#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MACF1	23499	broad.mit.edu	37	1	39797856	39797856	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr1:39797856C>G	ENST00000372915.3	+	36	5698	c.5611C>G	c.(5611-5613)Cta>Gta	p.L1871V	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.L1903V|MACF1_ENST00000564288.1_Missense_Mutation_p.L1866V|MACF1_ENST00000289893.4_Missense_Mutation_p.L306V			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1871					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.L306V(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TACAGATGCCCTAGAACAAGG	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											105.0	105.0	105.0					1																	39797856		2203	4300	6503	39570443	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.5611C>G	1.37:g.39797856C>G	ENSP00000362006:p.Leu1871Val	Somatic		Capture	Illumina GAIIx	Phase_I	39570443	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	C	11.31	1.601036	0.28534	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.72282	-0.64;-0.64	5.34	0.0307	0.14168	.	0.000000	0.40385	N	0.001103	T	0.73401	0.3582	L	0.37850	1.14	0.80722	D	1	D	0.63046	0.992	D	0.76071	0.987	T	0.71669	-0.4523	10	0.72032	D	0.01	.	10.4271	0.44385	0.0:0.4831:0.0:0.5169	.	1871	Q9UPN3	MACF1_HUMAN	V	1871;306	ENSP00000362006:L1871V;ENSP00000289893:L306V	ENSP00000289893:L306V	L	+	1	2	MACF1	39570443	0.366000	0.25014	0.991000	0.47740	0.991000	0.79684	0.185000	0.16958	-0.012000	0.14223	-0.266000	0.10368	CTA		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
PIGK	10026	broad.mit.edu	37	1	77620287	77620287	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr1:77620287C>T	ENST00000370812.3	-	9	856	c.833G>A	c.(832-834)aGt>aAt	p.S278N	PIGK_ENST00000359130.1_Missense_Mutation_p.S278N|PIGK_ENST00000445065.1_Missense_Mutation_p.S184N|PIGK_ENST00000478391.1_5'UTR|PIGK_ENST00000370813.5_Missense_Mutation_p.S202N	NM_005482.2	NP_005473.1	Q92643	GPI8_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class K	278					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|GPI-anchor transamidase activity (GO:0003923)|protein disulfide isomerase activity (GO:0003756)	p.S278N(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	19						CACACACAGACTTTTGGGACA	0.348																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	58.0	59.0					1																	77620287		2202	4299	6501	77392875	SO:0001583	missense	10026			AF022913	CCDS674.1	1p31.1	2013-02-26	2006-06-28		ENSG00000142892	ENSG00000142892		"""Phosphatidylinositol glycan anchor biosynthesis"""	8965	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	605087	"""phosphatidylinositol glycan, class K"""			9356492	Standard	NM_005482		Approved	hGPI8, GPI8	uc001dhk.3	Q92643	OTTHUMG00000009686	ENST00000370812.3:c.833G>A	1.37:g.77620287C>T	ENSP00000359848:p.Ser278Asn	Somatic		Capture	Illumina GAIIx	Phase_I	77392875	B2R7K3|B4E2M3|O14822|Q5TG77	Missense_Mutation	SNP	ENST00000370812.3	37	CCDS674.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.072306	0.55646	.	.	ENSG00000142892	ENST00000370812;ENST00000445065;ENST00000370813;ENST00000359130	T;T;T;T	0.46451	0.87;0.87;0.87;0.9	5.11	4.2	0.49525	.	0.039287	0.85682	N	0.000000	T	0.32615	0.0835	M	0.63843	1.955	0.58432	D	0.999999	B;B;B;B	0.29188	0.236;0.236;0.018;0.013	B;B;B;B	0.37943	0.261;0.261;0.055;0.065	T	0.28299	-1.0048	10	0.48119	T	0.1	-25.9268	13.7351	0.62813	0.0:0.9252:0.0:0.0748	.	202;184;278;278	B4E2M3;B1AK81;A6NEM5;Q92643	.;.;.;GPI8_HUMAN	N	278;184;202;278	ENSP00000359848:S278N;ENSP00000388854:S184N;ENSP00000359849:S202N;ENSP00000352041:S278N	ENSP00000352041:S278N	S	-	2	0	PIGK	77392875	1.000000	0.71417	0.996000	0.52242	0.905000	0.53344	7.387000	0.79785	1.286000	0.44565	0.591000	0.81541	AGT		0.348	PIGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026687.1	NM_005482	
CELSR2	1952	broad.mit.edu	37	1	109794761	109794761	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr1:109794761C>T	ENST00000271332.3	+	1	2121	c.2060C>T	c.(2059-2061)gCc>gTc	p.A687V		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	687	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A687V(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCTGTTACCGCCTCCGATGGC	0.557																																					NSCLC(158;1285 2011 34800 34852 42084)											1	Substitution - Missense(1)	ovary(1)	1											111.0	106.0	108.0					1																	109794761		2203	4300	6503	109596284	SO:0001583	missense	1952			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.2060C>T	1.37:g.109794761C>T	ENSP00000271332:p.Ala687Val	Somatic		Capture	Illumina GAIIx	Phase_I	109596284	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	17.91	3.504009	0.64410	.	.	ENSG00000143126	ENST00000271332	T	0.52295	0.67	4.95	4.95	0.65309	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.64538	0.2607	M	0.74389	2.26	0.54753	D	0.999982	D	0.89917	1.0	D	0.97110	1.0	T	0.66316	-0.5954	9	0.54805	T	0.06	.	18.4313	0.90627	0.0:1.0:0.0:0.0	.	687	Q9HCU4	CELR2_HUMAN	V	687	ENSP00000271332:A687V	ENSP00000271332:A687V	A	+	2	0	CELSR2	109596284	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	7.278000	0.78587	2.600000	0.87896	0.650000	0.86243	GCC		0.557	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
OR2G6	391211	broad.mit.edu	37	1	248685715	248685715	+	Silent	SNP	A	A	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr1:248685715A>T	ENST00000343414.4	+	1	800	c.768A>T	c.(766-768)atA>atT	p.I256I		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	256						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I256I(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGACCATCATATTCATGTACC	0.443																																																1	Substitution - coding silent(1)	ovary(1)	1											118.0	119.0	119.0					1																	248685715		2203	4300	6503	246752338	SO:0001819	synonymous_variant	391211				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.768A>T	1.37:g.248685715A>T		Somatic		Capture	Illumina GAIIx	Phase_I	246752338	B2RP33	Silent	SNP	ENST00000343414.4	37	CCDS31119.1																																																																																				0.443	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
PRKCQ	5588	broad.mit.edu	37	10	6504278	6504278	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr10:6504278C>A	ENST00000263125.5	-	14	1594	c.1495G>T	c.(1495-1497)Gga>Tga	p.G499*	PRKCQ_ENST00000539722.1_Nonsense_Mutation_p.G374*|PRKCQ_ENST00000397176.2_Nonsense_Mutation_p.G499*	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	499	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)	p.G499*(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	TAGACTATTCCTTTGGAATGA	0.408																																					Ovarian(50;572 1126 10530 25349 30594)											1	Substitution - Nonsense(1)	ovary(1)	10											115.0	117.0	116.0					10																	6504278		2203	4300	6503	6544284	SO:0001587	stop_gained	5588			L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1495G>T	10.37:g.6504278C>A	ENSP00000263125:p.Gly499*	Somatic		Capture	Illumina GAIIx	Phase_I	6544284	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Nonsense_Mutation	SNP	ENST00000263125.5	37	CCDS7079.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.805110|5.805110	0.96967|0.96967	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722|ENST00000397178	.|.	.|.	.|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.70465	.|0.3227	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.64453	.|-0.6404	.|4	0.87932|0.23891	D|T	0|0.37	.|.	19.2789|19.2789	0.94044|0.94044	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|N	499;499;374|271	.|.	ENSP00000263125:G499X|ENSP00000380363:K271N	G|K	-|-	1|3	0|2	PRKCQ|PRKCQ	6544284|6544284	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.215000|0.215000	0.24574|0.24574	7.513000|7.513000	0.81739|0.81739	2.542000|2.542000	0.85734|0.85734	0.563000|0.563000	0.77884|0.77884	GGA|AAG		0.408	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	
DCLRE1C	64421	broad.mit.edu	37	10	14981854	14981854	+	Silent	SNP	G	G	T	rs191086777		TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr10:14981854G>T	ENST00000378278.2	-	4	298	c.261C>A	c.(259-261)atC>atA	p.I87I	DCLRE1C_ENST00000453695.2_5'UTR|DCLRE1C_ENST00000357717.2_5'UTR|DCLRE1C_ENST00000396817.2_5'UTR|DCLRE1C_ENST00000378254.1_5'UTR|DCLRE1C_ENST00000378289.4_Silent_p.I87I|DCLRE1C_ENST00000378249.1_5'UTR|DCLRE1C_ENST00000378246.2_5'UTR|DCLRE1C_ENST00000378258.1_5'UTR|DCLRE1C_ENST00000378255.1_5'UTR			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	87					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.I87I(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						TAGGAGTCTCGATTTCAATAG	0.313								Non-homologous end-joining																																								1	Substitution - coding silent(1)	ovary(1)	10											38.0	41.0	40.0					10																	14981854		2192	4292	6484	15021860	SO:0001819	synonymous_variant	64421			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.261C>A	10.37:g.14981854G>T		Somatic		Capture	Illumina GAIIx	Phase_I	15021860	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Silent	SNP	ENST00000378278.2	37	CCDS31149.1																																																																																				0.313	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046934.1	NM_022487	
