#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chrUnknown:0C>T								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								9190	SO:0001628	intergenic_variant	4508																															Unknown.37:g.0C>T		Somatic		Capture	Illumina GAIIx	4	9190		Silent	SNP	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A,PatternScan_ATPASE_A	p.Y221		37	c.663		MT																																																																																			-	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A	0	0					MT-ATP6			C			9190	+1	no_errors	ENST00000361899	ensembl	human	known	54_36p	silent	SNP	NULL	T
DEFB127	140850	genome.wustl.edu	37	20	138225	138225	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr20:138225A>G	ENST00000382388.3	+	1	115	c.40A>G	c.(40-42)Aaa>Gaa	p.K14E		NM_139074.3	NP_620713.1	Q9H1M4	DB127_HUMAN	defensin, beta 127	14					defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)	9		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			GCTGTTCCAGAAACCCACAGG	0.473																																																0			20											108.0	95.0	99.0					20																	138225		2203	4300	6503	86225	SO:0001583	missense	140850			AY358796	CCDS12991.1	20p13	2008-02-01	2002-05-09	2002-05-10	ENSG00000088782	ENSG00000088782		"""Defensins, beta"""	16206	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 73"""	C20orf73		11854508	Standard	NM_139074		Approved	bA530N10.2, DEF-27	uc002wcy.2	Q9H1M4	OTTHUMG00000031617	ENST00000382388.3:c.40A>G	20.37:g.138225A>G	ENSP00000371825:p.Lys14Glu	Somatic		Capture	Illumina GAIIx	4	86225	Q14DW7	Missense_Mutation	SNP	NULL	p.K14E	ENST00000382388.3	37	c.40	CCDS12991.1	20	.	.	.	.	.	.	.	.	.	.	A	11.32	1.603430	0.28534	.	.	ENSG00000088782	ENST00000382388	T	0.14266	2.52	3.48	1.19	0.21007	.	.	.	.	.	T	0.07324	0.0185	.	.	.	0.20403	N	0.999905	B	0.14438	0.01	B	0.10450	0.005	T	0.39663	-0.9603	8	0.27082	T	0.32	-0.0115	3.4882	0.07627	0.6403:0.2353:0.1244:0.0	.	14	Q9H1M4	DB127_HUMAN	E	14	ENSP00000371825:K14E	ENSP00000371825:K14E	K	+	1	0	DEFB127	86225	0.259000	0.24043	0.713000	0.30519	0.990000	0.78478	0.473000	0.22132	0.215000	0.20761	0.533000	0.62120	AAA	-	NULL		0.473	DEFB127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB127	protein_coding	OTTHUMT00000077429.1	A	NM_139074		86225	+1	no_errors	NM_139074	genbank	human	reviewed	54_36p	missense	SNP	0.642	G
PLCXD1	55344	genome.wustl.edu	37	X	207451	207451	+	Intron	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chrX:207451C>T	ENST00000381657.2	+	4	907				PLCXD1_ENST00000399012.1_Intron|PLCXD1_ENST00000381663.3_Intron|PLCXD1_ENST00000484611.2_3'UTR	NM_018390.3	NP_060860.1	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 1						lipid metabolic process (GO:0006629)		phosphoric diester hydrolase activity (GO:0008081)			endometrium(3)|large_intestine(1)|lung(7)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAGGTGCGGCCGGGCTGAGGT	0.677													c|||	2082	0.415735	0.882	0.3012	5008	,	,		13923	0.12		0.3072	False		,,,				2504	0.2832															0			X						T		3534,872		1410,714,79	137.0	118.0	125.0			-2.4	0.0	X	dbSNP_134	125	2646,5944		406,1834,2055	no	intron	PLCXD1	NM_018390.3		1816,2548,2134	TT,TC,CC		30.8033,19.7912,47.5531			207451	6180,6816	2203	4295	6498	147451	SO:0001627	intron_variant	644670			AK002185	CCDS14103.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000182378	ENSG00000182378		"""Pseudoautosomal regions / PAR1"""	23148	protein-coding gene	gene with protein product							Standard	NM_018390		Approved	FLJ11323	uc004cpc.3	Q9NUJ7	OTTHUMG00000022693	ENST00000381657.2:c.393+8C>T	X.37:g.207451C>T		Somatic		Capture	Illumina GAIIx	4	147451	A2BH51|A2BH52	Missense_Mutation	SNP	superfamily_PLC-like phosphodiesterases	p.P619L	ENST00000381657.2	37	c.1856	CCDS14103.1	X																																																																																			-	NULL		0.677	PLCXD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC644670	protein_coding	OTTHUMT00000058879.2	C	NM_018390		147451	+1	no_start_codon:pseudogene:no_stop_codon	XM_497182	genbank	human	model	54_36p	missense	SNP	0.033	T
TBC1D24	57465	genome.wustl.edu	37	16	2546399	2546399	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr16:2546399A>G	ENST00000293970.5	+	2	383	c.250A>G	c.(250-252)Aag>Gag	p.K84E	TBC1D24_ENST00000434757.2_Missense_Mutation_p.K84E|RP11-20I23.1_ENST00000564543.1_Missense_Mutation_p.K84E|TBC1D24_ENST00000567020.1_Missense_Mutation_p.K84E	NM_001199107.1	NP_001186036.1	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	84	Rab-GAP TBC.				neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|terminal bouton (GO:0043195)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)	13						GATCGTGGGCAAGCACAGCAG	0.662																																																0			16											46.0	54.0	51.0					16																	2546399		2159	4269	6428	2486400	SO:0001583	missense	57465			AB032997	CCDS42107.1, CCDS55980.1	16p13.3	2014-05-07				ENSG00000162065			29203	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 6"""	613577	"""deafness, autosomal recessive 86"""	DFNB86		10574461, 24387994, 24729539	Standard	NM_001199107		Approved	KIAA1171, TLDC6, DFNA65	uc002cql.3	Q9ULP9		ENST00000293970.5:c.250A>G	16.37:g.2546399A>G	ENSP00000293970:p.Lys84Glu	Somatic		Capture	Illumina GAIIx	4	2486400	A0JNW3|B9A6M6|Q2KJ08	Missense_Mutation	SNP	HMMSmart_TBC,HMMPfam_TBC,superfamily_RabGAP_TBC,HMMSmart_TLDc,HMMPfam_TLD	p.K84E	ENST00000293970.5	37	c.250	CCDS55980.1	16	.	.	.	.	.	.	.	.	.	.	A	14.56	2.573200	0.45902	.	.	ENSG00000162065	ENST00000293970;ENST00000434757	T;T	0.24151	1.87;1.87	5.6	3.14	0.36123	Rab-GAP/TBC domain (1);	0.094767	0.64402	D	0.000001	T	0.21145	0.0509	L	0.45581	1.43	0.58432	D	0.999994	B;B;B	0.31879	0.344;0.344;0.295	B;B;B	0.28849	0.095;0.095;0.057	T	0.03875	-1.0996	10	0.33940	T	0.23	-41.0914	11.0472	0.47865	0.7045:0.2955:0.0:0.0	.	84;84;84	B9A6M6;Q9ULP9;Q9ULP9-2	.;TBC24_HUMAN;.	E	84	ENSP00000293970:K84E;ENSP00000390106:K84E	ENSP00000293970:K84E	K	+	1	0	TBC1D24	2486400	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	3.974000	0.56852	0.908000	0.36671	0.448000	0.29417	AAG	-	HMMSmart_TBC,HMMPfam_TBC		0.662	TBC1D24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D24	protein_coding	OTTHUMT00000435637.1	A	NM_020705		2486400	+1	no_errors	NM_020705	genbank	human	provisional	54_36p	missense	SNP	1.000	G
MBD3L3	653657	genome.wustl.edu	37	19	7056571	7056571	+	Missense_Mutation	SNP	G	G	T	rs111605618	byFrequency	TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr19:7056571G>T	ENST00000333843.4	-	2	423	c.389C>A	c.(388-390)gCt>gAt	p.A130D		NM_001164425.1	NP_001157897.1	A6NE82	MB3L3_HUMAN	methyl-CpG binding domain protein 3-like 3	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.A130D(1)		central_nervous_system(1)|lung(5)|stomach(1)	7						CTCAGCACCAGCCCTGTCCAG	0.637													-|||	838	0.167332	0.118	0.2522	5008	,	,		41704	0.0417		0.2962	False		,,,				2504	0.1708															1	Substitution - Missense(1)	stomach(1)	19											52.0	62.0	59.0					19																	7056571		692	1591	2283	7007571	SO:0001583	missense	653657				CCDS45944.1	19p13.2	2014-04-01			ENSG00000182315	ENSG00000182315			37205	protein-coding gene	gene with protein product							Standard	NM_001164425		Approved		uc021uns.1	A6NE82	OTTHUMG00000181976	ENST00000333843.4:c.389C>A	19.37:g.7056571G>T	ENSP00000333183:p.Ala130Asp	Somatic		Capture	Illumina GAIIx	4	7007571		Missense_Mutation	SNP	NULL	p.A130D	ENST00000333843.4	37	c.389	CCDS45944.1	19	.	.	.	.	.	.	.	.	.	.	.	3.926	-0.017102	0.07681	.	.	ENSG00000182315	ENST00000333843	.	.	.	0.742	-1.48	0.08745	.	.	.	.	.	T	0.32615	0.0835	L	0.43923	1.385	0.80722	P	0.0	.	.	.	.	.	.	T	0.33752	-0.9856	5	0.42905	T	0.14	-12.4801	2.5805	0.04817	0.2531:0.3037:0.4432:0.0	.	.	.	.	D	130	.	ENSP00000333183:A130D	A	-	2	0	MBD3L3	7007571	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.980000	0.03770	-1.270000	0.02433	-1.511000	0.00944	GCT	-	NULL		0.637	MBD3L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC653657	protein_coding	OTTHUMT00000458500.1	G	NM_001164425		7007571	-1	no_errors	XM_928697	genbank	human	model	54_36p	missense	SNP	0.000	T
PTPRD	5789	genome.wustl.edu	37	9	8484340	8484340	+	Silent	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr9:8484340A>G	ENST00000381196.4	-	27	3735	c.3192T>C	c.(3190-3192)gaT>gaC	p.D1064D	PTPRD_ENST00000356435.5_Silent_p.D1064D|PTPRD_ENST00000397606.3_Silent_p.D643D|PTPRD_ENST00000397611.3_Silent_p.D650D|PTPRD_ENST00000537002.1_Silent_p.D650D|PTPRD_ENST00000358503.5_Silent_p.D1042D|PTPRD_ENST00000486161.1_Silent_p.D653D|PTPRD_ENST00000355233.5_Silent_p.D653D|PTPRD_ENST00000397617.3_Silent_p.D643D|PTPRD_ENST00000360074.4_Silent_p.D1051D|PTPRD_ENST00000540109.1_Silent_p.D1064D|PTPRD_ENST00000471274.1_5'Flank	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1064	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TGGCTCGGCCATCCACTTCTT	0.378										TSP Lung(15;0.13)																																						0			9											79.0	76.0	77.0					9																	8484340		2203	4300	6503	8474340	SO:0001819	synonymous_variant	5789			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.3192T>C	9.37:g.8484340A>G		Somatic		Capture	Illumina GAIIx	4	8474340	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.D1064	ENST00000381196.4	37	c.3192	CCDS43786.1	9																																																																																			-	HMMSmart_SM00060,superfamily_Fibronectin type III		0.378	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	protein_coding	OTTHUMT00000055395.3	A			8474340	-1	no_errors	NM_002839	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
P2RY11	5032	genome.wustl.edu	37	19	10225228	10225228	+	Silent	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr19:10225228C>T	ENST00000321826.4	+	2	1123	c.939C>T	c.(937-939)gcC>gcT	p.A313A	PPAN-P2RY11_ENST00000393796.4_Silent_p.A733A|PPAN_ENST00000556468.1_Silent_p.A733A|PPAN-P2RY11_ENST00000428358.1_3'UTR	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11	313					activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			TGCCCCTGGCCTTCTGTGTCC	0.677																																																0			19											46.0	51.0	49.0					19																	10225228		2203	4300	6503	10086228	SO:0001819	synonymous_variant	5032			AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.939C>T	19.37:g.10225228C>T		Somatic		Capture	Illumina GAIIx	4	10086228	B2R8X9|O43190|Q9BYU4|Q9H170	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A313	ENST00000321826.4	37	c.939	CCDS12226.1	19																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.677	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY11	protein_coding	OTTHUMT00000316664.2	C	NM_002566		10086228	+1	no_errors	NM_002566	genbank	human	reviewed	54_36p	silent	SNP	0.971	T
ZNF653	115950	genome.wustl.edu	37	19	11609109	11609109	+	Splice_Site	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr19:11609109A>G	ENST00000293771.5	-	2	480		c.e2+1		CTC-398G3.6_ENST00000585656.1_Splice_Site|ZNF653_ENST00000593191.1_Splice_Site	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						GCCTCCACTTACTTTTCTTCC	0.617																																					Pancreas(83;980 1446 4542 6441 43352)											0			19											207.0	197.0	200.0					19																	11609109		2203	4300	6503	11470109	SO:0001630	splice_region_variant	115950			AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.343+1T>C	19.37:g.11609109A>G		Somatic		Capture	Illumina GAIIx	4	11470109	Q96AS7	Splice_Site	SNP	-	e2+2	ENST00000293771.5	37	c.343+2	CCDS12261.1	19	.	.	.	.	.	.	.	.	.	.	a	19.00	3.741009	0.69304	.	.	ENSG00000161914	ENST00000293771	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9607	0.53007	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF653	11470109	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.878000	0.63093	1.870000	0.54199	0.454000	0.30748	.	-	-		0.617	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF653	protein_coding	OTTHUMT00000458836.2	A	NM_138783	Intron	11470109	-1	no_errors	NM_138783	genbank	human	provisional	54_36p	splice_site	SNP	1.000	G
HIVEP1	3096	genome.wustl.edu	37	6	12124078	12124078	+	Silent	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr6:12124078C>T	ENST00000379388.2	+	4	4382	c.4050C>T	c.(4048-4050)ggC>ggT	p.G1350G	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1350					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TTCCAGCTGGCTTGAATACTC	0.438																																																0			6											68.0	64.0	65.0					6																	12124078		1902	4128	6030	12232064	SO:0001819	synonymous_variant	3096			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.4050C>T	6.37:g.12124078C>T		Somatic		Capture	Illumina GAIIx	4	12232064	B2RTU3|Q14122|Q5MPB1|Q5VW60	Silent	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.G1350	ENST00000379388.2	37	c.4050	CCDS43426.1	6																																																																																			-	NULL		0.438	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	protein_coding	OTTHUMT00000039870.2	C	NM_002114		12232064	+1	no_errors	NM_002114	genbank	human	validated	54_36p	silent	SNP	0.001	T
OPTN	10133	genome.wustl.edu	37	10	13151183	13151183	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr10:13151183G>C	ENST00000378748.3	+	4	423	c.61G>C	c.(61-63)Gga>Cga	p.G21R	OPTN_ENST00000378764.2_Missense_Mutation_p.G21R|OPTN_ENST00000482140.1_3'UTR|OPTN_ENST00000378757.2_Missense_Mutation_p.G21R|OPTN_ENST00000263036.5_Missense_Mutation_p.G21R|OPTN_ENST00000378747.3_Missense_Mutation_p.G21R|OPTN_ENST00000378752.3_Missense_Mutation_p.G21R	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	21					cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						TGAAAGCACAGGAAATGGACC	0.547																																																0			10											93.0	93.0	93.0					10																	13151183		2203	4300	6503	13191189	SO:0001583	missense	10133			AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.61G>C	10.37:g.13151183G>C	ENSP00000368022:p.Gly21Arg	Somatic		Capture	Illumina GAIIx	4	13191189	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	NULL	p.G21R	ENST00000378748.3	37	c.61	CCDS7094.1	10	.	.	.	.	.	.	.	.	.	.	G	19.82	3.899052	0.72754	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000378747	D;D;D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31;-2.31;-2.31	5.44	5.44	0.79542	.	0.254231	0.45126	D	0.000400	D	0.89626	0.6769	L	0.29908	0.895	0.48975	D	0.999733	D;D	0.89917	0.999;1.0	D;D	0.76575	0.988;0.988	D	0.90614	0.4554	10	0.66056	D	0.02	-22.1983	16.1896	0.81977	0.0:0.0:1.0:0.0	.	21;21	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	R	21	ENSP00000263036:G21R;ENSP00000368040:G21R;ENSP00000368032:G21R;ENSP00000368027:G21R;ENSP00000368022:G21R;ENSP00000368021:G21R	ENSP00000263036:G21R	G	+	1	0	OPTN	13191189	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	5.873000	0.69644	2.578000	0.87016	0.313000	0.20887	GGA	-	NULL		0.547	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPTN	protein_coding	OTTHUMT00000046834.1	G	NM_021980		13191189	+1	no_errors	NM_001008211	genbank	human	reviewed	54_36p	missense	SNP	0.997	C
OR7A17	26333	genome.wustl.edu	37	19	14991670	14991670	+	Silent	SNP	C	C	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr19:14991670C>G	ENST00000327462.2	-	1	594	c.498G>C	c.(496-498)ctG>ctC	p.L166L		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					TGCAGAAGGACAGCCACAATA	0.478																																																0			19											101.0	95.0	97.0					19																	14991670		2203	4300	6503	14852670	SO:0001819	synonymous_variant	26333			X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.498G>C	19.37:g.14991670C>G		Somatic		Capture	Illumina GAIIx	4	14852670	Q6IFQ6|Q96R98	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L166	ENST00000327462.2	37	c.498	CCDS12319.1	19																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.478	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A17	protein_coding	OTTHUMT00000466523.1	C	NM_030901		14852670	-1	no_errors	NM_030901	genbank	human	provisional	54_36p	silent	SNP	0.003	G
CCT8L2	150160	genome.wustl.edu	37	22	17072827	17072827	+	Missense_Mutation	SNP	A	A	T	rs34581886		TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr22:17072827A>T	ENST00000359963.3	-	1	873	c.614T>A	c.(613-615)gTg>gAg	p.V205E		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	205					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CAGCGCGCACACCCCAACACG	0.612																																																0			22											66.0	65.0	65.0					22																	17072827		2203	4300	6503	15452827	SO:0001583	missense	150160			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.614T>A	22.37:g.17072827A>T	ENSP00000353048:p.Val205Glu	Somatic		Capture	Illumina GAIIx	4	15452827	A4QPH3|Q9UJS3	Missense_Mutation	SNP	superfamily_GroEL equatorial domain-like,HMMPfam_Cpn60_TCP1,superfamily_GroEL-intermediate domain like,superfamily_GroEL apical domain-like	p.V205E	ENST00000359963.3	37	c.614	CCDS13738.1	22	.	.	.	.	.	.	.	.	.	.	a	13.89	2.372324	0.42003	.	.	ENSG00000198445	ENST00000359963	D	0.81996	-1.56	1.98	1.98	0.26296	.	0.000000	0.32503	U	0.006020	D	0.88858	0.6551	M	0.82323	2.585	0.09310	N	0.999999	D	0.76494	0.999	D	0.77557	0.99	T	0.78448	-0.2200	10	0.87932	D	0	-22.3053	5.9203	0.19078	1.0:0.0:0.0:0.0	.	205	Q96SF2	TCPQM_HUMAN	E	205	ENSP00000353048:V205E	ENSP00000353048:V205E	V	-	2	0	CCT8L2	15452827	0.879000	0.30193	0.076000	0.20297	0.059000	0.15707	3.474000	0.53129	0.922000	0.37019	0.312000	0.20444	GTG	-	superfamily_GroEL equatorial domain-like,HMMPfam_Cpn60_TCP1,superfamily_GroEL-intermediate domain like		0.612	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	protein_coding	OTTHUMT00000280580.1	A			15452827	-1	no_errors	NM_014406	genbank	human	validated	54_36p	missense	SNP	0.016	T
PTPRO	5800	genome.wustl.edu	37	12	15654720	15654720	+	Silent	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr12:15654720G>A	ENST00000281171.4	+	5	1158	c.828G>A	c.(826-828)tcG>tcA	p.S276S	PTPRO_ENST00000543886.1_Silent_p.S276S|PTPRO_ENST00000348962.2_Silent_p.S276S	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	276	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				AAATTCCCTCGGGCAACATTT	0.428																																																0			12											65.0	63.0	64.0					12																	15654720		2203	4300	6503	15545987	SO:0001819	synonymous_variant	5800			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.828G>A	12.37:g.15654720G>A		Somatic		Capture	Illumina GAIIx	4	15545987	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Silent	SNP	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.S276	ENST00000281171.4	37	c.828	CCDS8675.1	12																																																																																			-	NULL		0.428	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	protein_coding	OTTHUMT00000401079.1	G			15545987	+1	no_errors	NM_030667	genbank	human	reviewed	54_36p	silent	SNP	0.119	A
XKR3	150165	genome.wustl.edu	37	22	17280702	17280702	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr22:17280702A>G	ENST00000331428.5	-	3	650	c.548T>C	c.(547-549)aTg>aCg	p.M183T		NM_175878.3	NP_787074.2	Q5GH77	XKR3_HUMAN	XK, Kell blood group complex subunit-related family, member 3	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				ACTGATATACATCTGCAAAAT	0.378																																																0			22											182.0	172.0	175.0					22																	17280702		1888	4106	5994	15660702	SO:0001583	missense	150165			AY989815	CCDS42975.1	22q11.1	2007-01-16	2006-01-12		ENSG00000172967	ENSG00000172967			28778	protein-coding gene	gene with protein product		611674	"""X Kell blood group precursor-related family, member 3"""			16431037	Standard	NM_175878		Approved	MGC57211, XTES	uc002zlv.3	Q5GH77	OTTHUMG00000143726	ENST00000331428.5:c.548T>C	22.37:g.17280702A>G	ENSP00000331704:p.Met183Thr	Somatic		Capture	Illumina GAIIx	4	15660702	B2RPN1|Q52PG8|Q8N7E1	Missense_Mutation	SNP	HMMPfam_XK-related	p.M183T	ENST00000331428.5	37	c.548	CCDS42975.1	22	.	.	.	.	.	.	.	.	.	.	.	4.788	0.146528	0.09134	.	.	ENSG00000172967	ENST00000331428	T	0.62105	0.05	0.945	0.945	0.19543	.	0.389031	0.20776	U	0.085899	T	0.40886	0.1135	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30765	-0.9967	10	0.52906	T	0.07	.	6.1764	0.20447	1.0:0.0:0.0:0.0	.	183	Q5GH77	XKR3_HUMAN	T	183	ENSP00000331704:M183T	ENSP00000331704:M183T	M	-	2	0	XKR3	15660702	0.997000	0.39634	0.001000	0.08648	0.033000	0.12548	1.714000	0.37961	0.727000	0.32360	0.240000	0.17902	ATG	-	HMMPfam_XK-related		0.378	XKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR3	protein_coding	OTTHUMT00000289789.1	A	NM_175878		15660702	-1	no_errors	NM_175878	genbank	human	validated	54_36p	missense	SNP	0.998	G
NOMO3	408050	genome.wustl.edu	37	16	16345869	16345869	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr16:16345869A>T	ENST00000399336.4	+	8	957	c.785A>T	c.(784-786)gAc>gTc	p.D262V	NOMO3_ENST00000538468.1_Missense_Mutation_p.D95V|NOMO3_ENST00000263012.6_Missense_Mutation_p.D262V	NM_001004067.3	NP_001004067.1	P69849	NOMO3_HUMAN	NODAL modulator 3	262						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	8				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		CAGCCCCAAGACGAGAGTCTG	0.502																																																0			16											1.0	1.0	1.0					16																	16345869		105	285	390	16253370	SO:0001583	missense	408050			AK125530	CCDS42123.1	16p13	2004-11-24				ENSG00000103226			25242	protein-coding gene	gene with protein product		609159				15257293	Standard	NM_001004067		Approved		uc002deq.3	P69849	OTTHUMG00000170525	ENST00000399336.4:c.785A>T	16.37:g.16345869A>T	ENSP00000382274:p.Asp262Val	Somatic		Capture	Illumina GAIIx	4	16253370		Missense_Mutation	SNP	superfamily_Starch-binding domain-like,HMMPfam_Cna_B,superfamily_Carboxypeptidase regulatory domain	p.D262V	ENST00000399336.4	37	c.785	CCDS42123.1	16	.	.	.	.	.	.	.	.	.	.	.	15.46	2.839713	0.51057	.	.	ENSG00000103226	ENST00000263012;ENST00000399336;ENST00000538468	T;T;T	0.04194	3.69;3.7;3.68	4.09	4.09	0.47781	.	0.000000	0.85682	D	0.000000	T	0.13927	0.0337	M	0.77820	2.39	0.80722	D	1	D;P;P	0.55800	0.973;0.754;0.903	P;B;B	0.53593	0.73;0.313;0.31	T	0.04930	-1.0917	10	0.30854	T	0.27	-28.2383	12.6128	0.56560	1.0:0.0:0.0:0.0	.	95;262;262	F5H826;P69849;Q5JPE7-2	.;NOMO3_HUMAN;.	V	262;262;95	ENSP00000263012:D262V;ENSP00000382274:D262V;ENSP00000443768:D95V	ENSP00000263012:D262V	D	+	2	0	NOMO3	16253370	1.000000	0.71417	0.381000	0.26106	0.517000	0.34286	7.951000	0.87819	1.645000	0.50612	0.348000	0.21847	GAC	-	superfamily_Carboxypeptidase regulatory domain		0.502	NOMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOMO3	protein_coding	OTTHUMT00000409528.13	A	NM_001004067		16253370	+1	no_errors	NM_001004067	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
