#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MUC5AC	4586	genome.wustl.edu	37	11	1212846	1212846	+	3'UTR	SNP	T	T	C	rs137895563		TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr11:1212846T>C	ENST00000358378.6	+	0	87							P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		caacctctgctcctacaacca	0.532																																																0			11																																								1169422	SO:0001624	3_prime_UTR_variant	4586			AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000358378.6:c.*84T>C	11.37:g.1212846T>C		Somatic		Capture	Illumina GAIIx	4	1169422	O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	Silent	SNP	HMMSmart_SM00214,HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,PatternScan_VWFC_1,HMMPfam_VWC,HMMPfam_Cys_knot,HMMSmart_SM00041,PatternScan_CTCK_1	p.A31	ENST00000358378.6	37	c.93		11																																																																																			-	NULL		0.532	MUC5AC-002	PUTATIVE	basic|exp_conf	processed_transcript	MUC5AC	protein_coding	OTTHUMT00000396096.2	T	XM_001130382		1169422	+1	no_start_codon	ENST00000358378	ensembl	human	known	54_36p	silent	SNP	0.000	C
APBB1	322	genome.wustl.edu	37	11	6424974	6424974	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr11:6424974C>A	ENST00000609360.1	-	3	899	c.800G>T	c.(799-801)gGg>gTg	p.G267V	APBB1_ENST00000608645.1_Missense_Mutation_p.G8V|APBB1_ENST00000389906.2_Missense_Mutation_p.G267V|APBB1_ENST00000608655.1_Missense_Mutation_p.G47V|APBB1_ENST00000608704.1_Missense_Mutation_p.G8V|APBB1_ENST00000529519.1_Intron|APBB1_ENST00000609331.1_Missense_Mutation_p.G32V|APBB1_ENST00000299402.6_Missense_Mutation_p.G267V|APBB1_ENST00000530885.1_Missense_Mutation_p.G47V|APBB1_ENST00000608394.1_Missense_Mutation_p.G8V|APBB1_ENST00000311051.3_Missense_Mutation_p.G267V	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	267	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		GTAATAGGTCCCTGAGGTGTC	0.652																																					GBM(147;1810 2556 5672 39622)											0			11											79.0	76.0	77.0					11																	6424974		2201	4296	6497	6381550	SO:0001583	missense	322			L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.800G>T	11.37:g.6424974C>A	ENSP00000477213:p.Gly267Val	Somatic		Capture	Illumina GAIIx	4	6381550	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Missense_Mutation	SNP	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_PH domain-like,HMMSmart_SM00462,HMMPfam_PID	p.G267V	ENST00000609360.1	37	c.800		11	.	.	.	.	.	.	.	.	.	.	C	24.9	4.583066	0.86748	.	.	ENSG00000166313	ENST00000299402;ENST00000311051;ENST00000389906;ENST00000539758;ENST00000536523;ENST00000544288;ENST00000530885;ENST00000533407	D;D;D;D;D	0.94897	-3.55;-3.55;-3.55;-3.55;-1.59	4.53	4.53	0.55603	.	0.000000	0.64402	D	0.000001	D	0.96658	0.8909	M	0.71036	2.16	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.996	D	0.97103	0.9799	10	0.87932	D	0	-26.2811	14.7818	0.69772	0.0:1.0:0.0:0.0	.	116;32;47;267	B7Z1H5;F5H1C5;B7Z2Y0;O00213-2	.;.;.;.	V	267;267;267;116;8;32;47;8	ENSP00000299402:G267V;ENSP00000311912:G267V;ENSP00000374556:G267V;ENSP00000433338:G47V;ENSP00000437114:G8V	ENSP00000299402:G267V	G	-	2	0	APBB1	6381550	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.537000	0.82033	2.337000	0.79520	0.313000	0.20887	GGG	-	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1		0.652	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	APBB1	protein_coding	OTTHUMT00000471831.1	C	NM_001164		6381550	-1	no_errors	NM_001164	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577569	7577569	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr17:7577569A>C	ENST00000269305.4	-	7	901	c.712T>G	c.(712-714)Tgt>Ggt	p.C238G	TP53_ENST00000359597.4_Missense_Mutation_p.C238G|TP53_ENST00000445888.2_Missense_Mutation_p.C238G|TP53_ENST00000413465.2_Missense_Mutation_p.C238G|TP53_ENST00000420246.2_Missense_Mutation_p.C238G|TP53_ENST00000455263.2_Missense_Mutation_p.C238G|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238R(14)|p.C238S(12)|p.0?(8)|p.?(5)|p.C238G(4)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.C238fs*2(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.C145G(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.M237fs*1(1)|p.C238fs*9(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAACTGTTACACATGTAGTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	60	Substitution - Missense(31)|Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Insertion - Frameshift(1)|Insertion - In frame(1)	ovary(11)|liver(7)|biliary_tract(6)|bone(5)|upper_aerodigestive_tract(4)|large_intestine(4)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|lung(2)|skin(2)|prostate(2)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|oesophagus(1)|pancreas(1)	17	GRCh37	CM025271|CM056070	TP53	M							131.0	103.0	112.0					17																	7577569		2203	4300	6503	7518294	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.712T>G	17.37:g.7577569A>C	ENSP00000269305:p.Cys238Gly	Somatic		Capture	Illumina GAIIx	4	7518294	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.C238G	ENST00000269305.4	37	c.712	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	21.1	4.105582	0.77096	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.95;-9.95;-9.95;-9.95;-9.95;-9.95;-9.95;-9.95	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99969	0.9989	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.94772	0.7946	10	0.87932	D	0	-18.536	11.6823	0.51466	1.0:0.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	G	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238G;ENSP00000352610:C238G;ENSP00000269305:C238G;ENSP00000398846:C238G;ENSP00000391127:C238G;ENSP00000391478:C238G;ENSP00000425104:C106G;ENSP00000423862:C145G	ENSP00000269305:C238G	C	-	1	0	TP53	7518294	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.021000	0.93673	2.074000	0.62210	0.379000	0.24179	TGT	-	HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		7518294	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PRAMEF16	654348	genome.wustl.edu	37	1	13496383	13496383	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr1:13496383G>A	ENST00000376121.3	+	2	734	c.704G>A	c.(703-705)cGc>cAc	p.R235H		NM_001045480.1	NP_001038945.1	Q5VWM1	PRA16_HUMAN	PRAME family member 16	235					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)							Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGCAATCTTCGCAAACTCTTT	0.443																																																0			1											1.0	1.0	1.0					1																	13496383		104	200	304	13368970	SO:0001583	missense	654348					1p36.21	2013-01-17			ENSG00000204488			"""-"""	25767	protein-coding gene	gene with protein product							Standard	NM_001045480		Approved	OTTHUMG00000002933	uc001aux.3	Q5VWM1	OTTHUMG00000002933	ENST00000376121.3:c.704G>A	1.37:g.13496383G>A	ENSP00000365289:p.Arg235His	Somatic		Capture	Illumina GAIIx	4	13368970		Missense_Mutation	SNP	superfamily_SSF52047	p.R235H	ENST00000376121.3	37	c.704	CCDS41259.1	1	.	.	.	.	.	.	.	.	.	.	G	6.922	0.539868	0.13250	.	.	ENSG00000204488	ENST00000376121	T	0.20881	2.04	1.39	-1.51	0.08664	.	1.626380	0.03452	N	0.210871	T	0.15522	0.0374	L	0.38649	1.16	0.09310	N	1	B	0.18166	0.026	B	0.16289	0.015	T	0.20140	-1.0284	10	0.27082	T	0.32	.	4.3307	0.11062	0.5714:0.0:0.4286:0.0	.	235	Q5VWM1	PRA16_HUMAN	H	235	ENSP00000365289:R235H	ENSP00000365289:R235H	R	+	2	0	PRAMEF16	13368970	0.000000	0.05858	0.000000	0.03702	0.251000	0.25915	-0.043000	0.12043	-0.417000	0.07461	0.186000	0.17326	CGC	-	superfamily_SSF52047		0.443	PRAMEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF16	protein_coding	OTTHUMT00000008178.1	G	NM_001045480		13368970	+1	no_errors	NM_001045480	genbank	human	provisional	54_36p	missense	SNP	0.001	A
NBEAP3	100418905	genome.wustl.edu	37	22	16123203	16123203	+	IGR	SNP	T	T	C			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr22:16123203T>C								LA16c-4G1.3 (59967 upstream) : AP000525.9 (24775 downstream)																							CGGTCTCAGGTCCAAGATGGC	0.612																																																0			22																																								14503203	SO:0001628	intergenic_variant	729057																															22.37:g.16123203T>C		Somatic		Capture	Illumina GAIIx	4	14503203		RNA	SNP	-	NULL		37	NULL		22																																																																																			-	-	0	0.612					LOC729057			T			14503203	+1	no_errors	XR_042044	genbank	human	model	54_36p	rna	SNP	0.994	C
CPAMD8	27151	genome.wustl.edu	37	19	17091434	17091434	+	Silent	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr19:17091434G>A	ENST00000443236.1	-	14	1630	c.1599C>T	c.(1597-1599)taC>taT	p.Y533Y	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	486						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CAGCCACCTCGTAGTACAGGG	0.597																																																0			19											74.0	79.0	78.0					19																	17091434		2003	4171	6174	16952434	SO:0001819	synonymous_variant	27151			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1599C>T	19.37:g.17091434G>A		Somatic		Capture	Illumina GAIIx	4	16952434	Q8NC09|Q9ULD7	Silent	SNP	HMMPfam_A2M_N,HMMPfam_A2M_N_2,HMMPfam_A2M,superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_Thiol-ester_cl,PatternScan_ALPHA_2_MACROGLOBULIN,HMMPfam_A2M_comp,superfamily_Alpha-macroglobulin receptor domain,HMMPfam_A2M_recep,superfamily_Kazal-type serine protease inhibitors,HMMSmart_SM00280,HMMPfam_Kazal_1	p.Y533	ENST00000443236.1	37	c.1599	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	G	5.560	0.288163	0.10513	.	.	ENSG00000160111	ENST00000443236	.	.	.	2.9	-5.81	0.02340	.	.	.	.	.	T	0.53222	0.1783	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55655	-0.8107	4	.	.	.	.	10.9264	0.47193	0.7325:0.0:0.2675:0.0	.	.	.	.	M	544	.	.	T	-	2	0	CPAMD8	16952434	0.409000	0.25368	0.963000	0.40424	0.674000	0.39518	-0.496000	0.06436	-1.201000	0.02659	-0.670000	0.03821	ACG	-	HMMPfam_A2M_N_2		0.597	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	protein_coding	OTTHUMT00000257531.2	G	NM_015692		16952434	-1	no_errors	NM_015692	genbank	human	validated	54_36p	silent	SNP	0.994	A
