#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								3522	SO:0001628	intergenic_variant	4535																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	3522		Missense_Mutation	SNP	HMMPfam_NADHdh,PatternScan_COMPLEX1_ND1_1,PatternScan_COMPLEX1_ND1_2	p.I72T		37	c.215		MT																																																																																			-	HMMPfam_NADHdh	0	0					MT-ND1			T			3522	+1	no_errors	ENST00000361390	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			NT_113923																																								90129	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	90129		Missense_Mutation	SNP	HMMPfam_G_glu_transpept,PatternScan_G_GLU_TRANSPEPTIDASE	p.A227V		37	c.680		NT_113923																																																																																			-	HMMPfam_G_glu_transpept	0	0					ENSG00000216522			G			90129	-1	no_errors	ENST00000402757	ensembl	human	known	54_36p	missense	SNP	NULL	A
DOCK8	81704	genome.wustl.edu	37	9	463585	463585	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr9:463585T>A	ENST00000453981.1	+	47	6249	c.6137T>A	c.(6136-6138)cTc>cAc	p.L2046H	RP11-165F24.3_ENST00000586805.1_RNA|RP11-165F24.3_ENST00000589387.1_RNA|DOCK8_ENST00000432829.2_Missense_Mutation_p.L1978H|RP11-165F24.3_ENST00000593137.1_RNA|DOCK8_ENST00000469391.1_Missense_Mutation_p.L1946H|RP11-165F24.3_ENST00000415004.2_RNA|RP11-165F24.3_ENST00000592805.1_RNA|DOCK8_ENST00000382329.1_Missense_Mutation_p.L1513H|RP11-165F24.3_ENST00000588474.1_RNA|RP11-165F24.3_ENST00000590518.1_RNA|RP11-165F24.3_ENST00000585819.1_RNA|RP11-165F24.3_ENST00000591577.1_RNA|RP11-165F24.3_ENST00000589287.1_RNA|RP11-165F24.3_ENST00000588989.1_RNA|RP11-165F24.3_ENST00000608617.1_RNA			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	2046	DHR-2.			L -> F (in Ref. 8; AAG42221). {ECO:0000305}.	blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CAGCAGGAACTCAAAAAGAAC	0.413																																																0			9											73.0	71.0	72.0					9																	463585		2203	4300	6503	453585	SO:0001583	missense	81704			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.6137T>A	9.37:g.463585T>A	ENSP00000408464:p.Leu2046His	Somatic		Capture	Illumina GAIIx	4	453585	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	HMMPfam_Ded_cyto	p.L1978H	ENST00000453981.1	37	c.5933	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	T	23.9	4.469926	0.84533	.	.	ENSG00000107099	ENST00000453981;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.04	5.04	0.67666	.	0.065132	0.64402	D	0.000010	T	0.61924	0.2386	M	0.88181	2.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.992;0.994	T	0.70673	-0.4807	10	0.87932	D	0	.	14.7443	0.69480	0.0:0.0:0.0:1.0	.	1946;1513;2046	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	H	2046;1978;1946;1513	ENSP00000408464:L2046H;ENSP00000394888:L1978H;ENSP00000419438:L1946H;ENSP00000371766:L1513H	ENSP00000371766:L1513H	L	+	2	0	DOCK8	453585	1.000000	0.71417	0.991000	0.47740	0.988000	0.76386	7.470000	0.80973	2.031000	0.59945	0.460000	0.39030	CTC	-	HMMPfam_Ded_cyto		0.413	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	protein_coding	OTTHUMT00000171792.5	T	XM_036307		453585	+1	no_errors	NM_203447	genbank	human	validated	54_36p	missense	SNP	1.000	A
PHRF1	57661	genome.wustl.edu	37	11	592610	592610	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr11:592610T>A	ENST00000264555.5	+	6	684	c.556T>A	c.(556-558)Tgt>Agt	p.C186S	PHRF1_ENST00000413872.2_Missense_Mutation_p.C185S|PHRF1_ENST00000533464.1_Missense_Mutation_p.C182S|PHRF1_ENST00000416188.2_Missense_Mutation_p.C186S	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	186					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						CCCGACCTTCTGTGAGGTGTG	0.627																																																0			11											138.0	158.0	151.0					11																	592610		2176	4256	6432	582610	SO:0001583	missense	57661			BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.556T>A	11.37:g.592610T>A	ENSP00000264555:p.Cys186Ser	Somatic		Capture	Illumina GAIIx	4	582610	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	superfamily_RING/U-box,HMMPfam_zf-C3HC4,HMMSmart_SM00184,PatternScan_ZF_RING_1,PatternScan_ZF_PHD_1,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD	p.C186S	ENST00000264555.5	37	c.556		11	.	.	.	.	.	.	.	.	.	.	T	18.71	3.682838	0.68157	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	D;D;D;D	0.99252	-5.63;-5.63;-5.63;-5.63	4.11	4.11	0.48088	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.42548	D	0.000691	D	0.99684	0.9881	H	0.99404	4.55	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.97231	0.9884	10	0.87932	D	0	-10.4156	12.2284	0.54474	0.0:0.0:0.0:1.0	.	182;185;186;186	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	S	186;185;186;182	ENSP00000264555:C186S;ENSP00000388589:C185S;ENSP00000410626:C186S;ENSP00000431870:C182S	ENSP00000264555:C186S	C	+	1	0	PHRF1	582610	1.000000	0.71417	1.000000	0.80357	0.328000	0.28507	7.487000	0.81328	1.731000	0.51592	0.533000	0.62120	TGT	-	PatternScan_ZF_PHD_1,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,HMMSmart_SM00184		0.627	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHRF1	protein_coding	OTTHUMT00000382133.1	T	NM_020901		582610	+1	no_errors	NM_020901	genbank	human	validated	54_36p	missense	SNP	1.000	A
MYT1L	23040	genome.wustl.edu	37	2	1926808	1926808	+	Silent	SNP	G	G	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr2:1926808G>T	ENST00000399161.2	-	10	1480	c.733C>A	c.(733-735)Cgg>Agg	p.R245R	MYT1L_ENST00000428368.2_Silent_p.R245R	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	245					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R245R(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCACTTTTCCGACCCAGGTTT	0.468																																																1	Substitution - coding silent(1)	lung(1)	2											171.0	160.0	163.0					2																	1926808		1896	4121	6017	1905815	SO:0001819	synonymous_variant	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.733C>A	2.37:g.1926808G>T		Somatic		Capture	Illumina GAIIx	4	1905815	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	superfamily_SSF103637,HMMPfam_zf-C2HC,HMMPfam_MYT1,PatternScan_EF_HAND_1	p.R245	ENST00000399161.2	37	c.733		2																																																																																			-	NULL		0.468	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	protein_coding	OTTHUMT00000322493.1	G	NM_015025		1905815	-1	no_errors	NM_015025	genbank	human	validated	54_36p	silent	SNP	1.000	T
CNTN4	152330	genome.wustl.edu	37	3	3067877	3067877	+	Silent	SNP	G	G	A	rs375250470		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr3:3067877G>A	ENST00000397461.1	+	14	1962	c.1578G>A	c.(1576-1578)tcG>tcA	p.S526S	CNTN4_ENST00000397459.2_Silent_p.S198S|CNTN4_ENST00000418658.1_Silent_p.S526S|CNTN4_ENST00000358480.3_Silent_p.S307S|CNTN4_ENST00000427331.1_Silent_p.S526S|CNTN4_ENST00000448906.2_Silent_p.S198S	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	526	Ig-like C2-type 6.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		ATGATCACTCGCTAGACATCG	0.448																																																0			3						G	,,,	0,4406		0,0,2203	189.0	157.0	168.0		1578,594,1578,594	-10.0	0.0	3		168	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CNTN4	NM_001206955.1,NM_001206956.1,NM_175607.2,NM_175613.2	,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,	526/1027,198/698,526/1027,198/699	3067877	1,13005	2203	4300	6503	3042877	SO:0001819	synonymous_variant	152330			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.1578G>A	3.37:g.3067877G>A		Somatic		Capture	Illumina GAIIx	4	3042877	B2RAX3|Q8IX14|Q8TC35	Silent	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.S526	ENST00000397461.1	37	c.1578	CCDS43041.1	3																																																																																			-	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig		0.448	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	protein_coding	OTTHUMT00000239236.2	G			3042877	+1	no_errors	NM_175607	genbank	human	reviewed	54_36p	silent	SNP	0.957	A
C19orf71	100128569	genome.wustl.edu	37	19	3542790	3542790	+	Intron	SNP	C	C	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr19:3542790C>T	ENST00000329493.5	+	2	107				AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000389395.3_Intron|MFSD12_ENST00000398558.4_Missense_Mutation_p.G536R	NM_001135580.1	NP_001129052.1	A6NCJ1	CS071_HUMAN	chromosome 19 open reading frame 71											endometrium(2)	2						TAGTGGGTCCCCCAGTCTTCC	0.617																																																0			19											25.0	28.0	27.0					19																	3542790		1927	4120	6047	3493790	SO:0001627	intron_variant	126321				CCDS45918.1	19p13.3	2012-10-26			ENSG00000183397	ENSG00000183397			34496	protein-coding gene	gene with protein product							Standard	NM_001135580		Approved	LOC100128569	uc010xhm.2	A6NCJ1		ENST00000329493.5:c.84-443C>T	19.37:g.3542790C>T		Somatic		Capture	Illumina GAIIx	4	3493790		Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.G536R	ENST00000329493.5	37	c.1606	CCDS45918.1	19	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.153972	0.00325	.	.	ENSG00000161091	ENST00000398558	T	0.23147	1.92	1.59	0.444	0.16592	.	.	.	.	.	T	0.08537	0.0212	N	0.08118	0	0.09310	N	1	B	0.30406	0.278	B	0.19666	0.026	T	0.32322	-0.9911	9	0.07482	T	0.82	.	4.9453	0.13985	0.3556:0.6444:0.0:0.0	.	536	A8MXP7	.	R	536	ENSP00000381566:G536R	ENSP00000381566:G536R	G	-	1	0	C19orf28	3493790	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.986000	0.03747	0.200000	0.20447	-0.518000	0.04402	GGG	-	NULL		0.617	C19orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf28	protein_coding	OTTHUMT00000452943.1	C	NM_001135580		3493790	-1	no_errors	NM_021731	genbank	human	validated	54_36p	missense	SNP	0.009	T
CREBBP	1387	genome.wustl.edu	37	16	3789578	3789578	+	Splice_Site	SNP	C	C	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr16:3789578C>A	ENST00000262367.5	-	25	5090		c.e25+1		CREBBP_ENST00000382070.3_Splice_Site	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein						cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGGAAAACTACCTCGTGTTTG	0.517			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0			16											63.0	59.0	61.0					16																	3789578		2197	4300	6497	3729579	SO:0001630	splice_region_variant	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4280+1G>T	16.37:g.3789578C>A		Somatic		Capture	Illumina GAIIx	4	3729579	D3DUC9|O00147|Q16376|Q4LE28	Splice_Site	SNP	-	e25+1	ENST00000262367.5	37	c.4280+1	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771010	0.69992	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4402	0.94817	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CREBBP	3729579	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	7.701000	0.84566	2.665000	0.90641	0.561000	0.74099	.	-	-		0.517	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	protein_coding	OTTHUMT00000251591.2	C	NM_004380	Intron	3729579	-1	no_errors	NM_004380	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
PELP1	27043	genome.wustl.edu	37	17	4608230	4608230	+	5'Flank	SNP	T	T	A	rs60594518	byFrequency	TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr17:4608230T>A	ENST00000574876.1	-	0	0				PELP1_ENST00000301396.4_5'Flank|PELP1_ENST00000572293.1_5'Flank|PELP1_ENST00000570823.1_5'Flank|PELP1_ENST00000436683.2_5'Flank|PELP1_ENST00000269230.7_5'Flank|RP11-314A20.2_ENST00000497885.1_RNA			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1						cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						TCTCTGTCGATTTTTACAGAG	0.453																																																0			17																																								4554979	SO:0001631	upstream_gene_variant	0				CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8			17.37:g.4608230T>A	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	4554979	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Splice_Site	SNP	-	NULL	ENST00000574876.1	37	c.NULL	CCDS58503.1	17																																																																																			-	-		0.453	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	RPS12P29	protein_coding	OTTHUMT00000439140.2	T	NM_014389		4554979	-1	no_coding_region:pseudogene	ENST00000396944	ensembl	human	known	54_36p	splice_site	SNP	1.000	A
EPB41L3	23136	genome.wustl.edu	37	18	5415927	5415927	+	Missense_Mutation	SNP	C	C	T	rs201249884		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr18:5415927C>T	ENST00000341928.2	-	13	2297	c.1957G>A	c.(1957-1959)Gct>Act	p.A653T	EPB41L3_ENST00000540638.2_Intron|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000427684.2_Intron|EPB41L3_ENST00000400111.3_Intron|EPB41L3_ENST00000542652.2_Intron|EPB41L3_ENST00000342933.3_Missense_Mutation_p.A653T|EPB41L3_ENST00000542146.1_Intron	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	653	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						AGAGTGAGAGCGTATGGCACT	0.572																																																0			18						C	THR/ALA	0,4406		0,0,2203	168.0	120.0	136.0		1957	5.5	1.0	18		136	2,8598	2.2+/-6.3	0,2,4298	yes	missense	EPB41L3	NM_012307.2	58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	653/1088	5415927	2,13004	2203	4300	6503	5405927	SO:0001583	missense	23136			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1957G>A	18.37:g.5415927C>T	ENSP00000343158:p.Ala653Thr	Somatic		Capture	Illumina GAIIx	4	5405927	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	HMMSmart_SM00295,superfamily_Ubiquitin-like,HMMPfam_FERM_N,PatternScan_FERM_1,superfamily_Second domain of FERM,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_PH domain-like,HMMPfam_FERM_C,HMMPfam_FA,HMMPfam_SAB,HMMPfam_4_1_CTD	p.A653T	ENST00000341928.2	37	c.1957	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	C	27.1	4.796165	0.90453	0.0	2.33E-4	ENSG00000082397	ENST00000341928;ENST00000342933	D;D	0.82803	-1.65;-1.65	5.52	5.52	0.82312	.	0.164099	0.42172	D	0.000744	D	0.85146	0.5630	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.64506	0.926	D	0.87468	0.2412	10	0.87932	D	0	.	19.4559	0.94889	0.0:1.0:0.0:0.0	.	653	Q9Y2J2	E41L3_HUMAN	T	653	ENSP00000343158:A653T;ENSP00000341138:A653T	ENSP00000343158:A653T	A	-	1	0	EPB41L3	5405927	1.000000	0.71417	0.990000	0.47175	0.986000	0.74619	5.920000	0.70017	2.586000	0.87340	0.563000	0.77884	GCT	-	NULL		0.572	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	protein_coding	OTTHUMT00000254424.1	C	NM_012307		5405927	-1	no_errors	NM_012307	genbank	human	provisional	54_36p	missense	SNP	1.000	T
OR7E136P	155340	genome.wustl.edu	37	7	6907007	6907007	+	IGR	SNP	A	A	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr7:6907007A>G								CCZ1B (40606 upstream) : AC079804.2 (11168 downstream)																							GTCCACAATCATCTTGGGAAC	0.542																																																0			7																																								6873532	SO:0001628	intergenic_variant	641922																															7.37:g.6907007A>G		Somatic		Capture	Illumina GAIIx	4	6873532		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.542					LOC641922			A			6873532	-1	pseudogene	XR_037560	genbank	human	model	54_36p	rna	SNP	0.112	G
CAMTA1	23261	genome.wustl.edu	37	1	7110052	7110052	+	Intron	SNP	G	G	A	rs78087116	byFrequency	TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:7110052G>A	ENST00000303635.7	+	4	441				CAMTA1_ENST00000439411.2_Intron	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AGGAGGGAATGGGGTCCAGCG	0.612			T	WWTR1	epitheliod hemangioendothelioma								G|||	76	0.0151757	0.0552	0.0043	5008	,	,		17478	0.0		0.0	False		,,,				2504	0.0						Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0			1																																								7032639	SO:0001627	intron_variant	0			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.235-41312G>A	1.37:g.7110052G>A		Somatic		Capture	Illumina GAIIx	4	7032639	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	NULL	p.H148Y	ENST00000303635.7	37	c.442	CCDS30576.1	1																																																																																			-	NULL		0.612	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC100129476	protein_coding	OTTHUMT00000003588.3	G	NM_015215		7032639	-1	no_errors	XM_001718470	genbank	human	model	54_36p	missense	SNP	0.004	A