FAM134B	54463	genome.wustl.edu	37	5	16572166	16572166	+	Silent	SNP	G	G	A	rs374947524		TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr5:16572166G>A	ENST00000306320.9	-	2	452	c.366C>T	c.(364-366)gtC>gtT	p.V122V		NM_001034850.2	NP_001030022.1	Q9H6L5	F134B_HUMAN	family with sequence similarity 134, member B	122					sensory perception of pain (GO:0019233)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(1)	16						CAAGTATCATGACGGAAATCA	0.328																																																0			5						G		1,3743		0,1,1871	96.0	91.0	93.0		366	4.1	0.1	5		93	0,8210		0,0,4105	no	coding-synonymous	FAM134B	NM_001034850.1		0,1,5976	AA,AG,GG		0.0,0.0267,0.0084		122/498	16572166	1,11953	1872	4105	5977	16625166	SO:0001819	synonymous_variant	54463			BC053326	CCDS43304.1, CCDS43305.1	5p15.1	2014-09-17			ENSG00000154153	ENSG00000154153			25964	protein-coding gene	gene with protein product		613114				19838196, 24327336	Standard	NM_001034850		Approved	FLJ20152	uc003jfs.3	Q9H6L5	OTTHUMG00000161788	ENST00000306320.9:c.366C>T	5.37:g.16572166G>A		Somatic		Capture	Illumina GAIIx	4	16625166	Q69YN8|Q9H6K6|Q9H764|Q9NXM8	Silent	SNP	NULL	p.V122	ENST00000306320.9	37	c.366	CCDS43304.1	5																																																																																			-	NULL		0.328	FAM134B-001	KNOWN	basic|CCDS	protein_coding	FAM134B	protein_coding	OTTHUMT00000366090.1	G	NM_001034850		16625166	-1	no_errors	NM_001034850	genbank	human	validated	54_36p	silent	SNP	0.983	A
OVOL2	58495	genome.wustl.edu	37	20	18022360	18022360	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr20:18022360G>C	ENST00000278780.6	-	3	571	c.329C>G	c.(328-330)aCa>aGa	p.T110R	OVOL2_ENST00000483661.1_5'UTR	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2	110					angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						GCACGTGCCTGTGGTGAACTG	0.622																																																0			20											56.0	43.0	47.0					20																	18022360		2203	4300	6503	17970360	SO:0001583	missense	58495			AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.329C>G	20.37:g.18022360G>C	ENSP00000278780:p.Thr110Arg	Somatic		Capture	Illumina GAIIx	4	17970360	Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	Missense_Mutation	SNP	superfamily_SSF57667,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.T110R	ENST00000278780.6	37	c.329	CCDS13132.1	20	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827960	0.71143	.	.	ENSG00000125850	ENST00000278780	T	0.08546	3.08	5.57	5.57	0.84162	.	0.058365	0.64402	D	0.000003	T	0.15522	0.0374	L	0.36672	1.1	0.58432	D	0.999998	D	0.63880	0.993	P	0.58721	0.844	T	0.04811	-1.0925	10	0.06891	T	0.86	-12.4291	19.5466	0.95300	0.0:0.0:1.0:0.0	.	110	Q9BRP0	OVOL2_HUMAN	R	110	ENSP00000278780:T110R	ENSP00000278780:T110R	T	-	2	0	OVOL2	17970360	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.869000	0.69613	2.624000	0.88883	0.655000	0.94253	ACA	-	NULL		0.622	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVOL2	protein_coding	OTTHUMT00000078148.5	G	NM_021220		17970360	-1	no_errors	NM_021220	genbank	human	validated	54_36p	missense	SNP	0.998	C
UBA52	7311	genome.wustl.edu	37	19	18684529	18684529	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr19:18684529G>A	ENST00000442744.2	+	3	219	c.161G>A	c.(160-162)cGc>cAc	p.R54H	UBA52_ENST00000599551.1_Missense_Mutation_p.R54H|UBA52_ENST00000599595.1_Missense_Mutation_p.R54H|UBA52_ENST00000596273.1_Missense_Mutation_p.R54H|UBA52_ENST00000597451.1_Missense_Mutation_p.R54H|UBA52_ENST00000598780.1_Missense_Mutation_p.R54H|UBA52_ENST00000595158.1_Missense_Mutation_p.R54H|UBA52_ENST00000595683.1_Missense_Mutation_p.R54H|UBA52_ENST00000430157.2_Missense_Mutation_p.R54H|UBA52_ENST00000596304.1_Missense_Mutation_p.R54H|CRLF1_ENST00000594325.1_Intron	NM_001033930.1	NP_001029102.1	P62987	RL40_HUMAN	ubiquitin A-52 residue ribosomal protein fusion product 1	54	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|viral transcription (GO:0019083)|virion assembly (GO:0019068)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(2)	3						GAGGATGGCCGCACTCTCTCA	0.582																																																0			19											55.0	53.0	54.0					19																	18684529		2203	4300	6503	18545529	SO:0001583	missense	7311				CCDS12382.1	19p13.1-p12	2011-04-06			ENSG00000221983	ENSG00000221983		"""L ribosomal proteins"""	12458	protein-coding gene	gene with protein product	"""ribosomal protein L40"", ""ubiquitin-52 amino acid fusion protein"", ""ubiquitin carboxyl extension protein 52"", ""60S ribosomal protein L40"", ""ubiquitin-CEP52"""	191321				8188300	Standard	XM_005260051		Approved	RPL40, CEP52, HUBCEP52, MGC57125, MGC126879, MGC126881, L40	uc002njs.3	P62987		ENST00000442744.2:c.161G>A	19.37:g.18684529G>A	ENSP00000388107:p.Arg54His	Somatic		Capture	Illumina GAIIx	4	18545529	P02248|P02249|P02250|P14793|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	HMMSmart_SM00213,superfamily_Ubiquitin-like,HMMPfam_ubiquitin,PatternScan_UBIQUITIN_1,HMMPfam_Ribosomal_L40e	p.R54H	ENST00000442744.2	37	c.161	CCDS12382.1	19	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575071	0.65878	.	.	ENSG00000221983	ENST00000442744;ENST00000430157	T;T	0.74421	-0.84;-0.84	4.81	4.81	0.61882	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	T	0.70780	0.3263	L	0.55103	1.725	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.69847	-0.5034	10	0.62326	D	0.03	-12.0595	15.3581	0.74443	0.0:0.0:1.0:0.0	.	54	P62987	RL40_HUMAN	H	54	ENSP00000388107:R54H;ENSP00000396910:R54H	ENSP00000396910:R54H	R	+	2	0	UBA52	18545529	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	7.831000	0.86748	2.220000	0.72140	0.462000	0.41574	CGC	-	HMMSmart_SM00213,superfamily_Ubiquitin-like,HMMPfam_ubiquitin		0.582	UBA52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA52	protein_coding	OTTHUMT00000465117.2	G	NM_003333		18545529	+1	no_errors	NM_001033930	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ASXL2	55252	genome.wustl.edu	37	2	25990450	25990450	+	Splice_Site	SNP	A	A	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr2:25990450A>T	ENST00000435504.4	-	8	1069		c.e8+1		ASXL2_ENST00000497092.1_5'Flank|ASXL2_ENST00000272341.4_Splice_Site|ASXL2_ENST00000404843.1_Splice_Site|ASXL2_ENST00000336112.4_Splice_Site			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2						adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGCAAACTTACTGGTATGGA	0.368																																																0			2											103.0	99.0	100.0					2																	25990450		1860	4100	5960	25843954	SO:0001630	splice_region_variant	55252					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.775+1T>A	2.37:g.25990450A>T		Somatic		Capture	Illumina GAIIx	4	25843954	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Splice_Site	SNP	-	e8+2	ENST00000435504.4	37	c.775+2		2	.	.	.	.	.	.	.	.	.	.	A	21.0	4.083699	0.76642	.	.	ENSG00000143970	ENST00000435504;ENST00000336112	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5156	0.67816	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ASXL2	25843954	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	6.682000	0.74528	2.107000	0.64212	0.533000	0.62120	.	-	-		0.368	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	protein_coding	OTTHUMT00000325593.3	A	NM_018263	Intron	25843954	-1	no_errors	NM_018263	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
LRRC3B	116135	genome.wustl.edu	37	3	26751802	26751802	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr3:26751802G>C	ENST00000396641.2	+	2	1231	c.639G>C	c.(637-639)tgG>tgC	p.W213C	AC114877.3_ENST00000446601.1_lincRNA|LRRC3B_ENST00000456208.2_Missense_Mutation_p.W213C|LRRC3B_ENST00000417744.1_Missense_Mutation_p.W213C	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	213						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						TGTTTGGCTGGTTCACTATGG	0.478																																																0			3											78.0	76.0	77.0					3																	26751802		2203	4300	6503	26726806	SO:0001583	missense	116135			AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.639G>C	3.37:g.26751802G>C	ENSP00000379880:p.Trp213Cys	Somatic		Capture	Illumina GAIIx	4	26726806	Q5M8T0	Missense_Mutation	SNP	HMMPfam_LRRNT,HMMSmart_LRRNT,superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRR_TYP	p.W213C	ENST00000396641.2	37	c.639	CCDS2644.1	3	.	.	.	.	.	.	.	.	.	.	G	18.34	3.602078	0.66445	.	.	ENSG00000179796	ENST00000396641;ENST00000417744;ENST00000456208	T;T;T	0.61392	0.11;0.11;0.11	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.78672	0.4320	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78966	-0.1995	10	0.87932	D	0	-8.7385	19.8676	0.96824	0.0:0.0:1.0:0.0	.	213	Q96PB8	LRC3B_HUMAN	C	213	ENSP00000379880:W213C;ENSP00000406370:W213C;ENSP00000394940:W213C	ENSP00000379880:W213C	W	+	3	0	LRRC3B	26726806	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	TGG	-	NULL		0.478	LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC3B	protein_coding	OTTHUMT00000252997.2	G	NM_052953		26726806	+1	no_errors	NM_052953	genbank	human	provisional	54_36p	missense	SNP	1.000	C
ADAMTS1	9510	genome.wustl.edu	37	21	28212677	28212677	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr21:28212677C>G	ENST00000284984.3	-	5	2037	c.1583G>C	c.(1582-1584)tGg>tCg	p.W528S		NM_006988.3	NP_008919.3	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 1	528	Disintegrin.				heart trabecula formation (GO:0060347)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|negative regulation of cell proliferation (GO:0008285)|ovulation from ovarian follicle (GO:0001542)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.W528*(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(20)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	42		Breast(209;0.000962)		Lung(58;0.215)		GCCATCCGCCCACGGGAAGTG	0.522																																																1	Substitution - Nonsense(1)	lung(1)	21											87.0	75.0	79.0					21																	28212677		2203	4300	6503	27134548	SO:0001583	missense	9510			AF060152	CCDS33524.1	21q21.3	2008-05-14	2005-08-19		ENSG00000154734	ENSG00000154734		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	217	protein-coding gene	gene with protein product		605174	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 1"""			10438512	Standard	NM_006988		Approved	C3-C5, METH1, KIAA1346	uc002ymf.3	Q9UHI8	OTTHUMG00000078688	ENST00000284984.3:c.1583G>C	21.37:g.28212677C>G	ENSP00000284984:p.Trp528Ser	Somatic		Capture	Illumina GAIIx	4	27134548	D3DSD5|Q9NSJ8|Q9P2K0|Q9UH83|Q9UP80	Missense_Mutation	SNP	PatternScan_DISINTEGRIN_1,HMMPfam_Pep_M12B_propep,superfamily_SSF55486,HMMPfam_Reprolysin,PatternScan_ZINC_PROTEASE,HMMSmart_ACR,superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1	p.W528S	ENST00000284984.3	37	c.1583	CCDS33524.1	21	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559861	0.86335	.	.	ENSG00000154734	ENST00000284984	T	0.61742	0.08	5.12	5.12	0.69794	ADAM, cysteine-rich (1);	.	.	.	.	T	0.79511	0.4458	M	0.90595	3.13	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.76751	-0.2844	9	0.16420	T	0.52	.	19.1084	0.93307	0.0:1.0:0.0:0.0	.	528	Q9UHI8	ATS1_HUMAN	S	528	ENSP00000284984:W528S	ENSP00000284984:W528S	W	-	2	0	ADAMTS1	27134548	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	7.278000	0.78587	2.820000	0.97059	0.650000	0.86243	TGG	-	HMMSmart_ACR		0.522	ADAMTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS1	protein_coding	OTTHUMT00000171650.2	C			27134548	-1	no_errors	NM_006988	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PTK2B	2185	genome.wustl.edu	37	8	27277469	27277469	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr8:27277469G>C	ENST00000397501.1	+	8	1070	c.262G>C	c.(262-264)Gag>Cag	p.E88Q	PTK2B_ENST00000420218.2_Missense_Mutation_p.E88Q|PTK2B_ENST00000338238.4_Missense_Mutation_p.E88Q|PTK2B_ENST00000517339.1_Missense_Mutation_p.E88Q|PTK2B_ENST00000544172.1_Missense_Mutation_p.E88Q|PTK2B_ENST00000346049.5_Missense_Mutation_p.E88Q	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	88	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	CCGGTTGGCTGAGTGCTATGG	0.587																																																0			8											100.0	84.0	89.0					8																	27277469		2203	4300	6503	27333386	SO:0001583	missense	2185			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.262G>C	8.37:g.27277469G>C	ENSP00000380638:p.Glu88Gln	Somatic		Capture	Illumina GAIIx	4	27333386	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	HMMSmart_SM00295,superfamily_Second domain of FERM,HMMPfam_FERM_M,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,HMMPfam_Focal_AT,superfamily_FAT domain of focal adhesion kinase	p.E88Q	ENST00000397501.1	37	c.262	CCDS6057.1	8	.	.	.	.	.	.	.	.	.	.	G	15.28	2.786368	0.49997	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000521164;ENST00000346049;ENST00000420218;ENST00000522517;ENST00000412793;ENST00000517339	T;T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84;-0.84	5.15	5.15	0.70609	Band 4.1 domain (1);FERM domain (1);	0.297326	0.37577	N	0.002028	T	0.54935	0.1889	N	0.12182	0.205	0.50632	D	0.999884	B;B	0.13145	0.007;0.005	B;B	0.12837	0.008;0.006	T	0.51371	-0.8714	10	0.11182	T	0.66	.	13.996	0.64402	0.0:0.0:1.0:0.0	.	88;88	Q14289-2;Q14289	.;FAK2_HUMAN	Q	88;93;88;88;88;88;88;88;88;88	ENSP00000380638:E88Q;ENSP00000342242:E88Q;ENSP00000440926:E88Q;ENSP00000332816:E88Q;ENSP00000391995:E88Q;ENSP00000427931:E88Q	ENSP00000342242:E88Q	E	+	1	0	PTK2B	27333386	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.913000	0.63341	2.677000	0.91161	0.561000	0.74099	GAG	-	HMMSmart_SM00295		0.587	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	protein_coding	OTTHUMT00000219916.1	G	NM_004103		27333386	+1	no_errors	NM_004103	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
HERC2P10	390561	genome.wustl.edu	37	15	31125022	31125022	+	IGR	SNP	C	C	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr15:31125022C>A								AC004460.1 (31431 upstream) : FAN1 (71032 downstream)																							TGGAATTTGACCGGCAGTGCT	0.552																																																0			15																																								28912314	SO:0001628	intergenic_variant	730909																															15.37:g.31125022C>A		Somatic		Capture	Illumina GAIIx	4	28912314		Missense_Mutation	SNP	NULL	p.D67E		37	c.201		15																																																																																			-	NULL	0	0.552					LOC730909			C			28912314	+1	no_errors	XM_001718721	genbank	human	model	54_36p	missense	SNP	0.997	A
GAL3ST1	9514	genome.wustl.edu	37	22	30951341	30951341	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr22:30951341C>A	ENST00000402321.1	-	3	1188	c.871G>T	c.(871-873)Ggg>Tgg	p.G291W	GAL3ST1_ENST00000406361.1_Missense_Mutation_p.G291W|GAL3ST1_ENST00000401975.1_Missense_Mutation_p.G291W|GAL3ST1_ENST00000406955.1_Missense_Mutation_p.G291W|GAL3ST1_ENST00000443111.2_Missense_Mutation_p.G291W|GAL3ST1_ENST00000402369.1_Missense_Mutation_p.G291W|GAL3ST1_ENST00000338911.5_Missense_Mutation_p.G291W			Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	291					galactosylceramide biosynthetic process (GO:0006682)|glycosphingolipid metabolic process (GO:0006687)|myelination (GO:0042552)|protein N-linked glycosylation (GO:0006487)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21						TACAGCTCCCCCGAGAGCCGC	0.677																																																0			22											27.0	33.0	31.0					22																	30951341		2202	4295	6497	29281341	SO:0001583	missense	9514			D88667	CCDS13879.1	22q12.2	2007-04-02			ENSG00000128242	ENSG00000128242		"""Sulfotransferases, membrane-bound"""	24240	protein-coding gene	gene with protein product	"""cerebroside (3' phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase"""	602300				9847074, 9030544	Standard	NM_004861		Approved	CST	uc003aii.1	Q99999	OTTHUMG00000151200	ENST00000402321.1:c.871G>T	22.37:g.30951341C>A	ENSP00000385735:p.Gly291Trp	Somatic		Capture	Illumina GAIIx	4	29281341	Q96C63	Missense_Mutation	SNP	HMMPfam_Gal-3-0_sulfotr	p.G291W	ENST00000402321.1	37	c.871	CCDS13879.1	22	.	.	.	.	.	.	.	.	.	.	C	10.98	1.505365	0.26949	.	.	ENSG00000128242	ENST00000406955;ENST00000402321;ENST00000402369;ENST00000401975;ENST00000338911;ENST00000406361;ENST00000443111	T;T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38;2.38	5.55	5.55	0.83447	.	0.148894	0.64402	D	0.000017	T	0.40015	0.1100	M	0.66939	2.045	0.38003	D	0.93428	D	0.76494	0.999	D	0.72338	0.977	T	0.35450	-0.9788	10	0.72032	D	0.01	-49.9258	14.4558	0.67416	0.0:0.7437:0.2563:0.0	.	291	Q99999	G3ST1_HUMAN	W	291	ENSP00000385825:G291W;ENSP00000385735:G291W;ENSP00000384122:G291W;ENSP00000384388:G291W;ENSP00000343234:G291W;ENSP00000385207:G291W;ENSP00000402587:G291W	ENSP00000343234:G291W	G	-	1	0	GAL3ST1	29281341	0.178000	0.23122	0.126000	0.21872	0.087000	0.18053	1.824000	0.39072	2.615000	0.88500	0.561000	0.74099	GGG	-	HMMPfam_Gal-3-0_sulfotr		0.677	GAL3ST1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GAL3ST1	protein_coding	OTTHUMT00000321745.1	C	NM_004861		29281341	-1	no_errors	NM_004861	genbank	human	reviewed	54_36p	missense	SNP	0.098	A
SLC44A4	80736	genome.wustl.edu	37	6	31836946	31836946	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr6:31836946A>C	ENST00000229729.6	-	13	1239	c.1219T>G	c.(1219-1221)Tca>Gca	p.S407A	SLC44A4_ENST00000544672.1_Missense_Mutation_p.S331A|SLC44A4_ENST00000375562.4_Missense_Mutation_p.S365A	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	407					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	GGGTTGCATGATGTATTTATT	0.572																																																0			6											101.0	84.0	90.0					6																	31836946		1511	2709	4220	31944925	SO:0001583	missense	80736			AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.1219T>G	6.37:g.31836946A>C	ENSP00000229729:p.Ser407Ala	Somatic		Capture	Illumina GAIIx	4	31944925	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	HMMPfam_DUF580	p.S407A	ENST00000229729.6	37	c.1219	CCDS4724.2	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.06|17.06	3.291402|3.291402	0.59976|0.59976	.|.	.|.	ENSG00000204385|ENSG00000204385	ENST00000414427|ENST00000229729;ENST00000375562;ENST00000544672	.|T;T;T	.|0.11604	.|3.12;2.76;2.96	5.82|5.82	-2.5|-2.5	0.06384|0.06384	.|.	.|1.114660	.|0.06974	.|N	.|0.818621	T|T	0.02571|0.02571	0.0078|0.0078	N|N	0.17474|0.17474	0.49|0.49	0.09310|0.09310	N|N	1|1	.|B	.|0.11235	.|0.004	.|B	.|0.19666	.|0.026	T|T	0.49634|0.49634	-0.8919|-0.8919	5|10	.|0.66056	.|D	.|0.02	-21.1671|-21.1671	12.4694|12.4694	0.55779|0.55779	0.2476:0.0:0.0:0.7524|0.2476:0.0:0.0:0.7524	.|.	.|407	.|Q53GD3	.|CTL4_HUMAN	Q|A	290|407;365;331	.|ENSP00000229729:S407A;ENSP00000364712:S365A;ENSP00000444109:S331A	.|ENSP00000229729:S407A	H|S	-|-	3|1	2|0	SLC44A4|SLC44A4	31944925|31944925	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.577000|0.577000	0.36160|0.36160	0.055000|0.055000	0.14229|0.14229	-0.180000|-0.180000	0.10637|0.10637	0.482000|0.482000	0.46254|0.46254	CAT|TCA	-	HMMPfam_DUF580		0.572	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SLC44A4	protein_coding	OTTHUMT00000076234.3	A			31944925	-1	no_errors	NM_025257	genbank	human	validated	54_36p	missense	SNP	0.000	C
ADAMTS12	81792	genome.wustl.edu	37	5	33643577	33643577	+	Splice_Site	SNP	T	T	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr5:33643577T>C	ENST00000504830.1	-	10	1815		c.e10-2		ADAMTS12_ENST00000352040.3_Splice_Site|ADAMTS12_ENST00000504582.1_Splice_Site	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12						cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GCAGACGTTCTAGAAAACAAA	0.428										HNSCC(64;0.19)																																						0			5											102.0	106.0	105.0					5																	33643577		2203	4300	6503	33679334	SO:0001630	splice_region_variant	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1480-2A>G	5.37:g.33643577T>C		Somatic		Capture	Illumina GAIIx	4	33679334	A2RRN9|A5D6V6|Q6UWL3	Splice_Site	SNP	-	e10-2	ENST00000504830.1	37	c.1480-2	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	T	15.55	2.866358	0.51588	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7244	0.77743	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAMTS12	33679334	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	7.845000	0.86875	2.110000	0.64415	0.379000	0.24179	.	-	-		0.428	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	T	NM_030955	Intron	33679334	-1	no_errors	NM_030955	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
PIK3C3	5289	genome.wustl.edu	37	18	39637943	39637943	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr18:39637943T>C	ENST00000262039.4	+	22	2446	c.2360T>C	c.(2359-2361)aTg>aCg	p.M787T	PIK3C3_ENST00000588156.1_Missense_Mutation_p.M11T|PIK3C3_ENST00000398870.3_Missense_Mutation_p.M724T|PIK3C3_ENST00000593098.1_Missense_Mutation_p.M272T	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	787	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						GTAGAAGGAATGGGGGGCACA	0.468										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)											0			18											79.0	77.0	78.0					18																	39637943		2203	4300	6503	37891941	SO:0001583	missense	5289			Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.2360T>C	18.37:g.39637943T>C	ENSP00000262039:p.Met787Thr	Somatic		Capture	Illumina GAIIx	4	37891941	Q15134	Missense_Mutation	SNP	HMMSmart_C2,HMMSmart_PI3K_C2,superfamily_C2_CaLB,HMMPfam_PI3K_C2,superfamily_ARM-type_fold,HMMSmart_PI3Ka,HMMPfam_PI3Ka,superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2	p.M787T	ENST00000262039.4	37	c.2360	CCDS11920.1	18	.	.	.	.	.	.	.	.	.	.	T	20.4	3.986449	0.74589	.	.	ENSG00000078142	ENST00000262039;ENST00000398870	D;D	0.84589	-1.87;-1.87	5.21	5.21	0.72293	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.037347	0.85682	D	0.000000	D	0.93106	0.7805	M	0.89785	3.06	0.80722	D	1	P;B	0.34892	0.474;0.409	P;P	0.55303	0.773;0.546	D	0.92935	0.6367	9	.	.	.	.	14.7575	0.69576	0.0:0.0:0.0:1.0	.	724;787	A8MYT4;Q8NEB9	.;PK3C3_HUMAN	T	787;724	ENSP00000262039:M787T;ENSP00000381845:M724T	.	M	+	2	0	PIK3C3	37891941	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.633000	0.83260	1.962000	0.57031	0.454000	0.30748	ATG	-	superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc		0.468	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C3	protein_coding	OTTHUMT00000255804.1	T	NM_002647		37891941	+1	no_errors	NM_002647	genbank	human	validated	54_36p	missense	SNP	1.000	C