HSPG2	3339	genome.wustl.edu	37	1	22202222	22202222	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr1:22202222C>T	ENST00000374695.3	-	25	3281	c.3202G>A	c.(3202-3204)Gat>Aat	p.D1068N		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1068	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGCTGCCCATCGGGCCGCTGC	0.652																																																0			1											72.0	80.0	77.0					1																	22202222		2203	4300	6503	22074809	SO:0001583	missense	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.3202G>A	1.37:g.22202222C>T	ENSP00000363827:p.Asp1068Asn	Somatic		Capture	Illumina GAIIx	4	22074809	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	HMMPfam_SEA,HMMSmart_SM00200,HMMPfam_Ldl_recept_a,superfamily_LDL receptor-like module,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00181,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406,HMMSmart_SM00281,HMMPfam_Laminin_B,superfamily_Concanavalin A-like lectins/glucanases,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_LAM_1,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMPfam_V-set,HMMPfam_ig,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMPfam_EGF,HMMPfam_Laminin_G_1	p.D1068N	ENST00000374695.3	37	c.3202	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285962	0.80803	.	.	ENSG00000142798	ENST00000374695	T	0.35973	1.28	5.51	5.51	0.81932	Laminin B type IV (2);Laminin B, subgroup (1);	0.000000	0.41097	D	0.000955	T	0.59783	0.2219	M	0.68728	2.09	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60974	-0.7156	10	0.62326	D	0.03	.	16.8974	0.86104	0.0:1.0:0.0:0.0	.	1068	P98160	PGBM_HUMAN	N	1068	ENSP00000363827:D1068N	ENSP00000363827:D1068N	D	-	1	0	HSPG2	22074809	1.000000	0.71417	0.950000	0.38849	0.458000	0.32498	7.628000	0.83189	2.586000	0.87340	0.561000	0.74099	GAT	-	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00281,HMMPfam_Laminin_B		0.652	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	protein_coding	OTTHUMT00000007598.1	C	NM_005529		22074809	-1	no_errors	NM_005529	genbank	human	validated	54_36p	missense	SNP	0.998	T
SLC17A1	6568	genome.wustl.edu	37	6	25826701	25826701	+	Silent	SNP	C	C	G			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr6:25826701C>G	ENST00000244527.4	-	3	310	c.195G>C	c.(193-195)ctG>ctC	p.L65L	SLC17A1_ENST00000476801.1_Silent_p.L65L|SLC17A1_ENST00000427328.1_Silent_p.L65L|SLC17A1_ENST00000468082.1_Silent_p.L65L	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	65					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						TTATATTATCCAGGAGCTTCT	0.398																																																0			6											173.0	163.0	166.0					6																	25826701		2203	4300	6503	25934680	SO:0001819	synonymous_variant	6568				CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.195G>C	6.37:g.25826701C>G		Somatic		Capture	Illumina GAIIx	4	25934680	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Silent	SNP	superfamily_MFS general substrate transporter,HMMPfam_MFS_1	p.L65	ENST00000244527.4	37	c.195	CCDS4565.1	6																																																																																			-	superfamily_MFS general substrate transporter,HMMPfam_MFS_1		0.398	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A1	protein_coding	OTTHUMT00000043647.2	C			25934680	-1	no_errors	NM_005074	genbank	human	validated	54_36p	silent	SNP	0.000	G
TBC1D19	55296	genome.wustl.edu	37	4	26721734	26721734	+	Silent	SNP	T	T	C			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr4:26721734T>C	ENST00000264866.4	+	15	1349	c.1071T>C	c.(1069-1071)ttT>ttC	p.F357F	TBC1D19_ENST00000511789.1_Silent_p.F292F	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	357	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				ATGCTGTCTTTTACCCACCAA	0.284																																																0			4											77.0	83.0	81.0					4																	26721734		2203	4295	6498	26330832	SO:0001819	synonymous_variant	55296			AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.1071T>C	4.37:g.26721734T>C		Somatic		Capture	Illumina GAIIx	4	26330832	B9A6M0|Q9NUX1	Silent	SNP	HMMSmart_SM00164,superfamily_Ypt/Rab-GAP domain of gyp1p	p.F357	ENST00000264866.4	37	c.1071	CCDS3439.1	4																																																																																			-	HMMSmart_SM00164		0.284	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D19	protein_coding	OTTHUMT00000215052.2	T	NM_018317		26330832	+1	no_errors	NM_018317	genbank	human	validated	54_36p	silent	SNP	1.000	C
KIAA1522	57648	genome.wustl.edu	37	1	33237359	33237359	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr1:33237359C>G	ENST00000373480.1	+	6	2505	c.2402C>G	c.(2401-2403)cCg>cGg	p.P801R	KIAA1522_ENST00000401073.2_Missense_Mutation_p.P860R|KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000373481.3_Missense_Mutation_p.P812R	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	801	Pro-rich.									breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CAGAAGGAACCGGTGGGCTGT	0.692																																																0			1											25.0	29.0	28.0					1																	33237359		2029	4185	6214	33009946	SO:0001583	missense	57648			AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.2402C>G	1.37:g.33237359C>G	ENSP00000362579:p.Pro801Arg	Somatic		Capture	Illumina GAIIx	4	33009946	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	NULL	p.P860R	ENST00000373480.1	37	c.2579	CCDS55588.1	1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059407	0.55325	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.15603	2.41;2.43;2.45	4.53	2.64	0.31445	.	0.232503	0.29369	N	0.012342	T	0.15912	0.0383	L	0.40543	1.245	0.23416	N	0.997729	P;P;P	0.47545	0.858;0.772;0.897	B;B;P	0.44860	0.368;0.368;0.462	T	0.06643	-1.0815	10	0.62326	D	0.03	-1.9563	8.5375	0.33373	0.0:0.7643:0.0:0.2357	.	812;801;860	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	R	860;812;801	ENSP00000383851:P860R;ENSP00000362580:P812R;ENSP00000362579:P801R	ENSP00000362579:P801R	P	+	2	0	KIAA1522	33009946	0.668000	0.27493	0.117000	0.21633	0.117000	0.20001	1.279000	0.33191	0.461000	0.27071	0.650000	0.86243	CCG	-	NULL		0.692	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1522	protein_coding	OTTHUMT00000022130.1	C			33009946	+1	no_errors	NM_020888	genbank	human	validated	54_36p	missense	SNP	0.741	G
TLR6	10333	genome.wustl.edu	37	4	38829026	38829026	+	Missense_Mutation	SNP	T	T	G	rs114855575	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr4:38829026T>G	ENST00000381950.1	-	1	2134	c.2069A>C	c.(2068-2070)aAc>aCc	p.N690T	TLR6_ENST00000436693.2_Missense_Mutation_p.N690T			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	690	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.		N -> T (impairs the ability to induce NF- kappa-B activation; dbSNP:rs114855575). {ECO:0000269|PubMed:21618349}.		activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTCAATGCAGTTGATGATATT	0.388													T|||	6	0.00119808	0.0045	0.0	5008	,	,		22092	0.0		0.0	False		,,,				2504	0.0															0			4	GRCh37	CM076561	TLR6	M	rs114855575	T	THR/ASN	46,4360	48.9+/-83.8	0,46,2157	161.0	157.0	158.0		2069	3.6	0.9	4	dbSNP_132	158	0,8600		0,0,4300	no	missense	TLR6	NM_006068.4	65	0,46,6457	GG,GT,TT		0.0,1.044,0.3537	benign	690/797	38829026	46,12960	2203	4300	6503	38505421	SO:0001583	missense	10333				CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.2069A>C	4.37:g.38829026T>G	ENSP00000371376:p.Asn690Thr	Somatic		Capture	Illumina GAIIx	4	38505421	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRRCT,HMMPfam_LRRCT,superfamily_TIR,HMMSmart_TIR,HMMPfam_TIR	p.N690T	ENST00000381950.1	37	c.2069	CCDS3446.1	4	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	T	10.88	1.474541	0.26511	0.01044	0.0	ENSG00000174130	ENST00000436693;ENST00000381950	T;T	0.07908	3.15;3.15	4.79	3.57	0.40892	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.211881	0.40640	N	0.001051	T	0.07503	0.0189	L	0.58583	1.82	0.33881	D	0.636114	B	0.23128	0.08	B	0.24701	0.055	T	0.04693	-1.0933	10	0.51188	T	0.08	.	11.2356	0.48938	0.0:0.0:0.1538:0.8461	.	690	Q9Y2C9	TLR6_HUMAN	T	690	ENSP00000389600:N690T;ENSP00000371376:N690T	ENSP00000371376:N690T	N	-	2	0	TLR6	38505421	0.581000	0.26741	0.926000	0.36857	0.987000	0.75469	0.837000	0.27558	0.820000	0.34516	0.459000	0.35465	AAC	-	superfamily_TIR,HMMSmart_TIR,HMMPfam_TIR		0.388	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR6	protein_coding	OTTHUMT00000250431.1	T			38505421	-1	no_errors	NM_006068	genbank	human	reviewed	54_36p	missense	SNP	0.521	G
PPHLN1	51535	genome.wustl.edu	37	12	42681224	42681224	+	Intron	SNP	G	G	C			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr12:42681224G>C	ENST00000549190.1	+	2	215							Q8NEY8	PPHLN_HUMAN	periphilin 1						keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		CGAGCCCAGCGTGGGGACCAC	0.582																																																0			12																																								40967491	SO:0001627	intron_variant	727884			AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000549190.1:c.35-48461G>C	12.37:g.42681224G>C		Somatic		Capture	Illumina GAIIx	4	40967491	E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	RNA	SNP	-	NULL	ENST00000549190.1	37	NULL		12																																																																																			-	-		0.582	PPHLN1-001	PUTATIVE	basic	protein_coding	LOC727884	protein_coding	OTTHUMT00000404039.1	G	NM_201515		40967491	+1	pseudogene	XR_015225	genbank	human	model	54_36p	rna	SNP	0.990	C