JMJD1C	221037	broad.mit.edu	37	10	64950671	64950671	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr10:64950671A>G	ENST00000399262.2	-	17	6492	c.6274T>C	c.(6274-6276)Tat>Cat	p.Y2092H	JMJD1C_ENST00000542921.1_Missense_Mutation_p.Y1910H|JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000402544.1_Missense_Mutation_p.Y1855H	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	2092					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)	p.Y1855H(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CCCATTGAATATACTGGGGCA	0.453																																																1	Substitution - Missense(1)	ovary(1)	10											104.0	98.0	100.0					10																	64950671		1880	4120	6000	64620677	SO:0001583	missense	221037			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.6274T>C	10.37:g.64950671A>G	ENSP00000382204:p.Tyr2092His	Somatic		Capture	Illumina GAIIx	Phase_I	64620677	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555162	0.86231	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000542921	T;T;T	0.56776	0.78;0.44;0.78	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.72399	0.3455	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.995	T	0.74990	-0.3475	10	0.56958	D	0.05	-16.4664	15.5839	0.76468	1.0:0.0:0.0:0.0	.	2092;1910	Q15652;A0T124	JHD2C_HUMAN;.	H	2092;1855;1910	ENSP00000382204:Y2092H;ENSP00000384990:Y1855H;ENSP00000444682:Y1910H	ENSP00000382204:Y2092H	Y	-	1	0	JMJD1C	64620677	1.000000	0.71417	0.983000	0.44433	0.989000	0.77384	8.454000	0.90352	2.225000	0.72522	0.528000	0.53228	TAT		0.453	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
CFAP43	80217	broad.mit.edu	37	10	105990459	105990459	+	Missense_Mutation	SNP	C	C	T	rs551332560		TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr10:105990459C>T	ENST00000357060.3	-	2	323	c.208G>A	c.(208-210)Gtc>Atc	p.V70I	WDR96_ENST00000369719.1_5'UTR|WDR96_ENST00000278064.2_5'UTR|WDR96_ENST00000428666.1_Missense_Mutation_p.V70I|WDR96_ENST00000369720.1_5'UTR	NM_025145.5	NP_079421.5												p.V70I(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GTTGCCATGACGCCCACAATT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		15274	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	10											144.0	132.0	136.0					10																	105990459		2203	4300	6503	105980449	SO:0001583	missense	80217																														ENST00000357060.3:c.208G>A	10.37:g.105990459C>T	ENSP00000349568:p.Val70Ile	Somatic		Capture	Illumina GAIIx	Phase_I	105980449		Missense_Mutation	SNP	ENST00000357060.3	37	CCDS31281.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.196404	0.38806	.	.	ENSG00000197748	ENST00000357060;ENST00000428666	T;T	0.19105	2.17;2.17	4.83	3.92	0.45320	.	0.291378	0.18676	N	0.134302	T	0.17152	0.0412	L	0.40543	1.245	0.31000	N	0.720398	B;B;B	0.28760	0.221;0.098;0.066	B;B;B	0.17098	0.017;0.011;0.009	T	0.06320	-1.0833	10	0.31617	T	0.26	.	13.2535	0.60066	0.0:0.922:0.0:0.078	.	70;70;70	Q8NDM7-5;B4DHB6;Q8NDM7	.;.;WDR96_HUMAN	I	70	ENSP00000349568:V70I;ENSP00000400289:V70I	ENSP00000349568:V70I	V	-	1	0	WDR96	105980449	0.988000	0.35896	1.000000	0.80357	0.935000	0.57460	1.421000	0.34815	1.021000	0.39600	0.491000	0.48974	GTC		0.413	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
DNHD1	144132	broad.mit.edu	37	11	6592324	6592324	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr11:6592324C>G	ENST00000527990.2	+	40	13582	c.13582C>G	c.(13582-13584)Ctc>Gtc	p.L4528V	DNHD1_ENST00000254579.6_Missense_Mutation_p.L4528V			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	4528					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)	p.L4528V(1)		NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GGCCCACGCTCTCTGGACTGG	0.701																																																1	Substitution - Missense(1)	ovary(1)	11											22.0	27.0	25.0					11																	6592324		2057	4185	6242	6548900	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.13582C>G	11.37:g.6592324C>G	ENSP00000436180:p.Leu4528Val	Somatic		Capture	Illumina GAIIx	Phase_I	6548900	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.330860	0.60853	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000530197	T;T	0.13778	2.56;2.56	4.25	4.25	0.50352	Dynein heavy chain (1);	0.000000	0.51477	D	0.000088	T	0.32436	0.0829	M	0.62723	1.935	0.27249	N	0.958932	D;D;D	0.76494	0.997;0.999;0.997	D;D;D	0.87578	0.995;0.998;0.995	T	0.02766	-1.1113	10	0.56958	D	0.05	-12.6533	12.327	0.55018	0.0:1.0:0.0:0.0	.	3616;581;4528	B0I1S4;Q9NSW8;Q96M86	.;.;DNHD1_HUMAN	V	4528;4528;796	ENSP00000254579:L4528V;ENSP00000436180:L4528V	ENSP00000254579:L4528V	L	+	1	0	DNHD1	6548900	1.000000	0.71417	0.963000	0.40424	0.522000	0.34438	3.889000	0.56212	2.353000	0.79882	0.557000	0.71058	CTC		0.701	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
OR5AS1	219447	broad.mit.edu	37	11	55798443	55798443	+	Silent	SNP	T	T	C			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr11:55798443T>C	ENST00000313555.1	+	1	549	c.549T>C	c.(547-549)ccT>ccC	p.P183P		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P183P(1)		endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					ATATCCCACCTCTTCTGGCTT	0.423																																																1	Substitution - coding silent(1)	ovary(1)	11											284.0	281.0	282.0					11																	55798443		2201	4296	6497	55555019	SO:0001819	synonymous_variant	219447			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.549T>C	11.37:g.55798443T>C		Somatic		Capture	Illumina GAIIx	Phase_I	55555019	Q6IFB8	Silent	SNP	ENST00000313555.1	37	CCDS31516.1																																																																																				0.423	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391538.1	NM_001001921	
ANO1	55107	broad.mit.edu	37	11	69978061	69978061	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr11:69978061G>A	ENST00000355303.5	+	11	1439	c.1134G>A	c.(1132-1134)atG>atA	p.M378I	RP11-805J14.3_ENST00000530525.1_RNA|ANO1_ENST00000530676.1_Missense_Mutation_p.M262I|ANO1_ENST00000398543.2_Missense_Mutation_p.M262I|ANO1_ENST00000316296.5_Missense_Mutation_p.M350I|ANO1_ENST00000531349.1_Missense_Mutation_p.M113I|ANO1_ENST00000538023.1_Missense_Mutation_p.M378I	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	378					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)	p.M378I(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	ATATCACCATGTGCCCGCTTT	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											40.0	50.0	47.0					11																	69978061		2158	4248	6406	69655709	SO:0001583	missense	55107			BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.1134G>A	11.37:g.69978061G>A	ENSP00000347454:p.Met378Ile	Somatic		Capture	Illumina GAIIx	Phase_I	69655709	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	37	CCDS44663.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.93|19.93	3.918551|3.918551	0.73098|0.73098	.|.	.|.	ENSG00000131620|ENSG00000131620	ENST00000530480|ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000316296;ENST00000530676;ENST00000531349	.|T;T;T;T;T;T	.|0.74526	.|-0.42;-0.52;-0.85;-0.2;-0.85;-0.53	4.51|4.51	4.51|4.51	0.55191|0.55191	.|.	.|0.100480	.|0.64402	.|D	.|0.000003	D|D	0.87577|0.87577	0.6212|0.6212	M|M	0.91920|0.91920	3.255|3.255	0.58432|0.58432	D|D	0.999999|0.999999	.|P;P;D	.|0.54397	.|0.744;0.515;0.966	.|P;B;P	.|0.59643	.|0.582;0.157;0.861	D|D	0.90750|0.90750	0.4656|0.4656	5|9	.|.	.|.	.|.	.|.	17.2887|17.2887	0.87149|0.87149	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|113;350;378	.|E9PNA7;Q5XXA6-3;Q5XXA6	.|.;.;ANO1_HUMAN	Y|I	243|378;378;262;162;350;262;113	.|ENSP00000347454:M378I;ENSP00000444689:M378I;ENSP00000381551:M262I;ENSP00000319477:M350I;ENSP00000435797:M262I;ENSP00000432843:M113I	.|.	C|M	+|+	2|3	0|0	ANO1|ANO1	69655709|69655709	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.801000|0.801000	0.45260|0.45260	9.510000|9.510000	0.98004|0.98004	2.067000|2.067000	0.61834|0.61834	0.555000|0.555000	0.69702|0.69702	TGT|ATG		0.612	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043	
CCDC82	79780	broad.mit.edu	37	11	96117863	96117863	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr11:96117863C>T	ENST00000278520.5	-	3	477	c.49G>A	c.(49-51)Gtg>Atg	p.V17M	CCDC82_ENST00000525786.1_5'Flank|CCDC82_ENST00000542662.1_Missense_Mutation_p.V17M|CCDC82_ENST00000423339.2_Missense_Mutation_p.V17M			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	17								p.V17M(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		TGCTCAGGCACGTGACTCTTA	0.338																																																1	Substitution - Missense(1)	ovary(1)	11											74.0	71.0	72.0					11																	96117863		2200	4296	6496	95757511	SO:0001583	missense	79780			AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.49G>A	11.37:g.96117863C>T	ENSP00000278520:p.Val17Met	Somatic		Capture	Illumina GAIIx	Phase_I	95757511	B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Missense_Mutation	SNP	ENST00000278520.5	37	CCDS8307.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.874879	0.33069	.	.	ENSG00000149231	ENST00000278520;ENST00000542662;ENST00000423339;ENST00000538597;ENST00000530203	T;T;T;T	0.32515	1.83;1.83;1.83;1.45	5.77	1.77	0.24775	.	0.983418	0.08295	N	0.967843	T	0.20170	0.0485	L	0.36672	1.1	0.09310	N	0.999995	P;B	0.42757	0.789;0.226	B;B	0.27500	0.08;0.025	T	0.10847	-1.0612	10	0.52906	T	0.07	1.4465	9.947	0.41616	0.0:0.728:0.0:0.272	.	17;17	Q8N4S0-2;Q8N4S0	.;CCD82_HUMAN	M	17	ENSP00000278520:V17M;ENSP00000444010:V17M;ENSP00000397156:V17M;ENSP00000442723:V17M	ENSP00000278520:V17M	V	-	1	0	CCDC82	95757511	0.000000	0.05858	0.612000	0.29024	0.957000	0.61999	-0.767000	0.04720	0.141000	0.18875	0.655000	0.94253	GTG		0.338	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395542.2	NM_024725	
