#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
DENND4B	9909	genome.wustl.edu	37	1	153903542	153903543	+	Splice_Site	INS	-	-	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	-	-	-	G	-	-	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr1:153903542_153903543insG	ENST00000361217.4	-	25	4415		c.e25-2		DENND4B_ENST00000474386.1_Splice_Site	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B						positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGATGGGGCCTGGGGGAGCCAA	0.564																																																0			1																																								152170167	SO:0001630	splice_region_variant	9909			AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.3997-2->C	1.37:g.153903547_153903547dupG		Somatic		Capture	Illumina GAIIx	Phase_III	152170166	Q5T4K0	Splice_Site	INS	-	e24-2	ENST00000361217.4	37	c.NULL	CCDS44228.1	1																																																																																			-	-		0.564	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	protein_coding	OTTHUMT00000090278.2	-	XM_375806	Intron	152170167	-1	no_errors	NM_014856	genbank	human	validated	54_36p	splice_site_ins	INS	0.995:0.981	G
IGSF9	57549	genome.wustl.edu	37	1	159912756	159912756	+	Missense_Mutation	SNP	C	C	T	rs113355407		TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr1:159912756C>T	ENST00000368094.1	-	3	441	c.244G>A	c.(244-246)Gtg>Atg	p.V82M	IGSF9_ENST00000361509.3_Missense_Mutation_p.V82M	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	82	Ig-like 1.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.V82M(1)		central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CTCTTACCCACGTAATCAGGG	0.572																																																1	Substitution - Missense(1)	ovary(1)	1						C	MET/VAL,MET/VAL	0,4406		0,0,2203	51.0	53.0	52.0		244,244	3.7	1.0	1	dbSNP_132	52	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	IGSF9	NM_001135050.1,NM_020789.3	21,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	82/1180,82/1164	159912756	1,13005	2203	4300	6503	158179380	SO:0001583	missense	57549			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.244G>A	1.37:g.159912756C>T	ENSP00000357073:p.Val82Met	Somatic		Capture	Illumina GAIIx	4	158179380		Missense_Mutation	SNP	-	p.V82M	ENST00000368094.1	37	c.244	CCDS44254.1	1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.489811	0.44249	0.0	1.16E-4	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.27256	1.68;1.68	4.66	3.67	0.42095	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.34603	N	0.003831	T	0.20861	0.0502	L	0.36672	1.1	0.29464	N	0.85755	P;D	0.61697	0.798;0.99	B;P	0.60789	0.151;0.879	T	0.01367	-1.1373	9	.	.	.	.	10.8919	0.47000	0.0:0.6766:0.3233:0.0	.	82;82	Q9P2J2;C9JI81	TUTLA_HUMAN;.	M	82	ENSP00000355049:V82M;ENSP00000357073:V82M	.	V	-	1	0	IGSF9	158179380	0.011000	0.17503	1.000000	0.80357	0.975000	0.68041	1.071000	0.30666	2.290000	0.77057	0.557000	0.71058	GTG	-	NULL		0.572	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	protein_coding	OTTHUMT00000059115.1	C	NM_020789		158179380	-1	no_errors	NM_020789	genbank	human	validated	54_36p	missense	SNP	0.99	T
SPOCD1	90853	genome.wustl.edu	37	1	32280492	32280492	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr1:32280492G>T	ENST00000360482.2	-	2	572	c.443C>A	c.(442-444)gCc>gAc	p.A148D	SPOCD1_ENST00000373648.2_Missense_Mutation_p.A148D|SPOCD1_ENST00000533231.1_Missense_Mutation_p.A148D|SPOCD1_ENST00000257100.3_Intron	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	148					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)			p.A148D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CTCCCTGCAGGCCAGAGCTCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											64.0	71.0	69.0					1																	32280492		2203	4300	6503	32053079	SO:0001583	missense	90853			AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.443C>A	1.37:g.32280492G>T	ENSP00000353670:p.Ala148Asp	Somatic		Capture	Illumina GAIIx	4	32053079	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	-	p.A148D	ENST00000360482.2	37	c.443	CCDS347.1	1	.	.	.	.	.	.	.	.	.	.	g	9.218	1.032722	0.19590	.	.	ENSG00000134668	ENST00000360482;ENST00000373648;ENST00000533231	T;T;T	0.33654	1.86;1.4;1.85	3.08	-0.563	0.11778	.	.	.	.	.	T	0.17959	0.0431	N	0.08118	0	0.09310	N	1	B;B	0.25105	0.118;0.072	B;B	0.24541	0.054;0.024	T	0.20672	-1.0268	9	0.87932	D	0	-0.1822	7.1848	0.25793	0.6102:0.0:0.3898:0.0	.	148;148	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	D	148	ENSP00000353670:A148D;ENSP00000362752:A148D;ENSP00000435851:A148D	ENSP00000353670:A148D	A	-	2	0	SPOCD1	32053079	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.433000	0.06948	-0.438000	0.07232	-1.048000	0.02349	GCC	-	NULL		0.582	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	protein_coding	OTTHUMT00000381912.1	G	NM_144569		32053079	-1	no_errors	NM_144569	genbank	human	provisional	54_36p	missense	SNP		T
ZMYM6	9204	genome.wustl.edu	37	1	35454374	35454374	+	Missense_Mutation	SNP	A	A	C			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr1:35454374A>C	ENST00000357182.4	-	16	2536	c.2309T>G	c.(2308-2310)aTt>aGt	p.I770S	ZMYM6_ENST00000373340.2_Intron|ZMYM6_ENST00000487874.1_Intron|ZMYM6_ENST00000493328.1_5'UTR	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	770					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.I770S(1)		breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				ctctccacaaatgacacactg	0.333																																																1	Substitution - Missense(1)	ovary(1)	1											38.0	33.0	34.0					1																	35454374		1627	3766	5393	35226961	SO:0001583	missense	9204			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.2309T>G	1.37:g.35454374A>C	ENSP00000349708:p.Ile770Ser	Somatic		Capture	Illumina GAIIx	4	35226961	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	-	p.I770S	ENST00000357182.4	37	c.2309	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	A	11.21	1.572642	0.28092	.	.	ENSG00000163867	ENST00000357182	T	0.12361	2.69	3.56	3.56	0.40772	.	0.220645	0.36134	N	0.002777	T	0.11024	0.0269	L	0.52011	1.625	0.80722	D	1	P	0.37466	0.596	B	0.29267	0.1	T	0.06917	-1.0800	10	0.54805	T	0.06	-7.603	8.7304	0.34496	1.0:0.0:0.0:0.0	.	770	O95789	ZMYM6_HUMAN	S	770	ENSP00000349708:I770S	ENSP00000349708:I770S	I	-	2	0	ZMYM6	35226961	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.736000	0.62059	1.609000	0.50190	0.533000	0.62120	ATT	-	NULL		0.333	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	protein_coding	OTTHUMT00000011999.1	A	NM_007167		35226961	-1	no_errors	NM_007167	genbank	human	validated	54_36p	missense	SNP	1	C
YBX1	4904	genome.wustl.edu	37	1	43162857	43162857	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr1:43162857G>C	ENST00000321358.7	+	6	803	c.664G>C	c.(664-666)Gac>Cac	p.D222H	YBX1_ENST00000467957.1_3'UTR	NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	222					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)	p.D222H(1)		large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TCAGGGTGCTGACAACCAGGG	0.408																																																1	Substitution - Missense(1)	ovary(1)	1											93.0	84.0	87.0					1																	43162857		2203	4300	6503	42935444	SO:0001583	missense	4904			BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.664G>C	1.37:g.43162857G>C	ENSP00000361626:p.Asp222His	Somatic		Capture	Illumina GAIIx	4	42935444	P16990|P16991|Q14972|Q15325|Q5FVF0	Missense_Mutation	SNP	HMMPfam_CSD;superfamily_Nucleic acid-binding proteins	p.D222H	ENST00000321358.7	37	c.664	CCDS470.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574607	0.86542	.	.	ENSG00000065978	ENST00000321358;ENST00000332220;ENST00000318612	T;T	0.43688	1.34;0.94	5.38	5.38	0.77491	.	0.127403	0.64402	D	0.000001	T	0.67183	0.2866	M	0.82323	2.585	0.58432	D	0.999999	D	0.69078	0.997	D	0.68192	0.956	T	0.72200	-0.4362	10	0.72032	D	0.01	-5.8553	16.6181	0.84922	0.0:0.0:1.0:0.0	.	222	P67809	YBOX1_HUMAN	H	222;192;214	ENSP00000361626:D222H;ENSP00000405937:D192H	ENSP00000361621:D214H	D	+	1	0	YBX1	42935444	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.414000	0.80117	2.507000	0.84556	0.563000	0.77884	GAC	-	NULL		0.408	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YBX1	protein_coding	OTTHUMT00000019786.2	G	NM_004559		42935444	1	no_errors	NM_004559	genbank	human	validated	54_36p	missense	SNP	1	C
RAD54L	8438	genome.wustl.edu	37	1	46743829	46743829	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr1:46743829A>G	ENST00000371975.4	+	18	2793	c.2119A>G	c.(2119-2121)Aac>Gac	p.N707D	RAD54L_ENST00000442598.1_Missense_Mutation_p.N707D|LRRC41_ENST00000472710.1_5'Flank	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	707					chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.N707D(1)		breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		GGCAGGGTGGAACCACTGCAC	0.602								Direct reversal of damage;Homologous recombination																																								1	Substitution - Missense(1)	ovary(1)	1											46.0	40.0	42.0					1																	46743829		2203	4300	6503	46516416	SO:0001583	missense	8438			X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.2119A>G	1.37:g.46743829A>G	ENSP00000361043:p.Asn707Asp	Somatic		Capture	Illumina GAIIx	4	46516416	Q5TE31|Q6IUY3	Missense_Mutation	SNP	HMMPfam_SNF2_N;HMMPfam_Helicase_C;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.N707D	ENST00000371975.4	37	c.2119	CCDS532.1	1	.	.	.	.	.	.	.	.	.	.	A	12.85	2.063019	0.36373	.	.	ENSG00000085999	ENST00000442598;ENST00000371975;ENST00000535499	T;T	0.75367	-0.93;-0.93	5.12	3.94	0.45596	.	0.092240	0.64402	D	0.000001	T	0.64305	0.2586	L	0.45422	1.42	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.003;0.001	T	0.59526	-0.7438	10	0.22706	T	0.39	-20.3616	12.2025	0.54335	0.7406:0.2594:0.0:0.0	.	527;707	G3V1N0;Q92698	.;RAD54_HUMAN	D	707;707;527	ENSP00000396113:N707D;ENSP00000361043:N707D	ENSP00000361043:N707D	N	+	1	0	RAD54L	46516416	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.001000	0.49488	2.168000	0.68352	0.454000	0.30748	AAC	-	NULL		0.602	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L	protein_coding	OTTHUMT00000021272.1	A	NM_003579		46516416	1	no_errors	NM_003579	genbank	human	reviewed	54_36p	missense	SNP	1	G
CYP4X1	260293	genome.wustl.edu	37	1	47501767	47501767	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr1:47501767C>G	ENST00000371901.3	+	6	949	c.699C>G	c.(697-699)caC>caG	p.H233Q	CYP4X1_ENST00000538609.1_Missense_Mutation_p.H232Q	NM_178033.1	NP_828847.1	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X, polypeptide 1	233						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.H233Q(1)		endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	17						TGTTGTATCACAGTGACATAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	1											132.0	132.0	132.0					1																	47501767		2203	4300	6503	47274354	SO:0001583	missense	260293			AK091806	CCDS544.1	1p33	2008-02-05			ENSG00000186377	ENSG00000186377		"""Cytochrome P450s"""	20244	protein-coding gene	gene with protein product		614999				12176035	Standard	NM_178033		Approved	MGC40051	uc001cqt.3	Q8N118	OTTHUMG00000008017	ENST00000371901.3:c.699C>G	1.37:g.47501767C>G	ENSP00000360968:p.His233Gln	Somatic		Capture	Illumina GAIIx	4	47274354	G3V1U1|Q5VVE5|Q6ZN67|Q8NAZ3	Missense_Mutation	SNP	HMMPfam_p450;superfamily_Cytochrome P450	p.H233Q	ENST00000371901.3	37	c.699	CCDS544.1	1	.	.	.	.	.	.	.	.	.	.	C	9.965	1.223854	0.22457	.	.	ENSG00000186377	ENST00000538609;ENST00000371901	T;T	0.67865	-0.29;-0.29	5.91	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.60534	0.2276	L	0.46819	1.47	0.52501	D	0.999957	P;B	0.34757	0.467;0.229	B;B	0.38296	0.27;0.113	T	0.55515	-0.8129	10	0.24483	T	0.36	.	12.0953	0.53750	0.0:0.894:0.0:0.106	.	233;232	Q8N118;G3V1U1	CP4X1_HUMAN;.	Q	232;233	ENSP00000445965:H232Q;ENSP00000360968:H233Q	ENSP00000360968:H233Q	H	+	3	2	CYP4X1	47274354	0.872000	0.30054	0.942000	0.38095	0.086000	0.17979	1.643000	0.37217	1.162000	0.42619	0.591000	0.81541	CAC	-	HMMPfam_p450		0.423	CYP4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4X1	protein_coding	OTTHUMT00000022017.1	C	NM_178033		47274354	1	no_errors	NM_178033	genbank	human	reviewed	54_36p	missense	SNP	1	G