TP53TG5	27296	genome.wustl.edu	37	20	44006863	44006863	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr20:44006863G>A	ENST00000372726.3	-	1	170	c.14C>T	c.(13-15)gCa>gTa	p.A5V	SYS1-DBNDD2_ENST00000452133.1_Intron|TP53TG5_ENST00000494455.1_Intron|TP53TG5_ENST00000537995.1_5'UTR|SYS1-DBNDD2_ENST00000475242.1_Intron	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	5					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						CCTCTTCTTTGCTGATGGACT	0.552																																																0			20											229.0	202.0	211.0					20																	44006863		2203	4300	6503	43440277	SO:0001583	missense	27296			AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.14C>T	20.37:g.44006863G>A	ENSP00000361811:p.Ala5Val	Somatic		Capture	Illumina GAIIx	4	43440277		Missense_Mutation	SNP	NULL	p.A5V	ENST00000372726.3	37	c.14	CCDS13352.1	20	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353624	0.41700	.	.	ENSG00000124251	ENST00000372726	T	0.10099	2.91	4.51	0.362	0.16113	.	0.402400	0.23465	N	0.047882	T	0.06781	0.0173	L	0.38175	1.15	0.80722	D	1	B	0.30851	0.297	B	0.27262	0.078	T	0.30822	-0.9965	10	0.59425	D	0.04	-0.411	3.3256	0.07066	0.2923:0.0:0.5255:0.1821	.	5	Q9Y2B4	T53G5_HUMAN	V	5	ENSP00000361811:A5V	ENSP00000361811:A5V	A	-	2	0	TP53TG5	43440277	0.247000	0.23920	0.778000	0.31720	0.982000	0.71751	0.124000	0.15728	0.112000	0.17975	0.650000	0.86243	GCA	-	NULL		0.552	TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53TG5	protein_coding	OTTHUMT00000079460.1	G	NM_014477		43440277	-1	no_errors	NM_014477	genbank	human	validated	54_36p	missense	SNP	0.475	A
RYR1	6261	genome.wustl.edu	37	19	38964116	38964116	+	Silent	SNP	C	C	A	rs377185497		TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr19:38964116C>A	ENST00000359596.3	+	28	3865	c.3865C>A	c.(3865-3867)Cgg>Agg	p.R1289R	RYR1_ENST00000355481.4_Silent_p.R1289R|RYR1_ENST00000360985.3_Silent_p.R1289R			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1289	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCTTTTCCTGCGGCTGAGCCT	0.701																																																0			19											35.0	34.0	34.0					19																	38964116		2203	4300	6503	43655956	SO:0001819	synonymous_variant	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3865C>A	19.37:g.38964116C>A		Somatic		Capture	Illumina GAIIx	4	43655956	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_RYDR_ITPR,HMMPfam_SPRY,HMMSmart_SM00449,HMMPfam_RyR,HMMPfam_RIH_assoc,superfamily_EF-hand,HMMPfam_RR_TM4-6,HMMPfam_Ion_trans	p.R1289	ENST00000359596.3	37	c.3865	CCDS33011.1	19																																																																																			-	NULL		0.701	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	C			43655956	+1	no_errors	NM_000540	genbank	human	reviewed	54_36p	silent	SNP	0.949	A
ZKSCAN7	55888	genome.wustl.edu	37	3	44621964	44621964	+	Intron	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr3:44621964G>A	ENST00000419137.1	+	3	316				ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000341840.3_Intron																							TGGGGAtgctgctgctgctgc	0.582																																																0			3																																								44596968	SO:0001627	intron_variant	0																														ENST00000419137.1:c.316+12039G>A	3.37:g.44621964G>A		Somatic		Capture	Illumina GAIIx	4	44596968		Silent	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.S181	ENST00000419137.1	37	c.543		3																																																																																			-	superfamily_SSF50729		0.582	RP11-944L7.5-001	PUTATIVE	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	protein_coding	ENSG00000214820	protein_coding	OTTHUMT00000343829.1	G			44596968	-1	no_start_codon:no_stop_codon	ENST00000399045	ensembl	human	known	54_36p	silent	SNP	0.993	A
Unknown	0	genome.wustl.edu	37	12	53124430	53124430	+	IGR	SNP	C	C	T	rs180739478	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr12:53124430C>T								KRT77 (27183 upstream) : KRT76 (37508 downstream)																							AACAACGGCACGAAGAACAAG	0.438																																																0			12																																								51410697	SO:0001628	intergenic_variant	400036																															12.37:g.53124430C>T		Somatic		Capture	Illumina GAIIx	4	51410697		RNA	SNP	-	NULL		37	NULL		12																																																																																			-	-	0	0.438					LOC400036			C			51410697	+1	pseudogene	XR_042304	genbank	human	model	54_36p	rna	SNP	0.950	T
PNMAL2	57469	genome.wustl.edu	37	19	46998642	46998642	+	Silent	SNP	C	C	T			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr19:46998642C>T	ENST00000377655.2	-	1	80	c.81G>A	c.(79-81)ccG>ccA	p.P27P	PNMAL2_ENST00000594749.1_Intron|PNMAL2_ENST00000599531.1_Silent_p.P27P|AC011484.1_ENST00000377652.3_3'UTR			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2	27								p.P27P(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		ccaggccctccgggatgccgg	0.662																																																1	Substitution - coding silent(1)	lung(1)	19											37.0	41.0	40.0					19																	46998642		2076	4205	6281	51690482	SO:0001819	synonymous_variant	0			AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.81G>A	19.37:g.46998642C>T		Somatic		Capture	Illumina GAIIx	4	51690482	C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Silent	SNP	NULL	p.P27	ENST00000377655.2	37	c.81		19																																																																																			-	NULL		0.662	PNMAL2-201	KNOWN	basic	protein_coding	PNMAL2	protein_coding		C	NM_020709		51690482	-1	no_errors	NM_020709	genbank	human	validated	54_36p	silent	SNP	0.021	T
MIR518C	574477	genome.wustl.edu	37	19	54214270	54214270	+	RNA	SNP	C	C	G			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr19:54214270C>G	ENST00000384822.1	+	0	101				MIR524_ENST00000385242.1_RNA|MIR519D_ENST00000385246.1_RNA|MIR517A_ENST00000385001.1_RNA	NR_030199.1				microRNA 518c																		ATGCTGTGACCCTACAAAGGG	0.423																																																0			19											125.0	115.0	118.0					19																	54214270		1568	3582	5150	58906082			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207553	ENSG00000207553		"""ncRNAs / Micro RNAs"""	32109	non-coding RNA	RNA, micro				MIRN518C			Standard	NR_030199		Approved	hsa-mir-518c	uc021vac.1				19.37:g.54214270C>G		Somatic		Capture	Illumina GAIIx	4	58906082		RNA	SNP	-	NULL	ENST00000384822.1	37	NULL		19																																																																																			-	-		0.423	MIR518C-201	KNOWN	basic	miRNA	MIRN524	miRNA		C	NR_030199		58906082	+1	no_errors	ENST00000385242	ensembl	human	known	54_36p	rna	SNP	0.000	G
CHD7	55636	genome.wustl.edu	37	8	61750674	61750674	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr8:61750674C>T	ENST00000423902.2	+	19	4872	c.4393C>T	c.(4393-4395)Cga>Tga	p.R1465*	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1465					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GGATCTTCTACGAAAAGGGGC	0.373																																																0			8	GRCh37	CM060211	CHD7	M							43.0	39.0	40.0					8																	61750674		1841	4076	5917	61913228	SO:0001587	stop_gained	55636			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.4393C>T	8.37:g.61750674C>T	ENSP00000392028:p.Arg1465*	Somatic		Capture	Illumina GAIIx	4	61913228	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Nonsense_Mutation	SNP	superfamily_Chromo domain-like,HMMSmart_SM00298,HMMPfam_Chromo,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_SNF2_N,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_BRK,HMMSmart_SM00592	p.R1465*	ENST00000423902.2	37	c.4393	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	C	47	13.501862	0.99746	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	.	.	.	5.32	5.32	0.75619	.	0.074228	0.53938	D	0.000055	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.1997	15.0364	0.71751	0.1427:0.8573:0.0:0.0	.	.	.	.	X	1465	.	ENSP00000307304:R1465X	R	+	1	2	CHD7	61913228	0.970000	0.33590	0.486000	0.27416	0.999000	0.98932	2.404000	0.44539	2.660000	0.90430	0.655000	0.94253	CGA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.373	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	protein_coding	OTTHUMT00000383468.2	C	XM_098762		61913228	+1	no_errors	NM_017780	genbank	human	reviewed	54_36p	nonsense	SNP	0.917	T
LOC101927016	101927016	genome.wustl.edu	37	13	64321293	64321293	+	Silent	SNP	T	T	C			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr13:64321293T>C	ENST00000453638.2	+	1	360	c.360T>C	c.(358-360)ttT>ttC	p.F120F	RP11-473M10.3_ENST00000418943.1_lincRNA																endometrium(2)|lung(1)|urinary_tract(1)	4						ACCGGCCATTTTGCTTTAGAA	0.463																																																0			13																																								63219294	SO:0001819	synonymous_variant	647262																														ENST00000453638.2:c.360T>C	13.37:g.64321293T>C		Somatic		Capture	Illumina GAIIx	4	63219294		Silent	SNP	NULL	p.F92	ENST00000453638.2	37	c.276		13																																																																																			-	NULL		0.463	AL445989.1-201	KNOWN	basic|appris_principal	protein_coding	LOC647262	protein_coding		T			63219294	+1	no_errors	XM_934622	genbank	human	model	54_36p	silent	SNP	0.983	C