FGD4	121512	broad.mit.edu	37	12	32751500	32751500	+	Nonsense_Mutation	SNP	C	C	T	rs118203972		TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr12:32751500C>T	ENST00000427716.2	+	5	1094	c.670C>T	c.(670-672)Cga>Tga	p.R224*	FGD4_ENST00000531134.1_Nonsense_Mutation_p.R309*|FGD4_ENST00000381025.3_5'UTR|FGD4_ENST00000525053.1_Nonsense_Mutation_p.R336*|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000534526.2_Nonsense_Mutation_p.R361*|FGD4_ENST00000546442.1_Nonsense_Mutation_p.R131*	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	224	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.R224*(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					TTATGTCAACCGACTTGACCT	0.299																																																1	Substitution - Nonsense(1)	ovary(1)	12	GRCh37	CM073065	FGD4	M	rs118203972						87.0	86.0	86.0					12																	32751500		2203	4299	6502	32642767	SO:0001587	stop_gained	121512			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.670C>T	12.37:g.32751500C>T	ENSP00000394487:p.Arg224*	Somatic		Capture	Illumina GAIIx	Phase_I	32642767	Q6ULS2|Q8TCP6	Nonsense_Mutation	SNP	ENST00000427716.2	37	CCDS8727.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.037646	0.93630	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000546442;ENST00000525053	.	.	.	4.91	3.95	0.45737	.	0.000000	0.43110	D	0.000613	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.1136	13.1135	0.59288	0.2701:0.7299:0.0:0.0	.	.	.	.	X	361;309;224;131;336	.	ENSP00000379089:R224X	R	+	1	2	FGD4	32642767	0.997000	0.39634	0.999000	0.59377	0.763000	0.43281	2.023000	0.41040	2.426000	0.82243	0.655000	0.94253	CGA		0.299	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
AACS	65985	broad.mit.edu	37	12	125618566	125618566	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr12:125618566G>T	ENST00000316519.6	+	15	1773	c.1567G>T	c.(1567-1569)Gac>Tac	p.D523Y	AACS_ENST00000543665.1_Silent_p.A22A|AACS_ENST00000545511.1_Silent_p.A102A|AACS_ENST00000316543.10_Missense_Mutation_p.D121Y|AACS_ENST00000261686.6_Missense_Mutation_p.D523Y	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	523					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		GGCTCATGGCGACTACTGCAG	0.617																																																0			12											87.0	72.0	77.0					12																	125618566		2203	4300	6503	124184519	SO:0001583	missense	65985			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.1567G>T	12.37:g.125618566G>T	ENSP00000324842:p.Asp523Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	124184519	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	ENST00000316519.6	37	CCDS9263.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.731325|4.731325	0.89390|0.89390	.|.	.|.	ENSG00000081760|ENSG00000081760	ENST00000316519;ENST00000261686;ENST00000316543;ENST00000538851;ENST00000536118|ENST00000535001	D;D;T;D;T|.	0.87729|.	-2.29;-2.29;0.17;-2.29;0.17|.	5.75|5.75	5.75|5.75	0.90469|0.90469	AMP-dependent synthetase/ligase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88518|0.88518	0.6458|0.6458	H|H	0.96398|0.96398	3.815|3.815	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.91473|0.91473	0.5198|0.5198	10|6	0.87932|0.87932	D|D	0|0	.|.	19.9439|19.9439	0.97175|0.97175	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	523;523|.	Q86V21-2;Q86V21|.	.;AACS_HUMAN|.	Y|L	523;523;121;188;78|236	ENSP00000324842:D523Y;ENSP00000261686:D523Y;ENSP00000324929:D121Y;ENSP00000441686:D188Y;ENSP00000441331:D78Y|.	ENSP00000261686:D523Y|ENSP00000441909:R236L	D|R	+|+	1|2	0|0	AACS|AACS	124184519|124184519	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.859000|0.859000	0.49053|0.49053	8.963000|8.963000	0.93385|0.93385	2.706000|2.706000	0.92434|0.92434	0.561000|0.561000	0.74099|0.74099	GAC|CGA		0.617	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400202.1	NM_023928	
PIWIL1	9271	broad.mit.edu	37	12	130847320	130847320	+	Silent	SNP	A	A	C			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr12:130847320A>C	ENST00000245255.3	+	17	2252	c.1980A>C	c.(1978-1980)tcA>tcC	p.S660S		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	660	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.|RNA-binding. {ECO:0000250}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)	p.S660S(1)		breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GCTGGTTCTCACGCTGCATAT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	12											110.0	105.0	107.0					12																	130847320		2203	4300	6503	129413273	SO:0001819	synonymous_variant	9271			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1980A>C	12.37:g.130847320A>C		Somatic		Capture	Illumina GAIIx	Phase_I	129413273	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	ENST00000245255.3	37	CCDS9268.1																																																																																				0.398	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
UTP14C	9724	broad.mit.edu	37	13	52604308	52604308	+	Silent	SNP	C	C	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr13:52604308C>T	ENST00000521776.2	+	2	2101	c.1368C>T	c.(1366-1368)tcC>tcT	p.S456S		NM_021645.5	NP_067677.4	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)	456					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|rRNA processing (GO:0006364)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)		p.S456S(1)		breast(4)|cervix(1)|endometrium(1)|large_intestine(10)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	32		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)		AGGTGCTGTCCGAATTGAGGG	0.478																																																1	Substitution - coding silent(1)	ovary(1)	13											85.0	89.0	88.0					13																	52604308		2203	4300	6503	51502309	SO:0001819	synonymous_variant	9724			D87455	CCDS31978.1	13q12.2-q13.3	2010-11-23	2004-06-15	2004-06-16	ENSG00000253797	ENSG00000253797			20321	protein-coding gene	gene with protein product		608969	"""KIAA0266"""	KIAA0266		9039502, 16354793	Standard	NM_021645		Approved	2700066J21Rik	uc021rjw.1	Q5TAP6	OTTHUMG00000164353	ENST00000521776.2:c.1368C>T	13.37:g.52604308C>T		Somatic		Capture	Illumina GAIIx	Phase_I	51502309	Q5FWG3|Q92555	Silent	SNP	ENST00000521776.2	37	CCDS31978.1																																																																																				0.478	UTP14C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045049.2	NM_021645	
ZC3H14	79882	broad.mit.edu	37	14	89034472	89034472	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr14:89034472A>T	ENST00000251038.5	+	3	394	c.169A>T	c.(169-171)Aac>Tac	p.N57Y	ZC3H14_ENST00000556945.1_Missense_Mutation_p.N57Y|ZC3H14_ENST00000336693.4_Missense_Mutation_p.N23Y|ZC3H14_ENST00000557607.1_Intron|ZC3H14_ENST00000555755.1_Missense_Mutation_p.N57Y|ZC3H14_ENST00000302216.8_Missense_Mutation_p.N57Y|ZC3H14_ENST00000393514.5_Missense_Mutation_p.N57Y|ZC3H14_ENST00000359301.3_Missense_Mutation_p.N23Y	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	57						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.N57Y(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						GTTTCTAGGGAACAACACAAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	14											147.0	115.0	125.0					14																	89034472		2203	4300	6503	88104225	SO:0001583	missense	79882			AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.169A>T	14.37:g.89034472A>T	ENSP00000251038:p.Asn57Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	88104225	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	ENST00000251038.5	37	CCDS32133.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825232	0.71143	.	.	ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000554602;ENST00000380684;ENST00000556945;ENST00000556158;ENST00000555799;ENST00000555755;ENST00000393514;ENST00000336693;ENST00000557693;ENST00000555120	T;T;T;T;T;T;T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	5.62	5.62	0.85841	.	0.096735	0.64402	D	0.000002	T	0.79587	0.4471	L	0.43152	1.355	0.36656	D	0.877662	D;D;D;D	0.76494	0.999;0.998;0.991;0.998	D;D;P;D	0.80764	0.994;0.952;0.718;0.965	D	0.84486	0.0608	10	0.87932	D	0	-13.8914	15.8303	0.78745	1.0:0.0:0.0:0.0	.	57;57;57;57	G3V5R4;Q6PJT7-2;Q6PJT7-3;Q6PJT7	.;.;.;ZC3HE_HUMAN	Y	57;57;57;23;57;23;57;57;44;23;57;57;23;23;23	ENSP00000251038:N57Y;ENSP00000352250:N23Y;ENSP00000307025:N57Y;ENSP00000451638:N23Y;ENSP00000450474:N57Y;ENSP00000451389:N44Y;ENSP00000451489:N23Y;ENSP00000452475:N57Y;ENSP00000377150:N57Y;ENSP00000338002:N23Y;ENSP00000452210:N23Y;ENSP00000450451:N23Y	ENSP00000251038:N57Y	N	+	1	0	ZC3H14	88104225	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.806000	0.62569	2.133000	0.65898	0.533000	0.62120	AAC		0.408	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824	
PLCB2	5330	broad.mit.edu	37	15	40590827	40590827	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr15:40590827G>C	ENST00000260402.3	-	10	1182	c.933C>G	c.(931-933)caC>caG	p.H311Q	PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000557821.1_Missense_Mutation_p.H311Q|PLCB2_ENST00000456256.2_Missense_Mutation_p.H311Q	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	311					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.H311Q(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TCATGTCGTGGTGGAGCAGCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	15											107.0	112.0	110.0					15																	40590827		2164	4252	6416	38378119	SO:0001583	missense	5330				CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.933C>G	15.37:g.40590827G>C	ENSP00000260402:p.His311Gln	Somatic		Capture	Illumina GAIIx	Phase_I	38378119	A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	37	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.203653	0.38905	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.21932	1.99;1.98	4.67	3.73	0.42828	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);	0.451802	0.26086	N	0.026431	T	0.18087	0.0434	N	0.19112	0.55	0.80722	D	1	P;B;B	0.37122	0.583;0.158;0.021	P;B;B	0.45428	0.48;0.058;0.071	T	0.04579	-1.0941	10	0.26408	T	0.33	.	11.7245	0.51702	0.1452:0.0:0.8548:0.0	.	311;311;311	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	Q	311	ENSP00000260402:H311Q;ENSP00000411991:H311Q	ENSP00000260402:H311Q	H	-	3	2	PLCB2	38378119	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	1.588000	0.36633	2.438000	0.82558	0.561000	0.74099	CAC		0.562	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
