24M|ENSP00000350881:L325V	I|L	+|+	3|1	3|0	GRAMD1C|GRAMD1C	115117258|115117258	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.609000|4.609000	0.61148|0.61148	2.838000|2.838000	0.97847|0.97847	0.655000|0.655000	0.94253|0.94253	ATC|CTT		0.358	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	NM_017577	
ARHGAP31	57514	broad.mit.edu	37	3	119112360	119112360	+	Silent	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr3:119112360C>T	ENST00000264245.4	+	8	1460	c.928C>T	c.(928-930)Ctg>Ttg	p.L310L		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	310					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)	p.L310L(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						AATATTTAACCTGGGACGTTC	0.408																																					Pancreas(7;176 297 5394 51128 51241)											1	Substitution - coding silent(1)	ovary(1)	3											129.0	120.0	123.0					3																	119112360		1842	4082	5924	120595050	SO:0001819	synonymous_variant	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.928C>T	3.37:g.119112360C>T		Somatic		Capture	Illumina GAIIx	Phase_I	120595050	Q9ULL6	Silent	SNP	ENST00000264245.4	37	CCDS43135.1																																																																																				0.408	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
MAATS1	89876	broad.mit.edu	37	3	119434528	119434528	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr3:119434528C>T	ENST00000273390.5	+	6	697	c.620C>T	c.(619-621)gCa>gTa	p.A207V	MAATS1_ENST00000463700.1_Missense_Mutation_p.A207V	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	207			A -> P (in dbSNP:rs6438544). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005, ECO:0000269|Ref.2}.			mitochondrion (GO:0005739)		p.A207V(1)									CCATACTCTGCAGAATATGTA	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											161.0	146.0	151.0					3																	119434528		2203	4300	6503	120917218	SO:0001583	missense	89876			AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.620C>T	3.37:g.119434528C>T	ENSP00000273390:p.Ala207Val	Somatic		Capture	Illumina GAIIx	Phase_I	120917218	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Missense_Mutation	SNP	ENST00000273390.5	37	CCDS2994.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.42|19.42	3.823895|3.823895	0.71143|0.71143	.|.	.|.	ENSG00000183833|ENSG00000183833	ENST00000273390;ENST00000463700|ENST00000383667	T;T|.	0.23950|.	1.88;1.88|.	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	0.111910|.	0.64402|.	D|.	0.000007|.	T|.	0.35970|.	0.0950|.	N|N	0.08118|0.08118	0|0	0.21878|0.21878	N|N	0.999495|0.999495	B;B;B;B|.	0.22211|.	0.021;0.06;0.066;0.009|.	B;B;B;B|.	0.25506|.	0.03;0.054;0.061;0.002|.	T|.	0.47018|.	-0.9149|.	10|.	0.87932|0.87932	D|D	0|0	-8.0965|-8.0965	18.5803|18.5803	0.91168|0.91168	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	207;145;207;207|.	Q7Z4T9;Q7Z4T9-3;Q7Z4T9-7;Q7Z4T9-2|.	AAT1_HUMAN;.;.;.|.	V|X	207|185	ENSP00000273390:A207V;ENSP00000419489:A207V|.	ENSP00000273390:A207V|ENSP00000373163:Q185X	A|Q	+|+	2|1	0|0	C3orf15|C3orf15	120917218|120917218	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.860000|0.860000	0.49131|0.49131	5.692000|5.692000	0.68256|0.68256	2.488000|2.488000	0.83962|0.83962	0.585000|0.585000	0.79938|0.79938	GCA|CAG		0.473	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355222.1	NM_033364	
CASR	846	broad.mit.edu	37	3	122002834	122002834	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr3:122002834G>A	ENST00000490131.1	+	7	2405	c.2033G>A	c.(2032-2034)cGc>cAc	p.R678H	CASR_ENST00000296154.5_Missense_Mutation_p.R678H|CASR_ENST00000498619.1_Missense_Mutation_p.R688H|AC068754.1_ENST00000408547.1_RNA	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	678					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.R678H(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TGGACGTGCCGCCTGCGCCAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	3											94.0	78.0	83.0					3																	122002834		2203	4300	6503	123485524	SO:0001583	missense	846			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2033G>A	3.37:g.122002834G>A	ENSP00000418685:p.Arg678His	Somatic		Capture	Illumina GAIIx	Phase_I	123485524	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	37	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869007	0.72065	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.87966	-2.32;-2.32;-2.32	6.04	6.04	0.98038	GPCR, family 3, C-terminal (2);	0.046488	0.85682	D	0.000000	D	0.90848	0.7125	L	0.51914	1.62	0.54753	D	0.999989	D;D	0.64830	0.994;0.983	P;P	0.61940	0.896;0.817	D	0.87657	0.2532	10	0.26408	T	0.33	.	19.5674	0.95401	0.0:0.0:1.0:0.0	.	688;678	E7ENE0;P41180	.;CASR_HUMAN	H	678;688;678	ENSP00000418685:R678H;ENSP00000420194:R688H;ENSP00000296154:R678H	ENSP00000296154:R678H	R	+	2	0	CASR	123485524	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.743000	0.74848	2.873000	0.98535	0.561000	0.74099	CGC		0.612	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
MCM2	4171	broad.mit.edu	37	3	127325076	127325076	+	Silent	SNP	C	C	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr3:127325076C>A	ENST00000265056.7	+	5	1033	c.789C>A	c.(787-789)gcC>gcA	p.A263A		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	263					cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)	p.A263A(1)		ovary(3)|skin(2)|stomach(1)	6						ATGAGGCTGCCCTGGAGGTGG	0.617																																																1	Substitution - coding silent(1)	ovary(1)	3											168.0	144.0	152.0					3																	127325076		2203	4300	6503	128807766	SO:0001819	synonymous_variant	4171			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.789C>A	3.37:g.127325076C>A		Somatic		Capture	Illumina GAIIx	Phase_I	128807766	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Silent	SNP	ENST00000265056.7	37	CCDS3043.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.327465	0.24080	.	.	ENSG00000073111	ENST00000491422	.	.	.	5.1	2.3	0.28687	.	.	.	.	.	T	0.57169	0.2035	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48103	-0.9064	4	.	.	.	-34.8937	8.312	0.32077	0.0:0.7285:0.1286:0.143	.	.	.	.	H	126	.	.	P	+	2	0	MCM2	128807766	0.980000	0.34600	0.999000	0.59377	0.882000	0.50991	0.232000	0.17891	0.166000	0.19597	0.591000	0.81541	CCC		0.617	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
SLC9A9	285195	broad.mit.edu	37	3	142985717	142985717	+	Missense_Mutation	SNP	T	T	G	rs2289491	byFrequency	TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr3:142985717T>G	ENST00000316549.6	-	16	1973	c.1765A>C	c.(1765-1767)Ata>Cta	p.I589L		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	589			I -> V (in dbSNP:rs2289491). {ECO:0000269|PubMed:17974005}.		ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)	p.I589L(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						TGGTAATTTATGGCTAGTTCA	0.488																																																1	Substitution - Missense(1)	ovary(1)	3											140.0	133.0	135.0					3																	142985717		2203	4300	6503	144468407	SO:0001583	missense	285195			AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.1765A>C	3.37:g.142985717T>G	ENSP00000320246:p.Ile589Leu	Somatic		Capture	Illumina GAIIx	Phase_I	144468407	A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	T	0.022	-1.418073	0.01136	.	.	ENSG00000181804	ENST00000316549	T	0.22336	1.96	5.7	4.55	0.56014	.	0.409505	0.28119	N	0.016522	T	0.05318	0.0141	N	0.01242	-0.935	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.40059	-0.9583	10	0.02654	T	1	.	6.6015	0.22703	0.0:0.1299:0.1377:0.7324	.	589	Q8IVB4	SL9A9_HUMAN	L	589	ENSP00000320246:I589L	ENSP00000320246:I589L	I	-	1	0	SLC9A9	144468407	1.000000	0.71417	0.930000	0.37139	0.085000	0.17905	0.747000	0.26290	2.168000	0.68352	0.533000	0.62120	ATA		0.488	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653	