TP53	7157	genome.wustl.edu	37	17	7578272	7578272	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr17:7578272G>A	ENST00000269305.4	-	6	766	c.577C>T	c.(577-579)Cat>Tat	p.H193Y	TP53_ENST00000359597.4_Missense_Mutation_p.H193Y|TP53_ENST00000455263.2_Missense_Mutation_p.H193Y|TP53_ENST00000445888.2_Missense_Mutation_p.H193Y|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.H193Y|TP53_ENST00000413465.2_Missense_Mutation_p.H193Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193Y(29)|p.H193D(13)|p.0?(8)|p.?(6)|p.H193N(4)|p.A189_V197delAPPQHLIRV(4)|p.H193fs*16(3)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.H61D(2)|p.H100D(2)|p.P191fs*15(1)|p.H61Y(1)|p.P191fs*6(1)|p.H100Y(1)|p.P98_E105>Q(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.H193_I195>AP(1)|p.A189fs*53(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGATAAGATGCTGAGGAGGG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	85	Substitution - Missense(52)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	breast(14)|lung(12)|haematopoietic_and_lymphoid_tissue(8)|biliary_tract(7)|ovary(6)|upper_aerodigestive_tract(5)|liver(5)|oesophagus(5)|central_nervous_system(4)|skin(4)|bone(4)|large_intestine(3)|stomach(2)|urinary_tract(2)|pancreas(2)|adrenal_gland(1)|soft_tissue(1)	17											95.0	85.0	88.0					17																	7578272		2203	4300	6503	7518997	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.577C>T	17.37:g.7578272G>A	ENSP00000269305:p.His193Tyr	Somatic		Capture	Illumina GAIIx	4	7518997	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.H193Y	ENST00000269305.4	37	c.577	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.43	3.387715	0.61956	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99851	-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17;-7.17	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99873	0.9940	M	0.88906	2.99	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.96559	0.9414	10	0.87932	D	0	-29.0766	17.0767	0.86588	0.0:0.0:1.0:0.0	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193Y;ENSP00000352610:H193Y;ENSP00000269305:H193Y;ENSP00000398846:H193Y;ENSP00000391127:H193Y;ENSP00000391478:H193Y;ENSP00000425104:H61Y;ENSP00000423862:H100Y	ENSP00000269305:H193Y	H	-	1	0	TP53	7518997	1.000000	0.71417	0.971000	0.41717	0.032000	0.12392	9.813000	0.99286	2.702000	0.92279	0.655000	0.94253	CAT	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7518997	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PPIAP33	392285	genome.wustl.edu	37	9	7598226	7598226	+	IGR	SNP	A	A	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr9:7598226A>G								KDM4C (422578 upstream) : RP11-77E14.2 (187878 downstream)																							TTTCATCTGCACTGCCAAGAC	0.483																																																0			9																																								7588226	SO:0001628	intergenic_variant	392285																															9.37:g.7598226A>G		Somatic		Capture	Illumina GAIIx	4	7588226		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.483					LOC392285			A			7588226	+1	pseudogene	XR_017134	genbank	human	model	54_36p	rna	SNP	1.000	G
CTC1	80169	genome.wustl.edu	37	17	8138137	8138137	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr17:8138137G>A	ENST00000315684.8	-	9	1554	c.1547C>T	c.(1546-1548)cCg>cTg	p.P516L	CTC1_ENST00000581671.1_5'Flank	NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	516					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						GCTGCCTGGCGGAGCTAGAAG	0.577																																																0			17											91.0	94.0	93.0					17																	8138137		1954	4145	6099	8078862	SO:0001583	missense	80169			AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.1547C>T	17.37:g.8138137G>A	ENSP00000313759:p.Pro516Leu	Somatic		Capture	Illumina GAIIx	4	8078862	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	NULL	p.P516L	ENST00000315684.8	37	c.1547	CCDS42259.1	17	.	.	.	.	.	.	.	.	.	.	g	12.97	2.096808	0.36952	.	.	ENSG00000178971	ENST00000315684;ENST00000449476	D;D	0.82619	-1.63;-1.63	5.2	4.23	0.50019	.	0.086330	0.48767	D	0.000173	T	0.78597	0.4308	M	0.65975	2.015	0.28325	N	0.922072	B	0.31989	0.35	B	0.25614	0.062	T	0.74685	-0.3582	10	0.66056	D	0.02	-8.0759	9.7368	0.40392	0.0965:0.0:0.9035:0.0	.	516	Q2NKJ3	CTC1_HUMAN	L	516;481	ENSP00000313759:P516L;ENSP00000396018:P481L	ENSP00000313759:P516L	P	-	2	0	CTC1	8078862	0.872000	0.30054	0.142000	0.22268	0.783000	0.44284	3.591000	0.53986	1.223000	0.43536	0.598000	0.82781	CCG	-	NULL		0.577	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf68	protein_coding	OTTHUMT00000442012.1	G	NM_025099		8078862	-1	no_errors	NM_025099	genbank	human	validated	54_36p	missense	SNP	0.060	A
MUC16	94025	genome.wustl.edu	37	19	9069560	9069560	+	Silent	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr19:9069560G>A	ENST00000397910.4	-	3	18089	c.17886C>T	c.(17884-17886)acC>acT	p.T5962T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5964	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCCTGCCAGAGGTGAGAAGGG	0.493																																																0			19											102.0	98.0	99.0					19																	9069560		1986	4150	6136	8930560	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17886C>T	19.37:g.9069560G>A		Somatic		Capture	Illumina GAIIx	4	8930560	Q6ZQW5|Q96RK2	Silent	SNP	PatternScan_ATPASE_ALPHA_BETA,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.T5962	ENST00000397910.4	37	c.17886	CCDS54212.1	19																																																																																			-	NULL		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690		8930560	-1	no_errors	NM_024690	genbank	human	validated	54_36p	silent	SNP	0.000	A
SLC9B1P1	100128190	genome.wustl.edu	37	Y	13500754	13500754	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chrY:13500754C>T	ENST00000331172.6	-	5	567	c.568G>A	c.(568-570)Gca>Aca	p.A190T				A6NJY1	SL9P1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1 pseudogene 1	175						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										ACACATAATGCCAAACTCAGA	0.313																																																0			Y																																								11960754	SO:0001583	missense	0					Yq11.21	2013-07-15	2012-03-22	2011-07-26	ENSG00000183704	ENSG00000183704		"""Solute carriers"""	37492	pseudogene	pseudogene			"""Na+/H+ exchanger domain containing 1 pseudogene 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1 pseudogene 1"""	NHEDC1P1			Standard	NG_023008		Approved			A6NJY1		ENST00000331172.6:c.568G>A	Y.37:g.13500754C>T	ENSP00000331938:p.Ala190Thr	Somatic		Capture	Illumina GAIIx	4	11960754		Missense_Mutation	SNP	NULL	p.A175T	ENST00000331172.6	37	c.523		Y	.	.	.	.	.	.	.	.	.	.	N	11.01	1.512094	0.27036	.	.	ENSG00000183704	ENST00000331172	T	0.14893	2.47	1.4	1.4	0.22301	.	0.389991	0.24942	N	0.034367	T	0.10380	0.0254	.	.	.	.	.	.	.	.	.	.	.	.	T	0.08086	-1.0739	4	.	.	.	-15.4544	.	.	.	.	.	.	.	T	190	ENSP00000331938:A190T	.	A	-	1	0	AC134882.1	11960754	1.000000	0.71417	0.059000	0.19551	0.132000	0.20833	1.421000	0.34815	1.081000	0.41110	0.184000	0.17185	GCA	-	NULL		0.313	SLC9B1P1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000183704	protein_coding		C	NG_023008		11960754	-1	no_stop_codon	ENST00000331172	ensembl	human	known	54_36p	missense	SNP	0.095	T
CYP4F24P	388514	genome.wustl.edu	37	19	15881932	15881932	+	lincRNA	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr19:15881932G>A	ENST00000595525.1	+	0	1122																		p.W142fs*32(2)									TGCACCAGGCGGCAGGCCCTG	0.547																																																2	Deletion - Frameshift(2)	breast(2)	19																																								15742932			388514																															19.37:g.15881932G>A		Somatic		Capture	Illumina GAIIx	4	15742932		RNA	SNP	-	NULL	ENST00000595525.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	.	2.885	-0.230931	0.05983	.	.	ENSG00000225607	ENST00000412610	.	.	.	1.94	-0.53	0.11898	.	.	.	.	.	T	0.27900	0.0687	.	.	.	.	.	.	B	0.29212	0.237	B	0.27608	0.081	T	0.26573	-1.0099	6	0.56958	D	0.05	.	4.5069	0.11893	0.0:0.2172:0.3425:0.4402	.	149	B4DNA9	.	C	149	.	ENSP00000389636:R149C	R	-	1	0	AC011537.1	15742932	0.010000	0.17322	0.643000	0.29450	0.051000	0.14879	0.066000	0.14489	-0.035000	0.13691	-0.458000	0.05436	CGC	-	-		0.547	LLNLR-249E10.1-001	KNOWN	basic	lincRNA	LOC388514	lincRNA	OTTHUMT00000472008.1	G			15742932	-1	no_errors	XR_017598	genbank	human	model	54_36p	rna	SNP	0.924	A
UNC13A	23025	genome.wustl.edu	37	19	17753742	17753742	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr19:17753742G>A	ENST00000519716.2	-	20	2383	c.2384C>T	c.(2383-2385)tCg>tTg	p.S795L	UNC13A_ENST00000550896.1_Missense_Mutation_p.S793L|UNC13A_ENST00000552293.1_Missense_Mutation_p.S795L|UNC13A_ENST00000551649.1_Missense_Mutation_p.S795L|UNC13A_ENST00000252773.7_Missense_Mutation_p.S795L|UNC13A_ENST00000428389.2_Missense_Mutation_p.S883L	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	795					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GATGGCACCCGACACGGCAGA	0.502																																																0			19											46.0	48.0	47.0					19																	17753742		1967	4142	6109	17614742	SO:0001583	missense	23025			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2384C>T	19.37:g.17753742G>A	ENSP00000429562:p.Ser795Leu	Somatic		Capture	Illumina GAIIx	4	17614742	E5RHY9	Missense_Mutation	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,HMMPfam_DUF1041,HMMPfam_Membr_traf_MHD	p.S883L	ENST00000519716.2	37	c.2648	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	G	20.2	3.946807	0.73672	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51;-0.51	3.32	3.32	0.38043	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000002	T	0.81936	0.4928	M	0.73962	2.25	0.52099	D	0.999943	D	0.89917	1.0	D	0.77557	0.99	D	0.84366	0.0541	10	0.87932	D	0	-11.7627	12.4707	0.55785	0.0:0.0:1.0:0.0	.	795	Q9UPW8	UN13A_HUMAN	L	795;883;795;795;795;793	ENSP00000429562:S795L;ENSP00000400409:S883L;ENSP00000252773:S795L;ENSP00000447236:S795L;ENSP00000447572:S795L;ENSP00000446831:S793L	ENSP00000252773:S795L	S	-	2	0	UNC13A	17614742	1.000000	0.71417	0.075000	0.20258	0.732000	0.41865	9.512000	0.98008	1.565000	0.49641	0.313000	0.20887	TCG	-	superfamily_C2 domain (Calcium/lipid-binding domain CaLB)		0.502	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	protein_coding	OTTHUMT00000376169.2	G	XM_038604		17614742	-1	no_errors	NM_001080421	genbank	human	provisional	54_36p	missense	SNP	0.996	A
KIF13A	63971	genome.wustl.edu	37	6	17761101	17761101	+	IGR	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr6:17761101G>A	ENST00000259711.6	-	0	5941				KIF13A_ENST00000378814.5_Missense_Mutation_p.T1746I	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A						ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CCGTGAGGTTGTGCCTCCCTG	0.602																																																0			6											74.0	89.0	84.0					6																	17761101		2147	4248	6395	17869080	SO:0001628	intergenic_variant	63971			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313		6.37:g.17761101G>A		Somatic		Capture	Illumina GAIIx	4	17869080	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	HMMSmart_KISc,superfamily_SSF52540,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,superfamily_SMAD_FHA,HMMSmart_FHA,HMMPfam_FHA	p.T1746I	ENST00000259711.6	37	c.5237	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647598	0.29246	.	.	ENSG00000137177	ENST00000378814;ENST00000502297	T;T	0.71341	-0.56;1.87	5.32	0.939	0.19506	.	.	.	.	.	T	0.35885	0.0947	.	.	.	0.09310	N	1	B	0.15473	0.013	B	0.19391	0.025	T	0.33111	-0.9881	8	0.41790	T	0.15	.	6.5504	0.22431	0.3525:0.1271:0.5203:0.0	.	1746	Q9H1H9-3	.	I	1746;798	ENSP00000368091:T1746I;ENSP00000425616:T798I	ENSP00000368091:T1746I	T	-	2	0	KIF13A	17869080	0.021000	0.18746	0.001000	0.08648	0.087000	0.18053	0.211000	0.17474	0.242000	0.21303	-0.218000	0.12543	ACA	-	NULL		0.602	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	protein_coding	OTTHUMT00000039954.4	G			17869080	-1	no_errors	NM_001105568	genbank	human	validated	54_36p	missense	SNP	0.000	A
ST13P5	144106	genome.wustl.edu	37	11	18283837	18283837	+	IGR	SNP	T	T	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr11:18283837T>G								SAA2 (13647 upstream) : SAA1 (3883 downstream)																							GAGATGAAAATGTGGAGATAA	0.408																																																0			11																																								18240413	SO:0001628	intergenic_variant	0																															11.37:g.18283837T>G		Somatic		Capture	Illumina GAIIx	4	18240413		Missense_Mutation	SNP	superfamily_SSF48452,HMMSmart_TPR,HMMPfam_TPR_1,HMMSmart_STI1	p.N103K		37	c.309		11																																																																																			-	NULL	0	0.408					FAM10A5			T			18240413	+1	no_errors	ENST00000391478	ensembl	human	known	54_36p	missense	SNP	0.997	G
SMG1	23049	genome.wustl.edu	37	16	18880584	18880584	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr16:18880584C>G	ENST00000446231.2	-	20	3087	c.2675G>C	c.(2674-2676)aGa>aCa	p.R892T	SMG1_ENST00000389467.3_Missense_Mutation_p.R892T|snoU13_ENST00000459248.1_RNA			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	892	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CTTATCCAGTCTCTGGCAGCT	0.413																																																0			16											16.0	14.0	15.0					16																	18880584		1765	3935	5700	18788085	SO:0001583	missense	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.2675G>C	16.37:g.18880584C>G	ENSP00000402515:p.Arg892Thr	Somatic		Capture	Illumina GAIIx	4	18788085	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT,superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,PatternScan_PI3_4_KINASE_2,HMMPfam_FATC	p.R892T	ENST00000446231.2	37	c.2675	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971917	0.74246	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.15017	2.46;2.46	5.22	5.22	0.72569	Armadillo-type fold (1);	0.072562	0.53938	D	0.000058	T	0.30008	0.0751	L	0.44542	1.39	0.49483	D	0.999794	D	0.57899	0.981	D	0.67231	0.95	T	0.01899	-1.1251	10	0.02654	T	1	.	19.1566	0.93514	0.0:1.0:0.0:0.0	.	892	Q96Q15	SMG1_HUMAN	T	892	ENSP00000402515:R892T;ENSP00000374118:R892T	ENSP00000374118:R892T	R	-	2	0	SMG1	18788085	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.734000	0.84928	2.604000	0.88044	0.555000	0.69702	AGA	-	superfamily_ARM repeat		0.413	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	protein_coding	OTTHUMT00000391817.1	C	NM_015092		18788085	-1	no_errors	NM_015092	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
NAV2	89797	genome.wustl.edu	37	11	20077504	20077504	+	Splice_Site	SNP	G	G	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr11:20077504G>T	ENST00000396087.3	+	20	4999		c.e20+1		NAV2_ENST00000360655.4_Splice_Site|NAV2_ENST00000396085.1_Splice_Site|NAV2_ENST00000349880.4_Splice_Site|NAV2_ENST00000527559.2_Splice_Site|NAV2_ENST00000533917.1_Splice_Site|NAV2_ENST00000311043.8_Splice_Site|NAV2_ENST00000540292.1_Splice_Site	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2						glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						TTTgaagaaggtaaggaagga	0.488																																																0			11											44.0	40.0	42.0					11																	20077504		2203	4300	6503	20034080	SO:0001630	splice_region_variant	89797			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.4900+1G>T	11.37:g.20077504G>T		Somatic		Capture	Illumina GAIIx	4	20034080	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Splice_Site	SNP	-	e20+1	ENST00000396087.3	37	c.4900+1	CCDS58126.1	11																																																																																			-	-		0.488	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	protein_coding	OTTHUMT00000324112.1	G	NM_145117	Intron	20034080	+1	no_errors	NM_182964	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