SCNN1B	6338	broad.mit.edu	37	16	23390080	23390080	+	Silent	SNP	C	C	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr16:23390080C>A	ENST00000343070.2	+	11	1634	c.1458C>A	c.(1456-1458)acC>acA	p.T486T	SCNN1B_ENST00000307331.5_Silent_p.T531T|SCNN1B_ENST00000568923.1_Silent_p.T459T|SCNN1B_ENST00000568085.1_Silent_p.T450T	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	486					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)	p.T486T(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	CCAATATCACCCTGAGCAGGT	0.582																																																1	Substitution - coding silent(1)	ovary(1)	16											98.0	79.0	86.0					16																	23390080		2197	4300	6497	23297581	SO:0001819	synonymous_variant	6338			X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.1458C>A	16.37:g.23390080C>A		Somatic		Capture	Illumina GAIIx	Phase_I	23297581	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Silent	SNP	ENST00000343070.2	37	CCDS10609.1																																																																																				0.582	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
NLRC5	84166	broad.mit.edu	37	16	57075470	57075470	+	Missense_Mutation	SNP	G	G	A	rs148873682		TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr16:57075470G>A	ENST00000262510.6	+	18	3238	c.3013G>A	c.(3013-3015)Ggt>Agt	p.G1005S	NLRC5_ENST00000436936.1_Missense_Mutation_p.G1005S|NLRC5_ENST00000539144.1_Missense_Mutation_p.G1005S|NLRC5_ENST00000308149.7_Missense_Mutation_p.G1005S	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1005					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.G1005S(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CTGCCACCTCGGTCACCTCCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	16											78.0	74.0	75.0					16																	57075470		2198	4300	6498	55632971	SO:0001583	missense	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3013G>A	16.37:g.57075470G>A	ENSP00000262510:p.Gly1005Ser	Somatic		Capture	Illumina GAIIx	Phase_I	55632971	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	CCDS10773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.695|3.695	-0.062640|-0.062640	0.07273|0.07273	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;T;T;T;T|.	0.50548|.	0.74;0.74;0.74;0.74;0.74;0.74|.	2.43|2.43	-2.0|-2.0	0.07433|0.07433	.|.	0.899723|.	0.09062|.	N|.	0.854198|.	T|T	0.08133|0.08133	0.0203|0.0203	N|N	0.01267|0.01267	-0.92|-0.92	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.27971|.	0.015;0.086;0.196;0.029|.	B;B;B;B|.	0.17098|.	0.003;0.011;0.017;0.012|.	T|T	0.35773|0.35773	-0.9775|-0.9775	10|5	0.06494|.	T|.	0.89|.	.|.	5.4857|5.4857	0.16749|0.16749	0.1505:0.5427:0.3068:0.0|0.1505:0.5427:0.3068:0.0	.|.	1005;1005;1005;1005|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	S|Q	1005;1005;1005;479;1005;512;304|757	ENSP00000262510:G1005S;ENSP00000308886:G1005S;ENSP00000389739:G1005S;ENSP00000441727:G1005S;ENSP00000441597:G512S;ENSP00000440153:G304S|.	ENSP00000262510:G1005S|.	G|R	+|+	1|2	0|0	NLRC5|NLRC5	55632971|55632971	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.171000|0.171000	0.22731|0.22731	-3.588000|-3.588000	0.00422|0.00422	-0.371000|-0.371000	0.08004|0.08004	0.655000|0.655000	0.94253|0.94253	GGT|CGG		0.532	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
RNF43	54894	broad.mit.edu	37	17	56448295	56448295	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr17:56448295G>T	ENST00000584437.1	-	2	2307	c.352C>A	c.(352-354)Ccc>Acc	p.P118T	BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000407977.2_Missense_Mutation_p.P118T|RNF43_ENST00000581868.1_5'UTR|RNF43_ENST00000577716.1_Missense_Mutation_p.P118T|RNF43_ENST00000577625.1_5'UTR|RNF43_ENST00000583753.1_Intron|RNF43_ENST00000500597.2_Intron			Q68DV7	RNF43_HUMAN	ring finger protein 43	118					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P118T(1)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GACAGGCAGGGGCGGGGGGCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											54.0	50.0	51.0					17																	56448295		2203	4300	6503	53803294	SO:0001583	missense	54894				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.352C>A	17.37:g.56448295G>T	ENSP00000463069:p.Pro118Thr	Somatic		Capture	Illumina GAIIx	Phase_I	53803294	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	ENST00000584437.1	37	CCDS11607.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.666789	0.88251	.	.	ENSG00000108375	ENST00000407977	T	0.63096	-0.02	5.45	5.45	0.79879	.	0.089497	0.49305	D	0.000147	T	0.56366	0.1980	L	0.34521	1.04	0.80722	D	1	P	0.47409	0.895	B	0.43508	0.422	T	0.55866	-0.8073	10	0.34782	T	0.22	-4.2268	18.2765	0.90085	0.0:0.0:1.0:0.0	.	118	Q68DV7	RNF43_HUMAN	T	118	ENSP00000385328:P118T	ENSP00000385328:P118T	P	-	1	0	RNF43	53803294	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.605000	0.74155	2.555000	0.86185	0.655000	0.94253	CCC		0.602	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444713.1	NM_017763	
ABCA9	10350	broad.mit.edu	37	17	67047175	67047175	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr17:67047175C>G	ENST00000340001.4	-	2	304	c.93G>C	c.(91-93)ttG>ttC	p.L31F	ABCA9_ENST00000453985.2_Missense_Mutation_p.L31F|ABCA9_ENST00000495634.1_Missense_Mutation_p.L31F|ABCA9_ENST00000370732.2_Missense_Mutation_p.L31F	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	31					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.L31F(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					AGCATACCAACAAGGTCTGTC	0.373																																																1	Substitution - Missense(1)	ovary(1)	17											118.0	107.0	111.0					17																	67047175		2203	4300	6503	64558770	SO:0001583	missense	10350			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.93G>C	17.37:g.67047175C>G	ENSP00000342216:p.Leu31Phe	Somatic		Capture	Illumina GAIIx	Phase_I	64558770	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	C	3.409	-0.120530	0.06838	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.90676	-2.71;-2.71	4.88	-4.38	0.03622	.	0.830029	0.09461	N	0.799065	D	0.82318	0.5011	L	0.39514	1.22	0.09310	N	1	B;B	0.17667	0.023;0.014	B;B	0.29077	0.05;0.098	T	0.68341	-0.5434	10	0.38643	T	0.18	.	1.2001	0.01883	0.1347:0.2106:0.2815:0.3732	.	31;31	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	F	31;14;31;26	ENSP00000342216:L31F;ENSP00000359767:L31F	ENSP00000342216:L31F	L	-	3	2	ABCA9	64558770	0.000000	0.05858	0.004000	0.12327	0.002000	0.02628	-3.598000	0.00419	-0.595000	0.05828	-0.140000	0.14226	TTG		0.373	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
ABCA6	23460	broad.mit.edu	37	17	67079029	67079029	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr17:67079029G>A	ENST00000284425.2	-	36	4775	c.4601C>T	c.(4600-4602)gCt>gTt	p.A1534V	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1534					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.A1534V(1)		breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					CTGCCCTGCAGCCTGTGGGAA	0.433																																																1	Substitution - Missense(1)	ovary(1)	17											202.0	205.0	204.0					17																	67079029		2203	4300	6503	64590624	SO:0001583	missense	23460			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4601C>T	17.37:g.67079029G>A	ENSP00000284425:p.Ala1534Val	Somatic		Capture	Illumina GAIIx	Phase_I	64590624	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.972063	0.74246	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.83419	-1.72	5.03	5.03	0.67393	.	0.000000	0.49305	D	0.000154	D	0.92776	0.7703	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93833	0.7129	10	0.87932	D	0	.	17.8989	0.88897	0.0:0.0:1.0:0.0	.	1534	Q8N139	ABCA6_HUMAN	V	1534;394	ENSP00000284425:A1534V	ENSP00000284425:A1534V	A	-	2	0	ABCA6	64590624	1.000000	0.71417	0.939000	0.37840	0.322000	0.28314	5.629000	0.67798	2.787000	0.95880	0.650000	0.86243	GCT		0.433	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
ZNF536	9745	broad.mit.edu	37	19	31039137	31039137	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr19:31039137G>C	ENST00000355537.3	+	4	2758	c.2611G>C	c.(2611-2613)Ggg>Cgg	p.G871R		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	871					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.G871R(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGATCACTCGGGGCAGGCCAC	0.582																																																1	Substitution - Missense(1)	ovary(1)	19											70.0	74.0	72.0					19																	31039137		2203	4300	6503	35730977	SO:0001583	missense	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2611G>C	19.37:g.31039137G>C	ENSP00000347730:p.Gly871Arg	Somatic		Capture	Illumina GAIIx	Phase_I	35730977	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	37	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	1.482	-0.556844	0.03967	.	.	ENSG00000198597	ENST00000355537	T	0.07567	3.18	5.71	5.71	0.89125	.	0.276358	0.41823	N	0.000805	T	0.15003	0.0362	N	0.14661	0.345	0.53005	D	0.999966	D;D	0.71674	0.998;0.998	P;P	0.62649	0.905;0.905	T	0.16305	-1.0407	10	0.36615	T	0.2	-28.5431	19.8413	0.96690	0.0:0.0:1.0:0.0	.	871;871	A7E228;O15090	.;ZN536_HUMAN	R	871	ENSP00000347730:G871R	ENSP00000347730:G871R	G	+	1	0	ZNF536	35730977	1.000000	0.71417	0.270000	0.24601	0.033000	0.12548	4.345000	0.59360	2.705000	0.92388	0.579000	0.79373	GGG		0.582	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
KIAA0355	9710	broad.mit.edu	37	19	34833276	34833276	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr19:34833276C>T	ENST00000299505.6	+	10	3310	c.2437C>T	c.(2437-2439)Cct>Tct	p.P813S		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	813								p.P813S(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					GCCGCAGGGACCTAGAAATAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	19											160.0	168.0	165.0					19																	34833276		2203	4300	6503	39525116	SO:0001583	missense	9710				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.2437C>T	19.37:g.34833276C>T	ENSP00000299505:p.Pro813Ser	Somatic		Capture	Illumina GAIIx	Phase_I	39525116	Q2M3W4	Missense_Mutation	SNP	ENST00000299505.6	37	CCDS12436.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695153	0.88830	.	.	ENSG00000166398	ENST00000299505	T	0.31769	1.48	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.45637	0.1352	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.45673	-0.9245	10	0.87932	D	0	-12.1428	18.4893	0.90841	0.0:1.0:0.0:0.0	.	813	O15063	K0355_HUMAN	S	813	ENSP00000299505:P813S	ENSP00000299505:P813S	P	+	1	0	KIAA0355	39525116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.584000	0.67490	2.614000	0.88457	0.655000	0.94253	CCT		0.502	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