EPHA10	284656	genome.wustl.edu	37	1	38185713	38185713	+	Silent	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:38185713C>T	ENST00000373048.4	-	14	2429	c.2430G>A	c.(2428-2430)gcG>gcA	p.A810A	EPHA10_ENST00000446149.2_5'UTR|EPHA10_ENST00000540011.1_3'UTR|EPHA10_ENST00000427468.2_Silent_p.A810A|EPHA10_ENST00000330210.7_Silent_p.A305A	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	810	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGGCCCATAGCGCTGGGCTCC	0.632																																																0			1											33.0	37.0	36.0					1																	38185713		2180	4285	6465	37958300	SO:0001819	synonymous_variant	284656			AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.2430G>A	1.37:g.38185713C>T		Somatic		Capture	Illumina GAIIx	4	37958300	A4FU89|J3KPB5|Q6NW42	Silent	SNP	superfamily_Galactose-binding domain-like,HMMPfam_Ephrin_lbd,HMMSmart_SM00615,PatternScan_RECEPTOR_TYR_KIN_V_1,PatternScan_RECEPTOR_TYR_KIN_V_2,PatternScan_EGF_2,superfamily_Fibronectin type III,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_1	p.A810	ENST00000373048.4	37	c.2430	CCDS41305.1	1																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220		0.632	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	EPHA10	protein_coding	OTTHUMT00000012497.2	C	NM_173641		37958300	-1	no_errors	NM_001099439	genbank	human	validated	54_36p	silent	SNP	0.726	T
GUCA1B	2979	genome.wustl.edu	37	6	42156397	42156397	+	Missense_Mutation	SNP	G	G	T	rs147884871		TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr6:42156397G>T	ENST00000230361.3	-	2	375	c.280C>A	c.(280-282)Ctg>Atg	p.L94M		NM_002098.5	NP_002089.4	Q9UMX6	GUC1B_HUMAN	guanylate cyclase activator 1B (retina)	94	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				body fluid secretion (GO:0007589)|cell-cell signaling (GO:0007267)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			large_intestine(3)|lung(3)|skin(2)	8	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)			GTCCACTTCAGCTTGTGCTCC	0.542																																																0			6											143.0	97.0	113.0					6																	42156397		2203	4300	6503	42264375	SO:0001583	missense	2979			AF173227	CCDS4865.1	6p21.1	2013-02-14			ENSG00000112599	ENSG00000112599		"""EF-hand domain containing"""	4679	protein-coding gene	gene with protein product		602275				9119368	Standard	NM_002098		Approved	GCAP2, RP48	uc003orz.3	Q9UMX6	OTTHUMG00000014697	ENST00000230361.3:c.280C>A	6.37:g.42156397G>T	ENSP00000230361:p.Leu94Met	Somatic		Capture	Illumina GAIIx	4	42264375	Q9NU15	Missense_Mutation	SNP	superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1	p.L94M	ENST00000230361.3	37	c.280	CCDS4865.1	6	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327759	0.81690	.	.	ENSG00000112599	ENST00000230361;ENST00000372949	T	0.78924	-1.22	4.87	4.0	0.46444	EF-hand-like domain (1);	0.070231	0.64402	D	0.000015	T	0.80757	0.4684	L	0.60904	1.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83349	-0.0004	10	0.87932	D	0	.	11.4137	0.49939	0.0904:0.0:0.9096:0.0	.	94	Q9UMX6	GUC1B_HUMAN	M	94	ENSP00000230361:L94M	ENSP00000230361:L94M	L	-	1	2	GUCA1B	42264375	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.796000	0.62496	1.353000	0.45828	0.655000	0.94253	CTG	-	superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand		0.542	GUCA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA1B	protein_coding	OTTHUMT00000040550.1	G	NM_002098		42264375	-1	no_errors	NM_002098	genbank	human	validated	54_36p	missense	SNP	1.000	T
KLHL40	131377	genome.wustl.edu	37	3	42727990	42727990	+	Nonsense_Mutation	SNP	G	G	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr3:42727990G>T	ENST00000287777.4	+	1	980	c.880G>T	c.(880-882)Gag>Tag	p.E294*		NM_152393.2	NP_689606.2	Q2TBA0	KLH40_HUMAN	kelch-like family member 40	294					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											CAAAGCAGAGGAGGATGAGGA	0.572																																																0			3											171.0	170.0	170.0					3																	42727990		2203	4300	6503	42702994	SO:0001587	stop_gained	131377			AK056577	CCDS2703.1	3p21.33	2013-07-30	2013-02-22	2013-01-08	ENSG00000157119	ENSG00000157119		"""Kelch-like"", ""BTB/POZ domain containing"""	30372	protein-coding gene	gene with protein product	"""sarcosynapsin"", ""nemaline myopathy type 8"""	615340	"""kelch repeat and BTB (POZ) domain containing 5"", ""kelch-like 40 (Drosophila)"""	KBTBD5		23746549	Standard	NM_152393		Approved	SRYP, NEM8	uc003clv.1	Q2TBA0	OTTHUMG00000133045	ENST00000287777.4:c.880G>T	3.37:g.42727990G>T	ENSP00000287777:p.Glu294*	Somatic		Capture	Illumina GAIIx	4	42702994	Q86SI1|Q96MR2	Nonsense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,PatternScan_MGMT,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612	p.E294*	ENST00000287777.4	37	c.880	CCDS2703.1	3	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307683	0.60305	.	.	ENSG00000157119	ENST00000287777;ENST00000452129	.	.	.	5.09	4.21	0.49690	.	0.697372	0.12398	N	0.472366	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	13.0577	0.58990	0.0774:0.0:0.9226:0.0	.	.	.	.	X	294;39	.	ENSP00000287777:E294X	E	+	1	0	KBTBD5	42702994	1.000000	0.71417	0.028000	0.17463	0.098000	0.18820	4.924000	0.63418	1.161000	0.42604	0.655000	0.94253	GAG	-	NULL		0.572	KLHL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD5	protein_coding	OTTHUMT00000256651.1	G	NM_152393		42702994	+1	no_errors	NM_152393	genbank	human	validated	54_36p	nonsense	SNP	0.605	T
RSPH1	89765	genome.wustl.edu	37	21	43912881	43912881	+	Silent	SNP	T	T	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr21:43912881T>G	ENST00000291536.3	-	3	428	c.261A>C	c.(259-261)ggA>ggC	p.G87G	RSPH1_ENST00000398352.3_Silent_p.G49G	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	87					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						CATATCTGGATCCATCTGGAT	0.333																																					Esophageal Squamous(23;63 706 6286 10288 12913)											0			21											139.0	139.0	139.0					21																	43912881		2203	4300	6503	42785950	SO:0001819	synonymous_variant	89765			AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.261A>C	21.37:g.43912881T>G		Somatic		Capture	Illumina GAIIx	4	42785950	A8MWV0|B2RBN9|Q3MJA1	Silent	SNP	HMMPfam_MORN,superfamily_Histone H3 K4-specific methyltransferase SET7/9 N-terminal domain,HMMSmart_SM00698	p.G87	ENST00000291536.3	37	c.261	CCDS13688.1	21																																																																																			-	superfamily_Histone H3 K4-specific methyltransferase SET7/9 N-terminal domain,HMMPfam_MORN		0.333	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH1	protein_coding	OTTHUMT00000195379.1	T			42785950	-1	no_errors	NM_080860	genbank	human	validated	54_36p	silent	SNP	0.995	G
MYO5B	4645	genome.wustl.edu	37	18	47390737	47390737	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr18:47390737T>G	ENST00000285039.7	-	28	3916	c.3617A>C	c.(3616-3618)gAg>gCg	p.E1206A	MYO5B_ENST00000324581.6_Missense_Mutation_p.E347A|MYO5B_ENST00000587895.1_5'UTR	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1206					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GTTCTCTGACTCCAGCTCTTG	0.582																																																0			18											113.0	124.0	120.0					18																	47390737		1997	4168	6165	45644735	SO:0001583	missense	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3617A>C	18.37:g.47390737T>G	ENSP00000285039:p.Glu1206Ala	Somatic		Capture	Illumina GAIIx	4	45644735	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,HMMPfam_DIL	p.E1206A	ENST00000285039.7	37	c.3617	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	T	26.1	4.707335	0.89018	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.26957	1.7;1.7	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.55545	0.1927	M	0.84683	2.71	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.81914	0.937;0.995	T	0.61613	-0.7027	10	0.54805	T	0.06	.	15.2853	0.73822	0.0:0.0:0.0:1.0	.	1206;347	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	A	1206;347	ENSP00000285039:E1206A;ENSP00000315531:E347A	ENSP00000285039:E1206A	E	-	2	0	MYO5B	45644735	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.020000	0.88740	2.093000	0.63338	0.459000	0.35465	GAG	-	NULL		0.582	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	protein_coding	OTTHUMT00000448515.2	T			45644735	-1	no_errors	NM_001080467	genbank	human	provisional	54_36p	missense	SNP	1.000	G
SLC12A1	6557	genome.wustl.edu	37	15	48539135	48539135	+	Silent	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr15:48539135C>T	ENST00000558405.1	+	11	1496	c.1482C>T	c.(1480-1482)ccC>ccT	p.P494P	SLC12A1_ENST00000396577.3_Silent_p.P494P|SLC12A1_ENST00000380993.3_Silent_p.P494P			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	494					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	GGTTCGGCCCCCTCATCACTG	0.498																																																0			15											285.0	250.0	262.0					15																	48539135		2198	4297	6495	46326427	SO:0001819	synonymous_variant	6557				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.1482C>T	15.37:g.48539135C>T		Somatic		Capture	Illumina GAIIx	4	46326427	A8JYA2|E9PDW4	Silent	SNP	HMMPfam_AA_permease_N,HMMPfam_AA_permease	p.P494	ENST00000558405.1	37	c.1482	CCDS10129.2	15																																																																																			-	HMMPfam_AA_permease		0.498	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC12A1	protein_coding	OTTHUMT00000417131.1	C			46326427	+1	no_errors	NM_000338	genbank	human	validated	54_36p	silent	SNP	0.997	T
COL2A1	1280	genome.wustl.edu	37	12	48379703	48379703	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr12:48379703C>G	ENST00000380518.3	-	24	1737	c.1573G>C	c.(1573-1575)Ggt>Cgt	p.G525R	COL2A1_ENST00000337299.6_Missense_Mutation_p.G456R|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	525	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	ACCTTGGGACCTGCCAGACCA	0.627																																																0			12											45.0	45.0	45.0					12																	48379703		2122	4178	6300	46665970	SO:0001583	missense	1280			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.1573G>C	12.37:g.48379703C>G	ENSP00000369889:p.Gly525Arg	Somatic		Capture	Illumina GAIIx	4	46665970	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1,HMMPfam_Collagen,HMMSmart_SM00038,HMMPfam_COLFI	p.G525R	ENST00000380518.3	37	c.1573	CCDS41778.1	12	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867145	0.91511	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.99637	-6.29;-6.29	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.99782	0.9909	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96988	0.9720	10	0.87932	D	0	.	17.1221	0.86705	0.0:1.0:0.0:0.0	.	456;525	P02458-1;P02458	.;CO2A1_HUMAN	R	525;456;456	ENSP00000369889:G525R;ENSP00000338213:G456R	ENSP00000338213:G456R	G	-	1	0	COL2A1	46665970	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.840000	0.69402	2.572000	0.86782	0.609000	0.83330	GGT	-	HMMPfam_Collagen		0.627	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL2A1	protein_coding	OTTHUMT00000313810.2	C	NM_001844		46665970	-1	no_errors	NM_001844	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SMARCC1	6599	genome.wustl.edu	37	3	47702862	47702862	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr3:47702862A>G	ENST00000254480.5	-	21	2361	c.2242T>C	c.(2242-2244)Tct>Cct	p.S748P	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	748					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		ACTTTCCCAGAGGCTCGTGCT	0.522																																																0			3											108.0	91.0	97.0					3																	47702862		2203	4300	6503	47677866	SO:0001583	missense	6599			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.2242T>C	3.37:g.47702862A>G	ENSP00000254480:p.Ser748Pro	Somatic		Capture	Illumina GAIIx	4	47677866	Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	superfamily_BRCT,HMMSmart_CHROMO,HMMPfam_SWIRM,superfamily_Homeodomain_like,HMMSmart_SANT,HMMPfam_Myb_DNA-binding	p.S748P	ENST00000254480.5	37	c.2242	CCDS2758.1	3	.	.	.	.	.	.	.	.	.	.	A	19.02	3.746054	0.69418	.	.	ENSG00000173473	ENST00000254480	T	0.41065	1.01	5.71	5.71	0.89125	.	0.166180	0.51477	D	0.000100	T	0.42810	0.1219	L	0.48642	1.525	0.37546	D	0.918506	P	0.52692	0.955	P	0.49597	0.616	T	0.45205	-0.9277	10	0.31617	T	0.26	-22.098	9.6373	0.39817	0.9227:0.0:0.0773:0.0	.	748	Q92922	SMRC1_HUMAN	P	748	ENSP00000254480:S748P	ENSP00000254480:S748P	S	-	1	0	SMARCC1	47677866	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.907000	0.56348	2.168000	0.68352	0.528000	0.53228	TCT	-	NULL		0.522	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	protein_coding	OTTHUMT00000257491.1	A			47677866	-1	no_errors	NM_003074	genbank	human	validated	54_36p	missense	SNP	0.998	G
ZNF630	57232	genome.wustl.edu	37	X	47918466	47918466	+	Silent	SNP	T	T	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chrX:47918466T>C	ENST00000409324.3	-	5	1591	c.1365A>G	c.(1363-1365)ggA>ggG	p.G455G	ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000442455.3_Silent_p.G441G|ZNF630_ENST00000276054.4_Silent_p.G331G	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						AAGGTTTTTCTCCTGTATGAA	0.443																																																0			X											62.0	61.0	61.0					X																	47918466		2194	4287	6481	47803410	SO:0001819	synonymous_variant	57232			AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.1365A>G	X.37:g.47918466T>C		Somatic		Capture	Illumina GAIIx	4	47803410	F8WAG4|Q5H8Z5	Silent	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.G331	ENST00000409324.3	37	c.993	CCDS35237.2	X																																																																																			-	superfamily_SSF57667		0.443	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF630	protein_coding	OTTHUMT00000327254.1	T	NM_001037735		47803410	-1	no_errors	NM_001037735	genbank	human	validated	54_36p	silent	SNP	0.998	C
Unknown	0	genome.wustl.edu	37	11	49437301	49437301	+	IGR	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr11:49437301A>G								CTD-2026G22.1 (36080 upstream) : RP11-707M1.1 (145068 downstream)																							CCACTGCTCAAAAATACTGCA	0.353																																																0			11																																								49393877	SO:0001628	intergenic_variant	0																															11.37:g.49437301A>G		Somatic		Capture	Illumina GAIIx	4	49393877		Missense_Mutation	SNP	superfamily_Di-copper_centre	p.F2S		37	c.5		11																																																																																			-	superfamily_Di-copper_centre	0	0.353					TYRL			A			49393877	-1	no_start_codon	ENST00000243152	ensembl	human	known	54_36p	missense	SNP	1.000	G
GRASP	160622	genome.wustl.edu	37	12	52404692	52404692	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr12:52404692T>A	ENST00000293662.4	+	3	404	c.324T>A	c.(322-324)gaT>gaA	p.D108E	GRASP_ENST00000380039.2_5'Flank|GRASP_ENST00000552049.1_5'UTR|GRASP_ENST00000552963.1_3'UTR	NM_181711.2	NP_859062.1	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein	108	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein localization (GO:0008104)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				BRCA - Breast invasive adenocarcinoma(357;0.0967)		AGAAGGAGGATAACCAGACCT	0.542																																																0			12											179.0	166.0	171.0					12																	52404692		2203	4300	6503	50690959	SO:0001583	missense	160622			AC019244	CCDS8817.1, CCDS61124.1	12q13.13	2011-09-02			ENSG00000161835	ENSG00000161835			18707	protein-coding gene	gene with protein product		612027				10828067	Standard	NM_001271856		Approved		uc001rzo.2	Q7Z6J2	OTTHUMG00000169595	ENST00000293662.4:c.324T>A	12.37:g.52404692T>A	ENSP00000293662:p.Asp108Glu	Somatic		Capture	Illumina GAIIx	4	50690959	Q6PIF8|Q7Z741	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.D108E	ENST00000293662.4	37	c.324	CCDS8817.1	12	.	.	.	.	.	.	.	.	.	.	T	14.71	2.616093	0.46631	.	.	ENSG00000161835	ENST00000293662	T	0.25085	1.82	4.91	-3.95	0.04118	PDZ/DHR/GLGF (3);	0.344837	0.32301	N	0.006286	T	0.10165	0.0249	L	0.28504	0.86	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.27054	-1.0085	10	0.12103	T	0.63	-11.9168	0.8238	0.01116	0.2582:0.2895:0.2746:0.1777	.	108	Q7Z6J2	GRASP_HUMAN	E	108	ENSP00000293662:D108E	ENSP00000293662:D108E	D	+	3	2	GRASP	50690959	0.002000	0.14202	0.986000	0.45419	0.995000	0.86356	-1.788000	0.01763	-0.445000	0.07159	0.459000	0.35465	GAT	-	superfamily_PDZ domain-like,HMMPfam_PDZ		0.542	GRASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRASP	protein_coding	OTTHUMT00000404972.1	T			50690959	+1	no_errors	NM_181711	genbank	human	provisional	54_36p	missense	SNP	0.875	A
WDFY2	115825	genome.wustl.edu	37	13	52330520	52330520	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr13:52330520G>A	ENST00000298125.5	+	10	1166	c.986G>A	c.(985-987)cGc>cAc	p.R329H		NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	329							metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		AGCTCCAAGCGCTCCTCCATC	0.572																																																0			13											86.0	82.0	83.0					13																	52330520		2203	4300	6503	51228521	SO:0001583	missense	115825			AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.986G>A	13.37:g.52330520G>A	ENSP00000298125:p.Arg329His	Somatic		Capture	Illumina GAIIx	4	51228521	B1AL86|Q96CS1	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00064,HMMPfam_FYVE	p.R329H	ENST00000298125.5	37	c.986	CCDS9429.1	13	.	.	.	.	.	.	.	.	.	.	G	33	5.215711	0.95104	.	.	ENSG00000139668	ENST00000298125	T	0.45276	0.9	5.4	5.4	0.78164	Zinc finger, RING/FYVE/PHD-type (1);WD40 repeat-like-containing domain (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.045737	0.85682	D	0.000000	T	0.58694	0.2140	M	0.68317	2.08	0.80722	D	1	D	0.71674	0.998	P	0.56788	0.806	T	0.58707	-0.7589	10	0.45353	T	0.12	-16.5538	18.1725	0.89751	0.0:0.0:1.0:0.0	.	329	Q96P53	WDFY2_HUMAN	H	329	ENSP00000298125:R329H	ENSP00000298125:R329H	R	+	2	0	WDFY2	51228521	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.519000	0.84933	0.650000	0.86243	CGC	-	superfamily_WD40 repeat-like,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00064,HMMPfam_FYVE		0.572	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY2	protein_coding	OTTHUMT00000045985.3	G	NM_052950		51228521	+1	no_errors	NM_052950	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MC3R	4159	genome.wustl.edu	37	20	54824285	54824285	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr20:54824285T>A	ENST00000243911.2	+	1	498	c.386T>A	c.(385-387)gTg>gAg	p.V129E		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	129					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			ATCTCCCTGGTGGCCTCCATC	0.562																																																0			20											155.0	124.0	135.0					20																	54824285		2203	4300	6503	54257692	SO:0001583	missense	4159				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.386T>A	20.37:g.54824285T>A	ENSP00000243911:p.Val129Glu	Somatic		Capture	Illumina GAIIx	4	54257692	Q4KN27|Q9H517	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V166E	ENST00000243911.2	37	c.497	CCDS13449.2	20	.	.	.	.	.	.	.	.	.	.	T	22.6	4.304955	0.81247	.	.	ENSG00000124089	ENST00000243911	T	0.19394	2.15	4.98	4.98	0.66077	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	U	0.000038	T	0.46054	0.1373	M	0.74467	2.265	0.54753	D	0.99998	D	0.76494	0.999	D	0.71184	0.972	T	0.50154	-0.8861	10	0.87932	D	0	.	14.3394	0.66614	0.0:0.0:0.0:1.0	.	166	P41968	MC3R_HUMAN	E	129	ENSP00000243911:V129E	ENSP00000243911:V129E	V	+	2	0	MC3R	54257692	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.840000	0.86819	1.855000	0.53841	0.528000	0.53228	GTG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.562	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC3R	protein_coding	OTTHUMT00000079786.2	T			54257692	+1	no_errors	NM_019888	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
