#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OR14C36	127066	broad.mit.edu	37	1	248512740	248512740	+	Missense_Mutation	SNP	A	A	C			TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr1:248512740A>C	ENST00000317861.1	+	1	664	c.664A>C	c.(664-666)Acc>Ccc	p.T222P		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T222P(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						CATCTTTTCGACCGTGCTCGG	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											192.0	153.0	166.0					1																	248512740		2203	4300	6503	246579363	SO:0001583	missense	127066			BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.664A>C	1.37:g.248512740A>C	ENSP00000324534:p.Thr222Pro	Somatic		Capture	Illumina GAIIx	Phase_I	246579363	Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	37	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	A	10.40	1.340763	0.24339	.	.	ENSG00000177174	ENST00000317861	T	0.00207	8.55	3.91	1.5	0.22942	GPCR, rhodopsin-like superfamily (1);	0.280955	0.25247	N	0.032051	T	0.00666	0.0022	H	0.95816	3.725	0.09310	N	1	D	0.64830	0.994	D	0.71656	0.974	T	0.30001	-0.9993	10	0.87932	D	0	.	7.3069	0.26453	0.6291:0.0:0.3709:0.0	.	222	Q8NHC7	O14CZ_HUMAN	P	222	ENSP00000324534:T222P	ENSP00000324534:T222P	T	+	1	0	OR14C36	246579363	0.000000	0.05858	0.648000	0.29521	0.068000	0.16541	-0.142000	0.10311	0.592000	0.29728	0.324000	0.21423	ACC		0.498	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918	
FAM45A	404636	broad.mit.edu	37	10	120892035	120892035	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr10:120892035G>A	ENST00000361432.2	+	8	837	c.811G>A	c.(811-813)Gca>Aca	p.A271T	FAM45A_ENST00000489988.1_3'UTR|FAM45A_ENST00000544016.1_Missense_Mutation_p.A120T|FAM45A_ENST00000535029.1_3'UTR	NM_207009.2	NP_996892.1	Q8TCE6	FA45A_HUMAN	family with sequence similarity 45, member A	271								p.A271T(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	14		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0293)		AGAGGCCATGGCAATGGGCAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	10											210.0	215.0	213.0					10																	120892035		2203	4300	6503	120882025	SO:0001583	missense	404636			AF168713	CCDS7609.1	10q25	2008-09-04			ENSG00000119979	ENSG00000119979			31793	protein-coding gene	gene with protein product							Standard	NM_207009		Approved			Q8TCE6	OTTHUMG00000019143	ENST00000361432.2:c.811G>A	10.37:g.120892035G>A	ENSP00000354688:p.Ala271Thr	Somatic		Capture	Illumina GAIIx	Phase_I	120882025	B1AMV6|B4DDC3|D3DRC8|Q9NXW4	Missense_Mutation	SNP	ENST00000361432.2	37	CCDS7609.1	.	.	.	.	.	.	.	.	.	.	G	5.812	0.334107	0.11013	.	.	ENSG00000119979	ENST00000361432;ENST00000544016	.	.	.	5.65	1.91	0.25777	.	0.319926	0.38663	N	0.001601	T	0.10465	0.0256	N	0.02225	-0.63	0.31399	N	0.676868	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.06405	0.001;0.001;0.002;0.001	T	0.35992	-0.9766	9	0.02654	T	1	.	5.5851	0.17269	0.7032:0.144:0.1527:0.0	.	198;120;263;271	B4DNL9;B4DMU4;Q8TCE6-2;Q8TCE6	.;.;.;FA45A_HUMAN	T	271;120	.	ENSP00000354688:A271T	A	+	1	0	FAM45A	120882025	1.000000	0.71417	0.955000	0.39395	0.987000	0.75469	1.539000	0.36104	0.067000	0.16545	-0.302000	0.09304	GCA		0.423	FAM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050623.1	NM_207009	