DNAJC1	64215	genome.wustl.edu	37	10	22048511	22048511	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr10:22048511T>C	ENST00000376980.3	-	11	1474	c.1184A>G	c.(1183-1185)cAg>cGg	p.Q395R	DNAJC1_ENST00000483085.1_5'UTR	NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	395					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				CCTGGAATTCTGAACTGTCGA	0.557																																																0			10											54.0	48.0	50.0					10																	22048511		2203	4300	6503	22088517	SO:0001583	missense	64215			AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.1184A>G	10.37:g.22048511T>C	ENSP00000366179:p.Gln395Arg	Somatic		Capture	Illumina GAIIx	4	22088517	B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	superfamily_DnaJ_N,HMMSmart_DnaJ,HMMPfam_DnaJ,PatternScan_DNAJ_1,HMMSmart_SANT,HMMPfam_Myb_DNA-binding,superfamily_Homeodomain_like	p.Q395R	ENST00000376980.3	37	c.1184	CCDS7136.1	10	.	.	.	.	.	.	.	.	.	.	T	9.453	1.091031	0.20471	.	.	ENSG00000136770	ENST00000376980	T	0.23147	1.92	5.31	2.88	0.33553	.	0.708945	0.13847	N	0.358652	T	0.22975	0.0555	M	0.63843	1.955	0.24171	N	0.995621	P;P	0.44734	0.842;0.704	B;B	0.40165	0.321;0.17	T	0.11591	-1.0581	10	0.17369	T	0.5	-0.5877	7.0837	0.25245	0.1396:0.0:0.2913:0.5691	.	116;395	Q96NY3;Q96KC8	.;DNJC1_HUMAN	R	395	ENSP00000366179:Q395R	ENSP00000366179:Q395R	Q	-	2	0	DNAJC1	22088517	0.988000	0.35896	0.031000	0.17742	0.219000	0.24729	1.324000	0.33712	0.297000	0.22615	0.402000	0.26972	CAG	-	NULL		0.557	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC1	protein_coding	OTTHUMT00000047149.1	T	NM_022365		22088517	-1	no_errors	NM_022365	genbank	human	provisional	54_36p	missense	SNP	0.035	C
AP1G2	8906	genome.wustl.edu	37	14	24032597	24032597	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr14:24032597T>A	ENST00000308724.5	-	13	2157	c.1402A>T	c.(1402-1404)Att>Ttt	p.I468F	AP1G2_ENST00000397120.3_Missense_Mutation_p.I468F|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000556277.1_5'Flank	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	468					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		ACCTGGGAAATGTCTTCTGCC	0.597											OREG0022605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			14											63.0	53.0	57.0					14																	24032597		2202	4299	6501	23102437	SO:0001583	missense	8906			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1402A>T	14.37:g.24032597T>A	ENSP00000312442:p.Ile468Phe	Somatic	768	Capture	Illumina GAIIx	4	23102437	D3DS51|O75504	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_Adaptin_N,superfamily_Clath_adapt,HMMPfam_Alpha_adaptinC2,HMMSmart_Alpha_adaptinC2	p.I468F	ENST00000308724.5	37	c.1402	CCDS9602.1	14	.	.	.	.	.	.	.	.	.	.	T	13.04	2.117894	0.37339	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000545295;ENST00000535852	T;T	0.28666	1.6;1.6	4.58	4.58	0.56647	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	L	0.56124	1.755	0.58432	D	0.999999	P;D	0.54601	0.892;0.967	P;P	0.58331	0.756;0.837	T	0.18209	-1.0344	10	0.10902	T	0.67	-15.7196	11.9456	0.52926	0.0:0.0:0.0:1.0	.	468;323	O75843;Q86V28	AP1G2_HUMAN;.	F	468;468;237;323	ENSP00000312442:I468F;ENSP00000380309:I468F	ENSP00000312442:I468F	I	-	1	0	AP1G2	23102437	1.000000	0.71417	0.991000	0.47740	0.486000	0.33341	4.395000	0.59678	1.903000	0.55091	0.460000	0.39030	ATT	-	superfamily_ARM-type_fold,HMMPfam_Adaptin_N		0.597	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G2	protein_coding	OTTHUMT00000071812.4	T	NM_003917		23102437	-1	no_errors	NM_003917	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GZF1	64412	genome.wustl.edu	37	20	23350227	23350227	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr20:23350227G>A	ENST00000338121.5	+	5	1711	c.1634G>A	c.(1633-1635)cGt>cAt	p.R545H	GZF1_ENST00000377051.2_Missense_Mutation_p.R545H|GZF1_ENST00000544236.1_Missense_Mutation_p.R69H|GZF1_ENST00000542987.1_Missense_Mutation_p.R54H			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	545					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					TCAGGGGAGCGTCCCTACTGC	0.572																																																0			20											119.0	119.0	119.0					20																	23350227		2203	4300	6503	23298227	SO:0001583	missense	64412			AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.1634G>A	20.37:g.23350227G>A	ENSP00000338290:p.Arg545His	Somatic		Capture	Illumina GAIIx	4	23298227	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.R545H	ENST00000338121.5	37	c.1634	CCDS13151.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.700652	0.96802	.	.	ENSG00000125812	ENST00000544236;ENST00000338121;ENST00000542987;ENST00000377051	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	5.94	5.94	0.96194	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.213738	0.31461	N	0.007601	T	0.48390	0.1497	M	0.65677	2.01	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.38693	-0.9649	10	0.87932	D	0	.	19.3398	0.94336	0.0:0.0:1.0:0.0	.	545	Q9H116	GZF1_HUMAN	H	69;545;54;545	ENSP00000445458:R69H;ENSP00000338290:R545H;ENSP00000445118:R54H;ENSP00000366250:R545H	ENSP00000338290:R545H	R	+	2	0	GZF1	23298227	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.810000	0.99221	2.818000	0.97014	0.650000	0.86243	CGT	-	superfamily_C2H2 and C2HC zinc fingers		0.572	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GZF1	protein_coding	OTTHUMT00000078333.1	G	NM_022482		23298227	+1	no_errors	NM_022482	genbank	human	validated	54_36p	missense	SNP	1.000	A
PLK1	5347	genome.wustl.edu	37	16	23693447	23693447	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr16:23693447G>A	ENST00000300093.4	+	4	896	c.785G>A	c.(784-786)cGg>cAg	p.R262Q		NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	262	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		ACCTACCTCCGGATCAAGAAG	0.423																																					Colon(12;240 564 27038 33155)											0			16											133.0	123.0	127.0					16																	23693447		2197	4300	6497	23600948	SO:0001583	missense	5347				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.785G>A	16.37:g.23693447G>A	ENSP00000300093:p.Arg262Gln	Somatic		Capture	Illumina GAIIx	4	23600948	Q15153|Q99746	Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,superfamily_SSF82615,HMMPfam_POLO_box	p.R262Q	ENST00000300093.4	37	c.785	CCDS10616.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.687973	0.96784	.	.	ENSG00000166851	ENST00000300093;ENST00000425844	T	0.65364	-0.15	5.85	5.85	0.93711	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.71013	0.3290	L	0.33624	1.015	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	T	0.69796	-0.5048	10	0.45353	T	0.12	-22.4818	17.6669	0.88205	0.0:0.0:1.0:0.0	.	262	P53350	PLK1_HUMAN	Q	262;165	ENSP00000300093:R262Q	ENSP00000300093:R262Q	R	+	2	0	PLK1	23600948	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.391000	0.97249	2.768000	0.95171	0.655000	0.94253	CGG	-	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase		0.423	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK1	protein_coding	OTTHUMT00000214057.2	G	NM_005030		23600948	+1	no_errors	NM_005030	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ANKRD26	22852	genome.wustl.edu	37	10	27389064	27389064	+	Silent	SNP	C	C	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr10:27389064C>T	ENST00000376087.4	-	1	357	c.192G>A	c.(190-192)caG>caA	p.Q64Q	ANKRD26_ENST00000436985.2_Silent_p.Q64Q	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	64					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						GCAAAAGGATCTGCTGCACTT	0.587																																																0			10											97.0	105.0	102.0					10																	27389064		2030	4198	6228	27429070	SO:0001819	synonymous_variant	22852			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.192G>A	10.37:g.27389064C>T		Somatic		Capture	Illumina GAIIx	4	27429070	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Silent	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.Q64	ENST00000376087.4	37	c.192	CCDS41499.1	10																																																																																			-	superfamily_ANK		0.587	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	protein_coding	OTTHUMT00000047296.1	C			27429070	-1	no_errors	NM_014915	genbank	human	validated	54_36p	silent	SNP	0.000	T
APOBR	55911	genome.wustl.edu	37	16	28509450	28509450	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr16:28509450G>A	ENST00000431282.1	+	4	2987	c.2977G>A	c.(2977-2979)Gtg>Atg	p.V993M	CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000328423.5_Missense_Mutation_p.V993M|APOBR_ENST00000564831.1_Missense_Mutation_p.V1002M|CLN3_ENST00000569430.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	993					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						AAGGAGTCGCGTGCACCTCTC	0.687																																																0			16											18.0	22.0	20.0					16																	28509450		2160	4263	6423	28416951	SO:0001583	missense	55911			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.2977G>A	16.37:g.28509450G>A	ENSP00000416094:p.Val993Met	Somatic		Capture	Illumina GAIIx	4	28416951	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.V992M	ENST00000431282.1	37	c.2974		16	.	.	.	.	.	.	.	.	.	.	G	8.063	0.768506	0.15983	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.63744	-0.06;-0.06	4.63	3.68	0.42216	.	.	.	.	.	T	0.66752	0.2821	L	0.34521	1.04	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.68943	0.961;0.961	T	0.55283	-0.8165	9	0.87932	D	0	-4.5542	8.6521	0.34040	0.1073:0.0:0.8927:0.0	.	993;993	Q0VD83;Q9NS13	APOBR_HUMAN;.	M	993	ENSP00000327669:V993M;ENSP00000416094:V993M	ENSP00000327669:V993M	V	+	1	0	APOBR	28416951	0.097000	0.21791	0.012000	0.15200	0.109000	0.19521	3.370000	0.52372	0.948000	0.37687	0.457000	0.33378	GTG	-	NULL		0.687	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOB48R	protein_coding		G	NM_182804		28416951	+1	no_errors	NM_018690	genbank	human	reviewed	54_36p	missense	SNP	0.417	A
ATP2A1	487	genome.wustl.edu	37	16	28913204	28913204	+	Silent	SNP	C	C	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr16:28913204C>T	ENST00000357084.3	+	16	2388	c.2121C>T	c.(2119-2121)gaC>gaT	p.D707D	ATP2A1_ENST00000536376.1_Silent_p.D582D|ATP2A1_ENST00000395503.4_Silent_p.D707D	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	707					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						GCGTCAATGACGCCCCTGCCC	0.532																																																0			16											56.0	47.0	50.0					16																	28913204		2197	4300	6497	28820705	SO:0001819	synonymous_variant	487				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2121C>T	16.37:g.28913204C>T		Somatic		Capture	Illumina GAIIx	4	28820705	A8K5J9|B3KY17|O14984	Silent	SNP	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_Cation_ATPase_N,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Hydrolase,superfamily_HAD-like,HMMPfam_Cation_ATPase_C	p.D707	ENST00000357084.3	37	c.2121	CCDS10643.1	16																																																																																			-	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_Hydrolase,superfamily_HAD-like		0.532	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	protein_coding	OTTHUMT00000254686.2	C	NM_004320		28820705	+1	no_errors	NM_173201	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
MTURN	222166	genome.wustl.edu	37	7	30197090	30197090	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr7:30197090G>C	ENST00000324453.8	+	3	649	c.322G>C	c.(322-324)Gaa>Caa	p.E108Q	C7orf41_ENST00000415604.1_Missense_Mutation_p.E108Q|AC007036.5_ENST00000511893.1_RNA|C7orf41_ENST00000409688.1_Missense_Mutation_p.E67Q|C7orf41_ENST00000324489.5_Missense_Mutation_p.E75Q|C7orf41_ENST00000455738.1_Missense_Mutation_p.E75Q	NM_152793.2	NP_690006.2	Q8N3F0	MTURN_HUMAN		108					multicellular organismal development (GO:0007275)					NS(1)|large_intestine(2)	3						CGATGCGTTTGAAGAGTACAG	0.567																																																0			7											156.0	166.0	163.0					7																	30197090		2203	4300	6503	30163615	SO:0001583	missense	222166																														ENST00000324453.8:c.322G>C	7.37:g.30197090G>C	ENSP00000324204:p.Glu108Gln	Somatic		Capture	Illumina GAIIx	4	30163615	B8ZZW9|Q8N791|Q8N8M4|Q8NEX2	Missense_Mutation	SNP	NULL	p.E108Q	ENST00000324453.8	37	c.322	CCDS5425.2	7	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543565	0.65198	.	.	ENSG00000180354	ENST00000324453;ENST00000409688;ENST00000415604;ENST00000324489;ENST00000455738	.	.	.	6.17	6.17	0.99709	.	0.119736	0.56097	D	0.000039	T	0.51975	0.1706	N	0.19112	0.55	0.41370	D	0.987482	P	0.44816	0.844	B	0.44278	0.445	T	0.55554	-0.8123	9	0.62326	D	0.03	-16.672	19.8676	0.96824	0.0:0.0:1.0:0.0	.	108	Q8N3F0	CG041_HUMAN	Q	108;67;108;75;75	.	ENSP00000324204:E108Q	E	+	1	0	C7orf41	30163615	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	8.083000	0.89515	2.941000	0.99782	0.655000	0.94253	GAA	-	NULL		0.567	C7orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf41	protein_coding	OTTHUMT00000250409.1	G			30163615	+1	no_errors	NM_152793	genbank	human	validated	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	16	32403470	32403470	+	IGR	SNP	T	T	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr16:32403470T>A								RP11-17M15.2 (81594 upstream) : RP11-626K17.3 (62462 downstream)																							TCCCACTTCATTATGAAATTT	0.368																																																0			16																																								32310971	SO:0001628	intergenic_variant	647157																															16.37:g.32403470T>A		Somatic		Capture	Illumina GAIIx	4	32310971		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.368					LOC647157			T			32310971	+1	pseudogene	XR_017478	genbank	human	model	54_36p	rna	SNP	0.998	A
FUT10	84750	genome.wustl.edu	37	8	33246986	33246986	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr8:33246986G>A	ENST00000327671.5	-	4	1338	c.707C>T	c.(706-708)aCt>aTt	p.T236I	FUT10_ENST00000518076.1_5'UTR|FUT10_ENST00000335589.3_Missense_Mutation_p.T174I|FUT10_ENST00000518672.1_Missense_Mutation_p.T208I|FUT10_ENST00000524021.1_Missense_Mutation_p.T208I	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	236					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		CTCGATGTAAGTCATCAGCTC	0.468																																																0			8											113.0	103.0	106.0					8																	33246986		2203	4300	6503	33366528	SO:0001583	missense	84750			AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.707C>T	8.37:g.33246986G>A	ENSP00000332757:p.Thr236Ile	Somatic		Capture	Illumina GAIIx	4	33366528	A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Missense_Mutation	SNP	HMMPfam_Glyco_transf_10	p.T236I	ENST00000327671.5	37	c.707	CCDS6088.1	8	.	.	.	.	.	.	.	.	.	.	g	9.502	1.103430	0.20632	.	.	ENSG00000172728	ENST00000327671;ENST00000380081;ENST00000518672;ENST00000524021;ENST00000335589	T;T;T;T	0.26067	1.76;1.76;1.76;2.01	5.17	4.23	0.50019	.	0.617832	0.16581	N	0.208209	T	0.28995	0.0720	L	0.58101	1.795	0.18873	N	0.999985	P;B;B;B;P;B	0.41313	0.745;0.139;0.252;0.231;0.469;0.061	B;B;B;B;B;B	0.42245	0.381;0.189;0.133;0.32;0.234;0.374	T	0.19451	-1.0305	10	0.72032	D	0.01	-0.3393	10.5017	0.44810	0.0:0.0:0.6941:0.3059	.	286;236;208;174;236;278	B4E056;Q6P4F1-5;Q6P4F1-4;Q6P4F1-3;Q6P4F1;E7EU36	.;.;.;.;FUT10_HUMAN;.	I	236;278;208;208;174	ENSP00000332757:T236I;ENSP00000430428:T208I;ENSP00000429870:T208I;ENSP00000334997:T174I	ENSP00000332757:T236I	T	-	2	0	FUT10	33366528	0.899000	0.30636	0.480000	0.27341	0.143000	0.21401	1.874000	0.39568	2.562000	0.86427	0.552000	0.68991	ACT	-	HMMPfam_Glyco_transf_10		0.468	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT10	protein_coding	OTTHUMT00000376540.1	G	NM_032664		33366528	-1	no_errors	NM_032664	genbank	human	validated	54_36p	missense	SNP	0.445	A