COL24A1	255631	genome.wustl.edu	37	1	86334224	86334224	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr1:86334224C>T	ENST00000370571.2	-	37	3644	c.3278G>A	c.(3277-3279)aGa>aAa	p.R1093K	COL24A1_ENST00000436319.1_Missense_Mutation_p.R1093K	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1093	Collagen-like 10.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)	p.R1093K(1)		NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTGGCCTGATCTACCCAAGGG	0.468																																																1	Substitution - Missense(1)	ovary(1)	1											118.0	111.0	113.0					1																	86334224		1917	4132	6049	86106812	SO:0001583	missense	255631			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.3278G>A	1.37:g.86334224C>T	ENSP00000359603:p.Arg1093Lys	Somatic		Capture	Illumina GAIIx	4	86106812	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	-	p.R1093K	ENST00000370571.2	37	c.3278	CCDS41353.1	1	.	.	.	.	.	.	.	.	.	.	C	3.410	-0.120453	0.06838	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.93488	-3.23;-3.23	5.41	2.26	0.28386	.	0.932534	0.08693	N	0.907659	T	0.70684	0.3252	N	0.11560	0.145	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.60865	-0.7178	10	0.22109	T	0.4	.	6.6947	0.23193	0.0:0.5573:0.3419:0.1008	.	1093;1093	Q17RW2;Q17RW2-2	COOA1_HUMAN;.	K	1093	ENSP00000359603:R1093K;ENSP00000392531:R1093K	ENSP00000359603:R1093K	R	-	2	0	COL24A1	86106812	0.007000	0.16637	0.022000	0.16811	0.013000	0.08279	0.405000	0.21015	0.241000	0.21283	0.655000	0.94253	AGA	-	NULL		0.468	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL24A1	protein_coding	OTTHUMT00000029335.4	C	NM_152890		86106812	-1	no_errors	NM_152890	genbank	human	validated	54_36p	missense	SNP	0.92	T
KCNJ10	3766	genome.wustl.edu	37	1	160011339	160011339	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr1:160011339G>T	ENST00000368089.3	-	2	1210	c.984C>A	c.(982-984)agC>agA	p.S328R	KCNJ10_ENST00000509700.1_Intron	NM_002241.4	NP_002232.2	P78508	KCJ10_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 10	328					adult walking behavior (GO:0007628)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|membrane hyperpolarization (GO:0060081)|optic nerve development (GO:0021554)|potassium ion homeostasis (GO:0055075)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of resting membrane potential (GO:0060075)|regulation of sensory perception of pain (GO:0051930)|response to blue light (GO:0009637)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)	p.S328R(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)		Yohimbine(DB01392)	GGTCAAAAAGGCTAAAGTCAG	0.512																																					GBM(167;1368 2014 14817 36425 43215)											1	Substitution - Missense(1)	ovary(1)	1											109.0	95.0	99.0					1																	160011339		2203	4300	6503	158277963	SO:0001583	missense	3766			U52155	CCDS1193.1	1q23.2	2011-07-05			ENSG00000177807	ENSG00000177807		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6256	protein-coding gene	gene with protein product		602208				9367690, 8995301, 16382105	Standard	NM_002241		Approved	Kir4.1, Kir1.2	uc001fuw.2	P78508	OTTHUMG00000024073	ENST00000368089.3:c.984C>A	1.37:g.160011339G>T	ENSP00000357068:p.Ser328Arg	Somatic		Capture	Illumina GAIIx	4	158277963	A3KME7|Q5VUT9|Q8N4I7|Q92808	Missense_Mutation	SNP	HMMPfam_IRK;superfamily_E set domains;superfamily_Voltage-gated potassium channels	p.S328R	ENST00000368089.3	37	c.984	CCDS1193.1	1	.	.	.	.	.	.	.	.	.	.	G	14.45	2.538393	0.45176	.	.	ENSG00000177807	ENST00000368089	D	0.92495	-3.05	5.09	2.15	0.27550	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.208544	0.49916	D	0.000136	D	0.89438	0.6715	L	0.58810	1.83	0.41414	D	0.987751	P	0.45078	0.85	P	0.51742	0.678	D	0.87441	0.2395	10	0.46703	T	0.11	.	11.4492	0.50142	0.2324:0.0:0.7676:0.0	.	328	P78508	IRK10_HUMAN	R	328	ENSP00000357068:S328R	ENSP00000357068:S328R	S	-	3	2	KCNJ10	158277963	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.334000	0.52097	0.347000	0.23924	-0.797000	0.03246	AGC	-	HMMPfam_IRK		0.512	KCNJ10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ10	protein_coding	OTTHUMT00000060629.1	G	NM_002241		158277963	-1	no_errors	NM_002241	genbank	human	reviewed	54_36p	missense	SNP	1	T
SORCS3	22986	genome.wustl.edu	37	10	106982968	106982968	+	Silent	SNP	G	G	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr10:106982968G>T	ENST00000369701.3	+	20	3056	c.2829G>T	c.(2827-2829)ggG>ggT	p.G943G	SORCS3_ENST00000369699.4_3'UTR	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	943					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.G943G(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GTCAACTGGGGACCCTTACCT	0.468																																					NSCLC(116;1497 1690 7108 13108 14106)											1	Substitution - coding silent(1)	ovary(1)	10											205.0	196.0	199.0					10																	106982968		2203	4300	6503	106972958	SO:0001819	synonymous_variant	22986			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2829G>T	10.37:g.106982968G>T		Somatic		Capture	Illumina GAIIx	4	106972958	Q5VXF9|Q9NQJ2	Silent	SNP	HMMPfam_PKD;superfamily_PKD domain;HMMPfam_BNR;superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase	p.G943	ENST00000369701.3	37	c.2829	CCDS7558.1	10																																																																																			-	NULL		0.468	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	protein_coding	OTTHUMT00000050221.1	G	NM_014978		106972958	1	no_errors	NM_014978	genbank	human	reviewed	54_36p	silent	SNP	0.99	T
OR8K3	219473	genome.wustl.edu	37	11	56086256	56086256	+	Silent	SNP	A	A	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr11:56086256A>T	ENST00000312711.1	+	1	474	c.474A>T	c.(472-474)ctA>ctT	p.L158L		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L158L(1)		central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TTTCTCTTCTAGTCACCATAA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	11											111.0	113.0	112.0					11																	56086256		2201	4296	6497	55842832	SO:0001819	synonymous_variant	219473			AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.474A>T	11.37:g.56086256A>T		Somatic		Capture	Illumina GAIIx	4	55842832	Q6IFC4	Silent	SNP	-	p.L158	ENST00000312711.1	37	c.474	CCDS31527.1	11																																																																																			-	NULL		0.398	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K3	protein_coding	OTTHUMT00000391602.1	A	NM_001005202		55842832	1	no_errors	NM_001005202	genbank	human	provisional	54_36p	silent	SNP		T
SMTNL1	219537	genome.wustl.edu	37	11	57310464	57310464	+	Nonsense_Mutation	SNP	G	G	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr11:57310464G>T	ENST00000399154.2	+	1	349	c.349G>T	c.(349-351)Gag>Tag	p.E117*	SMTNL1_ENST00000457912.1_Nonsense_Mutation_p.E135*|SMTNL1_ENST00000527972.1_Nonsense_Mutation_p.E117*			A8MU46	SMTL1_HUMAN	smoothelin-like 1	117	Glu-rich.				negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E135*(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						CAGGAAAGAAGAGACCAAATC	0.522																																																1	Substitution - Nonsense(1)	ovary(1)	11											40.0	41.0	41.0					11																	57310464		1975	4174	6149	57067040	SO:0001587	stop_gained	219537			BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.349G>T	11.37:g.57310464G>T	ENSP00000382108:p.Glu117*	Somatic		Capture	Illumina GAIIx	4	57067040		Nonsense_Mutation	SNP	-	p.E135*	ENST00000399154.2	37	c.403		11	.	.	.	.	.	.	.	.	.	.	G	17.18	3.322769	0.60634	.	.	ENSG00000214872	ENST00000457912;ENST00000527972;ENST00000399154	.	.	.	5.44	2.47	0.30058	.	0.272316	0.19153	U	0.121393	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-13.8115	8.5167	0.33250	0.0817:0.2962:0.6221:0.0	.	.	.	.	X	135;117;117	.	ENSP00000382108:E117X	E	+	1	0	SMTNL1	57067040	0.992000	0.36948	0.930000	0.37139	0.288000	0.27193	3.175000	0.50855	0.632000	0.30432	0.655000	0.94253	GAG	-	NULL		0.522	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	SMTNL1	protein_coding		G	XM_166203		57067040	1	no_errors	NM_001105565	genbank	human	provisional	54_36p	nonsense	SNP	0.12	T
DLG2	1740	genome.wustl.edu	37	11	83180390	83180390	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr11:83180390C>T	ENST00000532653.1	-	20	2406	c.2104G>A	c.(2104-2106)Gag>Aag	p.E702K	DLG2_ENST00000280241.8_Missense_Mutation_p.E759K|DLG2_ENST00000543673.1_Missense_Mutation_p.E825K|DLG2_ENST00000537455.1_Missense_Mutation_p.E470K|DLG2_ENST00000330014.6_Missense_Mutation_p.E641K|DLG2_ENST00000404783.3_Missense_Mutation_p.E198K|DLG2_ENST00000398309.2_Missense_Mutation_p.E720K|DLG2_ENST00000426717.2_Missense_Mutation_p.E184K|DLG2_ENST00000376104.2_Missense_Mutation_p.E825K|DLG2_ENST00000418306.2_Missense_Mutation_p.E599K|DLG2_ENST00000531015.1_Missense_Mutation_p.E687K|DLG2_ENST00000524982.1_Missense_Mutation_p.E716K|DLG2_ENST00000376106.3_Missense_Mutation_p.E184K			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	417					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.E720K(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CCATCCACCTCGTAGTCTCGC	0.378																																																1	Substitution - Missense(1)	ovary(1)	11											175.0	164.0	168.0					11																	83180390		1893	4119	6012	82858038	SO:0001583	missense	1740			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.2104G>A	11.37:g.83180390C>T	ENSP00000435849:p.Glu702Lys	Somatic		Capture	Illumina GAIIx	4	82858038	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_Guanylate_kin;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.E720K	ENST00000532653.1	37	c.2158		11	.	.	.	.	.	.	.	.	.	.	C	35	5.520373	0.96416	.	.	ENSG00000150672	ENST00000398309;ENST00000426717;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000404783;ENST00000330014;ENST00000537455;ENST00000376106;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000457267;ENST00000420775	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.59638	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.25	5.52	5.52	0.82312	Guanylate kinase/L-type calcium channel (1);Guanylate kinase, conserved site (1);Guanylate kinase (2);	0.000000	0.64402	D	0.000003	D	0.88016	0.6324	H	0.99770	4.765	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;1.0;1.0;0.998	D	0.93378	0.6741	9	.	.	.	.	19.4398	0.94813	0.0:1.0:0.0:0.0	.	687;702;716;641;198;825;720;599	E9PIW2;B7Z2T4;E9PN83;B7Z264;B5MCC5;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	K	720;184;825;599;825;759;198;641;470;184;716;702;825;687;72;202	ENSP00000381355:E720K;ENSP00000393049:E184K;ENSP00000365272:E825K;ENSP00000402275:E599K;ENSP00000441994:E825K;ENSP00000280241:E759K;ENSP00000385113:E198K;ENSP00000381353:E641K;ENSP00000443248:E470K;ENSP00000365274:E184K;ENSP00000432894:E716K;ENSP00000435849:E702K;ENSP00000433848:E687K;ENSP00000409133:E72K;ENSP00000391017:E202K	.	E	-	1	0	DLG2	82858038	1.000000	0.71417	0.981000	0.43875	0.993000	0.82548	7.445000	0.80570	2.598000	0.87819	0.655000	0.94253	GAG	-	HMMPfam_Guanylate_kin		0.378	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	protein_coding	OTTHUMT00000259253.2	C	NM_001364		82858038	-1	no_errors	NM_001364	genbank	human	reviewed	54_36p	missense	SNP	1	T