COL25A1	84570	broad.mit.edu	37	4	109784537	109784537	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr4:109784537G>A	ENST00000399132.1	-	21	1620	c.1090C>T	c.(1090-1092)Cgg>Tgg	p.R364W	COL25A1_ENST00000399126.1_Missense_Mutation_p.R364W|COL25A1_ENST00000399127.1_Missense_Mutation_p.R360W	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1									p.R364W(1)		NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		GCTTCCCCCCGTTCACCCTGT	0.502																																																1	Substitution - Missense(1)	ovary(1)	4											43.0	44.0	44.0					4																	109784537		1835	4088	5923	110003986	SO:0001583	missense	84570			AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1090C>T	4.37:g.109784537G>A	ENSP00000382083:p.Arg364Trp	Somatic		Capture	Illumina GAIIx	Phase_I	110003986		Missense_Mutation	SNP	ENST00000399132.1	37	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.088045	0.55968	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;T;D	0.93604	-3.25;1.83;-3.25	5.52	5.52	0.82312	.	0.121454	0.50627	D	0.000106	D	0.97043	0.9034	M	0.88031	2.925	0.47123	D	0.999327	D;D	0.89917	1.0;1.0	D;D	0.87578	0.995;0.998	D	0.97311	0.9937	9	.	.	.	-7.1172	15.1785	0.72934	0.0:0.0:0.8503:0.1497	.	364;364	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	W	364;366;345;360;364;294	ENSP00000382083:R364W;ENSP00000382078:R360W;ENSP00000382077:R364W	.	R	-	1	2	COL25A1	110003986	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	2.784000	0.47774	2.578000	0.87016	0.650000	0.86243	CGG		0.502	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518	
ADAMTS12	81792	broad.mit.edu	37	5	33643573	33643573	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr5:33643573G>C	ENST00000504830.1	-	10	1817	c.1482C>G	c.(1480-1482)aaC>aaG	p.N494K	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.N494K|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	494	Disintegrin.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N494K(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TCTGGCAGACGTTCTAGAAAA	0.443										HNSCC(64;0.19)																																						1	Substitution - Missense(1)	ovary(1)	5											111.0	114.0	113.0					5																	33643573		2203	4300	6503	33679330	SO:0001583	missense	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1482C>G	5.37:g.33643573G>C	ENSP00000422554:p.Asn494Lys	Somatic		Capture	Illumina GAIIx	Phase_I	33679330	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354406	0.41700	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.59083	0.29;0.31	5.57	-3.03	0.05429	.	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	L	0.48174	1.505	0.80722	D	1	D;P	0.89917	1.0;0.951	D;P	0.78314	0.991;0.686	T	0.61549	-0.7040	10	0.36615	T	0.2	.	13.4561	0.61199	0.5944:0.0:0.4056:0.0	.	494;494	P58397-3;P58397	.;ATS12_HUMAN	K	494	ENSP00000422554:N494K;ENSP00000344847:N494K	ENSP00000344847:N494K	N	-	3	2	ADAMTS12	33679330	0.431000	0.25546	0.986000	0.45419	0.295000	0.27426	0.035000	0.13797	-0.402000	0.07633	-1.214000	0.01621	AAC		0.443	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
PCDHB2	56133	broad.mit.edu	37	5	140474407	140474407	+	Silent	SNP	G	G	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr5:140474407G>T	ENST00000194155.4	+	1	181	c.33G>T	c.(31-33)ccG>ccT	p.P11P		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	11					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P11P(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCGCGTTCCGAAACAAAGGC	0.547																																																1	Substitution - coding silent(1)	ovary(1)	5											82.0	86.0	84.0					5																	140474407		2203	4300	6503	140454591	SO:0001819	synonymous_variant	56133			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.33G>T	5.37:g.140474407G>T		Somatic		Capture	Illumina GAIIx	Phase_I	140454591	Q4KMU1	Silent	SNP	ENST00000194155.4	37	CCDS4244.1																																																																																				0.547	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
FAT2	2196	broad.mit.edu	37	5	150920314	150920314	+	Silent	SNP	G	G	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr5:150920314G>T	ENST00000261800.5	-	10	8865	c.8853C>A	c.(8851-8853)ccC>ccA	p.P2951P		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2951	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P2951P(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTGGCCCAGGGGGTCTCCCT	0.517																																																1	Substitution - coding silent(1)	ovary(1)	5											54.0	50.0	51.0					5																	150920314		2203	4300	6503	150900507	SO:0001819	synonymous_variant	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8853C>A	5.37:g.150920314G>T		Somatic		Capture	Illumina GAIIx	Phase_I	150900507	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1																																																																																				0.517	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
SH3PXD2B	285590	broad.mit.edu	37	5	171766097	171766097	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr5:171766097C>G	ENST00000311601.5	-	13	2182	c.2012G>C	c.(2011-2013)aGg>aCg	p.R671T	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	671					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)	p.R671T(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTGGCAGGCCTGAGCTTACT	0.602																																																1	Substitution - Missense(1)	ovary(1)	5											92.0	86.0	88.0					5																	171766097		2203	4300	6503	171698702	SO:0001583	missense	285590			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.2012G>C	5.37:g.171766097C>G	ENSP00000309714:p.Arg671Thr	Somatic		Capture	Illumina GAIIx	Phase_I	171698702	B6F0V2|Q9P2Q1	Missense_Mutation	SNP	ENST00000311601.5	37	CCDS34291.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631381	0.67015	.	.	ENSG00000174705	ENST00000311601	T	0.70045	-0.45	5.47	5.47	0.80525	.	0.153556	0.56097	D	0.000029	T	0.67795	0.2931	L	0.32530	0.975	0.47949	D	0.999552	D	0.69078	0.997	P	0.60789	0.879	T	0.65500	-0.6153	9	.	.	.	-32.5023	10.291	0.43596	0.0:0.9104:0.0:0.0896	.	671	A1X283	SPD2B_HUMAN	T	671	ENSP00000309714:R671T	.	R	-	2	0	SH3PXD2B	171698702	0.887000	0.30362	1.000000	0.80357	0.965000	0.64279	4.643000	0.61390	2.563000	0.86464	0.561000	0.74099	AGG		0.602	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963	
HIST1H3C	8352	broad.mit.edu	37	6	26045645	26045645	+	Missense_Mutation	SNP	C	C	G	rs375724815		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr6:26045645C>G	ENST00000540144.1	+	1	7	c.7C>G	c.(7-9)Cgt>Ggt	p.R3G	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	3					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)	p.R3G(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						GCAAATGGCTCGTACGAAGCA	0.502																																																1	Substitution - Missense(1)	ovary(1)	6											50.0	53.0	52.0					6																	26045645		2203	4298	6501	26153624	SO:0001583	missense	8352			X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.7C>G	6.37:g.26045645C>G	ENSP00000439493:p.Arg3Gly	Somatic		Capture	Illumina GAIIx	Phase_I	26153624	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000540144.1	37	CCDS4576.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474620	0.26511	.	.	ENSG00000196532	ENST00000540144	T	0.46451	0.87	4.67	4.67	0.58626	.	.	.	.	.	T	0.51483	0.1677	.	.	.	0.34843	D	0.740854	.	.	.	.	.	.	T	0.58059	-0.7703	6	0.66056	D	0.02	.	17.4292	0.87534	0.0:1.0:0.0:0.0	.	.	.	.	G	3	ENSP00000439493:R3G	ENSP00000439493:R3G	R	+	1	0	HIST1H3C	26153624	0.775000	0.28604	1.000000	0.80357	0.197000	0.23852	1.462000	0.35266	2.529000	0.85273	0.591000	0.81541	CGT		0.502	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040078.1	NM_003531	