KRTAP4-5	85289	genome.wustl.edu	37	17	39305911	39305911	+	Missense_Mutation	SNP	G	G	A	rs557154279|rs141058010	byFrequency	TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr17:39305911G>A	ENST00000343246.4	-	1	143	c.109C>T	c.(109-111)Cgc>Tgc	p.R37C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	37	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCTGGGGCGGCAGCAGGTG	0.657																																																0			17											25.0	29.0	27.0					17																	39305911		2176	4272	6448	36559437	SO:0001583	missense	85289			AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.109C>T	17.37:g.39305911G>A	ENSP00000340546:p.Arg37Cys	Somatic		Capture	Illumina GAIIx	4	36559437		Missense_Mutation	SNP	HMMPfam_Keratin_B2,PatternScan_TNFR_NGFR_1	p.R37C	ENST00000343246.4	37	c.109	CCDS32650.1	17	.	.	.	.	.	.	.	.	.	.	.	12.13	1.844454	0.32606	.	.	ENSG00000198271	ENST00000343246	T	0.01455	4.87	3.22	-1.8	0.07907	.	2.080600	0.03668	U	0.243553	T	0.02767	0.0083	L	0.57536	1.79	0.18873	N	0.999989	B	0.18461	0.028	B	0.12837	0.008	T	0.47045	-0.9147	10	0.56958	D	0.05	.	5.7249	0.18008	0.1011:0.0:0.4232:0.4757	.	37	Q9BYR2	KRA45_HUMAN	C	37	ENSP00000340546:R37C	ENSP00000340546:R37C	R	-	1	0	KRTAP4-5	36559437	0.000000	0.05858	0.674000	0.29902	0.928000	0.56348	-0.202000	0.09451	-0.272000	0.09259	0.556000	0.70494	CGC	-	HMMPfam_Keratin_B2		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-5	protein_coding	OTTHUMT00000257783.1	G			36559437	-1	no_errors	NM_033188	genbank	human	reviewed	54_36p	missense	SNP	0.934	A
TRPC4	7223	genome.wustl.edu	37	13	38211459	38211459	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr13:38211459C>A	ENST00000379705.3	-	11	3372	c.2515G>T	c.(2515-2517)Gtg>Ttg	p.V839L	TRPC4_ENST00000338947.5_Missense_Mutation_p.V666L|TRPC4_ENST00000379673.2_Intron|TRPC4_ENST00000379681.3_Missense_Mutation_p.V844L|TRPC4_ENST00000379679.1_Missense_Mutation_p.V666L|TRPC4_ENST00000447043.1_Intron|TRPC4_ENST00000358477.2_Intron|TRPC4_ENST00000426868.2_Intron|TRPC4_ENST00000355779.2_Intron			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	839	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		ATATCGGTCACAAAATTCACT	0.428																																																0			13											75.0	77.0	76.0					13																	38211459		2203	4300	6503	37109459	SO:0001583	missense	7223			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2515G>T	13.37:g.38211459C>A	ENSP00000369027:p.Val839Leu	Somatic		Capture	Illumina GAIIx	4	37109459	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248,HMMPfam_TRP_2,HMMPfam_Ion_trans,PatternScan_RIBOSOMAL_S2_1	p.V839L	ENST00000379705.3	37	c.2515	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106259	0.37145	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679	T;T;T;T	0.65364	-0.15;-0.15;0.05;0.05	5.9	5.9	0.94986	.	1.243620	0.06116	N	0.668079	T	0.50377	0.1612	N	0.19112	0.55	0.80722	D	1	B;P;B	0.38370	0.218;0.628;0.19	B;B;B	0.36922	0.056;0.236;0.05	T	0.19582	-1.0301	10	0.11182	T	0.66	-24.753	14.4356	0.67279	0.0:0.93:0.0:0.07	.	844;666;839	Q9UBN4-5;Q9UBN4-6;Q9UBN4	.;.;TRPC4_HUMAN	L	839;844;666;666	ENSP00000369027:V839L;ENSP00000369003:V844L;ENSP00000342580:V666L;ENSP00000369001:V666L	ENSP00000342580:V666L	V	-	1	0	TRPC4	37109459	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.766000	0.47629	2.786000	0.95864	0.563000	0.77884	GTG	-	NULL		0.428	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	protein_coding	OTTHUMT00000044574.2	C	NM_003306		37109459	-1	no_errors	NM_016179	genbank	human	validated	54_36p	missense	SNP	0.938	A
TRGV5	6978	genome.wustl.edu	37	7	38389255	38389255	+	RNA	SNP	A	A	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr7:38389255A>T	ENST00000390344.2	-	0	252									T cell receptor gamma variable 5																		AAGTTGGAAGATTTCTGACTG	0.423																																																0			7											66.0	59.0	61.0					7																	38389255		1848	4008	5856	38355780			0			M36286		7p14	2012-02-07				ENSG00000211697		"""T cell receptors / TRG locus"""	12290	other	T cell receptor gene	"""T-cell receptor, gamma, variable region V5"""			TCRGV5		2902186, 2969332	Standard	NG_001336		Approved	V1S5			OTTHUMG00000155101		7.37:g.38389255A>T		Somatic		Capture	Illumina GAIIx	4	38355780		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin	p.S19T	ENST00000390344.2	37	c.55		7																																																																																			-	HMMPfam_V-set		0.423	TRGV5-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRGV5	TR_V_gene	OTTHUMT00000338407.4	A	NG_001336		38355780	-1	no_stop_codon	ENST00000390344	ensembl	human	known	54_36p	missense	SNP	0.005	T
TRGV3	6976	genome.wustl.edu	37	7	38398412	38398412	+	RNA	SNP	A	A	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr7:38398412A>T	ENST00000390346.2	-	0	237							P03979	TVC_HUMAN	T cell receptor gamma variable 3						immune response (GO:0006955)	plasma membrane (GO:0005886)	MHC protein binding (GO:0042287)|peptide antigen binding (GO:0042605)										AAGTTGGAAGATTTCTGACTG	0.428																																																0			7											92.0	88.0	89.0					7																	38398412		1893	4114	6007	38364937			0			M13430		7p14	2012-02-07			ENSG00000211699	ENSG00000211699		"""T cell receptors / TRG locus"""	12288	other	T cell receptor gene	"""T-cell receptor, gamma, variable region V3"""			TCRGV3		2938743, 2969332	Standard	NG_001336		Approved	V1S3	uc003tgr.2	P03979	OTTHUMG00000155102		7.37:g.38398412A>T		Somatic		Capture	Illumina GAIIx	4	38364937		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin	p.S19T	ENST00000390346.2	37	c.55		7																																																																																			-	HMMPfam_V-set		0.428	TRGV3-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRGV3	TR_V_gene	OTTHUMT00000338416.3	A	NG_001336		38364937	-1	no_stop_codon	ENST00000390346	ensembl	human	known	54_36p	missense	SNP	0.017	T
SCN11A	11280	genome.wustl.edu	37	3	38892069	38892069	+	Silent	SNP	C	C	T	rs78953918	byFrequency	TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr3:38892069C>T	ENST00000302328.3	-	25	4428	c.4230G>A	c.(4228-4230)acG>acA	p.T1410T	SCN11A_ENST00000456224.3_Silent_p.T1372T|SCN11A_ENST00000450244.1_Silent_p.T1410T|SCN11A_ENST00000444237.2_Silent_p.T1410T	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1410					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GACATTCTAACGTAAAGATGA	0.398													T|||	13	0.00259585	0.0	0.0029	5008	,	,		19143	0.001		0.0089	False		,,,				2504	0.001															0			3						T		5,4401	825.8+/-416.5	0,5,2198	155.0	143.0	147.0		4230	-0.2	0.4	3	dbSNP_132	147	59,8541	816.5+/-406.9	0,59,4241	no	coding-synonymous	SCN11A	NM_014139.2		0,64,6439	TT,TC,CC		0.686,0.1135,0.4921		1410/1792	38892069	64,12942	2203	4300	6503	38867073	SO:0001819	synonymous_variant	11280			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4230G>A	3.37:g.38892069C>T		Somatic		Capture	Illumina GAIIx	4	38867073	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc	p.T1410	ENST00000302328.3	37	c.4230	CCDS33737.1	3																																																																																			-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.398	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	protein_coding	OTTHUMT00000109746.4	C	NM_014139		38867073	-1	no_errors	NM_014139	genbank	human	validated	54_36p	silent	SNP	0.007	T
ETV4	2118	genome.wustl.edu	37	17	41610582	41610582	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr17:41610582G>T	ENST00000319349.5	-	7	816	c.518C>A	c.(517-519)cCt>cAt	p.P173H	ETV4_ENST00000545954.1_Missense_Mutation_p.P134H|ETV4_ENST00000586826.1_5'Flank|ETV4_ENST00000591713.1_Missense_Mutation_p.P173H|ETV4_ENST00000538265.1_Missense_Mutation_p.P134H|ETV4_ENST00000545089.1_Intron|ETV4_ENST00000393664.2_Missense_Mutation_p.P173H	NM_001079675.2	NP_001073143.1	P43268	ETV4_HUMAN	ets variant 4	173	Gln-rich.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|motor neuron axon guidance (GO:0008045)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)		EWSR1/ETV4(6)|CANT1/ETV4(3)|TMPRSS2/ETV4(13)|DDX5_ENST00000540698/ETV4(2)|KLK2/ETV4(2)	ovary(2)|upper_aerodigestive_tract(1)	3		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		CCCATGGCCAGGGTGGGGCTG	0.587			T	"""EWSR1, TMPRSS2, DDX5, KLK2, CANT1"""	"""Ewing sarcoma, Prostate carcinoma"""																																Esophageal Squamous(116;1540 1611 12927 31103 34118)		Dom	yes		17	17q21	2118	"""ets variant gene 4 (E1A enhancer binding protein, E1AF)"""		"""M, E"""	0			17											64.0	64.0	64.0					17																	41610582		2203	4300	6503	38966108	SO:0001583	missense	2118			U18018	CCDS11465.1, CCDS58553.1, CCDS59292.1	17q21	2014-04-30	2008-09-12			ENSG00000175832			3493	protein-coding gene	gene with protein product	"""E1A enhancer binding protein"""	600711	"""ets variant gene 4 (E1A enhancer-binding protein, E1AF)"""			8530053, 1547944	Standard	NM_001986		Approved	E1A-F, E1AF, PEA3	uc002idw.3	P43268		ENST00000319349.5:c.518C>A	17.37:g.41610582G>T	ENSP00000321835:p.Pro173His	Somatic		Capture	Illumina GAIIx	4	38966108	A8K314|B7Z5J3|B7Z9J6|Q96AW9	Missense_Mutation	SNP	HMMPfam_ETS_PEA3_N,superfamily_SSF46785,HMMPfam_Ets,HMMSmart_ETS,PatternScan_ETS_DOMAIN_1,PatternScan_ETS_DOMAIN_2	p.P173H	ENST00000319349.5	37	c.518	CCDS11465.1	17	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239503	0.58995	.	.	ENSG00000175832	ENST00000319349;ENST00000393664;ENST00000538265;ENST00000545954	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.6	4.63	0.57726	PEA3-type ETS-domain transcription factor, N-terminal (1);	1.369320	0.04265	N	0.341010	T	0.44603	0.1301	L	0.46157	1.445	0.49213	D	0.999765	D;D	0.89917	0.998;1.0	D;D	0.72338	0.947;0.977	T	0.00267	-1.1863	10	0.87932	D	0	.	12.54	0.56163	0.0768:0.0:0.9232:0.0	.	134;173	B7Z5J3;P43268	.;ETV4_HUMAN	H	173;173;134;134	ENSP00000321835:P173H;ENSP00000377273:P173H;ENSP00000443846:P134H;ENSP00000440023:P134H	ENSP00000321835:P173H	P	-	2	0	ETV4	38966108	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.626000	0.83164	1.371000	0.46172	0.561000	0.74099	CCT	-	HMMPfam_ETS_PEA3_N		0.587	ETV4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV4	protein_coding	OTTHUMT00000453489.1	G	NM_001986		38966108	-1	no_errors	NM_001079675	genbank	human	validated	54_36p	missense	SNP	0.985	T
C2orf91	400950	genome.wustl.edu	37	2	42181169	42181169	+	5'Flank	SNP	T	T	A	rs76580820	byFrequency	TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr2:42181169T>A	ENST00000378711.2	-	0	0				C2orf91_ENST00000403980.1_5'UTR	NM_001242815.1	NP_001229744.1	Q6ZV80	CB091_HUMAN	chromosome 2 open reading frame 91																		ttattgtctgtctctgcctgc	0.433													T|||	501	0.10004	0.1967	0.0749	5008	,	,		18563	0.0774		0.0318	False		,,,				2504	0.0808															0			2																																								42034673	SO:0001631	upstream_gene_variant	0				CCDS56116.1	2p21	2012-02-17			ENSG00000205086	ENSG00000205086			42966	protein-coding gene	gene with protein product							Standard	NM_001242815		Approved		uc002rsf.1	Q6ZV80	OTTHUMG00000152307		2.37:g.42181169T>A	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	42034673		Missense_Mutation	SNP	NULL	p.T30S	ENST00000378711.2	37	c.88	CCDS56116.1	2																																																																																			-	NULL		0.433	C2orf91-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	uc002rsf.1	protein_coding	OTTHUMT00000325755.1	T	NM_001242815		42034673	-1	no_errors	ENST00000403980	ensembl	human	known	54_36p	missense	SNP	0.001	A
HHATL	57467	genome.wustl.edu	37	3	42739826	42739826	+	Silent	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr3:42739826G>A	ENST00000441594.1	-	6	762	c.501C>T	c.(499-501)ggC>ggT	p.G167G	HHATL_ENST00000310417.5_Silent_p.G167G	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	167					negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		GATCAAAAGTGCCTGTTACAA	0.572																																																0			3											61.0	63.0	62.0					3																	42739826		2203	4300	6503	42714830	SO:0001819	synonymous_variant	57467			AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.501C>T	3.37:g.42739826G>A		Somatic		Capture	Illumina GAIIx	4	42714830	Q8TBG3|Q9ULP7	Silent	SNP	HMMPfam_MBOAT	p.G167	ENST00000441594.1	37	c.501	CCDS2704.1	3																																																																																			-	NULL		0.572	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HHATL	protein_coding	OTTHUMT00000343627.1	G	NM_020707		42714830	-1	no_errors	NM_020707	genbank	human	provisional	54_36p	silent	SNP	0.998	A
CCR2	729230	genome.wustl.edu	37	3	46399720	46399720	+	Silent	SNP	C	C	T	rs371859867		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr3:46399720C>T	ENST00000400888.2	+	1	741	c.702C>T	c.(700-702)aaC>aaT	p.N234N	CCR2_ENST00000292301.4_Silent_p.N234N|CCR2_ENST00000465202.1_3'UTR|CCR2_ENST00000445132.2_Silent_p.N234N			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2	234					blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		GGTGTCGAAACGAGAAGAAGA	0.468																																																0			3						C	,	0,3136		0,0,1568	227.0	211.0	216.0		702,702	-10.1	0.0	3		216	1,7163		0,1,3581	no	coding-synonymous,coding-synonymous	CCR2	NM_001123041.2,NM_001123396.1	,	0,1,5149	TT,TC,CC		0.014,0.0,0.0097	,	234/375,234/361	46399720	1,10299	1568	3582	5150	46374724	SO:0001819	synonymous_variant	1231				CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.702C>T	3.37:g.46399720C>T		Somatic		Capture	Illumina GAIIx	4	46374724	A0AVQ3|B2RMT0|Q4VBL2	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.N234	ENST00000400888.2	37	c.702	CCDS43078.1	3																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.468	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCR2	protein_coding	OTTHUMT00000344292.1	C	NM_000647		46374724	+1	no_errors	ENST00000292301	ensembl	human	known	54_36p	silent	SNP	0.421	T
TDRD6	221400	genome.wustl.edu	37	6	46658388	46658388	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr6:46658388A>G	ENST00000316081.6	+	1	2523	c.2523A>G	c.(2521-2523)atA>atG	p.I841M	RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000434329.2_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.I841M|RP11-446F17.3_ENST00000422284.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	841	Tudor 4. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TTAGTGGGATACAGTCTGTGG	0.393																																																0			6											111.0	113.0	112.0					6																	46658388		2203	4300	6503	46766347	SO:0001583	missense	221400			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.2523A>G	6.37:g.46658388A>G	ENSP00000346065:p.Ile841Met	Somatic		Capture	Illumina GAIIx	4	46766347	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	HMMSmart_TUDOR,HMMPfam_TUDOR,superfamily_SSF63748	p.I841M	ENST00000316081.6	37	c.2523	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	A	10.62	1.401823	0.25291	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.12672	2.66;2.66	5.75	-4.9	0.03094	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	1.864110	0.01966	N	0.043723	T	0.06234	0.0161	L	0.47190	1.495	0.09310	N	1	P;P	0.40553	0.674;0.721	B;P	0.49477	0.409;0.612	T	0.25082	-1.0142	10	0.40728	T	0.16	-7.0814	0.3572	0.00358	0.2764:0.2855:0.1855:0.2526	.	841;841	F5H5M3;O60522	.;TDRD6_HUMAN	M	841	ENSP00000443299:I841M;ENSP00000346065:I841M	ENSP00000346065:I841M	I	+	3	3	TDRD6	46766347	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-0.541000	0.06099	-0.177000	0.10690	0.533000	0.62120	ATA	-	HMMPfam_TUDOR,superfamily_SSF63748,HMMSmart_TUDOR		0.393	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	protein_coding	OTTHUMT00000040800.1	A	XM_166443		46766347	+1	no_errors	NM_001010870	genbank	human	provisional	54_36p	missense	SNP	0.000	G
ZNF574	64763	genome.wustl.edu	37	19	42584967	42584967	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr19:42584967G>A	ENST00000600245.1	+	2	2864	c.2209G>A	c.(2209-2211)Ggt>Agt	p.G737S	ZNF574_ENST00000222339.7_Missense_Mutation_p.G827S|ZNF574_ENST00000359044.4_Missense_Mutation_p.G737S|CTB-59C6.3_ENST00000594531.1_RNA			Q6ZN55	ZN574_HUMAN	zinc finger protein 574	737					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20		Prostate(69;0.059)				CCGCCGCCGGGGTCTAGAGTG	0.657																																																0			19											85.0	93.0	90.0					19																	42584967		2203	4300	6503	47276807	SO:0001583	missense	64763			AK074788	CCDS12596.1	19q13.2	2013-09-20			ENSG00000105732	ENSG00000105732		"""Zinc fingers, C2H2-type"""	26166	protein-coding gene	gene with protein product						12477932	Standard	NM_022752		Approved	FLJ22059	uc002osm.4	Q6ZN55	OTTHUMG00000182751	ENST00000600245.1:c.2209G>A	19.37:g.42584967G>A	ENSP00000469029:p.Gly737Ser	Somatic		Capture	Illumina GAIIx	4	47276807	Q6IPE0|Q6ZN10|Q7L5Z5|Q8NCE3|Q9H6N0	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.G737S	ENST00000600245.1	37	c.2209	CCDS12596.1	19	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330364	0.41297	.	.	ENSG00000105732	ENST00000222339;ENST00000359044;ENST00000535775	T;T	0.05925	3.37;3.38	5.5	4.46	0.54185	.	0.213638	0.32106	N	0.006567	T	0.04363	0.0120	N	0.01576	-0.805	0.35485	D	0.798464	B;P	0.45715	0.259;0.865	B;P	0.49665	0.087;0.618	T	0.50004	-0.8878	10	0.62326	D	0.03	-14.5903	11.3266	0.49452	0.0878:0.0:0.9122:0.0	.	737;826	Q6ZN55;Q6ZN55-2	ZN574_HUMAN;.	S	827;737;344	ENSP00000222339:G827S;ENSP00000351939:G737S	ENSP00000222339:G827S	G	+	1	0	ZNF574	47276807	0.777000	0.28628	0.998000	0.56505	0.369000	0.29798	1.577000	0.36515	2.579000	0.87056	0.650000	0.86243	GGT	-	NULL		0.657	ZNF574-002	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ZNF574	protein_coding	OTTHUMT00000463458.1	G	NM_022752		47276807	+1	no_errors	NM_022752	genbank	human	validated	54_36p	missense	SNP	0.938	A