LDHB	3945	genome.wustl.edu	37	12	21796909	21796909	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr12:21796909C>G	ENST00000396076.1	-	4	713	c.381G>C	c.(379-381)aaG>aaC	p.K127N	LDHB_ENST00000350669.1_Missense_Mutation_p.K127N	NM_001174097.1	NP_001167568.1	P07195	LDHB_HUMAN	lactate dehydrogenase B	127					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|lactate metabolic process (GO:0006089)|NAD metabolic process (GO:0019674)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	L-lactate dehydrogenase activity (GO:0004459)|NAD binding (GO:0051287)	p.K127N(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	26						CAGGACTGTACTTGACGATCT	0.408																																																1	Substitution - Missense(1)	ovary(1)	12											130.0	124.0	126.0					12																	21796909		2203	4300	6503	21688176	SO:0001583	missense	3945				CCDS8691.1	12p12.2-p12.1	2012-10-02			ENSG00000111716	ENSG00000111716	1.1.1.27		6541	protein-coding gene	gene with protein product		150100					Standard	NM_002300		Approved		uc001rfe.3	P07195	OTTHUMG00000133760	ENST00000396076.1:c.381G>C	12.37:g.21796909C>G	ENSP00000379386:p.Lys127Asn	Somatic		Capture	Illumina GAIIx	4	21688176		Missense_Mutation	SNP	HMMPfam_Ldh_1_N;HMMPfam_Ldh_1_C;superfamily_LDH C-terminal domain-like;superfamily_NAD(P)-binding Rossmann-fold domains	p.K127N	ENST00000396076.1	37	c.381	CCDS8691.1	12	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020170	0.54576	.	.	ENSG00000111716	ENST00000396076;ENST00000350669;ENST00000396075;ENST00000450584	D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47	5.69	5.69	0.88448	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.096535	0.64402	D	0.000002	D	0.90776	0.7104	M	0.81112	2.525	0.58432	D	0.999998	B	0.34255	0.445	B	0.42422	0.387	D	0.90685	0.4608	10	0.72032	D	0.01	.	11.2332	0.48925	0.0:0.8588:0.0:0.1412	.	127	P07195	LDHB_HUMAN	N	127	ENSP00000379386:K127N;ENSP00000229319:K127N;ENSP00000379385:K127N;ENSP00000398015:K127N	ENSP00000229319:K127N	K	-	3	2	LDHB	21688176	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	0.733000	0.26087	2.683000	0.91414	0.563000	0.77884	AAG	-	HMMPfam_Ldh_1_N		0.408	LDHB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LDHB	protein_coding	OTTHUMT00000258220.2	C	NM_002300		21688176	-1	no_errors	NM_002300	genbank	human	validated	54_36p	missense	SNP	1	G
ZCCHC8	55596	genome.wustl.edu	37	12	122966491	122966491	+	Splice_Site	SNP	C	C	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr12:122966491C>G	ENST00000336229.4	-	9	1006		c.e9+1		ZCCHC8_ENST00000536306.1_Splice_Site|ZCCHC8_ENST00000543897.1_Splice_Site	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8						mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		GCCATTAGTACCTAATAACTC	0.393																																																0			12											116.0	109.0	111.0					12																	122966491		1853	4086	5939	121532444	SO:0001630	splice_region_variant	55596			BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.875+1G>C	12.37:g.122966491C>G		Somatic		Capture	Illumina GAIIx	4	121532444	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Splice_Site	SNP	-	e9+1	ENST00000336229.4	37	c.875+1		12	.	.	.	.	.	.	.	.	.	.	C	17.88	3.497748	0.64186	.	.	ENSG00000033030	ENST00000536306;ENST00000543897;ENST00000336229;ENST00000544054;ENST00000536663	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6942	0.96016	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZCCHC8	121532444	1.000000	0.71417	1.000000	0.80357	0.669000	0.39330	7.037000	0.76531	2.651000	0.90000	0.455000	0.32223	.	-	-		0.393	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	ZCCHC8	protein_coding		C	NM_017612	Intron	121532444	-1	no_errors	NM_017612	genbank	human	validated	54_36p	splice_site	SNP	1	G
TRPC4	7223	genome.wustl.edu	37	13	38225513	38225513	+	Silent	SNP	G	G	C			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr13:38225513G>C	ENST00000379705.3	-	8	2825	c.1968C>G	c.(1966-1968)ccC>ccG	p.P656P	TRPC4_ENST00000355779.2_Silent_p.P656P|TRPC4_ENST00000447043.1_Silent_p.P656P|TRPC4_ENST00000338947.5_Silent_p.P483P|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000358477.2_Silent_p.P656P|TRPC4_ENST00000426868.2_3'UTR|TRPC4_ENST00000379679.1_Silent_p.P483P|TRPC4_ENST00000379681.3_Silent_p.P656P			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	656	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.P656P(1)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TGACATTGAAGGGAGTAGGCA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	13											140.0	137.0	138.0					13																	38225513		2203	4300	6503	37123513	SO:0001819	synonymous_variant	7223			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1968C>G	13.37:g.38225513G>C		Somatic		Capture	Illumina GAIIx	4	37123513	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	-	p.P656	ENST00000379705.3	37	c.1968	CCDS9365.1	13																																																																																			-	NULL		0.433	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	protein_coding	OTTHUMT00000044574.2	G	NM_003306		37123513	-1	no_errors	NM_016179	genbank	human	validated	54_36p	silent	SNP	0.99	C
Unknown	0	genome.wustl.edu	37	13	75814539	75814539	+	IGR	SNP	C	C	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr13:75814539C>A								AL162571.1 (31366 upstream) : LINC01078 (10076 downstream)																							GTGGAGAACACGCAGCCTTGG	0.677																																																0			13																																								74712540	SO:0001628	intergenic_variant	647288																															13.37:g.75814539C>A		Somatic		Capture	Illumina GAIIx	4	74712540		RNA	SNP	-	NULL		37	NULL		13																																																																																			-	-	0	0.677					LOC647288			C			74712540	-1	pseudogene	XR_017516	genbank	human	model	54_36p	rna	SNP	0.004	A
Unknown	0	genome.wustl.edu	37	15	22440472	22440472	+	IGR	SNP	C	C	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr15:22440472C>G								RP11-2F9.4 (4295 upstream) : IGHV1OR15-1 (7909 downstream)																							GCTTGGCTCCCTTCTTGCAGC	0.458																																																0			15																																								19941836	SO:0001628	intergenic_variant	388076																															15.37:g.22440472C>G		Somatic		Capture	Illumina GAIIx	4	19941836		Missense_Mutation	SNP	-	p.K125N		37	c.375		15																																																																																			-	NULL	0	0.458					LOC388076			C			19941836	-1	pseudogene	XM_931016	genbank	human	model	54_36p	missense	SNP	1	G
NTRK3	4916	genome.wustl.edu	37	15	88420205	88420205	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr15:88420205C>A	ENST00000360948.2	-	19	2642	c.2481G>T	c.(2479-2481)ttG>ttT	p.L827F	NTRK3_ENST00000394480.2_Missense_Mutation_p.L813F|NTRK3_ENST00000557856.1_Missense_Mutation_p.L805F|NTRK3_ENST00000357724.2_Missense_Mutation_p.L819F|NTRK3_ENST00000355254.2_Missense_Mutation_p.L813F	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	827	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L813F(1)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGGCCTTCCCCAAAGCATGGA	0.537			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																													Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	1	Substitution - Missense(1)	ovary(1)	15											165.0	132.0	143.0					15																	88420205		2201	4299	6500	86221209	SO:0001583	missense	4916			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.2481G>T	15.37:g.88420205C>A	ENSP00000354207:p.Leu827Phe	Somatic		Capture	Illumina GAIIx	4	86221209	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	LRRNT;HMMPfam_LRRNT;Pkinase_Tyr;HMMPfam_Pkinase_Tyr;LRR_1;HMMPfam_LRR_1;Protein kinase-like (PK-like);superfamily_Protein kinase-like (PK-like);I-set;HMMPfam_I-set;ig;HMMPfam_ig;Immunoglobulin;superfamily_Immunoglobulin;L domain-like;superfamily_L domain-like	p.L827F	ENST00000360948.2	37	c.2481	CCDS32322.1	15	.	.	.	.	.	.	.	.	.	.	C	13.83	2.353701	0.41700	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254	T;T;T;T	0.76968	-1.06;-1.03;-0.98;-1.06	5.71	5.71	0.89125	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.064498	0.64402	D	0.000005	T	0.79730	0.4496	L	0.54965	1.715	0.80722	D	1	P;D;P	0.53462	0.883;0.96;0.529	P;P;B	0.52267	0.694;0.59;0.403	T	0.80137	-0.1508	10	0.52906	T	0.07	.	11.8376	0.52336	0.0:0.9201:0.0:0.0799	.	805;813;827	B7Z4C5;Q16288-3;Q16288	.;.;NTRK3_HUMAN	F	813;827;819;813	ENSP00000377990:L813F;ENSP00000354207:L827F;ENSP00000350356:L819F;ENSP00000347397:L813F	ENSP00000347397:L813F	L	-	3	2	NTRK3	86221209	1.000000	0.71417	0.991000	0.47740	0.019000	0.09904	2.003000	0.40844	2.709000	0.92574	0.655000	0.94253	TTG	-	NULL		0.537	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	protein_coding		C			86221209	-1	no_errors	NM_001012338	genbank	human	reviewed	54_36p	missense	SNP	1	A
PDXDC1	23042	genome.wustl.edu	37	16	15208329	15208329	+	Intron	SNP	C	C	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr16:15208329C>T	ENST00000535621.2	+	17	1587				RP11-1186N24.5_ENST00000605794.1_RNA|NPIPP1_ENST00000534799.2_RNA			Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGGGAGATGGCAAATTTATAA	0.368																																																0			16																																								15115830	SO:0001627	intron_variant	0			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000535621.2:c.1400-24407C>T	16.37:g.15208329C>T		Somatic		Capture	Illumina GAIIx	4	15115830	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Missense_Mutation	SNP	HMMPfam_GPS;HMMPfam_PLAT;HMMPfam_NPIP;superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain)	p.A652T	ENST00000535621.2	37	c.1954		16	.	.	.	.	.	.	.	.	.	.	.	3.165	-0.171292	0.06421	.	.	ENSG00000188599	ENST00000547107	.	.	.	0.764	-0.506	0.11989	.	1.790060	0.04396	U	0.363228	T	0.21550	0.0519	.	.	.	0.09310	N	1	B	0.26547	0.152	B	0.22152	0.038	T	0.15263	-1.0443	8	0.27785	T	0.31	.	4.3693	0.11239	0.0:0.5685:0.4315:0.0	.	612	Q6ZNL0	YP009_HUMAN	T	55	.	ENSP00000447959:A55T	A	-	1	0	NPIPP1	15115830	0.004000	0.15560	0.001000	0.08648	0.002000	0.02628	0.731000	0.26058	-0.139000	0.11414	0.436000	0.28706	GCC	-	NULL		0.368	PDXDC1-016	PUTATIVE	basic	protein_coding	uc002ddh.1	protein_coding	OTTHUMT00000422421.1	C	NM_015027		15115830	-1	no_start_codon	ENST00000340301	ensembl	human	known	54_36p	missense	SNP		T
ACSM2B	348158	genome.wustl.edu	37	16	20554276	20554276	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr16:20554276T>G	ENST00000329697.6	-	12	1637	c.1469A>C	c.(1468-1470)gAg>gCg	p.E490A	ACSM2B_ENST00000565322.1_Missense_Mutation_p.E411A|ACSM2B_ENST00000567001.1_Missense_Mutation_p.E490A|ACSM2B_ENST00000567288.1_5'Flank|ACSM2B_ENST00000565232.1_Missense_Mutation_p.E490A	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	490					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)	p.E490A(1)		breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						CACAGCCGTCTCAACCACAGC	0.557																																																1	Substitution - Missense(1)	ovary(1)	16											107.0	102.0	104.0					16																	20554276		2201	4299	6500	20461777	SO:0001583	missense	348158			AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.1469A>C	16.37:g.20554276T>G	ENSP00000327453:p.Glu490Ala	Somatic		Capture	Illumina GAIIx	4	20461777	Q86YT1	Missense_Mutation	SNP	-	p.E490A	ENST00000329697.6	37	c.1469	CCDS10586.1	16	.	.	.	.	.	.	.	.	.	.	T	14.35	2.508280	0.44660	.	.	ENSG00000066813	ENST00000329697	T	0.65916	-0.18	3.1	3.1	0.35709	AMP-dependent synthetase/ligase (1);	0.289161	0.24202	N	0.040602	T	0.75236	0.3822	M	0.73372	2.23	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.72625	0.978;0.978	T	0.77968	-0.2388	10	0.87932	D	0	-8.7215	11.459	0.50199	0.0:0.0:0.0:1.0	.	490;490	A8K051;Q68CK6	.;ACS2B_HUMAN	A	490	ENSP00000327453:E490A	ENSP00000327453:E490A	E	-	2	0	ACSM2B	20461777	1.000000	0.71417	0.009000	0.14445	0.328000	0.28507	6.168000	0.71908	1.423000	0.47198	0.416000	0.27883	GAG	-	NULL		0.557	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2B	protein_coding	OTTHUMT00000254417.2	T	NM_182617		20461777	-1	no_errors	NM_001105069	genbank	human	validated	54_36p	missense	SNP	0.98	G
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	17	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	7517845	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	Somatic		Capture	Illumina GAIIx	4	7517845	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R273H	ENST00000269305.4	37	c.818	CCDS11118.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	-	HMMPfam_P53		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517845	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.81	T