THOC7	80145	genome.wustl.edu	37	3	63824071	63824071	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr3:63824071T>A	ENST00000295899.5	-	3	354	c.242A>T	c.(241-243)tAt>tTt	p.Y81F	C3orf49_ENST00000295896.8_Intron|THOC7_ENST00000498422.1_5'UTR	NM_025075.2	NP_079351.2	Q6I9Y2	THOC7_HUMAN	THO complex 7 homolog (Drosophila)	81	Interaction with THOC5.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			central_nervous_system(1)|large_intestine(1)|ovary(1)|pancreas(1)	4				BRCA - Breast invasive adenocarcinoma(55;0.000439)|Kidney(15;0.00194)|KIRC - Kidney renal clear cell carcinoma(15;0.00218)		AATTTTTTCATAATTTTCCAT	0.303																																					Colon(48;665 1127 6720 18651)											0			3											35.0	36.0	36.0					3																	63824071		2199	4293	6492	63799111	SO:0001583	missense	80145			BC020599	CCDS2900.1, CCDS74957.1	3p14.1	2013-02-11			ENSG00000163634	ENSG00000163634		"""THO complex subunits"""	29874	protein-coding gene	gene with protein product	"""Ngg1 interacting factor 3 like 1 binding protein 1"", ""functional spliceosome-associated protein 24"""	611965				12951069	Standard	NM_001285404		Approved	NIF3L1BP1, FLJ23445, fSAP24	uc003dlt.4	Q6I9Y2	OTTHUMG00000158767	ENST00000295899.5:c.242A>T	3.37:g.63824071T>A	ENSP00000295899:p.Tyr81Phe	Somatic		Capture	Illumina GAIIx	4	63799111	Q6P1L3|Q8WUF2|Q9H5H0	Missense_Mutation	SNP	HMMPfam_THOC7	p.Y81F	ENST00000295899.5	37	c.242	CCDS2900.1	3	.	.	.	.	.	.	.	.	.	.	T	28.5	4.928053	0.92389	.	.	ENSG00000163634	ENST00000295899	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.76786	0.4036	M	0.64080	1.96	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77046	-0.2733	9	0.46703	T	0.11	-1.4079	15.884	0.79226	0.0:0.0:0.0:1.0	.	81	Q6I9Y2	THOC7_HUMAN	F	81	.	ENSP00000295899:Y81F	Y	-	2	0	THOC7	63799111	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.004000	0.88535	2.158000	0.67659	0.377000	0.23210	TAT	-	HMMPfam_THOC7		0.303	THOC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC7	protein_coding	OTTHUMT00000352096.1	T	NM_025075		63799111	-1	no_errors	NM_025075	genbank	human	validated	54_36p	missense	SNP	1.000	A
CNOT2	4848	genome.wustl.edu	37	12	70704723	70704723	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr12:70704723G>T	ENST00000418359.3	+	4	548	c.97G>T	c.(97-99)Gtc>Ttc	p.V33F	CNOT2_ENST00000229195.3_Missense_Mutation_p.V33F	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	33					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TGTAGAGGGGGTCGACAGTGA	0.358																																																0			12											98.0	96.0	97.0					12																	70704723		2203	4299	6502	68990990	SO:0001583	missense	4848			AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.97G>T	12.37:g.70704723G>T	ENSP00000412091:p.Val33Phe	Somatic		Capture	Illumina GAIIx	4	68990990	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	HMMPfam_NOT2_3_5	p.V33F	ENST00000418359.3	37	c.97	CCDS31857.1	12	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770465	0.69992	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000550160;ENST00000551132;ENST00000552915;ENST00000552483;ENST00000550641;ENST00000548159;ENST00000549750;ENST00000551043;ENST00000547867;ENST00000550194	T;T;T;T	0.48836	0.8;0.8;0.82;0.8	6.14	6.14	0.99180	.	0.053037	0.85682	D	0.000000	T	0.38799	0.1054	L	0.29908	0.895	0.80722	D	1	P	0.44877	0.845	B	0.39379	0.298	T	0.09574	-1.0668	10	0.13853	T	0.58	-3.0852	20.819	0.99723	0.0:0.0:1.0:0.0	.	33	Q9NZN8	CNOT2_HUMAN	F	33;33;33;33;13;33;24;13;24;33;33;24;33	ENSP00000229195:V33F;ENSP00000412091:V33F;ENSP00000449659:V24F;ENSP00000449260:V33F	ENSP00000229195:V33F	V	+	1	0	CNOT2	68990990	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.292000	0.65673	2.927000	0.99377	0.637000	0.83480	GTC	-	NULL		0.358	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT2	protein_coding	OTTHUMT00000404260.1	G			68990990	+1	no_errors	NM_014515	genbank	human	provisional	54_36p	missense	SNP	1.000	T
GOLGA6B	55889	genome.wustl.edu	37	15	72954797	72954797	+	Missense_Mutation	SNP	T	T	C	rs201618622	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr15:72954797T>C	ENST00000421285.3	+	11	1052	c.1052T>C	c.(1051-1053)gTg>gCg	p.V351A	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	351						Golgi apparatus (GO:0005794)		p.V351A(4)		NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						GAGCAGGAGGTGCAGAGAGTG	0.562													t|||	142	0.0283546	0.0159	0.0274	5008	,	,		15500	0.0258		0.0249	False		,,,				2504	0.0521															4	Substitution - Missense(4)	skin(2)|lung(1)|endometrium(1)	15											81.0	81.0	81.0					15																	72954797		2063	3889	5952	70741851	SO:0001583	missense	55889				CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.1052T>C	15.37:g.72954797T>C	ENSP00000408132:p.Val351Ala	Somatic		Capture	Illumina GAIIx	4	70741851	A8MYY7	Missense_Mutation	SNP	NULL	p.V351A	ENST00000421285.3	37	c.1052	CCDS10245.2	15	.	.	.	.	.	.	.	.	.	.	.	0.612	-0.824760	0.02755	.	.	ENSG00000215186	ENST00000421285	T	0.21031	2.03	0.372	0.372	0.16173	.	.	.	.	.	T	0.07143	0.0181	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36601	-0.9741	9	0.27082	T	0.32	.	4.8248	0.13410	0.0:0.7182:0.0:0.2818	.	351	A6NDN3	GOG6B_HUMAN	A	351	ENSP00000408132:V351A	ENSP00000408132:V351A	V	+	2	0	GOLGA6B	70741851	0.000000	0.05858	0.144000	0.22314	0.053000	0.15095	-2.065000	0.01386	-1.296000	0.02353	-1.896000	0.00531	GTG	-	NULL		0.562	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6B	protein_coding	OTTHUMT00000257474.4	T	NM_018652		70741851	+1	no_errors	ENST00000268079	ensembl	human	known	54_36p	missense	SNP	0.441	C
RAB11FIP5	26056	genome.wustl.edu	37	2	73303220	73303220	+	Silent	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr2:73303220G>A	ENST00000258098.6	-	4	1899	c.1659C>T	c.(1657-1659)agC>agT	p.S553S	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	553					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						CCAGCCCACTGCTCAGGGCTA	0.632																																																0			2											140.0	143.0	142.0					2																	73303220		2203	4300	6503	73156728	SO:0001819	synonymous_variant	26056			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.1659C>T	2.37:g.73303220G>A		Somatic		Capture	Illumina GAIIx	4	73156728	O94939|Q9P0M1	Silent	SNP	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2,HMMPfam_RBD-FIP	p.S553	ENST00000258098.6	37	c.1659	CCDS1923.1	2																																																																																			-	NULL		0.632	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP5	protein_coding	OTTHUMT00000251995.1	G	NM_015470		73156728	-1	no_errors	NM_015470	genbank	human	validated	54_36p	silent	SNP	1.000	A
SCAPER	49855	genome.wustl.edu	37	15	77057343	77057343	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr15:77057343G>A	ENST00000563290.1	-	14	1779	c.1684C>T	c.(1684-1686)Cgc>Tgc	p.R562C	SCAPER_ENST00000538941.2_Missense_Mutation_p.R316C|SCAPER_ENST00000324767.7_Missense_Mutation_p.R562C			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	562	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TTCTCTTCGCGTAACTTTTCC	0.328																																																0			15											108.0	92.0	97.0					15																	77057343		1804	4062	5866	74844398	SO:0001583	missense	49855			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1684C>T	15.37:g.77057343G>A	ENSP00000454973:p.Arg562Cys	Somatic		Capture	Illumina GAIIx	4	74844398	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	HMMSmart_SM00451,PatternScan_ZINC_FINGER_C2H2_1	p.R561C	ENST00000563290.1	37	c.1681	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	G	20.4	3.983349	0.74474	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.25250	1.82;1.81	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.41282	0.1152	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.967	T	0.15464	-1.0436	10	0.72032	D	0.01	.	14.7722	0.69688	0.0:0.0:0.8557:0.1443	.	583;316	Q9BY12-2;F5H7X8	.;.	C	562;316;584	ENSP00000326924:R562C;ENSP00000442190:R316C	ENSP00000303560:R584C	R	-	1	0	SCAPER	74844398	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.996000	0.57009	2.724000	0.93272	0.462000	0.41574	CGC	-	NULL		0.328	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	protein_coding	OTTHUMT00000419698.1	G	NM_020843		74844398	-1	no_errors	NM_020843	genbank	human	validated	54_36p	missense	SNP	1.000	A
C10orf55	414236	genome.wustl.edu	37	10	75671455	75671455	+	Silent	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr10:75671455G>A	ENST00000409178.1	-	5	784	c.444C>T	c.(442-444)acC>acT	p.T148T	PLAU_ENST00000494287.1_Intron|PLAU_ENST00000372762.4_Intron|PLAU_ENST00000372764.3_Intron|C10orf55_ENST00000412307.2_Silent_p.T148T|PLAU_ENST00000446342.1_5'UTR	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55	148										endometrium(1)	1	Prostate(51;0.0112)					AGGGAGCTGGGGTCCTCCGGA	0.632																																																0			10											31.0	38.0	35.0					10																	75671455		1327	2309	3636	75341461	SO:0001819	synonymous_variant	414236				CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.444C>T	10.37:g.75671455G>A		Somatic		Capture	Illumina GAIIx	4	75341461	Q3KRG4|Q8NAK4	Silent	SNP	NULL	p.T124	ENST00000409178.1	37	c.372	CCDS53541.1	10																																																																																			-	NULL		0.632	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf55	protein_coding	OTTHUMT00000048746.1	G	NM_001001791		75341461	-1	no_errors	NM_001001791	genbank	human	predicted	54_36p	silent	SNP	0.003	A
HK2P1	642546	genome.wustl.edu	37	X	79829078	79829078	+	IGR	SNP	T	T	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chrX:79829078T>A								FAM46D (128268 upstream) : BRWD3 (97274 downstream)																							CCTTCTCCCCTTCAGTGTCTG	0.582																																																0			X																																								79715734	SO:0001628	intergenic_variant	0																															X.37:g.79829078T>A		Somatic		Capture	Illumina GAIIx	4	79715734		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.582					LOC642546			T			79715734	-1	pseudogene	XR_038841	genbank	human	model	54_36p	rna	SNP	0.997	A
