#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
STXBP3	6814	broad.mit.edu	37	1	109301195	109301195	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr1:109301195A>G	ENST00000370008.3	+	5	372	c.322A>G	c.(322-324)Att>Gtt	p.I108V		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	108	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)	p.I108V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		AGCAGCATATATTTACTTCAC	0.284																																																1	Substitution - Missense(1)	ovary(1)	1											43.0	51.0	48.0					1																	109301195		2199	4277	6476	109102718	SO:0001583	missense	6814			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.322A>G	1.37:g.109301195A>G	ENSP00000359025:p.Ile108Val	Somatic		Capture	Illumina GAIIx	Phase_I	109102718	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	ENST00000370008.3	37	CCDS790.1	.	.	.	.	.	.	.	.	.	.	A	2.332	-0.353058	0.05173	.	.	ENSG00000116266	ENST00000370008	T	0.79554	-1.28	5.42	-4.36	0.03645	.	0.301640	0.35495	N	0.003179	T	0.15782	0.0380	N	0.01454	-0.855	0.26853	N	0.96812	B	0.02656	0.0	B	0.06405	0.002	T	0.43814	-0.9368	10	0.02654	T	1	-3.4145	1.6333	0.02737	0.2984:0.3631:0.0998:0.2387	.	108	O00186	STXB3_HUMAN	V	108	ENSP00000359025:I108V	ENSP00000359025:I108V	I	+	1	0	STXBP3	109102718	0.994000	0.37717	0.855000	0.33649	0.971000	0.66376	0.473000	0.22132	-0.630000	0.05567	0.383000	0.25322	ATT		0.284	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
SELP	6403	broad.mit.edu	37	1	169566334	169566334	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr1:169566334A>T	ENST00000263686.6	-	11	1823	c.1786T>A	c.(1786-1788)Tcc>Acc	p.S596T	SELP_ENST00000458599.2_Intron|SELP_ENST00000367794.2_Missense_Mutation_p.S534T|SELP_ENST00000367788.2_Missense_Mutation_p.S534T|SELP_ENST00000367792.2_Intron|SELP_ENST00000367786.2_Missense_Mutation_p.S534T|SELP_ENST00000367791.2_Intron|SELP_ENST00000367793.2_Missense_Mutation_p.S534T	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	596	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)	p.S596T(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	TGGCAGGTGGAGCCAACATTG	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											67.0	68.0	68.0					1																	169566334		2203	4300	6503	167832958	SO:0001583	missense	6403			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.1786T>A	1.37:g.169566334A>T	ENSP00000263686:p.Ser596Thr	Somatic		Capture	Illumina GAIIx	Phase_I	167832958	Q5R344|Q8IVD1	Missense_Mutation	SNP	ENST00000263686.6	37	CCDS1282.1	.	.	.	.	.	.	.	.	.	.	A	14.56	2.570453	0.45798	.	.	ENSG00000174175	ENST00000367790;ENST00000426706;ENST00000263686;ENST00000544572;ENST00000367793;ENST00000367794;ENST00000367788;ENST00000367786;ENST00000458599	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.13	3.95	0.45737	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.52532	D	0.000080	T	0.59128	0.2171	L	0.52206	1.635	0.80722	D	1	D;D;P	0.63046	0.992;0.985;0.633	P;P;B	0.62649	0.832;0.905;0.324	T	0.61647	-0.7020	10	0.45353	T	0.12	-23.7836	8.2581	0.31769	0.8242:0.0:0.0:0.1758	.	596;596;596	Q6NUL9;P16109;G3V1U2	.;LYAM3_HUMAN;.	T	596;595;596;596;534;534;534;534;519	ENSP00000263686:S596T;ENSP00000356767:S534T;ENSP00000356768:S534T;ENSP00000356762:S534T;ENSP00000356760:S534T	ENSP00000263686:S596T	S	-	1	0	SELP	167832958	0.944000	0.32072	0.983000	0.44433	0.193000	0.23685	0.728000	0.26013	1.900000	0.55004	0.528000	0.53228	TCC		0.498	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000083916.4	NM_003005	
RYR2	6262	broad.mit.edu	37	1	237811894	237811894	+	Missense_Mutation	SNP	C	C	T	rs374191985		TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr1:237811894C>T	ENST00000366574.2	+	49	7810	c.7493C>T	c.(7492-7494)gCg>gTg	p.A2498V	RYR2_ENST00000542537.1_Missense_Mutation_p.A2482V|RYR2_ENST00000360064.6_Missense_Mutation_p.A2496V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2498	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.A2496V(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GATCTCCGGGCGGCTGCTTCT	0.463																																																1	Substitution - Missense(1)	ovary(1)	1						C	VAL/ALA	1,3805		0,1,1902	69.0	63.0	65.0		7493	4.7	1.0	1		65	1,8225		0,1,4112	no	missense	RYR2	NM_001035.2	64	0,2,6014	TT,TC,CC		0.0122,0.0263,0.0166	possibly-damaging	2498/4968	237811894	2,12030	1903	4113	6016	235878517	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7493C>T	1.37:g.237811894C>T	ENSP00000355533:p.Ala2498Val	Somatic		Capture	Illumina GAIIx	Phase_I	235878517	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	31	5.086307	0.94100	2.63E-4	1.22E-4	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.89810	-2.57;-2.57;-2.57	4.73	4.73	0.59995	.	0.000000	0.64402	D	0.000013	D	0.94899	0.8351	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.71870	0.975	D	0.95573	0.8640	10	0.87932	D	0	-13.5883	18.5983	0.91236	0.0:1.0:0.0:0.0	.	2498	Q92736	RYR2_HUMAN	V	2498;2496;2482	ENSP00000355533:A2498V;ENSP00000353174:A2496V;ENSP00000443798:A2482V	ENSP00000353174:A2496V	A	+	2	0	RYR2	235878517	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.776000	0.85560	2.563000	0.86464	0.655000	0.94253	GCG		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
KIAA1217	56243	broad.mit.edu	37	10	24810787	24810787	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr10:24810787G>T	ENST00000376454.3	+	12	2415	c.2385G>T	c.(2383-2385)gaG>gaT	p.E795D	KIAA1217_ENST00000396445.1_Missense_Mutation_p.E478D|KIAA1217_ENST00000430453.2_Intron|KIAA1217_ENST00000376462.1_Missense_Mutation_p.E715D|KIAA1217_ENST00000458595.1_Missense_Mutation_p.E760D|KIAA1217_ENST00000307544.6_Missense_Mutation_p.E478D|KIAA1217_ENST00000376452.3_Missense_Mutation_p.E760D|KIAA1217_ENST00000396446.1_Missense_Mutation_p.E478D|KIAA1217_ENST00000376451.2_Missense_Mutation_p.E478D	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	795				E -> G (in Ref. 3; CAE45879). {ECO:0000305}.	embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.E795D(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						TTCTGAAGGAGGAGCCACACA	0.587																																																1	Substitution - Missense(1)	ovary(1)	10											71.0	69.0	70.0					10																	24810787		2203	4300	6503	24850793	SO:0001583	missense	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.2385G>T	10.37:g.24810787G>T	ENSP00000365637:p.Glu795Asp	Somatic		Capture	Illumina GAIIx	Phase_I	24850793	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138406	0.77775	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31;0.31;0.31;0.31;0.31;0.31	5.95	3.14	0.36123	.	0.096544	0.64402	D	0.000001	T	0.70064	0.3181	M	0.62088	1.915	0.58432	D	0.999994	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;1.0;0.999;0.997;1.0	D;D;D;D;D;D;D;D	0.87578	0.993;0.993;0.994;0.998;0.998;0.994;0.99;0.996	T	0.67894	-0.5552	10	0.49607	T	0.09	.	10.7386	0.46139	0.2603:0.0:0.7397:0.0	.	760;760;478;478;478;478;795;795	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	D	715;760;760;478;795;760;610;478;478;478;478;478	ENSP00000365645:E715D;ENSP00000365639:E760D;ENSP00000392625:E760D;ENSP00000365637:E795D;ENSP00000365635:E760D;ENSP00000404798:E610D;ENSP00000302343:E478D;ENSP00000379722:E478D;ENSP00000365634:E478D;ENSP00000379723:E478D	ENSP00000302343:E478D	E	+	3	2	KIAA1217	24850793	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.399000	0.34566	0.432000	0.26286	0.563000	0.77884	GAG		0.587	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
SGMS1	259230	broad.mit.edu	37	10	52071164	52071164	+	Silent	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr10:52071164G>A	ENST00000361781.2	-	9	1712	c.753C>T	c.(751-753)gaC>gaT	p.D251D	SGMS1_ENST00000429490.1_Silent_p.D82D	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	257					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)	p.D251D(1)		endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						GGGCTTCCCAGTCTCCGAAAA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	10											70.0	51.0	57.0					10																	52071164		2203	4300	6503	51741170	SO:0001819	synonymous_variant	259230			AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.753C>T	10.37:g.52071164G>A		Somatic		Capture	Illumina GAIIx	Phase_I	51741170	Q68U43|Q6EKK0|Q75SP1	Silent	SNP	ENST00000361781.2	37	CCDS7240.1																																																																																				0.433	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048074.2	NM_147156	
NLRP10	338322	broad.mit.edu	37	11	7984796	7984796	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr11:7984796G>T	ENST00000328600.2	-	1	408	c.247C>A	c.(247-249)Ctg>Atg	p.L83M		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	83	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)	p.L83M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGTTCCAACAGGTTCATGACC	0.547																																																1	Substitution - Missense(1)	ovary(1)	11											96.0	88.0	91.0					11																	7984796		2201	4296	6497	7941372	SO:0001583	missense	338322			AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.247C>A	11.37:g.7984796G>T	ENSP00000327763:p.Leu83Met	Somatic		Capture	Illumina GAIIx	Phase_I	7941372	Q2M3C4|Q6JGT0	Missense_Mutation	SNP	ENST00000328600.2	37	CCDS7784.1	.	.	.	.	.	.	.	.	.	.	G	9.318	1.057313	0.19907	.	.	ENSG00000182261	ENST00000328600	T	0.51817	0.69	3.66	1.5	0.22942	Pyrin (2);DEATH-like (2);	0.000000	0.32357	N	0.006217	T	0.41419	0.1158	L	0.31207	0.915	0.23180	N	0.998168	B	0.32543	0.375	P	0.47075	0.536	T	0.34625	-0.9821	10	0.49607	T	0.09	.	4.2058	0.10488	0.5393:0.0:0.4607:0.0	.	83	Q86W26	NAL10_HUMAN	M	83	ENSP00000327763:L83M	ENSP00000327763:L83M	L	-	1	2	NLRP10	7941372	1.000000	0.71417	0.988000	0.46212	0.309000	0.27889	2.966000	0.49208	0.356000	0.24157	-0.251000	0.11542	CTG		0.547	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385705.1	NM_176821	
RSF1	51773	broad.mit.edu	37	11	77451976	77451976	+	Silent	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr11:77451976G>A	ENST00000308488.6	-	4	680	c.378C>T	c.(376-378)ctC>ctT	p.L126L	RSF1-IT1_ENST00000528233.1_RNA|RSF1_ENST00000360355.2_Silent_p.L95L			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	126					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.L126L(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			GACACTCACAGAGGTACTGAA	0.363																																																1	Substitution - coding silent(1)	ovary(1)	11											61.0	53.0	56.0					11																	77451976		2200	4292	6492	77129624	SO:0001819	synonymous_variant	51773			AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.378C>T	11.37:g.77451976G>A		Somatic		Capture	Illumina GAIIx	Phase_I	77129624	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Silent	SNP	ENST00000308488.6	37	CCDS8253.1																																																																																				0.363	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578	