ZNF624	57547	genome.wustl.edu	37	17	16525650	16525650	+	Silent	SNP	G	G	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr17:16525650G>A	ENST00000311331.7	-	6	2641	c.2550C>T	c.(2548-2550)agC>agT	p.S850S		NM_020787.3	NP_065838.2	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	850					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S850S(1)		breast(4)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	26				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GTACAGTAAGGCTCGAACTAC	0.348																																					NSCLC(186;1023 2134 13330 38202 39800)											1	Substitution - coding silent(1)	ovary(1)	17											134.0	136.0	135.0					17																	16525650		2203	4300	6503	16466375	SO:0001819	synonymous_variant	57547			AB037770	CCDS11180.1	17p11.2	2013-01-08			ENSG00000197566	ENSG00000197566		"""Zinc fingers, C2H2-type"", ""-"""	29254	protein-coding gene	gene with protein product						10718198	Standard	NM_020787		Approved	KIAA1349	uc010cpi.2	Q9P2J8	OTTHUMG00000058996	ENST00000311331.7:c.2550C>T	17.37:g.16525650G>A		Somatic		Capture	Illumina GAIIx	4	16466375	Q3SY62|Q3SY63|Q6ZN27	Silent	SNP	-	p.S850	ENST00000311331.7	37	c.2550	CCDS11180.1	17																																																																																			-	NULL		0.348	ZNF624-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF624	protein_coding	OTTHUMT00000130512.3	G	XM_047617		16466375	-1	no_errors	NM_020787	genbank	human	validated	54_36p	silent	SNP	0.01	A
H3F3AP4	440926	genome.wustl.edu	37	2	175584699	175584699	+	RNA	SNP	G	G	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr2:175584699G>A	ENST00000442996.1	+	0	217																											GAAGCAACTGGCTACAAAAGC	0.547											OREG0015078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2																																								175292945			0																															2.37:g.175584699G>A		Somatic	1924	Capture	Illumina GAIIx	4	175292945		Missense_Mutation	SNP	-	p.A22T	ENST00000442996.1	37	c.64		2																																																																																			-	NULL		0.547	AC018890.6-002	KNOWN	basic	antisense	ENSG00000196285	antisense	OTTHUMT00000334128.1	G			175292945	1	no_errors	ENST00000375183	ensembl	human	known	54_36p	missense	SNP	1	A
MEX3C	51320	genome.wustl.edu	37	18	48703666	48703666	+	5'UTR	SNP	T	T	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr18:48703666T>G	ENST00000591040.1	-	0	323							Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.K150N(1)		endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		TAGTTGCTCCTTTGGGTCCAA	0.488																																																1	Substitution - Missense(1)	ovary(1)	18											86.0	81.0	83.0					18																	48703666		2203	4300	6503	46957664	SO:0001623	5_prime_UTR_variant	51320			BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.-476A>C	18.37:g.48703666T>G		Somatic		Capture	Illumina GAIIx	4	46957664	A1L022|Q9NZE3	Missense_Mutation	SNP	-	p.K345N	ENST00000591040.1	37	c.1035		18	.	.	.	.	.	.	.	.	.	.	T	17.21	3.330625	0.60743	.	.	ENSG00000176624	ENST00000406189	T	0.34072	1.38	5.88	5.88	0.94601	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.55689	0.1936	M	0.83384	2.64	0.80722	D	1	D	0.61697	0.99	P	0.57846	0.828	T	0.61987	-0.6949	10	0.62326	D	0.03	-14.244	9.7276	0.40342	0.0:0.0781:0.0:0.9219	.	345	Q5U5Q3	MEX3C_HUMAN	N	345	ENSP00000385610:K345N	ENSP00000385610:K345N	K	-	3	2	MEX3C	46957664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.859000	0.39418	2.246000	0.74042	0.533000	0.62120	AAA	-	NULL		0.488	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	MEX3C	protein_coding	OTTHUMT00000449559.1	T	NM_016626		46957664	-1	no_errors	NM_016626	genbank	human	validated	54_36p	missense	SNP	1	G
MAN2B1	4125	genome.wustl.edu	37	19	12775790	12775790	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr19:12775790T>A	ENST00000456935.2	-	4	486	c.446A>T	c.(445-447)gAg>gTg	p.E149V	CTD-2192J16.24_ENST00000597961.1_Missense_Mutation_p.E146V|WDR83_ENST00000418543.3_5'Flank|MAN2B1_ENST00000221363.4_Missense_Mutation_p.E149V	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	149					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)	p.E149V(1)		breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						ATTGGCGAACTCCAGGCGCCC	0.607																																																1	Substitution - Missense(1)	ovary(1)	19											61.0	47.0	52.0					19																	12775790		2203	4300	6503	12636790	SO:0001583	missense	4125				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.446A>T	19.37:g.12775790T>A	ENSP00000395473:p.Glu149Val	Somatic		Capture	Illumina GAIIx	4	12636790	G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_38;superfamily_Galactose mutarotase-like;superfamily_Glycoside hydrolase/deacetylase;HMMPfam_Glyco_hydro_38C;HMMPfam_Alpha-mann_mid;superfamily_Families 57/38 glycoside transferase middle domain	p.E149V	ENST00000456935.2	37	c.446	CCDS32919.1	19	.	.	.	.	.	.	.	.	.	.	T	28.9	4.964317	0.92791	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	D;D	0.83250	-1.7;-1.7	5.69	5.69	0.88448	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.156867	0.30830	N	0.008793	D	0.93400	0.7895	H	0.95437	3.67	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.972;0.978	D	0.95039	0.8176	10	0.87932	D	0	-63.539	13.8998	0.63797	0.0:0.0:0.0:1.0	.	149;149	G5E928;O00754	.;MA2B1_HUMAN	V	149;88;149	ENSP00000395473:E149V;ENSP00000221363:E149V	ENSP00000221363:E149V	E	-	2	0	MAN2B1	12636790	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	7.569000	0.82380	2.171000	0.68590	0.402000	0.26972	GAG	-	HMMPfam_Glyco_hydro_38		0.607	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAN2B1	protein_coding	OTTHUMT00000344062.1	T			12636790	-1	no_errors	NM_000528	genbank	human	reviewed	54_36p	missense	SNP	1	A
OR7C1	26664	genome.wustl.edu	37	19	14910239	14910239	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr19:14910239G>A	ENST00000248073.2	-	1	784	c.710C>T	c.(709-711)gCg>gTg	p.A237V	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	237					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A237V(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						GGTGGAAAACGCTTTGTGCTT	0.468																																																1	Substitution - Missense(1)	ovary(1)	19											67.0	64.0	65.0					19																	14910239		2203	4300	6503	14771239	SO:0001583	missense	26664			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.710C>T	19.37:g.14910239G>A	ENSP00000248073:p.Ala237Val	Somatic		Capture	Illumina GAIIx	4	14771239	Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.A237V	ENST00000248073.2	37	c.710	CCDS12317.1	19	.	.	.	.	.	.	.	.	.	.	g	17.62	3.435325	0.62955	.	.	ENSG00000127530	ENST00000248073	T	0.00342	8.03	3.64	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34676	U	0.003771	T	0.00412	0.0013	M	0.81802	2.56	0.25771	N	0.984839	P	0.50156	0.932	P	0.44394	0.448	T	0.45934	-0.9227	10	0.72032	D	0.01	.	13.18	0.59649	0.0:0.0:1.0:0.0	.	237	O76099	OR7C1_HUMAN	V	237	ENSP00000248073:A237V	ENSP00000248073:A237V	A	-	2	0	OR7C1	14771239	1.000000	0.71417	0.187000	0.23214	0.010000	0.07245	3.867000	0.56047	2.024000	0.59613	0.543000	0.68304	GCG	-	HMMPfam_7tm_1		0.468	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	protein_coding	OTTHUMT00000466519.1	G			14771239	-1	no_errors	NM_198944	genbank	human	validated	54_36p	missense	SNP	1	A
JAK3	3718	genome.wustl.edu	37	19	17937626	17937626	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr19:17937626C>T	ENST00000527670.1	-	23	3330	c.3301G>A	c.(3301-3303)Gga>Aga	p.G1101R	JAK3_ENST00000458235.1_Missense_Mutation_p.G1101R			P52333	JAK3_HUMAN	Janus kinase 3	1101	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.G1101R(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CCCCGGCTTCCGCTCCACAGC	0.622		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	1	Substitution - Missense(1)	ovary(1)	19											120.0	107.0	111.0					19																	17937626		2203	4300	6503	17798626	SO:0001583	missense	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.3301G>A	19.37:g.17937626C>T	ENSP00000432511:p.Gly1101Arg	Somatic		Capture	Illumina GAIIx	4	17798626	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	Pkinase_Tyr;HMMPfam_Pkinase_Tyr	p.G1101R	ENST00000527670.1	37	c.3301	CCDS12366.1	19	.	.	.	.	.	.	.	.	.	.	C	4.042	0.005319	0.07866	.	.	ENSG00000105639	ENST00000458235;ENST00000527670	T;T	0.75154	-0.91;-0.91	3.5	2.44	0.29823	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.51719	0.1691	N	0.21194	0.64	0.09310	N	1	P	0.36125	0.538	B	0.19148	0.024	T	0.24333	-1.0163	9	0.22109	T	0.4	2.6838	8.6716	0.34154	0.0:0.7655:0.2345:0.0	.	1101	P52333	JAK3_HUMAN	R	1101	ENSP00000391676:G1101R;ENSP00000432511:G1101R	ENSP00000391676:G1101R	G	-	1	0	JAK3	17798626	0.000000	0.05858	0.030000	0.17652	0.040000	0.13550	0.633000	0.24598	0.679000	0.31345	-0.828000	0.03084	GGA	-	NULL		0.622	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK3	protein_coding	OTTHUMT00000385549.1	C	NM_000215		17798626	-1	no_errors	NM_000215	genbank	human	reviewed	54_36p	missense	SNP	0.02	T
LRP1B	53353	genome.wustl.edu	37	2	141214104	141214104	+	Missense_Mutation	SNP	T	T	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr2:141214104T>A	ENST00000389484.3	-	62	10854	c.9883A>T	c.(9883-9885)Acc>Tcc	p.T3295S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3295	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.T3295S(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CAAGTGTGGGTTTTTCCAGGG	0.433										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											118.0	109.0	112.0					2																	141214104		2203	4300	6503	140930574	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9883A>T	2.37:g.141214104T>A	ENSP00000374135:p.Thr3295Ser	Somatic		Capture	Illumina GAIIx	4	140930574	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	HMMPfam_Ldl_recept_a;HMMPfam_EGF;HMMPfam_EGF_CA;HMMPfam_EGF_2;superfamily_EGF/Laminin;superfamily_YWTD domain;HMMPfam_Ldl_recept_b;HMMPfam_NHL;superfamily_LDL receptor-like module	p.T3295S	ENST00000389484.3	37	c.9883	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	11.82	1.752434	0.31046	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.86164	-2.08	5.31	4.1	0.47936	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.716583	0.12900	U	0.429862	T	0.73598	0.3607	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.58549	-0.7617	10	0.05833	T	0.94	.	6.8506	0.24012	0.2571:0.0:0.1341:0.6087	.	3295	Q9NZR2	LRP1B_HUMAN	S	3295;3233	ENSP00000374135:T3295S	ENSP00000374135:T3295S	T	-	1	0	LRP1B	140930574	0.938000	0.31826	0.997000	0.53966	0.995000	0.86356	2.064000	0.41432	1.992000	0.58205	0.528000	0.53228	ACC	-	HMMPfam_EGF		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	T	NM_018557		140930574	-1	no_errors	NM_018557	genbank	human	validated	54_36p	missense	SNP	0.03	A
LRP1B	53353	genome.wustl.edu	37	2	141459320	141459320	+	Missense_Mutation	SNP	C	C	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr2:141459320C>G	ENST00000389484.3	-	40	7368	c.6397G>C	c.(6397-6399)Gtt>Ctt	p.V2133L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2133					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.V2133L(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AATATTTTAACCTCCTTCAGG	0.398										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											1	Substitution - Missense(1)	ovary(1)	2											120.0	112.0	115.0					2																	141459320		2203	4300	6503	141175790	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6397G>C	2.37:g.141459320C>G	ENSP00000374135:p.Val2133Leu	Somatic		Capture	Illumina GAIIx	4	141175790	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	HMMPfam_Ldl_recept_a;HMMPfam_EGF;HMMPfam_EGF_CA;HMMPfam_EGF_2;superfamily_EGF/Laminin;superfamily_YWTD domain;HMMPfam_Ldl_recept_b;HMMPfam_NHL;superfamily_LDL receptor-like module	p.V2133L	ENST00000389484.3	37	c.6397	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048730	0.36181	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.90563	-2.69	4.58	3.64	0.41730	Six-bladed beta-propeller, TolB-like (1);	0.081973	0.48767	U	0.000164	T	0.79816	0.4511	N	0.13043	0.29	0.35716	D	0.816806	B	0.02656	0.0	B	0.06405	0.002	T	0.73697	-0.3901	10	0.17832	T	0.49	.	9.7288	0.40348	0.0:0.8878:0.0:0.1122	.	2133	Q9NZR2	LRP1B_HUMAN	L	2133;2071	ENSP00000374135:V2133L	ENSP00000374135:V2133L	V	-	1	0	LRP1B	141175790	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.632000	0.54287	0.975000	0.38392	0.467000	0.42956	GTT	-	NULL		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	C	NM_018557		141175790	-1	no_errors	NM_018557	genbank	human	validated	54_36p	missense	SNP	0.99	G