ZAN	7455	genome.wustl.edu	37	7	100350330	100350330	+	RNA	SNP	C	C	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr7:100350330C>A	ENST00000348028.3	+	0	2767				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CACCATCTCCCCAGAAAAACT	0.483																																																0			7											273.0	311.0	299.0					7																	100350330		1862	4109	5971	100188266			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100350330C>A		Somatic		Capture	Illumina GAIIx	4	100188266	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	HMMSmart_SM00137,HMMPfam_MAM,PatternScan_MAM_1,superfamily_Serine proterase inhibitors,HMMPfam_TIL,PatternScan_EGF_2,HMMSmart_SM00215,HMMPfam_TIL_assoc,HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,HMMSmart_SM00181,HMMSmart_SM00214,superfamily_EGF/Laminin,HMMPfam_EGF,PatternScan_EGF_1	p.P868T	ENST00000348028.3	37	c.2602		7	.	.	.	.	.	.	.	.	.	.	a	3.609	-0.079913	0.07141	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.56941	0.43;0.43;0.43	3.31	-6.62	0.01813	.	0.825977	0.09857	N	0.746823	T	0.19765	0.0475	N	0.03608	-0.345	0.18873	N	0.999989	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09618	-1.0666	10	0.46703	T	0.11	.	1.7495	0.02969	0.3099:0.3634:0.0922:0.2346	.	868;868	F5H0T8;Q9Y493	.;ZAN_HUMAN	T	868	ENSP00000445943:P868T;ENSP00000445091:P868T;ENSP00000444427:P868T	ENSP00000423579:P868T	P	+	1	0	ZAN	100188266	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.675000	0.01947	-1.490000	0.01842	-1.583000	0.00853	CCA	-	NULL		0.483	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	polymorphic_pseudogene	OTTHUMT00000347214.1	C	NM_003386		100188266	+1	no_errors	ENST00000349350	ensembl	human	known	54_36p	missense	SNP	0.000	A
NALCN	259232	genome.wustl.edu	37	13	101725994	101725994	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr13:101725994G>A	ENST00000251127.6	-	37	4220	c.4139C>T	c.(4138-4140)aCc>aTc	p.T1380I		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1380					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GAACAGTACGGTAATAGCTTT	0.348																																																0			13											91.0	82.0	85.0					13																	101725994		2203	4300	6503	100523995	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4139C>T	13.37:g.101725994G>A	ENSP00000251127:p.Thr1380Ile	Somatic		Capture	Illumina GAIIx	4	100523995	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.T1380I	ENST00000251127.6	37	c.4139	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750204	0.49257	.	.	ENSG00000102452	ENST00000251127	D	0.97256	-4.31	5.75	5.75	0.90469	Ion transport (1);	0.044116	0.85682	D	0.000000	D	0.85894	0.5803	N	0.00125	-2.05	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.83064	-0.0146	10	0.12430	T	0.62	.	19.9598	0.97242	0.0:0.0:1.0:0.0	.	1380	Q8IZF0	NALCN_HUMAN	I	1380	ENSP00000251127:T1380I	ENSP00000251127:T1380I	T	-	2	0	NALCN	100523995	1.000000	0.71417	0.871000	0.34182	0.996000	0.88848	9.837000	0.99465	2.716000	0.92895	0.655000	0.94253	ACC	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.348	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	protein_coding	OTTHUMT00000045663.2	G	NM_052867		100523995	-1	no_errors	NM_052867	genbank	human	validated	54_36p	missense	SNP	1.000	A
FGF14	2259	genome.wustl.edu	37	13	102375268	102375268	+	Silent	SNP	C	C	T			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr13:102375268C>T	ENST00000376143.4	-	5	656	c.657G>A	c.(655-657)ccG>ccA	p.P219P	ITGBL1_ENST00000415285.1_3'UTR|FGF14_ENST00000376131.4_Silent_p.P224P	NM_004115.3	NP_004106.1	Q92915	FGF14_HUMAN	fibroblast growth factor 14	219					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cell-cell signaling (GO:0007267)|JNK cascade (GO:0007254)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|positive regulation of sodium ion transport (GO:0010765)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)	29	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CCCCAGGCTTCGGGACCGTTT	0.478																																																0			13											233.0	182.0	199.0					13																	102375268		2203	4300	6503	101173269	SO:0001819	synonymous_variant	2259				CCDS9500.1, CCDS9501.1	13q34	2008-02-05			ENSG00000102466	ENSG00000102466			3671	protein-coding gene	gene with protein product		601515				8790420, 17236779	Standard	NM_175929		Approved	FHF4, SCA27	uc001vpf.2	Q92915	OTTHUMG00000017303	ENST00000376143.4:c.657G>A	13.37:g.102375268C>T		Somatic		Capture	Illumina GAIIx	4	101173269	Q86YN7|Q96QX6	Silent	SNP	superfamily_Cytok_IL1_like,HMMSmart_FGF,HMMPfam_FGF,PatternScan_HBGF_FGF	p.P224	ENST00000376143.4	37	c.672	CCDS9501.1	13																																																																																			-	NULL		0.478	FGF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF14	protein_coding	OTTHUMT00000045679.2	C			101173269	-1	no_errors	NM_175929	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
KIAA1324	57535	genome.wustl.edu	37	1	109714569	109714569	+	Silent	SNP	G	G	C			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr1:109714569G>C	ENST00000369939.3	+	4	732	c.549G>C	c.(547-549)ctG>ctC	p.L183L	KIAA1324_ENST00000529753.1_Silent_p.L183L	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	183					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		CCGTCAACCTGAAGCAATCTG	0.542																																																0			1											150.0	125.0	134.0					1																	109714569		2203	4300	6503	109516092	SO:0001819	synonymous_variant	57535			AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.549G>C	1.37:g.109714569G>C		Somatic		Capture	Illumina GAIIx	4	109516092	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Silent	SNP	superfamily_Growth factor receptor domain,superfamily_Mannose 6-phosphate receptor domain	p.L183	ENST00000369939.3	37	c.549	CCDS794.1	1																																																																																			-	superfamily_Growth factor receptor domain		0.542	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1324	protein_coding	OTTHUMT00000032389.2	G	NM_020775		109516092	+1	no_errors	NM_020775	genbank	human	validated	54_36p	silent	SNP	0.998	C
SYCP1	6847	genome.wustl.edu	37	1	115430307	115430307	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr1:115430307T>A	ENST00000369522.3	+	15	1491	c.1251T>A	c.(1249-1251)agT>agA	p.S417R	SYCP1_ENST00000369518.1_Missense_Mutation_p.S417R	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	417					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAAATCAAGTGAGCTGGGTA	0.239																																																0			1											47.0	52.0	50.0					1																	115430307		2192	4272	6464	115231830	SO:0001583	missense	6847			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.1251T>A	1.37:g.115430307T>A	ENSP00000358535:p.Ser417Arg	Somatic		Capture	Illumina GAIIx	4	115231830	O14963|Q5VXJ6	Missense_Mutation	SNP	HMMPfam_SCP-1	p.S417R	ENST00000369522.3	37	c.1251	CCDS879.1	1	.	.	.	.	.	.	.	.	.	.	T	11.32	1.604731	0.28623	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.56103	0.48;0.48;0.48	5.04	1.17	0.20885	.	1.171960	0.06062	N	0.658476	T	0.22551	0.0544	L	0.54323	1.7	0.27659	N	0.947149	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.005	T	0.18871	-1.0323	10	0.42905	T	0.14	0.0552	1.4496	0.02372	0.1668:0.0995:0.2045:0.5292	.	417;417	B7ZLS9;Q15431	.;SYCP1_HUMAN	R	417	ENSP00000358535:S417R;ENSP00000410011:S417R;ENSP00000358531:S417R	ENSP00000358531:S417R	S	+	3	2	SYCP1	115231830	0.569000	0.26643	0.995000	0.50966	0.945000	0.59286	0.591000	0.23969	0.263000	0.21812	0.491000	0.48974	AGT	-	HMMPfam_SCP-1		0.239	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	protein_coding	OTTHUMT00000033386.1	T	NM_003176		115231830	+1	no_errors	NM_003176	genbank	human	validated	54_36p	missense	SNP	0.997	A
C5	727	genome.wustl.edu	37	9	123751964	123751964	+	Silent	SNP	C	C	T			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr9:123751964C>T	ENST00000223642.1	-	24	3065	c.3036G>A	c.(3034-3036)ctG>ctA	p.L1012L		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1012					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	CAACGCTCATCAGCTCCGCCT	0.438																																																0			9											77.0	75.0	76.0					9																	123751964		2203	4300	6503	122791785	SO:0001819	synonymous_variant	727			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.3036G>A	9.37:g.123751964C>T		Somatic		Capture	Illumina GAIIx	4	122791785	Q14CJ0|Q27I61	Silent	SNP	PatternScan_ALPHA_2_MACROGLOBULIN,HMMPfam_A2M_N,HMMPfam_A2M_N_2,superfamily_Anaphylatoxin,HMMPfam_ANATO,HMMSmart_ANATO,PatternScan_ANAPHYLATOXIN_1,HMMPfam_A2M,superfamily_Terp_cyc_toroid,HMMPfam_A2M_comp,superfamily_AM_receptor_bind,HMMPfam_A2M_recep,HMMSmart_C345C,HMMPfam_NTR	p.L1012	ENST00000223642.1	37	c.3036	CCDS6826.1	9																																																																																			-	superfamily_Terp_cyc_toroid		0.438	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5	protein_coding	OTTHUMT00000053844.1	C	NM_001735		122791785	-1	no_errors	NM_001735	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