EXPH5	23086	broad.mit.edu	37	11	108385374	108385374	+	Missense_Mutation	SNP	A	A	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr11:108385374A>G	ENST00000265843.4	-	6	970	c.860T>C	c.(859-861)tTt>tCt	p.F287S	EXPH5_ENST00000428840.1_Missense_Mutation_p.F211S|EXPH5_ENST00000524840.1_5'UTR|EXPH5_ENST00000525344.1_Missense_Mutation_p.F280S|EXPH5_ENST00000443411.1_Missense_Mutation_p.F99S	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	287					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)	p.F287S(1)		breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CCTAGGAGAAAAGGTTTTAAA	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											95.0	90.0	92.0					11																	108385374		2201	4298	6499	107890584	SO:0001583	missense	23086				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.860T>C	11.37:g.108385374A>G	ENSP00000265843:p.Phe287Ser	Somatic		Capture	Illumina GAIIx	Phase_I	107890584	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.460487	0.63401	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.06294	3.92;3.83;3.69;3.92;3.73;3.32	5.67	5.67	0.87782	.	0.105878	0.42548	D	0.000685	T	0.19446	0.0467	M	0.69823	2.125	0.31610	N	0.651609	D	0.89917	1.0	D	0.85130	0.997	T	0.26710	-1.0095	10	0.66056	D	0.02	-20.0778	5.0773	0.14638	0.708:0.1762:0.1158:0.0	.	287	Q8NEV8	EXPH5_HUMAN	S	287;211;99;280;131;211;99	ENSP00000265843:F287S;ENSP00000391966:F211S;ENSP00000411390:F99S;ENSP00000432546:F280S;ENSP00000432683:F211S;ENSP00000446434:F99S	ENSP00000265843:F287S	F	-	2	0	EXPH5	107890584	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.272000	0.51616	2.154000	0.67381	0.533000	0.62120	TTT		0.363	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
GPR162	27239	broad.mit.edu	37	12	6936245	6936245	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr12:6936245T>C	ENST00000311268.3	+	5	2430	c.1643T>C	c.(1642-1644)gTt>gCt	p.V548A	LEPREL2_ENST00000396725.2_RNA|GPR162_ENST00000382315.3_Missense_Mutation_p.V244A|LEPREL2_ENST00000606935.1_RNA|LEPREL2_ENST00000251761.8_RNA|GPR162_ENST00000428545.2_Missense_Mutation_p.V264A	NM_019858.1	NP_062832.1	Q16538	GP162_HUMAN	G protein-coupled receptor 162	548						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V548A(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(1)	18						AGCAGAGCCGTTGGACTTCCT	0.672																																																1	Substitution - Missense(1)	ovary(1)	12											61.0	72.0	68.0					12																	6936245		2199	4297	6496	6806506	SO:0001583	missense	27239			U47928, U47929, U47924, U47925	CCDS8563.1, CCDS44819.1	12p13	2012-08-21						"""GPCR / Class A : Orphans"""	16693	protein-coding gene	gene with protein product						15777626	Standard	NM_014449		Approved	A-2, GRCA	uc001qqw.1	Q16538		ENST00000311268.3:c.1643T>C	12.37:g.6936245T>C	ENSP00000311528:p.Val548Ala	Somatic		Capture	Illumina GAIIx	Phase_I	6806506	Q16664|Q59EH5|Q66K56	Missense_Mutation	SNP	ENST00000311268.3	37	CCDS8563.1	.	.	.	.	.	.	.	.	.	.	T	11.03	1.517709	0.27123	.	.	ENSG00000250510	ENST00000311268;ENST00000428545;ENST00000382315	T;T;T	0.42900	3.12;0.96;0.96	4.56	2.25	0.28309	.	.	.	.	.	T	0.21427	0.0516	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21930	-1.0231	9	0.16896	T	0.51	.	5.5664	0.17173	0.0:0.2181:0.0:0.7819	.	264;548	Q16538-2;Q16538	.;GP162_HUMAN	A	548;264;244	ENSP00000311528:V548A;ENSP00000399670:V264A;ENSP00000371752:V244A	ENSP00000311528:V548A	V	+	2	0	GPR162	6806506	0.000000	0.05858	0.012000	0.15200	0.909000	0.53808	0.427000	0.21379	0.886000	0.36113	0.418000	0.28097	GTT		0.672	GPR162-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399478.1	NM_019858	
FOXJ2	55810	broad.mit.edu	37	12	8200663	8200663	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr12:8200663C>G	ENST00000162391.3	+	7	2148	c.1003C>G	c.(1003-1005)Cca>Gca	p.P335A	FOXJ2_ENST00000428177.2_Missense_Mutation_p.P335A	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	335					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.P335A(1)		autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		GGGTGCTCCTCCACTGCACAC	0.667																																																1	Substitution - Missense(1)	ovary(1)	12											54.0	50.0	52.0					12																	8200663		2203	4300	6503	8091930	SO:0001583	missense	55810			AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.1003C>G	12.37:g.8200663C>G	ENSP00000162391:p.Pro335Ala	Somatic		Capture	Illumina GAIIx	Phase_I	8091930	A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	ENST00000162391.3	37	CCDS8587.1	.	.	.	.	.	.	.	.	.	.	C	6.087	0.384425	0.11524	.	.	ENSG00000065970	ENST00000162391;ENST00000428177	D;D	0.94576	-3.31;-3.46	5.61	2.31	0.28768	.	1.531970	0.03900	N	0.280158	D	0.88239	0.6383	N	0.16478	0.41	0.27451	N	0.953432	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.78160	-0.2312	10	0.22706	T	0.39	.	6.067	0.19868	0.0:0.5179:0.3779:0.1042	.	335;335	Q9P0K8;Q9P0K8-2	FOXJ2_HUMAN;.	A	335	ENSP00000162391:P335A;ENSP00000403411:P335A	ENSP00000162391:P335A	P	+	1	0	FOXJ2	8091930	0.221000	0.23642	0.702000	0.30337	0.911000	0.54048	0.671000	0.25172	1.315000	0.45114	0.491000	0.48974	CCA		0.667	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400088.1	NM_018416	
KRT73	319101	broad.mit.edu	37	12	53012064	53012064	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr12:53012064G>A	ENST00000305748.3	-	1	279	c.245C>T	c.(244-246)gCt>gTt	p.A82V	RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	82	Gly-rich.|Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.A82V(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		CATGCTGCCAGCAAAGCCACT	0.637																																																1	Substitution - Missense(1)	ovary(1)	12											100.0	112.0	108.0					12																	53012064		2203	4300	6503	51298331	SO:0001583	missense	319101			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.245C>T	12.37:g.53012064G>A	ENSP00000307014:p.Ala82Val	Somatic		Capture	Illumina GAIIx	Phase_I	51298331	Q32MB2	Missense_Mutation	SNP	ENST00000305748.3	37	CCDS8834.1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.069980	0.36566	.	.	ENSG00000186049	ENST00000305748	T	0.77358	-1.09	4.64	4.64	0.57946	.	0.119337	0.37012	N	0.002282	T	0.68522	0.3010	L	0.52364	1.645	0.26933	N	0.966418	B	0.23058	0.079	B	0.21360	0.034	T	0.53151	-0.8479	10	0.13853	T	0.58	.	11.1758	0.48598	0.0878:0.0:0.9122:0.0	.	82	Q86Y46	K2C73_HUMAN	V	82	ENSP00000307014:A82V	ENSP00000307014:A82V	A	-	2	0	KRT73	51298331	0.001000	0.12720	0.963000	0.40424	0.890000	0.51754	0.757000	0.26433	2.512000	0.84698	0.655000	0.94253	GCT		0.637	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068	
ZNF605	100289635	broad.mit.edu	37	12	133509732	133509732	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr12:133509732C>G	ENST00000360187.4	-	4	373	c.25G>C	c.(25-27)Gag>Cag	p.E9Q	ZNF605_ENST00000331711.7_5'UTR|ZNF605_ENST00000392321.3_Missense_Mutation_p.E9Q	NM_183238.3	NP_899061.1	Q86T29	ZN605_HUMAN	zinc finger protein 605	9	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E9Q(1)		breast(1)|kidney(16)|large_intestine(5)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00227)|all_epithelial(31;0.142)		OV - Ovarian serous cystadenocarcinoma(86;9.24e-09)|Epithelial(86;2.11e-07)|all cancers(50;5.27e-06)		GCCACATCCTCAAATGATATC	0.403																																																1	Substitution - Missense(1)	ovary(1)	12											4.0	3.0	3.0					12																	133509732		1688	2535	4223	132019805	SO:0001583	missense	100289635			AL832623	CCDS31938.1, CCDS53850.1	12q24.33	2013-01-08	2009-09-11	2009-09-11		ENSG00000196458		"""Zinc fingers, C2H2-type"", ""-"""	28068	protein-coding gene	gene with protein product							Standard	NM_183238		Approved		uc001uli.3	Q86T29		ENST00000360187.4:c.25G>C	12.37:g.133509732C>G	ENSP00000353314:p.Glu9Gln	Somatic		Capture	Illumina GAIIx	Phase_I	132019805	B3KVG4|D3DXJ0|Q86T91	Missense_Mutation	SNP	ENST00000360187.4	37	CCDS31938.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.128988	0.37533	.	.	ENSG00000196458	ENST00000360187;ENST00000392321	T;T	0.02197	4.4;4.4	3.35	2.35	0.29111	Krueppel-associated box (4);	.	.	.	.	T	0.05640	0.0148	M	0.62016	1.91	0.34357	D	0.690543	P;P	0.45827	0.867;0.81	P;B	0.50378	0.639;0.301	T	0.43261	-0.9402	9	0.31617	T	0.26	.	11.9305	0.52843	0.0:0.8222:0.1778:0.0	.	9;9	B3KVG4;Q86T29	.;ZN605_HUMAN	Q	9	ENSP00000353314:E9Q;ENSP00000376135:E9Q	ENSP00000353314:E9Q	E	-	1	0	ZNF605	132019805	1.000000	0.71417	0.990000	0.47175	0.897000	0.52465	3.418000	0.52721	1.882000	0.54519	0.462000	0.41574	GAG		0.403	ZNF605-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397135.2	NM_183238	
LPAR6	10161	broad.mit.edu	37	13	48986113	48986113	+	Silent	SNP	T	T	G	rs199857507		TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr13:48986113T>G	ENST00000378434.4	-	7	2071	c.447A>C	c.(445-447)gcA>gcC	p.A149A	LPAR6_ENST00000345941.2_Silent_p.A149A|RB1_ENST00000267163.4_Intron	NM_005767.5	NP_005758.2	P43657	LPAR6_HUMAN	lysophosphatidic acid receptor 6	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.0?(15)|p.?(4)|p.A149A(3)		NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	14						AAACGGCGGGTGCACTTCCTC	0.433																																																22	Whole gene deletion(15)|Unknown(4)|Substitution - coding silent(3)	bone(10)|breast(4)|ovary(3)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	13											29.0	31.0	31.0					13																	48986113		2202	4300	6502	47884114	SO:0001819	synonymous_variant	10161			AF000546	CCDS9410.1	13q14	2012-08-08	2009-06-23	2009-06-23	ENSG00000139679	ENSG00000139679		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	15520	protein-coding gene	gene with protein product		609239	"""purinergic receptor P2Y, G-protein coupled, 5"""	P2RY5		11004484, 9755289, 19386608	Standard	NM_005767		Approved	P2Y5	uc010acu.3	P43657	OTTHUMG00000016895	ENST00000378434.4:c.447A>C	13.37:g.48986113T>G		Somatic		Capture	Illumina GAIIx	Phase_I	47884114	A4FTW9|B3KVF2|F2YGU4|O15133|Q3KPF5|Q53FA0|Q5VW44|Q7Z3S0|Q7Z3S6	Silent	SNP	ENST00000378434.4	37	CCDS9410.1																																																																																				0.433	LPAR6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276280.2	NM_005767	
DAAM1	23002	broad.mit.edu	37	14	59821991	59821991	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr14:59821991C>G	ENST00000395125.1	+	20	2518	c.2495C>G	c.(2494-2496)gCa>gGa	p.A832G	DAAM1_ENST00000553966.1_3'UTR|DAAM1_ENST00000351081.1_Missense_Mutation_p.A832G|DAAM1_ENST00000360909.3_Missense_Mutation_p.A822G	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	832	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)	p.A832G(1)		breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		AGAGGGAATGCATATGGATTC	0.433																																																1	Substitution - Missense(1)	ovary(1)	14											147.0	136.0	139.0					14																	59821991		2203	4300	6503	58891744	SO:0001583	missense	23002			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.2495C>G	14.37:g.59821991C>G	ENSP00000378557:p.Ala832Gly	Somatic		Capture	Illumina GAIIx	Phase_I	58891744	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	37	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	C	33	5.206763	0.95033	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	T;T;T	0.37058	1.22;1.22;1.22	5.81	5.81	0.92471	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.092055	0.85682	D	0.000000	T	0.73837	0.3638	H	0.95645	3.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	T	0.80845	-0.1200	10	0.87932	D	0	.	20.4375	0.99097	0.0:1.0:0.0:0.0	.	822;832	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	G	822;832;801;832	ENSP00000354162:A822G;ENSP00000247170:A832G;ENSP00000378557:A832G	ENSP00000247170:A832G	A	+	2	0	DAAM1	58891744	1.000000	0.71417	0.980000	0.43619	0.892000	0.51952	7.776000	0.85560	2.906000	0.99361	0.655000	0.94253	GCA		0.433	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