NUP62	23636	genome.wustl.edu	37	19	50411693	50411693	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr19:50411693G>C	ENST00000596217.1	-	2	3259	c.1372C>G	c.(1372-1374)Ctg>Gtg	p.L458V	NUP62_ENST00000597723.1_Missense_Mutation_p.L382V|NUP62_ENST00000422090.2_Missense_Mutation_p.L458V|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000597029.1_Missense_Mutation_p.L458V|NUP62_ENST00000413454.1_Missense_Mutation_p.L458V|NUP62_ENST00000352066.3_Missense_Mutation_p.L458V|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000600583.1_5'Flank			P37198	NUP62_HUMAN	nucleoporin 62kDa	458					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GACGTGTTCAGGTGCTCGATG	0.582																																																0			19											166.0	154.0	158.0					19																	50411693		2203	4300	6503	55103505	SO:0001583	missense	23636			X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.1372C>G	19.37:g.50411693G>C	ENSP00000471191:p.Leu458Val	Somatic		Capture	Illumina GAIIx	4	55103505	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Missense_Mutation	SNP	HMMPfam_Nsp1_C	p.L458V	ENST00000596217.1	37	c.1372	CCDS12788.1	19	.	.	.	.	.	.	.	.	.	.	G	17.24	3.340433	0.60963	.	.	ENSG00000213024	ENST00000352066;ENST00000422090;ENST00000413454	T;T;T	0.38722	1.12;1.12;1.12	5.11	1.73	0.24493	Nucleoporin, NSP1-like, C-terminal (1);	0.000000	0.53938	U	0.000046	T	0.30978	0.0782	L	0.45051	1.395	0.51767	D	0.999932	B	0.26744	0.158	B	0.30782	0.12	T	0.04693	-1.0933	9	.	.	.	-6.6156	6.9144	0.24352	0.1633:0.1445:0.6922:0.0	.	458	P37198	NUP62_HUMAN	V	458	ENSP00000305503:L458V;ENSP00000407331:L458V;ENSP00000387991:L458V	.	L	-	1	2	NUP62	55103505	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	1.832000	0.39151	0.405000	0.25532	0.655000	0.94253	CTG	-	NULL		0.582	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NUP62	protein_coding	OTTHUMT00000464991.1	G	NM_153719		55103505	-1	no_errors	NM_012346	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DST	667	genome.wustl.edu	37	6	56482019	56482019	+	Silent	SNP	G	G	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr6:56482019G>T	ENST00000370765.6	-	24	6353	c.6246C>A	c.(6244-6246)gtC>gtA	p.V2082V	DST_ENST00000370788.2_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	0					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATCATCCCTGACTGAACATG	0.478																																																0			6											172.0	169.0	170.0					6																	56482019		2203	4300	6503	56589978	SO:0001819	synonymous_variant	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.6246C>A	6.37:g.56482019G>T		Somatic		Capture	Illumina GAIIx	4	56589978	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	HMMSmart_SPEC,superfamily_Spectrin,HMMPfam_Spectrin,superfamily_SSF75399,HMMSmart_PLEC,HMMPfam_Plectin	p.V2082	ENST00000370765.6	37	c.6246	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.672340	0.00758	.	.	ENSG00000151914	ENST00000522360	.	.	.	5.77	-4.85	0.03142	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4112	0.11434	0.2329:0.2855:0.3877:0.0939	.	.	.	.	X	170	.	.	S	-	2	0	DST	56589978	0.025000	0.19082	0.074000	0.20217	0.551000	0.35334	-0.065000	0.11617	-1.052000	0.03222	-1.761000	0.00669	TCA	-	NULL		0.478	DST-010	KNOWN	basic|CCDS	protein_coding	DST	protein_coding	OTTHUMT00000041027.2	G	NM_001723		56589978	-1	no_errors	NM_001723	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
KIAA1211	57482	genome.wustl.edu	37	4	57181696	57181696	+	Silent	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr4:57181696G>C	ENST00000504228.1	+	6	2133	c.2028G>C	c.(2026-2028)ctG>ctC	p.L676L	KIAA1211_ENST00000541073.1_Silent_p.L669L|KIAA1211_ENST00000264229.6_Silent_p.L676L			Q6ZU35	K1211_HUMAN	KIAA1211	676										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CCAGAATCCTGAAGAACGCAG	0.667																																																0			4											51.0	58.0	56.0					4																	57181696		2013	4179	6192	56876453	SO:0001819	synonymous_variant	57482			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.2028G>C	4.37:g.57181696G>C		Somatic		Capture	Illumina GAIIx	4	56876453	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	NULL	p.L676	ENST00000504228.1	37	c.2028	CCDS43230.1	4																																																																																			-	NULL		0.667	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	protein_coding	OTTHUMT00000362097.2	G	NM_020722		56876453	+1	no_errors	NM_020722	genbank	human	validated	54_36p	silent	SNP	0.920	C
LOC101929415	101929415	genome.wustl.edu	37	8	57390559	57390559	+	RNA	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr8:57390559C>T	ENST00000518662.1	+	0	694																											AAGCAGAAACCTTGCTGAATG	0.388																																																0			8																																								57553113			389662																															8.37:g.57390559C>T		Somatic		Capture	Illumina GAIIx	4	57553113		RNA	SNP	-	NULL	ENST00000518662.1	37	NULL		8																																																																																			-	-		0.388	RP11-17A4.2-001	KNOWN	basic	antisense	LOC389662	antisense	OTTHUMT00000378652.1	C			57553113	-1	pseudogene	XR_016813	genbank	human	model	54_36p	rna	SNP	0.006	T
ZNF528	84436	genome.wustl.edu	37	19	52918473	52918473	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr19:52918473T>G	ENST00000360465.3	+	7	794	c.368T>G	c.(367-369)tTt>tGt	p.F123C	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		CTACAGCTATTTCAAGCTGAA	0.373																																																0			19											47.0	48.0	48.0					19																	52918473		2203	4300	6503	57610285	SO:0001583	missense	84436			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.368T>G	19.37:g.52918473T>G	ENSP00000353652:p.Phe123Cys	Somatic		Capture	Illumina GAIIx	4	57610285	B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.F123C	ENST00000360465.3	37	c.368	CCDS33091.1	19	.	.	.	.	.	.	.	.	.	.	T	11.06	1.527241	0.27299	.	.	ENSG00000167555	ENST00000360465	T	0.05382	3.45	1.43	0.3	0.15776	.	.	.	.	.	T	0.16854	0.0405	M	0.69823	2.125	0.09310	N	1	D	0.89917	1.0	D	0.68192	0.956	T	0.09862	-1.0655	9	0.54805	T	0.06	.	4.1708	0.10329	0.0:0.0:0.3704:0.6296	.	123	Q3MIS6	ZN528_HUMAN	C	123	ENSP00000353652:F123C	ENSP00000353652:F123C	F	+	2	0	ZNF528	57610285	0.000000	0.05858	0.002000	0.10522	0.283000	0.27025	0.019000	0.13444	0.033000	0.15463	0.397000	0.26171	TTT	-	NULL		0.373	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	protein_coding	OTTHUMT00000344336.1	T	NM_032423		57610285	+1	no_errors	NM_032423	genbank	human	validated	54_36p	missense	SNP	0.013	G
ZBTB46	140685	genome.wustl.edu	37	20	62422006	62422006	+	Silent	SNP	C	C	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr20:62422006C>A	ENST00000245663.4	-	2	255	c.105G>T	c.(103-105)gtG>gtT	p.V35V	ZBTB46_ENST00000395104.1_Silent_p.V35V|ZBTB46_ENST00000302995.2_Silent_p.V35V|ZBTB46_ENST00000480766.1_5'Flank	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	35	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					CCTCCACGACCACGCAGACGT	0.607																																																0			20											70.0	56.0	61.0					20																	62422006		2203	4300	6503	61892450	SO:0001819	synonymous_variant	140685			AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.105G>T	20.37:g.62422006C>A		Somatic		Capture	Illumina GAIIx	4	61892450	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Silent	SNP	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB,HMMSmart_ZnF_C2H2,superfamily_SSF57667,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.V35	ENST00000245663.4	37	c.105	CCDS13538.1	20																																																																																			-	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB		0.607	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB46	protein_coding	OTTHUMT00000080232.2	C	NM_025224		61892450	-1	no_errors	NM_025224	genbank	human	provisional	54_36p	silent	SNP	0.713	A
NOL11	25926	genome.wustl.edu	37	17	65734280	65734280	+	Silent	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr17:65734280G>A	ENST00000253247.4	+	14	1687	c.1572G>A	c.(1570-1572)gaG>gaA	p.E524E	SNORA38B_ENST00000363524.1_RNA|NOL11_ENST00000535137.1_Silent_p.E342E	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	524					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTAATATGGAGTCAGTTTTTG	0.338																																																0			17											55.0	57.0	56.0					17																	65734280		2203	4300	6503	63164742	SO:0001819	synonymous_variant	25926			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.1572G>A	17.37:g.65734280G>A		Somatic		Capture	Illumina GAIIx	4	63164742	B7Z5V9|Q7L5S1|Q9UG18	Silent	SNP	HMMPfam_NUC205	p.E524	ENST00000253247.4	37	c.1572	CCDS11671.1	17																																																																																			-	NULL		0.338	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL11	protein_coding	OTTHUMT00000448074.1	G	NM_015462		63164742	+1	no_errors	NM_015462	genbank	human	provisional	54_36p	silent	SNP	0.997	A
EGR2	1959	genome.wustl.edu	37	10	64575684	64575684	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr10:64575684C>A	ENST00000242480.3	-	1	431	c.106G>T	c.(106-108)Gtg>Ttg	p.V36L	EGR2_ENST00000411732.1_5'UTR|EGR2_ENST00000439032.1_Missense_Mutation_p.V36L|EGR2_ENST00000493899.2_5'UTR	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	36					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					AAGATGGTCACCGACGTGGCG	0.612																																																0			10											143.0	132.0	136.0					10																	64575684		2203	4300	6503	64245690	SO:0001583	missense	1959			BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.106G>T	10.37:g.64575684C>A	ENSP00000242480:p.Val36Leu	Somatic		Capture	Illumina GAIIx	4	64245690	B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.V36L	ENST00000242480.3	37	c.106	CCDS7267.1	10	.	.	.	.	.	.	.	.	.	.	C	13.34	2.206698	0.39003	.	.	ENSG00000122877	ENST00000242480;ENST00000439032;ENST00000432380	T;T	0.12255	2.7;2.7	5.1	5.1	0.69264	.	0.147587	0.44902	D	0.000419	T	0.12092	0.0294	L	0.39020	1.185	0.80722	D	1	P	0.37330	0.59	B	0.34138	0.176	T	0.14896	-1.0456	10	0.16896	T	0.51	-11.8299	17.7043	0.88304	0.0:1.0:0.0:0.0	.	36	P11161	EGR2_HUMAN	L	36;36;49	ENSP00000242480:V36L;ENSP00000402040:V36L	ENSP00000242480:V36L	V	-	1	0	EGR2	64245690	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.592000	0.46171	2.548000	0.85928	0.556000	0.70494	GTG	-	NULL		0.612	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGR2	protein_coding	OTTHUMT00000048245.2	C	NM_000399		64245690	-1	no_errors	NM_000399	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TSGA10IP	254187	genome.wustl.edu	37	11	65714957	65714957	+	RNA	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr11:65714957G>C	ENST00000532620.1	+	0	892				TSGA10IP_ENST00000608857.1_RNA			Q3SY00	T10IP_HUMAN	testis specific, 10 interacting protein											endometrium(2)|kidney(3)|lung(9)	14						GCAAAGCCTGGGTGCTGAGGA	0.647																																																0			11											34.0	41.0	39.0					11																	65714957		1944	4128	6072	65471533			254187			AK057442	CCDS66138.1	11q13.1	2014-03-25			ENSG00000175513	ENSG00000175513			26555	protein-coding gene	gene with protein product						14702039	Standard	NM_152762		Approved	FLJ32880, FAM161C	uc001ogk.1	Q3SY00	OTTHUMG00000166753		11.37:g.65714957G>C		Somatic		Capture	Illumina GAIIx	4	65471533	Q3SXZ9|Q3SY01|Q96M26	Missense_Mutation	SNP	NULL	p.G221R	ENST00000532620.1	37	c.661		11																																																																																			-	NULL		0.647	TSGA10IP-001	KNOWN	basic	processed_transcript	TSGA10IP	polymorphic_pseudogene	OTTHUMT00000391373.2	G	NM_152762		65471533	+1	pseudogene	NM_152762	genbank	human	validated	54_36p	missense	SNP	0.003	C
TSEN54	283989	genome.wustl.edu	37	17	73517579	73517579	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr17:73517579G>C	ENST00000333213.6	+	7	647	c.611G>C	c.(610-612)aGc>aCc	p.S204T		NM_207346.2	NP_997229.2	Q7Z6J9	SEN54_HUMAN	TSEN54 tRNA splicing endonuclease subunit	204					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)	13	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			AAGAGGAGCAGCTCCAGCCCT	0.587																																																0			17											101.0	94.0	96.0					17																	73517579		2203	4300	6503	71029174	SO:0001583	missense	283989			AK097583	CCDS11724.1	17q25.1	2013-08-06	2013-08-06		ENSG00000182173	ENSG00000182173		"""tRNA splicing endonuclease subunits"""	27561	protein-coding gene	gene with protein product		608755	"""tRNA splicing endonuclease 54 homolog (SEN54, S. cerevisiae)"", ""tRNA splicing endonuclease 54 homolog (S. cerevisiae)"""			15109492	Standard	NM_207346		Approved	SEN54, SEN54L	uc002jof.1	Q7Z6J9		ENST00000333213.6:c.611G>C	17.37:g.73517579G>C	ENSP00000327487:p.Ser204Thr	Somatic		Capture	Illumina GAIIx	4	71029174	Q86WV3|Q86XE4|Q8N9H2	Missense_Mutation	SNP	NULL	p.S204T	ENST00000333213.6	37	c.611	CCDS11724.1	17	.	.	.	.	.	.	.	.	.	.	G	4.096	0.015919	0.07959	.	.	ENSG00000182173	ENST00000434205;ENST00000333213	T	0.57436	0.4	4.89	1.07	0.20283	.	0.534736	0.23618	N	0.046274	T	0.28300	0.0699	L	0.34521	1.04	0.32426	N	0.548646	P	0.39665	0.682	B	0.30401	0.115	T	0.26710	-1.0095	10	0.22706	T	0.39	-0.8024	3.4517	0.07501	0.1075:0.1686:0.5517:0.1722	.	204	Q7Z6J9	SEN54_HUMAN	T	103;204	ENSP00000327487:S204T	ENSP00000327487:S204T	S	+	2	0	TSEN54	71029174	0.236000	0.23804	0.801000	0.32222	0.084000	0.17831	0.396000	0.20867	0.422000	0.26005	-0.176000	0.13171	AGC	-	NULL		0.587	TSEN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN54	protein_coding	OTTHUMT00000447618.1	G	NM_207346		71029174	+1	no_errors	NM_207346	genbank	human	validated	54_36p	missense	SNP	0.971	C
ZNF638	27332	genome.wustl.edu	37	2	71577352	71577352	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr2:71577352T>A	ENST00000409544.1	+	2	1898	c.1268T>A	c.(1267-1269)aTa>aAa	p.I423K	ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000264447.4_Missense_Mutation_p.I423K|ZNF638_ENST00000355812.3_Missense_Mutation_p.I423K|ZNF638_ENST00000377802.2_Missense_Mutation_p.I423K	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	423					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TCTCCAAGAATATTTCCACAT	0.383																																																0			2											93.0	96.0	95.0					2																	71577352		2203	4300	6503	71430860	SO:0001583	missense	27332			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1268T>A	2.37:g.71577352T>A	ENSP00000386433:p.Ile423Lys	Somatic		Capture	Illumina GAIIx	4	71430860	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	HMMSmart_SM00451,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.I423K	ENST00000409544.1	37	c.1268	CCDS1917.1	2	.	.	.	.	.	.	.	.	.	.	T	17.14	3.312177	0.60414	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.74632	-0.28;-0.86;0.28;-0.28;1.26;1.26	5.85	5.85	0.93711	Zinc finger, U1-type (1);	0.113229	0.64402	D	0.000003	T	0.77239	0.4101	L	0.27053	0.805	0.58432	D	0.999999	D;D;D;D;D	0.71674	0.998;0.998;0.993;0.99;0.998	D;P;P;P;P	0.65323	0.934;0.905;0.857;0.784;0.905	T	0.79135	-0.1928	10	0.54805	T	0.06	-20.6745	14.2025	0.65714	0.0:0.0:0.0:1.0	.	529;423;423;423;423	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	K	423;529;423;423;423;423	ENSP00000386669:I423K;ENSP00000438189:I529K;ENSP00000348066:I423K;ENSP00000367033:I423K;ENSP00000264447:I423K;ENSP00000386433:I423K	ENSP00000264447:I423K	I	+	2	0	ZNF638	71430860	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.483000	0.60264	2.245000	0.73994	0.533000	0.62120	ATA	-	HMMSmart_SM00451		0.383	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	protein_coding	OTTHUMT00000327431.1	T	NM_014497		71430860	+1	no_errors	NM_001014972	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MAP1B	4131	genome.wustl.edu	37	5	71493094	71493094	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr5:71493094A>T	ENST00000296755.7	+	5	4210	c.3912A>T	c.(3910-3912)gaA>gaT	p.E1304D		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1304					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TGACCCAAGAAGTAGTTGAAG	0.517																																					Melanoma(17;367 822 11631 31730 47712)											0			5											53.0	50.0	51.0					5																	71493094		2203	4300	6503	71528850	SO:0001583	missense	4131			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.3912A>T	5.37:g.71493094A>T	ENSP00000296755:p.Glu1304Asp	Somatic		Capture	Illumina GAIIx	4	71528850	A2BDK5	Missense_Mutation	SNP	HMMPfam_MAP1B_neuraxin,PatternScan_MAP1B_NEURAXIN	p.E1304D	ENST00000296755.7	37	c.3912	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	A	15.45	2.836196	0.50951	.	.	ENSG00000131711	ENST00000296755	T	0.03580	3.88	5.86	4.71	0.59529	.	0.313605	0.27841	N	0.017640	T	0.02012	0.0063	N	0.08118	0	0.30364	N	0.783501	P;B	0.35192	0.489;0.321	B;B	0.33295	0.161;0.092	T	0.40757	-0.9546	10	0.19590	T	0.45	-16.9436	8.6203	0.33857	0.8573:0.0:0.1427:0.0	.	1178;1304	A2BDK6;P46821	.;MAP1B_HUMAN	D	1304	ENSP00000296755:E1304D	ENSP00000296755:E1304D	E	+	3	2	MAP1B	71528850	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.445000	0.35079	2.241000	0.73720	0.533000	0.62120	GAA	-	NULL		0.517	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	protein_coding	OTTHUMT00000218561.6	A	NM_005909		71528850	+1	no_errors	NM_005909	genbank	human	validated	54_36p	missense	SNP	0.974	T
SPDYE7P	441251	genome.wustl.edu	37	7	72334862	72334862	+	IGR	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr7:72334862G>A								RN7SL625P (22557 upstream) : POM121 (15073 downstream)																							TGGGGTCCTCGTCGTCCTCCT	0.562																																																0			7											14.0	15.0	15.0					7																	72334862		691	1590	2281	71972798	SO:0001628	intergenic_variant	0																															7.37:g.72334862G>A		Somatic		Capture	Illumina GAIIx	4	71972798		Silent	SNP	NULL	p.D118		37	c.354		7																																																																																			-	NULL	0	0.562					ENSG00000179994			G			71972798	-1	no_errors	ENST00000355920	ensembl	human	known	54_36p	silent	SNP	0.000	A
RHBDF2	79651	genome.wustl.edu	37	17	74468867	74468867	+	Silent	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr17:74468867C>T	ENST00000313080.4	-	18	2325	c.2052G>A	c.(2050-2052)ctG>ctA	p.L684L	RHBDF2_ENST00000389760.4_Silent_p.L655L|RHBDF2_ENST00000591885.1_Silent_p.L655L	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	684					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						CCAGCTTCTCCAGGTCCCTCA	0.607																																																0			17											53.0	36.0	42.0					17																	74468867		2203	4300	6503	71980462	SO:0001819	synonymous_variant	79651			BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.2052G>A	17.37:g.74468867C>T		Somatic		Capture	Illumina GAIIx	4	71980462	A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	Silent	SNP	HMMPfam_Rhomboid	p.L684	ENST00000313080.4	37	c.2052	CCDS32743.1	17																																																																																			-	HMMPfam_Rhomboid		0.607	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	RHBDF2	protein_coding	OTTHUMT00000450134.1	C	NM_024599		71980462	-1	no_errors	NM_024599	genbank	human	validated	54_36p	silent	SNP	1.000	T
CLEC18B	497190	genome.wustl.edu	37	16	74451961	74451961	+	Missense_Mutation	SNP	G	G	A	rs151079980	byFrequency	TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr16:74451961G>A	ENST00000339953.5	-	3	573	c.452C>T	c.(451-453)aCg>aTg	p.T151M		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	151	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.T151K(1)		endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						ACTCACCTGCGTGTAGTGGGT	0.592																																																1	Substitution - Missense(1)	lung(1)	16											9.0	10.0	9.0					16																	74451961		1775	3623	5398	73009462	SO:0001583	missense	0			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.452C>T	16.37:g.74451961G>A	ENSP00000341051:p.Thr151Met	Somatic		Capture	Illumina GAIIx	4	73009462	B4DF90	Missense_Mutation	SNP	superfamily_PR-1-like,HMMSmart_SM00198,HMMPfam_SCP,HMMSmart_SM00181,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00034,superfamily_C-type lectin-like,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1	p.T151M	ENST00000339953.5	37	c.452	CCDS32484.1	16	91	0.041666666666666664	5	0.01016260162601626	17	0.04696132596685083	20	0.03496503496503497	49	0.06464379947229551	g	16.79	3.221692	0.58560	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492	T	0.16073	2.37	3.57	3.57	0.40892	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.09686	0.0238	H	0.95982	3.75	0.46113	D	0.998879	D;D	0.89917	0.999;1.0	D;D	0.66716	0.943;0.946	T	0.45920	-0.9228	10	0.66056	D	0.02	.	10.55	0.45083	0.0:0.0:1.0:0.0	.	151;151	C9JSV1;Q6UXF7	.;CL18B_HUMAN	M	151	ENSP00000341051:T151M	ENSP00000268492:T151M	T	-	2	0	CLEC18B	73009462	1.000000	0.71417	0.986000	0.45419	0.699000	0.40488	5.199000	0.65152	1.821000	0.53095	0.531000	0.56144	ACG	-	superfamily_PR-1-like,HMMSmart_SM00198,HMMPfam_SCP		0.592	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC18B	protein_coding	OTTHUMT00000434697.1	G	NM_001011880		73009462	-1	no_errors	NM_001011880	genbank	human	validated	54_36p	missense	SNP	0.996	A
ELMSAN1	91748	genome.wustl.edu	37	14	74206097	74206097	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr14:74206097C>G	ENST00000286523.5	-	2	1397	c.615G>C	c.(613-615)aaG>aaC	p.K205N	ELMSAN1_ENST00000486739.1_5'Flank|ELMSAN1_ENST00000394071.2_Missense_Mutation_p.K205N	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										TTGGGGGTTTCTTGGCTGCGT	0.642																																																0			14											42.0	47.0	45.0					14																	74206097		2203	4300	6503	73275850	SO:0001583	missense	91748			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.615G>C	14.37:g.74206097C>G	ENSP00000286523:p.Lys205Asn	Somatic		Capture	Illumina GAIIx	4	73275850	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	HMMPfam_ELM2,superfamily_Homeodomain_like,HMMSmart_SANT,HMMPfam_Myb_DNA-binding	p.K205N	ENST00000286523.5	37	c.615	CCDS9819.1	14	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081598	0.55753	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.17854	2.26;2.26;2.26;2.25	5.14	4.25	0.50352	.	0.089021	0.48286	D	0.000194	T	0.13200	0.0320	N	0.24115	0.695	0.31120	N	0.708936	P;P	0.52842	0.956;0.956	B;B	0.41764	0.366;0.366	T	0.02925	-1.1093	10	0.56958	D	0.05	-26.7067	13.6089	0.62063	0.0:0.9246:0.0:0.0754	.	205;205	A0PJD3;Q6PJG2	.;CN043_HUMAN	N	205	ENSP00000377634:K205N;ENSP00000286523:K205N;ENSP00000407767:K205N;ENSP00000402380:K205N	ENSP00000286523:K205N	K	-	3	2	C14orf43	73275850	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.129000	0.64739	1.162000	0.42619	0.462000	0.41574	AAG	-	NULL		0.642	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf43	protein_coding	OTTHUMT00000317793.1	C	NM_194278		73275850	-1	no_errors	NM_001043318	genbank	human	validated	54_36p	missense	SNP	0.999	G