ZKSCAN4	387032	broad.mit.edu	37	6	28212964	28212964	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr6:28212964C>G	ENST00000377294.2	-	5	1811	c.1568G>C	c.(1567-1569)gGt>gCt	p.G523A	ZKSCAN4_ENST00000423974.2_Missense_Mutation_p.G368A	NM_019110.3	NP_061983.2	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	523					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G523A(1)		endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						TCGAGTGAAACCTTTTCCACA	0.413																																																1	Substitution - Missense(1)	ovary(1)	6											160.0	148.0	152.0					6																	28212964		2203	4300	6503	28320943	SO:0001583	missense	387032			AK056698	CCDS4647.1	6p21	2013-01-09	2007-02-20	2007-02-20	ENSG00000187626	ENSG00000187626		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13854	protein-coding gene	gene with protein product		611643	"""zinc finger protein 307"", ""zinc finger protein 427"""	ZNF307, ZNF427		12477932	Standard	NM_019110		Approved	p373c6.1, P1P373C6, FLJ32136, ZSCAN36	uc003nks.1	Q969J2	OTTHUMG00000014511	ENST00000377294.2:c.1568G>C	6.37:g.28212964C>G	ENSP00000366509:p.Gly523Ala	Somatic		Capture	Illumina GAIIx	Phase_I	28320943	B2RE32|Q5U7L4	Missense_Mutation	SNP	ENST00000377294.2	37	CCDS4647.1	.	.	.	.	.	.	.	.	.	.	C	2.217	-0.379365	0.05000	.	.	ENSG00000187626	ENST00000377294;ENST00000423974	T;T	0.15834	2.39;2.39	5.58	4.67	0.58626	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01523	0.0049	N	0.00686	-1.255	0.23731	N	0.996995	B	0.34349	0.45	B	0.32864	0.154	T	0.21280	-1.0250	9	0.02654	T	1	.	16.0859	0.81049	0.0:0.866:0.134:0.0	.	523	Q969J2	ZKSC4_HUMAN	A	523;368	ENSP00000366509:G523A;ENSP00000401978:G368A	ENSP00000366509:G523A	G	-	2	0	ZKSCAN4	28320943	0.000000	0.05858	1.000000	0.80357	0.982000	0.71751	0.338000	0.19858	2.774000	0.95407	0.655000	0.94253	GGT		0.413	ZKSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040179.1	NM_019110	
MRPS18B	28973	broad.mit.edu	37	6	30590648	30590648	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr6:30590648G>T	ENST00000259873.4	+	5	551	c.394G>T	c.(394-396)Ggt>Tgt	p.G132C	MRPS18B_ENST00000472229.1_3'UTR|MRPS18B_ENST00000506373.2_Intron	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	132					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)	p.G132C(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						CGCCCACACGGGTATCATCTT	0.502																																																1	Substitution - Missense(1)	ovary(1)	6											159.0	129.0	140.0					6																	30590648		1511	2709	4220	30698627	SO:0001583	missense	28973			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.394G>T	6.37:g.30590648G>T	ENSP00000259873:p.Gly132Cys	Somatic		Capture	Illumina GAIIx	Phase_I	30698627	A6NDQ0|Q659G4|Q9BS27	Missense_Mutation	SNP	ENST00000259873.4	37	CCDS4682.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.626484	0.66901	.	.	ENSG00000204568	ENST00000259873;ENST00000376508	T	0.59083	0.29	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.82190	0.4983	H	0.96080	3.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87015	0.2125	10	0.87932	D	0	.	17.2153	0.86941	0.0:0.0:1.0:0.0	.	109;132	Q5STN0;Q9Y676	.;RT18B_HUMAN	C	132;109	ENSP00000259873:G132C	ENSP00000259873:G132C	G	+	1	0	MRPS18B	30698627	1.000000	0.71417	0.376000	0.26042	0.393000	0.30537	6.444000	0.73452	2.793000	0.96121	0.655000	0.94253	GGT		0.502	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076584.2		
TCTE1	202500	broad.mit.edu	37	6	44254122	44254122	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr6:44254122C>T	ENST00000371505.4	-	3	547	c.425G>A	c.(424-426)tGc>tAc	p.C142Y	TCTE1_ENST00000371504.1_5'Flank|TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371503.3_5'UTR|RP11-444E17.6_ENST00000505802.1_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	142								p.C142Y(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGCCACGTGGCACACGGGCCA	0.607																																																1	Substitution - Missense(1)	ovary(1)	6											81.0	75.0	77.0					6																	44254122		2203	4300	6503	44362100	SO:0001583	missense	202500			BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.425G>A	6.37:g.44254122C>T	ENSP00000360560:p.Cys142Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	44362100	B4DX59|Q8IYS6	Missense_Mutation	SNP	ENST00000371505.4	37	CCDS4910.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.167290	0.78339	.	.	ENSG00000146221	ENST00000371505	T	0.54279	0.58	4.95	4.95	0.65309	.	0.045897	0.85682	D	0.000000	T	0.60971	0.2310	M	0.71206	2.165	0.80722	D	1	D	0.71674	0.998	D	0.64042	0.921	T	0.57447	-0.7810	10	0.21014	T	0.42	-29.292	18.1798	0.89773	0.0:1.0:0.0:0.0	.	142	Q5JU00	TCTE1_HUMAN	Y	142	ENSP00000360560:C142Y	ENSP00000360560:C142Y	C	-	2	0	TCTE1	44362100	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.610000	0.61155	2.284000	0.76573	0.563000	0.77884	TGC		0.607	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040736.1	NM_182539	
GPR110	266977	broad.mit.edu	37	6	46978027	46978027	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr6:46978027G>A	ENST00000371253.2	-	11	1359	c.1144C>T	c.(1144-1146)Ctt>Ttt	p.L382F	GPR110_ENST00000283297.5_Missense_Mutation_p.L185F|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	382					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L382F(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						GCTGAATTAAGGATATTGTCA	0.418																																																1	Substitution - Missense(1)	ovary(1)	6											69.0	63.0	65.0					6																	46978027		2203	4300	6503	47085986	SO:0001583	missense	266977			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.1144C>T	6.37:g.46978027G>A	ENSP00000360299:p.Leu382Phe	Somatic		Capture	Illumina GAIIx	Phase_I	47085986	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	ENST00000371253.2	37	CCDS34471.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688990	0.48097	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000283297	T;T	0.50277	0.75;0.76	5.2	4.32	0.51571	.	0.000000	0.49305	D	0.000153	T	0.55862	0.1947	M	0.74258	2.255	0.28760	N	0.900978	D	0.76494	0.999	D	0.68765	0.96	T	0.57177	-0.7856	10	0.87932	D	0	-20.9314	13.5794	0.61893	0.0763:0.0:0.9237:0.0	.	382	Q5T601	GP110_HUMAN	F	382;382;185	ENSP00000360299:L382F;ENSP00000283297:L185F	ENSP00000283297:L185F	L	-	1	0	GPR110	47085986	0.998000	0.40836	0.264000	0.24511	0.510000	0.34073	1.895000	0.39778	1.307000	0.44944	0.549000	0.68633	CTT		0.418	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
TINAG	27283	broad.mit.edu	37	6	54212311	54212311	+	Missense_Mutation	SNP	C	C	T	rs376779713		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr6:54212311C>T	ENST00000259782.4	+	6	991	c.895C>T	c.(895-897)Cgt>Tgt	p.R299C		NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	299					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R299C(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			CCTGAGAAAACGTGGGTAAAT	0.403																																																1	Substitution - Missense(1)	ovary(1)	6						C	CYS/ARG	0,4406		0,0,2203	88.0	78.0	81.0		895	5.8	1.0	6		81	1,8599	1.2+/-3.3	0,1,4299	no	missense	TINAG	NM_014464.3	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	299/477	54212311	1,13005	2203	4300	6503	54320270	SO:0001583	missense	27283			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.895C>T	6.37:g.54212311C>T	ENSP00000259782:p.Arg299Cys	Somatic		Capture	Illumina GAIIx	Phase_I	54320270	Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	ENST00000259782.4	37	CCDS4955.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827422	0.71143	0.0	1.16E-4	ENSG00000137251	ENST00000259782	D	0.84146	-1.81	5.77	5.77	0.91146	Peptidase C1A, papain C-terminal (2);	0.168599	0.43919	D	0.000514	D	0.91106	0.7200	M	0.88105	2.93	0.80722	D	1	D	0.76494	0.999	D	0.63597	0.916	D	0.90865	0.4741	10	0.44086	T	0.13	.	13.5316	0.61625	0.1559:0.8441:0.0:0.0	.	299	Q9UJW2	TINAG_HUMAN	C	299	ENSP00000259782:R299C	ENSP00000259782:R299C	R	+	1	0	TINAG	54320270	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.098000	0.41757	2.728000	0.93425	0.591000	0.81541	CGT		0.403	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040984.1	NM_014464	