HAT1	8520	genome.wustl.edu	37	2	172844218	172844218	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr2:172844218C>T	ENST00000264108.4	+	10	1070	c.1034C>T	c.(1033-1035)gCc>gTc	p.A345V	HAT1_ENST00000392584.1_Missense_Mutation_p.A260V|SLC25A12_ENST00000472748.1_Intron	NM_003642.3	NP_003633.1	O14929	HAT1_HUMAN	histone acetyltransferase 1	345					chromatin organization (GO:0006325)|chromatin silencing at telomere (GO:0006348)|DNA packaging (GO:0006323)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4 acetylation (GO:0043967)|internal protein amino acid acetylation (GO:0006475)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	H4 histone acetyltransferase activity (GO:0010485)|histone acetyltransferase activity (GO:0004402)	p.A345V(1)		breast(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|prostate(1)	19			OV - Ovarian serous cystadenocarcinoma(117;0.216)			ATGAGTGATGCCGAACAATAC	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											131.0	133.0	132.0					2																	172844218		2203	4300	6503	172552464	SO:0001583	missense	8520			AF030424	CCDS2245.1	2q31.2-q33.1	2011-07-01			ENSG00000128708	ENSG00000128708	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"""	4821	protein-coding gene	gene with protein product		603053				9427644	Standard	NM_003642		Approved	KAT1	uc002uhi.3	O14929	OTTHUMG00000132282	ENST00000264108.4:c.1034C>T	2.37:g.172844218C>T	ENSP00000264108:p.Ala345Val	Somatic		Capture	Illumina GAIIx	4	172552464	Q49A44|Q53QF0|Q53SU4|Q6P594|Q8WWB9	Missense_Mutation	SNP	superfamily_Acyl-CoA N-acyltransferases (Nat)	p.A345V	ENST00000264108.4	37	c.1034	CCDS2245.1	2	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521317	0.64747	.	.	ENSG00000128708	ENST00000392584;ENST00000264108	.	.	.	6.08	5.19	0.71726	.	0.096995	0.64402	D	0.000001	T	0.53206	0.1782	L	0.36672	1.1	0.47476	D	0.999434	B;B	0.27380	0.166;0.177	B;B	0.21151	0.033;0.033	T	0.55296	-0.8163	9	0.87932	D	0	-12.7674	15.8101	0.78552	0.0:0.9341:0.0:0.0659	.	260;345	O14929-2;O14929	.;HAT1_HUMAN	V	260;345	.	ENSP00000264108:A345V	A	+	2	0	HAT1	172552464	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.527000	0.45615	2.894000	0.99253	0.655000	0.94253	GCC	-	NULL		0.348	HAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAT1	protein_coding	OTTHUMT00000255377.1	C	NM_003642		172552464	1	no_errors	NM_003642	genbank	human	reviewed	54_36p	missense	SNP	1	T
CDK5R2	8941	genome.wustl.edu	37	2	219825429	219825429	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr2:219825429G>T	ENST00000302625.4	+	1	1053	c.887G>T	c.(886-888)cGc>cTc	p.R296L	AC097468.7_ENST00000429343.1_RNA	NM_003936.4	NP_003927.1	Q13319	CD5R2_HUMAN	cyclin-dependent kinase 5, regulatory subunit 2 (p39)	296					cerebellum development (GO:0021549)|hippocampus development (GO:0021766)|layer formation in cerebral cortex (GO:0021819)|neuron migration (GO:0001764)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|superior olivary nucleus maturation (GO:0021722)	cyclin-dependent protein kinase 5 holoenzyme complex (GO:0016533)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	cyclin-dependent protein kinase 5 activator activity (GO:0016534)|lipid binding (GO:0008289)	p.R296L(1)		central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	8		Renal(207;0.0474)		Epithelial(149;9.77e-07)|all cancers(144;0.000167)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCTGGCAGCGCTGCCTGCGC	0.627																																																1	Substitution - Missense(1)	ovary(1)	2											69.0	71.0	70.0					2																	219825429		2203	4300	6503	219533673	SO:0001583	missense	8941			U34051	CCDS2427.1	2q35	2008-05-22			ENSG00000171450	ENSG00000171450			1776	protein-coding gene	gene with protein product	"""neuronal CDK5 activator isoform"""	603764				7592934	Standard	NM_003936		Approved	p39nck5ai, P39, NCK5AI	uc002vjf.4	Q13319	OTTHUMG00000133083	ENST00000302625.4:c.887G>T	2.37:g.219825429G>T	ENSP00000304250:p.Arg296Leu	Somatic		Capture	Illumina GAIIx	4	219533673	Q4ZFW6	Missense_Mutation	SNP	HMMPfam_CDK5_activator;superfamily_Cyclin-like	p.R296L	ENST00000302625.4	37	c.887	CCDS2427.1	2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338411	0.81911	.	.	ENSG00000171450	ENST00000302625	D	0.85088	-1.94	4.52	4.52	0.55395	Cyclin-like (2);	0.211813	0.25109	U	0.033067	D	0.91074	0.7191	M	0.62723	1.935	0.45946	D	0.99877	D	0.89917	1.0	D	0.79108	0.992	D	0.92156	0.5732	10	0.87932	D	0	-9.2002	17.0983	0.86642	0.0:0.0:1.0:0.0	.	296	Q13319	CD5R2_HUMAN	L	296	ENSP00000304250:R296L	ENSP00000304250:R296L	R	+	2	0	CDK5R2	219533673	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	5.006000	0.63978	2.372000	0.80975	0.650000	0.86243	CGC	-	HMMPfam_CDK5_activator		0.627	CDK5R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5R2	protein_coding	OTTHUMT00000256728.1	G	NM_003936		219533673	1	no_errors	NM_003936	genbank	human	reviewed	54_36p	missense	SNP	1	T
PSMD1	5707	genome.wustl.edu	37	2	232026116	232026116	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr2:232026116G>T	ENST00000308696.6	+	20	2443	c.2281G>T	c.(2281-2283)Gtt>Ttt	p.V761F	PSMD1_ENST00000373635.4_Missense_Mutation_p.V761F|PSMD1_ENST00000409643.1_Missense_Mutation_p.V761F	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	761					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)	p.V761F(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GCCTTCTGTGGTTGGCGTCCT	0.433																																																1	Substitution - Missense(1)	ovary(1)	2											466.0	380.0	409.0					2																	232026116		2203	4300	6503	231734360	SO:0001583	missense	5707			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.2281G>T	2.37:g.232026116G>T	ENSP00000309474:p.Val761Phe	Somatic		Capture	Illumina GAIIx	4	231734360	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	-	p.V761F	ENST00000308696.6	37	c.2281	CCDS2482.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.127191	0.94429	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.89227	0.6655	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.78314	0.945;0.991	D	0.91385	0.5130	9	0.72032	D	0.01	-20.0762	19.9231	0.97094	0.0:0.0:1.0:0.0	.	761;761	Q99460;Q99460-2	PSMD1_HUMAN;.	F	761	.	ENSP00000309474:V761F	V	+	1	0	PSMD1	231734360	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.717000	0.92951	0.655000	0.94253	GTT	-	NULL		0.433	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD1	protein_coding	OTTHUMT00000256958.2	G			231734360	1	no_errors	NM_002807	genbank	human	reviewed	54_36p	missense	SNP	1	T
MAP3K7CL	56911	genome.wustl.edu	37	21	30547115	30547115	+	Frame_Shift_Del	DEL	A	A	-			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr21:30547115delA	ENST00000399947.2	+	9	908	c.631delA	c.(631-633)acgfs	p.T211fs	MAP3K7CL_ENST00000399934.1_Frame_Shift_Del_p.T111fs|MAP3K7CL_ENST00000399926.1_Frame_Shift_Del_p.T111fs|MAP3K7CL_ENST00000341618.4_Frame_Shift_Del_p.T211fs|MAP3K7CL_ENST00000545939.1_Frame_Shift_Del_p.T105fs|MAP3K7CL_ENST00000339024.4_Frame_Shift_Del_p.T111fs|MAP3K7CL_ENST00000399928.1_Frame_Shift_Del_p.T111fs|MAP3K7CL_ENST00000399925.1_Frame_Shift_Del_p.T111fs|MAP3K7CL_ENST00000399935.2_Frame_Shift_Del_p.T111fs|MAP3K7CL_ENST00000286791.5_3'UTR	NM_020152.2	NP_064537.1	P57077	M3KCL_HUMAN	MAP3K7 C-terminal like	211						cytosol (GO:0005829)|nucleus (GO:0005634)		p.T211fs*7(1)									CGAGGCTCTGACGGAGGAGAA	0.507																																																1	Deletion - Frameshift(1)	ovary(1)	21											119.0	111.0	114.0					21																	30547115		2203	4300	6503	29468986	SO:0001589	frameshift_variant	56911			AF269161	CCDS13584.1, CCDS68182.1, CCDS74775.1	21q22.3	2013-02-22	2013-02-22	2013-02-22	ENSG00000156265	ENSG00000156265			16457	protein-coding gene	gene with protein product		611110	"""chromosome 21 open reading frame 7"""	C21orf7			Standard	NM_020152		Approved	TAKL, TAK1L, TAKL-1, TAKL-2, TAKL-4	uc002ynf.3	P57077	OTTHUMG00000078806	ENST00000399947.2:c.631delA	21.37:g.30547115delA	ENSP00000382828:p.Thr211fs	Somatic		Capture	Illumina GAIIx	Phase_III	29468986	D3DSE0|Q8TCL9	Frame_Shift_Del	DEL	-	p.T211fs	ENST00000399947.2	37	c.631	CCDS13584.1	21																																																																																			(deletion:cds_exon[29468904,29469084])	NULL		0.507	MAP3K7CL-001	KNOWN	basic|CCDS	protein_coding	C21orf7	protein_coding	OTTHUMT00000171865.2	A	NM_020152		29468986	1	no_errors	NM_020152	genbank	human	provisional	54_36p	frame_shift_del	DEL	0.902	-
TXNRD2	10587	genome.wustl.edu	37	22	19902798	19902798	+	Splice_Site	SNP	A	A	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr22:19902798A>T	ENST00000400521.1	-	7	536	c.530T>A	c.(529-531)aTt>aAt	p.I177N	TXNRD2_ENST00000535882.1_Splice_Site_p.I176N|TXNRD2_ENST00000400518.1_Splice_Site_p.I147N|TXNRD2_ENST00000491939.1_5'UTR|TXNRD2_ENST00000400519.1_Splice_Site_p.I176N|TXNRD2_ENST00000542719.1_Splice_Site_p.I147N|TXNRD2_ENST00000334363.9_Splice_Site_p.I177N	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	177					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)	p.I177N(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					TGACAGCAGAATCTGAGGAGA	0.607																																																1	Substitution - Missense(1)	ovary(1)	22											54.0	64.0	61.0					22																	19902798		2062	4198	6260	18282798	SO:0001630	splice_region_variant	10587			AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.529-1T>A	22.37:g.19902798A>T		Somatic		Capture	Illumina GAIIx	4	18282798	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Missense_Mutation	SNP	-	p.I177N	ENST00000400521.1	37	c.530	CCDS42981.1	22	.	.	.	.	.	.	.	.	.	.	A	3.238	-0.155908	0.06544	.	.	ENSG00000184470	ENST00000400518;ENST00000538798;ENST00000400521;ENST00000400525;ENST00000540474;ENST00000400519;ENST00000535882;ENST00000542719;ENST00000334363	T;T;T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.35;0.35;0.93	4.58	2.49	0.30216	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.340491	0.29551	N	0.011834	T	0.31702	0.0805	N	0.08118	0	0.28042	N	0.933698	B;B;B;B	0.29270	0.145;0.24;0.087;0.145	B;B;B;B	0.36608	0.167;0.229;0.167;0.167	T	0.26467	-1.0102	10	0.22706	T	0.39	-8.2076	8.7708	0.34731	0.2534:0.0:0.7466:0.0	.	177;177;145;176	Q9NNW7;E7EWK1;Q6M1B7;D3YTF9	TRXR2_HUMAN;.;.;.	N	147;177;177;154;81;176;176;147;177	ENSP00000383362:I147N;ENSP00000383365:I177N;ENSP00000383369:I154N;ENSP00000383363:I176N;ENSP00000439314:I176N;ENSP00000439570:I147N;ENSP00000334451:I177N	ENSP00000334451:I177N	I	-	2	0	TXNRD2	18282798	0.974000	0.33945	0.998000	0.56505	0.032000	0.12392	1.629000	0.37071	0.670000	0.31165	-0.394000	0.06481	ATT	-	NULL		0.607	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	TXNRD2	protein_coding	OTTHUMT00000314903.3	A	NM_006440	Missense_Mutation	18282798	-1	no_errors	ENST00000400516	ensembl	human	known	54_36p	missense	SNP	0.74	T