FCGBP	8857	broad.mit.edu	37	19	40368417	40368417	+	Missense_Mutation	SNP	C	C	T	rs547191912		TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr19:40368417C>T	ENST00000221347.6	-	28	12938	c.12931G>A	c.(12931-12933)Gtc>Atc	p.V4311I		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4311						extracellular vesicular exosome (GO:0070062)		p.V4311I(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCCATGCAGACGTCCAGAACA	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		24316	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19											136.0	139.0	138.0					19																	40368417		2203	4297	6500	45060257	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12931G>A	19.37:g.40368417C>T	ENSP00000221347:p.Val4311Ile	Somatic		Capture	Illumina GAIIx	Phase_I	45060257	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	10.61	1.399284	0.25291	.	.	ENSG00000090920	ENST00000221347	T	0.78003	-1.14	4.08	3.02	0.34903	Uncharacterised domain, cysteine-rich (2);	0.260617	0.31167	U	0.008139	T	0.71013	0.3290	M	0.65498	2.005	0.22240	N	0.999265	P	0.38395	0.629	B	0.30401	0.115	T	0.62459	-0.6850	10	0.34782	T	0.22	.	13.1363	0.59411	0.0:0.8378:0.1622:0.0	.	4311	Q9Y6R7	FCGBP_HUMAN	I	4311	ENSP00000221347:V4311I	ENSP00000221347:V4311I	V	-	1	0	FCGBP	45060257	0.000000	0.05858	0.992000	0.48379	0.728000	0.41692	-0.064000	0.11636	1.042000	0.40150	0.305000	0.20034	GTC		0.622	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
FUT1	2523	broad.mit.edu	37	19	49253511	49253511	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr19:49253511G>A	ENST00000310160.3	-	4	2002	c.1028C>T	c.(1027-1029)gCg>gTg	p.A343V	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	343					carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)	p.A343V(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		CAGGAAGGCCGCCTCCGGCTT	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											40.0	38.0	39.0					19																	49253511		2203	4300	6503	53945323	SO:0001583	missense	2523				CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.1028C>T	19.37:g.49253511G>A	ENSP00000312021:p.Ala343Val	Somatic		Capture	Illumina GAIIx	Phase_I	53945323	O14505|O14506|O14507	Missense_Mutation	SNP	ENST00000310160.3	37	CCDS12733.1	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979560	0.53827	.	.	ENSG00000174951	ENST00000310160;ENST00000539428	D	0.97089	-4.24	4.69	4.69	0.59074	.	0.000000	0.64402	D	0.000016	D	0.98488	0.9496	M	0.86740	2.835	0.42134	D	0.991485	D	0.89917	1.0	D	0.91635	0.999	D	0.99470	1.0945	10	0.87932	D	0	-3.8309	15.4994	0.75684	0.0:0.0:1.0:0.0	.	343	P19526	FUT1_HUMAN	V	343;333	ENSP00000312021:A343V	ENSP00000312021:A343V	A	-	2	0	FUT1	53945323	0.999000	0.42202	0.373000	0.26003	0.060000	0.15804	5.751000	0.68720	2.619000	0.88677	0.561000	0.74099	GCG		0.567	FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466194.1	NM_000148	
CCNT2	905	broad.mit.edu	37	2	135711833	135711833	+	Missense_Mutation	SNP	T	T	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr2:135711833T>G	ENST00000264157.5	+	9	1838	c.1808T>G	c.(1807-1809)gTt>gGt	p.V603G	CCNT2_ENST00000295238.6_Missense_Mutation_p.V603G|CCNT2_ENST00000537343.1_Missense_Mutation_p.V428G	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	603					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.V603G(1)		endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		AGGAGTCCTGTTGGCCTGAGC	0.532																																																1	Substitution - Missense(1)	ovary(1)	2											127.0	117.0	120.0					2																	135711833		2203	4300	6503	135428303	SO:0001583	missense	905			AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.1808T>G	2.37:g.135711833T>G	ENSP00000264157:p.Val603Gly	Somatic		Capture	Illumina GAIIx	Phase_I	135428303	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	ENST00000264157.5	37	CCDS2174.1	.	.	.	.	.	.	.	.	.	.	T	8.917	0.960094	0.18507	.	.	ENSG00000082258	ENST00000537343;ENST00000295238;ENST00000264157	T;T	0.23147	1.92;1.92	5.58	4.43	0.53597	.	0.378279	0.29972	N	0.010735	T	0.19846	0.0477	L	0.44542	1.39	0.52099	D	0.999945	B;B;B	0.31548	0.161;0.22;0.328	B;B;B	0.31101	0.079;0.054;0.124	T	0.03684	-1.1013	10	0.15499	T	0.54	.	10.9291	0.47207	0.0:0.0728:0.0:0.9272	.	428;603;603	B4DH21;O60583;O60583-2	.;CCNT2_HUMAN;.	G	428;603;603	ENSP00000295238:V603G;ENSP00000264157:V603G	ENSP00000264157:V603G	V	+	2	0	CCNT2	135428303	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.587000	0.53957	2.131000	0.65755	0.533000	0.62120	GTT		0.532	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254629.1	NM_058241	
SCN2A	6326	broad.mit.edu	37	2	166172150	166172150	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr2:166172150A>G	ENST00000375437.2	+	11	1843	c.1553A>G	c.(1552-1554)gAg>gGg	p.E518G	SCN2A_ENST00000375427.2_Missense_Mutation_p.E518G|SCN2A_ENST00000357398.3_Missense_Mutation_p.E518G|SCN2A_ENST00000283256.6_Missense_Mutation_p.E518G	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	518					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.E518G(1)		NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ggagaagaagagaaaaATGAC	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											50.0	52.0	52.0					2																	166172150		2203	4300	6503	165880396	SO:0001583	missense	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1553A>G	2.37:g.166172150A>G	ENSP00000364586:p.Glu518Gly	Somatic		Capture	Illumina GAIIx	Phase_I	165880396	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	A	12.98	2.101054	0.37048	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	5.9	5.9	0.94986	Domain of unknown function DUF3451 (1);	0.903868	0.09580	N	0.782983	D	0.95733	0.8612	M	0.85373	2.75	0.44946	D	0.997961	B;B	0.22211	0.0;0.066	B;B	0.32928	0.002;0.155	D	0.90640	0.4574	9	.	.	.	.	16.0056	0.80359	1.0:0.0:0.0:0.0	.	518;518	Q99250-2;Q99250	.;SCN2A_HUMAN	G	518	ENSP00000364586:E518G;ENSP00000349973:E518G;ENSP00000283256:E518G;ENSP00000364576:E518G	.	E	+	2	0	SCN2A	165880396	0.979000	0.34478	1.000000	0.80357	0.855000	0.48748	2.335000	0.43929	2.251000	0.74343	0.528000	0.53228	GAG		0.378	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
SMARCAL1	50485	broad.mit.edu	37	2	217332751	217332751	+	Silent	SNP	G	G	A	rs2271335	byFrequency	TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr2:217332751G>A	ENST00000357276.4	+	14	2556	c.2226G>A	c.(2224-2226)acG>acA	p.T742T	SMARCAL1_ENST00000358207.5_Silent_p.T742T	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	742	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.		T -> M (in dbSNP:rs2271336).		cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)	p.T742T(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		ACGCAATTACGCAAGAGCTTG	0.438									Schimke Immuno-Osseous Dysplasia				G|||	7	0.00139776	0.0	0.0	5008	,	,		19641	0.001		0.0	False		,,,				2504	0.0061															1	Substitution - coding silent(1)	ovary(1)	2											135.0	128.0	131.0					2																	217332751		2203	4300	6503	217040996	SO:0001819	synonymous_variant	50485	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2226G>A	2.37:g.217332751G>A		Somatic		Capture	Illumina GAIIx	Phase_I	217040996	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Silent	SNP	ENST00000357276.4	37	CCDS2403.1																																																																																				0.438	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
SLC11A1	6556	broad.mit.edu	37	2	219257824	219257824	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr2:219257824G>A	ENST00000233202.6	+	12	1625	c.1285G>A	c.(1285-1287)Gat>Aat	p.D429N	SLC11A1_ENST00000539932.1_Missense_Mutation_p.D311N	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	429					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)	p.D429N(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGCCTCAATGATCTGCTCAA	0.657																																																1	Substitution - Missense(1)	ovary(1)	2											87.0	65.0	73.0					2																	219257824		2203	4300	6503	218966068	SO:0001583	missense	6556			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.1285G>A	2.37:g.219257824G>A	ENSP00000233202:p.Asp429Asn	Somatic		Capture	Illumina GAIIx	Phase_I	218966068	C0H5Y3	Missense_Mutation	SNP	ENST00000233202.6	37	CCDS2415.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047902	0.75846	.	.	ENSG00000018280	ENST00000233202;ENST00000539932	T;T	0.69561	-0.41;-0.41	4.6	4.6	0.57074	.	0.000000	0.64402	D	0.000002	T	0.75752	0.3892	L	0.45698	1.435	0.80722	D	1	D;P	0.64830	0.994;0.93	D;P	0.63381	0.914;0.861	T	0.78537	-0.2166	10	0.66056	D	0.02	-29.8657	17.6413	0.88137	0.0:0.0:1.0:0.0	.	311;429	C0H5Y3;P49279	.;NRAM1_HUMAN	N	429;311	ENSP00000233202:D429N;ENSP00000443435:D311N	ENSP00000233202:D429N	D	+	1	0	SLC11A1	218966068	1.000000	0.71417	0.988000	0.46212	0.007000	0.05969	9.193000	0.94954	2.396000	0.81511	0.563000	0.77884	GAT		0.657	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578	