ZNF292	23036	broad.mit.edu	37	6	87967138	87967138	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr6:87967138C>T	ENST00000369577.3	+	8	3834	c.3791C>T	c.(3790-3792)cCt>cTt	p.P1264L	ZNF292_ENST00000339907.4_Missense_Mutation_p.P1259L	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1264						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.P1119L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CCTTTCCTTCCTTTACCTGCA	0.388																																																1	Substitution - Missense(1)	ovary(1)	6											62.0	58.0	59.0					6																	87967138		1895	4114	6009	88023857	SO:0001583	missense	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.3791C>T	6.37:g.87967138C>T	ENSP00000358590:p.Pro1264Leu	Somatic		Capture	Illumina GAIIx	Phase_I	88023857	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.021659	0.75275	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.08984	3.03;3.04	5.5	5.5	0.81552	.	0.257993	0.39985	N	0.001217	T	0.18002	0.0432	L	0.47716	1.5	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.00909	-1.1518	10	0.87932	D	0	.	19.4074	0.94653	0.0:1.0:0.0:0.0	.	1264	O60281	ZN292_HUMAN	L	1264;1259	ENSP00000358590:P1264L;ENSP00000342847:P1259L	ENSP00000342847:P1259L	P	+	2	0	ZNF292	88023857	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.404000	0.59735	2.599000	0.87857	0.650000	0.86243	CCT		0.388	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
MDN1	23195	broad.mit.edu	37	6	90385899	90385899	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr6:90385899C>G	ENST00000369393.3	-	77	12682	c.12567G>C	c.(12565-12567)tgG>tgC	p.W4189C	RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000428876.1_Missense_Mutation_p.W4189C			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4189					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.W4189C(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GGCATCCATCCCATGAAGACG	0.443																																																1	Substitution - Missense(1)	ovary(1)	6											109.0	100.0	103.0					6																	90385899		2203	4300	6503	90442620	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12567G>C	6.37:g.90385899C>G	ENSP00000358400:p.Trp4189Cys	Somatic		Capture	Illumina GAIIx	Phase_I	90442620	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.647323	0.67358	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03860	3.78;3.78	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.19208	0.0461	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00589	-1.1656	10	0.48119	T	0.1	.	20.0666	0.97706	0.0:1.0:0.0:0.0	.	4189	Q9NU22	MDN1_HUMAN	C	4189	ENSP00000358400:W4189C;ENSP00000413970:W4189C	ENSP00000358400:W4189C	W	-	3	0	MDN1	90442620	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.152000	0.77419	2.826000	0.97356	0.561000	0.74099	TGG		0.443	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
TNRC18	84629	broad.mit.edu	37	7	5416592	5416592	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr7:5416592C>T	ENST00000430969.1	-	8	2842	c.2494G>A	c.(2494-2496)Gcc>Acc	p.A832T	TNRC18_ENST00000399537.4_Missense_Mutation_p.A832T	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	832							chromatin binding (GO:0003682)	p.A832T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		AACGCAGGGGCCATGCCCTGG	0.667																																																1	Substitution - Missense(1)	ovary(1)	7											20.0	27.0	25.0					7																	5416592		1964	4133	6097	5383118	SO:0001583	missense	84629			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.2494G>A	7.37:g.5416592C>T	ENSP00000395538:p.Ala832Thr	Somatic		Capture	Illumina GAIIx	Phase_I	5383118	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.286375	0.40494	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000413081	T;T	0.11063	2.81;2.81	4.76	2.63	0.31362	.	.	.	.	.	T	0.04137	0.0115	N	0.02539	-0.55	0.25447	N	0.988042	B	0.06786	0.001	B	0.06405	0.002	T	0.36672	-0.9738	9	0.39692	T	0.17	.	5.9928	0.19476	0.0:0.5746:0.0:0.4254	.	832	O15417	TNC18_HUMAN	T	832;832;234	ENSP00000382452:A832T;ENSP00000395538:A832T	ENSP00000382452:A832T	A	-	1	0	TNRC18	5383118	1.000000	0.71417	0.982000	0.44146	0.954000	0.61252	1.948000	0.40303	0.987000	0.38709	0.561000	0.74099	GCC		0.667	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ADAM22	53616	broad.mit.edu	37	7	87760739	87760739	+	Silent	SNP	T	T	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr7:87760739T>C	ENST00000265727.7	+	11	1060	c.981T>C	c.(979-981)gtT>gtC	p.V327V	ADAM22_ENST00000315984.7_Silent_p.V327V|ADAM22_ENST00000439864.1_Silent_p.V327V|ADAM22_ENST00000398201.4_Silent_p.V327V|ADAM22_ENST00000398209.3_Silent_p.V327V|ADAM22_ENST00000398204.4_Silent_p.V327V			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	327	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V327V(2)		endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			GTGATGCAGTTCACCTTTTTT	0.338																																																2	Substitution - coding silent(2)	ovary(2)	7											113.0	110.0	111.0					7																	87760739		1850	4099	5949	87598675	SO:0001819	synonymous_variant	53616			AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.981T>C	7.37:g.87760739T>C		Somatic		Capture	Illumina GAIIx	Phase_I	87598675	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Silent	SNP	ENST00000265727.7	37	CCDS47637.1																																																																																				0.338	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268370.2	NM_021723	
MOSPD3	64598	broad.mit.edu	37	7	100212803	100212803	+	Silent	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr7:100212803C>G	ENST00000393950.2	+	5	987	c.705C>G	c.(703-705)acC>acG	p.T235T	MOSPD3_ENST00000424091.2_Silent_p.T225T|MOSPD3_ENST00000223054.4_Silent_p.T235T|MOSPD3_ENST00000379527.2_Silent_p.T235T	NM_023948.4	NP_076438.1	O75425	MSPD3_HUMAN	motile sperm domain containing 3	235					heart development (GO:0007507)	integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)	p.T235T(1)		breast(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					TCCTCCGGACCTGAGCTCCGT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	7											94.0	88.0	90.0					7																	100212803		2203	4300	6503	100050739	SO:0001819	synonymous_variant	64598			BC011653	CCDS5701.1, CCDS47662.1	7q22	2009-11-06			ENSG00000106330	ENSG00000106330			25078	protein-coding gene	gene with protein product		609125				15533722	Standard	XM_005250531		Approved	CDS3, NET30	uc003uvs.3	O75425	OTTHUMG00000159599	ENST00000393950.2:c.705C>G	7.37:g.100212803C>G		Somatic		Capture	Illumina GAIIx	Phase_I	100050739	A4D2D1|A6NG17|C9JE89|D6W5W1|O75423|O75424	Silent	SNP	ENST00000393950.2	37	CCDS5701.1																																																																																				0.627	MOSPD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356395.1	NM_023948	
ZAN	7455	broad.mit.edu	37	7	100377117	100377117	+	RNA	SNP	G	G	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr7:100377117G>T	ENST00000348028.3	+	0	6531				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E2122*(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGAACAGCAGGAGAACCCGAG	0.632																																																1	Substitution - Nonsense(1)	ovary(1)	7											28.0	31.0	30.0					7																	100377117		2049	4191	6240	100215053			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100377117G>T		Somatic		Capture	Illumina GAIIx	Phase_I	100215053	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Nonsense_Mutation	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	G	59	36.002018	0.99983	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	.	.	.	3.72	0.709	0.18150	.	1.441970	0.04569	N	0.392985	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	5.673	0.17733	0.1125:0.3896:0.4978:0.0	.	.	.	.	X	2122;2122;2122;633	.	ENSP00000445091:E2122X	E	+	1	0	ZAN	100215053	0.002000	0.14202	0.001000	0.08648	0.023000	0.10783	0.314000	0.19432	0.144000	0.18951	0.558000	0.71614	GAG		0.632	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