IRAK2	3656	genome.wustl.edu	37	3	10254964	10254964	+	Missense_Mutation	SNP	C	C	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr3:10254964C>T	ENST00000256458.4	+	5	692	c.602C>T	c.(601-603)gCa>gTa	p.A201V		NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	201					activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)	p.A201V(1)		breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						TGGAGTGAGGCAGACGTGGTC	0.532																																																1	Substitution - Missense(1)	ovary(1)	3											81.0	77.0	79.0					3																	10254964		2203	4300	6503	10229964	SO:0001583	missense	3656			AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.602C>T	3.37:g.10254964C>T	ENSP00000256458:p.Ala201Val	Somatic		Capture	Illumina GAIIx	4	10229964	B4DQZ6|Q08AG6|Q5K546	Missense_Mutation	SNP	Death;HMMPfam_Death;Pkinase;HMMPfam_Pkinase	p.A201V	ENST00000256458.4	37	c.602	CCDS33697.1	3	.	.	.	.	.	.	.	.	.	.	C	2.365	-0.345618	0.05208	.	.	ENSG00000134070	ENST00000256458	T	0.34072	1.38	5.34	-1.19	0.09585	Protein kinase-like domain (1);	0.819118	0.10867	N	0.625353	T	0.15132	0.0365	N	0.08118	0	0.09310	N	0.999995	B	0.10296	0.003	B	0.08055	0.003	T	0.23119	-1.0197	10	0.27785	T	0.31	-3.0719	4.8819	0.13683	0.0:0.3338:0.1644:0.5018	.	201	O43187	IRAK2_HUMAN	V	201	ENSP00000256458:A201V	ENSP00000256458:A201V	A	+	2	0	IRAK2	10229964	0.000000	0.05858	0.112000	0.21494	0.492000	0.33523	-0.821000	0.04452	0.041000	0.15688	-0.136000	0.14681	GCA	-	NULL		0.532	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK2	protein_coding	OTTHUMT00000339623.1	C			10229964	1	no_errors	NM_001570	genbank	human	reviewed	54_36p	missense	SNP	0	T
GPR128	84873	genome.wustl.edu	37	3	100373846	100373846	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr3:100373846C>A	ENST00000273352.3	+	12	1815	c.1547C>A	c.(1546-1548)aCa>aAa	p.T516K	GPR128_ENST00000481506.1_3'UTR|GPR128_ENST00000475887.1_Missense_Mutation_p.T221K	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	516					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T516K(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						ATACCCAGGACAGACACCATT	0.428																																					Pancreas(87;185 1975 7223 18722)											1	Substitution - Missense(1)	ovary(1)	3											231.0	197.0	209.0					3																	100373846		2203	4300	6503	101856536	SO:0001583	missense	84873			AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.1547C>A	3.37:g.100373846C>A	ENSP00000273352:p.Thr516Lys	Somatic		Capture	Illumina GAIIx	4	101856536	Q14D94|Q86SQ2	Missense_Mutation	SNP	-	p.T516K	ENST00000273352.3	37	c.1547	CCDS2938.1	3	.	.	.	.	.	.	.	.	.	.	C	6.738	0.505011	0.12822	.	.	ENSG00000144820	ENST00000273352;ENST00000475887	T;T	0.37752	1.18;1.55	5.48	-11.0	0.00169	GPCR, family 2-like (1);	2.975240	0.00649	N	0.000546	T	0.28234	0.0697	L	0.40543	1.245	0.09310	N	1	B;B	0.30146	0.27;0.27	B;B	0.31812	0.136;0.136	T	0.08046	-1.0741	10	0.30854	T	0.27	.	13.3073	0.60359	0.1612:0.6547:0.1841:0.0	.	221;516	E9PHI0;Q96K78	.;GP128_HUMAN	K	516;221	ENSP00000273352:T516K;ENSP00000419788:T221K	ENSP00000273352:T516K	T	+	2	0	GPR128	101856536	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.330000	0.01110	-2.040000	0.00916	-0.262000	0.10625	ACA	-	NULL		0.428	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR128	protein_coding	OTTHUMT00000353236.1	C			101856536	1	no_errors	NM_032787	genbank	human	provisional	54_36p	missense	SNP		A
ACAD9	28976	genome.wustl.edu	37	3	128625093	128625104	+	Splice_Site	DEL	GTGAGTGGCCCC	GTGAGTGGCCCC	-	rs372636698		TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	GTGAGTGGCCCC	GTGAGTGGCCCC	GTGAGTGGCCCC	-	GTGAGTGGCCCC	GTGAGTGGCCCC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr3:128625093_128625104delGTGAGTGGCCCC	ENST00000308982.7	+	12	1359		c.e12+1		ACAD9_ENST00000511526.1_Splice_Site	NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9							dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.?(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						CATCTTCGAGGTGAGTGGCCCCGCCACCAGCT	0.651																																																1	Unknown(1)	ovary(1)	3																																								130107794	SO:0001630	splice_region_variant	28976			AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.1278+1GTGAGTGGCCCC>-	3.37:g.128625093_128625104delGTGAGTGGCCCC		Somatic		Capture	Illumina GAIIx	Phase_III	130107783	D3DNB8|Q8WXX3	Splice_Site	DEL	-	e12+1	ENST00000308982.7	37	c.NULL	CCDS3053.1	3																																																																																			(deletion:intron[130107783,130109717])	-		0.651	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD9	protein_coding	OTTHUMT00000358405.1	GTGAGTGGCCCC	NM_014049	Intron	130107794	1	no_errors	NM_014049	genbank	human	validated	54_36p	splice_site_del	DEL	1.000:1.000:0.997:0.997:0.990:0.661:0.074:0.001:0.002:0.006:0.000:0.000	-
ZBBX	79740	genome.wustl.edu	37	3	167016202	167016202	+	Silent	SNP	T	T	C	rs376514276		TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr3:167016202T>C	ENST00000392766.2	-	18	2110	c.1770A>G	c.(1768-1770)caA>caG	p.Q590Q	ZBBX_ENST00000455345.2_Silent_p.Q590Q|ZBBX_ENST00000392764.1_Silent_p.Q561Q|ZBBX_ENST00000392767.2_Silent_p.Q590Q|ZBBX_ENST00000307529.5_Silent_p.Q590Q	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	590						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.Q590Q(2)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						GTCCTTGATATTGTTTTGTTA	0.299																																																2	Substitution - coding silent(2)	ovary(2)	3											133.0	133.0	133.0					3																	167016202		1818	4068	5886	168498896	SO:0001819	synonymous_variant	79740			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1770A>G	3.37:g.167016202T>C		Somatic		Capture	Illumina GAIIx	4	168498896	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Silent	SNP	-	p.Q590	ENST00000392766.2	37	c.1770	CCDS3199.2	3																																																																																			-	NULL		0.299	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	protein_coding	OTTHUMT00000257657.3	T	NM_024687		168498896	-1	no_errors	NM_024687	genbank	human	validated	54_36p	silent	SNP	0.69	C
MAP3K13	9175	genome.wustl.edu	37	3	185165674	185165674	+	Missense_Mutation	SNP	G	G	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr3:185165674G>T	ENST00000265026.3	+	5	1283	c.949G>T	c.(949-951)Gtc>Ttc	p.V317F	MAP3K13_ENST00000424227.1_Missense_Mutation_p.V317F|MAP3K13_ENST00000535426.1_Missense_Mutation_p.V173F|MAP3K13_ENST00000443863.1_Missense_Mutation_p.V173F|MAP3K13_ENST00000446828.1_Missense_Mutation_p.V110F	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13									p.V317F(1)		NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			TGCTGGCACGGTCGCATGGAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											75.0	71.0	72.0					3																	185165674		2203	4300	6503	186648368	SO:0001583	missense	9175			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.949G>T	3.37:g.185165674G>T	ENSP00000265026:p.Val317Phe	Somatic		Capture	Illumina GAIIx	4	186648368		Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.V317F	ENST00000265026.3	37	c.949	CCDS3270.1	3	.	.	.	.	.	.	.	.	.	.	G	21.3	4.128765	0.77549	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026;ENST00000420577	D;D;D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87;-1.87;-1.87	5.58	5.58	0.84498	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85952	0.5817	N	0.11756	0.17	0.80722	D	1	D;P;D	0.67145	0.991;0.925;0.996	D;P;D	0.75484	0.967;0.804;0.986	D	0.85034	0.0919	10	0.29301	T	0.29	.	19.9414	0.97163	0.0:0.0:1.0:0.0	.	173;110;317	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	F	110;317;173;173;317;62	ENSP00000411483:V110F;ENSP00000399910:V317F;ENSP00000409325:V173F;ENSP00000439257:V173F;ENSP00000265026:V317F;ENSP00000415712:V62F	ENSP00000265026:V317F	V	+	1	0	MAP3K13	186648368	1.000000	0.71417	0.459000	0.27081	0.406000	0.30931	9.824000	0.99380	2.779000	0.95612	0.650000	0.86243	GTC	-	HMMPfam_Pkinase		0.443	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K13	protein_coding	OTTHUMT00000345268.1	G	NM_004721		186648368	1	no_errors	NM_004721	genbank	human	reviewed	54_36p	missense	SNP	1	T
PDLIM3	27295	genome.wustl.edu	37	4	186427686	186427686	+	Silent	SNP	G	G	A	rs201775052		TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr4:186427686G>A	ENST00000284770.5	-	6	856	c.783C>T	c.(781-783)gaC>gaT	p.D261D	PDLIM3_ENST00000284767.5_3'UTR|PDLIM3_ENST00000284771.6_Silent_p.D213D	NM_014476.5	NP_055291.2	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain 3	261					actin filament organization (GO:0007015)|heart development (GO:0007507)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of muscle (GO:0008307)|zinc ion binding (GO:0008270)	p.D261D(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		CAGAGCCATCGTCCACCATTC	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		17264	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	4											72.0	69.0	70.0					4																	186427686		2203	4300	6503	186664680	SO:0001819	synonymous_variant	27295			AF002280	CCDS3844.1, CCDS47172.1, CCDS75218.1, CCDS75219.1	4q35	2014-09-17			ENSG00000154553	ENSG00000154553			20767	protein-coding gene	gene with protein product		605889				10063829, 8828038	Standard	NM_014476		Approved	ALP	uc003ixw.4	Q53GG5	OTTHUMG00000160412	ENST00000284770.5:c.783C>T	4.37:g.186427686G>A		Somatic		Capture	Illumina GAIIx	4	186664680	B2R866|O43590|O60439|O60440|Q8N6Y6|Q9BVP4	Silent	SNP	-	p.D261	ENST00000284770.5	37	c.783	CCDS3844.1	4																																																																																			-	NULL		0.607	PDLIM3-001	KNOWN	basic|CCDS	protein_coding	PDLIM3	protein_coding	OTTHUMT00000360499.2	G	NM_014476		186664680	-1	no_errors	NM_014476	genbank	human	reviewed	54_36p	silent	SNP	0.99	A
TAS2R1	50834	genome.wustl.edu	37	5	9629483	9629483	+	Missense_Mutation	SNP	C	C	A	rs370795531		TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr5:9629483C>A	ENST00000382492.2	-	1	980	c.662G>T	c.(661-663)gGt>gTt	p.G221V	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	221					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.G221V(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						GATGGGTGCACCCCTGCCAGG	0.493																																																1	Substitution - Missense(1)	ovary(1)	5											55.0	63.0	60.0					5																	9629483		2203	4300	6503	9682483	SO:0001583	missense	50834			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.662G>T	5.37:g.9629483C>A	ENSP00000371932:p.Gly221Val	Somatic		Capture	Illumina GAIIx	4	9682483	Q646G8	Missense_Mutation	SNP	-	p.G221V	ENST00000382492.2	37	c.662	CCDS3876.1	5	.	.	.	.	.	.	.	.	.	.	C	10.18	1.280230	0.23392	.	.	ENSG00000169777	ENST00000382492	T	0.00745	5.75	5.55	-0.799	0.10901	.	3.229410	0.00923	N	0.002603	T	0.01029	0.0034	L	0.43152	1.355	0.09310	N	1	B	0.27316	0.175	B	0.27170	0.077	T	0.48352	-0.9043	9	.	.	.	.	5.3529	0.16045	0.0:0.3136:0.1567:0.5297	.	221	Q9NYW7	TA2R1_HUMAN	V	221	ENSP00000371932:G221V	.	G	-	2	0	TAS2R1	9682483	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.040000	0.13905	-0.053000	0.13289	-0.140000	0.14226	GGT	-	NULL		0.493	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R1	protein_coding	OTTHUMT00000206988.2	C			9682483	-1	no_errors	NM_019599	genbank	human	reviewed	54_36p	missense	SNP		A
OR4A21P	81322	genome.wustl.edu	37	11	55259392	55259392	+	IGR	SNP	G	G	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr11:55259392G>T								OR4A15 (122998 upstream) : OR4C15 (62390 downstream)														p.C225F(1)									TTCTACACCTGTGCATCCCAC	0.458																																																1	Substitution - Missense(1)	ovary(1)	11																																								55015968	SO:0001628	intergenic_variant	0																															11.37:g.55259392G>T		Somatic		Capture	Illumina GAIIx	4	55015968		Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.C225F		37	c.674		11																																																																																			-	NULL	0	0.458					ENSG00000181943			G			55015968	1	no_errors	ENST00000314657	ensembl	human	known	54_36p	missense	SNP	1	T
OR5AK3P	81228	genome.wustl.edu	37	11	56738971	56738971	+	IGR	SNP	T	T	C	rs200581407		TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr11:56738971T>C								AP000479.1 (93417 upstream) : OR5AK2 (17375 downstream)														p.Y149Y(1)									CTGGCTCATATATTATAGGCT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	11																																								56495547	SO:0001628	intergenic_variant	81228																															11.37:g.56738971T>C		Somatic		Capture	Illumina GAIIx	4	56495547		Silent	SNP	-	p.Y149		37	c.447		11																																																																																			-	NULL	0	0.398					OR5AK3P			T			56495547	1	no_errors	ENST00000326876	ensembl	human	known	54_36p	silent	SNP		C