RB1	5925	genome.wustl.edu	37	13	48947629	48947629	+	Splice_Site	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr13:48947629G>A	ENST00000267163.4	+	12	1353		c.e12+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.?(23)|p.0?(15)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTATTTTAACGTAAGCCATAT	0.279		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	38	Unknown(23)|Whole gene deletion(15)	bone(12)|eye(6)|urinary_tract(5)|breast(5)|endometrium(3)|central_nervous_system(2)|lung(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)	13	GRCh37	CS890133|CS982341	RB1	S							80.0	87.0	84.0					13																	48947629		2202	4287	6489	47845630	SO:0001630	splice_region_variant	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1215+1G>A	13.37:g.48947629G>A		Somatic		Capture	Illumina GAIIx	4	47845630	A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	-	e12+1	ENST00000267163.4	37	c.1215+1	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681750	0.68042	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0805	0.93179	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47845630	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	7.247000	0.78257	2.510000	0.84645	0.563000	0.77884	.	-	-		0.279	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	G		Intron	47845630	+1	no_errors	NM_000321	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
SPIDR	23514	genome.wustl.edu	37	8	48508396	48508396	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr8:48508396G>A	ENST00000297423.4	+	9	1505	c.1121G>A	c.(1120-1122)gGa>gAa	p.G374E	SPIDR_ENST00000518074.1_Missense_Mutation_p.G314E|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Missense_Mutation_p.G304E	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	374	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											ATTCCAAGTGGAAGTTGCCCT	0.388																																																0			8											106.0	99.0	101.0					8																	48508396		1835	4097	5932	48670949	SO:0001583	missense	23514			AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1121G>A	8.37:g.48508396G>A	ENSP00000297423:p.Gly374Glu	Somatic		Capture	Illumina GAIIx	4	48670949	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	NULL	p.G374E	ENST00000297423.4	37	c.1121	CCDS43737.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.78|15.78	2.934695|2.934695	0.52866|0.52866	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000519401|ENST00000297423;ENST00000518074;ENST00000541342;ENST00000524006	.|.	.|.	.|.	5.45|5.45	1.73|1.73	0.24493|0.24493	.|.	.|1.180830	.|0.05895	.|N	.|0.629029	T|T	0.41050|0.41050	0.1142|0.1142	L|L	0.50333|0.50333	1.59|1.59	0.28821|0.28821	N|N	0.897694|0.897694	.|B;B;B;B	.|0.23891	.|0.093;0.093;0.093;0.093	.|B;B;B;B	.|0.24541	.|0.054;0.054;0.054;0.054	T|T	0.33954|0.33954	-0.9848|-0.9848	5|9	.|0.28530	.|T	.|0.3	.|.	5.7678|5.7678	0.18237|0.18237	0.5074:0.0:0.4926:0.0|0.5074:0.0:0.4926:0.0	.|.	.|314;304;374;374	.|B4E0Y6;B4DFV2;B4DEV5;Q14159	.|.;.;.;K0146_HUMAN	K|E	56|374;314;304;63	.|.	.|ENSP00000297423:G374E	E|G	+|+	1|2	0|0	KIAA0146|KIAA0146	48670949|48670949	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.703000|0.703000	0.40648|0.40648	1.366000|1.366000	0.34193|0.34193	0.599000|0.599000	0.29845|0.29845	0.655000|0.655000	0.94253|0.94253	GAA|GGA	-	NULL		0.388	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0146	protein_coding	OTTHUMT00000377611.1	G	NM_001080394		48670949	+1	no_errors	NM_001080394	genbank	human	predicted	54_36p	missense	SNP	0.612	A
QARS	5859	genome.wustl.edu	37	3	49140785	49140785	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr3:49140785T>C	ENST00000306125.6	-	5	846	c.509A>G	c.(508-510)gAc>gGc	p.D170G	QARS_ENST00000414533.1_Missense_Mutation_p.D159G|QARS_ENST00000470225.1_5'Flank|QARS_ENST00000420147.2_Missense_Mutation_p.D188G			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	170					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CACCTGCATGTCCACTTCATT	0.512																																																0			3											159.0	139.0	146.0					3																	49140785		2203	4300	6503	49115789	SO:0001583	missense	5859			X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.509A>G	3.37:g.49140785T>C	ENSP00000307567:p.Asp170Gly	Somatic		Capture	Illumina GAIIx	4	49115789	B4DWJ2	Missense_Mutation	SNP	HMMPfam_tRNA_synt_1c_R1,HMMPfam_tRNA_synt_1c_R2,superfamily_SSF52374,HMMPfam_tRNA-synt_1c,PatternScan_AA_TRNA_LIGASE_I,HMMPfam_tRNA-synt_1c_C,superfamily_Ribosomal_L25rel	p.D170G	ENST00000306125.6	37	c.509	CCDS2788.1	3	.	.	.	.	.	.	.	.	.	.	T	27.9	4.872981	0.91664	.	.	ENSG00000172053	ENST00000306125;ENST00000414533;ENST00000420147;ENST00000452739;ENST00000417025	T;T	0.31247	1.53;1.5	5.6	5.6	0.85130	Glutaminyl-tRNA synthetase, class Ib, non-specific RNA-binding domain 2 (1);	0.048431	0.85682	D	0.000000	T	0.64757	0.2627	M	0.91300	3.195	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;1.0	T	0.74025	-0.3797	10	0.87932	D	0	-24.7121	15.7913	0.78367	0.0:0.0:0.0:1.0	.	188;159;170	B7Z840;B4DWJ2;P47897	.;.;SYQ_HUMAN	G	170;159;188;212;170	ENSP00000307567:D170G;ENSP00000390015:D159G	ENSP00000307567:D170G	D	-	2	0	QARS	49115789	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.642000	0.83385	2.124000	0.65301	0.528000	0.53228	GAC	-	HMMPfam_tRNA_synt_1c_R2		0.512	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QARS	protein_coding	OTTHUMT00000345689.2	T	NM_005051		49115789	-1	no_errors	NM_005051	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FAM120C	54954	genome.wustl.edu	37	X	54143030	54143030	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chrX:54143030G>A	ENST00000375180.2	-	10	2316	c.2260C>T	c.(2260-2262)Ctc>Ttc	p.L754F	FAM120C_ENST00000328235.4_Missense_Mutation_p.L754F	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	754							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GCTGGATTGAGCATACTGGGC	0.512																																																0			X											137.0	98.0	111.0					X																	54143030		2203	4300	6503	54159755	SO:0001583	missense	54954			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.2260C>T	X.37:g.54143030G>A	ENSP00000364324:p.Leu754Phe	Somatic		Capture	Illumina GAIIx	4	54159755	B2RMT7	Missense_Mutation	SNP	NULL	p.L754F	ENST00000375180.2	37	c.2260	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	G	22.7	4.321913	0.81580	.	.	ENSG00000184083	ENST00000375180;ENST00000328235	T;T	0.49139	0.79;0.79	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	M	0.62723	1.935	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.71656	0.946;0.974	T	0.69628	-0.5094	10	0.72032	D	0.01	-7.5205	15.4059	0.74877	0.0:0.0:1.0:0.0	.	754;754	F8W881;Q9NX05	.;F120C_HUMAN	F	754	ENSP00000364324:L754F;ENSP00000329896:L754F	ENSP00000329896:L754F	L	-	1	0	FAM120C	54159755	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.159000	0.64923	1.955000	0.56771	0.523000	0.50628	CTC	-	NULL		0.512	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	protein_coding	OTTHUMT00000056795.2	G	NM_017848		54159755	-1	no_errors	NM_017848	genbank	human	validated	54_36p	missense	SNP	1.000	A
CACNA2D3	55799	genome.wustl.edu	37	3	54786662	54786662	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr3:54786662G>A	ENST00000474759.1	+	12	1252	c.1204G>A	c.(1204-1206)Gcg>Acg	p.A402T	CACNA2D3_ENST00000288197.5_Missense_Mutation_p.A402T|CACNA2D3_ENST00000490478.1_Missense_Mutation_p.A308T|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.A402T	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	402	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	ACGAGAGGCTGCGTTTGCAGA	0.498																																																0			3											101.0	107.0	105.0					3																	54786662		2163	4272	6435	54761702	SO:0001583	missense	55799			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1204G>A	3.37:g.54786662G>A	ENSP00000419101:p.Ala402Thr	Somatic		Capture	Illumina GAIIx	4	54761702	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	HMMPfam_VWA_N,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_Cache_1	p.A402T	ENST00000474759.1	37	c.1204	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	G	11.19	1.566140	0.27915	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624;ENST00000438476	T;T;T;T	0.13901	2.55;2.55;2.55;2.55	6.02	5.14	0.70334	von Willebrand factor, type A (3);	0.104095	0.64402	D	0.000003	T	0.06188	0.0160	N	0.01751	-0.74	0.51012	D	0.999907	B	0.19073	0.033	B	0.26517	0.07	T	0.23583	-1.0184	10	0.06625	T	0.88	.	17.4407	0.87564	0.0:0.1243:0.8757:0.0	.	402	Q8IZS8	CA2D3_HUMAN	T	402;402;402;308;308;307	ENSP00000389506:A402T;ENSP00000419101:A402T;ENSP00000288197:A402T;ENSP00000417279:A308T	ENSP00000288197:A402T	A	+	1	0	CACNA2D3	54761702	1.000000	0.71417	0.783000	0.31826	0.244000	0.25665	7.338000	0.79269	1.551000	0.49450	-0.165000	0.13383	GCG	-	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA		0.498	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	protein_coding	OTTHUMT00000351402.1	G			54761702	+1	no_errors	NM_018398	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
OR4A16	81327	genome.wustl.edu	37	11	55110733	55110733	+	Silent	SNP	T	T	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr11:55110733T>G	ENST00000314721.2	+	1	107	c.57T>G	c.(55-57)ccT>ccG	p.P19P		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	19						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						CTCAAGATCCTGATGTGAAAA	0.408																																																0			11											68.0	62.0	64.0					11																	55110733		2201	4296	6497	54867309	SO:0001819	synonymous_variant	81327			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.57T>G	11.37:g.55110733T>G		Somatic		Capture	Illumina GAIIx	4	54867309	Q6IFL3	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.P19	ENST00000314721.2	37	c.57	CCDS31499.1	11																																																																																			-	superfamily_SSF81321		0.408	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A16	protein_coding	OTTHUMT00000391160.1	T	NM_001005274		54867309	+1	no_errors	NM_001005274	genbank	human	provisional	54_36p	silent	SNP	0.000	G
DST	667	genome.wustl.edu	37	6	56480743	56480743	+	Silent	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr6:56480743G>A	ENST00000370765.6	-	24	7629	c.7522C>T	c.(7522-7524)Ctg>Ttg	p.L2508L	DST_ENST00000244364.6_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000312431.6_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1804					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCATCAACCAGGCCTCTATGC	0.512																																																0			6											78.0	81.0	80.0					6																	56480743		2203	4300	6503	56588702	SO:0001819	synonymous_variant	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7522C>T	6.37:g.56480743G>A		Somatic		Capture	Illumina GAIIx	4	56588702	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	HMMSmart_SPEC,superfamily_Spectrin,HMMPfam_Spectrin,superfamily_SSF75399,HMMSmart_PLEC,HMMPfam_Plectin	p.L2508	ENST00000370765.6	37	c.7522	CCDS4959.1	6																																																																																			-	superfamily_SSF75399,HMMSmart_PLEC,HMMPfam_Plectin		0.512	DST-010	KNOWN	basic|CCDS	protein_coding	DST	protein_coding	OTTHUMT00000041027.2	G	NM_001723		56588702	-1	no_errors	NM_001723	genbank	human	reviewed	54_36p	silent	SNP	0.953	A
FAM111A	63901	genome.wustl.edu	37	11	58920084	58920084	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr11:58920084A>C	ENST00000528737.1	+	5	3761	c.943A>C	c.(943-945)Aag>Cag	p.K315Q	FAM111A_ENST00000531147.1_Missense_Mutation_p.K315Q|FAM111A_ENST00000533703.1_Missense_Mutation_p.K315Q|FAM111A_ENST00000361723.3_Missense_Mutation_p.K315Q|FAM111A_ENST00000420244.1_Missense_Mutation_p.K315Q			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	315					defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				TGAAAACTTCAAGAAAAAAAT	0.328																																																0			11											32.0	37.0	36.0					11																	58920084		2197	4295	6492	58676660	SO:0001583	missense	63901			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.943A>C	11.37:g.58920084A>C	ENSP00000434435:p.Lys315Gln	Somatic		Capture	Illumina GAIIx	4	58676660	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	superfamily_Pept_Ser_Cys	p.K315Q	ENST00000528737.1	37	c.943	CCDS7973.1	11	.	.	.	.	.	.	.	.	.	.	A	10.50	1.366974	0.24771	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	5.65	-5.96	0.02234	.	0.863009	0.10334	N	0.687203	T	0.34193	0.0889	L	0.58101	1.795	0.09310	N	1	B	0.29988	0.264	B	0.23150	0.044	T	0.20974	-1.0259	10	0.35671	T	0.21	-12.2533	7.7983	0.29160	0.3842:0.4237:0.1921:0.0	.	315	Q96PZ2	F111A_HUMAN	Q	315	ENSP00000434435:K315Q;ENSP00000406683:K315Q;ENSP00000355264:K315Q;ENSP00000433154:K315Q;ENSP00000431631:K315Q	ENSP00000355264:K315Q	K	+	1	0	FAM111A	58676660	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.384000	0.02542	-0.783000	0.04534	-0.321000	0.08615	AAG	-	NULL		0.328	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	protein_coding	OTTHUMT00000393975.1	A	NM_022074		58676660	+1	no_errors	NM_022074	genbank	human	validated	54_36p	missense	SNP	0.002	C
DNAJC6	9829	genome.wustl.edu	37	1	65871792	65871792	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:65871792C>T	ENST00000395325.3	+	16	2453	c.2296C>T	c.(2296-2298)Cgt>Tgt	p.R766C	DNAJC6_ENST00000371069.4_Missense_Mutation_p.R823C|DNAJC6_ENST00000263441.7_Missense_Mutation_p.R753C	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	766					cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						CCAGAACGAACGTGGGAAAGG	0.542																																																0			1											122.0	119.0	120.0					1																	65871792		2203	4300	6503	65644380	SO:0001583	missense	9829			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.2296C>T	1.37:g.65871792C>T	ENSP00000378735:p.Arg766Cys	Somatic		Capture	Illumina GAIIx	4	65644380	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	superfamily_(Phosphotyrosine protein) phosphatases II,HMMPfam_PTEN_C2,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),superfamily_Chaperone J-domain,HMMSmart_SM00271,HMMPfam_DnaJ	p.R766C	ENST00000395325.3	37	c.2296	CCDS30739.1	1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964640	0.53507	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	T;T;T	0.22945	1.93;1.93;1.93	4.84	4.84	0.62591	Heat shock protein DnaJ, N-terminal (1);	0.207947	0.41500	D	0.000866	T	0.41558	0.1164	M	0.75085	2.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.976	T	0.32214	-0.9915	10	0.59425	D	0.04	.	13.1496	0.59482	0.1597:0.8403:0.0:0.0	.	823;766	O75061-2;O75061	.;AUXI_HUMAN	C	753;766;823	ENSP00000263441:R753C;ENSP00000378735:R766C;ENSP00000360108:R823C	ENSP00000263441:R753C	R	+	1	0	DNAJC6	65644380	0.997000	0.39634	0.986000	0.45419	0.379000	0.30106	3.144000	0.50616	2.496000	0.84212	0.561000	0.74099	CGT	-	NULL		0.542	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	protein_coding	OTTHUMT00000025134.1	C			65644380	+1	no_errors	NM_014787	genbank	human	validated	54_36p	missense	SNP	0.977	T