MGAM	8972	broad.mit.edu	37	7	141722199	141722199	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr7:141722199A>G	ENST00000549489.2	+	7	937	c.842A>G	c.(841-843)aAg>aGg	p.K281R	MGAM_ENST00000475668.2_Missense_Mutation_p.K281R	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	281	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.K281R(2)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ATGAATTGGAAGACCTGGCCC	0.483																																																2	Substitution - Missense(2)	ovary(2)	7											132.0	126.0	128.0					7																	141722199		1953	4157	6110	141368668	SO:0001583	missense	8972			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.842A>G	7.37:g.141722199A>G	ENSP00000447378:p.Lys281Arg	Somatic		Capture	Illumina GAIIx	Phase_I	141368668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	37	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	A	14.40	2.523813	0.44866	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.85861	-2.04	5.55	3.22	0.36961	Glycoside hydrolase-type carbohydrate-binding (1);	0.113760	0.40222	N	0.001160	T	0.74359	0.3706	L	0.28694	0.88	0.30876	N	0.731961	B	0.12013	0.005	B	0.10450	0.005	T	0.66416	-0.5929	10	0.32370	T	0.25	.	8.2373	0.31634	0.8385:0.0:0.1615:0.0	.	281	O43451	MGA_HUMAN	R	281;281;158	ENSP00000447378:K281R	ENSP00000316431:K158R	K	+	2	0	MGAM	141368668	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.685000	0.25378	0.551000	0.29008	0.533000	0.62120	AAG		0.483	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
KRBA1	84626	broad.mit.edu	37	7	149418594	149418594	+	Missense_Mutation	SNP	G	G	C	rs189055696|rs386719300	byFrequency	TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr7:149418594G>C	ENST00000485033.2	+	4	434	c.434G>C	c.(433-435)gGt>gCt	p.G145A	KRBA1_ENST00000319551.8_Missense_Mutation_p.G145A|KRBA1_ENST00000255992.10_Missense_Mutation_p.G145A|KRBA1_ENST00000479560.1_3'UTR			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	145								p.G145A(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGCCCAACTGGTGACGGGGTC	0.637																																																1	Substitution - Missense(1)	ovary(1)	7											23.0	26.0	25.0					7																	149418594		2070	4207	6277	149049527	SO:0001583	missense	84626			AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.434G>C	7.37:g.149418594G>C	ENSP00000420112:p.Gly145Ala	Somatic		Capture	Illumina GAIIx	Phase_I	149049527	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.519|9.519	1.107665|1.107665	0.20714|0.20714	.|.	.|.	ENSG00000133619|ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033|ENST00000467333	T;T;T|.	0.64085|.	0.0;-0.08;-0.08|.	3.43|3.43	2.51|2.51	0.30379|0.30379	.|.	0.616958|.	0.13530|.	N|.	0.381031|.	T|T	0.33904|0.33904	0.0879|0.0879	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	1|1	P|.	0.49961|.	0.93|.	B|.	0.42087|.	0.375|.	T|T	0.21075|0.21075	-1.0256|-1.0256	10|5	0.59425|.	D|.	0.04|.	0.2257|0.2257	8.6109|8.6109	0.33801|0.33801	0.0:0.2371:0.7629:0.0|0.0:0.2371:0.7629:0.0	.|.	145|.	A5PL33|.	KRBA1_HUMAN|.	A|C	145|54	ENSP00000255992:G145A;ENSP00000317165:G145A;ENSP00000420112:G145A|.	ENSP00000255992:G145A|.	G|W	+|+	2|3	0|0	KRBA1|KRBA1	149049527|149049527	0.083000|0.083000	0.21467|0.21467	0.005000|0.005000	0.12908|0.12908	0.002000|0.002000	0.02628|0.02628	1.284000|1.284000	0.33249|0.33249	0.772000|0.772000	0.33382|0.33382	-0.282000|-0.282000	0.10007|0.10007	GGT|TGG		0.637	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	NM_032534	
SNTG1	54212	broad.mit.edu	37	8	51449245	51449245	+	Nonsense_Mutation	SNP	T	T	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr8:51449245T>A	ENST00000522124.1	+	11	1218	c.557T>A	c.(556-558)tTa>tAa	p.L186*	SNTG1_ENST00000276467.5_Nonsense_Mutation_p.L186*|SNTG1_ENST00000517473.1_Nonsense_Mutation_p.L186*|SNTG1_ENST00000518864.1_Nonsense_Mutation_p.L186*	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	186					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.L186*(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CAGGACACATTATCATGCTCG	0.438																																																1	Substitution - Nonsense(1)	ovary(1)	8											155.0	146.0	149.0					8																	51449245		2203	4300	6503	51611798	SO:0001587	stop_gained	54212			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.557T>A	8.37:g.51449245T>A	ENSP00000429842:p.Leu186*	Somatic		Capture	Illumina GAIIx	Phase_I	51611798	Q2M3Q0|Q9NY98	Nonsense_Mutation	SNP	ENST00000522124.1	37	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.786592	0.90367	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	.	.	.	4.81	4.81	0.61882	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	13.1961	0.59738	0.0:0.0:0.0:1.0	.	.	.	.	X	186	.	ENSP00000276467:L186X	L	+	2	0	SNTG1	51611798	0.992000	0.36948	0.002000	0.10522	0.051000	0.14879	6.608000	0.74168	1.804000	0.52760	0.402000	0.26972	TTA		0.438	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1		
RGS20	8601	broad.mit.edu	37	8	54871009	54871009	+	Silent	SNP	T	T	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr8:54871009T>C	ENST00000297313.3	+	6	1250	c.1158T>C	c.(1156-1158)atT>atC	p.I386I	RGS20_ENST00000522225.1_Silent_p.I120I|RGS20_ENST00000276500.4_Silent_p.I239I|RGS20_ENST00000344277.6_Silent_p.I271I|RGS20_ENST00000517405.1_3'UTR	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	386					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.I386I(1)		breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			AGAAATCTATTGAAGCATAGG	0.343																																																1	Substitution - coding silent(1)	ovary(1)	8											58.0	49.0	52.0					8																	54871009		2203	4300	6503	55033562	SO:0001819	synonymous_variant	8601			AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.1158T>C	8.37:g.54871009T>C		Somatic		Capture	Illumina GAIIx	Phase_I	55033562	Q96BG9	Silent	SNP	ENST00000297313.3	37	CCDS6155.1																																																																																				0.343	RGS20-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380058.1		
PRDM14	63978	broad.mit.edu	37	8	70978671	70978671	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr8:70978671C>T	ENST00000276594.2	-	5	1183	c.982G>A	c.(982-984)Gtc>Atc	p.V328I		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	328	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)	p.V328I(1)		NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GCACAGTTGACATAGGACATC	0.428																																					NSCLC(129;99 1813 5906 40656 46114)											1	Substitution - Missense(1)	ovary(1)	8											128.0	125.0	126.0					8																	70978671		2203	4300	6503	71141225	SO:0001583	missense	63978			AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.982G>A	8.37:g.70978671C>T	ENSP00000276594:p.Val328Ile	Somatic		Capture	Illumina GAIIx	Phase_I	71141225	Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	37	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.682484	0.88542	.	.	ENSG00000147596	ENST00000276594	T	0.78595	-1.19	5.89	5.89	0.94794	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.83968	0.5369	L	0.41492	1.28	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78909	-0.2018	10	0.22109	T	0.4	-29.9487	20.2618	0.98447	0.0:1.0:0.0:0.0	.	328	Q9GZV8	PRD14_HUMAN	I	328	ENSP00000276594:V328I	ENSP00000276594:V328I	V	-	1	0	PRDM14	71141225	1.000000	0.71417	0.993000	0.49108	0.971000	0.66376	7.481000	0.81124	2.793000	0.96121	0.655000	0.94253	GTC		0.428	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1		