ADTRP	84830	genome.wustl.edu	37	6	11723656	11723657	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	GC	GC	GC	AT	GC	GC	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr6:11723656_11723657GC>AT	ENST00000414691.3	-	5	993_994	c.583_584GC>AT	c.(583-585)GCt>ATt	p.A195I	ADTRP_ENST00000379413.2_Missense_Mutation_p.A195I|ADTRP_ENST00000514824.1_5'UTR|ADTRP_ENST00000229583.5_Missense_Mutation_p.A213I	NM_032744.3	NP_116133.1	Q96IZ2	ADTRP_HUMAN	androgen-dependent TFPI-regulating protein	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											AGAGAAGAAAGCTGCTAGACCC	0.48																																																0			6																																								11831643	SO:0001583	missense	84830			AJ420520	CCDS4521.1, CCDS47374.1	6p24.1	2012-01-30	2012-01-27	2012-01-27	ENSG00000111863	ENSG00000111863			21214	protein-coding gene	gene with protein product	"""androgen-induced 1-like"""	614348	"""chromosome 6 open reading frame 105"""	C6orf105		21868574	Standard	NM_032744		Approved	dJ413H6.1, AIG1L	uc011dip.2	Q96IZ2	OTTHUMG00000014260	ENST00000414691.3:c.583_584delinsAT	6.37:g.11723656_11723657delinsAT	ENSP00000404416:p.Ala195Ile	Somatic		Capture	Illumina GAIIx	4	11831642	B2R7T9|B4DV39|Q5THW1	Missense_Mutation	DNP	-	p.A195I	ENST00000414691.3	37	c.584_583	CCDS4521.1	6																																																																																			-	NULL		0.480	ADTRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf105	protein_coding	OTTHUMT00000039864.3	GC	NM_032744		11831643	-1	no_errors	NM_032744	genbank	human	validated	54_36p	missense	DNP	0.018:0.002	AT
PHF3	23469	genome.wustl.edu	37	6	64389952	64389952	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr6:64389952A>G	ENST00000262043.3	+	3	636	c.296A>G	c.(295-297)aAt>aGt	p.N99S	PHF3_ENST00000509330.1_Missense_Mutation_p.N99S|PHF3_ENST00000393387.1_Missense_Mutation_p.N99S			Q92576	PHF3_HUMAN	PHD finger protein 3	99					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.N99S(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			GAAAGTGGCAATGATACCATT	0.323																																					GBM(135;136 1820 29512 34071 46235)											1	Substitution - Missense(1)	ovary(1)	6											136.0	136.0	136.0					6																	64389952		2203	4300	6503	64447911	SO:0001583	missense	23469			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.296A>G	6.37:g.64389952A>G	ENSP00000262043:p.Asn99Ser	Somatic		Capture	Illumina GAIIx	4	64447911	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	-	p.N99S	ENST00000262043.3	37	c.296	CCDS4966.1	6	.	.	.	.	.	.	.	.	.	.	A	15.63	2.890123	0.52014	.	.	ENSG00000118482	ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387;ENST00000514822	T;T;T;T;T	0.49432	1.5;2.13;1.58;0.78;2.13	5.87	4.7	0.59300	.	0.168554	0.28322	N	0.015775	T	0.28863	0.0716	M	0.64997	1.995	0.38638	D	0.95154	B;P	0.40211	0.106;0.707	B;B	0.38655	0.021;0.278	T	0.07539	-1.0767	10	0.27785	T	0.31	-22.0289	11.7252	0.51706	0.931:0.0:0.069:0.0	.	99;99	Q92576;D6R9X2	PHF3_HUMAN;.	S	11;99;52;99;99;29	ENSP00000425227:N11S;ENSP00000262043:N99S;ENSP00000424078:N52S;ENSP00000422841:N99S;ENSP00000377048:N99S	ENSP00000262043:N99S	N	+	2	0	PHF3	64447911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.973000	0.63763	1.041000	0.40125	0.482000	0.46254	AAT	-	NULL		0.323	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF3	protein_coding	OTTHUMT00000041086.2	A			64447911	1	no_errors	NM_015153	genbank	human	provisional	54_36p	missense	SNP	1	G
Unknown	0	genome.wustl.edu	37	7	64030651	64030651	+	IGR	SNP	G	G	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr7:64030651G>T								ZNF680 (7167 upstream) : ZNF107 (95924 downstream)																							GCTCGTCCATGAAGCAGCTGA	0.642																																																0			7																																								63668086	SO:0001628	intergenic_variant	100129293																															7.37:g.64030651G>T		Somatic		Capture	Illumina GAIIx	4	63668086		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.642					LOC100129293			G			63668086	-1	pseudogene	XR_038218	genbank	human	model	54_36p	rna	SNP	1	T
PKD1L1	168507	genome.wustl.edu	37	7	47886536	47886536	+	Silent	SNP	C	C	T			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr7:47886536C>T	ENST00000289672.2	-	32	5144	c.5094G>A	c.(5092-5094)gaG>gaA	p.E1698E		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1698	GPS.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.E1698E(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CAGATTTCCACTCTCTCTTGT	0.403																																																1	Substitution - coding silent(1)	ovary(1)	7											118.0	112.0	114.0					7																	47886536		2203	4300	6503	47853061	SO:0001819	synonymous_variant	168507			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5094G>A	7.37:g.47886536C>T		Somatic		Capture	Illumina GAIIx	4	47853061	Q6UWK1	Silent	SNP	-	p.E1698	ENST00000289672.2	37	c.5094	CCDS34633.1	7																																																																																			-	NULL		0.403	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	protein_coding	OTTHUMT00000340974.1	C	NM_138295		47853061	-1	no_errors	NM_138295	genbank	human	reviewed	54_36p	silent	SNP	0.62	T
SEMA3D	223117	genome.wustl.edu	37	7	84644478	84644478	+	Missense_Mutation	SNP	A	A	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr7:84644478A>G	ENST00000284136.6	-	14	1643	c.1600T>C	c.(1600-1602)Tgc>Cgc	p.C534R	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	534	PSI.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.C534R(1)		NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TAAGTGTCGCATCTGTGCAAG	0.463																																					Ovarian(63;442 1191 17318 29975 31528)											1	Substitution - Missense(1)	ovary(1)	7											151.0	140.0	144.0					7																	84644478		2203	4300	6503	84482414	SO:0001583	missense	223117			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1600T>C	7.37:g.84644478A>G	ENSP00000284136:p.Cys534Arg	Somatic		Capture	Illumina GAIIx	4	84482414	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	HMMPfam_Sema;superfamily_Sema domain;HMMPfam_PSI;HMMPfam_V-set;superfamily_Plexin repeat;superfamily_Immunoglobulin	p.C534R	ENST00000284136.6	37	c.1600	CCDS34676.1	7	.	.	.	.	.	.	.	.	.	.	A	25.1	4.601959	0.87055	.	.	ENSG00000153993	ENST00000284136	D	0.92699	-3.09	5.75	5.75	0.90469	Semaphorin/CD100 antigen (1);	0.000000	0.85682	D	0.000000	D	0.97626	0.9222	H	0.97390	3.995	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99094	1.0841	10	0.87932	D	0	.	16.0459	0.80720	1.0:0.0:0.0:0.0	.	534	O95025	SEM3D_HUMAN	R	534	ENSP00000284136:C534R	ENSP00000284136:C534R	C	-	1	0	SEMA3D	84482414	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.196000	0.70406	0.459000	0.35465	TGC	-	HMMPfam_PSI		0.463	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	protein_coding	OTTHUMT00000336084.2	A	NM_152754		84482414	-1	no_errors	NM_152754	genbank	human	validated	54_36p	missense	SNP	1	G
AASS	10157	genome.wustl.edu	37	7	121758477	121758477	+	Missense_Mutation	SNP	T	T	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr7:121758477T>G	ENST00000393376.1	-	5	666	c.571A>C	c.(571-573)Agc>Cgc	p.S191R	AASS_ENST00000473553.1_Intron|AASS_ENST00000417368.2_Missense_Mutation_p.S191R			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	191	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)	p.S191R(1)		autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						GCCTGACTGCTATTCCTGTAG	0.413																																																1	Substitution - Missense(1)	ovary(1)	7											118.0	109.0	112.0					7																	121758477		2203	4300	6503	121545713	SO:0001583	missense	10157			AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.571A>C	7.37:g.121758477T>G	ENSP00000377040:p.Ser191Arg	Somatic		Capture	Illumina GAIIx	4	121545713	O95462	Missense_Mutation	SNP	HMMPfam_Saccharop_dh;HMMPfam_AlaDh_PNT_C;HMMPfam_AlaDh_PNT_N;superfamily_NAD(P)-binding Rossmann-fold domains;superfamily_Formate/glycerate dehydrogenase catalytic domain-like;superfamily_Glyceraldehyde-3-phosphate dehydrogenase-like C-terminal domain	p.S191R	ENST00000393376.1	37	c.571	CCDS5783.1	7	.	.	.	.	.	.	.	.	.	.	.	19.93	3.918476	0.73098	.	.	ENSG00000008311	ENST00000393376;ENST00000417368	.	.	.	4.83	4.83	0.62350	.	0.177976	0.64402	D	0.000009	T	0.62122	0.2402	M	0.73962	2.25	0.53688	D	0.999971	P	0.47910	0.902	P	0.47470	0.548	T	0.61387	-0.7073	9	0.14656	T	0.56	-17.1179	14.6123	0.68524	0.0:0.0:0.0:1.0	.	191	Q9UDR5	AASS_HUMAN	R	191	.	ENSP00000351834:S191R	S	-	1	0	AASS	121545713	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.902000	0.69869	2.046000	0.60703	0.529000	0.55759	AGC	-	NULL		0.413	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AASS	protein_coding	OTTHUMT00000347300.1	T	NM_005763		121545713	-1	no_errors	NM_005763	genbank	human	reviewed	54_36p	missense	SNP	1	G
Unknown	0	genome.wustl.edu	37	8	12237177	12237177	+	IGR	SNP	C	C	G	rs372141555		TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr8:12237177C>G								FAM66A (11053 upstream) : RP11-351I21.11 (33158 downstream)																							ATCTCCAGTACCCTCCAAATA	0.512																																																0			8																																								12281548	SO:0001628	intergenic_variant	649352																															8.37:g.12237177C>G		Somatic		Capture	Illumina GAIIx	4	12281548		RNA	SNP	-	NULL		37	NULL		8																																																																																			-	-	0	0.512					LOC649352			C			12281548	-1	pseudogene	XR_042361	genbank	human	model	54_36p	rna	SNP	1	G
TRPS1	7227	genome.wustl.edu	37	8	116426774	116426774	+	Missense_Mutation	SNP	G	G	C			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr8:116426774G>C	ENST00000220888.5	-	6	3482	c.3323C>G	c.(3322-3324)gCt>gGt	p.A1108G	TRPS1_ENST00000395715.3_Missense_Mutation_p.A1121G|TRPS1_ENST00000520276.1_Missense_Mutation_p.A1112G|TRPS1_ENST00000519076.1_Missense_Mutation_p.A862G			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	1108	Mediates interaction with RNF4. {ECO:0000250}.				chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.A1108G(1)		autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CAGCCAATCAGCTTCACTCTG	0.468									Langer-Giedion syndrome																																							1	Substitution - Missense(1)	ovary(1)	8											103.0	100.0	101.0					8																	116426774		1903	4125	6028	116495950	SO:0001583	missense	7227	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.3323C>G	8.37:g.116426774G>C	ENSP00000220888:p.Ala1108Gly	Somatic		Capture	Illumina GAIIx	4	116495950	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	HMMPfam_GATA;superfamily_C2H2 and C2HC zinc fingers;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.A1121G	ENST00000220888.5	37	c.3362		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.0|20.0	3.930906|3.930906	0.73327|0.73327	.|.	.|.	ENSG00000104447|ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276|ENST00000518018	D;D;D;D|.	0.98777|.	-5.13;-5.1;-5.05;-5.1|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.057398|.	0.64402|.	D|.	0.000001|.	T|T	0.52273|0.52273	0.1724|0.1724	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	P;P;P|.	0.50943|.	0.94;0.9;0.94|.	P;B;P|.	0.48189|.	0.57;0.366;0.57|.	T|T	0.45877|0.45877	-0.9231|-0.9231	10|5	0.87932|.	D|.	0|.	.|.	19.865|19.865	0.96801|0.96801	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1112;1108;1121|.	Q9UHF7-3;Q9UHF7;Q9UHF7-2|.	.;TRPS1_HUMAN;.|.	G|R	1121;1108;862;1112|232	ENSP00000379065:A1121G;ENSP00000220888:A1108G;ENSP00000428910:A862G;ENSP00000428680:A1112G|.	ENSP00000220888:A1108G|.	A|S	-|-	2|3	0|2	TRPS1|TRPS1	116495950|116495950	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.637000|7.637000	0.83313|0.83313	2.685000|2.685000	0.91497|0.91497	0.655000|0.655000	0.94253|0.94253	GCT|AGC	-	NULL		0.468	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	protein_coding	OTTHUMT00000286436.3	G	NM_014112		116495950	-1	no_errors	NM_014112	genbank	human	reviewed	54_36p	missense	SNP	1	C