COL4A4	1286	broad.mit.edu	37	2	227898182	227898182	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr2:227898182G>A	ENST00000396625.3	-	38	3728	c.3521C>T	c.(3520-3522)cCt>cTt	p.P1174L	COL4A4_ENST00000329662.7_Missense_Mutation_p.P1174L	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1174	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.P1174L(1)		breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		GTTCAGGCCAGGTGATCCGGA	0.532											OREG0015250	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	2											53.0	55.0	54.0					2																	227898182		1948	4158	6106	227606426	SO:0001583	missense	1286				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.3521C>T	2.37:g.227898182G>A	ENSP00000379866:p.Pro1174Leu	Somatic	2323	Capture	Illumina GAIIx	Phase_I	227606426	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	37	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.627365	0.46944	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.96685	-4.09;-4.09	5.36	5.36	0.76844	.	.	.	.	.	D	0.98009	0.9344	M	0.82323	2.585	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.98450	1.0591	9	0.62326	D	0.03	.	14.5865	0.68328	0.0:0.0:1.0:0.0	.	1174	P53420	CO4A4_HUMAN	L	1174	ENSP00000379866:P1174L;ENSP00000328553:P1174L	ENSP00000328553:P1174L	P	-	2	0	COL4A4	227606426	0.998000	0.40836	0.175000	0.22980	0.008000	0.06430	5.281000	0.65609	2.521000	0.84997	0.650000	0.86243	CCT		0.532	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
SLC19A3	80704	broad.mit.edu	37	2	228564085	228564085	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr2:228564085C>A	ENST00000258403.3	-	3	417	c.346G>T	c.(346-348)Gtc>Ttc	p.V116F	SLC19A3_ENST00000409287.1_Intron|SLC19A3_ENST00000541617.1_Missense_Mutation_p.V112F	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	116					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.V116F(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	GCGGCGGTGACCATCCCATAG	0.552																																																1	Substitution - Missense(1)	ovary(1)	2											98.0	97.0	97.0					2																	228564085		2203	4300	6503	228272329	SO:0001583	missense	80704			AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.346G>T	2.37:g.228564085C>A	ENSP00000258403:p.Val116Phe	Somatic		Capture	Illumina GAIIx	Phase_I	228272329		Missense_Mutation	SNP	ENST00000258403.3	37	CCDS2468.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.686225	0.47991	.	.	ENSG00000135917	ENST00000258403;ENST00000541617;ENST00000456524	T;T;T	0.80033	-1.33;-1.33;0.38	5.8	5.8	0.92144	Major facilitator superfamily domain, general substrate transporter (1);	0.173169	0.49916	D	0.000121	T	0.74581	0.3735	L	0.38649	1.16	0.80722	D	1	B;B	0.33044	0.092;0.395	B;B	0.40009	0.077;0.316	T	0.68232	-0.5463	10	0.08837	T	0.75	-29.8901	14.8391	0.70209	0.1438:0.8562:0.0:0.0	.	112;116	F5H2M8;Q9BZV2	.;S19A3_HUMAN	F	116;112;116	ENSP00000258403:V116F;ENSP00000445519:V112F;ENSP00000399001:V116F	ENSP00000258403:V116F	V	-	1	0	SLC19A3	228272329	0.987000	0.35691	0.143000	0.22291	0.362000	0.29581	3.138000	0.50570	2.749000	0.94314	0.655000	0.94253	GTC		0.552	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		
SP140	11262	broad.mit.edu	37	2	231110601	231110601	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr2:231110601A>G	ENST00000392045.3	+	7	802	c.688A>G	c.(688-690)Ata>Gta	p.I230V	SP140_ENST00000343805.6_Intron|SP140_ENST00000350136.5_Missense_Mutation_p.I210V|SP140_ENST00000417495.3_Missense_Mutation_p.I227V|SP140_ENST00000420434.3_Missense_Mutation_p.I230V|SP140_ENST00000486687.2_Intron	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	230					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.I230V(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGCTATACAAATAGATGAAGG	0.383																																																1	Substitution - Missense(1)	ovary(1)	2											126.0	112.0	116.0					2																	231110601		1902	4124	6026	230818845	SO:0001583	missense	11262			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.688A>G	2.37:g.231110601A>G	ENSP00000375899:p.Ile230Val	Somatic		Capture	Illumina GAIIx	Phase_I	230818845	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	A	0.026	-1.371503	0.01225	.	.	ENSG00000079263	ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000420434	T;T;T	0.50813	0.92;0.74;0.73	2.79	-4.69	0.03299	.	.	.	.	.	T	0.18002	0.0432	N	0.08118	0	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.29579	-1.0007	9	0.06494	T	0.89	.	5.264	0.15589	0.3687:0.1773:0.454:0.0	.	230;227;230;230	E7EUR5;E7ESH9;Q13342;E7EX75	.;.;LY10_HUMAN;.	V	230;210;230;227;230	ENSP00000345846:I210V;ENSP00000375899:I230V;ENSP00000398210:I230V	ENSP00000345846:I210V	I	+	1	0	SP140	230818845	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.363000	0.07593	-1.127000	0.02925	-0.400000	0.06385	ATA		0.383	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
C22orf42	150297	broad.mit.edu	37	22	32545766	32545766	+	Splice_Site	SNP	G	G	C			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr22:32545766G>C	ENST00000382097.3	-	8	728	c.656C>G	c.(655-657)gCa>gGa	p.A219G	C22orf42_ENST00000490640.1_5'UTR	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	219								p.A219G(1)		NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						TCTCTCCTTTGCCTGCAATAG	0.353																																																1	Substitution - Missense(1)	ovary(1)	22											33.0	34.0	34.0					22																	32545766		2199	4299	6498	30875766	SO:0001630	splice_region_variant	150297			BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.655-1C>G	22.37:g.32545766G>C		Somatic		Capture	Illumina GAIIx	Phase_I	30875766	A4QPH5	Missense_Mutation	SNP	ENST00000382097.3	37	CCDS33639.1	.	.	.	.	.	.	.	.	.	.	G	2.644	-0.283462	0.05642	.	.	ENSG00000205856	ENST00000382097	T	0.26373	1.74	0.598	-1.2	0.09554	.	.	.	.	.	T	0.15219	0.0367	N	0.08118	0	0.09310	N	1	P	0.41597	0.756	P	0.48114	0.567	T	0.15578	-1.0432	8	0.87932	D	0	.	.	.	.	.	219	Q6IC83	CV042_HUMAN	G	219	ENSP00000371529:A219G	ENSP00000371529:A219G	A	-	2	0	C22orf42	30875766	0.002000	0.14202	0.001000	0.08648	0.109000	0.19521	-0.362000	0.07602	-1.293000	0.02362	0.064000	0.15345	GCA		0.353	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859	Missense_Mutation
ARL6IP5	10550	broad.mit.edu	37	3	69153673	69153673	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr3:69153673A>C	ENST00000273258.3	+	3	557	c.453A>C	c.(451-453)aaA>aaC	p.K151N	ARL6IP5_ENST00000478935.1_Intron	NM_006407.3	NP_006398.1	O75915	PRAF3_HUMAN	ADP-ribosylation factor-like 6 interacting protein 5	151	Targeting to endoplasmic reticulum membrane. {ECO:0000250}.				intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|L-glutamate transport (GO:0015813)|negative regulation of mitochondrial membrane potential (GO:0010917)|negative regulation of transport (GO:0051051)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of stress-activated MAPK cascade (GO:0032874)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.K151N(1)		biliary_tract(1)|endometrium(1)|large_intestine(2)|ovary(1)|prostate(1)|urinary_tract(1)	7		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.78e-05)|Epithelial(33;0.000818)|LUSC - Lung squamous cell carcinoma(21;0.0118)|Lung(16;0.0189)|KIRC - Kidney renal clear cell carcinoma(39;0.203)|Kidney(39;0.238)		TGGAGAATAAAATGGAAGGAA	0.453																																																1	Substitution - Missense(1)	ovary(1)	3											104.0	96.0	99.0					3																	69153673		2203	4300	6503	69236363	SO:0001583	missense	10550			AF070523	CCDS2912.1	3p14	2014-05-12	2014-05-12		ENSG00000144746	ENSG00000144746			16937	protein-coding gene	gene with protein product	"""PRA1 domain family 3"""	605709				11242046, 11042152	Standard	NM_006407		Approved	PRAF3, JWA, GTRAP3-18, DERP11, HSPC127	uc003dnr.3	O75915	OTTHUMG00000158773	ENST00000273258.3:c.453A>C	3.37:g.69153673A>C	ENSP00000273258:p.Lys151Asn	Somatic		Capture	Illumina GAIIx	Phase_I	69236363	B2R6V5|Q53ES3|Q5KU08	Missense_Mutation	SNP	ENST00000273258.3	37	CCDS2912.1	.	.	.	.	.	.	.	.	.	.	A	16.46	3.128211	0.56721	.	.	ENSG00000144746	ENST00000273258	T	0.45276	0.9	5.93	0.919	0.19392	.	0.041720	0.85682	D	0.000000	T	0.34571	0.0902	M	0.69463	2.115	0.80722	D	1	P	0.35923	0.528	B	0.35550	0.205	T	0.05053	-1.0909	10	0.33940	T	0.23	-16.7759	5.8647	0.18768	0.4795:0.1401:0.3804:0.0	.	151	O75915	PRAF3_HUMAN	N	151	ENSP00000273258:K151N	ENSP00000273258:K151N	K	+	3	2	ARL6IP5	69236363	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.192000	0.32150	0.140000	0.18849	0.533000	0.62120	AAA		0.453	ARL6IP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352132.1	NM_006407	
FILIP1L	11259	broad.mit.edu	37	3	99568055	99568055	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr3:99568055A>G	ENST00000354552.3	-	5	2935	c.2465T>C	c.(2464-2466)gTc>gCc	p.V822A	CMSS1_ENST00000496116.1_Intron|FILIP1L_ENST00000476723.1_Intron|FILIP1L_ENST00000487087.1_Missense_Mutation_p.V398A|FILIP1L_ENST00000471562.1_Missense_Mutation_p.V582A|CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000331335.5_Missense_Mutation_p.V822A|FILIP1L_ENST00000383694.2_Missense_Mutation_p.V582A	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	822						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.V822A(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						ACCATTGATGACTGCACGTTC	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											214.0	198.0	203.0					3																	99568055		1977	4155	6132	101050745	SO:0001583	missense	11259				CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.2465T>C	3.37:g.99568055A>G	ENSP00000346560:p.Val822Ala	Somatic		Capture	Illumina GAIIx	Phase_I	101050745	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Missense_Mutation	SNP	ENST00000354552.3	37	CCDS43117.1	.	.	.	.	.	.	.	.	.	.	A	1.741	-0.491793	0.04322	.	.	ENSG00000168386	ENST00000354552;ENST00000487087;ENST00000471562;ENST00000331335;ENST00000383694;ENST00000441620;ENST00000495625	T;T;T;T;T;T	0.26373	2.06;1.77;1.75;2.07;1.75;1.74	5.87	5.87	0.94306	.	0.000000	0.47093	D	0.000247	T	0.16128	0.0388	N	0.08118	0	0.35768	D	0.82066	B;B	0.27625	0.183;0.115	B;B	0.26416	0.069;0.031	T	0.18053	-1.0349	10	0.41790	T	0.15	-10.8786	16.2813	0.82687	1.0:0.0:0.0:0.0	.	822;822	Q4L180-2;Q4L180	.;FIL1L_HUMAN	A	822;398;582;822;582;568;582	ENSP00000346560:V822A;ENSP00000417774:V398A;ENSP00000419642:V582A;ENSP00000327880:V822A;ENSP00000373192:V582A;ENSP00000419874:V582A	ENSP00000327880:V822A	V	-	2	0	FILIP1L	101050745	1.000000	0.71417	0.995000	0.50966	0.906000	0.53458	5.287000	0.65645	2.244000	0.73946	0.533000	0.62120	GTC		0.438	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