TBC1D2B	23102	genome.wustl.edu	37	15	78305432	78305432	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr15:78305432C>T	ENST00000300584.3	-	9	2002	c.2003G>A	c.(2002-2004)cGt>cAt	p.R668H	TBC1D2B_ENST00000409931.3_Missense_Mutation_p.R668H	NM_015079.5|NM_144572.1	NP_055894.6|NP_653173.1	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B	668	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(3)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26						CACCTTGGAACGGTGCTCGTG	0.532																																																0			15											108.0	91.0	97.0					15																	78305432		2196	4293	6489	76092487	SO:0001583	missense	23102			AB028978	CCDS32301.2, CCDS45314.1	15q24.3-q25.1	2005-11-29			ENSG00000167202	ENSG00000167202			29183	protein-coding gene	gene with protein product						10470851	Standard	NM_015079		Approved	KIAA1055	uc002bcy.4	Q9UPU7	OTTHUMG00000152885	ENST00000300584.3:c.2003G>A	15.37:g.78305432C>T	ENSP00000300584:p.Arg668His	Somatic		Capture	Illumina GAIIx	4	76092487	A7MD42|Q8N1F9|Q9NXM0	Missense_Mutation	SNP	superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164	p.R542H	ENST00000300584.3	37	c.1625	CCDS45314.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.6|28.6	4.935388|4.935388	0.92458|0.92458	.|.	.|.	ENSG00000167202|ENSG00000167202	ENST00000409931;ENST00000300584|ENST00000418039	T;T|.	0.34472|.	1.36;1.36|.	5.47|5.47	5.47|5.47	0.80525|0.80525	Rab-GAP/TBC domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90601|0.90601	0.7053|0.7053	H|H	0.97962|0.97962	4.115|4.115	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;1.0;0.999|.	D|D	0.93708|0.93708	0.7021|0.7021	10|5	0.87932|.	D|.	0|.	.|.	18.6826|18.6826	0.91551|0.91551	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	668;120;668|.	Q9UPU7-2;Q9UPU7-3;Q9UPU7|.	.;.;TBD2B_HUMAN|.	H|I	668|550	ENSP00000387165:R668H;ENSP00000300584:R668H|.	ENSP00000300584:R668H|.	R|V	-|-	2|1	0|0	TBC1D2B|TBC1D2B	76092487|76092487	1.000000|1.000000	0.71417|0.71417	0.980000|0.980000	0.43619|0.43619	0.685000|0.685000	0.39939|0.39939	7.631000|7.631000	0.83237|0.83237	2.723000|2.723000	0.93209|0.93209	0.655000|0.655000	0.94253|0.94253	CGT|GTT	-	superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164		0.532	TBC1D2B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D2B	protein_coding	OTTHUMT00000328369.3	C	NM_015079		76092487	-1	no_errors	NM_015079	genbank	human	validated	54_36p	missense	SNP	1.000	T
PPEF2	5470	genome.wustl.edu	37	4	76804191	76804191	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr4:76804191A>G	ENST00000286719.7	-	10	1177	c.821T>C	c.(820-822)gTt>gCt	p.V274A		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	274	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CCAACAGAAAACATCTTGCAG	0.378																																					NSCLC(105;1359 1603 15961 44567 47947)											0			4											100.0	99.0	100.0					4																	76804191		2203	4300	6503	77023215	SO:0001583	missense	5470			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.821T>C	4.37:g.76804191A>G	ENSP00000286719:p.Val274Ala	Somatic		Capture	Illumina GAIIx	4	77023215	O14831	Missense_Mutation	SNP	HMMPfam_IQ,HMMPfam_PPP5,superfamily_Metallo-dependent phosphatases,HMMSmart_SM00156,HMMPfam_Metallophos,PatternScan_SER_THR_PHOSPHATASE,HMMSmart_SM00054,superfamily_EF-hand,HMMPfam_efhand,PatternScan_EF_HAND_1	p.V274A	ENST00000286719.7	37	c.821	CCDS34013.1	4	.	.	.	.	.	.	.	.	.	.	A	22.1	4.238583	0.79800	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	T	0.05855	3.38	4.21	4.21	0.49690	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.371975	0.27941	N	0.017222	T	0.18130	0.0435	L	0.53617	1.68	0.48632	D	0.999689	D;D	0.71674	0.998;0.996	D;D	0.71414	0.919;0.973	T	0.00349	-1.1798	10	0.87932	D	0	-5.8817	11.3122	0.49370	1.0:0.0:0.0:0.0	.	274;274	O14830-2;O14830	.;PPE2_HUMAN	A	274	ENSP00000286719:V274A	ENSP00000286719:V274A	V	-	2	0	PPEF2	77023215	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.445000	0.90326	1.771000	0.52183	0.533000	0.62120	GTT	-	superfamily_Metallo-dependent phosphatases,HMMSmart_SM00156,HMMPfam_Metallophos		0.378	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	protein_coding	OTTHUMT00000362929.1	A	NM_006239		77023215	-1	no_errors	NM_006239	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SYTL2	54843	genome.wustl.edu	37	11	85435247	85435247	+	Intron	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr11:85435247G>A	ENST00000528231.1	-	8	1737				SYTL2_ENST00000354566.3_Silent_p.P751P|SYTL2_ENST00000525423.1_Silent_p.P751P|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000359152.5_Silent_p.P1275P	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		GGAGAGGAATGGGTTGCCTAT	0.438																																																0			11											78.0	76.0	77.0					11																	85435247		2203	4299	6502	85112895	SO:0001627	intron_variant	54843			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1460-3245C>T	11.37:g.85435247G>A		Somatic		Capture	Illumina GAIIx	4	85112895	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Silent	SNP	PatternScan_PHOSPHOPANTETHEINE,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.P751	ENST00000528231.1	37	c.2253	CCDS53688.1	11																																																																																			-	NULL		0.438	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	protein_coding	OTTHUMT00000392192.1	G	NM_206927		85112895	-1	no_errors	NM_206927	genbank	human	reviewed	54_36p	silent	SNP	0.239	A
DMTF1	9988	genome.wustl.edu	37	7	86823197	86823197	+	Missense_Mutation	SNP	C	C	A	rs201236280		TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr7:86823197C>A	ENST00000394703.5	+	18	2370	c.1807C>A	c.(1807-1809)Cct>Act	p.P603T	DMTF1_ENST00000432937.2_Missense_Mutation_p.P515T|DMTF1_ENST00000331242.7_Missense_Mutation_p.P603T|DMTF1_ENST00000413276.2_Missense_Mutation_p.P533T|DMTF1_ENST00000414194.2_Missense_Mutation_p.P337T|TMEM243_ENST00000481425.1_5'Flank	NM_021145.3	NP_066968.3	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	603	Interaction with CCND1, CCND2 and CCND3. {ECO:0000250}.|Required for transcriptional activation. {ECO:0000250}.				cell cycle (GO:0007049)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)	16	Esophageal squamous(14;0.0058)					TTTTCCTGAGCCTCCAGACGC	0.438																																																0			7											139.0	124.0	129.0					7																	86823197		2203	4300	6503	86661133	SO:0001583	missense	9988			AF084530	CCDS5601.1, CCDS47633.1	7q21	2014-06-25			ENSG00000135164	ENSG00000135164			14603	protein-coding gene	gene with protein product	"""cyclin D-binding Myb-like protein"""	608491				10095122, 24958102	Standard	NR_024549		Approved	DMP1, DMTF, hDMP1, MRUL	uc003uih.3	Q9Y222	OTTHUMG00000154135	ENST00000394703.5:c.1807C>A	7.37:g.86823197C>A	ENSP00000378193:p.Pro603Thr	Somatic		Capture	Illumina GAIIx	4	86661133	B2RBE1|B4DJS5|Q05C48|Q59G79|Q6IS13|Q969T2|Q9H2Z2|Q9H2Z3	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00717,HMMPfam_Myb_DNA-binding	p.P603T	ENST00000394703.5	37	c.1807	CCDS5601.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.33|16.33	3.092905|3.092905	0.56075|0.56075	.|.	.|.	ENSG00000135164|ENSG00000135164	ENST00000331242;ENST00000413276;ENST00000432937;ENST00000394703;ENST00000414194|ENST00000454008	T;T;T;T;T|.	0.47177|.	0.86;0.85;0.86;0.86;0.87|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.56124|0.56124	0.1964|0.1964	N|N	0.24115|0.24115	0.695|0.695	0.43308|0.43308	D|D	0.995318|0.995318	P|.	0.47762|.	0.9|.	B|.	0.43301|.	0.415|.	T|T	0.49194|0.49194	-0.8965|-0.8965	10|5	0.07644|.	T|.	0.81|.	-10.5806|-10.5806	19.0721|19.0721	0.93143|0.93143	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	603|.	Q9Y222|.	DMTF1_HUMAN|.	T|R	603;533;515;603;337|70	ENSP00000332171:P603T;ENSP00000402627:P533T;ENSP00000412532:P515T;ENSP00000378193:P603T;ENSP00000415910:P337T|.	ENSP00000332171:P603T|.	P|S	+|+	1|3	0|2	DMTF1|DMTF1	86661133|86661133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.914000|0.914000	0.54420|0.54420	3.495000|3.495000	0.53280|0.53280	2.742000|2.742000	0.94016|0.94016	0.655000|0.655000	0.94253|0.94253	CCT|AGC	-	NULL		0.438	DMTF1-002	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	DMTF1	protein_coding	OTTHUMT00000334025.5	C	NM_021145		86661133	+1	no_errors	NM_021145	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CNR1	1268	genome.wustl.edu	37	6	88853950	88853950	+	Silent	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr6:88853950G>A	ENST00000537554.1	-	2	4606	c.1044C>T	c.(1042-1044)atC>atT	p.I348I	CNR1_ENST00000369501.2_Silent_p.I348I|CNR1_ENST00000535130.1_Silent_p.I348I|CNR1_ENST00000468898.1_Silent_p.I315I|CNR1_ENST00000369499.2_Silent_p.I348I|CNR1_ENST00000549716.1_Silent_p.I287I|CNR1_ENST00000428600.2_Silent_p.I348I|CNR1_ENST00000549890.1_Silent_p.I348I|CNR1_ENST00000362094.5_3'UTR	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	348					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	ACACCACCAGGATCAGGACCA	0.517																																																0			6											156.0	164.0	161.0					6																	88853950		2203	4300	6503	88910669	SO:0001819	synonymous_variant	1268			AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.1044C>T	6.37:g.88853950G>A		Somatic		Capture	Illumina GAIIx	4	88910669	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.I348	ENST00000537554.1	37	c.1044	CCDS5015.1	6																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.517	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	protein_coding	OTTHUMT00000354204.2	G			88910669	-1	no_errors	NM_016083	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
IGKV1-37	28931	genome.wustl.edu	37	2	89597125	89597125	+	RNA	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr2:89597125G>A	ENST00000465170.1	-	0	293									immunoglobulin kappa variable 1-37 (non-functional)																		CCACTGAACCGAGATGGGACT	0.463																																																0			2											3.0	3.0	3.0					2																	89597125		1142	3151	4293	89378240			0			X59316		2p11.2	2012-02-08	2008-09-15		ENSG00000239862	ENSG00000239862		"""Immunoglobulins / IGK locus"""	5739	other	immunoglobulin gene			"""immunoglobulin kappa variable 1-37"""				Standard	NG_000834		Approved	IGKV137, O14			OTTHUMG00000151689		2.37:g.89597125G>A		Somatic		Capture	Illumina GAIIx	4	89378240		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv	p.R83W	ENST00000465170.1	37	c.247		2																																																																																			-	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv		0.463	IGKV1-37-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211617	IG_V_gene	OTTHUMT00000323488.1	G	NG_000834		89378240	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390262	ensembl	human	known	54_36p	missense	SNP	0.157	A
ZNF644	84146	genome.wustl.edu	37	1	91404899	91404899	+	Nonsense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:91404899G>C	ENST00000370440.1	-	3	2229	c.2012C>G	c.(2011-2013)tCa>tGa	p.S671*	ZNF644_ENST00000337393.5_Nonsense_Mutation_p.S671*|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	671					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		AAAACTACTTGATTGTGAGGT	0.373																																																0			1											129.0	129.0	129.0					1																	91404899		2203	4299	6502	91177487	SO:0001587	stop_gained	84146			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.2012C>G	1.37:g.91404899G>C	ENSP00000359469:p.Ser671*	Somatic		Capture	Illumina GAIIx	4	91177487	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Nonsense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.S671*	ENST00000370440.1	37	c.2012	CCDS731.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.562403	0.98361	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000536941	.	.	.	6.02	6.02	0.97574	.	0.147182	0.46145	D	0.000308	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-1.3032	20.547	0.99278	0.0:0.0:1.0:0.0	.	.	.	.	X	671;671;243	.	ENSP00000337008:S671X	S	-	2	0	ZNF644	91177487	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.641000	0.61375	2.850000	0.98022	0.650000	0.86243	TCA	-	NULL		0.373	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	protein_coding	OTTHUMT00000027846.2	G	NM_032186		91177487	-1	no_errors	NM_201269	genbank	human	validated	54_36p	nonsense	SNP	1.000	C
CNN3	1266	genome.wustl.edu	37	1	95363362	95363362	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:95363362T>C	ENST00000370206.4	-	7	1309	c.926A>G	c.(925-927)cAt>cGt	p.H309R	CNN3_ENST00000545882.1_Missense_Mutation_p.H268R|CNN3_ENST00000394202.4_Missense_Mutation_p.H263R|CNN3_ENST00000538964.1_Missense_Mutation_p.H309R|CNN3_ENST00000487539.1_5'Flank	NM_001839.3	NP_001830.1	Q15417	CNN3_HUMAN	calponin 3, acidic	309	Asp/Glu-rich (acidic).				actomyosin structure organization (GO:0031032)|epithelial cell differentiation (GO:0030855)	focal adhesion (GO:0005925)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|stomach(1)|urinary_tract(2)	18		all_lung(203;0.00206)|Lung NSC(277;0.00948)		all cancers(265;0.0325)|Epithelial(280;0.0861)		GTACTCGCCATGATACTCATC	0.438																																																0			1											272.0	237.0	249.0					1																	95363362		2203	4300	6503	95135950	SO:0001583	missense	1266			BC025372	CCDS30775.1, CCDS65592.1, CCDS65593.1	1p22-p21	2010-07-08			ENSG00000117519	ENSG00000117519			2157	protein-coding gene	gene with protein product		602374				8526917	Standard	NM_001839		Approved		uc001dqz.4	Q15417	OTTHUMG00000010783	ENST00000370206.4:c.926A>G	1.37:g.95363362T>C	ENSP00000359225:p.His309Arg	Somatic		Capture	Illumina GAIIx	4	95135950	B4DFK6|B4DP09|F8WA86|Q6FHA7	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033,PatternScan_CALPONIN_1,HMMPfam_Calponin	p.H309R	ENST00000370206.4	37	c.926	CCDS30775.1	1	.	.	.	.	.	.	.	.	.	.	T	9.628	1.135755	0.21123	.	.	ENSG00000117519	ENST00000370206;ENST00000538964;ENST00000394202;ENST00000545882	T;T;T;T	0.30448	1.55;1.55;1.53;1.55	6.04	3.72	0.42706	.	0.216674	0.49916	D	0.000134	T	0.03434	0.0099	N	0.03608	-0.345	0.42028	D	0.991013	B;B	0.09022	0.0;0.002	B;B	0.12156	0.001;0.007	T	0.38134	-0.9675	10	0.05721	T	0.95	-9.6157	9.1131	0.36741	0.0:0.0641:0.1253:0.8106	.	263;309	F8WA86;Q15417	.;CNN3_HUMAN	R	309;309;263;268	ENSP00000359225:H309R;ENSP00000437665:H309R;ENSP00000377752:H263R;ENSP00000440081:H268R	ENSP00000359225:H309R	H	-	2	0	CNN3	95135950	0.998000	0.40836	0.952000	0.39060	0.753000	0.42808	2.177000	0.42509	0.517000	0.28361	0.460000	0.39030	CAT	-	NULL		0.438	CNN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN3	protein_coding	OTTHUMT00000029702.2	T	NM_001839		95135950	-1	no_errors	NM_001839	genbank	human	validated	54_36p	missense	SNP	1.000	C
C10orf12	26148	genome.wustl.edu	37	10	98741357	98741357	+	Silent	SNP	T	T	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr10:98741357T>C	ENST00000286067.2	+	1	317	c.210T>C	c.(208-210)gaT>gaC	p.D70D		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	70										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		TGCGCCAGGATTTAGAGGCAA	0.433																																																0			10											83.0	79.0	80.0					10																	98741357		2203	4300	6503	98731347	SO:0001819	synonymous_variant	26148			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.210T>C	10.37:g.98741357T>C		Somatic		Capture	Illumina GAIIx	4	98731347	Q9H945|Q9Y457	Silent	SNP	NULL	p.D70	ENST00000286067.2	37	c.210	CCDS7452.1	10																																																																																			-	NULL		0.433	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	protein_coding	OTTHUMT00000049627.1	T	NM_015652		98731347	+1	no_errors	NM_015652	genbank	human	predicted	54_36p	silent	SNP	0.932	C
NXF2	56001	genome.wustl.edu	37	X	101572404	101572404	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chrX:101572404C>T	ENST00000372758.1	+	9	1152	c.302C>T	c.(301-303)aCg>aTg	p.T101M	NXF2_ENST00000372763.1_Missense_Mutation_p.T13M|NXF2_ENST00000330252.5_Missense_Mutation_p.T101M|NXF2_ENST00000372757.1_Missense_Mutation_p.T101M|NXF2_ENST00000395088.2_Missense_Mutation_p.T101M			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2	101					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|lung(2)	4						CGTATTACCACGTGGAGAAAT	0.463																																																0			X											18.0	18.0	18.0					X																	101572404		1848	3527	5375	101459060	SO:0001583	missense	56001			AJ277526	CCDS14497.1	Xq22.1	2011-05-25			ENSG00000185554				8072	protein-coding gene	gene with protein product	"""cancer/testis antigen 39"", ""TAP like protein 2"""	300315				11073998, 11279525	Standard	NM_022053		Approved	CT39, TAPL-2	uc004eix.4	Q9GZY0		ENST00000372758.1:c.302C>T	X.37:g.101572404C>T	ENSP00000361844:p.Thr101Met	Somatic		Capture	Illumina GAIIx	4	101459060	Q9BXU4|Q9NSS1|Q9NX66	Missense_Mutation	SNP	superfamily_SSF54928,HMMPfam_Tap-RNA_bind,superfamily_SSF52058,superfamily_SSF54427,HMMPfam_NTF2,superfamily_UBA_like,HMMSmart_TAP_C,HMMPfam_TAP_C	p.T101M	ENST00000372758.1	37	c.302	CCDS14497.1	X	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.093350	0.00364	.	.	ENSG00000185554	ENST00000395088;ENST00000330252;ENST00000372763;ENST00000372758;ENST00000372757	T;T;T;T;T	0.42900	0.96;0.96;0.97;0.96;0.96	2.26	-2.21	0.06973	.	.	.	.	.	T	0.20981	0.0505	N	0.14661	0.345	0.09310	N	1	B;B	0.21309	0.054;0.011	B;B	0.11329	0.006;0.002	T	0.16247	-1.0409	9	0.32370	T	0.25	-0.0641	6.0356	0.19706	0.0:0.5273:0.0:0.4727	.	13;101	Q5JRM6;Q9GZY0	.;NXF2_HUMAN	M	101;101;13;101;101	ENSP00000378523:T101M;ENSP00000331471:T101M;ENSP00000361849:T13M;ENSP00000361844:T101M;ENSP00000361843:T101M	ENSP00000331471:T101M	T	+	2	0	NXF2	101459060	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.006000	0.12833	-0.602000	0.05775	0.181000	0.17075	ACG	-	NULL		0.463	NXF2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF2	protein_coding	OTTHUMT00000057618.1	C	NM_017809		101459060	+1	no_errors	NM_017809	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
MOK	5891	genome.wustl.edu	37	14	102717243	102717243	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr14:102717243A>T	ENST00000361847.2	-	7	727	c.496T>A	c.(496-498)Tgg>Agg	p.W166R	MOK_ENST00000193029.6_5'UTR|MOK_ENST00000524214.1_Missense_Mutation_p.W136R|MOK_ENST00000522874.1_Missense_Mutation_p.W165R	NM_014226.1	NP_055041.1	Q9UQ07	MOK_HUMAN	MOK protein kinase	166	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)										GCCCGGTACCAGCGGGTGGAG	0.567																																																0			14											84.0	85.0	85.0					14																	102717243		2203	4300	6503	101786996	SO:0001583	missense	5891			AB022694	CCDS9971.1, CCDS61552.1	14q32	2014-04-23	2011-09-06	2011-09-06	ENSG00000080823	ENSG00000080823			9833	protein-coding gene	gene with protein product		605762	"""renal tumor antigen"""	RAGE		8781117, 10421840	Standard	NM_014226		Approved	RAGE1, STK30	uc001ylm.4	Q9UQ07	OTTHUMG00000164896	ENST00000361847.2:c.496T>A	14.37:g.102717243A>T	ENSP00000355304:p.Trp166Arg	Somatic		Capture	Illumina GAIIx	4	101786996	B2R6Z4|B7Z7P6|E7ER76|E7ERR8|Q92790|Q93067	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.W166R	ENST00000361847.2	37	c.496	CCDS9971.1	14	.	.	.	.	.	.	.	.	.	.	.	23.6	4.436922	0.83885	.	.	ENSG00000080823	ENST00000522874;ENST00000361847;ENST00000524214	T;T;T	0.47177	0.85;0.85;0.85	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72407	0.3456	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.77651	-0.2508	10	0.87932	D	0	-13.2241	15.6057	0.76668	1.0:0.0:0.0:0.0	.	136;166	E7ERR8;Q9UQ07	.;MOK_HUMAN	R	165;166;136	ENSP00000429469:W165R;ENSP00000355304:W166R;ENSP00000428942:W136R	ENSP00000355304:W166R	W	-	1	0	RAGE	101786996	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	8.317000	0.89987	2.166000	0.68216	0.533000	0.62120	TGG	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.567	MOK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAGE	protein_coding	OTTHUMT00000380848.3	A			101786996	-1	no_errors	NM_014226	genbank	human	provisional	54_36p	missense	SNP	1.000	T
PKD2L1	9033	genome.wustl.edu	37	10	102057174	102057174	+	Silent	SNP	G	G	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr10:102057174G>T	ENST00000318222.3	-	5	1303	c.921C>A	c.(919-921)gtC>gtA	p.V307V	PKD2L1_ENST00000338519.3_Intron|PKD2L1_ENST00000353274.3_Silent_p.V307V	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	307					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		TGGCATTGTAGACTGAGAAGT	0.557																																																0			10											89.0	91.0	90.0					10																	102057174		2203	4300	6503	102047164	SO:0001819	synonymous_variant	9033			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.921C>A	10.37:g.102057174G>T		Somatic		Capture	Illumina GAIIx	4	102047164	O75972|Q5W039|Q9UP35|Q9UPA2	Silent	SNP	HMMPfam_PKD_channel,superfamily_Voltage-gated potassium channels	p.V307	ENST00000318222.3	37	c.921	CCDS7492.1	10																																																																																			-	HMMPfam_PKD_channel		0.557	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2L1	protein_coding	OTTHUMT00000049863.2	G	NM_016112		102047164	-1	no_errors	NM_016112	genbank	human	reviewed	54_36p	silent	SNP	0.998	T
RINT1	60561	genome.wustl.edu	37	7	105177014	105177014	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr7:105177014G>C	ENST00000257700.2	+	3	322	c.91G>C	c.(91-93)Gac>Cac	p.D31H		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	31					G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TGTTGTAGGTGACATAAATGT	0.323																																																0			7											170.0	174.0	173.0					7																	105177014		2203	4300	6503	104964250	SO:0001583	missense	60561			AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.91G>C	7.37:g.105177014G>C	ENSP00000257700:p.Asp31His	Somatic		Capture	Illumina GAIIx	4	104964250	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	HMMPfam_RINT1_TIP1	p.D31H	ENST00000257700.2	37	c.91	CCDS34726.1	7	.	.	.	.	.	.	.	.	.	.	G	8.820	0.937292	0.18206	.	.	ENSG00000135249	ENST00000257700	T	0.27402	1.67	5.33	2.4	0.29515	.	0.278669	0.32736	N	0.005703	T	0.21103	0.0508	L	0.38838	1.175	0.37759	D	0.926249	B	0.02656	0.0	B	0.06405	0.002	T	0.06899	-1.0801	10	0.48119	T	0.1	-3.6382	6.4269	0.21773	0.2364:0.1318:0.6318:0.0	.	31	Q6NUQ1	RINT1_HUMAN	H	31	ENSP00000257700:D31H	ENSP00000257700:D31H	D	+	1	0	RINT1	104964250	1.000000	0.71417	0.986000	0.45419	0.027000	0.11550	2.008000	0.40893	0.185000	0.20105	0.591000	0.81541	GAC	-	NULL		0.323	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RINT1	protein_coding	OTTHUMT00000348686.1	G	NM_021930		104964250	+1	no_errors	NM_021930	genbank	human	validated	54_36p	missense	SNP	0.777	C