KCNB2	9312	broad.mit.edu	37	8	73849162	73849162	+	Silent	SNP	G	G	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr8:73849162G>T	ENST00000523207.1	+	3	2160	c.1572G>T	c.(1570-1572)ctG>ctT	p.L524L		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	524					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.L524L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	ACGAGCAGCTGAACAACACGT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	8											123.0	120.0	121.0					8																	73849162		2203	4300	6503	74011716	SO:0001819	synonymous_variant	9312			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1572G>T	8.37:g.73849162G>T		Somatic		Capture	Illumina GAIIx	Phase_I	74011716	Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	37	CCDS6209.1																																																																																				0.507	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
RGS22	26166	broad.mit.edu	37	8	101075775	101075775	+	Nonsense_Mutation	SNP	A	A	T	rs373041410		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr8:101075775A>T	ENST00000360863.6	-	8	1415	c.1221T>A	c.(1219-1221)taT>taA	p.Y407*	RGS22_ENST00000523287.1_Nonsense_Mutation_p.Y226*|RGS22_ENST00000523437.1_Nonsense_Mutation_p.Y395*	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	407					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.Y407*(1)	RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TGCCAATGTCATAAGTCCTAT	0.393																																																1	Substitution - Nonsense(1)	ovary(1)	8											154.0	139.0	144.0					8																	101075775		1864	4105	5969	101144951	SO:0001587	stop_gained	26166			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.1221T>A	8.37:g.101075775A>T	ENSP00000354109:p.Tyr407*	Somatic		Capture	Illumina GAIIx	Phase_I	101144951	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Nonsense_Mutation	SNP	ENST00000360863.6	37	CCDS43758.1	.	.	.	.	.	.	.	.	.	.	A	37	6.219361	0.97385	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	.	.	.	5.68	-5.01	0.02991	.	0.000000	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9776	0.64282	0.5003:0.0:0.4997:0.0	.	.	.	.	X	407;395;226;395	.	ENSP00000354109:Y407X	Y	-	3	2	RGS22	101144951	0.521000	0.26258	0.273000	0.24645	0.021000	0.10359	-0.263000	0.08670	-0.902000	0.03886	-1.007000	0.02485	TAT		0.393	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	
DMRT3	58524	broad.mit.edu	37	9	990347	990347	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr9:990347T>A	ENST00000190165.2	+	2	799	c.761T>A	c.(760-762)gTg>gAg	p.V254E		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	254					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V254E(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		CCGCTTGAAGTGTTAAAAAAG	0.572																																																1	Substitution - Missense(1)	ovary(1)	9											63.0	69.0	67.0					9																	990347		2203	4300	6503	980347	SO:0001583	missense	58524			AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.761T>A	9.37:g.990347T>A	ENSP00000190165:p.Val254Glu	Somatic		Capture	Illumina GAIIx	Phase_I	980347	Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Missense_Mutation	SNP	ENST00000190165.2	37	CCDS6443.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.384715	0.42308	.	.	ENSG00000064218	ENST00000190165	T	0.56444	0.46	4.62	4.62	0.57501	DMRTA motif (1);UBA-like (1);	0.064498	0.64402	D	0.000009	T	0.65770	0.2723	L	0.48642	1.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69363	-0.5165	10	0.87932	D	0	-28.1735	14.0403	0.64672	0.0:0.0:0.0:1.0	.	254	Q9NQL9	DMRT3_HUMAN	E	254	ENSP00000190165:V254E	ENSP00000190165:V254E	V	+	2	0	DMRT3	980347	1.000000	0.71417	0.668000	0.29813	0.128000	0.20619	7.287000	0.78681	1.728000	0.51552	0.374000	0.22700	GTG		0.572	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051490.1	NM_021240	
ARID3C	138715	broad.mit.edu	37	9	34622527	34622527	+	Splice_Site	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr9:34622527C>G	ENST00000378909.2	-	5	958		c.e5-1		DCTN3_ENST00000447983.2_5'Flank|DCTN3_ENST00000378913.2_5'Flank|DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000341694.2_5'Flank|DCTN3_ENST00000259632.7_5'Flank|DCTN3_ENST00000477738.2_5'Flank	NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.?(2)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		CCACTCTCCTCTAGAAGAACA	0.552																																																2	Unknown(2)	ovary(1)|skin(1)	9											63.0	68.0	66.0					9																	34622527		2203	4300	6503	34612527	SO:0001630	splice_region_variant	138715				CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.866-1G>C	9.37:g.34622527C>G		Somatic		Capture	Illumina GAIIx	Phase_I	34612527		Splice_Site	SNP	ENST00000378909.2	37	CCDS35006.1	.	.	.	.	.	.	.	.	.	.	C	6.767	0.510337	0.12883	.	.	ENSG00000205143	ENST00000378909	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2586	0.54636	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ARID3C	34612527	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	4.091000	0.57700	2.603000	0.88011	0.448000	0.29417	.		0.552	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	XM_071061	Intron
CA9	768	broad.mit.edu	37	9	35679329	35679329	+	Missense_Mutation	SNP	G	G	T	rs202078638		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr9:35679329G>T	ENST00000378357.4	+	7	1159	c.1055G>T	c.(1054-1056)aGt>aTt	p.S352I	CA9_ENST00000493245.1_3'UTR	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	352	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)	p.S352I(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	GTGATGCTGAGTGCTAAGCAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	9											174.0	151.0	158.0					9																	35679329		2203	4300	6503	35669329	SO:0001583	missense	768			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.1055G>T	9.37:g.35679329G>T	ENSP00000367608:p.Ser352Ile	Somatic		Capture	Illumina GAIIx	Phase_I	35669329	Q5T4R1	Missense_Mutation	SNP	ENST00000378357.4	37	CCDS6585.1	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824087	0.71143	.	.	ENSG00000107159	ENST00000378357;ENST00000544074	T	0.61392	0.11	5.37	4.41	0.53225	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.153114	0.47093	D	0.000257	D	0.82296	0.5006	H	0.96943	3.91	0.39933	D	0.974313	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87236	0.2263	10	0.87932	D	0	.	11.5292	0.50597	0.0:0.1806:0.8194:0.0	.	352;352	F5H404;Q16790	.;CAH9_HUMAN	I	352	ENSP00000367608:S352I	ENSP00000367608:S352I	S	+	2	0	CA9	35669329	0.997000	0.39634	1.000000	0.80357	0.961000	0.63080	3.210000	0.51129	2.665000	0.90641	0.467000	0.42956	AGT		0.527	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216	
FRMPD1	22844	broad.mit.edu	37	9	37732367	37732367	+	Missense_Mutation	SNP	G	G	C	rs142759682	byFrequency	TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr9:37732367G>C	ENST00000539465.1	+	10	1518	c.925G>C	c.(925-927)Gcg>Ccg	p.A309P	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000541302.1_Missense_Mutation_p.A178P|FRMPD1_ENST00000377765.3_Missense_Mutation_p.A309P|FRMPD1_ENST00000536622.1_Missense_Mutation_p.A131P			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	309	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.A309P(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		ACTCCGACTCGCGGCTCTGCA	0.507																																																1	Substitution - Missense(1)	ovary(1)	9											63.0	64.0	64.0					9																	37732367		2203	4300	6503	37722367	SO:0001583	missense	22844			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.925G>C	9.37:g.37732367G>C	ENSP00000444411:p.Ala309Pro	Somatic		Capture	Illumina GAIIx	Phase_I	37722367	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918454	0.92249	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000536622;ENST00000541302	D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41	5.34	5.34	0.76211	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.94732	0.8300	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95297	0.8400	10	0.87932	D	0	-15.0169	16.5411	0.84385	0.0:0.0:1.0:0.0	.	178;309	B4DZC8;Q5SYB0	.;FRPD1_HUMAN	P	309;309;131;178	ENSP00000366995:A309P;ENSP00000444411:A309P;ENSP00000437762:A131P;ENSP00000444804:A178P	ENSP00000366995:A309P	A	+	1	0	FRMPD1	37722367	1.000000	0.71417	0.541000	0.28102	0.936000	0.57629	9.412000	0.97347	2.504000	0.84457	0.655000	0.94253	GCG		0.507	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