TF	7018	broad.mit.edu	37	3	133478059	133478059	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr3:133478059G>T	ENST00000402696.3	+	9	1574	c.1089G>T	c.(1087-1089)tgG>tgT	p.W363C	TF_ENST00000264998.3_Missense_Mutation_p.W236C	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	363	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)	p.W363C(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	CTGTGAAGTGGTGTGCGCTGA	0.502																																																1	Substitution - Missense(1)	ovary(1)	3											170.0	167.0	168.0					3																	133478059		2203	4300	6503	134960749	SO:0001583	missense	7018				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.1089G>T	3.37:g.133478059G>T	ENSP00000385834:p.Trp363Cys	Somatic		Capture	Illumina GAIIx	Phase_I	134960749	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	ENST00000402696.3	37	CCDS3080.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.668124	0.67814	.	.	ENSG00000091513	ENST00000402696;ENST00000264998	T;T	0.57595	0.39;0.39	4.53	4.53	0.55603	.	0.109197	0.64402	D	0.000002	D	0.82692	0.5092	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89466	0.3740	10	0.87932	D	0	-25.4603	16.5466	0.84448	0.0:0.0:1.0:0.0	.	363	P02787	TRFE_HUMAN	C	363;236	ENSP00000385834:W363C;ENSP00000264998:W236C	ENSP00000264998:W236C	W	+	3	0	TF	134960749	1.000000	0.71417	1.000000	0.80357	0.762000	0.43233	6.926000	0.75835	2.495000	0.84180	0.462000	0.41574	TGG		0.502	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063	
CSN3	1448	broad.mit.edu	37	4	71114781	71114781	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr4:71114781C>G	ENST00000304954.3	+	4	240	c.154C>G	c.(154-156)Cca>Gca	p.P52A		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	187					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)		p.P52A(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						GTATTATGTGCCAAATAGCTA	0.343																																																1	Substitution - Missense(1)	ovary(1)	4											116.0	115.0	116.0					4																	71114781		2203	4300	6503	71149370	SO:0001583	missense	1448			U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.154C>G	4.37:g.71114781C>G	ENSP00000304822:p.Pro52Ala	Somatic		Capture	Illumina GAIIx	Phase_I	71149370	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	ENST00000304954.3	37	CCDS3538.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535973	0.45176	.	.	ENSG00000171209	ENST00000304954	T	0.20881	2.04	4.38	-0.487	0.12060	.	1.189540	0.06263	N	0.694347	T	0.12944	0.0314	N	0.22421	0.69	0.09310	N	1	B	0.27286	0.174	B	0.24006	0.05	T	0.34153	-0.9840	10	0.72032	D	0.01	-19.1112	3.4424	0.07468	0.1926:0.4077:0.0:0.3997	.	52	P07498	CASK_HUMAN	A	52	ENSP00000304822:P52A	ENSP00000304822:P52A	P	+	1	0	CSN3	71149370	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.195000	0.09546	-0.133000	0.11537	0.557000	0.71058	CCA		0.343	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251555.1	NM_005212	
HSPA4L	22824	broad.mit.edu	37	4	128751886	128751886	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr4:128751886G>T	ENST00000296464.4	+	18	2671	c.2260G>T	c.(2260-2262)Gca>Tca	p.A754S	HSPA4L_ENST00000505726.1_Missense_Mutation_p.A728S|HSPA4L_ENST00000439123.2_Missense_Mutation_p.A785S|HSPA4L_ENST00000508776.1_Missense_Mutation_p.A754S	NM_014278.2	NP_055093.2	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like	754					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)	p.A754S(1)		central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						TAAGATGAATGCACAGAACAA	0.343																																																1	Substitution - Missense(1)	ovary(1)	4											95.0	95.0	95.0					4																	128751886		2203	4299	6502	128971336	SO:0001583	missense	22824			AB023421	CCDS3734.1	4q28	2011-09-07			ENSG00000164070	ENSG00000164070		"""Heat shock proteins / HSP70"""	17041	protein-coding gene	gene with protein product						10524232	Standard	NM_014278		Approved	APG-1, Osp94, HSPH3	uc003ifm.3	O95757	OTTHUMG00000133302	ENST00000296464.4:c.2260G>T	4.37:g.128751886G>T	ENSP00000296464:p.Ala754Ser	Somatic		Capture	Illumina GAIIx	Phase_I	128971336	A2ICT2|Q4W5M5|Q8IWA2	Missense_Mutation	SNP	ENST00000296464.4	37	CCDS3734.1	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793459	0.50102	.	.	ENSG00000164070	ENST00000508776;ENST00000439123;ENST00000296464;ENST00000505726	T;T;T;T	0.01464	5.0;5.0;5.0;4.86	5.31	5.31	0.75309	.	0.054782	0.64402	D	0.000001	T	0.04998	0.0134	L	0.60957	1.885	0.43334	D	0.995374	B;D	0.63046	0.01;0.992	B;P	0.53006	0.056;0.715	T	0.52411	-0.8579	10	0.30854	T	0.27	.	14.0595	0.64790	0.0:0.0:0.8494:0.1506	.	728;754	E9PDE8;O95757	.;HS74L_HUMAN	S	754;785;754;728	ENSP00000422482:A754S;ENSP00000393926:A785S;ENSP00000296464:A754S;ENSP00000425645:A728S	ENSP00000296464:A754S	A	+	1	0	HSPA4L	128971336	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	3.992000	0.56980	2.763000	0.94921	0.563000	0.77884	GCA		0.343	HSPA4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257096.3	NM_014278	
DDO	8528	broad.mit.edu	37	6	110714313	110714313	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr6:110714313C>T	ENST00000368924.3	-	5	790	c.775G>A	c.(775-777)Gta>Ata	p.V259I	DDO_ENST00000368923.3_Missense_Mutation_p.V200I	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	231					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)	p.V259I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		CCTAGGGTTACATGGGATGTA	0.522																																																1	Substitution - Missense(1)	ovary(1)	6											125.0	136.0	132.0					6																	110714313		2203	4300	6503	110821006	SO:0001583	missense	8528			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.775G>A	6.37:g.110714313C>T	ENSP00000357920:p.Val259Ile	Somatic		Capture	Illumina GAIIx	Phase_I	110821006	A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Missense_Mutation	SNP	ENST00000368924.3	37	CCDS5082.1	.	.	.	.	.	.	.	.	.	.	C	18.88	3.716727	0.68844	.	.	ENSG00000203797	ENST00000368924;ENST00000368923;ENST00000368925	D;D;D	0.82526	-1.62;-1.62;-1.62	5.84	5.84	0.93424	.	0.197986	0.43919	D	0.000504	D	0.86644	0.5982	M	0.64997	1.995	0.58432	D	0.999991	D;D	0.76494	0.999;0.996	D;D	0.69142	0.962;0.922	D	0.86563	0.1842	10	0.51188	T	0.08	-21.8661	13.3587	0.60644	0.0:0.9281:0.0:0.0719	.	200;259	Q99489-4;Q99489-3	.;.	I	259;200;231	ENSP00000357920:V259I;ENSP00000357919:V200I;ENSP00000357921:V231I	ENSP00000357919:V200I	V	-	1	0	DDO	110821006	0.988000	0.35896	0.704000	0.30370	0.463000	0.32649	2.835000	0.48175	2.769000	0.95229	0.563000	0.77884	GTA		0.522	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041796.1		
SLC2A12	154091	broad.mit.edu	37	6	134349982	134349982	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr6:134349982C>G	ENST00000275230.5	-	2	1136	c.981G>C	c.(979-981)aaG>aaC	p.K327N		NM_145176.2	NP_660159.1	Q8TD20	GTR12_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 12	327					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.K327N(1)		NS(1)|breast(1)|large_intestine(6)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	17	Breast(56;0.214)|Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0101)|GBM - Glioblastoma multiforme(68;0.0123)		TGCTAATGACCTTGACGACTC	0.488																																					Melanoma(122;1663 1672 14489 35294 41228)											1	Substitution - Missense(1)	ovary(1)	6											81.0	68.0	73.0					6																	134349982		2203	4300	6503	134391675	SO:0001583	missense	154091			AL035699	CCDS5169.1	6q23.2	2013-05-22			ENSG00000146411	ENSG00000146411		"""Solute carriers"""	18067	protein-coding gene	gene with protein product		610372				11780753, 11832379	Standard	XM_006715349		Approved	GLUT12, GLUT8	uc003qem.1	Q8TD20	OTTHUMG00000015611	ENST00000275230.5:c.981G>C	6.37:g.134349982C>G	ENSP00000275230:p.Lys327Asn	Somatic		Capture	Illumina GAIIx	Phase_I	134391675	B3KV17|Q7Z6U3|Q96MR8	Missense_Mutation	SNP	ENST00000275230.5	37	CCDS5169.1	.	.	.	.	.	.	.	.	.	.	C	9.986	1.229537	0.22542	.	.	ENSG00000146411	ENST00000275230	T	0.67698	-0.28	5.16	1.92	0.25849	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	N	0.19112	0.55	0.58432	D	0.999993	B	0.27997	0.197	B	0.36464	0.225	T	0.05869	-1.0859	10	0.14252	T	0.57	-20.5346	8.7687	0.34719	0.0:0.6017:0.0:0.3983	.	327	Q8TD20	GTR12_HUMAN	N	327	ENSP00000275230:K327N	ENSP00000275230:K327N	K	-	3	2	SLC2A12	134391675	1.000000	0.71417	1.000000	0.80357	0.286000	0.27126	1.624000	0.37018	0.218000	0.20820	-1.595000	0.00837	AAG		0.488	SLC2A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042302.1		
NXPH1	30010	broad.mit.edu	37	7	8790932	8790932	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr7:8790932A>G	ENST00000405863.1	+	3	1260	c.349A>G	c.(349-351)Aaa>Gaa	p.K117E	NXPH1_ENST00000497400.1_3'UTR|NXPH1_ENST00000602349.1_5'UTR	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1	117	III.					extracellular region (GO:0005576)		p.K117E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		CAAGTTTAAGAAAATGTTTGG	0.468																																																1	Substitution - Missense(1)	ovary(1)	7											81.0	78.0	79.0					7																	8790932		1838	4079	5917	8757457	SO:0001583	missense	30010			AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.349A>G	7.37:g.8790932A>G	ENSP00000384551:p.Lys117Glu	Somatic		Capture	Illumina GAIIx	Phase_I	8757457	Q8NB31	Missense_Mutation	SNP	ENST00000405863.1	37	CCDS47540.1	.	.	.	.	.	.	.	.	.	.	A	19.35	3.811723	0.70797	.	.	ENSG00000122584	ENST00000405863;ENST00000438764;ENST00000429542	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	M	0.83953	2.67	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.83736	0.0201	9	0.87932	D	0	-15.6341	16.6406	0.85098	1.0:0.0:0.0:0.0	.	117	P58417	NXPH1_HUMAN	E	117	.	ENSP00000384551:K117E	K	+	1	0	NXPH1	8757457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.307000	0.96226	2.326000	0.78906	0.533000	0.62120	AAA		0.468	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324591.1	NM_152745	