ATM	472	genome.wustl.edu	37	11	108121543	108121543	+	Missense_Mutation	SNP	C	C	T	rs201719927	byFrequency	TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr11:108121543C>T	ENST00000452508.2	+	11	1540	c.1351C>T	c.(1351-1353)Cgt>Tgt	p.R451C	ATM_ENST00000278616.4_Missense_Mutation_p.R451C			Q13315	ATM_HUMAN	ATM serine/threonine kinase	451					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ACATGGGGAACGTACACCATA	0.408			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)			C|||	5	0.000998403	0.0	0.0043	5008	,	,		19170	0.0		0.0	False		,,,				2504	0.002					yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0			11											115.0	98.0	103.0					11																	108121543		2201	4298	6499	107626753	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1351C>T	11.37:g.108121543C>T	ENSP00000388058:p.Arg451Cys	Somatic		Capture	Illumina GAIIx	4	107626753	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_FAT,superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2,HMMPfam_FATC	p.R451C	ENST00000452508.2	37	c.1351	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762562	0.69763	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.02158	4.42;4.76;4.76	6.08	6.08	0.98989	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.10035	0.0246	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.65874	0.939	T	0.00261	-1.1868	10	0.49607	T	0.09	.	13.5204	0.61563	0.2545:0.7455:0.0:0.0	.	451	Q13315	ATM_HUMAN	C	451	ENSP00000435747:R451C;ENSP00000278616:R451C;ENSP00000388058:R451C	ENSP00000278616:R451C	R	+	1	0	ATM	107626753	1.000000	0.71417	0.948000	0.38648	0.514000	0.34195	5.087000	0.64480	2.894000	0.99253	0.591000	0.81541	CGT	-	superfamily_ARM repeat		0.408	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	protein_coding	OTTHUMT00000389938.1	C	NM_000051		107626753	+1	no_errors	NM_000051	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
STXBP3	6814	genome.wustl.edu	37	1	109301203	109301203	+	Silent	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:109301203C>T	ENST00000370008.3	+	5	380	c.330C>T	c.(328-330)ttC>ttT	p.F110F		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	110	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		ATATTTACTTCACTGACTGTA	0.289																																																0			1											43.0	50.0	48.0					1																	109301203		2199	4274	6473	109102726	SO:0001819	synonymous_variant	6814			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.330C>T	1.37:g.109301203C>T		Somatic		Capture	Illumina GAIIx	4	109102726	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Silent	SNP	superfamily_Sec1-like,HMMPfam_Sec1	p.F110	ENST00000370008.3	37	c.330	CCDS790.1	1																																																																																			-	superfamily_Sec1-like,HMMPfam_Sec1		0.289	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	protein_coding	OTTHUMT00000030591.1	C	NM_007269		109102726	+1	no_errors	NM_007269	genbank	human	validated	54_36p	silent	SNP	1.000	T
PAK3	5063	genome.wustl.edu	37	X	110366350	110366350	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chrX:110366350A>G	ENST00000372010.1	+	5	461	c.19A>G	c.(19-21)Aat>Gat	p.N7D	PAK3_ENST00000446737.1_Missense_Mutation_p.N7D|PAK3_ENST00000417227.1_Missense_Mutation_p.N7D|PAK3_ENST00000425146.1_Missense_Mutation_p.N7D|PAK3_ENST00000519681.1_Missense_Mutation_p.N7D|PAK3_ENST00000372007.5_Missense_Mutation_p.N7D|PAK3_ENST00000360648.4_Missense_Mutation_p.N7D|PAK3_ENST00000518291.1_Missense_Mutation_p.N7D|PAK3_ENST00000262836.4_Missense_Mutation_p.N7D			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	7					activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						CGGTCTGGATAATGAAGAGAA	0.458										TSP Lung(19;0.15)																																						0			X											108.0	111.0	110.0					X																	110366350		2203	4300	6503	110253006	SO:0001583	missense	5063			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.19A>G	X.37:g.110366350A>G	ENSP00000361080:p.Asn7Asp	Somatic		Capture	Illumina GAIIx	4	110253006	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	HMMPfam_PBD,HMMSmart_SM00285,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.N7D	ENST00000372010.1	37	c.19	CCDS48153.1	X	.	.	.	.	.	.	.	.	.	.	A	9.103	1.004639	0.19199	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000429193;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.70869	-0.51;-0.51;-0.52;-0.51;-0.51;-0.5;-0.5;-0.51;-0.52	5.2	5.2	0.72013	.	0.175390	0.47455	D	0.000236	T	0.49150	0.1540	N	0.08118	0	0.26836	N	0.968483	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.0	T	0.39840	-0.9594	10	0.35671	T	0.21	.	10.519	0.44907	0.9202:0.0:0.0798:0.0	.	7;7;7;7	O75914-4;O75914-3;O75914;O75914-2	.;.;PAK3_HUMAN;.	D	7	ENSP00000410853:N7D;ENSP00000401982:N7D;ENSP00000361080:N7D;ENSP00000429113:N7D;ENSP00000361077:N7D;ENSP00000428921:N7D;ENSP00000353864:N7D;ENSP00000389172:N7D;ENSP00000262836:N7D	ENSP00000262836:N7D	N	+	1	0	PAK3	110253006	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.788000	0.75105	1.847000	0.53656	0.486000	0.48141	AAT	-	NULL		0.458	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAK3	protein_coding	OTTHUMT00000057918.1	A	NM_002578		110253006	+1	no_errors	NM_002578	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
RASAL1	8437	genome.wustl.edu	37	12	113556985	113556985	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr12:113556985C>T	ENST00000261729.5	-	8	905	c.590G>A	c.(589-591)cGg>cAg	p.R197Q	RASAL1_ENST00000418411.2_5'UTR|RASAL1_ENST00000548055.1_Missense_Mutation_p.R197Q|RASAL1_ENST00000446861.3_Missense_Mutation_p.R197Q|RASAL1_ENST00000546530.1_Missense_Mutation_p.R197Q			O95294	RASL1_HUMAN	RAS protein activator like 1 (GAP1 like)	197	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(3)|prostate(2)|skin(2)	43						GAGCTCCACCCGCAGTGGGGA	0.607																																																0			12											90.0	78.0	82.0					12																	113556985		2203	4300	6503	112041368	SO:0001583	missense	8437			AF086713	CCDS9165.1, CCDS55888.1, CCDS55889.1, CCDS73529.1	12q23-q24	2013-01-10			ENSG00000111344	ENSG00000111344		"""Pleckstrin homology (PH) domain containing"""	9873	protein-coding gene	gene with protein product		604118				9751798	Standard	NM_001193520		Approved	RASAL	uc001tul.3	O95294	OTTHUMG00000169705	ENST00000261729.5:c.590G>A	12.37:g.113556985C>T	ENSP00000261729:p.Arg197Gln	Somatic		Capture	Illumina GAIIx	4	112041368	B7ZKM4|C9JFK5|F8VQX1|Q52M03|Q59H24|Q96CC7	Missense_Mutation	SNP	HMMSmart_SM00239,HMMPfam_C2,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00323,superfamily_GTPase activation domain GAP,HMMPfam_RasGAP,PatternScan_RAS_GTPASE_ACTIV_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMSmart_SM00107,HMMPfam_BTK	p.R197Q	ENST00000261729.5	37	c.590	CCDS9165.1	12	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049257	0.55218	.	.	ENSG00000111344	ENST00000546530;ENST00000261729;ENST00000446861;ENST00000548055	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	5.55	5.55	0.83447	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.267836	0.35936	N	0.002891	T	0.55321	0.1913	L	0.36672	1.1	0.25146	N	0.990465	P;P;P;P;P;P;P	0.43412	0.637;0.803;0.584;0.637;0.482;0.806;0.584	B;B;B;B;B;B;B	0.40702	0.281;0.129;0.184;0.281;0.109;0.338;0.13	T	0.50508	-0.8820	10	0.13108	T	0.6	.	13.8649	0.63583	0.1534:0.8466:0.0:0.0	.	197;197;197;209;197;197;197	B7ZKM4;B4DG06;F8VRH9;Q59H24;F8VQX1;O95294;O95294-2	.;.;.;.;.;RASL1_HUMAN;.	Q	197	ENSP00000450244:R197Q;ENSP00000261729:R197Q;ENSP00000395920:R197Q;ENSP00000448510:R197Q	ENSP00000261729:R197Q	R	-	2	0	RASAL1	112041368	0.976000	0.34144	0.969000	0.41365	0.948000	0.59901	2.582000	0.46085	2.627000	0.88993	0.561000	0.74099	CGG	-	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2		0.607	RASAL1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL1	protein_coding	OTTHUMT00000405522.2	C	NM_004658		112041368	-1	no_errors	NM_004658	genbank	human	reviewed	54_36p	missense	SNP	0.978	T
HSPB8	26353	genome.wustl.edu	37	12	119617169	119617169	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr12:119617169C>G	ENST00000281938.2	+	1	723	c.52C>G	c.(52-54)Cga>Gga	p.R18G	RP11-64B16.4_ENST00000535921.1_RNA|RP11-64B16.3_ENST00000538405.1_RNA	NM_014365.2	NP_055180.1	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	18					cell death (GO:0008219)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	14	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCGCCTGCGCCGAGACCCCTT	0.617																																																0			12											87.0	103.0	97.0					12																	119617169		2203	4300	6503	118101552	SO:0001583	missense	26353			AF191017	CCDS9189.1	12q24.23	2014-09-17	2004-04-23					"""Heat shock proteins / HSPB"""	30171	protein-coding gene	gene with protein product		608014	"""heat shock 27kDa protein 8"""			10833516, 11085516	Standard	NM_014365		Approved	H11, E2IG1, HSP22, HspB8	uc001txb.3	Q9UJY1		ENST00000281938.2:c.52C>G	12.37:g.119617169C>G	ENSP00000281938:p.Arg18Gly	Somatic		Capture	Illumina GAIIx	4	118101552	B2R6A6|Q6FIH3|Q9UKS3	Missense_Mutation	SNP	superfamily_HSP20-like chaperones,HMMPfam_HSP20	p.R18G	ENST00000281938.2	37	c.52	CCDS9189.1	12	.	.	.	.	.	.	.	.	.	.	C	15.28	2.785377	0.49997	.	.	ENSG00000152137	ENST00000281938	D	0.87103	-2.21	4.42	1.11	0.20524	.	0.061061	0.64402	D	0.000011	T	0.81273	0.4788	L	0.50333	1.59	0.50813	D	0.99989	P	0.42757	0.789	B	0.37198	0.243	T	0.77877	-0.2424	9	.	.	.	.	13.9681	0.64221	0.4006:0.5994:0.0:0.0	.	18	Q9UJY1	HSPB8_HUMAN	G	18	ENSP00000281938:R18G	.	R	+	1	2	HSPB8	118101552	0.919000	0.31177	0.999000	0.59377	0.998000	0.95712	-0.043000	0.12043	0.446000	0.26666	0.563000	0.77884	CGA	-	NULL		0.617	HSPB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB8	protein_coding	OTTHUMT00000401647.1	C	NM_014365		118101552	+1	no_errors	NM_014365	genbank	human	reviewed	54_36p	missense	SNP	0.998	G
DMXL1	1657	genome.wustl.edu	37	5	118513137	118513137	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr5:118513137G>C	ENST00000311085.8	+	27	6924	c.6844G>C	c.(6844-6846)Gat>Cat	p.D2282H	DMXL1_ENST00000539542.1_Missense_Mutation_p.D2282H	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2282										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AGGAAGCTTAGATGAAGCATT	0.343																																																0			5											93.0	91.0	92.0					5																	118513137		2202	4300	6502	118541036	SO:0001583	missense	1657			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.6844G>C	5.37:g.118513137G>C	ENSP00000309690:p.Asp2282His	Somatic		Capture	Illumina GAIIx	4	118541036		Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_SUBTILASE_ASP,PatternScan_WD_REPEATS_1	p.D2282H	ENST00000311085.8	37	c.6844	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186688	0.78789	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.13420	2.6;2.59	5.96	5.96	0.96718	.	0.127282	0.64402	D	0.000001	T	0.37865	0.1019	M	0.71581	2.175	0.80722	D	1	D;D	0.60160	0.985;0.987	P;P	0.61940	0.896;0.789	T	0.03000	-1.1084	10	0.87932	D	0	-22.6059	20.0324	0.97544	0.0:0.0:1.0:0.0	.	2282;2282	F5H269;Q9Y485	.;DMXL1_HUMAN	H	2282	ENSP00000309690:D2282H;ENSP00000439479:D2282H	ENSP00000309690:D2282H	D	+	1	0	DMXL1	118541036	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.173000	0.94815	2.832000	0.97577	0.655000	0.94253	GAT	-	NULL		0.343	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	protein_coding	OTTHUMT00000250862.1	G	NM_005509		118541036	+1	no_errors	NM_005509	genbank	human	validated	54_36p	missense	SNP	1.000	C
DNAH10	196385	genome.wustl.edu	37	12	124272445	124272445	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr12:124272445G>C	ENST00000409039.3	+	10	1358	c.1333G>C	c.(1333-1335)Gag>Cag	p.E445Q		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	445	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGCCAAGATAGAGGCTTCGGG	0.557																																																0			12											52.0	47.0	49.0					12																	124272445		2203	4300	6503	122838398	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1333G>C	12.37:g.124272445G>C	ENSP00000386770:p.Glu445Gln	Somatic		Capture	Illumina GAIIx	4	122838398	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	HMMPfam_DHC_N1	p.E263Q	ENST00000409039.3	37	c.787	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	18.36	3.606620	0.66558	.	.	ENSG00000197653	ENST00000409039	T	0.55930	0.49	5.55	4.66	0.58398	Dynein heavy chain, domain-1 (1);	0.169822	0.35708	N	0.003032	T	0.75635	0.3876	M	0.91249	3.19	0.39819	D	0.972802	D	0.89917	1.0	D	0.87578	0.998	T	0.78550	-0.2161	10	0.26408	T	0.33	.	12.8649	0.57934	0.0758:0.0:0.9242:0.0	.	445	Q8IVF4	DYH10_HUMAN	Q	445	ENSP00000386770:E445Q	ENSP00000386770:E445Q	E	+	1	0	DNAH10	122838398	1.000000	0.71417	0.857000	0.33713	0.248000	0.25809	9.774000	0.98992	1.335000	0.45486	0.561000	0.74099	GAG	-	HMMPfam_DHC_N1		0.557	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	G			122838398	+1	no_errors	NM_207437	genbank	human	validated	54_36p	missense	SNP	1.000	C
UROC1	131669	genome.wustl.edu	37	3	126220122	126220122	+	Splice_Site	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr3:126220122C>T	ENST00000290868.2	-	10	957	c.904G>A	c.(904-906)Gaa>Aaa	p.E302K	UROC1_ENST00000383579.3_Missense_Mutation_p.E362K	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	302					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		TTCCTTGCTTCCCTGGAAGGA	0.587																																																0			3											179.0	170.0	173.0					3																	126220122		2203	4300	6503	127702812	SO:0001630	splice_region_variant	131669			AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.903-1G>A	3.37:g.126220122C>T		Somatic		Capture	Illumina GAIIx	4	127702812	E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	superfamily_Urocanase,HMMPfam_Urocanase,PatternScan_UROCANASE	p.E302K	ENST00000290868.2	37	c.904	CCDS3038.1	3	.	.	.	.	.	.	.	.	.	.	C	6.594	0.477972	0.12521	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.44881	0.91;0.91	4.83	4.83	0.62350	Urocanase domain (2);	0.104250	0.64402	D	0.000004	T	0.23926	0.0579	N	0.25201	0.72	0.50313	D	0.999868	B;B	0.14012	0.009;0.003	B;B	0.21360	0.034;0.013	T	0.07966	-1.0745	10	0.05525	T	0.97	-9.8843	9.1178	0.36769	0.0:0.8992:0.0:0.1008	.	362;302	E9PE13;Q96N76	.;HUTU_HUMAN	K	302;362	ENSP00000290868:E302K;ENSP00000373073:E362K	ENSP00000290868:E302K	E	-	1	0	UROC1	127702812	1.000000	0.71417	0.997000	0.53966	0.186000	0.23388	3.577000	0.53885	2.241000	0.73720	0.491000	0.48974	GAA	-	superfamily_Urocanase,HMMPfam_Urocanase		0.587	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROC1	protein_coding	OTTHUMT00000370325.2	C	NM_144639	Missense_Mutation	127702812	-1	no_errors	NM_144639	genbank	human	provisional	54_36p	missense	SNP	1.000	T
FLNC	2318	genome.wustl.edu	37	7	128478049	128478049	+	Silent	SNP	G	G	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr7:128478049G>C	ENST00000325888.8	+	6	1239	c.978G>C	c.(976-978)gtG>gtC	p.V326V	FLNC_ENST00000346177.6_Silent_p.V326V	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	326					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AGGCTAAGGTGGTTCCCAACA	0.562																																																0			7											126.0	133.0	131.0					7																	128478049		2068	4203	6271	128265285	SO:0001819	synonymous_variant	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.978G>C	7.37:g.128478049G>C		Somatic		Capture	Illumina GAIIx	4	128265285	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_E set domains,HMMPfam_Filamin,HMMSmart_SM00557	p.V326	ENST00000325888.8	37	c.978	CCDS43644.1	7																																																																																			-	superfamily_E set domains,HMMPfam_Filamin,HMMSmart_SM00557		0.562	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	protein_coding	OTTHUMT00000059948.3	G			128265285	+1	no_errors	NM_001458	genbank	human	reviewed	54_36p	silent	SNP	0.998	C
LRRC6	23639	genome.wustl.edu	37	8	133645116	133645116	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr8:133645116C>G	ENST00000519595.1	-	5	621	c.523G>C	c.(523-525)Gat>Cat	p.D175H	LRRC6_ENST00000518642.1_Missense_Mutation_p.D175H|LRRC6_ENST00000250173.1_Missense_Mutation_p.D175H|LRRC6_ENST00000520446.1_Intron			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	175					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			AGACAGTGATCTTTTTCCTGC	0.408																																																0			8											276.0	243.0	255.0					8																	133645116		2203	4300	6503	133714298	SO:0001583	missense	23639			U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.523G>C	8.37:g.133645116C>G	ENSP00000429791:p.Asp175His	Somatic		Capture	Illumina GAIIx	4	133714298	Q13648|Q4G183	Missense_Mutation	SNP	superfamily_Outer arm dynein light chain 1,HMMSmart_SM00365,HMMPfam_LRR_1,HMMSmart_SM00446,HMMPfam_CS	p.D175H	ENST00000519595.1	37	c.523		8	.	.	.	.	.	.	.	.	.	.	C	11.37	1.619215	0.28801	.	.	ENSG00000129295	ENST00000519595;ENST00000518642;ENST00000250173;ENST00000395414	T;T;T	0.54479	0.75;0.57;0.75	5.23	3.39	0.38822	.	0.485566	0.22220	N	0.062966	T	0.42223	0.1193	L	0.38531	1.155	0.27078	N	0.963166	P	0.40032	0.699	B	0.40534	0.332	T	0.26643	-1.0097	10	0.45353	T	0.12	-6.4462	9.0253	0.36224	0.1482:0.7748:0.0:0.077	.	175	Q86X45	LRRC6_HUMAN	H	175	ENSP00000429791:D175H;ENSP00000428610:D175H;ENSP00000250173:D175H	ENSP00000250173:D175H	D	-	1	0	LRRC6	133714298	1.000000	0.71417	0.993000	0.49108	0.356000	0.29392	1.348000	0.33987	0.666000	0.31087	0.555000	0.69702	GAT	-	NULL		0.408	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	LRRC6	protein_coding	OTTHUMT00000379578.1	C	NM_012472		133714298	-1	no_errors	NM_012472	genbank	human	provisional	54_36p	missense	SNP	1.000	G
UTRN	7402	genome.wustl.edu	37	6	144795801	144795801	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr6:144795801C>A	ENST00000367545.3	+	24	3242	c.3242C>A	c.(3241-3243)aCt>aAt	p.T1081N		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1081					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GAAATAGAGACTAATCTTCGA	0.363																																																0			6											105.0	105.0	105.0					6																	144795801		2203	4300	6503	144837494	SO:0001583	missense	7402			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.3242C>A	6.37:g.144795801C>A	ENSP00000356515:p.Thr1081Asn	Somatic		Capture	Illumina GAIIx	4	144837494	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC,superfamily_WW_Rsp5_WWP,HMMSmart_WW,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_SSF47473,HMMPfam_efhand_1,HMMPfam_efhand_2,HMMPfam_ZZ,HMMSmart_ZnF_ZZ,PatternScan_ZF_ZZ_1	p.T1081N	ENST00000367545.3	37	c.3242	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	C	4.479	0.088703	0.08583	.	.	ENSG00000152818	ENST00000367545	T	0.32988	1.43	5.68	4.81	0.61882	.	1.341790	0.05087	N	0.484530	T	0.12518	0.0304	N	0.22421	0.69	0.49213	D	0.99976	B	0.25169	0.119	B	0.30029	0.11	T	0.06844	-1.0804	10	0.17369	T	0.5	.	14.2938	0.66298	0.0:0.9291:0.0:0.0708	.	1081	P46939	UTRO_HUMAN	N	1081	ENSP00000356515:T1081N	ENSP00000356515:T1081N	T	+	2	0	UTRN	144837494	0.123000	0.22298	0.004000	0.12327	0.050000	0.14768	2.919000	0.48836	1.396000	0.46663	0.563000	0.77884	ACT	-	HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC		0.363	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	protein_coding	OTTHUMT00000042551.1	C			144837494	+1	no_errors	NM_007124	genbank	human	reviewed	54_36p	missense	SNP	0.032	A
EDNRA	1909	genome.wustl.edu	37	4	148406955	148406955	+	Missense_Mutation	SNP	G	G	A	rs188759418	byFrequency	TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr4:148406955G>A	ENST00000324300.5	+	2	637	c.122G>A	c.(121-123)cGt>cAt	p.R41H	EDNRA_ENST00000511804.1_Intron|EDNRA_ENST00000358556.4_Missense_Mutation_p.R41H|EDNRA_ENST00000506066.1_Missense_Mutation_p.R41H|EDNRA_ENST00000339690.5_Missense_Mutation_p.R41H	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	41					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.R41H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	ACCACTTTTCGTGGCACAGAG	0.458													G|||	2	0.000399361	0.0008	0.0	5008	,	,		20050	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	4											157.0	132.0	141.0					4																	148406955		2203	4300	6503	148626405	SO:0001583	missense	1909			D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.122G>A	4.37:g.148406955G>A	ENSP00000315011:p.Arg41His	Somatic		Capture	Illumina GAIIx	4	148626405	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R41H	ENST00000324300.5	37	c.122	CCDS3769.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.012	-1.652579	0.00785	.	.	ENSG00000151617	ENST00000358556;ENST00000339690;ENST00000394047;ENST00000324300;ENST00000506066	T;D;T;T	0.82081	0.36;-1.57;-0.84;0.36	5.96	-8.12	0.01078	.	1.356400	0.04488	N	0.379053	T	0.59569	0.2203	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.55224	-0.8174	10	0.35671	T	0.21	0.234	7.1544	0.25628	0.5417:0.1615:0.2318:0.0651	.	41;41;41	P25101-4;P25101-2;P25101	.;.;EDNRA_HUMAN	H	41	ENSP00000351359:R41H;ENSP00000341556:R41H;ENSP00000315011:R41H;ENSP00000425281:R41H	ENSP00000315011:R41H	R	+	2	0	EDNRA	148626405	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-1.997000	0.01470	-2.593000	0.00455	-1.945000	0.00491	CGT	-	NULL		0.458	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRA	protein_coding	OTTHUMT00000364635.1	G			148626405	+1	no_errors	NM_001957	genbank	human	validated	54_36p	missense	SNP	0.000	A