KPNA1	3836	genome.wustl.edu	37	3	122168481	122168481	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr3:122168481T>C	ENST00000344337.6	-	9	1033	c.857A>G	c.(856-858)aAt>aGt	p.N286S	KPNA1_ENST00000466923.1_5'UTR	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)	286	Binding to RAG1.				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		AATTTTATCATTGGGTCCATC	0.458																																					Melanoma(12;340 801 11196 19797)											0			3											85.0	79.0	81.0					3																	122168481		2203	4300	6503	123651171	SO:0001583	missense	3836			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.857A>G	3.37:g.122168481T>C	ENSP00000343701:p.Asn286Ser	Somatic		Capture	Illumina GAIIx	4	123651171	D3DN93|Q6IBQ9|Q9BQ56	Missense_Mutation	SNP	HMMPfam_IBB,superfamily_ARM repeat,HMMPfam_Arm,HMMSmart_SM00185	p.N286S	ENST00000344337.6	37	c.857	CCDS3013.1	3	.	.	.	.	.	.	.	.	.	.	T	27.1	4.799954	0.90538	.	.	ENSG00000114030	ENST00000344337;ENST00000465882	T;T	0.68025	-0.3;-0.3	5.1	5.1	0.69264	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80401	0.4616	M	0.82517	2.595	0.80722	D	1	D	0.65815	0.995	P	0.60236	0.871	T	0.83320	-0.0018	10	0.59425	D	0.04	-15.946	14.2384	0.65941	0.0:0.0:0.0:1.0	.	286	P52294	IMA1_HUMAN	S	286	ENSP00000343701:N286S;ENSP00000419890:N286S	ENSP00000343701:N286S	N	-	2	0	KPNA1	123651171	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.525000	0.81892	2.137000	0.66172	0.460000	0.39030	AAT	-	superfamily_ARM repeat,HMMPfam_Arm,HMMSmart_SM00185		0.458	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	protein_coding	OTTHUMT00000355740.1	T	NM_002264		123651171	-1	no_errors	NM_002264	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CNTNAP5	129684	genome.wustl.edu	37	2	125555828	125555828	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr2:125555828G>T	ENST00000431078.1	+	19	3509	c.3145G>T	c.(3145-3147)Gca>Tca	p.A1049S		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1049	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GACAACCCAGGCACCCAGTCT	0.453																																																0			2											161.0	156.0	157.0					2																	125555828		1967	4148	6115	125272298	SO:0001583	missense	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3145G>T	2.37:g.125555828G>T	ENSP00000399013:p.Ala1049Ser	Somatic		Capture	Illumina GAIIx	4	125272298	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	PatternScan_FA58C_1,PatternScan_FIBRIN_AG_C_DOMAIN,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_FA58C,superfamily_Gal_bind_like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_2,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMSmart_EGF,HMMPfam_EGF,superfamily_Fibrinogen_a/b/g_C	p.A1049S	ENST00000431078.1	37	c.3145	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	G	3.959	-0.010668	0.07727	.	.	ENSG00000155052	ENST00000431078	T	0.37752	1.18	5.92	1.46	0.22682	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.435748	0.18778	N	0.131402	T	0.22820	0.0551	L	0.35414	1.06	0.09310	N	1	P	0.35363	0.497	B	0.34038	0.174	T	0.17531	-1.0366	10	0.13853	T	0.58	.	10.1538	0.42809	0.244:0.0:0.6552:0.1007	.	1049	Q8WYK1	CNTP5_HUMAN	S	1049	ENSP00000399013:A1049S	ENSP00000399013:A1049S	A	+	1	0	CNTNAP5	125272298	0.165000	0.22948	0.035000	0.18076	0.534000	0.34807	0.410000	0.21098	0.103000	0.17682	-0.813000	0.03139	GCA	-	superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2		0.453	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	G			125272298	+1	no_errors	NM_130773	genbank	human	reviewed	54_36p	missense	SNP	0.438	T
ENG	2022	genome.wustl.edu	37	9	130592101	130592101	+	Silent	SNP	C	C	T	rs116146060	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr9:130592101C>T	ENST00000373203.4	-	3	625	c.225G>A	c.(223-225)ccG>ccA	p.P75P	Y_RNA_ENST00000410489.1_RNA|ENG_ENST00000344849.3_Silent_p.P75P	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	75	Required for interaction with EGL.				artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						CCAGCTGTGACGGGCCCTGGG	0.557									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia				c|||	14	0.00279553	0.0106	0.0	5008	,	,		19660	0.0		0.0	False		,,,				2504	0.0															0			9						T	,	13,4393	20.2+/-43.8	0,13,2190	80.0	73.0	75.0		225,225	0.7	0.0	9	dbSNP_132	75	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ENG	NM_000118.2,NM_001114753.1	,	0,13,6490	TT,TC,CC		0.0,0.2951,0.1	,	75/626,75/659	130592101	13,12993	2203	4300	6503	129631922	SO:0001819	synonymous_variant	2022	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.225G>A	9.37:g.130592101C>T		Somatic		Capture	Illumina GAIIx	4	129631922	Q14248|Q14926|Q5T9C0	Silent	SNP	HMMPfam_Zona_pellucida	p.P75	ENST00000373203.4	37	c.225	CCDS48029.1	9																																																																																			-	NULL		0.557	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENG	protein_coding	OTTHUMT00000054313.1	C			129631922	-1	no_errors	NM_000118	genbank	human	reviewed	54_36p	silent	SNP	0.007	T
HNRNPKP2	389053	genome.wustl.edu	37	2	136957639	136957639	+	IGR	SNP	G	G	A	rs370048377|rs199814361	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr2:136957639G>A								CXCR4 (81904 upstream) : RN7SKP141 (190262 downstream)																							GCCTCAACTCGCAGTCAAAGT	0.453																																																0			2																																								136674109	SO:0001628	intergenic_variant	389053																															2.37:g.136957639G>A		Somatic		Capture	Illumina GAIIx	4	136674109		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.453					LOC389053			G			136674109	-1	pseudogene	XR_017204	genbank	human	model	54_36p	rna	SNP	1.000	A
CYP11B2	1585	genome.wustl.edu	37	8	143998503	143998503	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr8:143998503G>A	ENST00000323110.2	-	2	369	c.367C>T	c.(367-369)Cgt>Tgt	p.R123C		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	123					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)	p.R123C(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TTGTGCCCACGATGTTGTCTG	0.612									Familial Hyperaldosteronism type I																																							1	Substitution - Missense(1)	large_intestine(1)	8											176.0	131.0	146.0					8																	143998503		2203	4300	6503	143995505	SO:0001583	missense	1585	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.367C>T	8.37:g.143998503G>A	ENSP00000325822:p.Arg123Cys	Somatic		Capture	Illumina GAIIx	4	143995505	B0ZBE4|Q16726	Missense_Mutation	SNP	HMMPfam_p450,superfamily_Cytochrome P450,PatternScan_CYTOCHROME_P450	p.R123C	ENST00000323110.2	37	c.367	CCDS6393.1	8	.	.	.	.	.	.	.	.	.	.	.	13.16	2.154245	0.38021	.	.	ENSG00000179142	ENST00000323110	T	0.69175	-0.38	3.9	3.03	0.35002	.	0.145050	0.31963	N	0.006787	T	0.68044	0.2958	M	0.76838	2.35	0.31530	N	0.661336	P	0.41624	0.757	B	0.43680	0.427	T	0.73597	-0.3932	10	0.62326	D	0.03	.	9.2266	0.37410	0.1089:0.0:0.8911:0.0	.	123	P19099	C11B2_HUMAN	C	123	ENSP00000325822:R123C	ENSP00000325822:R123C	R	-	1	0	CYP11B2	143995505	0.122000	0.22280	0.002000	0.10522	0.213000	0.24496	1.575000	0.36493	0.855000	0.35359	0.557000	0.71058	CGT	-	HMMPfam_p450,superfamily_Cytochrome P450		0.612	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	protein_coding	OTTHUMT00000359904.1	G			143995505	-1	no_errors	NM_000498	genbank	human	reviewed	54_36p	missense	SNP	0.799	A
GPR89B	51463	genome.wustl.edu	37	1	147408748	147408748	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr1:147408748T>C	ENST00000314163.7	+	2	194	c.50T>C	c.(49-51)tTt>tCt	p.F17S		NM_016334.3	NP_057418.1	P0CG08	GPHRB_HUMAN	G protein-coupled receptor 89B	17					protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	voltage-gated ion channel activity (GO:0005244)			large_intestine(1)	1	all_hematologic(923;0.0276)					CAGATACTATTTTTTGGATTT	0.303																																																0			1											130.0	122.0	125.0					1																	147408748		2203	4298	6501	145875372	SO:0001583	missense	51463			U78723	CCDS930.1	1q21.1	2014-06-19	2007-06-06	2007-06-06	ENSG00000188092	ENSG00000188092			13840	protein-coding gene	gene with protein product		612806	"""G protein-coupled receptor 89"", ""G protein-coupled receptor 89C"""	GPR89, GPR89C		11042152	Standard	NM_016334		Approved	SH120	uc001epv.4	P0CG08	OTTHUMG00000013452	ENST00000314163.7:c.50T>C	1.37:g.147408748T>C	ENSP00000358233:p.Phe17Ser	Somatic		Capture	Illumina GAIIx	4	145875372	A6NN37|B2RUV3|B3KMN3|Q53FQ9|Q5T2V8|Q5T5P5|Q659E2|Q6NVY5|Q9P0S4|Q9Y302	Missense_Mutation	SNP	NULL	p.F17S	ENST00000314163.7	37	c.50	CCDS930.1	1	.	.	.	.	.	.	.	.	.	.	t	19.21	3.784308	0.70222	.	.	ENSG00000188092	ENST00000314163	.	.	.	4.07	4.07	0.47477	.	0.000000	0.85682	U	0.000000	T	0.54319	0.1851	.	.	.	0.80722	D	1	P	0.46512	0.879	P	0.52031	0.688	T	0.58831	-0.7567	8	0.49607	T	0.09	-13.3426	12.1772	0.54192	0.0:0.0:0.0:1.0	.	17	B4DT03	.	S	17	.	ENSP00000358233:F17S	F	+	2	0	GPR89B	145875372	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	7.130000	0.77235	1.721000	0.51461	0.392000	0.25879	TTT	-	NULL		0.303	GPR89B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR89B	protein_coding	OTTHUMT00000037481.2	T	NM_016334		145875372	+1	no_errors	NM_016334	genbank	human	validated	54_36p	missense	SNP	1.000	C
FMNL2	114793	genome.wustl.edu	37	2	153485024	153485024	+	Nonsense_Mutation	SNP	G	G	T			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr2:153485024G>T	ENST00000475377.2	+	5	702	c.502G>T	c.(502-504)Gaa>Taa	p.E168*	FMNL2_ENST00000288670.9_Nonsense_Mutation_p.E793*			Q96PY5	FMNL2_HUMAN	formin-like 2	793	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						GAACTTTGCTGAAAGCATTCA	0.448																																																0			2											106.0	109.0	108.0					2																	153485024		2132	4253	6385	153193270	SO:0001587	stop_gained	114793			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000475377.2:c.502G>T	2.37:g.153485024G>T	ENSP00000418959:p.Glu168*	Somatic		Capture	Illumina GAIIx	4	153193270	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Nonsense_Mutation	SNP	HMMPfam_Drf_GBD,HMMPfam_Drf_FH3,superfamily_FH2_actin_bd,HMMSmart_FH2,HMMPfam_FH2	p.E793*	ENST00000475377.2	37	c.2377		2	.	.	.	.	.	.	.	.	.	.	G	39	7.357049	0.98235	.	.	ENSG00000157827	ENST00000288670;ENST00000421344;ENST00000475377	.	.	.	5.31	5.31	0.75309	.	0.132599	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	19.1722	0.93583	0.0:0.0:1.0:0.0	.	.	.	.	X	793;274;168	.	ENSP00000288670:E793X	E	+	1	0	FMNL2	153193270	1.000000	0.71417	0.763000	0.31416	0.998000	0.95712	9.629000	0.98417	2.763000	0.94921	0.563000	0.77884	GAA	-	superfamily_FH2_actin_bd,HMMSmart_FH2,HMMPfam_FH2		0.448	FMNL2-002	NOVEL	basic|exp_conf	protein_coding	FMNL2	protein_coding	OTTHUMT00000333583.3	G	NM_052905		153193270	+1	no_errors	NM_052905	genbank	human	reviewed	54_36p	nonsense	SNP	0.980	T