NFU1	27247	genome.wustl.edu	37	2	69627565	69627565	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr2:69627565G>C	ENST00000410022.2	-	7	856	c.651C>G	c.(649-651)atC>atG	p.I217M	NFU1_ENST00000462320.1_Missense_Mutation_p.I76M|NFU1_ENST00000303698.3_Missense_Mutation_p.I193M|NFU1_ENST00000471185.1_Intron|NFU1_ENST00000394305.1_Missense_Mutation_p.I76M	NM_001002755.2	NP_001002755.1	Q9UMS0	NFU1_HUMAN	NFU1 iron-sulfur cluster scaffold	217	NifU.				iron-sulfur cluster assembly (GO:0016226)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron ion binding (GO:0005506)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	7						TCAGAGTAATGATTGAACTAG	0.418																																																0			2											158.0	151.0	154.0					2																	69627565		2203	4300	6503	69481069	SO:0001583	missense	27247			AJ132584	CCDS33217.1, CCDS42694.1, CCDS46315.1	2p15-p13	2014-07-03	2014-07-03	2006-10-24	ENSG00000169599	ENSG00000169599			16287	protein-coding gene	gene with protein product		608100	"""HIRA interacting protein 5"", ""NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)"""	HIRIP5		11342215, 12886008	Standard	NR_045631		Approved	CGI-33, NifU, NIFUC	uc002sfk.3	Q9UMS0	OTTHUMG00000152668	ENST00000410022.2:c.651C>G	2.37:g.69627565G>C	ENSP00000387219:p.Ile217Met	Somatic		Capture	Illumina GAIIx	4	69481069	B4DUL9|Q53QE5|Q6VNZ8|Q7Z5B1|Q7Z5B2|Q9Y322	Missense_Mutation	SNP	superfamily_NIF_FeS_clus_asmbl_NifU-like_N,HMMPfam_Nfu_N,HMMPfam_NifU	p.I217M	ENST00000410022.2	37	c.651	CCDS33217.1	2	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422301	0.43020	.	.	ENSG00000169599	ENST00000410022;ENST00000303698;ENST00000394305;ENST00000462320;ENST00000450796;ENST00000484177	T;T;T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99;-0.99;-0.99	5.19	4.3	0.51218	NIF system FeS cluster assembly, NifU, C-terminal (2);	0.045788	0.85682	N	0.000000	T	0.67382	0.2887	N	0.21282	0.65	0.54753	D	0.99998	B;B	0.32467	0.321;0.372	B;B	0.39771	0.187;0.309	T	0.69993	-0.4994	10	0.59425	D	0.04	-8.7191	15.0518	0.71877	0.0:0.1424:0.8576:0.0	.	193;217	Q9UMS0-3;Q9UMS0	.;NFU1_HUMAN	M	217;193;76;76;76;76	ENSP00000387219:I217M;ENSP00000306965:I193M;ENSP00000377842:I76M;ENSP00000418598:I76M;ENSP00000415102:I76M;ENSP00000417693:I76M	ENSP00000306965:I193M	I	-	3	3	NFU1	69481069	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.592000	0.46171	1.396000	0.46663	0.563000	0.77884	ATC	-	HMMPfam_NifU		0.418	NFU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFU1	protein_coding	OTTHUMT00000327279.3	G	NM_015700		69481069	-1	no_errors	NM_001002755	genbank	human	validated	54_36p	missense	SNP	1.000	C
LMBRD1	55788	genome.wustl.edu	37	6	70410676	70410676	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr6:70410676A>G	ENST00000370577.3	-	12	1398	c.1169T>C	c.(1168-1170)aTa>aCa	p.I390T	LMBRD1_ENST00000370570.1_Missense_Mutation_p.I317T	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	390					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						AAAGAACCATATGCCAATATT	0.244																																																0			6											17.0	18.0	17.0					6																	70410676		2149	4228	6377	70467397	SO:0001583	missense	55788			AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.1169T>C	6.37:g.70410676A>G	ENSP00000359609:p.Ile390Thr	Somatic		Capture	Illumina GAIIx	4	70467397	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	HMMPfam_LMBR1	p.I390T	ENST00000370577.3	37	c.1169	CCDS4969.1	6	.	.	.	.	.	.	.	.	.	.	A	15.41	2.826471	0.50739	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.21191	2.02;2.02	5.23	4.04	0.47022	.	.	.	.	.	T	0.35393	0.0930	M	0.85630	2.765	0.80722	D	1	D	0.76494	0.999	D	0.64144	0.922	T	0.36480	-0.9746	9	0.59425	D	0.04	-13.5649	12.1498	0.54044	0.8565:0.1435:0.0:0.0	.	390	Q9NUN5	LMBD1_HUMAN	T	390;317	ENSP00000359609:I390T;ENSP00000359602:I317T	ENSP00000359602:I317T	I	-	2	0	LMBRD1	70467397	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.317000	0.96327	0.807000	0.34208	0.482000	0.46254	ATA	-	HMMPfam_LMBR1		0.244	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBRD1	protein_coding	OTTHUMT00000041124.1	A	NM_018368		70467397	-1	no_errors	NM_018368	genbank	human	provisional	54_36p	missense	SNP	1.000	G
FAM135A	57579	genome.wustl.edu	37	6	71238092	71238092	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr6:71238092G>A	ENST00000418814.2	+	16	4326	c.3712G>A	c.(3712-3714)Gta>Ata	p.V1238I	FAM135A_ENST00000505868.1_Missense_Mutation_p.V1238I|FAM135A_ENST00000370479.3_Missense_Mutation_p.V1025I|FAM135A_ENST00000361499.3_Missense_Mutation_p.V1042I|FAM135A_ENST00000457062.2_Missense_Mutation_p.V1025I|FAM135A_ENST00000505769.1_Missense_Mutation_p.V818I	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	1238										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						TTATTTTAGTGTAGAAGAAGA	0.433																																																0			6											203.0	174.0	184.0					6																	71238092		2203	4300	6503	71294813	SO:0001583	missense	57579			AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.3712G>A	6.37:g.71238092G>A	ENSP00000410768:p.Val1238Ile	Somatic		Capture	Illumina GAIIx	4	71294813	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	superfamily_SSF53474,HMMPfam_DUF676	p.V1042I	ENST00000418814.2	37	c.3124	CCDS55028.1	6	.	.	.	.	.	.	.	.	.	.	G	0.768	-0.766912	0.02974	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T;T	0.21031	2.37;2.36;2.03;2.36;2.36;2.38	5.14	-5.69	0.02428	.	0.470812	0.25741	N	0.028607	T	0.01592	0.0051	N	0.03608	-0.345	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.001	B;B;B;B;B	0.10450	0.001;0.005;0.001;0.001;0.005	T	0.27262	-1.0079	10	0.05620	T	0.96	.	13.3981	0.60865	0.4765:0.0:0.5235:0.0	.	818;1238;1238;1042;1025	D6RCC7;Q9P2D6-4;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;.;F135A_HUMAN;.;.	I	1238;1025;818;1025;1042;1238	ENSP00000410768:V1238I;ENSP00000359510:V1025I;ENSP00000423785:V818I;ENSP00000409201:V1025I;ENSP00000354913:V1042I;ENSP00000423307:V1238I	ENSP00000354913:V1042I	V	+	1	0	FAM135A	71294813	0.001000	0.12720	0.017000	0.16124	0.014000	0.08584	-0.168000	0.09925	-1.364000	0.02161	-1.936000	0.00505	GTA	-	NULL		0.433	FAM135A-001	KNOWN	basic|CCDS	protein_coding	FAM135A	protein_coding	OTTHUMT00000041137.2	G	NM_020819		71294813	+1	no_errors	NM_001105531	genbank	human	validated	54_36p	missense	SNP	0.992	A
PTCD2	79810	genome.wustl.edu	37	5	71616321	71616321	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr5:71616321C>G	ENST00000380639.5	+	1	128	c.112C>G	c.(112-114)Cgc>Ggc	p.R38G	PTCD2_ENST00000543322.1_Missense_Mutation_p.R38G|PTCD2_ENST00000536805.1_5'UTR|MRPS27_ENST00000457646.4_5'Flank|MRPS27_ENST00000513900.1_5'Flank|PTCD2_ENST00000503868.1_Missense_Mutation_p.R38G|MRPS27_ENST00000515404.1_5'Flank|MRPS27_ENST00000261413.5_5'Flank|MRPS27_ENST00000522095.1_5'Flank	NM_024754.3	NP_079030.3	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	38					kidney development (GO:0001822)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|muscle fiber development (GO:0048747)|regulation of mRNA processing (GO:0050684)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(1)|skin(1)	11		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		TGTCAGCTGCCGCTGCCCTCT	0.602																																																0			5											31.0	35.0	34.0					5																	71616321		1969	4171	6140	71652077	SO:0001583	missense	79810			BC018720	CCDS4014.2, CCDS68891.1, CCDS68892.1, CCDS75258.1	5q13.2	2008-02-05			ENSG00000049883	ENSG00000049883			25734	protein-coding gene	gene with protein product		615484				12477932	Standard	XM_005248601		Approved	FLJ12598	uc003kcb.3	Q8WV60	OTTHUMG00000100953	ENST00000380639.5:c.112C>G	5.37:g.71616321C>G	ENSP00000370013:p.Arg38Gly	Somatic		Capture	Illumina GAIIx	4	71652077	B7Z5D0|B7Z8L7|E9PFV7|Q6IA65|Q9H9R0	Missense_Mutation	SNP	HMMPfam_PPR	p.R38G	ENST00000380639.5	37	c.112	CCDS4014.2	5	.	.	.	.	.	.	.	.	.	.	C	15.65	2.895445	0.52121	.	.	ENSG00000049883	ENST00000380639;ENST00000543322;ENST00000503868	.	.	.	5.4	3.55	0.40652	.	0.781807	0.12604	N	0.454453	T	0.55862	0.1947	L	0.60455	1.87	0.80722	D	1	B;B	0.18013	0.025;0.017	B;B	0.18561	0.013;0.022	T	0.55636	-0.8110	9	0.45353	T	0.12	.	7.5147	0.27593	0.0:0.744:0.1665:0.0894	.	38;38	E9PFV7;Q8WV60	.;PTCD2_HUMAN	G	38	.	ENSP00000308948:R38G	R	+	1	0	PTCD2	71652077	1.000000	0.71417	0.997000	0.53966	0.390000	0.30446	1.198000	0.32223	1.509000	0.48786	0.561000	0.74099	CGC	-	NULL		0.602	PTCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCD2	protein_coding	OTTHUMT00000218562.6	C	NM_024754		71652077	+1	no_errors	NM_024754	genbank	human	validated	54_36p	missense	SNP	0.924	G
CFAP70	118491	genome.wustl.edu	37	10	75107941	75107941	+	Silent	SNP	G	G	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr10:75107941G>C	ENST00000310715.3	-	5	522	c.402C>G	c.(400-402)ccC>ccG	p.P134P	TTC18_ENST00000493787.1_Intron|TTC18_ENST00000355577.3_5'UTR|TTC18_ENST00000394865.1_Silent_p.P134P|TTC18_ENST00000401621.2_Silent_p.P134P|TTC18_ENST00000340329.3_Silent_p.P134P|Y_RNA_ENST00000384742.1_RNA	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		134						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					GAGTTTCTAAGGGTGAGCCTT	0.418																																																0			10											123.0	110.0	114.0					10																	75107941		2203	4300	6503	74777947	SO:0001819	synonymous_variant	118491																														ENST00000310715.3:c.402C>G	10.37:g.75107941G>C		Somatic		Capture	Illumina GAIIx	4	74777947	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Silent	SNP	HMMSmart_SM00028,superfamily_TPR-like,HMMPfam_TPR_1	p.P134	ENST00000310715.3	37	c.402	CCDS7324.3	10																																																																																			-	NULL		0.418	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC18	protein_coding		G			74777947	-1	no_errors	NM_145170	genbank	human	provisional	54_36p	silent	SNP	0.951	C
Unknown	0	genome.wustl.edu	37	6	85996790	85996790	+	IGR	SNP	G	G	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr6:85996790G>T								TBX18 (522553 upstream) : RP11-30P6.6 (100146 downstream)																							TTGGGTTATGGTCAACTTATG	0.413																																																0			6																																								86053509	SO:0001628	intergenic_variant	643858																															6.37:g.85996790G>T		Somatic		Capture	Illumina GAIIx	4	86053509		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.413					KRT18P30			G			86053509	+1	pseudogene	XR_042318	genbank	human	model	54_36p	rna	SNP	1.000	T
CNBD1	168975	genome.wustl.edu	37	8	88364008	88364008	+	Nonsense_Mutation	SNP	C	C	T	rs75840995	byFrequency	TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr8:88364008C>T	ENST00000518476.1	+	9	1189	c.1138C>T	c.(1138-1140)Cga>Tga	p.R380*		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	380								p.R380*(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						TGTGAAACTACGATCAAATAA	0.284													C|||	2	0.000399361	0.0	0.0	5008	,	,		14048	0.001		0.001	False		,,,				2504	0.0															2	Substitution - Nonsense(2)	large_intestine(2)	8											66.0	62.0	63.0					8																	88364008		1795	4034	5829	88433124	SO:0001587	stop_gained	168975			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.1138C>T	8.37:g.88364008C>T	ENSP00000430073:p.Arg380*	Somatic		Capture	Illumina GAIIx	4	88433124		Nonsense_Mutation	SNP	PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2,superfamily_cNMP_binding,HMMPfam_cNMP_binding	p.R380*	ENST00000518476.1	37	c.1138	CCDS55259.1	8	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	19.98	3.927408	0.73327	.	.	ENSG00000176571	ENST00000518476	.	.	.	5.22	1.26	0.21427	.	1.332330	0.05197	N	0.504149	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-0.1799	2.3862	0.04366	0.1534:0.5309:0.1489:0.1668	.	.	.	.	X	380	.	ENSP00000430073:R380X	R	+	1	2	CNBD1	88433124	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.073000	0.14640	-0.062000	0.13088	-0.324000	0.08512	CGA	-	superfamily_cNMP_binding,HMMPfam_cNMP_binding		0.284	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNBD1	protein_coding	OTTHUMT00000375113.2	C	NM_173538		88433124	+1	no_errors	NM_173538	genbank	human	provisional	54_36p	nonsense	SNP	0.000	T
CDK6	1021	genome.wustl.edu	37	7	92300799	92300799	+	Silent	SNP	G	G	A	rs140690409	byFrequency	TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr7:92300799G>A	ENST00000265734.4	-	5	999	c.588C>T	c.(586-588)taC>taT	p.Y196Y	CDK6_ENST00000424848.2_Silent_p.Y196Y	NM_001259.6	NP_001250.1	Q00534	CDK6_HUMAN	cyclin-dependent kinase 6	196	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				astrocyte development (GO:0014002)|cell cycle arrest (GO:0007050)|cell dedifferentiation (GO:0043697)|cell division (GO:0051301)|dentate gyrus development (GO:0021542)|G1/S transition of mitotic cell cycle (GO:0000082)|generation of neurons (GO:0048699)|gliogenesis (GO:0042063)|hematopoietic stem cell differentiation (GO:0060218)|lateral ventricle development (GO:0021670)|mitotic cell cycle (GO:0000278)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular senescence (GO:2000773)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of osteoblast differentiation (GO:0045668)|Notch signaling pathway (GO:0007219)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of erythrocyte differentiation (GO:0045646)|regulation of gene expression (GO:0010468)|response to virus (GO:0009615)|T cell differentiation in thymus (GO:0033077)|type B pancreatic cell development (GO:0003323)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	11	all_cancers(62;8.72e-12)|all_epithelial(64;3.65e-10)|Breast(17;0.000675)|all_lung(186;0.0392)|Lung NSC(181;0.053)|all_neural(327;0.219)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;1.2e-06)|all cancers(6;3.1e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CGGGGGTGGCGTAGCTGGACT	0.488			T	MLLT10	ALL								G|||	2	0.000399361	0.0015	0.0	5008	,	,		21030	0.0		0.0	False		,,,				2504	0.0						Dom	yes		7	7q21-q22	1021	cyclin-dependent kinase 6		L	0			7						G	,	8,4398	14.3+/-33.2	0,8,2195	105.0	92.0	97.0		588,588	-3.8	0.9	7	dbSNP_134	97	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	CDK6	NM_001145306.1,NM_001259.6	,	0,8,6495	AA,AG,GG		0.0,0.1816,0.0615	,	196/327,196/327	92300799	8,12998	2203	4300	6503	92138735	SO:0001819	synonymous_variant	1021				CCDS5628.1	7q21-q22	2011-11-08			ENSG00000105810	ENSG00000105810		"""Cyclin-dependent kinases"""	1777	protein-coding gene	gene with protein product		603368				1639063	Standard	NM_001259		Approved	PLSTIRE	uc010lez.3	Q00534	OTTHUMG00000131697	ENST00000265734.4:c.588C>T	7.37:g.92300799G>A		Somatic		Capture	Illumina GAIIx	4	92138735	A4D1G0	Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.Y196	ENST00000265734.4	37	c.588	CCDS5628.1	7																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.488	CDK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK6	protein_coding	OTTHUMT00000254605.2	G			92138735	-1	no_errors	NM_001259	genbank	human	validated	54_36p	silent	SNP	0.978	A
UGGT2	55757	genome.wustl.edu	37	13	96485232	96485232	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr13:96485232C>T	ENST00000376747.3	-	38	4547	c.4477G>A	c.(4477-4479)Gct>Act	p.A1493T		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1493	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						CTTATCTCAGCATCATACTCC	0.348																																																0			13											223.0	195.0	205.0					13																	96485232		2202	4299	6501	95283233	SO:0001583	missense	55757			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.4477G>A	13.37:g.96485232C>T	ENSP00000365938:p.Ala1493Thr	Somatic		Capture	Illumina GAIIx	4	95283233	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	HMMPfam_UDP-g_GGTase,superfamily_Nucleotide-diphospho-sugar transferases	p.A1493T	ENST00000376747.3	37	c.4477	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	C	1.971	-0.436519	0.04636	.	.	ENSG00000102595	ENST00000376747	T	0.22134	1.97	5.87	2.21	0.28008	.	0.312530	0.38548	N	0.001656	T	0.08935	0.0221	N	0.10916	0.065	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.25433	-1.0132	10	0.22109	T	0.4	-2.9145	5.5208	0.16931	0.1739:0.1591:0.0:0.667	.	1493	Q9NYU1	UGGG2_HUMAN	T	1493	ENSP00000365938:A1493T	ENSP00000365938:A1493T	A	-	1	0	UGGT2	95283233	0.970000	0.33590	0.369000	0.25952	0.765000	0.43378	0.128000	0.15810	0.150000	0.19136	-0.136000	0.14681	GCT	-	superfamily_Nucleotide-diphospho-sugar transferases		0.348	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGCGL2	protein_coding	OTTHUMT00000045507.1	C	NM_020121		95283233	-1	no_errors	NM_020121	genbank	human	provisional	54_36p	missense	SNP	0.990	T