SPRED1	161742	broad.mit.edu	37	15	38643268	38643268	+	Silent	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr15:38643268C>G	ENST00000299084.4	+	7	1598	c.738C>G	c.(736-738)gtC>gtG	p.V246V		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	246	KBD. {ECO:0000255|PROSITE- ProRule:PRU00821}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)	p.V246V(1)		kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		ATGAGATTGTCAGAATAAACC	0.383									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)											1	Substitution - coding silent(1)	ovary(1)	15											57.0	53.0	54.0					15																	38643268		2200	4297	6497	36430560	SO:0001819	synonymous_variant	161742	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.738C>G	15.37:g.38643268C>G		Somatic		Capture	Illumina GAIIx	Phase_I	36430560	B2RPJ8|Q05D53|Q8N256	Silent	SNP	ENST00000299084.4	37	CCDS32193.1																																																																																				0.383	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418217.1		
DISP2	85455	broad.mit.edu	37	15	40662322	40662322	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr15:40662322C>T	ENST00000267889.3	+	8	4096	c.4009C>T	c.(4009-4011)Cgg>Tgg	p.R1337W	LINC00594_ENST00000561261.1_lincRNA|RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	1337					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)		p.R1337W(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CAATGGGAAGCGGGACACCCT	0.632																																																1	Substitution - Missense(1)	ovary(1)	15											87.0	91.0	90.0					15																	40662322		2203	4300	6503	38449614	SO:0001583	missense	85455			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.4009C>T	15.37:g.40662322C>T	ENSP00000267889:p.Arg1337Trp	Somatic		Capture	Illumina GAIIx	Phase_I	38449614	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	ENST00000267889.3	37	CCDS10056.1	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578940	0.65878	.	.	ENSG00000140323	ENST00000267889	T	0.33216	1.42	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.42743	0.1216	L	0.34521	1.04	0.53688	D	0.999979	D	0.89917	1.0	D	0.91635	0.999	T	0.31138	-0.9954	10	0.87932	D	0	-30.3382	11.3479	0.49571	0.3078:0.6922:0.0:0.0	.	1337	A7MBM2	DISP2_HUMAN	W	1337	ENSP00000267889:R1337W	ENSP00000267889:R1337W	R	+	1	2	DISP2	38449614	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.483000	0.53194	2.600000	0.87896	0.561000	0.74099	CGG		0.632	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
FOXB1	27023	broad.mit.edu	37	15	60297434	60297434	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr15:60297434C>G	ENST00000396057.4	+	2	751	c.272C>G	c.(271-273)cCa>cGa	p.P91R	FOXB1_ENST00000560857.1_Intron	NM_012182.2	NP_036314.2	Q99853	FOXB1_HUMAN	forkhead box B1	91					axon target recognition (GO:0007412)|cell migration in diencephalon (GO:0061381)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|floor plate development (GO:0033504)|hypothalamus cell migration (GO:0021855)|inferior colliculus development (GO:0061379)|lactation (GO:0007595)|mammary gland lobule development (GO:0061377)|mammillary body development (GO:0021767)|mammillothalamic axonal tract development (GO:0061374)|midbrain development (GO:0030901)|negative regulation of neuron apoptotic process (GO:0043524)|somitogenesis (GO:0001756)|spinal cord development (GO:0021510)|telencephalon cell migration (GO:0022029)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|visual learning (GO:0008542)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P91R(1)		central_nervous_system(1)|kidney(1)|lung(3)|ovary(1)	6						GCGCTGCACCCAAGCTGCGGG	0.647																																																1	Substitution - Missense(1)	ovary(1)	15											44.0	47.0	46.0					15																	60297434		2203	4298	6501	58084726	SO:0001583	missense	27023			AF055080	CCDS32255.1	15q22.2	2014-09-09			ENSG00000171956	ENSG00000171956		"""Forkhead boxes"""	3799	protein-coding gene	gene with protein product							Standard	NM_012182		Approved	HFKH-5, FKH5	uc002agj.1	Q99853	OTTHUMG00000172011	ENST00000396057.4:c.272C>G	15.37:g.60297434C>G	ENSP00000379369:p.Pro91Arg	Somatic		Capture	Illumina GAIIx	Phase_I	58084726	O60652|O75917|Q14CL2	Missense_Mutation	SNP	ENST00000396057.4	37	CCDS32255.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.122134	0.77436	.	.	ENSG00000171956	ENST00000396057	D	0.95853	-3.83	3.63	3.63	0.41609	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.64402	U	0.000001	D	0.98030	0.9351	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98985	1.0806	10	0.87932	D	0	.	14.0321	0.64622	0.0:1.0:0.0:0.0	.	91	Q99853	FOXB1_HUMAN	R	91	ENSP00000379369:P91R	ENSP00000379369:P91R	P	+	2	0	FOXB1	58084726	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.604000	0.82830	1.838000	0.53458	0.650000	0.86243	CCA		0.647	FOXB1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416378.1		
SV2B	9899	broad.mit.edu	37	15	91801658	91801658	+	Silent	SNP	C	C	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr15:91801658C>T	ENST00000394232.1	+	5	1262	c.792C>T	c.(790-792)ggC>ggT	p.G264G	SV2B_ENST00000545111.2_Silent_p.G113G|SV2B_ENST00000330276.4_Silent_p.G264G	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	264					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.G264G(1)		NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			CAGGCTGGGGCTTCAGCATGG	0.532																																																1	Substitution - coding silent(1)	ovary(1)	15											142.0	109.0	120.0					15																	91801658		2198	4298	6496	89602662	SO:0001819	synonymous_variant	9899			AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.792C>T	15.37:g.91801658C>T		Somatic		Capture	Illumina GAIIx	Phase_I	89602662	B4DH30|C6G489|O94840|Q6IAR8	Silent	SNP	ENST00000394232.1	37	CCDS10370.1																																																																																				0.532	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848	
GSG1L	146395	broad.mit.edu	37	16	27840263	27840263	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr16:27840263G>A	ENST00000447459.2	-	5	761	c.677C>T	c.(676-678)tCc>tTc	p.S226F	GSG1L_ENST00000395724.3_Missense_Mutation_p.S175F|GSG1L_ENST00000380897.3_Missense_Mutation_p.S71F|GSG1L_ENST00000380898.2_Missense_Mutation_p.S71F|GSG1L_ENST00000569166.1_Missense_Mutation_p.S71F	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	226					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S71F(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						GCAGGTAAAGGAGCCCCACGC	0.562																																																1	Substitution - Missense(1)	ovary(1)	16											53.0	42.0	46.0					16																	27840263		2197	4300	6497	27747764	SO:0001583	missense	146395			AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.677C>T	16.37:g.27840263G>A	ENSP00000394954:p.Ser226Phe	Somatic		Capture	Illumina GAIIx	Phase_I	27747764	Q7Z6F8|Q8TB81	Missense_Mutation	SNP	ENST00000447459.2	37	CCDS45450.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782985	0.90282	.	.	ENSG00000169181	ENST00000447459;ENST00000395724;ENST00000380898;ENST00000380897	T;T;D;D	0.90133	0.74;0.94;-2.62;-2.62	5.25	5.25	0.73442	.	0.060277	0.64402	D	0.000002	D	0.94640	0.8272	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.78314	0.988;0.982;0.991	D	0.94788	0.7959	10	0.59425	D	0.04	-17.9935	17.6134	0.88061	0.0:0.0:1.0:0.0	.	175;71;226	Q6UXU4-3;Q6UXU4-4;Q6UXU4	.;.;GSG1L_HUMAN	F	226;175;71;71	ENSP00000394954:S226F;ENSP00000379074:S175F;ENSP00000370283:S71F;ENSP00000370282:S71F	ENSP00000370282:S71F	S	-	2	0	GSG1L	27747764	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.998000	0.88491	2.459000	0.83118	0.655000	0.94253	TCC		0.562	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433832.2	NM_144675	
TP53	7157	broad.mit.edu	37	17	7578268	7578268	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr17:7578268A>C	ENST00000269305.4	-	6	770	c.581T>G	c.(580-582)cTt>cGt	p.L194R	TP53_ENST00000455263.2_Missense_Mutation_p.L194R|TP53_ENST00000420246.2_Missense_Mutation_p.L194R|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.L194R|TP53_ENST00000445888.2_Missense_Mutation_p.L194R|TP53_ENST00000413465.2_Missense_Mutation_p.L194R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	194	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> F (in sporadic cancers; somatic mutation).|L -> H (in sporadic cancers; somatic mutation).|L -> I (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L194R(47)|p.L194P(8)|p.L194H(8)|p.0?(8)|p.?(6)|p.L101R(5)|p.L62R(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.L194fs*15(1)|p.L194fs*14(1)|p.L101H(1)|p.L194fs*52(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.L62H(1)|p.I195fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACTCGGATAAGATGCTGAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	108	Substitution - Missense(75)|Whole gene deletion(8)|Deletion - Frameshift(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Insertion - Frameshift(1)|Complex - frameshift(1)	breast(19)|lung(14)|ovary(14)|large_intestine(11)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(6)|oesophagus(6)|biliary_tract(5)|skin(5)|bone(4)|upper_aerodigestive_tract(3)|stomach(3)|central_nervous_system(2)|pancreas(2)|liver(2)|soft_tissue(1)|prostate(1)	17											97.0	87.0	90.0					17																	7578268		2203	4300	6503	7518993	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.581T>G	17.37:g.7578268A>C	ENSP00000269305:p.Leu194Arg	Somatic		Capture	Illumina GAIIx	Phase_I	7518993	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.029856	0.54790	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.984;1.0;1.0;1.0;1.0	D	0.96375	0.9277	10	0.87932	D	0	-29.6709	13.709	0.62656	1.0:0.0:0.0:0.0	.	155;194;194;101;194;194;194	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	194;194;194;194;194;194;183;101;62;101;62	ENSP00000410739:L194R;ENSP00000352610:L194R;ENSP00000269305:L194R;ENSP00000398846:L194R;ENSP00000391127:L194R;ENSP00000391478:L194R;ENSP00000425104:L62R;ENSP00000423862:L101R	ENSP00000269305:L194R	L	-	2	0	TP53	7518993	1.000000	0.71417	0.300000	0.25030	0.031000	0.12232	9.287000	0.95975	2.183000	0.69458	0.533000	0.62120	CTT		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
LIG3	3980	broad.mit.edu	37	17	33313103	33313103	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr17:33313103C>T	ENST00000378526.4	+	3	777	c.644C>T	c.(643-645)gCc>gTc	p.A215V	LIG3_ENST00000262327.5_Missense_Mutation_p.A215V|LIG3_ENST00000586407.1_3'UTR	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	215					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)	p.A128V(1)		endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	GTGAAAGGCGCCTCATTTGTC	0.448								Other BER factors																																								1	Substitution - Missense(1)	ovary(1)	17											156.0	151.0	153.0					17																	33313103		2203	4300	6503	30337216	SO:0001583	missense	3980				CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.644C>T	17.37:g.33313103C>T	ENSP00000367787:p.Ala215Val	Somatic		Capture	Illumina GAIIx	Phase_I	30337216	Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	37	CCDS11284.2	.	.	.	.	.	.	.	.	.	.	C	9.633	1.136831	0.21123	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.62232	0.17;0.04	5.81	4.84	0.62591	.	0.581380	0.17225	N	0.182176	T	0.42585	0.1209	N	0.15975	0.35	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.003;0.002;0.001	T	0.11817	-1.0572	10	0.19147	T	0.46	-4.6544	11.6738	0.51417	0.0:0.9195:0.0:0.0805	.	215;215;215;215	E5KLB5;P49916;E5KLB6;Q96DF0	.;DNLI3_HUMAN;.;.	V	215	ENSP00000367787:A215V;ENSP00000262327:A215V	ENSP00000262327:A215V	A	+	2	0	LIG3	30337216	0.013000	0.17824	0.033000	0.17914	0.012000	0.07955	2.627000	0.46469	2.746000	0.94184	0.655000	0.94253	GCC		0.448	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975	