CHD7	55636	genome.wustl.edu	37	8	61750655	61750655	+	Silent	SNP	A	A	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA		dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr8:61750655A>G	ENST00000423902.2	+	19	4853	c.4374A>G	c.(4372-4374)aaA>aaG	p.K1458K	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1458	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.K1458K(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TTTCCAAGAAAGAAATAGAGG	0.353																																																1	Substitution - coding silent(1)	ovary(1)	8											34.0	30.0	31.0					8																	61750655		1799	4023	5822	61913209	SO:0001819	synonymous_variant	55636			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.4374A>G	8.37:g.61750655A>G		Somatic		Capture	Illumina GAIIx	Phase_III	61913209	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	HMMPfam_SNF2_N;HMMPfam_Chromo;HMMPfam_Helicase_C;HMMPfam_TCH;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Chromo domain-like	p.K1458	ENST00000423902.2	37	c.4374	CCDS47865.1	8																																																																																			-	NULL		0.353	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	protein_coding	OTTHUMT00000383468.2	A	XM_098762		61913209	1	no_errors	NM_017780	genbank	human	reviewed	54_36p	silent	SNP	1	G
KCNQ3	3786	genome.wustl.edu	37	8	133196524	133196524	+	Nonsense_Mutation	SNP	G	G	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr8:133196524G>A	ENST00000388996.4	-	3	988	c.568C>T	c.(568-570)Cga>Tga	p.R190*	KCNQ3_ENST00000521134.1_Nonsense_Mutation_p.R70*|KCNQ3_ENST00000519445.1_Nonsense_Mutation_p.R190*	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	190					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.R190*(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	AACTTCAGTCGGCCCCGCCAG	0.537																																																1	Substitution - Nonsense(1)	ovary(1)	8											84.0	86.0	86.0					8																	133196524		2203	4300	6503	133265706	SO:0001587	stop_gained	3786			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.568C>T	8.37:g.133196524G>A	ENSP00000373648:p.Arg190*	Somatic		Capture	Illumina GAIIx	4	133265706	A2VCT8|B4DJY4|E7EQ89	Nonsense_Mutation	SNP	HMMPfam_Ion_trans;HMMPfam_KCNQ_channel;superfamily_Voltage-gated potassium channels	p.R190*	ENST00000388996.4	37	c.568	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	G	32	5.153288	0.94645	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	.	.	.	5.87	1.07	0.20283	.	0.100176	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.5127	15.6646	0.77217	0.0:0.0:0.2032:0.7968	.	.	.	.	X	190;70;190;179;69	.	ENSP00000373648:R190X	R	-	1	2	KCNQ3	133265706	0.989000	0.36119	0.753000	0.31225	0.932000	0.56968	1.458000	0.35223	0.228000	0.21019	0.655000	0.94253	CGA	-	HMMPfam_Ion_trans		0.537	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	protein_coding	OTTHUMT00000268621.2	G	NM_004519		133265706	-1	no_errors	NM_004519	genbank	human	reviewed	54_36p	nonsense	SNP	0.97	A
RABEPK	10244	genome.wustl.edu	37	9	127996047	127996047	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr9:127996047T>C	ENST00000373538.3	+	8	1217	c.907T>C	c.(907-909)Tgg>Cgg	p.W303R	RABEPK_ENST00000259460.8_Missense_Mutation_p.W252R|RABEPK_ENST00000394125.4_Missense_Mutation_p.W303R|RABEPK_ENST00000394124.4_3'UTR	NM_005833.3	NP_005824.2	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs	303					receptor-mediated endocytosis (GO:0006898)|vesicle docking involved in exocytosis (GO:0006904)	endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)		p.W303R(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15						TATCATTCCATGGCCAGTGAC	0.458																																																1	Substitution - Missense(1)	ovary(1)	9											198.0	169.0	179.0					9																	127996047		2203	4300	6503	127035868	SO:0001583	missense	10244			BC000503	CCDS6862.1, CCDS55341.1	9q33.1-q33.3	2010-04-19			ENSG00000136933	ENSG00000136933			16896	protein-coding gene	gene with protein product		605962				9230071	Standard	NM_005833		Approved	RAB9P40, bA65N13.1	uc004bpi.3	Q7Z6M1	OTTHUMG00000020674	ENST00000373538.3:c.907T>C	9.37:g.127996047T>C	ENSP00000362639:p.Trp303Arg	Somatic		Capture	Illumina GAIIx	4	127035868	A8K403|O00568|Q69YR2|Q6FHA4|Q6IBG7|Q6P092|Q86Y76|Q9BWB1	Missense_Mutation	SNP	-	p.W303R	ENST00000373538.3	37	c.907	CCDS6862.1	9	.	.	.	.	.	.	.	.	.	.	T	22.8	4.343164	0.82022	.	.	ENSG00000136933	ENST00000394125;ENST00000259460;ENST00000373538	T;T;T	0.42131	1.69;0.98;1.69	5.68	5.68	0.88126	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.994;0.997	T	0.61758	-0.6997	10	0.20046	T	0.44	-10.4465	15.1064	0.72324	0.0:0.0:0.0:1.0	.	252;303	Q7Z6M1-2;Q7Z6M1	.;RABEK_HUMAN	R	303;252;303	ENSP00000377683:W303R;ENSP00000259460:W252R;ENSP00000362639:W303R	ENSP00000259460:W252R	W	+	1	0	RABEPK	127035868	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.627000	0.83176	2.153000	0.67306	0.528000	0.53228	TGG	-	NULL		0.458	RABEPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEPK	protein_coding	OTTHUMT00000054064.1	T	NM_005833		127035868	1	no_errors	NM_005833	genbank	human	provisional	54_36p	missense	SNP	1	C
VAV2	7410	genome.wustl.edu	37	9	136656967	136656967	+	Missense_Mutation	SNP	C	C	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr9:136656967C>A	ENST00000371850.3	-	13	1157	c.1126G>T	c.(1126-1128)Gtt>Ttt	p.V376F	VAV2_ENST00000371851.1_Missense_Mutation_p.V371F|VAV2_ENST00000406606.3_Missense_Mutation_p.V371F	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	376	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V371F(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TCCCGTTTAACTTCATTGATG	0.483																																																1	Substitution - Missense(1)	ovary(1)	9											157.0	146.0	150.0					9																	136656967		2203	4300	6503	135646788	SO:0001583	missense	7410				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.1126G>T	9.37:g.136656967C>A	ENSP00000360916:p.Val376Phe	Somatic		Capture	Illumina GAIIx	4	135646788	A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Missense_Mutation	SNP	HMMPfam_RhoGEF;HMMPfam_SH2;HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_CH;HMMPfam_PH;HMMPfam_C1_1;HMMPfam_SH3_2;superfamily_Calponin-homology domain CH-domain;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like;superfamily_SH2 domain;superfamily_Cysteine-rich domain	p.V371F	ENST00000371850.3	37	c.1111	CCDS48053.1	9	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117870	0.77323	.	.	ENSG00000160293	ENST00000371850;ENST00000371851;ENST00000406606;ENST00000325440	T;T;T	0.69040	-0.37;-0.37;-0.37	4.0	4.0	0.46444	Dbl homology (DH) domain (3);	0.139330	0.48286	D	0.000196	T	0.79323	0.4426	M	0.70595	2.14	0.80722	D	1	D;D	0.57899	0.981;0.96	P;D	0.63381	0.541;0.914	T	0.83259	-0.0049	10	0.87932	D	0	.	16.4582	0.84029	0.0:1.0:0.0:0.0	.	376;371	P52735;P52735-3	VAV2_HUMAN;.	F	376;371;371;371	ENSP00000360916:V376F;ENSP00000360917:V371F;ENSP00000385362:V371F	ENSP00000317258:V371F	V	-	1	0	VAV2	135646788	1.000000	0.71417	0.928000	0.36995	0.725000	0.41563	5.867000	0.69597	1.927000	0.55829	0.549000	0.68633	GTT	-	NULL		0.483	VAV2-001	KNOWN	basic|CCDS	protein_coding	VAV2	protein_coding	OTTHUMT00000054939.1	C			135646788	-1	no_errors	NM_003371	genbank	human	reviewed	54_36p	missense	SNP	1	A
LOC645166	645166	genome.wustl.edu	37	2	91843530	91843530	+	RNA	SNP	T	T	G			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chr2:91843530T>G	ENST00000609777.1	-	0	64																											GCCAGCAGTCTGCAGAGGAGG	0.567																																																0			2																																								91207257			0																															2.37:g.91843530T>G		Somatic		Capture	Illumina GAIIx	4	91207257		Splice_Site	SNP	-	e1-2	ENST00000609777.1	37	c.1-2		2																																																																																			-	-		0.567	AC027612.6-002	KNOWN	basic	processed_transcript	ENSG00000162685	pseudogene	OTTHUMT00000471986.1	T			91207257	-1	no_start_codon:no_stop_codon	ENST00000294715	ensembl	human	known	54_36p	splice_site	SNP	0	G
IRS4	8471	genome.wustl.edu	37	X	107976663	107976663	+	Missense_Mutation	SNP	G	G	A			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chrX:107976663G>A	ENST00000372129.2	-	1	2988	c.2912C>T	c.(2911-2913)cCa>cTa	p.P971L	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	971					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.P971L(2)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GTCGTTTGCTGGATTTGGAAA	0.483																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	X											152.0	139.0	143.0					X																	107976663		2203	4300	6503	107863319	SO:0001583	missense	8471			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2912C>T	X.37:g.107976663G>A	ENSP00000361202:p.Pro971Leu	Somatic		Capture	Illumina GAIIx	4	107863319		Missense_Mutation	SNP	HMMPfam_PH;HMMPfam_IRS;superfamily_PH domain-like	p.P971L	ENST00000372129.2	37	c.2912	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	G	10.87	1.473876	0.26423	.	.	ENSG00000133124	ENST00000372129	T	0.35973	1.28	5.16	4.27	0.50696	.	0.367155	0.25683	N	0.028995	T	0.24586	0.0596	L	0.29908	0.895	0.09310	N	0.999999	B	0.28128	0.201	B	0.22386	0.039	T	0.14448	-1.0472	10	0.42905	T	0.14	-1.6166	9.2734	0.37686	0.0791:0.0:0.7755:0.1454	.	971	O14654	IRS4_HUMAN	L	971	ENSP00000361202:P971L	ENSP00000361202:P971L	P	-	2	0	IRS4	107863319	0.008000	0.16893	0.006000	0.13384	0.194000	0.23727	0.472000	0.22116	1.084000	0.41184	0.600000	0.82982	CCA	-	NULL		0.483	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	protein_coding	OTTHUMT00000057879.1	G	NM_003604		107863319	-1	no_errors	NM_003604	genbank	human	reviewed	54_36p	missense	SNP	0.06	A
TENM1	10178	genome.wustl.edu	37	X	123785913	123785913	+	Missense_Mutation	SNP	T	T	C			TCGA-25-1315-01A-01W-0494-09	TCGA-25-1315-10A-01W-0494-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	454_PCR_WGA	1	dbGAP	Illumina GAIIx	52f45b5e-af86-454c-be63-a56c6c21b730	77383f45-bd83-4d11-86e5-c4ce8a0ae73b	g.chrX:123785913T>C	ENST00000371130.3	-	8	1493	c.1430A>G	c.(1429-1431)gAt>gGt	p.D477G	TENM1_ENST00000422452.2_Missense_Mutation_p.D477G	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	477					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.D479G(1)									CTGTGTATCATCAGAGCCCTT	0.433																																																1	Substitution - Missense(1)	ovary(1)	X											139.0	121.0	127.0					X																	123785913		2203	4300	6503	123613594	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1430A>G	X.37:g.123785913T>C	ENSP00000360171:p.Asp477Gly	Somatic		Capture	Illumina GAIIx	4	123613594	B2RTR5|Q5JZ17	Missense_Mutation	SNP	HMMPfam_NHL;HMMPfam_EGF;HMMPfam_RHS_repeat;superfamily_Carboxypeptidase regulatory domain;HMMPfam_Ten_N;superfamily_Nitrous oxide reductase N-terminal domain;HMMPfam_EGF_2;superfamily_NHL repeat;superfamily_EGF/Laminin	p.D477G	ENST00000371130.3	37	c.1430	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	T	9.293	1.051002	0.19827	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.19669	2.13;2.13	5.3	5.3	0.74995	.	0.270493	0.35585	N	0.003113	T	0.11665	0.0284	N	0.08118	0	0.09310	N	0.999996	B;B;B	0.19817	0.039;0.023;0.002	B;B;B	0.11329	0.006;0.004;0.001	T	0.20438	-1.0275	10	0.23302	T	0.38	.	14.3195	0.66476	0.0:0.0:0.0:1.0	.	476;477;477	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	G	477	ENSP00000360171:D477G;ENSP00000403954:D477G	ENSP00000360171:D477G	D	-	2	0	ODZ1	123613594	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	4.727000	0.61993	1.760000	0.52011	0.486000	0.48141	GAT	-	NULL		0.433	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	protein_coding	OTTHUMT00000058985.1	T	NM_014253		123613594	-1	no_errors	NM_014253	genbank	human	provisional	54_36p	missense	SNP	0.85	C