SVEP1	79987	broad.mit.edu	37	9	113276232	113276232	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr9:113276232A>C	ENST00000401783.2	-	4	1455	c.1119T>G	c.(1117-1119)tgT>tgG	p.C373W	SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000302728.8_Missense_Mutation_p.C373W|SVEP1_ENST00000374469.1_Missense_Mutation_p.C350W|SVEP1_ENST00000374461.1_Missense_Mutation_p.C350W	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	373					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.C373W(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						ACTCACGTTCACAGGTCTGGC	0.453																																																1	Substitution - Missense(1)	ovary(1)	9											56.0	54.0	55.0					9																	113276232		1946	4138	6084	112316053	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1119T>G	9.37:g.113276232A>C	ENSP00000384917:p.Cys373Trp	Somatic		Capture	Illumina GAIIx	Phase_I	112316053	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	A	19.18	3.777213	0.70107	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	D;D;D;D	0.99245	-5.62;-5.62;-5.62;-5.62	5.88	-4.06	0.03986	Complement control module (1);Growth factor, receptor (1);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99152	0.9707	M	0.83603	2.65	0.52099	D	0.999942	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.997;0.999;0.998	D	0.99084	1.0838	10	0.87932	D	0	.	13.0479	0.58937	0.4953:0.0:0.5047:0.0	.	373;373;373;373	E9PBN8;Q4LDE5;B3KV07;Q4LDE5-2	.;SVEP1_HUMAN;.;.	W	373;350;373;350	ENSP00000384917:C373W;ENSP00000363593:C350W;ENSP00000304118:C373W;ENSP00000363585:C350W	ENSP00000304118:C373W	C	-	3	2	SVEP1	112316053	0.991000	0.36638	0.944000	0.38274	0.893000	0.52053	0.394000	0.20834	-0.828000	0.04273	0.528000	0.53228	TGT		0.453	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PAPPA	5069	broad.mit.edu	37	9	119139876	119139876	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr9:119139876C>G	ENST00000328252.3	+	20	4996	c.4627C>G	c.(4627-4629)Ctc>Gtc	p.L1543V	PAPPA_ENST00000483254.1_3'UTR|PAPPA_ENST00000534838.1_Missense_Mutation_p.L581V	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1543	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.L1543V(1)		NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CACTGCTGGTCTCAAGTGGTA	0.522																																																1	Substitution - Missense(1)	ovary(1)	9											191.0	150.0	164.0					9																	119139876		2203	4300	6503	118179697	SO:0001583	missense	5069				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.4627C>G	9.37:g.119139876C>G	ENSP00000330658:p.Leu1543Val	Somatic		Capture	Illumina GAIIx	Phase_I	118179697	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.947743	0.92593	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.03982	4.49;3.74	5.97	5.97	0.96955	Sushi/SCR/CCP (1);	0.058448	0.64402	D	0.000001	T	0.22898	0.0553	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.80764	0.945;0.994	T	0.00013	-1.2419	10	0.45353	T	0.12	-25.8562	20.4301	0.99081	0.0:1.0:0.0:0.0	.	581;1543	F5GZ19;Q13219	.;PAPP1_HUMAN	V	1543;581	ENSP00000330658:L1543V;ENSP00000441461:L581V	ENSP00000330658:L1543V	L	+	1	0	PAPPA	118179697	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.456000	0.80751	2.834000	0.97654	0.557000	0.71058	CTC		0.522	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
PPP6C	5537	broad.mit.edu	37	9	127916197	127916197	+	Silent	SNP	G	G	A	rs142534549	byFrequency	TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr9:127916197G>A	ENST00000373547.4	-	5	546	c.447C>T	c.(445-447)ctC>ctT	p.L149L	PPP6C_ENST00000373546.3_Silent_p.L2L|PPP6C_ENST00000451402.1_Silent_p.L186L|PPP6C_ENST00000415905.1_Silent_p.L127L	NM_002721.4	NP_002712.1	O00743	PPP6_HUMAN	protein phosphatase 6, catalytic subunit	149					G1/S transition of mitotic cell cycle (GO:0000082)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.L149L(1)		NS(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(3)	14						CTGCTACTGTGAGCATGTCAA	0.338																																																1	Substitution - coding silent(1)	ovary(1)	9						G	,,	1,4405	4.2+/-10.8	0,1,2202	105.0	108.0	107.0		558,381,447	3.9	1.0	9	dbSNP_134	107	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	PPP6C	NM_001123355.1,NM_001123369.1,NM_002721.4	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	186/343,127/284,149/306	127916197	1,13005	2203	4300	6503	126956018	SO:0001819	synonymous_variant	5537			AF035158	CCDS6861.1, CCDS48018.1, CCDS48019.1	9q33.3	2010-03-17			ENSG00000119414	ENSG00000119414		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9323	protein-coding gene	gene with protein product		612725				9143513	Standard	NM_002721		Approved	PP6	uc004bpg.4	O00743	OTTHUMG00000020671	ENST00000373547.4:c.447C>T	9.37:g.127916197G>A		Somatic		Capture	Illumina GAIIx	Phase_I	126956018	B2R5V6|B7Z2W9|B7Z5K9|Q5U0A2|Q9UIC9	Silent	SNP	ENST00000373547.4	37	CCDS6861.1																																																																																				0.338	PPP6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054060.1	NM_016294	
EGFL7	51162	broad.mit.edu	37	9	139566726	139566726	+	Silent	SNP	G	G	A	rs564796941		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr9:139566726G>A	ENST00000371699.1	+	10	1721	c.810G>A	c.(808-810)aaG>aaA	p.K270K	EGFL7_ENST00000406555.3_Silent_p.K270K|EGFL7_ENST00000371698.3_Silent_p.K270K|MIR126_ENST00000362291.1_RNA|EGFL7_ENST00000308874.7_Silent_p.K270K			Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	270					angiogenesis (GO:0001525)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|negative regulation of cell migration (GO:0030336)|negative regulation of Notch signaling pathway (GO:0045746)|positive regulation of endothelial cell proliferation (GO:0001938)|vasculogenesis (GO:0001570)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)	p.K270K(1)		kidney(2)|ovary(1)|prostate(2)|urinary_tract(1)	6	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		GCTCCTGCAAGAAAGACTCGT	0.652											OREG0019619	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	9											100.0	86.0	91.0					9																	139566726		2202	4300	6502	138686547	SO:0001819	synonymous_variant	51162			AF186111	CCDS7002.1	9q34.3	2008-02-05			ENSG00000172889	ENSG00000172889			20594	protein-coding gene	gene with protein product		608582					Standard	NM_016215		Approved	ZNEU1	uc004cih.3	Q9UHF1	OTTHUMG00000020938	ENST00000371699.1:c.810G>A	9.37:g.139566726G>A		Somatic	1649	Capture	Illumina GAIIx	Phase_I	138686547	B3KRP0|M9VTX9|Q5M7Y5|Q5VUD5|Q96EG0	Silent	SNP	ENST00000371699.1	37	CCDS7002.1																																																																																				0.652	EGFL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055094.1	NM_016215	
MORC4	79710	broad.mit.edu	37	X	106229431	106229431	+	Splice_Site	SNP	C	C	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chrX:106229431C>T	ENST00000355610.4	-	4	583		c.e4-1		MORC4_ENST00000535534.1_Intron|MORC4_ENST00000255495.7_Splice_Site	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	Q8TE76	MORC4_HUMAN	MORC family CW-type zinc finger 4							nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.?(1)		endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	28						AAAGCCAAAGCTGCAATTACA	0.393																																																1	Unknown(1)	ovary(1)	X											77.0	72.0	73.0					X																	106229431		1827	4065	5892	106116087	SO:0001630	splice_region_variant	79710			AK021627	CCDS14525.2, CCDS48146.1	Xq22.3	2008-02-05	2005-06-15	2005-06-15	ENSG00000133131	ENSG00000133131			23485	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 2"", ""zinc finger, CW type with coiled-coil domain 2"""	ZCWCC2		14607086	Standard	NM_024657		Approved	ZCW4, FLJ11565	uc004emp.4	Q8TE76	OTTHUMG00000022155	ENST00000355610.4:c.309-1G>A	X.37:g.106229431C>T		Somatic		Capture	Illumina GAIIx	Phase_I	106116087	A1YR23|A1YR24|H7BXF1|Q5JUK7|Q96MZ2|Q9HAI7	Splice_Site	SNP	ENST00000355610.4	37	CCDS14525.2	.	.	.	.	.	.	.	.	.	.	C	21.4	4.148006	0.78001	.	.	ENSG00000133131	ENST00000355610;ENST00000255495	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.875	0.79154	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MORC4	106116087	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.488000	0.81441	2.565000	0.86533	0.600000	0.82982	.		0.393	MORC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057816.3	NM_024657	Intron