MYL4	4635	broad.mit.edu	37	17	45299066	45299066	+	Missense_Mutation	SNP	T	T	C			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr17:45299066T>C	ENST00000354968.1	+	5	460	c.332T>C	c.(331-333)cTg>cCg	p.L111P	MYL4_ENST00000572316.1_Missense_Mutation_p.L111P|snoU13_ENST00000516279.1_RNA|MYL4_ENST00000393450.1_Missense_Mutation_p.L111P	NM_001002841.1	NP_001002841.1	P12829	MYL4_HUMAN	myosin, light chain 4, alkali; atrial, embryonic	111					cardiac muscle contraction (GO:0060048)|muscle filament sliding (GO:0030049)|positive regulation of ATPase activity (GO:0032781)|regulation of the force of heart contraction (GO:0002026)	A band (GO:0031672)|cytosol (GO:0005829)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|calcium ion binding (GO:0005509)|myosin II heavy chain binding (GO:0032038)	p.L111P(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)	11						GTCAAGATGCTGGACTTTGAG	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											164.0	140.0	148.0					17																	45299066		2203	4300	6503	42654065	SO:0001583	missense	4635				CCDS11510.1	17q21.32	2013-09-19	2006-09-29		ENSG00000198336	ENSG00000198336		"""Myosins / Light chain"", ""EF-hand domain containing"""	7585	protein-coding gene	gene with protein product	"""myosin, atrial/fetal muscle, light chain"""	160770	"""myosin, light polypeptide 4, alkali; atrial, embryonic"""			3417683	Standard	NM_002476		Approved	ALC1, AMLC, GT1, PRO1957	uc002ilg.3	P12829	OTTHUMG00000178232	ENST00000354968.1:c.332T>C	17.37:g.45299066T>C	ENSP00000347055:p.Leu111Pro	Somatic		Capture	Illumina GAIIx	Phase_I	42654065	D3DXJ7|P11783	Missense_Mutation	SNP	ENST00000354968.1	37	CCDS11510.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.328565	0.81690	.	.	ENSG00000198336	ENST00000354968;ENST00000393450	D;D	0.82433	-1.61;-1.61	5.23	5.23	0.72850	EF-hand-like domain (1);	0.110120	0.43416	D	0.000575	D	0.91663	0.7365	M	0.91090	3.175	0.80722	D	1	D	0.65815	0.995	P	0.62014	0.897	D	0.93343	0.6711	10	0.87932	D	0	-14.7868	13.3507	0.60601	0.0:0.0:0.0:1.0	.	111	P12829	MYL4_HUMAN	P	111	ENSP00000347055:L111P;ENSP00000377096:L111P	ENSP00000347055:L111P	L	+	2	0	MYL4	42654065	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.920000	0.87521	2.086000	0.62901	0.454000	0.30748	CTG		0.542	MYL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441059.1	NM_001002841	
LAMA1	284217	broad.mit.edu	37	18	6992560	6992560	+	Splice_Site	SNP	T	T	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr18:6992560T>G	ENST00000389658.3	-	36	5261	c.5168A>C	c.(5167-5169)aAg>aCg	p.K1723T		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1723	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)	p.K1723T(1)		NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGAAACTTACTTGAGTTCAAG	0.423																																																1	Substitution - Missense(1)	ovary(1)	18											161.0	142.0	148.0					18																	6992560		2203	4300	6503	6982560	SO:0001630	splice_region_variant	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5168+1A>C	18.37:g.6992560T>G		Somatic		Capture	Illumina GAIIx	Phase_I	6982560		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	T	12.43	1.934452	0.34096	.	.	ENSG00000101680	ENST00000389658	T	0.11604	2.76	5.5	4.31	0.51392	Laminin I (1);	0.342461	0.30473	N	0.009556	T	0.15478	0.0373	M	0.61703	1.905	0.58432	D	0.999994	P	0.44521	0.837	B	0.43867	0.434	T	0.01591	-1.1317	9	.	.	.	.	12.2054	0.54348	0.0:0.0:0.1429:0.8571	.	1723	P25391	LAMA1_HUMAN	T	1723	ENSP00000374309:K1723T	.	K	-	2	0	LAMA1	6982560	1.000000	0.71417	1.000000	0.80357	0.321000	0.28281	1.974000	0.40559	0.898000	0.36418	0.383000	0.25322	AAG		0.423	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	Missense_Mutation
ZNF236	7776	broad.mit.edu	37	18	74637432	74637432	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr18:74637432G>A	ENST00000253159.8	+	22	4141	c.3943G>A	c.(3943-3945)Gtt>Att	p.V1315I	ZNF236_ENST00000320610.9_Missense_Mutation_p.V1317I	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1315					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V1315I(1)		NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GAACAACTCTGTTCTAACAGG	0.502																																																1	Substitution - Missense(1)	ovary(1)	18											75.0	73.0	74.0					18																	74637432		1996	4170	6166	72766420	SO:0001583	missense	7776			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.3943G>A	18.37:g.74637432G>A	ENSP00000253159:p.Val1315Ile	Somatic		Capture	Illumina GAIIx	Phase_I	72766420	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.198279	0.79015	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.11495	2.77;2.96	4.53	4.53	0.55603	.	0.000000	0.64402	D	0.000001	T	0.22898	0.0553	L	0.34521	1.04	0.54753	D	0.999989	D	0.64830	0.994	D	0.72625	0.978	T	0.02144	-1.1206	10	0.34782	T	0.22	.	17.6314	0.88109	0.0:0.0:1.0:0.0	.	1315	Q9UL36	ZN236_HUMAN	I	1315	ENSP00000253159:V1315I;ENSP00000444524:V1315I	ENSP00000253159:V1315I	V	+	1	0	ZNF236	72766420	1.000000	0.71417	0.104000	0.21259	0.523000	0.34469	9.190000	0.94934	2.216000	0.71823	0.557000	0.71058	GTT		0.502	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
CEACAM8	1088	broad.mit.edu	37	19	43093708	43093708	+	Silent	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr19:43093708G>A	ENST00000244336.5	-	3	705	c.604C>T	c.(604-606)Cta>Tta	p.L202L	LIPE-AS1_ENST00000594688.1_RNA|LIPE-AS1_ENST00000594624.2_RNA|CEACAM8_ENST00000599005.1_Intron	NM_001816.3	NP_001807.2	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 8	202	Ig-like C2-type 1.				immune response (GO:0006955)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.L202L(1)		endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	16		Prostate(69;0.00899)				ACACTGAGTAGAGTGAGGGTC	0.522																																																1	Substitution - coding silent(1)	ovary(1)	19											272.0	243.0	253.0					19																	43093708		2203	4300	6503	47785548	SO:0001819	synonymous_variant	1088			D90064	CCDS12610.1	19q13.2	2013-01-29			ENSG00000124469	ENSG00000124469		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1820	protein-coding gene	gene with protein product		615747		CGM6		2208113, 2306228	Standard	NM_001816		Approved	CD66b	uc002oud.2	P31997	OTTHUMG00000151124	ENST00000244336.5:c.604C>T	19.37:g.43093708G>A		Somatic		Capture	Illumina GAIIx	Phase_I	47785548	O60399|Q16574	Silent	SNP	ENST00000244336.5	37	CCDS12610.1																																																																																				0.522	CEACAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321430.1		
LTBP1	4052	broad.mit.edu	37	2	33590523	33590523	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr2:33590523G>A	ENST00000404816.2	+	31	5017	c.4664G>A	c.(4663-4665)gGa>gAa	p.G1555E	LTBP1_ENST00000402934.1_Missense_Mutation_p.G1174E|LTBP1_ENST00000390003.4_Missense_Mutation_p.G1230E|LTBP1_ENST00000407925.1_Missense_Mutation_p.G1229E|LTBP1_ENST00000272273.5_Missense_Mutation_p.G453E|LTBP1_ENST00000418533.2_Missense_Mutation_p.G1187E|LTBP1_ENST00000354476.3_Missense_Mutation_p.G1556E|LTBP1_ENST00000404525.1_Missense_Mutation_p.G1176E			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1555	TB 4.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.G1556E(1)		breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TGTCTGTATGGAGAGGCCTGG	0.537																																																1	Substitution - Missense(1)	ovary(1)	2											114.0	107.0	110.0					2																	33590523		2203	4300	6503	33444027	SO:0001583	missense	4052				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.4664G>A	2.37:g.33590523G>A	ENSP00000386043:p.Gly1555Glu	Somatic		Capture	Illumina GAIIx	Phase_I	33444027	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	G	31	5.079442	0.94050	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000272273	D;D;D;D;D;D;D;D	0.97352	-4.35;-4.35;-4.35;-4.35;-4.35;-4.35;-4.35;-4.35	5.52	5.52	0.82312	Matrix fibril-associated (3);TGF-beta binding (1);	.	.	.	.	D	0.98883	0.9622	M	0.92833	3.35	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D	0.99572	1.0971	9	0.87932	D	0	.	19.4505	0.94865	0.0:0.0:1.0:0.0	.	453;1555;1187;1176;1229;1230;1556	E7EUU6;Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	.;LTBP1_HUMAN;.;.;.;.;.	E	1555;1556;1230;1187;1174;1176;1229;453	ENSP00000386043:G1555E;ENSP00000346467:G1556E;ENSP00000374653:G1230E;ENSP00000393057:G1187E;ENSP00000384373:G1174E;ENSP00000385359:G1176E;ENSP00000384091:G1229E;ENSP00000272273:G453E	ENSP00000272273:G453E	G	+	2	0	LTBP1	33444027	1.000000	0.71417	0.901000	0.35422	0.987000	0.75469	9.756000	0.98918	2.597000	0.87782	0.655000	0.94253	GGA		0.537	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
SLC20A1	6574	broad.mit.edu	37	2	113414816	113414816	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr2:113414816A>T	ENST00000272542.3	+	6	1315	c.776A>T	c.(775-777)gAa>gTa	p.E259V	SLC20A1_ENST00000480984.1_3'UTR	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	259					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)	p.E259V(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						AGAAAAATTGAACGTAAGTAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											115.0	115.0	115.0					2																	113414816		2203	4300	6503	113131287	SO:0001583	missense	6574				CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.776A>T	2.37:g.113414816A>T	ENSP00000272542:p.Glu259Val	Somatic		Capture	Illumina GAIIx	Phase_I	113131287	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	ENST00000272542.3	37	CCDS2099.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.32|16.32	3.089883|3.089883	0.55968|0.55968	.|.	.|.	ENSG00000144136|ENSG00000144136	ENST00000272542;ENST00000409095|ENST00000433924	D|.	0.91068|.	-2.78|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.136165|.	0.64402|.	D|.	0.000004|.	T|.	0.58750|.	0.2144|.	L|L	0.39147|0.39147	1.195|1.195	0.58432|0.58432	D|D	0.99999|0.99999	B;B|.	0.29955|.	0.263;0.263|.	B;B|.	0.33121|.	0.158;0.158|.	T|.	0.55685|.	-0.8102|.	10|.	0.29301|.	T|.	0.29|.	-26.9741|-26.9741	14.0542|14.0542	0.64756|0.64756	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	259;259|.	A7LNJ1;Q8WUM9|.	.;S20A1_HUMAN|.	V|C	259;71|84	ENSP00000272542:E259V|.	ENSP00000272542:E259V|.	E|X	+|+	2|3	0|0	SLC20A1|SLC20A1	113131287|113131287	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.187000|7.187000	0.77730|0.77730	2.210000|2.210000	0.71456|0.71456	0.533000|0.533000	0.62120|0.62120	GAA|TGA		0.378	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