PCDH19	57526	genome.wustl.edu	37	X	99551783	99551783	+	Missense_Mutation	SNP	C	C	T	rs368872920		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chrX:99551783C>T	ENST00000373034.4	-	6	4614	c.2939G>A	c.(2938-2940)cGt>cAt	p.R980H	PCDH19_ENST00000255531.7_Missense_Mutation_p.R933H|PCDH19_ENST00000464981.1_5'Flank|PCDH19_ENST00000420881.2_Missense_Mutation_p.R932H	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	980			R -> C (in dbSNP:rs3764758). {ECO:0000269|PubMed:22267240}.		homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						GGACTTGGAACGGATGGGCAT	0.547																																																0			X						C	HIS/ARG,HIS/ARG,HIS/ARG	0,3578		0,0,1504,570	70.0	67.0	68.0		2798,2939,2795	5.8	1.0	X		68	1,6588		0,1,2383,1821	no	missense,missense,missense	PCDH19	NM_001105243.1,NM_001184880.1,NM_020766.2	29,29,29	0,1,3887,2391	TT,TC,CC,C		0.0152,0.0,0.0098	probably-damaging,probably-damaging,probably-damaging	933/1102,980/1149,932/1101	99551783	1,10166	2074	4205	6279	99438439	SO:0001583	missense	57526			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.2939G>A	X.37:g.99551783C>T	ENSP00000362125:p.Arg980His	Somatic		Capture	Illumina GAIIx	4	99438439	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.R933H	ENST00000373034.4	37	c.2798	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882982	0.33255	0.0	1.52E-4	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.54479	0.6;0.64;0.57	5.84	5.84	0.93424	.	0.118844	0.52532	D	0.000064	T	0.68879	0.3049	L	0.54323	1.7	0.80722	D	1	P;D;D	0.89917	0.941;1.0;1.0	P;D;D	0.70716	0.482;0.97;0.935	T	0.65549	-0.6141	10	0.37606	T	0.19	.	19.1326	0.93413	0.0:1.0:0.0:0.0	.	980;933;932	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	H	932;980;933	ENSP00000400327:R932H;ENSP00000362125:R980H;ENSP00000255531:R933H	ENSP00000255531:R933H	R	-	2	0	PCDH19	99438439	1.000000	0.71417	0.982000	0.44146	0.601000	0.36947	5.713000	0.68415	2.469000	0.83416	0.600000	0.82982	CGT	-	NULL		0.547	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	protein_coding	OTTHUMT00000057479.2	C	NM_020766		99438439	-1	no_errors	NM_001105243	genbank	human	validated	54_36p	missense	SNP	0.998	T
VPS13B	157680	genome.wustl.edu	37	8	100847945	100847945	+	Silent	SNP	C	C	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr8:100847945C>T	ENST00000358544.2	+	54	10107	c.9996C>T	c.(9994-9996)gaC>gaT	p.D3332D	VPS13B_ENST00000357162.2_Silent_p.D3307D|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3332					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATGCCATTGACATCAACAGTC	0.438																																					Colon(161;2205 2542 7338 31318)											0			8											64.0	58.0	60.0					8																	100847945		2203	4300	6503	100917121	SO:0001819	synonymous_variant	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.9996C>T	8.37:g.100847945C>T		Somatic		Capture	Illumina GAIIx	4	100917121	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	PatternScan_ZINC_PROTEASE	p.D3332	ENST00000358544.2	37	c.9996	CCDS6280.1	8																																																																																			-	NULL		0.438	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	protein_coding	OTTHUMT00000277138.1	C	NM_184042		100917121	+1	no_errors	NM_017890	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
RGS22	26166	genome.wustl.edu	37	8	100994204	100994204	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr8:100994204G>C	ENST00000360863.6	-	22	3515	c.3321C>G	c.(3319-3321)caC>caG	p.H1107Q	RGS22_ENST00000523287.1_Missense_Mutation_p.H926Q|RGS22_ENST00000523437.1_Missense_Mutation_p.H1095Q	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	1107	RGS 2. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ACTCCTTCCGGTGTTCAATAA	0.363																																																0			8											219.0	214.0	215.0					8																	100994204		1900	4128	6028	101063380	SO:0001583	missense	26166			AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.3321C>G	8.37:g.100994204G>C	ENSP00000354109:p.His1107Gln	Somatic		Capture	Illumina GAIIx	4	101063380	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Missense_Mutation	SNP	superfamily_Regulator of G-protein signaling RGS,HMMSmart_SM00315,HMMPfam_RGS	p.H1107Q	ENST00000360863.6	37	c.3321	CCDS43758.1	8	.	.	.	.	.	.	.	.	.	.	G	10.21	1.286519	0.23478	.	.	ENSG00000132554	ENST00000360863;ENST00000427793;ENST00000523287;ENST00000523437	T;T;T	0.21361	2.01;2.01;2.01	5.0	2.24	0.28232	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.421858	0.25427	N	0.030747	T	0.17109	0.0411	L	0.38531	1.155	0.24806	N	0.992679	P;P;B	0.46784	0.884;0.884;0.119	P;P;B	0.47299	0.543;0.543;0.037	T	0.08330	-1.0727	10	0.22706	T	0.39	.	5.3751	0.16160	0.2969:0.0:0.5684:0.1348	.	1095;1107;926	A8K944;Q8NE09;G3V112	.;RGS22_HUMAN;.	Q	1107;1094;926;1095	ENSP00000354109:H1107Q;ENSP00000429382:H926Q;ENSP00000428212:H1095Q	ENSP00000354109:H1107Q	H	-	3	2	RGS22	101063380	0.904000	0.30761	1.000000	0.80357	0.958000	0.62258	-0.023000	0.12456	0.516000	0.28340	0.585000	0.79938	CAC	-	superfamily_Regulator of G-protein signaling RGS,HMMSmart_SM00315,HMMPfam_RGS		0.363	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS22	protein_coding	OTTHUMT00000380365.1	G	NM_015668		101063380	-1	no_errors	NM_015668	genbank	human	validated	54_36p	missense	SNP	0.989	C
CENPE	1062	genome.wustl.edu	37	4	104035657	104035657	+	Silent	SNP	A	A	G	rs202097843		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr4:104035657A>G	ENST00000265148.3	-	46	7584	c.7495T>C	c.(7495-7497)Ttg>Ctg	p.L2499L	CENPE_ENST00000380026.3_Silent_p.L2378L	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2499					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTTTCTCTCAATAGCCTTATA	0.323													A|||	1	0.000199681	0.0	0.0	5008	,	,		19116	0.0		0.001	False		,,,				2504	0.0															0			4											176.0	164.0	168.0					4																	104035657		2202	4300	6502	104255106	SO:0001819	synonymous_variant	1062			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.7495T>C	4.37:g.104035657A>G		Somatic		Capture	Illumina GAIIx	4	104255106	A6NKY9|A8K2U7|Q4LE75	Silent	SNP	HMMSmart_SM00129,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,PatternScan_AA_TRNA_LIGASE_I	p.L2499	ENST00000265148.3	37	c.7495	CCDS34042.1	4																																																																																			-	NULL		0.323	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	protein_coding		A			104255106	-1	no_errors	NM_001813	genbank	human	validated	54_36p	silent	SNP	0.016	G
LOC100129138	100129138	genome.wustl.edu	37	1	104616079	104616079	+	lincRNA	SNP	C	C	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:104616079C>T	ENST00000418362.1	+	0	435					NR_033990.1																						GCTGGTGAAGCGAAGGATGTC	0.587																																																0			1																																								104417602			0																															1.37:g.104616079C>T		Somatic		Capture	Illumina GAIIx	4	104417602		RNA	SNP	-	NULL	ENST00000418362.1	37	NULL		1																																																																																			-	-		0.587	RP11-364B6.1-001	KNOWN	basic	lincRNA	LOC100129138	lincRNA	OTTHUMT00000030377.1	C			104417602	+1	no_errors	XR_036957	genbank	human	model	54_36p	rna	SNP	0.000	T
RIMS2	9699	genome.wustl.edu	37	8	104831829	104831829	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr8:104831829C>A	ENST00000507740.1	+	1	330	c.94C>A	c.(94-96)Ctt>Att	p.L32I	RIMS2_ENST00000262231.10_Missense_Mutation_p.L32I|RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000522174.1_3'UTR	NM_014677.4	NP_055492.3	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ACAAAATGAGCTTTTTGGACA	0.318										HNSCC(12;0.0054)																																						0			8											103.0	98.0	100.0					8																	104831829		1818	4080	5898	104901005	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000507740.1:c.94C>A	8.37:g.104831829C>A	ENSP00000423559:p.Leu32Ile	Somatic		Capture	Illumina GAIIx	4	104901005	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMSmart_SM00228,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.L32I	ENST00000507740.1	37	c.94	CCDS43761.1	8	.	.	.	.	.	.	.	.	.	.	C	9.425	1.084072	0.20309	.	.	ENSG00000176406	ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894	T;T;T;T	0.18960	2.18;2.28;2.25;2.18	5.71	3.79	0.43588	.	.	.	.	.	T	0.11879	0.0289	N	0.08118	0	0.80722	D	1	B;B	0.13594	0.008;0.008	B;B	0.14578	0.011;0.011	T	0.08764	-1.0706	9	0.27785	T	0.31	.	14.7519	0.69533	0.2634:0.7366:0.0:0.0	.	32;32	Q9UQ26-1;Q9UQ26-3	.;.	I	32	ENSP00000425205:L32I;ENSP00000262231:L32I;ENSP00000423559:L32I;ENSP00000386228:L32I	ENSP00000262231:L32I	L	+	1	0	RIMS2	104901005	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.867000	0.39499	1.351000	0.45789	0.585000	0.79938	CTT	-	NULL		0.318	RIMS2-005	NOVEL	basic|CCDS	protein_coding	RIMS2	protein_coding	OTTHUMT00000367215.1	C	NM_001100117		104901005	+1	no_errors	NM_014677	genbank	human	validated	54_36p	missense	SNP	1.000	A
RP5-947P14.1	0	genome.wustl.edu	37	1	106623645	106623645	+	lincRNA	SNP	C	C	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:106623645C>A	ENST00000437803.1	+	0	165																											CATCCGCATCCGTGTAGGGCC	0.652																																																0			1																																								106425168			126987																															1.37:g.106623645C>A		Somatic		Capture	Illumina GAIIx	4	106425168		RNA	SNP	-	NULL	ENST00000437803.1	37	NULL		1																																																																																			-	-		0.652	RP5-947P14.1-001	KNOWN	basic	lincRNA	LOC126987	lincRNA	OTTHUMT00000030361.1	C			106425168	-1	no_errors	XR_016153	genbank	human	model	54_36p	rna	SNP	0.033	A
ARHGEF38	54848	genome.wustl.edu	37	4	106534658	106534658	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr4:106534658G>T	ENST00000420470.2	+	3	646	c.502G>T	c.(502-504)Gta>Tta	p.V168L	ARHGEF38_ENST00000265154.2_Missense_Mutation_p.V168L	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	168	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						GGCCATGCAAGTAATTGGTAT	0.413																																																0			4											129.0	121.0	124.0					4																	106534658		2203	4300	6503	106754107	SO:0001583	missense	54848			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.502G>T	4.37:g.106534658G>T	ENSP00000416125:p.Val168Leu	Somatic		Capture	Illumina GAIIx	4	106754107	C9JIB4	Missense_Mutation	SNP	PatternScan_DH_1,superfamily_DH-domain,HMMPfam_RhoGEF	p.V168L	ENST00000420470.2	37	c.502	CCDS56338.1	4	.	.	.	.	.	.	.	.	.	.	G	0.703	-0.790197	0.02884	.	.	ENSG00000236699	ENST00000265154;ENST00000420470	T;T	0.62498	0.02;0.02	5.67	4.83	0.62350	Dbl homology (DH) domain (4);	0.315912	0.27891	N	0.017425	T	0.32436	0.0829	N	0.03050	-0.425	0.25725	N	0.985337	B	0.14805	0.011	B	0.18561	0.022	T	0.19910	-1.0291	10	0.09084	T	0.74	-0.1461	8.9817	0.35970	0.1372:0.1239:0.7389:0.0	.	168	Q9NXL2	ARH38_HUMAN	L	168	ENSP00000265154:V168L;ENSP00000416125:V168L	ENSP00000265154:V168L	V	+	1	0	ARHGEF38	106754107	1.000000	0.71417	0.995000	0.50966	0.022000	0.10575	2.316000	0.43761	1.379000	0.46325	-0.150000	0.13652	GTA	-	superfamily_DH-domain,HMMPfam_RhoGEF		0.413	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	FLJ20184	protein_coding	OTTHUMT00000336934.3	G	NM_017700		106754107	+1	no_errors	NM_017700	genbank	human	predicted	54_36p	missense	SNP	1.000	T
XPNPEP1	7511	genome.wustl.edu	37	10	111647899	111647899	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr10:111647899A>C	ENST00000502935.1	-	7	679	c.560T>G	c.(559-561)aTt>aGt	p.I187S	XPNPEP1_ENST00000430337.1_5'UTR|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.I187S|XPNPEP1_ENST00000369680.4_Missense_Mutation_p.I144S|XPNPEP1_ENST00000369683.1_Missense_Mutation_p.I73S					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		CTTGACAGGAATGAGGTGATG	0.532																																																0			10											78.0	68.0	71.0					10																	111647899		2203	4300	6503	111637889	SO:0001583	missense	7511				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.560T>G	10.37:g.111647899A>C	ENSP00000421566:p.Ile187Ser	Somatic		Capture	Illumina GAIIx	4	111637889		Missense_Mutation	SNP	HMMPfam_Creatinase_N,superfamily_Creatinase/aminopeptidase,HMMPfam_Peptidase_M24,PatternScan_PROLINE_PEPTIDASE	p.I144S	ENST00000502935.1	37	c.431	CCDS7560.2	10	.	.	.	.	.	.	.	.	.	.	A	17.98	3.520806	0.64747	.	.	ENSG00000108039	ENST00000502935;ENST00000369683;ENST00000322238;ENST00000369680;ENST00000403138;ENST00000423625	.	.	.	5.74	5.74	0.90152	Creatinase (1);	0.323851	0.33382	N	0.004972	T	0.67163	0.2864	L	0.59436	1.845	0.39822	D	0.972848	B;B;B	0.28998	0.119;0.062;0.23	B;B;B	0.40825	0.108;0.151;0.341	T	0.69837	-0.5037	9	0.62326	D	0.03	-3.4298	14.6152	0.68544	1.0:0.0:0.0:0.0	.	187;187;144	B4E2P4;G5E9Y2;Q9NQW7	.;.;XPP1_HUMAN	S	187;73;187;144;144;144	.	ENSP00000324011:I187S	I	-	2	0	XPNPEP1	111637889	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	8.100000	0.89544	2.182000	0.69389	0.496000	0.49642	ATT	-	NULL		0.532	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	protein_coding	OTTHUMT00000050264.2	A			111637889	-1	no_errors	NM_020383	genbank	human	provisional	54_36p	missense	SNP	1.000	C
HSDL2	84263	genome.wustl.edu	37	9	115216388	115216388	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr9:115216388C>G	ENST00000398805.3	+	9	1188	c.961C>G	c.(961-963)Ctc>Gtc	p.L321V	HSDL2_ENST00000262542.7_Missense_Mutation_p.L201V|HSDL2_ENST00000398803.1_Missense_Mutation_p.L248V|HSDL2_ENST00000539114.1_Missense_Mutation_p.L116V|HSDL2_ENST00000488101.1_3'UTR	NM_032303.4	NP_115679.2	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2	321	SCP2.					membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|cervix(2)|endometrium(1)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(2)	13						TAAGGACTCTCTCAGTGATGA	0.398																																																0			9											156.0	141.0	146.0					9																	115216388		1884	4116	6000	114256209	SO:0001583	missense	84263			AY093428	CCDS43864.1, CCDS56582.1	9q32	2011-09-14			ENSG00000119471	ENSG00000119471		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18572	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 13C, member 1"""		"""chromosome 9 open reading frame 99"""	C9orf99		12834046, 19027726	Standard	NM_032303		Approved	SDR13C1	uc004bga.2	Q6YN16	OTTHUMG00000020504	ENST00000398805.3:c.961C>G	9.37:g.115216388C>G	ENSP00000381785:p.Leu321Val	Somatic		Capture	Illumina GAIIx	4	114256209	A8K1L4|A8K8X1|A8MSV3|Q658M8|Q9BT58	Missense_Mutation	SNP	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_adh_short,PatternScan_ADH_SHORT,superfamily_Sterol carrier protein SCP,HMMPfam_SCP2	p.L321V	ENST00000398805.3	37	c.961	CCDS43864.1	9	.	.	.	.	.	.	.	.	.	.	C	18.10	3.549345	0.65311	.	.	ENSG00000119471	ENST00000398805;ENST00000398803;ENST00000262542;ENST00000539114	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.94	5.94	0.96194	SCP2 sterol-binding domain (2);	0.160827	0.56097	D	0.000032	T	0.24044	0.0582	L	0.37507	1.11	0.47183	D	0.999344	P;D;B	0.53745	0.717;0.962;0.017	B;P;B	0.49451	0.243;0.611;0.078	T	0.00369	-1.1784	10	0.33940	T	0.23	.	12.7824	0.57485	0.1634:0.8365:0.0:0.0	.	248;248;321	Q6YN16-2;B2R923;Q6YN16	.;.;HSDL2_HUMAN	V	321;248;201;116	ENSP00000381785:L321V;ENSP00000381783:L248V;ENSP00000262542:L201V;ENSP00000442278:L116V	ENSP00000262542:L201V	L	+	1	0	HSDL2	114256209	0.939000	0.31865	0.999000	0.59377	0.833000	0.47200	1.890000	0.39728	2.821000	0.97095	0.484000	0.47621	CTC	-	superfamily_Sterol carrier protein SCP,HMMPfam_SCP2		0.398	HSDL2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	HSDL2	protein_coding	OTTHUMT00000053681.1	C	NM_032303		114256209	+1	no_errors	NM_032303	genbank	human	provisional	54_36p	missense	SNP	0.988	G