INO80D	54891	genome.wustl.edu	37	2	206870074	206870074	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr2:206870074C>A	ENST00000403263.1	-	11	2506	c.2102G>T	c.(2101-2103)gGa>gTa	p.G701V	Vault_ENST00000516676.1_RNA	NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	701					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						GGATTGTATTCCTGAAGCTCC	0.488																																																0			2											125.0	115.0	118.0					2																	206870074		1930	4130	6060	206578319	SO:0001583	missense	54891				CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.2102G>T	2.37:g.206870074C>A	ENSP00000384198:p.Gly701Val	Somatic		Capture	Illumina GAIIx	4	206578319	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	NULL	p.G701V	ENST00000403263.1	37	c.2102	CCDS46500.1	2	.	.	.	.	.	.	.	.	.	.	C	3.624	-0.077039	0.07184	.	.	ENSG00000114933	ENST00000403263;ENST00000233270	T	0.32988	1.43	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.12050	0.0293	N	0.00926	-1.1	0.80722	D	1	B	0.26483	0.15	B	0.23852	0.049	T	0.23048	-1.0199	10	0.32370	T	0.25	.	14.4709	0.67517	0.1469:0.8531:0.0:0.0	.	701	Q53TQ3-2	.	V	701	ENSP00000384198:G701V	ENSP00000233270:G701V	G	-	2	0	INO80D	206578319	1.000000	0.71417	0.990000	0.47175	0.175000	0.22909	3.632000	0.54287	2.636000	0.89361	0.591000	0.81541	GGA	-	NULL		0.488	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80D	protein_coding	OTTHUMT00000336459.1	C	NM_017759		206578319	-1	no_errors	NM_017759	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZDBF2	57683	genome.wustl.edu	37	2	207175370	207175370	+	Missense_Mutation	SNP	C	C	T	rs201802013	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr2:207175370C>T	ENST00000374423.3	+	5	6504	c.6118C>T	c.(6118-6120)Cgg>Tgg	p.R2040W		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2040							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TAATGATATTCGGTTTATATG	0.353													C|||	2	0.000399361	0.0	0.0	5008	,	,		19819	0.0		0.002	False		,,,				2504	0.0															0			2						C	TRP/ARG	1,3647		0,1,1823	25.0	24.0	24.0		6118	3.8	0.0	2		24	20,8132		0,20,4056	yes	missense	ZDBF2	NM_020923.1	101	0,21,5879	TT,TC,CC		0.2453,0.0274,0.178	benign	2040/2355	207175370	21,11779	1824	4076	5900	206883615	SO:0001583	missense	57683			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6118C>T	2.37:g.207175370C>T	ENSP00000363545:p.Arg2040Trp	Somatic		Capture	Illumina GAIIx	4	206883615	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	HMMPfam_zf-DBF	p.R2040W	ENST00000374423.3	37	c.6118	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	C	12.74	2.027464	0.35797	2.74E-4	0.002453	ENSG00000204186	ENST00000374423	T	0.46819	0.86	5.79	3.82	0.43975	.	.	.	.	.	T	0.23572	0.0570	N	0.14661	0.345	0.09310	N	1	D	0.56968	0.978	B	0.36504	0.226	T	0.12785	-1.0534	9	0.62326	D	0.03	.	3.494	0.07648	0.2768:0.5183:0.1158:0.0891	.	2040	Q9HCK1	ZDBF2_HUMAN	W	2040	ENSP00000363545:R2040W	ENSP00000363545:R2040W	R	+	1	2	ZDBF2	206883615	0.000000	0.05858	0.007000	0.13788	0.034000	0.12701	0.491000	0.22419	1.434000	0.47414	0.563000	0.77884	CGG	-	NULL		0.353	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	protein_coding	OTTHUMT00000336458.1	C	NM_020923		206883615	+1	no_errors	NM_020923	genbank	human	validated	54_36p	missense	SNP	0.000	T
TSNAX	7257	genome.wustl.edu	37	1	231673019	231673019	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr1:231673019G>A	ENST00000366639.4	+	3	340	c.182G>A	c.(181-183)cGg>cAg	p.R61Q	TSNAX-DISC1_ENST00000602962.1_Missense_Mutation_p.R61Q|TSNAX_ENST00000602825.1_3'UTR	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X	61					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				AAACTTAGTCGGGATATAACT	0.328																																																0			1											127.0	130.0	129.0					1																	231673019		2203	4300	6503	229739642	SO:0001583	missense	7257			X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.182G>A	1.37:g.231673019G>A	ENSP00000355599:p.Arg61Gln	Somatic		Capture	Illumina GAIIx	4	229739642	B1APC6	Missense_Mutation	SNP	superfamily_Translin,HMMPfam_Translin	p.R61Q	ENST00000366639.4	37	c.182	CCDS1596.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.159977	0.94727	.	.	ENSG00000116918	ENST00000366639;ENST00000413309	.	.	.	6.08	6.08	0.98989	Translin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83478	0.5263	M	0.87381	2.88	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	T	0.83052	-0.0152	9	0.39692	T	0.17	.	15.7628	0.78101	0.0667:0.0:0.9333:0.0	.	61	Q99598	TSNAX_HUMAN	Q	61	.	ENSP00000355599:R61Q	R	+	2	0	TSNAX	229739642	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.318000	0.96334	2.890000	0.99128	0.655000	0.94253	CGG	-	superfamily_Translin,HMMPfam_Translin		0.328	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSNAX	protein_coding	OTTHUMT00000095267.2	G	NM_005999		229739642	+1	no_errors	NM_005999	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SP100	6672	genome.wustl.edu	37	2	231404024	231404024	+	Missense_Mutation	SNP	C	C	T	rs199971910	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr2:231404024C>T	ENST00000340126.4	+	25	2168	c.2137C>T	c.(2137-2139)Cgg>Tgg	p.R713W	AC010149.4_ENST00000414539.1_RNA|AC010149.4_ENST00000455357.1_RNA	NM_001080391.1	NP_001073860.1	P23497	SP100_HUMAN	SP100 nuclear antigen	0					cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CAAATGGGGACGGCTGTTCTG	0.498													C|||	2	0.000399361	0.0	0.0	5008	,	,		21099	0.0		0.002	False		,,,				2504	0.0															0			2						C	TRP/ARG	1,4117		0,1,2058	129.0	133.0	132.0		2137	-8.5	0.0	2		132	28,8376		0,28,4174	yes	missense	SP100	NM_001080391.1	101	0,29,6232	TT,TC,CC		0.3332,0.0243,0.2316	possibly-damaging	713/886	231404024	29,12493	2059	4202	6261	231112268	SO:0001583	missense	6672			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000340126.4:c.2137C>T	2.37:g.231404024C>T	ENSP00000343023:p.Arg713Trp	Somatic		Capture	Illumina GAIIx	4	231112268	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	HMMPfam_Sp100,superfamily_SAND domain-like,HMMPfam_SAND,HMMSmart_SM00258,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain	p.R713W	ENST00000340126.4	37	c.2137	CCDS42832.1	2	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	C|C	9.927|9.927	1.213851|1.213851	0.22289|0.22289	2.43E-4|2.43E-4	0.003332|0.003332	ENSG00000067066|ENSG00000067066	ENST00000340126;ENST00000414648|ENST00000431952	D|.	0.85013|.	-1.93|.	4.24|4.24	-8.48|-8.48	0.00935|0.00935	.|.	.|.	.|.	.|.	.|.	T|T	0.16041|0.16041	0.0386|0.0386	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B;D|.	0.56968|.	0.296;0.978|.	B;B|.	0.43916|.	0.122;0.436|.	T|T	0.21518|0.21518	-1.0243|-1.0243	9|5	0.49607|.	T|.	0.09|.	.|.	7.2749|7.2749	0.26279|0.26279	0.1355:0.6002:0.1598:0.1045|0.1355:0.6002:0.1598:0.1045	.|.	183;713|.	E9PHN1;P23497-4|.	.;.|.	W|M	713;183|86	ENSP00000343023:R713W|.	ENSP00000343023:R713W|.	R|T	+|+	1|2	2|0	SP100|SP100	231112268|231112268	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-2.490000|-2.490000	0.00975|0.00975	-2.504000|-2.504000	0.00508|0.00508	-1.194000|-1.194000	0.01681|0.01681	CGG|ACG	-	superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1		0.498	SP100-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SP100	protein_coding	OTTHUMT00000332246.1	C	NM_003113		231112268	+1	no_errors	NM_001080391	genbank	human	validated	54_36p	missense	SNP	0.000	T
ERO1LB	56605	genome.wustl.edu	37	1	236389626	236389626	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr1:236389626T>G	ENST00000354619.5	-	12	1196	c.995A>C	c.(994-996)aAt>aCt	p.N332T		NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	332					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	TTCTTCTGCATTTCCAGTGTA	0.363																																																0			1											86.0	87.0	87.0					1																	236389626		2203	4300	6503	234456249	SO:0001583	missense	56605			AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.995A>C	1.37:g.236389626T>G	ENSP00000346635:p.Asn332Thr	Somatic		Capture	Illumina GAIIx	4	234456249	B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Missense_Mutation	SNP	superfamily_ERO1,HMMPfam_ERO1	p.N332T	ENST00000354619.5	37	c.995	CCDS31064.1	1	.	.	.	.	.	.	.	.	.	.	T	17.36	3.368725	0.61624	.	.	ENSG00000086619	ENST00000354619;ENST00000264181	T;T	0.43688	0.94;0.94	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.60157	0.2247	M	0.86178	2.8	0.80722	D	1	P	0.42871	0.792	P	0.50537	0.643	T	0.63897	-0.6533	10	0.41790	T	0.15	-29.4649	15.3744	0.74593	0.0:0.0:0.0:1.0	.	332	Q86YB8	ERO1B_HUMAN	T	332;57	ENSP00000346635:N332T;ENSP00000264181:N57T	ENSP00000264181:N57T	N	-	2	0	ERO1LB	234456249	1.000000	0.71417	0.883000	0.34634	0.899000	0.52679	3.941000	0.56607	2.028000	0.59812	0.472000	0.43445	AAT	-	superfamily_ERO1,HMMPfam_ERO1		0.363	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERO1LB	protein_coding	OTTHUMT00000096371.1	T	NM_019891		234456249	-1	no_errors	NM_019891	genbank	human	provisional	54_36p	missense	SNP	0.995	G
OVCA2	124641	genome.wustl.edu	37	17	1945795	1945796	+	Intron	INS	-	-	CTCT	rs374096215|rs146098354|rs371990589	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr17:1945795_1945796insCTCT	ENST00000572195.1	+	2	199				RP11-667K14.3_ENST00000572790.1_lincRNA|DPH1_ENST00000263083.6_Intron|RP11-667K14.4_ENST00000572404.1_RNA|DPH1_ENST00000570477.1_Intron	NM_080822.2	NP_543012.1	Q8WZ82	OVCA2_HUMAN	ovarian tumor suppressor candidate 2						metabolic process (GO:0008152)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)										GCCTCGATTCCCTTTTTCTCTC	0.53											OREG0024078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		556	0.111022	0.205	0.1167	5008	,	,		17505	0.001		0.0785	False		,,,				2504	0.1268															0			17																																								1892546	SO:0001627	intron_variant	0			AF321875	CCDS11015.1	17p13.3	2012-10-08			ENSG00000262664	ENSG00000262664			24203	protein-coding gene	gene with protein product	"""candidate tumor suppressor in ovarian cancer 2"""	607896				11979432, 8616839, 16368187	Standard	NM_080822		Approved		uc002ftx.3	Q8WZ82	OTTHUMG00000132471	ENST00000572195.1:c.185-103->CTCT	17.37:g.1945795_1945796insCTCT		Somatic	599	Capture	Illumina GAIIx	4	1892545	Q86XN3|Q8IW87|Q9UCX9	Frame_Shift_Ins	INS	NULL	p.G319fs	ENST00000572195.1	37	c.956_955	CCDS11015.1	17																																																																																			-	NULL		0.530	OVCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100134144	protein_coding	OTTHUMT00000255636.5	-	NM_080822		1892546	-1	no_start_codon:pseudogene:no_stop_codon	XM_001717999	genbank	human	model	54_36p	frame_shift_ins	INS	0.000:0.001	CTCT