OLA1	29789	broad.mit.edu	37	2	175006591	175006591	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr2:175006591C>G	ENST00000409546.1	-	5	1201	c.571G>C	c.(571-573)Gct>Cct	p.A191P	OLA1_ENST00000428402.2_Missense_Mutation_p.A171P|OLA1_ENST00000284719.3_Missense_Mutation_p.A171P|OLA1_ENST00000344357.5_Missense_Mutation_p.A13P					Obg-like ATPase 1									p.A171P(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						CCTCTCACAGCCACCTTTTCT	0.303																																																1	Substitution - Missense(1)	ovary(1)	2											92.0	91.0	91.0					2																	175006591		2203	4299	6502	174714837	SO:0001583	missense	29789				CCDS2255.1, CCDS42779.1	2q31.1	2014-06-24	2007-07-27	2007-07-27	ENSG00000138430	ENSG00000138430			28833	protein-coding gene	gene with protein product		611175	"""GTP-binding protein 9 (putative)"""	GTPBP9		17430889, 24486488	Standard	NM_013341		Approved	PTD004	uc002uih.3	Q9NTK5	OTTHUMG00000132335	ENST00000409546.1:c.571G>C	2.37:g.175006591C>G	ENSP00000386350:p.Ala191Pro	Somatic		Capture	Illumina GAIIx	Phase_I	174714837		Missense_Mutation	SNP	ENST00000409546.1	37		.	.	.	.	.	.	.	.	.	.	C	16.70	3.196030	0.58126	.	.	ENSG00000138430	ENST00000284719;ENST00000344357;ENST00000428402;ENST00000409546;ENST00000429575	T;T;T;T	0.49720	2.16;2.16;0.77;2.16	5.72	5.72	0.89469	TGS-like domain (1);	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	M	0.82716	2.605	0.80722	D	1	B;B;B;B	0.28258	0.205;0.022;0.003;0.022	B;B;B;B	0.27170	0.077;0.076;0.023;0.076	T	0.59915	-0.7364	10	0.66056	D	0.02	.	19.8622	0.96787	0.0:1.0:0.0:0.0	.	171;171;13;171	Q9NTK5-3;D7EHM2;Q9NTK5-2;Q9NTK5	.;.;.;OLA1_HUMAN	P	171;13;171;191;13	ENSP00000284719:A171P;ENSP00000340167:A13P;ENSP00000410385:A171P;ENSP00000386350:A191P	ENSP00000284719:A171P	A	-	1	0	OLA1	174714837	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.442000	0.80503	2.691000	0.91804	0.591000	0.81541	GCT		0.303	OLA1-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333877.1	NM_013341	
ANKRD44	91526	broad.mit.edu	37	2	197878307	197878307	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr2:197878307C>G	ENST00000328737.2	-	18	1853	c.1777G>C	c.(1777-1779)Gcg>Ccg	p.A593P	ANKRD44_ENST00000282272.8_Missense_Mutation_p.A610P|ANKRD44_ENST00000337207.5_Missense_Mutation_p.A593P|ANKRD44_ENST00000450567.1_Missense_Mutation_p.A593P			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	618								p.A593P(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTGATAAGCGCTTCCACACAT	0.507																																																1	Substitution - Missense(1)	ovary(1)	2											221.0	209.0	213.0					2																	197878307		2203	4300	6503	197586552	SO:0001583	missense	91526			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.1777G>C	2.37:g.197878307C>G	ENSP00000331516:p.Ala593Pro	Somatic		Capture	Illumina GAIIx	Phase_I	197586552	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Missense_Mutation	SNP	ENST00000328737.2	37		.	.	.	.	.	.	.	.	.	.	C	19.96	3.922618	0.73213	.	.	ENSG00000065413	ENST00000424317;ENST00000282272;ENST00000328737;ENST00000450567;ENST00000337207;ENST00000422886	T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	4.43	4.43	0.53597	.	0.060668	0.64402	D	0.000003	T	0.79209	0.4407	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80096	-0.1525	10	0.41790	T	0.15	.	17.2648	0.87083	0.0:1.0:0.0:0.0	.	636	Q8N8A2-2	.	P	433;610;593;593;593;293	ENSP00000403415:A433P;ENSP00000282272:A610P;ENSP00000331516:A593P;ENSP00000402420:A593P;ENSP00000338794:A593P;ENSP00000416319:A293P	ENSP00000282272:A610P	A	-	1	0	ANKRD44	197586552	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	3.024000	0.49674	2.294000	0.77228	0.655000	0.94253	GCG		0.507	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000335113.1	NM_153697	
SP140	11262	broad.mit.edu	37	2	231175500	231175500	+	Silent	SNP	G	G	C			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr2:231175500G>C	ENST00000392045.3	+	24	2331	c.2217G>C	c.(2215-2217)ccG>ccC	p.P739P	SP140_ENST00000420434.3_Silent_p.P712P|SP140_ENST00000350136.5_Silent_p.P608P|SP140_ENST00000486687.2_Silent_p.P663P|SP140_ENST00000343805.6_Silent_p.P679P|SP140_ENST00000417495.3_Silent_p.P625P	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	739					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P739P(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AGGAGTCTCCGGGAAGCCAAC	0.537																																																1	Substitution - coding silent(1)	ovary(1)	2											7.0	7.0	7.0					2																	231175500		1767	3995	5762	230883744	SO:0001819	synonymous_variant	11262			U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.2217G>C	2.37:g.231175500G>C		Somatic		Capture	Illumina GAIIx	Phase_I	230883744	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Silent	SNP	ENST00000392045.3	37	CCDS42831.1																																																																																				0.537	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
SOGA1	140710	broad.mit.edu	37	20	35444192	35444192	+	Silent	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr20:35444192G>A	ENST00000357779.3	-	5	1265	c.939C>T	c.(937-939)caC>caT	p.H313H	SOGA1_ENST00000456801.2_Silent_p.H154H|SOGA1_ENST00000279034.6_Silent_p.H313H|SOGA1_ENST00000237536.4_Silent_p.H551H			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	313					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.H551H(1)		endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CGTCCAGCTCGTGCTCCGAGC	0.647																																																1	Substitution - coding silent(1)	ovary(1)	20											15.0	17.0	16.0					20																	35444192		2149	4270	6419	34877606	SO:0001819	synonymous_variant	140710			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.939C>T	20.37:g.35444192G>A		Somatic		Capture	Illumina GAIIx	Phase_I	34877606	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Silent	SNP	ENST00000357779.3	37																																																																																					0.647	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
ZBTB46	140685	broad.mit.edu	37	20	62421516	62421516	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr20:62421516C>A	ENST00000245663.4	-	2	745	c.595G>T	c.(595-597)Gag>Tag	p.E199*	ZBTB46_ENST00000395104.1_Nonsense_Mutation_p.E199*|ZBTB46_ENST00000302995.2_Nonsense_Mutation_p.E199*|ZBTB46_ENST00000480766.1_5'Flank	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	199					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.E199*(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					TCCTGATCCTCTTTCCCGTAG	0.617																																																1	Substitution - Nonsense(1)	ovary(1)	20											51.0	49.0	50.0					20																	62421516		2203	4300	6503	61891960	SO:0001587	stop_gained	140685			AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.595G>T	20.37:g.62421516C>A	ENSP00000245663:p.Glu199*	Somatic		Capture	Illumina GAIIx	Phase_I	61891960	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Nonsense_Mutation	SNP	ENST00000245663.4	37	CCDS13538.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002737	0.93227	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	.	.	.	5.64	5.64	0.86602	.	0.053976	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	18.6907	0.91582	0.0:1.0:0.0:0.0	.	.	.	.	X	199	.	ENSP00000245663:E199X	E	-	1	0	ZBTB46	61891960	1.000000	0.71417	0.942000	0.38095	0.028000	0.11728	7.372000	0.79612	2.674000	0.91012	0.650000	0.86243	GAG		0.617	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
MX2	4600	broad.mit.edu	37	21	42754410	42754410	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr21:42754410G>T	ENST00000330714.3	+	5	835	c.651G>T	c.(649-651)gaG>gaT	p.E217D	MX2_ENST00000543692.1_Missense_Mutation_p.E172D	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	217	Dynamin-type G.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.E217D(1)		breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				CCTCCCCTGAGGTTCCAGACC	0.607																																																1	Substitution - Missense(1)	ovary(1)	21											85.0	78.0	80.0					21																	42754410		2203	4300	6503	41676280	SO:0001583	missense	4600				CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.651G>T	21.37:g.42754410G>T	ENSP00000333657:p.Glu217Asp	Somatic		Capture	Illumina GAIIx	Phase_I	41676280	B7Z5D3|D3DSI7	Missense_Mutation	SNP	ENST00000330714.3	37	CCDS13672.1	.	.	.	.	.	.	.	.	.	.	g	0.013	-1.617630	0.00828	.	.	ENSG00000183486	ENST00000330714;ENST00000543692	D;D	0.96716	-4.1;-3.58	3.54	-3.72	0.04411	Dynamin, GTPase domain (2);	0.322211	0.30989	N	0.008475	T	0.78162	0.4240	N	0.00801	-1.175	0.09310	N	1	B	0.11235	0.004	B	0.17979	0.02	T	0.78677	-0.2111	10	0.02654	T	1	-9.3973	2.8562	0.05573	0.0931:0.3354:0.1712:0.4004	.	217	P20592	MX2_HUMAN	D	217;172	ENSP00000333657:E217D;ENSP00000446017:E172D	ENSP00000333657:E217D	E	+	3	2	MX2	41676280	0.021000	0.18746	0.001000	0.08648	0.493000	0.33554	-0.255000	0.08769	-0.528000	0.06366	-0.979000	0.02580	GAG		0.607	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1	NM_002463	
EFHB	151651	broad.mit.edu	37	3	19921292	19921292	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr3:19921292G>A	ENST00000295824.9	-	13	2494	c.2333C>T	c.(2332-2334)gCa>gTa	p.A778V	EFHB_ENST00000344838.4_Missense_Mutation_p.A648V	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	778							calcium ion binding (GO:0005509)	p.A778V(1)		breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						CAATATCTCTGCAATCTAGAA	0.289																																																1	Substitution - Missense(1)	ovary(1)	3											111.0	109.0	110.0					3																	19921292		2203	4300	6503	19896296	SO:0001583	missense	151651			AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.2333C>T	3.37:g.19921292G>A	ENSP00000295824:p.Ala778Val	Somatic		Capture	Illumina GAIIx	Phase_I	19896296	A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Missense_Mutation	SNP	ENST00000295824.9	37	CCDS33715.2	.	.	.	.	.	.	.	.	.	.	G	17.31	3.356215	0.61293	.	.	ENSG00000163576	ENST00000295824;ENST00000344838	T;T	0.24538	3.16;1.85	5.57	3.74	0.42951	.	0.537720	0.19138	N	0.121749	T	0.24314	0.0589	M	0.61703	1.905	0.26814	N	0.968949	B;P	0.36222	0.047;0.544	B;B	0.33392	0.037;0.163	T	0.08973	-1.0696	9	.	.	.	-0.6437	9.482	0.38906	0.0677:0.0:0.6774:0.2548	.	648;778	Q8N7U6-3;Q8N7U6	.;EFHB_HUMAN	V	778;648	ENSP00000295824:A778V;ENSP00000342263:A648V	.	A	-	2	0	EFHB	19896296	1.000000	0.71417	0.989000	0.46669	0.975000	0.68041	3.607000	0.54102	0.677000	0.31305	0.655000	0.94253	GCA		0.289	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318673.2	NM_144715	
CLDN18	51208	broad.mit.edu	37	3	137717848	137717848	+	Nonsense_Mutation	SNP	C	C	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr3:137717848C>A	ENST00000343735.4	+	1	272	c.138C>A	c.(136-138)taC>taA	p.Y46*		NM_001002026.2	NP_001002026.1	P56856	CLD18_HUMAN	claudin 18	46					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.A91D(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6						TTTTCAACTACCAGGGGCTGT	0.587																																																1	Substitution - Missense(1)	ovary(1)	3											109.0	100.0	103.0					3																	137717848		2203	4300	6503	139200538	SO:0001587	stop_gained	51208			AF221069, AY102073	CCDS3095.1, CCDS33862.1	3q	2008-08-27			ENSG00000066405	ENSG00000066405		"""Claudins"""	2039	protein-coding gene	gene with protein product		609210	"""surfactant associated protein J"""	SFTPJ			Standard	NM_001002026		Approved		uc003ero.1	P56856	OTTHUMG00000159762	ENST00000343735.4:c.138C>A	3.37:g.137717848C>A	ENSP00000340939:p.Tyr46*	Somatic		Capture	Illumina GAIIx	Phase_I	139200538	A5PL21|Q96PH4	Nonsense_Mutation	SNP	ENST00000343735.4	37	CCDS33862.1	.	.	.	.	.	.	.	.	.	.	C	36	5.932889	0.97116	.	.	ENSG00000066405	ENST00000343735	.	.	.	4.28	0.462	0.16695	.	0.075151	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	9.8274	0.40921	0.0:0.7035:0.0:0.2964	.	.	.	.	X	46	.	ENSP00000340939:Y46X	Y	+	3	2	CLDN18	139200538	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	1.364000	0.34171	0.196000	0.20367	0.563000	0.77884	TAC		0.587	CLDN18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357198.2	NM_001002026	