SMARCD3	6604	genome.wustl.edu	37	7	150937567	150937567	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr7:150937567C>A	ENST00000262188.8	-	9	1391	c.981G>T	c.(979-981)caG>caT	p.Q327H	RP4-548D19.3_ENST00000607902.1_RNA|SMARCD3_ENST00000356800.2_Missense_Mutation_p.Q314H|SMARCD3_ENST00000477169.1_5'Flank|SMARCD3_ENST00000392811.2_Missense_Mutation_p.Q314H|MIR671_ENST00000390183.1_RNA	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	327	SWIB.				cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGTGAGGCGCTGGGGAATCT	0.512																																																0			7											80.0	84.0	82.0					7																	150937567		2203	4300	6503	150568500	SO:0001583	missense	6604			U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.981G>T	7.37:g.150937567C>A	ENSP00000262188:p.Gln327His	Somatic		Capture	Illumina GAIIx	4	150568500	D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	Missense_Mutation	SNP	superfamily_SWIB/MDM2 domain,HMMPfam_SWIB,HMMSmart_SM00151	p.Q327H	ENST00000262188.8	37	c.981	CCDS34780.1	7	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532406	0.64972	.	.	ENSG00000082014	ENST00000262188;ENST00000392811;ENST00000356800;ENST00000347683	T;T;T	0.48522	0.82;0.81;0.81	5.16	4.29	0.51040	SWIB domain (1);SWIB/MDM2 domain (2);	0.000000	0.85682	D	0.000000	T	0.68430	0.3000	M	0.82630	2.6	0.80722	D	1	D;D	0.60575	0.988;0.984	D;P	0.72338	0.977;0.903	T	0.70498	-0.4855	10	0.44086	T	0.13	-21.1533	12.4211	0.55520	0.0:0.9182:0.0:0.0818	.	314;327	Q6STE5-2;Q6STE5	.;SMRD3_HUMAN	H	327;314;314;279	ENSP00000262188:Q327H;ENSP00000376558:Q314H;ENSP00000349254:Q314H	ENSP00000262188:Q327H	Q	-	3	2	SMARCD3	150568500	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.361000	0.34136	1.173000	0.42796	0.563000	0.77884	CAG	-	superfamily_SWIB/MDM2 domain,HMMPfam_SWIB,HMMSmart_SM00151		0.512	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD3	protein_coding	OTTHUMT00000348825.1	C	NM_001003801		150568500	-1	no_errors	NM_001003801	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
EIF2A	83939	genome.wustl.edu	37	3	150290101	150290101	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr3:150290101T>C	ENST00000460851.1	+	10	1277	c.1168T>C	c.(1168-1170)Tgg>Cgg	p.W390R	EIF2A_ENST00000273435.5_Missense_Mutation_p.W385R|EIF2A_ENST00000487799.1_Missense_Mutation_p.W365R|SERP1_ENST00000479209.1_Intron|EIF2A_ENST00000383043.3_Missense_Mutation_p.W176R|SERP1_ENST00000490945.1_Intron|EIF2A_ENST00000406576.3_Missense_Mutation_p.W329R			Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A, 65kDa	390					positive regulation of signal transduction (GO:0009967)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|ribosome assembly (GO:0042255)|SREBP signaling pathway (GO:0032933)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular space (GO:0005615)	ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)|tRNA binding (GO:0000049)			cervix(1)|endometrium(2)|kidney(1)|lung(3)	7		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ATACAAAATTTGGCATTATAC	0.413																																																0			3											73.0	66.0	68.0					3																	150290101		1865	4101	5966	151772791	SO:0001583	missense	83939			AF212241	CCDS46935.1	3q25.1	2011-01-19	2006-01-24		ENSG00000144895	ENSG00000144895			3254	protein-coding gene	gene with protein product		609234				12133843, 1620067	Standard	NM_032025		Approved	EIF-2A	uc003eya.3	Q9BY44	OTTHUMG00000159775	ENST00000460851.1:c.1168T>C	3.37:g.150290101T>C	ENSP00000417229:p.Trp390Arg	Somatic		Capture	Illumina GAIIx	4	151772791	A8MPS6|B4DF96|B4DQ14|D3DNI9|Q5QTR2|Q7Z4E9|Q8NFM1|Q96EW9|Q96K81	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMPfam_eIF2A	p.W390R	ENST00000460851.1	37	c.1168	CCDS46935.1	3	.	.	.	.	.	.	.	.	.	.	T	22.8	4.336118	0.81801	.	.	ENSG00000144895	ENST00000487799;ENST00000460851;ENST00000406576;ENST00000273435;ENST00000383043	T;T;T;T;T	0.61859	0.59;0.55;0.07;0.56;0.09	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);Translation initiation factor 2A, beta propellor-like domain (1);	0.000000	0.85682	D	0.000000	T	0.81197	0.4772	M	0.90759	3.145	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.996	D;D;D	0.87578	0.998;0.989;0.989	D	0.84942	0.0866	10	0.87932	D	0	-8.318	16.8222	0.85835	0.0:0.0:0.0:1.0	.	329;365;390	B4DF96;B4DQ14;Q9BY44	.;.;EIF2A_HUMAN	R	365;390;329;385;176	ENSP00000420537:W365R;ENSP00000417229:W390R;ENSP00000385292:W329R;ENSP00000273435:W385R;ENSP00000372513:W176R	ENSP00000273435:W385R	W	+	1	0	EIF2A	151772791	1.000000	0.71417	0.985000	0.45067	0.995000	0.86356	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	TGG	-	HMMPfam_eIF2A		0.413	EIF2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF2A	protein_coding	OTTHUMT00000357259.2	T	NM_032025		151772791	+1	no_errors	NM_032025	genbank	human	validated	54_36p	missense	SNP	1.000	C
SPTA1	6708	genome.wustl.edu	37	1	158614178	158614178	+	Silent	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:158614178C>T	ENST00000368147.4	-	30	4383	c.4203G>A	c.(4201-4203)caG>caA	p.Q1401Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1401					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.Q1401Q(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CACAGTTCCCCTGGAACATCT	0.458																																																1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	1											90.0	87.0	88.0					1																	158614178		1957	4151	6108	156880802	SO:0001819	synonymous_variant	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4203G>A	1.37:g.158614178C>T		Somatic		Capture	Illumina GAIIx	4	156880802	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_EF-hand,HMMPfam_efhand_Ca_insen	p.Q1401	ENST00000368147.4	37	c.4203	CCDS41423.1	1																																																																																			-	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150		0.458	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	C	NM_003126		156880802	-1	no_errors	NM_003126	genbank	human	reviewed	54_36p	silent	SNP	0.986	T
PTPRN2	5799	genome.wustl.edu	37	7	158334165	158334165	+	Intron	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr7:158334165G>A	ENST00000389418.4	-	1	122				PTPRN2_ENST00000389416.4_Intron|PTPRN2_ENST00000389413.3_Intron|AC078942.1_ENST00000448698.1_RNA|PTPRN2_ENST00000404321.2_Missense_Mutation_p.T45M|PTPRN2_ENST00000409483.1_Intron	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2						negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CACTGGCTCCGTCCTCTCCCT	0.527																																																0			7											171.0	159.0	163.0					7																	158334165		876	1991	2867	158026926	SO:0001627	intron_variant	5799			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.112+46084C>T	7.37:g.158334165G>A		Somatic		Capture	Illumina GAIIx	4	158026926	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.T49M	ENST00000389418.4	37	c.146	CCDS5947.1	7	.	.	.	.	.	.	.	.	.	.	G	3.609	-0.079902	0.07141	.	.	ENSG00000155093	ENST00000404321	T	0.03152	4.03	2.2	-4.4	0.03600	.	.	.	.	.	T	0.02571	0.0078	.	.	.	0.09310	N	1	D	0.53151	0.958	B	0.38156	0.266	T	0.34329	-0.9833	8	0.87932	D	0	.	4.4046	0.11402	0.0:0.295:0.4617:0.2433	.	45	Q92932-3	.	M	45	ENSP00000385464:T45M	ENSP00000385464:T45M	T	-	2	0	PTPRN2	158026926	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	-1.824000	0.01708	-0.704000	0.05042	0.467000	0.42956	ACG	-	NULL		0.527	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	protein_coding	OTTHUMT00000353214.1	G			158026926	-1	no_start_codon	ENST00000404321	ensembl	human	known	54_36p	missense	SNP	0.036	A
IGSF9	57549	genome.wustl.edu	37	1	159904217	159904217	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:159904217A>G	ENST00000368094.1	-	8	1156	c.959T>C	c.(958-960)cTc>cCc	p.L320P	IGSF9_ENST00000361509.3_Missense_Mutation_p.L320P|IGSF9_ENST00000493195.1_5'Flank	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	320					dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			AGGCTTACAGAGCACAGTGAG	0.647																																																0			1											50.0	41.0	44.0					1																	159904217		2197	4291	6488	158170841	SO:0001583	missense	57549			AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.959T>C	1.37:g.159904217A>G	ENSP00000357073:p.Leu320Pro	Somatic		Capture	Illumina GAIIx	4	158170841		Missense_Mutation	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMSmart_SM00408,HMMPfam_I-set,HMMPfam_ig,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III	p.L320P	ENST00000368094.1	37	c.959	CCDS44254.1	1	.	.	.	.	.	.	.	.	.	.	A	15.76	2.927847	0.52759	.	.	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.31247	1.5;1.5	4.65	4.65	0.58169	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.37095	N	0.002246	T	0.39145	0.1067	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.999;0.979	D;P	0.69654	0.965;0.756	T	0.21348	-1.0248	9	.	.	.	-11.563	12.0867	0.53702	1.0:0.0:0.0:0.0	.	320;320	Q9P2J2;C9JI81	TUTLA_HUMAN;.	P	320	ENSP00000355049:L320P;ENSP00000357073:L320P	.	L	-	2	0	IGSF9	158170841	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.710000	0.47169	1.947000	0.56498	0.482000	0.46254	CTC	-	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409		0.647	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	protein_coding	OTTHUMT00000059115.1	A	NM_020789		158170841	-1	no_errors	NM_020789	genbank	human	validated	54_36p	missense	SNP	1.000	G
NR1I3	9970	genome.wustl.edu	37	1	161209164	161209164	+	5'Flank	SNP	G	G	A	rs79769623	byFrequency	TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:161209164G>A	ENST00000367982.4	-	0	0				NR1I3_ENST00000428574.2_5'Flank|NR1I3_ENST00000508387.1_5'Flank|NR1I3_ENST00000511944.1_5'Flank|NR1I3_ENST00000512372.1_5'Flank|NR1I3_ENST00000367984.4_5'Flank|NR1I3_ENST00000515621.1_5'Flank|NR1I3_ENST00000367985.3_5'Flank|NR1I3_ENST00000508740.1_5'Flank|NR1I3_ENST00000367979.2_5'Flank|NR1I3_ENST00000511748.1_5'Flank|NR1I3_ENST00000437437.2_5'Flank|NR1I3_ENST00000367981.3_5'Flank|NR1I3_ENST00000412844.2_5'Flank|NR1I3_ENST00000505005.1_5'Flank|NR1I3_ENST00000442691.2_5'Flank|NR1I3_ENST00000502985.1_5'Flank|NR1I3_ENST00000367983.4_5'Flank|NR1I3_ENST00000504010.1_5'Flank|NR1I3_ENST00000367980.2_5'Flank|NR1I3_ENST00000515452.1_5'Flank|NR1I3_ENST00000511676.1_5'Flank|NR1I3_ENST00000506209.1_5'Flank			Q14994	NR1I3_HUMAN	nuclear receptor subfamily 1, group I, member 3						androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	15	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			agccgagatcgcagcactgca	0.557													g|||	834	0.166534	0.1354	0.111	5008	,	,		13028	0.2272		0.167	False		,,,				2504	0.1851															0			1																																								159475788	SO:0001631	upstream_gene_variant	0			Z30425	CCDS1228.1, CCDS41427.1, CCDS41428.1, CCDS41429.1, CCDS41430.1, CCDS44260.1, CCDS44261.1, CCDS44262.1, CCDS53405.1, CCDS53406.1, CCDS53407.1, CCDS53408.1, CCDS53409.1, CCDS53410.1, CCDS53411.1	1q23.3	2013-01-16			ENSG00000143257	ENSG00000143257		"""Nuclear hormone receptors"""	7969	protein-coding gene	gene with protein product	"""constitutive androstane receptor"""	603881				8114692	Standard	NM_001077480		Approved	MB67, CAR1, CAR	uc001fzp.3	Q14994	OTTHUMG00000034347		1.37:g.161209164G>A	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	159475788	E9PB75|E9PC13|E9PDU3|E9PGH6|E9PH10|E9PHC8|E9PHN4|F1D8Q0|F1D8Q1|Q0VAC9|Q4U0F0|Q5VTW5|Q5VTW6|Q6GZ68|Q6GZ76|Q6GZ77|Q6GZ78|Q6GZ79|Q6GZ82|Q6GZ83|Q6GZ84|Q6GZ85|Q6GZ87|Q6GZ89	Missense_Mutation	SNP	NULL	p.A12V	ENST00000367982.4	37	c.35	CCDS41430.1	1																																																																																			-	NULL		0.557	NR1I3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000215841	protein_coding	OTTHUMT00000083048.2	G			159475788	-1	no_start_codon:no_stop_codon	ENST00000400985	ensembl	human	known	54_36p	missense	SNP	0.000	A
HSPA6	3310	genome.wustl.edu	37	1	161494921	161494921	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:161494921A>G	ENST00000309758.4	+	1	886	c.473A>G	c.(472-474)cAg>cGg	p.Q158R	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	158					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TCGCAGCGCCAGGCCACCAAG	0.662																																																0			1											29.0	33.0	32.0					1																	161494921		2203	4299	6502	159761545	SO:0001583	missense	3310				CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.473A>G	1.37:g.161494921A>G	ENSP00000310219:p.Gln158Arg	Somatic		Capture	Illumina GAIIx	4	159761545	Q1HBA8|Q8IYK7|Q9BT95	Missense_Mutation	SNP	superfamily_Actin-like ATPase domain,HMMPfam_HSP70,PatternScan_HSP70_1,PatternScan_HSP70_2,PatternScan_HSP70_3,superfamily_Heat shock protein 70kD (HSP70) peptide-binding domain,superfamily_Heat shock protein 70kD (HSP70) C-terminal subdomain	p.Q158R	ENST00000309758.4	37	c.473	CCDS1231.1	1	.	.	.	.	.	.	.	.	.	.	.	13.67	2.306400	0.40795	.	.	ENSG00000173110	ENST00000309758;ENST00000545155	T	0.01119	5.31	3.43	3.43	0.39272	.	0.000000	0.41097	U	0.000949	T	0.02193	0.0068	H	0.96604	3.85	0.51482	D	0.999928	B	0.23591	0.088	B	0.32149	0.141	T	0.00936	-1.1508	10	0.72032	D	0.01	-10.7283	9.8777	0.41213	1.0:0.0:0.0:0.0	.	158	P17066	HSP76_HUMAN	R	158;134	ENSP00000310219:Q158R	ENSP00000310219:Q158R	Q	+	2	0	HSPA6	159761545	1.000000	0.71417	1.000000	0.80357	0.495000	0.33615	6.152000	0.71812	1.409000	0.46915	0.478000	0.44815	CAG	-	superfamily_Actin-like ATPase domain,HMMPfam_HSP70		0.662	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA6	protein_coding	OTTHUMT00000083308.1	A	NM_002155		159761545	+1	no_errors	NM_002155	genbank	human	validated	54_36p	missense	SNP	1.000	G
ETFDH	2110	genome.wustl.edu	37	4	159627945	159627945	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr4:159627945C>A	ENST00000511912.1	+	12	1965	c.1633C>A	c.(1633-1635)Cct>Act	p.P545T	ETFDH_ENST00000307738.5_Missense_Mutation_p.P498T	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	545					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		TGACAGTATACCTGTAAATAG	0.408																																																0			4											104.0	105.0	105.0					4																	159627945		2203	4300	6503	159847395	SO:0001583	missense	2110			S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.1633C>A	4.37:g.159627945C>A	ENSP00000426638:p.Pro545Thr	Somatic		Capture	Illumina GAIIx	4	159847395	B4E3R9|J3KND9|Q7Z347	Missense_Mutation	SNP	superfamily_FAD/NAD(P)-binding domain,HMMPfam_Pyr_redox_2,HMMPfam_ETF_QO	p.P545T	ENST00000511912.1	37	c.1633	CCDS3800.1	4	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962532	0.74016	.	.	ENSG00000171503	ENST00000511912;ENST00000307738	D;D	0.94330	-3.4;-3.4	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.97993	0.9339	H	0.96269	3.795	0.80722	D	1	D;D;D	0.71674	0.985;0.985;0.998	D;D;D	0.76575	0.94;0.94;0.988	D	0.98842	1.0755	10	0.87932	D	0	-16.6108	19.6878	0.95987	0.0:1.0:0.0:0.0	.	498;484;545	B4E3R9;B4DEQ0;Q16134	.;.;ETFD_HUMAN	T	545;498	ENSP00000426638:P545T;ENSP00000303552:P498T	ENSP00000303552:P498T	P	+	1	0	ETFDH	159847395	1.000000	0.71417	0.787000	0.31911	0.496000	0.33645	7.818000	0.86416	2.646000	0.89796	0.591000	0.81541	CCT	-	HMMPfam_ETF_QO		0.408	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETFDH	protein_coding	OTTHUMT00000365718.2	C			159847395	+1	no_errors	NM_004453	genbank	human	reviewed	54_36p	missense	SNP	0.995	A
MECOM	2122	genome.wustl.edu	37	3	168812908	168812908	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr3:168812908T>C	ENST00000464456.1	-	11	3584	c.2384A>G	c.(2383-2385)aAt>aGt	p.N795S	MECOM_ENST00000460814.1_Missense_Mutation_p.N795S|MECOM_ENST00000468789.1_Missense_Mutation_p.N804S|MECOM_ENST00000494292.1_Missense_Mutation_p.N983S|MECOM_ENST00000264674.3_Missense_Mutation_p.N869S|MECOM_ENST00000392736.3_Missense_Mutation_p.N804S|MECOM_ENST00000472280.1_Missense_Mutation_p.N805S|MECOM_ENST00000433243.2_Missense_Mutation_p.N805S	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						TCTGTCTAAATTGGTTTGTTG	0.353																																																0			3											185.0	161.0	169.0					3																	168812908		2203	4300	6503	170295602	SO:0001583	missense	2122			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2384A>G	3.37:g.168812908T>C	ENSP00000419770:p.Asn795Ser	Somatic		Capture	Illumina GAIIx	4	170295602	Q13466|Q6FH90	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.N868S	ENST00000464456.1	37	c.2603	CCDS54669.1	3	.	.	.	.	.	.	.	.	.	.	T	15.98	2.991992	0.54041	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21;3.21;3.21;3.21	5.78	5.78	0.91487	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.12008	0.0292	N	0.20328	0.56	0.80722	D	1	P;P;D;P;B	0.54964	0.951;0.668;0.969;0.837;0.45	P;B;P;B;P	0.52554	0.702;0.254;0.624;0.359;0.528	T	0.05699	-1.0869	10	0.52906	T	0.07	-10.2827	16.1138	0.81283	0.0:0.0:0.0:1.0	.	992;796;983;869;804	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	S	869;804;795;805;983;804;795;805	ENSP00000264674:N869S;ENSP00000376493:N804S;ENSP00000419770:N795S;ENSP00000420048:N805S;ENSP00000417899:N983S;ENSP00000419995:N804S;ENSP00000420466:N795S;ENSP00000394302:N805S	ENSP00000264674:N869S	N	-	2	0	MECOM	170295602	1.000000	0.71417	0.959000	0.39883	0.048000	0.14542	7.991000	0.88244	2.220000	0.72140	0.533000	0.62120	AAT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.353	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	EVI1	protein_coding	OTTHUMT00000351519.1	T	NM_005241, NM_004991		170295602	-1	no_errors	NM_001105077	genbank	human	validated	54_36p	missense	SNP	1.000	C
PLD1	5337	genome.wustl.edu	37	3	171427394	171427394	+	Silent	SNP	T	T	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr3:171427394T>A	ENST00000351298.4	-	10	1143	c.1017A>T	c.(1015-1017)cgA>cgT	p.R339R	PLD1_ENST00000340989.4_Silent_p.R339R|PLD1_ENST00000342215.6_Silent_p.R339R|PLD1_ENST00000356327.5_Silent_p.R339R	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	339					chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	ATGACCCAAATCGATGATCTT	0.388																																					NSCLC(149;2174 3517 34058)											0			3											169.0	158.0	162.0					3																	171427394		2203	4300	6503	172910088	SO:0001819	synonymous_variant	5337			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.1017A>T	3.37:g.171427394T>A		Somatic		Capture	Illumina GAIIx	4	172910088		Silent	SNP	HMMPfam_PX,HMMSmart_SM00312,superfamily_PX domain,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Phospholipase D/nuclease,HMMPfam_PLDc,HMMSmart_SM00155	p.R339	ENST00000351298.4	37	c.1017	CCDS3216.1	3																																																																																			-	superfamily_Phospholipase D/nuclease		0.388	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	protein_coding	OTTHUMT00000346730.2	T	NM_002662		172910088	-1	no_errors	NM_002662	genbank	human	validated	54_36p	silent	SNP	0.996	A
ACBD6	84320	genome.wustl.edu	37	1	180405030	180405030	+	Intron	SNP	C	C	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:180405030C>A	ENST00000367595.3	-	4	1072				MIR3121_ENST00000579680.1_RNA	NM_032360.3	NP_115736.1	Q9BR61	ACBD6_HUMAN	acyl-CoA binding domain containing 6							cytoplasm (GO:0005737)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)		ACBD6/RRP15(2)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	7						GCAAGAACGTCAATGGTGGTG	0.403																																																0			1																																								178671653	SO:0001627	intron_variant	0			BC006505	CCDS1339.1	1q25.1	2013-10-11	2010-04-30		ENSG00000135847			"""Ankyrin repeat domain containing"""	23339	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 6"""			18268358	Standard	NM_032360		Approved	MGC2404	uc001gog.3	Q9BR61	OTTHUMG00000035117	ENST00000367595.3:c.385-5633G>T	1.37:g.180405030C>A		Somatic		Capture	Illumina GAIIx	4	178671653		RNA	SNP	-	NULL	ENST00000367595.3	37	NULL	CCDS1339.1	1																																																																																			-	-		0.403	ACBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100130511	protein_coding	OTTHUMT00000084998.1	C	NM_032360		178671653	+1	pseudogene	XR_038100	genbank	human	model	54_36p	rna	SNP	1.000	A
TRIM7	81786	genome.wustl.edu	37	5	180627120	180627120	+	Intron	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr5:180627120G>A	ENST00000274773.7	-	3	680				CTC-338M12.6_ENST00000502812.2_RNA|CTC-338M12.6_ENST00000419707.2_RNA|TRIM7_ENST00000422067.2_Intron|CTC-338M12.6_ENST00000509080.1_RNA|TRIM7_ENST00000393319.3_Missense_Mutation_p.H12Y|CTC-338M12.6_ENST00000511517.1_RNA|CTC-338M12.6_ENST00000512508.1_RNA|TRIM7_ENST00000361809.3_Intron|TRIM7_ENST00000504241.1_5'Flank|TRIM7_ENST00000393315.1_Intron|CTC-338M12.6_ENST00000514784.1_RNA	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7							cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		ACTTGAACATGGAGACATAAC	0.582																																					Esophageal Squamous(128;2258 2308 35507 48647)											0			5											66.0	66.0	66.0					5																	180627120		2203	4300	6503	180559726	SO:0001627	intron_variant	81786			AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.619-39C>T	5.37:g.180627120G>A		Somatic		Capture	Illumina GAIIx	4	180559726	A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Missense_Mutation	SNP	HMMSmart_PRY,HMMPfam_SPRY,HMMSmart_SPRY	p.H12Y	ENST00000274773.7	37	c.34	CCDS4462.1	5	.	.	.	.	.	.	.	.	.	.	G	13.83	2.355519	0.41700	.	.	ENSG00000146054	ENST00000393319	T	0.58506	0.33	4.81	-7.1	0.01547	.	.	.	.	.	T	0.29783	0.0744	.	.	.	0.09310	N	1	B	0.22683	0.073	B	0.25405	0.06	T	0.20806	-1.0264	7	.	.	.	.	2.2512	0.04043	0.1313:0.1483:0.2113:0.5091	.	12	Q9C029-4	.	Y	12	ENSP00000376994:H12Y	.	H	-	1	0	TRIM7	180559726	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-2.294000	0.01144	-0.760000	0.04677	0.462000	0.41574	CAT	-	NULL		0.582	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM7	protein_coding	OTTHUMT00000253569.3	G	NM_203296		180559726	-1	no_errors	NM_203297	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