CDKN1B	1027	broad.mit.edu	37	12	12871005	12871005	+	Missense_Mutation	SNP	G	G	A			TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr12:12871005G>A	ENST00000228872.4	+	1	948	c.232G>A	c.(232-234)Gag>Aag	p.E78K	CDKN1B_ENST00000477087.1_Intron|CDKN1B_ENST00000396340.1_Missense_Mutation_p.E78K	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	78					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)	p.E78K(1)		breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		CGAGTGGCAAGAGGTGGAGAA	0.592																																																1	Substitution - Missense(1)	ovary(1)	12											76.0	86.0	82.0					12																	12871005		2203	4300	6503	12762272	SO:0001583	missense	1027			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.232G>A	12.37:g.12871005G>A	ENSP00000228872:p.Glu78Lys	Somatic		Capture	Illumina GAIIx	Phase_I	12762272	Q16307|Q5U0H2|Q9BUS6	Missense_Mutation	SNP	ENST00000228872.4	37	CCDS8653.1	.	.	.	.	.	.	.	.	.	.	G	13.01	2.108103	0.37242	.	.	ENSG00000111276	ENST00000228872;ENST00000535674;ENST00000396340	D;D	0.83335	-1.71;-1.71	5.4	4.49	0.54785	.	0.327017	0.29280	N	0.012602	T	0.65004	0.2650	N	0.10733	0.035	0.30028	N	0.813755	P	0.35124	0.485	B	0.36922	0.236	T	0.60342	-0.7282	10	0.08837	T	0.75	-22.9136	11.439	0.50086	0.0:0.1619:0.7193:0.1187	.	78	P46527	CDN1B_HUMAN	K	78;27;78	ENSP00000228872:E78K;ENSP00000379629:E78K	ENSP00000228872:E78K	E	+	1	0	CDKN1B	12762272	0.995000	0.38212	0.990000	0.47175	0.998000	0.95712	2.443000	0.44881	2.536000	0.85505	0.650000	0.86243	GAG		0.592	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313878.2	NM_004064	
TEX26	122046	broad.mit.edu	37	13	31540436	31540436	+	Nonsense_Mutation	SNP	C	C	T	rs193234818	byFrequency	TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr13:31540436C>T	ENST00000380473.3	+	5	560	c.547C>T	c.(547-549)Cga>Tga	p.R183*	TEX26_ENST00000530916.1_Intron	NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	183								p.R183*(2)									CACTGAATTCCGAAGGAATTA	0.423													C|||	3	0.000599042	0.0	0.0014	5008	,	,		17160	0.0		0.0	False		,,,				2504	0.002															2	Substitution - Nonsense(2)	ovary(1)|lung(1)	13											80.0	77.0	78.0					13																	31540436		2203	4300	6503	30438436	SO:0001587	stop_gained	122046			BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	ENST00000380473.3:c.547C>T	13.37:g.31540436C>T	ENSP00000369840:p.Arg183*	Somatic		Capture	Illumina GAIIx	Phase_I	30438436		Nonsense_Mutation	SNP	ENST00000380473.3	37	CCDS9339.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	25.2	4.615390	0.87359	.	.	ENSG00000175664	ENST00000380473	.	.	.	5.41	3.58	0.41010	.	0.100459	0.42821	D	0.000658	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9032	7.5701	0.27902	0.1625:0.7485:0.0:0.089	.	.	.	.	X	183	.	ENSP00000369840:R183X	R	+	1	2	C13orf26	30438436	1.000000	0.71417	0.988000	0.46212	0.709000	0.40893	1.359000	0.34113	1.410000	0.46936	0.650000	0.86243	CGA		0.423	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325	
UACA	55075	broad.mit.edu	37	15	70959967	70959967	+	Missense_Mutation	SNP	C	C	G			TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr15:70959967C>G	ENST00000322954.6	-	16	3241	c.3056G>C	c.(3055-3057)aGt>aCt	p.S1019T	UACA_ENST00000560441.1_Missense_Mutation_p.S1004T|UACA_ENST00000379983.2_Missense_Mutation_p.S1006T|UACA_ENST00000539319.1_Missense_Mutation_p.S910T	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	1019					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.S1006T(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TTCTTCTTCACTGACACTATA	0.373																																																1	Substitution - Missense(1)	ovary(1)	15											104.0	97.0	100.0					15																	70959967		2199	4297	6496	68747021	SO:0001583	missense	55075			AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.3056G>C	15.37:g.70959967C>G	ENSP00000314556:p.Ser1019Thr	Somatic		Capture	Illumina GAIIx	Phase_I	68747021	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	37	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	C	0.053	-1.245510	0.01481	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.33865	1.39;1.4;1.87	5.82	3.94	0.45596	.	