TLR6	10333	broad.mit.edu	37	4	38829758	38829758	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr4:38829758C>G	ENST00000381950.1	-	1	1402	c.1337G>C	c.(1336-1338)aGa>aCa	p.R446T	TLR6_ENST00000436693.2_Missense_Mutation_p.R446T			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	446					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.R446T(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGGTAAACATCTGAAAACAGA	0.363																																																1	Substitution - Missense(1)	ovary(1)	4											119.0	128.0	125.0					4																	38829758		2203	4300	6503	38506153	SO:0001583	missense	10333				CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.1337G>C	4.37:g.38829758C>G	ENSP00000371376:p.Arg446Thr	Somatic		Capture	Illumina GAIIx	Phase_I	38506153	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	ENST00000381950.1	37	CCDS3446.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684241	0.47991	.	.	ENSG00000174130	ENST00000436693;ENST00000381950	T;T	0.51817	0.69;0.69	5.14	5.14	0.70334	.	0.229670	0.39020	N	0.001495	T	0.47303	0.1438	M	0.65975	2.015	0.30697	N	0.750666	B	0.21309	0.054	B	0.25987	0.065	T	0.55786	-0.8086	10	0.87932	D	0	.	10.2453	0.43336	0.0:0.8708:0.0:0.1292	.	446	Q9Y2C9	TLR6_HUMAN	T	446	ENSP00000389600:R446T;ENSP00000371376:R446T	ENSP00000371376:R446T	R	-	2	0	TLR6	38506153	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.521000	0.45563	2.392000	0.81423	0.484000	0.47621	AGA		0.363	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250431.1		
FGA	2243	broad.mit.edu	37	4	155506887	155506887	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr4:155506887G>T	ENST00000302053.3	-	5	1772	c.1694C>A	c.(1693-1695)cCt>cAt	p.P565H	FGA_ENST00000403106.3_Missense_Mutation_p.P565H	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	565					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)	p.P565H(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	AGCTATCCCAGGGTGATGAGA	0.433																																					NSCLC(143;340 1922 20892 22370 48145)											1	Substitution - Missense(1)	ovary(1)	4											94.0	91.0	92.0					4																	155506887		2203	4300	6503	155726337	SO:0001583	missense	2243				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1694C>A	4.37:g.155506887G>T	ENSP00000306361:p.Pro565His	Somatic		Capture	Illumina GAIIx	Phase_I	155726337	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	G	2.541	-0.306281	0.05458	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.56275	0.47;2.92	4.46	-1.41	0.08941	.	20.600900	0.00166	N	0.000000	T	0.35278	0.0926	N	0.24115	0.695	0.09310	N	1	B;B	0.33448	0.412;0.07	B;B	0.34385	0.181;0.06	T	0.09618	-1.0666	10	0.13108	T	0.6	.	4.6513	0.12596	0.5887:0.1533:0.2579:0.0	.	565;565	P02671-2;P02671	.;FIBA_HUMAN	H	565	ENSP00000306361:P565H;ENSP00000385981:P565H	ENSP00000306361:P565H	P	-	2	0	FGA	155726337	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.636000	0.24644	-0.131000	0.11578	-0.768000	0.03414	CCT		0.433	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
PAIP1	10605	broad.mit.edu	37	5	43539094	43539094	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr5:43539094C>A	ENST00000306846.3	-	5	1010	c.778G>T	c.(778-780)Gat>Tat	p.D260Y	PAIP1_ENST00000514514.1_Missense_Mutation_p.D181Y|PAIP1_ENST00000436644.2_Missense_Mutation_p.D181Y|PAIP1_ENST00000338972.4_Missense_Mutation_p.D148Y	NM_006451.4|NM_182789.3	NP_006442.2|NP_877590.1	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	260	MIF4G.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	RNA binding (GO:0003723)|translation activator activity (GO:0008494)	p.D260Y(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Lung NSC(6;2.07e-05)					GTAACTTCATCCCCTTTTGCA	0.323																																																1	Substitution - Missense(1)	ovary(1)	5											157.0	149.0	151.0					5																	43539094		2203	4300	6503	43574851	SO:0001583	missense	10605			AF013758	CCDS3947.1, CCDS3948.1, CCDS47204.1	5p12	2008-02-05			ENSG00000172239	ENSG00000172239			16945	protein-coding gene	gene with protein product		605184				9548260, 11230166	Standard	NM_006451		Approved		uc003job.3	Q9H074	OTTHUMG00000096960	ENST00000306846.3:c.778G>T	5.37:g.43539094C>A	ENSP00000302768:p.Asp260Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	43574851	A6NKV8|O60455|Q96B61|Q9BS63	Missense_Mutation	SNP	ENST00000306846.3	37	CCDS3947.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937812	0.92458	.	.	ENSG00000172239	ENST00000306846;ENST00000436644;ENST00000338972;ENST00000514514;ENST00000511321;ENST00000508537	T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84	5.98	5.98	0.97165	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.56529	0.1991	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.56848	-0.7911	10	0.87932	D	0	-31.1594	20.4561	0.99145	0.0:1.0:0.0:0.0	.	181;260;181	D6REB4;Q9H074;Q9H074-2	.;PAIP1_HUMAN;.	Y	260;181;148;181;148;148	ENSP00000302768:D260Y;ENSP00000387729:D181Y;ENSP00000339622:D148Y;ENSP00000425084:D181Y;ENSP00000425675:D148Y;ENSP00000425736:D148Y	ENSP00000302768:D260Y	D	-	1	0	PAIP1	43574851	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.597000	0.67577	2.847000	0.97988	0.591000	0.81541	GAT		0.323	PAIP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214024.1	NM_006451	
ITGA1	3672	broad.mit.edu	37	5	52183670	52183670	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr5:52183670G>A	ENST00000282588.6	+	8	1255	c.797G>A	c.(796-798)cGg>cAg	p.R266Q		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	266	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)	p.R266Q(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				ACGGAAGCCCGGGGTGCCCGA	0.398																																																1	Substitution - Missense(1)	ovary(1)	5											92.0	94.0	93.0					5																	52183670		2203	4300	6503	52219427	SO:0001583	missense	3672			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.797G>A	5.37:g.52183670G>A	ENSP00000282588:p.Arg266Gln	Somatic		Capture	Illumina GAIIx	Phase_I	52219427	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	37	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804229	0.90623	.	.	ENSG00000213949	ENST00000282588	D	0.83506	-1.73	5.91	5.03	0.67393	von Willebrand factor, type A (3);	0.123359	0.52532	D	0.000064	T	0.68659	0.3025	N	0.25245	0.725	0.52099	D	0.99994	P	0.38020	0.615	B	0.32090	0.14	T	0.66748	-0.5845	10	0.25751	T	0.34	.	10.8405	0.46712	0.0749:0.1331:0.792:0.0	.	266	P56199	ITA1_HUMAN	Q	266	ENSP00000282588:R266Q	ENSP00000282588:R266Q	R	+	2	0	ITGA1	52219427	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.992000	0.63889	1.493000	0.48517	0.655000	0.94253	CGG		0.398	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
SKIV2L2	23517	broad.mit.edu	37	5	54693247	54693247	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr5:54693247G>C	ENST00000230640.5	+	20	2439	c.2185G>C	c.(2185-2187)Gtc>Ctc	p.V729L	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.V628L	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	729					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.V729L(1)		NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				GTCATAGGTTGTCCCAGTTTT	0.383																																					Melanoma(2;92 134 23744 29976 33782)											1	Substitution - Missense(1)	ovary(1)	5											154.0	145.0	148.0					5																	54693247		2203	4300	6503	54729004	SO:0001583	missense	23517			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.2185G>C	5.37:g.54693247G>C	ENSP00000230640:p.Val729Leu	Somatic		Capture	Illumina GAIIx	Phase_I	54729004	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	37	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154385	0.78114	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.34859	1.34;1.39	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.53834	0.1821	M	0.87971	2.92	0.80722	D	1	B;P	0.45396	0.122;0.857	B;P	0.45406	0.081;0.479	T	0.64123	-0.6481	10	0.62326	D	0.03	-18.3469	19.2769	0.94034	0.0:0.0:1.0:0.0	.	628;729	F5H7E2;P42285	.;SK2L2_HUMAN	L	729;628	ENSP00000230640:V729L;ENSP00000442583:V628L	ENSP00000230640:V729L	V	+	1	0	SKIV2L2	54729004	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.414000	0.80117	2.636000	0.89361	0.655000	0.94253	GTC		0.383	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
IL3	3562	broad.mit.edu	37	5	131398379	131398379	+	Silent	SNP	C	C	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr5:131398379C>A	ENST00000296870.2	+	5	532	c.354C>A	c.(352-354)atC>atA	p.I118I		NM_000588.3	NP_000579.2	P08700	IL3_HUMAN	interleukin 3	118					cell-cell signaling (GO:0007267)|embryonic hemopoiesis (GO:0035162)|immune response (GO:0006955)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-3 receptor binding (GO:0005135)	p.I118I(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)	10		all_cancers(142;7.42e-12)|Lung NSC(810;4.25e-07)|all_lung(232;1.93e-06)|Prostate(281;0.00741)|Breast(839;0.0544)|Lung SC(612;0.122)|Ovarian(839;0.223)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.0161)|Lung(113;0.105)	Amlexanox(DB01025)	CAATCCATATCAAGGACGGTG	0.498											OREG0016762	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	5											146.0	143.0	144.0					5																	131398379		2203	4300	6503	131426278	SO:0001819	synonymous_variant	3562			M14743	CCDS4149.1	5q23-q31	2014-04-04	2014-04-04		ENSG00000164399	ENSG00000164399		"""Interleukins and interleukin receptors"""	6011	protein-coding gene	gene with protein product	"""multilineage-colony-stimulating factor"", ""hematopoietic growth factor"", ""P-cell stimulating factor"", ""mast-cell growth factor"", ""colony-stimulating factor, multiple"""	147740	"""interleukin 3 (colony-stimulating factor, multiple)"""			3489530	Standard	NM_000588		Approved	IL-3, MULTI-CSF, MCGF, MGC79398, MGC79399	uc003kwe.1	P08700	OTTHUMG00000059640	ENST00000296870.2:c.354C>A	5.37:g.131398379C>A		Somatic	1587	Capture	Illumina GAIIx	Phase_I	131426278	Q6GS87	Silent	SNP	ENST00000296870.2	37	CCDS4149.1																																																																																				0.498	IL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132639.1	NM_000588	