HMCN1	83872	genome.wustl.edu	37	1	186136015	186136015	+	Missense_Mutation	SNP	G	G	A	rs147769095	byFrequency	TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:186136015G>A	ENST00000271588.4	+	100	15744	c.15515G>A	c.(15514-15516)cGc>cAc	p.R5172H	HMCN1_ENST00000367492.2_Missense_Mutation_p.R5172H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5172	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGATCTTATCGCTGTGTGGTC	0.453													G|||	3	0.000599042	0.0015	0.0	5008	,	,		20248	0.0		0.001	False		,,,				2504	0.0															0			1						G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	230.0	193.0	206.0		15515	2.8	1.0	1	dbSNP_134	206	7,8593	5.7+/-21.5	0,7,4293	yes	missense	HMCN1	NM_031935.2	29	0,8,6495	AA,AG,GG		0.0814,0.0227,0.0615	benign	5172/5636	186136015	8,12998	2203	4300	6503	184402638	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15515G>A	1.37:g.186136015G>A	ENSP00000271588:p.Arg5172His	Somatic		Capture	Illumina GAIIx	4	184402638	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	superfamily_vWA-like,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,HMMPfam_I-set,HMMSmart_SM00406,PatternScan_CECROPIN,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00682,HMMPfam_G2F,superfamily_GFP-like,PatternScan_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,HMMPfam_EGF_CA,PatternScan_EGF_2	p.R5172H	ENST00000271588.4	37	c.15515	CCDS30956.1	1	3	0.0013736263736263737	2	0.0040650406504065045	0	0.0	0	0.0	1	0.0013192612137203166	G	13.88	2.370369	0.42003	2.27E-4	8.14E-4	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.92446	-3.04;-3.04	5.69	2.84	0.33178	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);	0.171741	0.52532	N	0.000063	D	0.83727	0.5317	L	0.31752	0.955	0.39120	D	0.961649	B	0.17268	0.021	B	0.15052	0.012	T	0.72966	-0.4131	10	0.27785	T	0.31	.	5.5803	0.17247	0.3276:0.0:0.5475:0.1249	.	5172	Q96RW7	HMCN1_HUMAN	H	5172	ENSP00000271588:R5172H;ENSP00000356462:R5172H	ENSP00000271588:R5172H	R	+	2	0	HMCN1	184402638	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.037000	0.49775	0.353000	0.24079	-0.140000	0.14226	CGC	-	PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,HMMSmart_SM00181,superfamily_EGF/Laminin		0.453	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	G	NM_031935		184402638	+1	no_errors	NM_031935	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
YEATS2	55689	genome.wustl.edu	37	3	183474439	183474439	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr3:183474439A>C	ENST00000305135.5	+	12	1709	c.1514A>C	c.(1513-1515)cAg>cCg	p.Q505P		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	505					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ATGGACAAGCAGCCGGGGCAG	0.463																																																0			3											65.0	70.0	68.0					3																	183474439		1912	4136	6048	184957133	SO:0001583	missense	55689			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.1514A>C	3.37:g.183474439A>C	ENSP00000306983:p.Gln505Pro	Somatic		Capture	Illumina GAIIx	4	184957133	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	HMMPfam_YEATS	p.Q505P	ENST00000305135.5	37	c.1514	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	A	6.001	0.368610	0.11352	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.29655	1.56	0.235	0.235	0.15431	.	.	.	.	.	T	0.13286	0.0322	N	0.08118	0	0.25722	N	0.98537	P	0.34662	0.462	B	0.32805	0.153	T	0.20240	-1.0281	8	0.34782	T	0.22	.	.	.	.	.	505	Q9ULM3	YETS2_HUMAN	P	505	ENSP00000306983:Q505P	ENSP00000306983:Q505P	Q	+	2	0	YEATS2	184957133	1.000000	0.71417	0.995000	0.50966	0.763000	0.43281	2.637000	0.46553	0.263000	0.21812	0.260000	0.18958	CAG	-	NULL		0.463	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	protein_coding	OTTHUMT00000346507.2	A	NM_018023		184957133	+1	no_errors	NM_018023	genbank	human	provisional	54_36p	missense	SNP	0.999	C
ABCC5	10057	genome.wustl.edu	37	3	183669341	183669341	+	Silent	SNP	G	G	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr3:183669341G>A	ENST00000334444.6	-	20	3072	c.2832C>T	c.(2830-2832)tcC>tcT	p.S944S	ABCC5_ENST00000265586.6_Silent_p.S944S	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	944	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GCAGCCGGGAGGAAGCTCGCA	0.577																																																0			3											60.0	66.0	64.0					3																	183669341		2061	4216	6277	185152035	SO:0001819	synonymous_variant	10057			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.2832C>T	3.37:g.183669341G>A		Somatic		Capture	Illumina GAIIx	4	185152035	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.S944	ENST00000334444.6	37	c.2832	CCDS43176.1	3																																																																																			-	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane		0.577	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	protein_coding	OTTHUMT00000346350.1	G	NM_005688		185152035	-1	no_errors	NM_005688	genbank	human	reviewed	54_36p	silent	SNP	0.997	A
TMEFF2	23671	genome.wustl.edu	37	2	193049114	193049114	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr2:193049114C>A	ENST00000272771.5	-	3	1562	c.378G>T	c.(376-378)gaG>gaT	p.E126D	TMEFF2_ENST00000392314.1_Missense_Mutation_p.E126D|TMEFF2_ENST00000409056.3_Missense_Mutation_p.E126D	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2	126	Kazal-like 1. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			CCACAAGTATCTCACTCTGCT	0.468																																					Pancreas(50;1277 1381 28487 47072)											0			2											209.0	170.0	183.0					2																	193049114		2203	4300	6503	192757359	SO:0001583	missense	23671			AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.378G>T	2.37:g.193049114C>A	ENSP00000272771:p.Glu126Asp	Somatic		Capture	Illumina GAIIx	4	192757359	Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Missense_Mutation	SNP	superfamily_Kazal-type serine protease inhibitors,HMMSmart_SM00280,HMMPfam_Kazal_1,superfamily_EGF/Laminin,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2	p.E126D	ENST00000272771.5	37	c.378	CCDS2314.1	2	.	.	.	.	.	.	.	.	.	.	C	17.92	3.505955	0.64410	.	.	ENSG00000144339	ENST00000392314;ENST00000272771;ENST00000409056	T;T;T	0.05081	3.5;3.5;3.5	5.57	2.36	0.29203	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.000000	0.85682	D	0.000000	T	0.09024	0.0223	N	0.25094	0.71	0.47183	D	0.999341	D;P	0.67145	0.996;0.51	P;B	0.60609	0.877;0.216	T	0.38351	-0.9665	10	0.22706	T	0.39	-17.6919	9.4021	0.38440	0.0:0.5925:0.0:0.4075	.	126;126	Q9UIK5-3;Q9UIK5	.;TEFF2_HUMAN	D	126	ENSP00000376128:E126D;ENSP00000272771:E126D;ENSP00000386871:E126D	ENSP00000272771:E126D	E	-	3	2	TMEFF2	192757359	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.790000	0.26900	0.725000	0.32318	-0.216000	0.12614	GAG	-	superfamily_Kazal-type serine protease inhibitors,HMMSmart_SM00280,HMMPfam_Kazal_1		0.468	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEFF2	protein_coding	OTTHUMT00000256065.2	C	NM_016192		192757359	-1	no_errors	NM_016192	genbank	human	provisional	54_36p	missense	SNP	0.999	A
CFHR2	3080	genome.wustl.edu	37	1	196876081	196876081	+	Intron	SNP	A	A	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:196876081A>T	ENST00000367421.3	+	2	135				CFHR4_ENST00000251424.4_Intron|CFHR4_ENST00000367416.2_Missense_Mutation_p.Y176F|CFHR4_ENST00000367418.2_Intron|CFHR4_ENST00000608469.1_Intron			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TATGAATGCTATGATGGATAT	0.383																																																0			1																																								195142704	SO:0001627	intron_variant	10877			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-42504A>T	1.37:g.196876081A>T		Somatic		Capture	Illumina GAIIx	4	195142704	Q14310|Q5T9T1	Missense_Mutation	SNP	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.Y177F	ENST00000367421.3	37	c.530		1	.	.	.	.	.	.	.	.	.	.	.	10.38	1.332999	0.24167	.	.	ENSG00000134365	ENST00000367416	T	0.64260	-0.09	2.96	-5.92	0.02261	.	.	.	.	.	T	0.58963	0.2159	M	0.72353	2.195	0.09310	N	1	P;P	0.50819	0.67;0.939	P;P	0.52710	0.707;0.557	T	0.49862	-0.8894	9	0.10902	T	0.67	.	4.2562	0.10719	0.2042:0.0:0.3322:0.4636	.	176;177	C9J7J7;Q5DVJ7	.;.	F	176	ENSP00000356386:Y176F	ENSP00000356386:Y176F	Y	+	2	0	CFHR4	195142704	0.000000	0.05858	0.000000	0.03702	0.678000	0.39670	-2.954000	0.00676	-1.925000	0.01063	0.352000	0.21897	TAT	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.383	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	CFHR4	protein_coding		A	NM_005666		195142704	+1	no_errors	ENST00000367416	ensembl	human	known	54_36p	missense	SNP	0.008	T
ST13P19	100131961	genome.wustl.edu	37	1	210440486	210440486	+	IGR	SNP	C	C	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:210440486C>T								SERTAD4 (20886 upstream) : HHAT (61109 downstream)																							TGCTCTCCACCCACTCTCTCA	0.468																																																0			1																																								208507109	SO:0001628	intergenic_variant	0																															1.37:g.210440486C>T		Somatic		Capture	Illumina GAIIx	4	208507109		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.468					LOC100131961			C			208507109	-1	pseudogene	XR_036984	genbank	human	model	54_36p	rna	SNP	0.989	T
CNIH4	29097	genome.wustl.edu	37	1	224559064	224559064	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:224559064A>T	ENST00000465271.1	+	4	406	c.331A>T	c.(331-333)Atg>Ttg	p.M111L	CNIH4_ENST00000366858.3_Intron|CNIH4_ENST00000468318.1_3'UTR|CNIH4_ENST00000366856.3_Missense_Mutation_p.M111L|CNIH4_ENST00000366857.5_Intron	NM_014184.3	NP_054903.1	Q9P003	CNIH4_HUMAN	cornichon family AMPA receptor auxiliary protein 4	111					intracellular signal transduction (GO:0035556)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(3)|lung(2)|ovary(2)	7				GBM - Glioblastoma multiforme(131;0.00341)		GAAGTCACACATGAAAGAAGC	0.398																																																0			1											211.0	188.0	196.0					1																	224559064		2203	4300	6503	222625687	SO:0001583	missense	29097				CCDS1543.1, CCDS60429.1, CCDS60430.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143771	ENSG00000143771			25013	protein-coding gene	gene with protein product			"""cornichon homolog 4 (Drosophila)"""			11042152	Standard	NM_014184		Approved	HSPC163	uc001hom.2	Q9P003	OTTHUMG00000037635	ENST00000465271.1:c.331A>T	1.37:g.224559064A>T	ENSP00000420443:p.Met111Leu	Somatic		Capture	Illumina GAIIx	4	222625687	A8K1Q8|B2R553|Q9H0X8	Missense_Mutation	SNP	HMMPfam_Cornichon	p.M111L	ENST00000465271.1	37	c.331	CCDS1543.1	1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.456224	0.26161	.	.	ENSG00000143771	ENST00000465271;ENST00000366856	T;T	0.39056	1.1;1.1	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.26593	0.0650	N	0.20328	0.56	0.80722	D	1	B	0.09022	0.002	B	0.11329	0.006	T	0.10800	-1.0614	10	0.02654	T	1	-28.6929	15.7712	0.78170	1.0:0.0:0.0:0.0	.	111	Q9P003	CNIH4_HUMAN	L	111	ENSP00000420443:M111L;ENSP00000355821:M111L	ENSP00000355821:M111L	M	+	1	0	CNIH4	222625687	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.221000	0.95188	2.174000	0.68829	0.533000	0.62120	ATG	-	HMMPfam_Cornichon		0.398	CNIH4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNIH4	protein_coding	OTTHUMT00000091754.1	A	NM_014184		222625687	+1	no_errors	NM_014184	genbank	human	provisional	54_36p	missense	SNP	1.000	T
BRCA2	675	genome.wustl.edu	37	13	32971045	32971048	+	Frame_Shift_Del	DEL	TACT	TACT	-	rs80359769|rs80359768		TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	TACT	TACT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr13:32971045_32971048delTACT	ENST00000380152.3	+	26	9745_9748	c.9512_9515delTACT	c.(9511-9516)atacttfs	p.IL3171fs	BRCA2_ENST00000544455.1_Frame_Shift_Del_p.IL3171fs			P51587	BRCA2_HUMAN	breast cancer 2, early onset	3171					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AATATTGACATACTTTGCAATGAA	0.358			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0			13																																								31869048	SO:0001589	frameshift_variant	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.9512_9515delTACT	13.37:g.32971045_32971048delTACT	ENSP00000369497:p.Ile3171fs	Somatic		Capture	Illumina GAIIx	4	31869045	O00183|O15008|Q13879|Q5TBJ7	Frame_Shift_Del	DEL	HMMPfam_BRCA2,superfamily_BRCA2_helical,HMMPfam_BRCA-2_helical,superfamily_Nucleic_acid_OB,HMMPfam_BRCA-2_OB1,HMMPfam_Tower,superfamily_SSF81878,HMMPfam_BRCA-2_OB3	p.L3172fs	ENST00000380152.3	37	c.9512_9515	CCDS9344.1	13																																																																																			(deletion:cds_exon[31869035,31869181])	HMMPfam_BRCA-2_OB3,superfamily_Nucleic_acid_OB		0.358	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	protein_coding	OTTHUMT00000046000.2	TACT	NM_000059		31869048	+1	no_errors	NM_000059	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.000:0.000:0.595:0.744	-
DSN1	79980	genome.wustl.edu	37	20	35396374	35396374	+	Frame_Shift_Del	DEL	G	G	-			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr20:35396374delG	ENST00000426836.1	-	4	799	c.427delC	c.(427-429)cagfs	p.Q143fs	DSN1_ENST00000373734.4_Frame_Shift_Del_p.Q36fs|DSN1_ENST00000373750.4_Frame_Shift_Del_p.Q143fs|DSN1_ENST00000373745.3_Frame_Shift_Del_p.Q143fs|DSN1_ENST00000448110.2_Frame_Shift_Del_p.Q127fs|DSN1_ENST00000473615.1_5'UTR|DSN1_ENST00000373740.3_Frame_Shift_Del_p.Q71fs	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component	143					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)		p.Q143*(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				AACCTTACCTGGAAACTGGAA	0.418																																																1	Substitution - Nonsense(1)	skin(1)	20											110.0	106.0	107.0					20																	35396374		2203	4300	6503	34829788	SO:0001589	frameshift_variant	79980			AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.427delC	20.37:g.35396374delG	ENSP00000389810:p.Gln143fs	Somatic		Capture	Illumina GAIIx	4	34829788	B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	Frame_Shift_Del	DEL	HMMPfam_Mis12_component	p.Q143fs	ENST00000426836.1	37	c.427	CCDS13286.1	20																																																																																			(deletion:cds_exon[34829786,34829859])	HMMPfam_Mis12_component		0.418	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSN1	protein_coding	OTTHUMT00000079043.2	G	NM_024918		34829788	-1	no_errors	NM_024918	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
KRTAP9-9	81870	genome.wustl.edu	37	17	39412139	39412141	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	TGC	TGC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr17:39412139_39412141delTGC	ENST00000394008.1	+	1	504_506	c.502_504delTGC	c.(502-504)tgcdel	p.C169del		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	154						keratin filament (GO:0045095)		p.C168C(1)		endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CCAGCCTTCTTGCTGCTGATCAA	0.547																																																1	Substitution - coding silent(1)	endometrium(1)	17																																								36665667	SO:0001651	inframe_deletion	81870			AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.502_504delTGC	17.37:g.39412142_39412144delTGC	ENSP00000377576:p.Cys169del	Somatic		Capture	Illumina GAIIx	4	36665665	B5MDD6|Q9BYQ1	In_Frame_Del	DEL	HMMPfam_Keratin_B2	p.C154in_frame_del	ENST00000394008.1	37	c.457_459	CCDS54127.1	17																																																																																			(deletion:cds_exon[36665424,36665673])	NULL		0.547	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-9	protein_coding	OTTHUMT00000257710.1	TGC	NM_030975		36665667	+1	no_errors	NM_030975	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.864:0.914:0.972	-
RPS11	6205	genome.wustl.edu	37	19	50003817	50003818	+	IGR	INS	-	-	AG	rs532302136|rs138052193|rs72372238		TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr19:50003817_50003818insAG	ENST00000270625.2	+	0	614				SNORD35B_ENST00000363660.1_RNA|MIR150_ENST00000385048.1_RNA|hsa-mir-150_ENST00000602157.1_Frame_Shift_Ins_p.Q13fs	NM_001015.4	NP_001006.1	P62280	RS11_HUMAN	ribosomal protein S11						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	7		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00206)|GBM - Glioblastoma multiforme(486;0.0245)		GGGGAGAGCACAGACCACCGCG	0.629																																																0			19																																								54695630	SO:0001628	intergenic_variant	0			AB007152	CCDS12769.1	19q13.3	2011-08-03			ENSG00000142534	ENSG00000142534		"""S ribosomal proteins"""	10384	protein-coding gene	gene with protein product	"""40S ribosomal protein S11"""	180471				1577483, 9582194	Standard	NM_001015		Approved	S11	uc002pob.2	P62280			19.37:g.50003818_50003819dupAG		Somatic		Capture	Illumina GAIIx	4	54695629	B2R4F5|P04643|Q498Y6|Q6IRY0	Frame_Shift_Ins	INS	NULL	p.T14fs	ENST00000270625.2	37	c.37_38	CCDS12769.1	19																																																																																			-	NULL		0.629	RPS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128528	protein_coding	OTTHUMT00000465288.1	-	NM_001015		54695630	+1	no_errors	XM_001724244	genbank	human	model	54_36p	frame_shift_ins	INS	0.000:0.000	AG
FAM111A	63901	genome.wustl.edu	37	11	58919404	58919404	+	Frame_Shift_Del	DEL	G	G	-			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr11:58919404delG	ENST00000528737.1	+	5	3081	c.263delG	c.(262-264)agafs	p.R88fs	FAM111A_ENST00000420244.1_Frame_Shift_Del_p.R88fs|FAM111A_ENST00000533703.1_Frame_Shift_Del_p.R88fs|FAM111A_ENST00000361723.3_Frame_Shift_Del_p.R88fs|FAM111A_ENST00000531147.1_Frame_Shift_Del_p.R88fs			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	88					defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				AACCACAGGAGAAACCAAGAT	0.403																																																0			11											106.0	106.0	106.0					11																	58919404		2201	4295	6496	58675980	SO:0001589	frameshift_variant	63901			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.263delG	11.37:g.58919404delG	ENSP00000434435:p.Arg88fs	Somatic		Capture	Illumina GAIIx	4	58675980	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Frame_Shift_Del	DEL	superfamily_Pept_Ser_Cys	p.R88fs	ENST00000528737.1	37	c.263	CCDS7973.1	11																																																																																			(deletion:cds_exon[58675799,58677553])	NULL		0.403	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	protein_coding	OTTHUMT00000393975.1	G	NM_022074		58675980	+1	no_errors	NM_022074	genbank	human	validated	54_36p	frame_shift_del	DEL	0.000	-
LRRC32	2615	genome.wustl.edu	37	11	76371354	76371354	+	Frame_Shift_Del	DEL	G	G	-			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr11:76371354delG	ENST00000407242.2	-	3	1525	c.1283delC	c.(1282-1284)ccafs	p.P428fs	LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000404995.1_Frame_Shift_Del_p.P428fs|LRRC32_ENST00000260061.5_Frame_Shift_Del_p.P428fs|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	428					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						AGGCTCATCTGGCCCCCCACA	0.662																																																0			11											19.0	20.0	19.0					11																	76371354		2199	4291	6490	76049002	SO:0001589	frameshift_variant	2615			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1283delC	11.37:g.76371354delG	ENSP00000384126:p.Pro428fs	Somatic		Capture	Illumina GAIIx	4	76049002	Q86V06	Frame_Shift_Del	DEL	HMMPfam_LRRNT,HMMSmart_LRRNT,superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRR_TYP	p.P428fs	ENST00000407242.2	37	c.1283	CCDS8245.1	11																																																																																			(deletion:cds_exon[76048296,76050200])	superfamily_SSF52058		0.662	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	protein_coding	OTTHUMT00000257926.2	G	NM_005512		76049002	-1	no_errors	NM_005512	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.000	-
SPOPL	339745	genome.wustl.edu	37	2	139322292	139322300	+	In_Frame_Del	DEL	GCTGAAGGT	GCTGAAGGT	-			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	GCTGAAGGT	GCTGAAGGT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr2:139322292_139322300delGCTGAAGGT	ENST00000280098.4	+	9	1231_1239	c.852_860delGCTGAAGGT	c.(850-861)cggctgaaggtc>cgc	p.LKV285del		NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	285					negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		CACTGGAACGGCTGAAGGTCATGTGCGAA	0.392																																																0			2																																								139038770	SO:0001651	inframe_deletion	339745				CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.852_860delGCTGAAGGT	2.37:g.139322292_139322300delGCTGAAGGT	ENSP00000280098:p.Leu285_Val287del	Somatic		Capture	Illumina GAIIx	4	139038762		In_Frame_Del	DEL	superfamily_Traf_like,HMMSmart_MATH,HMMPfam_MATH,superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB	p.LKV285in_frame_del	ENST00000280098.4	37	c.852_860	CCDS33298.1	2																																																																																			(deletion:cds_exon[139038748,139038890])	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB		0.392	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOPL	protein_coding	OTTHUMT00000331897.1	GCTGAAGGT			139038770	+1	no_errors	NM_001001664	genbank	human	validated	54_36p	in_frame_del	DEL	0.996:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
HEATR1	55127	genome.wustl.edu	37	1	236719544	236719558	+	Splice_Site	DEL	CTCCAGATGAATCAC	CTCCAGATGAATCAC	-			TCGA-29-1693-01A-01W-0633-09	TCGA-29-1693-10A-01W-0633-09	CTCCAGATGAATCAC	CTCCAGATGAATCAC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f86c7b2-2bf7-469c-92a6-eea9263daf4f	d6e9cf10-809b-49cb-9229-cf05553458d9	g.chr1:236719544_236719558delCTCCAGATGAATCAC	ENST00000366582.3	-	38	5470_5484	c.5356_5370delGTGATTCATCTGGAG	c.(5356-5370)gtgattcatctggagdel	p.VIHLE1786del	HEATR1_ENST00000366581.2_Splice_Site_p.VIHLE1705del	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1786					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TAGTGATTTTCTCCAGATGAATCACCTACAGGAAT	0.447																																																0			1																																								234786181	SO:0001630	splice_region_variant	55127			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.5356-1GTGATTCATCTGGAG>-	1.37:g.236719544_236719558delCTCCAGATGAATCAC		Somatic		Capture	Illumina GAIIx	4	234786167	Q5T3Q8|Q6P197|Q9NW23	In_Frame_Del	DEL	superfamily_ARM-type_fold,HMMPfam_HEAT,HMMPfam_BP28CT	p.VIHLE1786in_frame_del	ENST00000366582.3	37	c.5370_5356	CCDS31066.1	1																																																																																			(deletion:cds_exon[234786023,234786181])	superfamily_ARM-type_fold		0.447	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	protein_coding	OTTHUMT00000096635.1	CTCCAGATGAATCAC	XM_375853	In_Frame_Del	234786181	-1	no_errors	NM_018072	genbank	human	validated	54_36p	in_frame_del	DEL	1.000:1.000:0.999:0.932:0.915:0.802:0.780:0.913:0.992:0.992:0.996:0.997:0.997:0.998:0.999	-