MCM4	4173	broad.mit.edu	37	8	48883167	48883167	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr8:48883167G>A	ENST00000262105.2	+	11	1740	c.1531G>A	c.(1531-1533)Gac>Aac	p.D511N	MCM4_ENST00000518680.1_3'UTR|MCM4_ENST00000523944.1_Missense_Mutation_p.D511N	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	511	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.D511N(1)		biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				GCTGTGTGGCGACCCTGGTAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	8											112.0	98.0	102.0					8																	48883167		2203	4300	6503	49045720	SO:0001583	missense	4173				CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.1531G>A	8.37:g.48883167G>A	ENSP00000262105:p.Asp511Asn	Somatic		Capture	Illumina GAIIx	Phase_I	49045720	Q8NEH1|Q99658	Missense_Mutation	SNP	ENST00000262105.2	37	CCDS6143.1	.	.	.	.	.	.	.	.	.	.	G	35	5.416122	0.96092	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229;ENST00000520637	T;T;T	0.15139	2.45;2.45;2.45	6.17	6.17	0.99709	ATPase, AAA+ type, core (1);	0.082144	0.85682	D	0.000000	T	0.67230	0.2871	H	0.99682	4.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82037	-0.0656	10	0.87932	D	0	-39.4048	20.8794	0.99867	0.0:0.0:1.0:0.0	.	511;511	B3KMX0;P33991	.;MCM4_HUMAN	N	511;511;498;471;229	ENSP00000430194:D511N;ENSP00000262105:D511N;ENSP00000427875:D229N	ENSP00000262105:D511N	D	+	1	0	MCM4	49045720	1.000000	0.71417	0.995000	0.50966	0.708000	0.40852	9.790000	0.99075	2.941000	0.99782	0.655000	0.94253	GAC		0.552	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914	
RB1CC1	9821	broad.mit.edu	37	8	53555086	53555086	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr8:53555086C>A	ENST00000025008.5	-	18	4685	c.4162G>T	c.(4162-4164)Gaa>Taa	p.E1388*	RB1CC1_ENST00000435644.2_Nonsense_Mutation_p.E1388*|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Nonsense_Mutation_p.E1388*	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1388					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.E1388*(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTACTGACTTCTTCTTCAAGC	0.408																																					GBM(180;1701 2102 13475 42023 52570)											1	Substitution - Nonsense(1)	ovary(1)	8											109.0	102.0	104.0					8																	53555086		2203	4300	6503	53717639	SO:0001587	stop_gained	9821			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4162G>T	8.37:g.53555086C>A	ENSP00000025008:p.Glu1388*	Somatic		Capture	Illumina GAIIx	Phase_I	53717639	Q86YR4|Q8WVU9|Q92601	Nonsense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	C	48	14.656720	0.99805	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	.	.	.	5.61	4.72	0.59763	.	0.054132	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-10.4334	15.3987	0.74818	0.0:0.8603:0.1397:0.0	.	.	.	.	X	1388	.	ENSP00000025008:E1388X	E	-	1	0	RB1CC1	53717639	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.955000	0.63638	1.321000	0.45227	0.655000	0.94253	GAA		0.408	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
TRPA1	8989	broad.mit.edu	37	8	72973971	72973971	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr8:72973971A>G	ENST00000262209.4	-	7	1040	c.833T>C	c.(832-834)tTt>tCt	p.F278S		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	278					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)	p.F278S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GGTGGCAGCAAAATGAATGGC	0.403																																																1	Substitution - Missense(1)	ovary(1)	8											152.0	124.0	134.0					8																	72973971		2203	4300	6503	73136525	SO:0001583	missense	8989			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.833T>C	8.37:g.72973971A>G	ENSP00000262209:p.Phe278Ser	Somatic		Capture	Illumina GAIIx	Phase_I	73136525	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	37	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.619400	0.87460	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.64085	-0.08;-0.08	4.94	4.94	0.65067	Ankyrin repeat-containing domain (4);	0.171885	0.53938	D	0.000057	T	0.78457	0.4286	M	0.84511	2.7	0.80722	D	1	D	0.65815	0.995	D	0.63877	0.919	T	0.78735	-0.2088	10	0.30078	T	0.28	-20.6897	14.7654	0.69634	1.0:0.0:0.0:0.0	.	278	O75762	TRPA1_HUMAN	S	130;278	ENSP00000428151:F130S;ENSP00000262209:F278S	ENSP00000262209:F278S	F	-	2	0	TRPA1	73136525	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.197000	0.89727	2.080000	0.62538	0.533000	0.62120	TTT		0.403	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
TGFBR1	7046	broad.mit.edu	37	9	101900289	101900289	+	Silent	SNP	G	G	T	rs201112150		TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chr9:101900289G>T	ENST00000374994.4	+	4	840	c.723G>T	c.(721-723)tcG>tcT	p.S241S	TGFBR1_ENST00000552516.1_Silent_p.S245S|TGFBR1_ENST00000550253.1_Silent_p.S172S|TGFBR1_ENST00000374990.2_Silent_p.S164S	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	241	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		S -> L (in LDS1). {ECO:0000269|PubMed:16596670, ECO:0000269|PubMed:16791849}.		activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)	p.S241S(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				AAGAACGTTCGTGGTTCCGTG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	9											173.0	168.0	169.0					9																	101900289		2203	4300	6503	100940110	SO:0001819	synonymous_variant	7046				CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.723G>T	9.37:g.101900289G>T		Somatic		Capture	Illumina GAIIx	Phase_I	100940110	Q6IR47|Q706C0|Q706C1	Silent	SNP	ENST00000374994.4	37	CCDS6738.1																																																																																				0.413	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3		
TENM1	10178	broad.mit.edu	37	X	124029956	124029956	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chrX:124029956C>G	ENST00000371130.3	-	2	415	c.352G>C	c.(352-354)Gac>Cac	p.D118H	TENM1_ENST00000422452.2_Missense_Mutation_p.D118H	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	118	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.D118H(1)									AGTGCATGGTCAGGTGAGGCA	0.507																																																1	Substitution - Missense(1)	ovary(1)	X											278.0	225.0	243.0					X																	124029956		2203	4300	6503	123857637	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.352G>C	X.37:g.124029956C>G	ENSP00000360171:p.Asp118His	Somatic		Capture	Illumina GAIIx	Phase_I	123857637	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.862187	0.51482	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.31510	1.49;1.49	5.56	5.56	0.83823	Teneurin intracellular, N-terminal (2);	0.240686	0.33309	N	0.005054	T	0.30417	0.0764	N	0.22421	0.69	0.47094	D	0.999316	B;B;B	0.32425	0.371;0.371;0.371	B;B;B	0.38985	0.287;0.287;0.287	T	0.14980	-1.0453	10	0.72032	D	0.01	.	18.7885	0.91964	0.0:1.0:0.0:0.0	.	118;118;118	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	H	118	ENSP00000360171:D118H;ENSP00000403954:D118H	ENSP00000360171:D118H	D	-	1	0	ODZ1	123857637	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	4.575000	0.60908	2.469000	0.83416	0.600000	0.82982	GAC		0.507	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
BCORL1	63035	broad.mit.edu	37	X	129148822	129148822	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2393-01A-01W-0799-08	TCGA-25-2393-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	f2a76a1f-296b-4431-abba-8c4850f6bd9a	f02718de-eecc-4536-99dc-c4c41f8e6cdb	g.chrX:129148822G>A	ENST00000218147.7	+	4	2271	c.2074G>A	c.(2074-2076)Gag>Aag	p.E692K	BCORL1_ENST00000303743.5_Missense_Mutation_p.E692K|BCORL1_ENST00000359304.2_Missense_Mutation_p.E692K|BCORL1_ENST00000540052.1_Missense_Mutation_p.E692K			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	692					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.E692K(1)		breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CATCTTTCCCGAGATCGTGAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	X											70.0	58.0	62.0					X																	129148822		2203	4300	6503	128976503	SO:0001583	missense	63035			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2074G>A	X.37:g.129148822G>A	ENSP00000218147:p.Glu692Lys	Somatic		Capture	Illumina GAIIx	Phase_I	128976503	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.62|13.62	2.290931|2.290931	0.40494|0.40494	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	T;T;T;T;T|.	0.48522|.	0.83;1.23;0.81;0.83;1.31|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	0.000000|.	0.37178|.	N|.	0.002211|.	T|T	0.44477|0.44477	0.1295|0.1295	N|N	0.24115|0.24115	0.695|0.695	0.30684|0.30684	N|N	0.752011|0.752011	D;D|.	0.76494|.	0.999;0.976|.	P;B|.	0.61201|.	0.885;0.353|.	T|T	0.44832|0.44832	-0.9302|-0.9302	10|5	0.26408|.	T|.	0.33|.	-9.2769|-9.2769	18.0781|18.0781	0.89433|0.89433	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	692;692|.	Q5H9F3-2;Q5H9F3|.	.;BCORL_HUMAN|.	K|Q	692;692;692;692;292|127	ENSP00000218147:E692K;ENSP00000307541:E692K;ENSP00000352253:E692K;ENSP00000437775:E692K;ENSP00000399483:E292K|.	ENSP00000218147:E692K|.	E|R	+|+	1|2	0|0	BCORL1|BCORL1	128976503|128976503	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.333000|0.333000	0.28666|0.28666	4.592000|4.592000	0.61027|0.61027	2.205000|2.205000	0.71048|0.71048	0.436000|0.436000	0.28706|0.28706	GAG|CGA		0.602	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