PCDHB14	56122	broad.mit.edu	37	5	140603463	140603463	+	Missense_Mutation	SNP	A	A	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr5:140603463A>T	ENST00000239449.4	+	1	386	c.386A>T	c.(385-387)cAc>cTc	p.H129L	PCDHB14_ENST00000515856.2_Intron	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	129	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.H129L(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATAAATGATCACTCCCCTACA	0.418																																					Ovarian(141;50 1831 27899 33809 37648)											1	Substitution - Missense(1)	ovary(1)	5											76.0	84.0	82.0					5																	140603463		2203	4300	6503	140583647	SO:0001583	missense	56122			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.386A>T	5.37:g.140603463A>T	ENSP00000239449:p.His129Leu	Somatic		Capture	Illumina GAIIx	Phase_I	140583647	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	21.2	4.108516	0.77096	.	.	ENSG00000120327	ENST00000239449	T	0.20738	2.05	4.92	4.92	0.64577	Cadherin (1);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.54711	0.1875	H	0.97265	3.97	0.80722	D	1	D	0.52996	0.957	P	0.54401	0.751	T	0.73190	-0.4061	9	0.87932	D	0	.	14.5321	0.67934	1.0:0.0:0.0:0.0	.	129	Q9Y5E9	PCDBE_HUMAN	L	129	ENSP00000239449:H129L	ENSP00000239449:H129L	H	+	2	0	PCDHB14	140583647	0.990000	0.36364	0.991000	0.47740	0.991000	0.79684	9.079000	0.94032	1.971000	0.57363	0.528000	0.53228	CAC		0.418	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
ANKS1A	23294	broad.mit.edu	37	6	34950588	34950588	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr6:34950588A>C	ENST00000360359.3	+	5	930	c.792A>C	c.(790-792)caA>caC	p.Q264H	ANKS1A_ENST00000535627.1_Missense_Mutation_p.Q264H	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	264					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.Q264H(1)		cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						ATGTGGTGCAAATCCTGCTGG	0.557																																																1	Substitution - Missense(1)	ovary(1)	6											158.0	126.0	137.0					6																	34950588		2203	4300	6503	35058566	SO:0001583	missense	23294			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.792A>C	6.37:g.34950588A>C	ENSP00000353518:p.Gln264His	Somatic		Capture	Illumina GAIIx	Phase_I	35058566	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	37	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587815	0.46110	.	.	ENSG00000064999	ENST00000544150;ENST00000360359;ENST00000535627	T;T	0.64618	-0.11;-0.11	5.85	4.67	0.58626	Ankyrin repeat-containing domain (3);	0.000000	0.47852	D	0.000209	T	0.59224	0.2178	L	0.43646	1.37	0.39985	D	0.974977	D;D	0.71674	0.984;0.998	P;D	0.83275	0.827;0.996	T	0.65179	-0.6231	10	0.59425	D	0.04	-3.821	7.192	0.25831	0.7789:0.1478:0.0733:0.0	.	264;264	B4DQW8;Q92625	.;ANS1A_HUMAN	H	264	ENSP00000353518:Q264H;ENSP00000438752:Q264H	ENSP00000353518:Q264H	Q	+	3	2	ANKS1A	35058566	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.234000	0.51320	1.014000	0.39417	0.533000	0.62120	CAA		0.557	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
KLC4	89953	broad.mit.edu	37	6	43039324	43039324	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr6:43039324G>C	ENST00000394056.2	+	11	1770	c.1275G>C	c.(1273-1275)tgG>tgC	p.W425C	KLC4_ENST00000347162.5_Missense_Mutation_p.W425C|RP11-387M24.5_ENST00000606123.1_RNA|KLC4_ENST00000453940.2_Missense_Mutation_p.W348C|KLC4_ENST00000259708.3_Missense_Mutation_p.W443C|KLC4_ENST00000479388.1_Missense_Mutation_p.W425C|KLC4_ENST00000394058.1_Missense_Mutation_p.W425C			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	425						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.W425C(1)		endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			AGCCCATCTGGATGCATGCAG	0.602																																																1	Substitution - Missense(1)	ovary(1)	6											69.0	69.0	69.0					6																	43039324		2203	4300	6503	43147302	SO:0001583	missense	89953			AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1275G>C	6.37:g.43039324G>C	ENSP00000377620:p.Trp425Cys	Somatic		Capture	Illumina GAIIx	Phase_I	43147302	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	37	CCDS4883.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658858	0.67586	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T	0.80994	-1.41;-1.37;-1.44;-1.41;-1.41;-1.41	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000016	D	0.89853	0.6835	M	0.85542	2.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	P;D;D	0.91635	0.876;0.999;0.997	D	0.87789	0.2617	10	0.38643	T	0.18	-18.9835	20.1236	0.97970	0.0:0.0:1.0:0.0	.	348;443;425	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	C	425;348;443;425;425;425	ENSP00000340221:W425C;ENSP00000395806:W348C;ENSP00000259708:W443C;ENSP00000418031:W425C;ENSP00000377620:W425C;ENSP00000377622:W425C	ENSP00000259708:W443C	W	+	3	0	KLC4	43147302	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.858000	0.99539	2.765000	0.95021	0.555000	0.69702	TGG		0.602	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
SP4	6671	broad.mit.edu	37	7	21470026	21470026	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr7:21470026C>G	ENST00000222584.3	+	3	1461	c.1243C>G	c.(1243-1245)Cag>Gag	p.Q415E		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	415					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.Q415E(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GCCTCAGCAACAGATCATTCA	0.468																																																1	Substitution - Missense(1)	ovary(1)	7											110.0	111.0	111.0					7																	21470026		2203	4300	6503	21436551	SO:0001583	missense	6671				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1243C>G	7.37:g.21470026C>G	ENSP00000222584:p.Gln415Glu	Somatic		Capture	Illumina GAIIx	Phase_I	21436551	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179168	0.57800	.	.	ENSG00000105866	ENST00000222584	T	0.15603	2.41	4.68	4.68	0.58851	.	0.279919	0.37304	N	0.002158	T	0.39733	0.1089	M	0.74647	2.275	0.80722	D	1	P	0.49447	0.924	P	0.59424	0.857	T	0.13388	-1.0511	10	0.38643	T	0.18	.	17.7858	0.88538	0.0:1.0:0.0:0.0	.	415	Q02446	SP4_HUMAN	E	415	ENSP00000222584:Q415E	ENSP00000222584:Q415E	Q	+	1	0	SP4	21436551	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.539000	0.67199	2.426000	0.82243	0.467000	0.42956	CAG		0.468	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
HOXA1	3198	broad.mit.edu	37	7	27135134	27135134	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr7:27135134C>T	ENST00000343060.4	-	1	459	c.398G>A	c.(397-399)gGa>gAa	p.G133E	HOTAIRM1_ENST00000429611.3_RNA|HOXA1_ENST00000355633.5_Intron|HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000434063.3_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	133					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.G133E(1)		endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGAGAGATTTCCAGAGTAAAC	0.567																																																1	Substitution - Missense(1)	ovary(1)	7											74.0	78.0	77.0					7																	27135134		2203	4300	6503	27101659	SO:0001583	missense	3198				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.398G>A	7.37:g.27135134C>T	ENSP00000343246:p.Gly133Glu	Somatic		Capture	Illumina GAIIx	Phase_I	27101659	A4D184|B2R8U7|O43363	Missense_Mutation	SNP	ENST00000343060.4	37	CCDS5401.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311849	0.81358	.	.	ENSG00000105991	ENST00000343060	T	0.32753	1.44	4.88	4.88	0.63580	.	0.245352	0.40064	N	0.001189	T	0.57007	0.2024	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61302	-0.7090	10	0.72032	D	0.01	.	16.9571	0.86262	0.0:1.0:0.0:0.0	.	133	P49639	HXA1_HUMAN	E	133	ENSP00000343246:G133E	ENSP00000343246:G133E	G	-	2	0	HOXA1	27101659	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.843000	0.75384	2.543000	0.85770	0.462000	0.41574	GGA		0.567	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358454.1		
NEUROD6	63974	broad.mit.edu	37	7	31378207	31378207	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr7:31378207C>G	ENST00000297142.3	-	2	998	c.676G>C	c.(676-678)Gat>Cat	p.D226H		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	226					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.D226H(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						TTGGAATTATCAAGAGTCCCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	7											106.0	90.0	95.0					7																	31378207		2203	4300	6503	31344732	SO:0001583	missense	63974			AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.676G>C	7.37:g.31378207C>G	ENSP00000297142:p.Asp226His	Somatic		Capture	Illumina GAIIx	Phase_I	31344732	Q548T9|Q9H3H6	Missense_Mutation	SNP	ENST00000297142.3	37	CCDS5434.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.419677	0.42918	.	.	ENSG00000164600	ENST00000297142	T	0.64260	-0.09	5.32	5.32	0.75619	Neurogenic differentiation factor, domain of unknown function (1);	0.222347	0.45126	D	0.000400	T	0.67135	0.2861	M	0.62723	1.935	0.80722	D	1	P	0.41345	0.746	B	0.43809	0.432	T	0.70831	-0.4765	10	0.59425	D	0.04	-14.595	19.0046	0.92844	0.0:1.0:0.0:0.0	.	226	Q96NK8	NDF6_HUMAN	H	226	ENSP00000297142:D226H	ENSP00000297142:D226H	D	-	1	0	NEUROD6	31344732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.572000	0.67411	2.481000	0.83766	0.650000	0.86243	GAT		0.532	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728	
BCL7B	9275	broad.mit.edu	37	7	72966511	72966511	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr7:72966511T>A	ENST00000223368.2	-	2	577	c.154A>T	c.(154-156)Aca>Tca	p.T52S	BCL7B_ENST00000482231.1_5'UTR|BCL7B_ENST00000411832.1_Missense_Mutation_p.T52S	NM_001707.3	NP_001698.2	Q9BQE9	BCL7B_HUMAN	B-cell CLL/lymphoma 7B	52							actin binding (GO:0003779)	p.T52S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	9		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTGCTGTCTGTCACAGGAACC	0.388																																																1	Substitution - Missense(1)	ovary(1)	7											112.0	110.0	110.0					7																	72966511		2203	4300	6503	72604447	SO:0001583	missense	9275			X89985	CCDS5550.1, CCDS56489.1, CCDS75613.1	7q11.23	2008-07-18			ENSG00000106635	ENSG00000106635			1005	protein-coding gene	gene with protein product		605846				8605326, 9806765	Standard	NM_001707		Approved		uc003tyf.2	Q9BQE9	OTTHUMG00000023412	ENST00000223368.2:c.154A>T	7.37:g.72966511T>A	ENSP00000223368:p.Thr52Ser	Somatic		Capture	Illumina GAIIx	Phase_I	72604447	A8K226|C9JWD3|D3DXF0|O43769|Q13845|Q6ZW75	Missense_Mutation	SNP	ENST00000223368.2	37	CCDS5550.1	.	.	.	.	.	.	.	.	.	.	t	14.53	2.562033	0.45590	.	.	ENSG00000106635	ENST00000223368;ENST00000411832	T	0.42900	0.96	4.83	3.65	0.41850	.	0.234553	0.41294	D	0.000914	T	0.24353	0.0590	N	0.11064	0.09	0.27916	N	0.938447	P;B	0.38617	0.64;0.072	B;B	0.40602	0.334;0.067	T	0.08722	-1.0708	10	0.35671	T	0.21	.	9.1027	0.36678	0.0:0.0947:0.0:0.9053	.	52;52	C9JWD3;Q9BQE9	.;BCL7B_HUMAN	S	52	ENSP00000223368:T52S	ENSP00000223368:T52S	T	-	1	0	BCL7B	72604447	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	1.691000	0.37721	1.925000	0.55765	0.378000	0.23410	ACA		0.388	BCL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252194.1	NM_001707	