0.499227	0.21524	N	0.073169	T	0.25717	0.0626	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.001	B;B;B;B	0.09377	0.002;0.001;0.001;0.004	T	0.20505	-1.0273	10	0.14252	T	0.57	-4.4818	10.3516	0.43939	0.0:0.791:0.0:0.209	.	910;1019;1019;1006	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	T	1019;1006;910	ENSP00000314556:S1019T;ENSP00000369319:S1006T;ENSP00000438667:S910T	ENSP00000314556:S1019T	S	-	2	0	UACA	68747021	0.000000	0.05858	0.042000	0.18584	0.082000	0.17680	0.130000	0.15850	0.810000	0.34279	0.561000	0.74099	AGT		0.373	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
EFCAB5	374786	broad.mit.edu	37	17	28417568	28417568	+	Silent	SNP	C	C	A			TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr17:28417568C>A	ENST00000394835.3	+	20	4005	c.3813C>A	c.(3811-3813)ggC>ggA	p.G1271G	EFCAB5_ENST00000320856.5_Silent_p.G1147G|RP11-1148O4.2_ENST00000582938.1_RNA|EFCAB5_ENST00000394832.2_Intron	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	1271							calcium ion binding (GO:0005509)	p.G1271G(1)		breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TTAACATCGGCCAAAATAGGA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	17											140.0	137.0	138.0					17																	28417568		1851	4094	5945	25441694	SO:0001819	synonymous_variant	374786			AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.3813C>A	17.37:g.28417568C>A		Somatic		Capture	Illumina GAIIx	Phase_I	25441694	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Silent	SNP	ENST00000394835.3	37	CCDS11254.2																																																																																				0.443	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
ABCA9	10350	broad.mit.edu	37	17	67028402	67028402	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr17:67028402C>T	ENST00000340001.4	-	10	1503	c.1292G>A	c.(1291-1293)cGa>cAa	p.R431Q	ABCA9_ENST00000453985.2_Missense_Mutation_p.R431Q|ABCA9_ENST00000370732.2_Missense_Mutation_p.R431Q	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	431					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.R431Q(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GGGAGAACATCGATGTCCATA	0.438																																																1	Substitution - Missense(1)	ovary(1)	17											90.0	74.0	79.0					17																	67028402		2203	4300	6503	64539997	SO:0001583	missense	10350			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.1292G>A	17.37:g.67028402C>T	ENSP00000342216:p.Arg431Gln	Somatic		Capture	Illumina GAIIx	Phase_I	64539997	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	37	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	C	14.60	2.584033	0.46110	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.88509	-2.21;-2.39	5.05	-2.27	0.06846	.	0.824963	0.09988	N	0.730167	T	0.77772	0.4180	L	0.28014	0.82	0.09310	N	1	B;B	0.23442	0.085;0.025	B;B	0.15870	0.014;0.01	T	0.60596	-0.7232	10	0.23302	T	0.38	.	7.561	0.27851	0.0:0.437:0.1092:0.4538	.	431;431	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	Q	431;414;431;426	ENSP00000342216:R431Q;ENSP00000359767:R431Q	ENSP00000342216:R431Q	R	-	2	0	ABCA9	64539997	0.000000	0.05858	0.001000	0.08648	0.675000	0.39556	-0.903000	0.04084	-0.277000	0.09193	0.609000	0.83330	CGA		0.438	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