PAK3	5063	broad.mit.edu	37	X	110459766	110459766	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chrX:110459766T>C	ENST00000372010.1	+	18	2012	c.1570T>C	c.(1570-1572)Tct>Cct	p.S524P	PAK3_ENST00000262836.4_Missense_Mutation_p.S524P|PAK3_ENST00000425146.1_Missense_Mutation_p.S509P|PAK3_ENST00000519681.1_Missense_Mutation_p.S530P|PAK3_ENST00000372007.5_Missense_Mutation_p.S509P|PAK3_ENST00000417227.1_Missense_Mutation_p.S530P|PAK3_ENST00000518291.1_Missense_Mutation_p.S545P|PAK3_ENST00000360648.4_Missense_Mutation_p.S545P|PAK3_ENST00000446737.1_Missense_Mutation_p.S509P			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	524	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.S509P(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						TAGGCGAGGATCTGCCAAGGA	0.438										TSP Lung(19;0.15)																																						1	Substitution - Missense(1)	ovary(1)	X											129.0	120.0	123.0					X																	110459766		2203	4300	6503	110346422	SO:0001583	missense	5063			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1570T>C	X.37:g.110459766T>C	ENSP00000361080:p.Ser524Pro	Somatic		Capture	Illumina GAIIx	Phase_I	110346422	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	T	19.05	3.751392	0.69533	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.54	4.34	0.51931	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75708	0.3886	L	0.51914	1.62	0.58432	D	0.999999	D;P;D;D;D	0.67145	0.995;0.875;0.996;0.995;0.996	D;P;D;D;D	0.72625	0.962;0.817;0.978;0.962;0.978	T	0.76242	-0.3031	10	0.87932	D	0	.	11.8016	0.52130	0.0:0.0:0.145:0.855	.	530;545;524;509;524	O75914-4;O75914-3;O75914;O75914-2;B1GX77	.;.;PAK3_HUMAN;.;.	P	509;509;524;530;509;545;545;530;524	ENSP00000410853:S509P;ENSP00000401982:S509P;ENSP00000361080:S524P;ENSP00000429113:S530P;ENSP00000361077:S509P;ENSP00000428921:S545P;ENSP00000353864:S545P;ENSP00000389172:S530P;ENSP00000262836:S524P	ENSP00000262836:S524P	S	+	1	0	PAK3	110346422	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	2.420000	0.44679	0.721000	0.32231	0.427000	0.28365	TCT		0.438	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
TKTL1	8277	broad.mit.edu	37	X	153549204	153549204	+	Missense_Mutation	SNP	G	G	C	rs201125069		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chrX:153549204G>C	ENST00000369915.3	+	8	1319	c.1130G>C	c.(1129-1131)gGa>gCa	p.G377A	TKTL1_ENST00000217905.7_Missense_Mutation_p.G117A|TKTL1_ENST00000369912.2_Missense_Mutation_p.G321A	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	377					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)	p.G377A(1)		NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ATCCGGATAGGAGGCCTCGCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	X											262.0	199.0	220.0					X																	153549204		2203	4300	6503	153202398	SO:0001583	missense	8277			X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.1130G>C	X.37:g.153549204G>C	ENSP00000358931:p.Gly377Ala	Somatic		Capture	Illumina GAIIx	Phase_I	153202398	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	ENST00000369915.3	37	CCDS35448.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.044787	0.00398	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000217905;ENST00000369912	T;T;T	0.37058	1.22;1.22;1.22	4.82	3.0	0.34707	Transketolase-like, pyrimidine-binding domain (2);	0.121411	0.53938	N	0.000042	T	0.18923	0.0454	N	0.04820	-0.15	0.54753	D	0.999984	B;P;P	0.35807	0.033;0.522;0.522	B;B;B	0.41946	0.035;0.371;0.371	T	0.05649	-1.0872	10	0.12766	T	0.61	-12.7183	8.3532	0.32314	0.0903:0.1534:0.7563:0.0	.	117;371;377	B7Z7M4;B7Z7I0;P51854	.;.;TKTL1_HUMAN	A	377;321;117;321	ENSP00000358931:G377A;ENSP00000217905:G117A;ENSP00000358928:G321A	ENSP00000217905:G117A	G	+	2	0	TKTL1	153202398	0.984000	0.35163	0.019000	0.16419	0.050000	0.14768	1.866000	0.39489	0.431000	0.26258	0.436000	0.28706	GGA		0.522	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058923.1	NM_012253	
F8	2157	broad.mit.edu	37	X	154227760	154227760	+	Missense_Mutation	SNP	A	A	T			TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture;Sequenom			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chrX:154227760A>T	ENST00000360256.4	-	2	459	c.259T>A	c.(259-261)Tgg>Agg	p.W87R		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	87	F5/8 type A 1.|Plastocyanin-like 1.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.W87R(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TTACCCATCCAGGGTGGCCTT	0.388																																																2	Substitution - Missense(2)	ovary(2)	X											138.0	121.0	126.0					X																	154227760		2203	4300	6503	153880954	SO:0001583	missense	2157			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.259T>A	X.37:g.154227760A>T	ENSP00000353393:p.Trp87Arg	Somatic		Capture	Illumina GAIIx	Phase_I	153880954	Q14286|Q5HY69	Missense_Mutation	SNP	ENST00000360256.4	37	CCDS35457.1	.	.	.	.	.	.	.	.	.	.	A	15.10	2.732019	0.48939	.	.	ENSG00000185010	ENST00000360256;ENST00000423959;ENST00000453950	D;D;D	0.99113	-5.44;-5.44;-5.44	5.01	5.01	0.66863	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99248	0.9738	M	0.88512	2.96	0.36783	D	0.884461	D;D	0.89917	0.991;1.0	D;D	0.91635	0.931;0.999	D	0.99948	1.1503	10	0.72032	D	0.01	-6.2382	10.1198	0.42614	1.0:0.0:0.0:0.0	.	52;87	B1B0G8;P00451	.;FA8_HUMAN	R	87;52;81	ENSP00000353393:W87R;ENSP00000409446:W52R;ENSP00000389153:W81R	ENSP00000353393:W87R	W	-	1	0	F8	153880954	1.000000	0.71417	0.991000	0.47740	0.359000	0.29487	5.610000	0.67668	1.654000	0.50703	0.242000	0.17961	TGG		0.388	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
CD163L1	283316	broad.mit.edu	37	12	7527226	7527245	+	Frame_Shift_Del	DEL	CACACCACGTGGGCATCGCT	CACACCACGTGGGCATCGCT	-	rs374448838		TCGA-25-1313-01A-01W-0492-08	TCGA-25-1313-10A-01W-0492-08	CACACCACGTGGGCATCGCT	CACACCACGTGGGCATCGCT	-	-	CACACCACGTGGGCATCGCT	CACACCACGTGGGCATCGCT	Unknown	Valid	Somatic	Phase_I	WXS	Illumina_Capture			Illumina GAIIx	500e327c-04ed-470b-9385-5cc070030525	bd93f362-b23a-41b7-8ad4-478cf8b18c95	g.chr12:7527226_7527245delCACACCACGTGGGCATCGCT	ENST00000313599.3	-	13	3259_3278	c.3202_3221delAGCGATGCCCACGTGGTGTG	c.(3202-3222)agcgatgcccacgtggtgtgtfs	p.SDAHVVC1068fs	CD163L1_ENST00000544331.1_5'Flank|CD163L1_ENST00000396630.1_Frame_Shift_Del_p.SDAHVVC1068fs|CD163L1_ENST00000416109.2_Frame_Shift_Del_p.SDAHVVC1078fs			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1068	SRCR 10. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.D1069N(1)|p.D1069fs*27(1)|p.S1068S(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CAGCTTTTGACACACCACGTGGGCATCGCTCAGGTCCCAG	0.614											OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				3	Substitution - Missense(1)|Deletion - Frameshift(1)|Substitution - coding silent(1)	ovary(1)|lung(1)|large_intestine(1)	12																																								7418512	SO:0001589	frameshift_variant	283316			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3202_3221delAGCGATGCCCACGTGGTGTG	12.37:g.7527226_7527245delCACACCACGTGGGCATCGCT	ENSP00000315945:p.Ser1068fs	Somatic	642	Capture	Illumina GAIIx	Phase_I	7418493	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Frame_Shift_Del	DEL	ENST00000313599.3	37	CCDS8577.1																																																																																				0.614	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