KIAA1324L	222223	broad.mit.edu	37	7	86544109	86544109	+	Missense_Mutation	SNP	G	G	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr7:86544109G>T	ENST00000450689.2	-	13	1846	c.1661C>A	c.(1660-1662)aCc>aAc	p.T554N	KIAA1324L_ENST00000297222.6_Missense_Mutation_p.T314N|KIAA1324L_ENST00000490995.1_5'UTR|KIAA1324L_ENST00000444627.1_Missense_Mutation_p.T554N|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.T387N	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	554						integral component of membrane (GO:0016021)		p.T314N(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					GATGATATGGGTGTAAGCTTG	0.318																																																1	Substitution - Missense(1)	ovary(1)	7											202.0	173.0	183.0					7																	86544109		2203	4300	6503	86382045	SO:0001583	missense	222223			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1661C>A	7.37:g.86544109G>T	ENSP00000413445:p.Thr554Asn	Somatic		Capture	Illumina GAIIx	Phase_I	86382045	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	ENST00000450689.2	37	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.0|25.0	4.595586|4.595586	0.86953|0.86953	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314	.|T;T;T;T	.|0.20200	.|2.37;2.15;2.09;2.12	5.95|5.95	5.06|5.06	0.68205|0.68205	.|Growth factor, receptor (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.44973|0.44973	0.1319|0.1319	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	.|D;P;P	.|0.59767	.|0.986;0.928;0.928	.|P;P;P	.|0.61201	.|0.885;0.55;0.55	T|T	0.48364|0.48364	-0.9042|-0.9042	5|10	.|0.62326	.|D	.|0.03	.|.	16.2363|16.2363	0.82377|0.82377	0.0:0.1329:0.8671:0.0|0.0:0.1329:0.8671:0.0	.|.	.|554;314;387	.|A8MWY0;A8MWY0-2;B4DJV3	.|K132L_HUMAN;.;.	Q|N	514|554;314;554;387	.|ENSP00000413445:T554N;ENSP00000297222:T314N;ENSP00000397377:T554N;ENSP00000402390:T387N	.|ENSP00000297222:T314N	H|T	-|-	3|2	2|0	KIAA1324L|KIAA1324L	86382045|86382045	1.000000|1.000000	0.71417|0.71417	0.432000|0.432000	0.26747|0.26747	0.990000|0.990000	0.78478|0.78478	9.150000|9.150000	0.94667|0.94667	1.497000|1.497000	0.48584|0.48584	0.563000|0.563000	0.77884|0.77884	CAC|ACC		0.318	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
CROT	54677	broad.mit.edu	37	7	87027959	87027959	+	Nonstop_Mutation	SNP	A	A	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr7:87027959A>G	ENST00000331536.3	+	18	2023	c.1838A>G	c.(1837-1839)tAg>tGg	p.*613W	CROT_ENST00000419147.2_Nonstop_Mutation_p.*641W	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	0					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)	p.*613W(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	ACTCATCTTTAGAGATGAATC	0.398																																																1	Nonstop extension(1)	ovary(1)	7											86.0	79.0	81.0					7																	87027959		2203	4300	6503	86865895	SO:0001578	stop_lost	54677				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1838A>G	7.37:g.87027959A>G	ENSP00000331981:p.*613Trpext*2	Somatic		Capture	Illumina GAIIx	Phase_I	86865895	A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Nonstop_Mutation	SNP	ENST00000331536.3	37	CCDS5604.1	.	.	.	.	.	.	.	.	.	.	A	17.60	3.430178	0.62844	.	.	ENSG00000005469	ENST00000419147;ENST00000331536	.	.	.	6.08	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0503	0.53503	0.933:0.0:0.067:0.0	.	.	.	.	W	641;613	.	.	X	+	2	0	CROT	86865895	1.000000	0.71417	0.999000	0.59377	0.807000	0.45602	8.095000	0.89535	1.117000	0.41842	0.533000	0.62120	TAG		0.398	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151	
ZNF804B	219578	broad.mit.edu	37	7	88965092	88965092	+	Silent	SNP	A	A	G			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr7:88965092A>G	ENST00000333190.4	+	4	3405	c.2796A>G	c.(2794-2796)gtA>gtG	p.V932V		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	932							metal ion binding (GO:0046872)	p.V932V(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TAGAAAGAGTACAAGCCAAGA	0.408										HNSCC(36;0.09)																																						1	Substitution - coding silent(1)	ovary(1)	7											116.0	123.0	121.0					7																	88965092		2202	4300	6502	88803028	SO:0001819	synonymous_variant	219578			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2796A>G	7.37:g.88965092A>G		Somatic		Capture	Illumina GAIIx	Phase_I	88803028	B2RTV2|Q7Z714|Q96MN7	Silent	SNP	ENST00000333190.4	37	CCDS5613.1																																																																																				0.408	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
DLX5	1749	broad.mit.edu	37	7	96653817	96653817	+	Missense_Mutation	SNP	G	G	C			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr7:96653817G>C	ENST00000222598.4	-	1	592	c.119C>G	c.(118-120)tCt>tGt	p.S40C	DLX5_ENST00000486603.2_Missense_Mutation_p.S40C|DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	40					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.S40C(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GGTAGCTGAAGACTCGGGCAA	0.597																																																1	Substitution - Missense(1)	ovary(1)	7											54.0	58.0	56.0					7																	96653817		2203	4300	6503	96491753	SO:0001583	missense	1749				CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.119C>G	7.37:g.96653817G>C	ENSP00000222598:p.Ser40Cys	Somatic		Capture	Illumina GAIIx	Phase_I	96491753	B7Z4P3|Q9UPL1	Missense_Mutation	SNP	ENST00000222598.4	37	CCDS5647.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442207	0.83993	.	.	ENSG00000105880	ENST00000222598	D	0.90504	-2.68	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.96103	0.8730	M	0.88310	2.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.96798	0.9587	10	0.87932	D	0	-8.6267	18.2087	0.89863	0.0:0.0:1.0:0.0	.	40;40	B7Z4P3;P56178	.;DLX5_HUMAN	C	40	ENSP00000222598:S40C	ENSP00000222598:S40C	S	-	2	0	DLX5	96491753	1.000000	0.71417	0.958000	0.39756	0.839000	0.47603	9.564000	0.98151	2.526000	0.85167	0.561000	0.74099	TCT		0.597	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334371.2		
ABCA1	19	broad.mit.edu	37	9	107599275	107599275	+	Missense_Mutation	SNP	T	T	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr9:107599275T>A	ENST00000374736.3	-	11	1691	c.1297A>T	c.(1297-1299)Atg>Ttg	p.M433L		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	433					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.M433L(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	ACAAGGTCCATTTCTTGGCTG	0.522																																																1	Substitution - Missense(1)	ovary(1)	9											140.0	104.0	116.0					9																	107599275		2203	4300	6503	106639096	SO:0001583	missense	19			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.1297A>T	9.37:g.107599275T>A	ENSP00000363868:p.Met433Leu	Somatic		Capture	Illumina GAIIx	Phase_I	106639096	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	T	18.04	3.535493	0.64972	.	.	ENSG00000165029	ENST00000374736	D	0.84730	-1.89	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.85243	0.5652	M	0.80847	2.515	0.80722	D	1	B	0.20780	0.048	B	0.16289	0.015	T	0.81848	-0.0744	10	0.25751	T	0.34	.	15.7204	0.77705	0.0:0.0:0.0:1.0	.	433	O95477	ABCA1_HUMAN	L	433	ENSP00000363868:M433L	ENSP00000363868:M433L	M	-	1	0	ABCA1	106639096	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.810000	0.62598	2.170000	0.68504	0.533000	0.62120	ATG		0.522	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
USP20	10868	broad.mit.edu	37	9	132632056	132632056	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr9:132632056C>T	ENST00000315480.4	+	14	1656	c.1498C>T	c.(1498-1500)Cca>Tca	p.P500S	USP20_ENST00000358355.1_Missense_Mutation_p.P500S|USP20_ENST00000372429.3_Missense_Mutation_p.P500S			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	500	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.P500S(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				GCCGGCCAAGCCAGGCGCCTG	0.607																																																1	Substitution - Missense(1)	ovary(1)	9											64.0	67.0	66.0					9																	132632056		1925	4116	6041	131671877	SO:0001583	missense	10868			AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.1498C>T	9.37:g.132632056C>T	ENSP00000313811:p.Pro500Ser	Somatic		Capture	Illumina GAIIx	Phase_I	131671877	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Missense_Mutation	SNP	ENST00000315480.4	37	CCDS43892.1	.	.	.	.	.	.	.	.	.	.	C	1.263	-0.615399	0.03663	.	.	ENSG00000136878	ENST00000372429;ENST00000315480;ENST00000358355	T;T;T	0.16457	2.34;2.34;2.34	4.84	3.95	0.45737	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.294826	0.40222	N	0.001143	T	0.08626	0.0214	N	0.25094	0.71	0.33786	D	0.624921	B	0.02656	0.0	B	0.10450	0.005	T	0.19516	-1.0303	10	0.11485	T	0.65	.	4.0476	0.09779	0.1712:0.5955:0.1459:0.0874	.	500	Q9Y2K6	UBP20_HUMAN	S	500	ENSP00000361506:P500S;ENSP00000313811:P500S;ENSP00000351122:P500S	ENSP00000313811:P500S	P	+	1	0	USP20	131671877	0.999000	0.42202	0.993000	0.49108	0.467000	0.32768	0.921000	0.28718	1.402000	0.46780	0.655000	0.94253	CCA		0.607	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054604.2		
ANAPC2	29882	broad.mit.edu	37	9	140074648	140074648	+	Missense_Mutation	SNP	C	C	A			TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr9:140074648C>A	ENST00000323927.2	-	10	1879	c.1875G>T	c.(1873-1875)aaG>aaT	p.K625N		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	625					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.K625N(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GCTGCTCATACTTCTTGCAGT	0.627																																																1	Substitution - Missense(1)	ovary(1)	9											78.0	68.0	71.0					9																	140074648		2203	4300	6503	139194469	SO:0001583	missense	29882			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1875G>T	9.37:g.140074648C>A	ENSP00000314004:p.Lys625Asn	Somatic		Capture	Illumina GAIIx	Phase_I	139194469	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	37	CCDS7033.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.945756	0.34377	.	.	ENSG00000176248	ENST00000323927	T	0.73897	-0.79	4.51	3.37	0.38596	Cullin, N-terminal (1);Cullin homology (3);	0.138131	0.48767	D	0.000166	T	0.62600	0.2441	L	0.40543	1.245	0.44380	D	0.997283	B;B	0.18166	0.026;0.021	B;B	0.20384	0.029;0.017	T	0.57470	-0.7806	10	0.22109	T	0.4	-36.8419	10.714	0.46002	0.0:0.8823:0.0:0.1177	.	625;622	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	N	625	ENSP00000314004:K625N	ENSP00000314004:K625N	K	-	3	2	ANAPC2	139194469	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	1.088000	0.30877	2.058000	0.61347	0.313000	0.20887	AAG		0.627	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	NM_013366	
ADAMTS18	170692	broad.mit.edu	37	16	77401459	77401470	+	In_Frame_Del	DEL	GCCGGGGTAGCC	GCCGGGGTAGCC	-	rs141796905|rs113746494		TCGA-25-2401-01A-01W-0799-08	TCGA-25-2401-10A-01W-0799-08	GCCGGGGTAGCC	GCCGGGGTAGCC	-	-	GCCGGGGTAGCC	GCCGGGGTAGCC	Unknown	Valid	Somatic	Phase_I	WXS	Illumina_Capture			Illumina GAIIx	22ec28a8-514c-47ec-baf8-2d9aa77036d9	aeaddbe0-52da-487c-a700-7f557396da3a	g.chr16:77401459_77401470delGCCGGGGTAGCC	ENST00000282849.5	-	4	1064_1075	c.646_657delGGCTACCCCGGC	c.(646-657)ggctaccccggcdel	p.GYPG216del	ADAMTS18_ENST00000567121.1_5'UTR	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	216					eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G219V(1)|p.G216_G219del(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TCCGGCCAGAGCCGGGGTAGCCACGGTACCGC	0.542																																																2	Substitution - Missense(1)|Deletion - In frame(1)	ovary(1)|lung(1)	16																																								75958971	SO:0001651	inframe_deletion	170692			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.646_657delGGCTACCCCGGC	16.37:g.77401459_77401470delGCCGGGGTAGCC	ENSP00000282849:p.Gly216_Gly219del	Somatic		Capture	Illumina GAIIx	Phase_I	75958960	Q6P4R5|Q6ZWJ9	In_Frame_Del	DEL	ENST00000282849.5	37	CCDS10926.1																																																																																				0.542	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