HES1	3280	broad.mit.edu	37	3	193855991	193855991	+	Missense_Mutation	SNP	C	C	T			TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr3:193855991C>T	ENST00000232424.3	+	4	1048	c.812C>T	c.(811-813)gCg>gTg	p.A271V		NM_005524.3	NP_005515.1	P30042	ES1_HUMAN	hes family bHLH transcription factor 1	0						mitochondrion (GO:0005739)		p.A271V(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		TCGCTTACGGCGGACTCCATG	0.657																																																1	Substitution - Missense(1)	ovary(1)	3											15.0	17.0	16.0					3																	193855991		2191	4280	6471	195338685	SO:0001583	missense	3280			L19314	CCDS3305.1	3q28-q29	2013-10-17	2013-10-17	2003-01-10	ENSG00000114315	ENSG00000114315		"""Basic helix-loop-helix proteins"""	5192	protein-coding gene	gene with protein product		139605	"""hairy homolog (Drosophila)"", ""hairy and enhancer of split 1, (Drosophila)"""	HRY		8020957	Standard	NM_005524		Approved	FLJ20408, HES-1, Hes1, bHLHb39	uc003ftq.2	Q14469	OTTHUMG00000155984	ENST00000232424.3:c.812C>T	3.37:g.193855991C>T	ENSP00000232424:p.Ala271Val	Somatic		Capture	Illumina GAIIx	Phase_I	195338685	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	ENST00000232424.3	37	CCDS3305.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.224069	0.58668	.	.	ENSG00000114315	ENST00000232424	T	0.60171	0.21	5.39	5.39	0.77823	.	0.583143	0.16604	N	0.207201	T	0.45935	0.1367	L	0.34521	1.04	0.36934	D	0.892057	P	0.36412	0.552	B	0.24006	0.05	T	0.54430	-0.8295	10	0.39692	T	0.17	-27.0657	18.5087	0.90907	0.0:1.0:0.0:0.0	.	271	Q14469	HES1_HUMAN	V	271	ENSP00000232424:A271V	ENSP00000232424:A271V	A	+	2	0	HES1	195338685	0.952000	0.32445	0.999000	0.59377	0.992000	0.81027	4.271000	0.58902	2.682000	0.91365	0.655000	0.94253	GCG		0.657	HES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342632.1		
RICTOR	253260	broad.mit.edu	37	5	38952518	38952518	+	Silent	SNP	T	T	C			TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr5:38952518T>C	ENST00000357387.3	-	30	2937	c.2907A>G	c.(2905-2907)gtA>gtG	p.V969V	RICTOR_ENST00000296782.5_Silent_p.V969V|RICTOR_ENST00000503698.1_5'Flank	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2									p.V969V(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CAAGTACATATACACAGGTCC	0.378																																																1	Substitution - coding silent(1)	ovary(1)	5											61.0	62.0	62.0					5																	38952518		2203	4298	6501	38988275	SO:0001819	synonymous_variant	253260				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2907A>G	5.37:g.38952518T>C		Somatic		Capture	Illumina GAIIx	Phase_I	38988275		Silent	SNP	ENST00000357387.3	37	CCDS34148.1																																																																																				0.378	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
PHF3	23469	broad.mit.edu	37	6	64416112	64416112	+	Silent	SNP	A	A	T			TCGA-25-2408-01A-01W-0799-08	TCGA-25-2408-10A-01W-0799-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2bd1faf5-c689-4c4c-b2bb-e5378031482e	f991bacd-6e6e-4605-8e30-89bf6061c196	g.chr6:64416112A>T	ENST00000262043.3	+	12	3901	c.3561A>T	c.(3559-3561)ccA>ccT	p.P1187P	PHF3_ENST00000393387.1_Silent_p.P1187P			Q92576	PHF3_HUMAN	PHD finger protein 3	1187					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.P1187P(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			CTCCTGCTCCACGGTAATTTT	0.368																																					GBM(135;136 1820 29512 34071 46235)											1	Substitution - coding silent(1)	ovary(1)	6											55.0	52.0	53.0					6																	64416112		2203	4300	6503	64474071	SO:0001819	synonymous_variant	23469			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.3561A>T	6.37:g.64416112A>T		Somatic		Capture	Illumina GAIIx	Phase_I	64474071	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Silent	SNP	ENST00000262043.3	37	CCDS4966.1																																																																																				0.368	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