RAI1	10743	genome.wustl.edu	37	17	17697102	17697102	+	Frame_Shift_Del	DEL	G	G	-	rs398124422|rs34083643|rs398124421|rs587780431		TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr17:17697102delG	ENST00000353383.1	+	3	1309	c.840delG	c.(838-840)cagfs	p.Q291fs	RAI1_ENST00000261641.6_Frame_Shift_Del_p.Q291fs	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	291	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)	p.Q280fs*84(1)		breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		ACcagcagcagcagcagcagc	0.627																																																1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)	17											20.0	25.0	23.0					17																	17697102		2038	4033	6071	17637827	SO:0001589	frameshift_variant	10743			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.840delG	17.37:g.17697102delG	ENSP00000323074:p.Gln291fs	Somatic		Capture	Illumina GAIIx	4	17637827	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Frame_Shift_Del	DEL	HMMSmart_SM00249	p.Q280fs	ENST00000353383.1	37	c.840	CCDS11188.1	17																																																																																			(deletion:cds_exon[17636988,17642552])	NULL		0.627	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	protein_coding	OTTHUMT00000131775.1	G	NM_030665		17637827	+1	no_errors	NM_030665	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.999	-
FANCM	57697	genome.wustl.edu	37	14	45633736	45633748	+	Frame_Shift_Del	DEL	GTTATTATCCTTT	GTTATTATCCTTT	-	rs147805461	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	GTTATTATCCTTT	GTTATTATCCTTT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr14:45633736_45633748delGTTATTATCCTTT	ENST00000267430.5	+	10	1841_1853	c.1756_1768delGTTATTATCCTTT	c.(1756-1770)gttattatcctttctfs	p.VIILS586fs	FANCM_ENST00000542564.2_Frame_Shift_Del_p.VIILS560fs|FANCM_ENST00000556036.1_Frame_Shift_Del_p.VIILS586fs	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	586	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						AGGCAGGATAGTTATTATCCTTTCTGAAGGACG	0.399								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																							0			14																																								44703498	SO:0001589	frameshift_variant	57697	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1756_1768delGTTATTATCCTTT	14.37:g.45633736_45633748delGTTATTATCCTTT	ENSP00000267430:p.Val586fs	Somatic		Capture	Illumina GAIIx	4	44703486	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Frame_Shift_Del	DEL	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,HMMSmart_SM00490,HMMPfam_Helicase_C,superfamily_Restriction endonuclease-like,HMMPfam_ERCC4,superfamily_RuvA domain 2-like	p.V586fs	ENST00000267430.5	37	c.1756_1768	CCDS32070.1	14																																																																																			(deletion:cds_exon[44703312,44703518])	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.399	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	protein_coding	OTTHUMT00000410474.1	GTTATTATCCTTT	XM_048128		44703498	+1	no_errors	NM_020937	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:0.995:1.000:1.000:0.999:1.000:1.000:0.973:0.988:0.979:0.227:0.203	-
TMEM260	54916	genome.wustl.edu	37	14	57101641	57101654	+	Frame_Shift_Del	DEL	TGTGGCCAATGAAG	TGTGGCCAATGAAG	-	rs150375138		TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	TGTGGCCAATGAAG	TGTGGCCAATGAAG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr14:57101641_57101654delTGTGGCCAATGAAG	ENST00000261556.6	+	14	1871_1884	c.1749_1762delTGTGGCCAATGAAG	c.(1747-1764)tctgtggccaatgaagaafs	p.VANEE584fs	TMEM260_ENST00000538838.1_3'UTR|RP11-1085N6.2_ENST00000555924.1_RNA|TMEM260_ENST00000536419.1_Frame_Shift_Del_p.VANEE118fs|RP11-1085N6.2_ENST00000553800.1_RNA	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	584						integral component of membrane (GO:0016021)											CTTGGGAATCTGTGGCCAATGAAGAAATGTGGCA	0.36																																																0			14																																								56171407	SO:0001589	frameshift_variant	54916			AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.1749_1762delTGTGGCCAATGAAG	14.37:g.57101641_57101654delTGTGGCCAATGAAG	ENSP00000261556:p.Val584fs	Somatic		Capture	Illumina GAIIx	4	56171394	A8KAN4|B3KPF5|Q86XE1	Frame_Shift_Del	DEL	NULL	p.V584fs	ENST00000261556.6	37	c.1749_1762	CCDS9727.2	14																																																																																			(deletion:cds_exon[56171370,56171423])	NULL		0.360	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf101	protein_coding	OTTHUMT00000276924.1	TGTGGCCAATGAAG	NM_017799		56171407	+1	no_errors	NM_017799	genbank	human	validated	54_36p	frame_shift_del	DEL	0.995:1.000:1.000:0.998:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:0.995:1.000	-
GATS	352954	genome.wustl.edu	37	7	99821839	99821844	+	Intron	DEL	TTTTTT	TTTTTT	-	rs10673922|rs372167927	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	TTTTTT	TTTTTT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr7:99821839_99821844delTTTTTT	ENST00000436886.2	-	3	466				GATS_ENST00000543273.1_RNA	NM_178831.6	NP_849153.3	Q8NAP1	GATS_HUMAN	GATS, stromal antigen 3 opposite strand											endometrium(2)|large_intestine(2)|lung(4)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCCAACAGGAtttttttttttttttt	0.529														2822	0.563498	0.7436	0.4193	5008	,	,		18721	0.3383		0.5924	False		,,,				2504	0.6247															0			7																																								99659780	SO:0001627	intron_variant	10734			AK095056	CCDS43621.1	7q22.1	2014-08-13	2009-04-08	2009-04-08	ENSG00000160844	ENSG00000239521			29954	protein-coding gene	gene with protein product	"""stromal antigen 3 opposite strand"""					12477932	Standard	NM_178831		Approved	DKFZp686B07267, STAG3OS	uc003uua.4	Q8NAP1	OTTHUMG00000155289	ENST00000436886.2:c.218-141AAAAAA>-	7.37:g.99821845_99821850delTTTTTT		Somatic		Capture	Illumina GAIIx	4	99659775	D6W5V0|Q68D93|Q6P198|Q6PII7|Q7Z720|Q86UK9	Frame_Shift_Del	DEL	superfamily_ARM repeat,HMMPfam_STAG	p.D1224fs	ENST00000436886.2	37	c.3672_3675	CCDS43621.1	7																																																																																			(deletion:cds_exon[99659773,99659778], flank[99659779,99709778])	NULL		0.529	GATS-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG3	protein_coding		TTTTTT	NM_178831		99659780	+1	no_stop_codon	ENST00000394018	ensembl	human	known	54_36p	frame_shift_del	DEL	0.113:0.101:0.089:0.076	-
HNRNPA0	10949	genome.wustl.edu	37	5	137088945	137088946	+	In_Frame_Ins	INS	-	-	GCT	rs78232709|rs201570235|rs548286503	byFrequency	TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr5:137088945_137088946insGCT	ENST00000314940.4	-	1	1093_1094	c.810_811insAGC	c.(808-813)agcggc>agcAGCggc	p.270_271insS		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	270	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ccgccgccgccgcTCTTCATGG	0.673														38	0.00758786	0.0015	0.013	5008	,	,		9196	0.0		0.0209	False		,,,				2504	0.0061															0			5								20,3804		3,14,1895						2.6	0.0		dbSNP_131	9	196,7418		14,168,3625	no	coding	HNRNPA0	NM_006805.3		17,182,5520	A1A1,A1R,RR		2.5742,0.523,1.8884				216,11222				137116845	SO:0001652	inframe_insertion	10949			U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.808_810dupAGC	5.37:g.137088946_137088948dupGCT	ENSP00000316042:p.Ser270_Ser270dup	Somatic		Capture	Illumina GAIIx	4	137116844	Q6IB18	In_Frame_Ins	INS	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.270in_frame_insS	ENST00000314940.4	37	c.811_810	CCDS4193.1	5																																																																																			-	NULL		0.673	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPA0	protein_coding	OTTHUMT00000251221.1	-	NM_006805		137116845	-1	no_errors	NM_006805	genbank	human	reviewed	54_36p	in_frame_ins	INS	0.989:0.989	GCT
MLLT4	4301	genome.wustl.edu	37	6	168299145	168299146	+	Frame_Shift_Ins	INS	-	-	G			TCGA-29-1697-01A-01W-0633-09	TCGA-29-1697-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c8fb542e-1713-4e61-84ac-6b9f85288da0	84b432ab-5c6b-4e47-a516-444cb68b5455	g.chr6:168299145_168299146insG	ENST00000447894.2	+	11	1578_1579	c.1578_1579insG	c.(1579-1581)ggafs	p.G527fs	MLLT4_ENST00000392112.1_Frame_Shift_Ins_p.G511fs|MLLT4_ENST00000344191.4_Frame_Shift_Ins_p.G527fs|MLLT4_ENST00000366806.2_Frame_Shift_Ins_p.G527fs|MLLT4_ENST00000392108.3_Frame_Shift_Ins_p.G527fs|MLLT4_ENST00000351017.4_Frame_Shift_Ins_p.G527fs|MLLT4_ENST00000400822.3_Frame_Shift_Ins_p.G526fs			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	527					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GACATAAACCTGGGTAAATAGA	0.351			T	MLL	AL																																		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0			6																																								168041995	SO:0001589	frameshift_variant	4301			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.1580dupG	6.37:g.168299148_168299148dupG	ENSP00000404595:p.Gly527fs	Somatic		Capture	Illumina GAIIx	4	168041994	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Frame_Shift_Ins	INS	HMMPfam_RA,HMMSmart_RA,superfamily_SSF54236,superfamily_SMAD_FHA,HMMSmart_FHA,HMMPfam_FHA,HMMPfam_DIL,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ	p.I526fs	ENST00000447894.2	37	c.1575_1576		6																																																																																			-	NULL		0.351	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	protein_coding	OTTHUMT00000372077.1	-	NM_005936		168041995	+1	no_errors	NM_001040001	genbank	human	validated	54_36p	frame_shift_ins	INS	0.994:1.000	G