FAT4	79633	genome.wustl.edu	37	4	126412360	126412360	+	Missense_Mutation	SNP	C	C	G	rs267600018		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr4:126412360C>G	ENST00000394329.3	+	17	14396	c.14383C>G	c.(14383-14385)Ctc>Gtc	p.L4795V	FAT4_ENST00000335110.5_Missense_Mutation_p.L3036V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4795	Necessary and sufficient for interaction with MPDZ. {ECO:0000250}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGTGGAGAGGCTCAACACACC	0.517																																																0			4											59.0	62.0	61.0					4																	126412360		2203	4300	6503	126631810	SO:0001583	missense	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.14383C>G	4.37:g.126412360C>G	ENSP00000377862:p.Leu4795Val	Somatic		Capture	Illumina GAIIx	4	126631810	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_EGF	p.L4738V	ENST00000394329.3	37	c.14212	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	16.61	3.170666	0.57584	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	D;D	0.89196	-2.29;-2.48	4.87	4.87	0.63330	.	0.000000	0.29892	U	0.010923	D	0.94066	0.8098	M	0.76574	2.34	0.58432	D	0.999998	D;D;D	0.67145	0.996;0.993;0.996	D;D;D	0.80764	0.994;0.987;0.994	D	0.94746	0.7923	10	0.72032	D	0.01	.	17.0284	0.86454	0.0:1.0:0.0:0.0	.	3036;4795;4794	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	V	4795;3036	ENSP00000377862:L4795V;ENSP00000335169:L3036V	ENSP00000335169:L3036V	L	+	1	0	FAT4	126631810	1.000000	0.71417	1.000000	0.80357	0.547000	0.35210	5.553000	0.67287	2.253000	0.74438	0.491000	0.48974	CTC	-	NULL		0.517	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	C	NM_024582		126631810	+1	no_errors	NM_024582	genbank	human	validated	54_36p	missense	SNP	1.000	G
NTMT1	28989	genome.wustl.edu	37	9	132397560	132397560	+	Silent	SNP	C	C	T	rs372305359		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr9:132397560C>T	ENST00000372486.1	+	4	838	c.489C>T	c.(487-489)atC>atT	p.I163I	NTMT1_ENST00000372483.4_Silent_p.I163I|NTMT1_ENST00000372480.1_Silent_p.I163I|NTMT1_ENST00000372481.3_Missense_Mutation_p.S135L|NTMT1_ENST00000482347.1_Silent_p.I75I			Q9BV86	NTM1A_HUMAN	N-terminal Xaa-Pro-Lys N-methyltransferase 1	163					chromosome segregation (GO:0007059)|N-terminal peptidyl-proline dimethylation (GO:0018016)|N-terminal peptidyl-serine dimethylation (GO:0035572)|N-terminal peptidyl-serine trimethylation (GO:0035573)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein methyltransferase activity (GO:0008276)										ACGGCATCATCGTCATCAAAG	0.637																																																0			9						C	,,,	0,4406		0,0,2203	103.0	87.0	92.0		,489,,	-10.0	0.6	9		92	2,8598	2.2+/-6.3	0,2,4298	no	utr-3,coding-synonymous,utr-3,utr-3	METTL11A,ASB6	NM_001202403.1,NM_014064.2,NM_017873.3,NM_177999.2	,,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,,	,163/224,,	132397560	2,13004	2203	4300	6503	131437381	SO:0001819	synonymous_variant	28989			AF110776	CCDS35160.1, CCDS69682.1, CCDS75918.1	9q34.2	2012-11-05	2012-06-12	2012-06-12	ENSG00000148335	ENSG00000148335	2.1.1.n5		23373	protein-coding gene	gene with protein product		613560	"""chromosome 9 open reading frame 32"", ""methyltransferase like 11A"""	C9orf32, METTL11A		20481588	Standard	XM_005251939		Approved	AD-003, HOMT1A	uc004byd.1	Q9BV86	OTTHUMG00000020785	ENST00000372486.1:c.489C>T	9.37:g.132397560C>T		Somatic		Capture	Illumina GAIIx	4	131437381	A8K4J2|A8K8G7|Q5SZB9|Q9UI28	Missense_Mutation	SNP	HMMPfam_DUF858,superfamily_SSF53335	p.S135L	ENST00000372486.1	37	c.404	CCDS35160.1	9	.	.	.	.	.	.	.	.	.	.	C	8.088	0.773843	0.16051	0.0	2.33E-4	ENSG00000148335	ENST00000372481	T	0.34667	1.35	5.01	-10.0	0.00425	.	.	.	.	.	T	0.26376	0.0644	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20405	-1.0276	8	0.87932	D	0	-14.7028	14.1201	0.65182	0.0:0.2021:0.0826:0.7152	.	135	Q9BV86-2	.	L	135	ENSP00000361559:S135L	ENSP00000361559:S135L	S	+	2	0	METTL11A	131437381	0.000000	0.05858	0.620000	0.29132	0.510000	0.34073	-2.451000	0.01006	-2.234000	0.00715	-2.165000	0.00325	TCG	-	HMMPfam_DUF858		0.637	NTMT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	METTL11A	protein_coding	OTTHUMT00000054589.1	C	NM_014064		131437381	+1	no_errors	ENST00000372481	ensembl	human	known	54_36p	missense	SNP	0.952	T
NRG2	9542	genome.wustl.edu	37	5	139266939	139266939	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr5:139266939T>A	ENST00000361474.1	-	2	1082	c.858A>T	c.(856-858)aaA>aaT	p.K286N	NRG2_ENST00000394770.1_Missense_Mutation_p.K286N|NRG2_ENST00000289422.7_Missense_Mutation_p.K286N|NRG2_ENST00000545385.1_Missense_Mutation_p.K286N|NRG2_ENST00000358522.3_Missense_Mutation_p.K286N|NRG2_ENST00000289409.4_Missense_Mutation_p.K286N|NRG2_ENST00000340391.3_Missense_Mutation_p.K83N|NRG2_ENST00000518130.1_5'UTR|NRG2_ENST00000541337.1_Missense_Mutation_p.K286N	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	286	Ig-like C2-type.				embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTTGCCATATTTGATGCGAA	0.577																																																0			5											167.0	143.0	151.0					5																	139266939		2203	4300	6503	139247123	SO:0001583	missense	9542				CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.858A>T	5.37:g.139266939T>A	ENSP00000354910:p.Lys286Asn	Somatic		Capture	Illumina GAIIx	4	139247123		Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_Neuregulin	p.K286N	ENST00000361474.1	37	c.858	CCDS4217.1	5	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678965	0.68042	.	.	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000394770;ENST00000340391;ENST00000289409;ENST00000358522;ENST00000544729;ENST00000378238	T;T;T;T;T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	5.64	2.89	0.33648	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.068939	0.56097	D	0.000039	T	0.69314	0.3097	L	0.41906	1.305	0.43485	D	0.995719	D;D;D;D	0.76494	0.97;0.971;0.999;0.978	P;P;D;P	0.68765	0.846;0.856;0.96;0.775	T	0.67991	-0.5527	10	0.62326	D	0.03	-14.8121	6.4174	0.21723	0.0:0.6339:0.0:0.3661	.	286;286;286;286	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	N	286;286;286;286;286;286;83;286;286;194;286	ENSP00000444235:K286N;ENSP00000289422:K286N;ENSP00000354910:K286N;ENSP00000438753:K286N;ENSP00000378251:K286N;ENSP00000342660:K83N;ENSP00000289409:K286N;ENSP00000351323:K286N;ENSP00000367483:K286N	ENSP00000289409:K286N	K	-	3	2	NRG2	139247123	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	1.026000	0.30103	0.726000	0.32339	-0.468000	0.05107	AAA	-	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2		0.577	NRG2-001	KNOWN	basic|CCDS	protein_coding	NRG2	protein_coding	OTTHUMT00000251340.1	T	NM_013982		139247123	-1	no_errors	NM_013982	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MOXD2P	100289017	genome.wustl.edu	37	7	141943929	141943929	+	RNA	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr7:141943929G>A	ENST00000477615.1	-	0	0							A6NHM9	MOXD2_HUMAN	monooxygenase, DBH-like 2, pseudogene								copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)										GTGATGCACCGTTGTCTCATT	0.517																																																0			7																																								141590402			642128					7q34	2010-09-24	2010-09-24	2010-09-24	ENSG00000240268	ENSG00000240268			33605	pseudogene	pseudogene			"""monooxygenase, DBH-like 2 pseudogene"""	MOXD2			Standard	NR_024346		Approved		uc022amw.1	A6NHM9	OTTHUMG00000158566		7.37:g.141943929G>A		Somatic		Capture	Illumina GAIIx	4	141590402		Missense_Mutation	SNP	HMMSmart_SM00664,HMMPfam_DOMON,HMMPfam_Cu2_monooxygen,superfamily_PHM/PNGase F,HMMPfam_Cu2_monoox_C	p.T246M	ENST00000477615.1	37	c.737		7																																																																																			-	HMMPfam_Cu2_monooxygen,superfamily_PHM/PNGase F		0.517	MOXD2P-002	KNOWN	basic	processed_transcript	MOXD2	pseudogene	OTTHUMT00000351330.2	G	NR_024346		141590402	-1	no_start_codon:no_stop_codon	ENST00000389113	ensembl	human	known	54_36p	missense	SNP	0.912	A
UTRN	7402	genome.wustl.edu	37	6	144759887	144759887	+	Silent	SNP	C	C	T	rs114118949	byFrequency	TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr6:144759887C>T	ENST00000367545.3	+	11	1248	c.1248C>T	c.(1246-1248)caC>caT	p.H416H		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	416	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		ACAGGCTGCACGATGTGCTGA	0.517													C|||	2	0.000399361	0.0	0.0	5008	,	,		18457	0.002		0.0	False		,,,				2504	0.0															0			6											99.0	92.0	94.0					6																	144759887		2203	4300	6503	144801580	SO:0001819	synonymous_variant	7402			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.1248C>T	6.37:g.144759887C>T		Somatic		Capture	Illumina GAIIx	4	144801580	Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC,superfamily_WW_Rsp5_WWP,HMMSmart_WW,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_SSF47473,HMMPfam_efhand_1,HMMPfam_efhand_2,HMMPfam_ZZ,HMMSmart_ZnF_ZZ,PatternScan_ZF_ZZ_1	p.H416	ENST00000367545.3	37	c.1248	CCDS34547.1	6																																																																																			-	HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC		0.517	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	protein_coding	OTTHUMT00000042551.1	C			144801580	+1	no_errors	NM_007124	genbank	human	reviewed	54_36p	silent	SNP	0.991	T
ARSI	340075	genome.wustl.edu	37	5	149677353	149677353	+	Silent	SNP	G	G	A	rs528847762		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr5:149677353G>A	ENST00000328668.7	-	2	1713	c.1134C>T	c.(1132-1134)agC>agT	p.S378S		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	378					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCGGCCCTCGCTGATGGCCG	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		18808	0.001		0.0	False		,,,				2504	0.0															0			5											42.0	45.0	44.0					5																	149677353		2203	4299	6502	149657546	SO:0001819	synonymous_variant	340075			AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1134C>T	5.37:g.149677353G>A		Somatic		Capture	Illumina GAIIx	4	149657546	A1L3B0|B3KV22|B7XD03	Silent	SNP	HMMPfam_Sulfatase,superfamily_Alkaline phosphatase-like,PatternScan_SULFATASE_1,PatternScan_SULFATASE_2	p.S378	ENST00000328668.7	37	c.1134	CCDS34275.1	5																																																																																			-	HMMPfam_Sulfatase,superfamily_Alkaline phosphatase-like		0.632	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSI	protein_coding	OTTHUMT00000373681.1	G	NM_001012301		149657546	-1	no_errors	NM_001012301	genbank	human	validated	54_36p	silent	SNP	0.965	A
HRNR	388697	genome.wustl.edu	37	1	152193842	152193842	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:152193842A>T	ENST00000368801.2	-	3	338	c.263T>A	c.(262-264)aTc>aAc	p.I88N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	88					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTGCCAATGATTTTATTACG	0.398																																																0			1											158.0	128.0	138.0					1																	152193842		2203	4300	6503	150460466	SO:0001583	missense	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.263T>A	1.37:g.152193842A>T	ENSP00000357791:p.Ile88Asn	Somatic		Capture	Illumina GAIIx	4	150460466	Q5DT20|Q5U1F4	Missense_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,PatternScan_S100_CABP,PatternScan_EF_HAND_1,HMMPfam_SVS_QK	p.I88N	ENST00000368801.2	37	c.263	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	A	8.127	0.782154	0.16189	.	.	ENSG00000197915	ENST00000368801	T	0.06768	3.26	4.97	3.86	0.44501	EF-hand-like domain (1);	.	.	.	.	T	0.06645	0.0170	L	0.52364	1.645	0.25118	N	0.990663	D	0.54207	0.965	P	0.51742	0.678	T	0.22591	-1.0212	9	0.72032	D	0.01	.	6.8161	0.23831	0.8989:0.0:0.1011:0.0	.	88	Q86YZ3	HORN_HUMAN	N	88	ENSP00000357791:I88N	ENSP00000357791:I88N	I	-	2	0	HRNR	150460466	0.477000	0.25909	0.964000	0.40570	0.059000	0.15707	1.203000	0.32284	2.220000	0.72140	0.443000	0.29094	ATC	-	superfamily_SSF47473		0.398	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	protein_coding	OTTHUMT00000034016.1	A	XM_373868		150460466	-1	no_errors	NM_001009931	genbank	human	validated	54_36p	missense	SNP	0.099	T
ABCF2	10061	genome.wustl.edu	37	7	150921059	150921059	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr7:150921059G>A	ENST00000287844.2	-	4	618	c.509C>T	c.(508-510)gCc>gTc	p.A170V	ABCF2_ENST00000222388.2_Missense_Mutation_p.A170V|ABCF2_ENST00000473874.1_5'Flank	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	170	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTCCAGCATGGCCCGCTCTGT	0.602																																																0			7											100.0	88.0	92.0					7																	150921059		2203	4300	6503	150551992	SO:0001583	missense	10061			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.509C>T	7.37:g.150921059G>A	ENSP00000287844:p.Ala170Val	Somatic		Capture	Illumina GAIIx	4	150551992	O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.A170V	ENST00000287844.2	37	c.509	CCDS5923.1	7	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835523	0.50951	.	.	ENSG00000033050	ENST00000222388;ENST00000287844;ENST00000468073;ENST00000441774	D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31	5.81	5.81	0.92471	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.193670	0.53938	D	0.000044	D	0.85969	0.5821	N	0.12887	0.27	0.36037	D	0.839801	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.83273	-0.0042	10	0.26408	T	0.33	-0.872	13.9691	0.64228	0.0:0.0:0.8486:0.1514	.	170;170	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	V	170	ENSP00000222388:A170V;ENSP00000287844:A170V;ENSP00000419720:A170V;ENSP00000395785:A170V	ENSP00000222388:A170V	A	-	2	0	ABCF2	150551992	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.005000	0.70716	2.746000	0.94184	0.655000	0.94253	GCC	-	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran		0.602	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	protein_coding	OTTHUMT00000336086.1	G	NM_005692		150551992	-1	no_errors	NM_005692	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GALNT13	114805	genome.wustl.edu	37	2	155098634	155098634	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr2:155098634G>T	ENST00000392825.3	+	5	970	c.403G>T	c.(403-405)Gtt>Ttt	p.V135F	GALNT13_ENST00000409237.1_Missense_Mutation_p.V135F	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	135	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						CCTTAGAACTGTTTACAGTGT	0.388																																																0			2											128.0	117.0	120.0					2																	155098634		2203	4300	6503	154806880	SO:0001583	missense	114805			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.403G>T	2.37:g.155098634G>T	ENSP00000376570:p.Val135Phe	Somatic		Capture	Illumina GAIIx	4	154806880	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	superfamily_Nucleotide-diphospho-sugar transferases,HMMPfam_Glycos_transf_2,superfamily_Ricin B-like lectins,HMMSmart_SM00458,HMMPfam_Ricin_B_lectin	p.V135F	ENST00000392825.3	37	c.403	CCDS2199.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.163533	0.94727	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.61158	0.13;0.13	5.56	5.56	0.83823	Glycosyl transferase, family 2 (1);	0.119560	0.56097	D	0.000031	D	0.83385	0.5243	H	0.96398	3.815	0.80722	D	1	D;P	0.54397	0.966;0.954	D;D	0.64506	0.926;0.92	D	0.88482	0.3069	10	0.87932	D	0	.	18.1371	0.89623	0.0:0.0:1.0:0.0	.	135;135	Q08ER7;Q8IUC8	.;GLT13_HUMAN	F	135	ENSP00000376570:V135F;ENSP00000387239:V135F	ENSP00000376570:V135F	V	+	1	0	GALNT13	154806880	1.000000	0.71417	0.988000	0.46212	0.979000	0.70002	6.800000	0.75165	2.621000	0.88768	0.579000	0.79373	GTT	-	superfamily_Nucleotide-diphospho-sugar transferases,HMMPfam_Glycos_transf_2		0.388	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT13	protein_coding	OTTHUMT00000254870.2	G	NM_052917		154806880	+1	no_errors	NM_052917	genbank	human	validated	54_36p	missense	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158622341	158622341	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:158622341C>G	ENST00000368147.4	-	23	3471	c.3291G>C	c.(3289-3291)tgG>tgC	p.W1097C		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1097					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCTCTTGAATCCATTCCAGCA	0.448																																																0			1											149.0	138.0	142.0					1																	158622341		1917	4125	6042	156888965	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3291G>C	1.37:g.158622341C>G	ENSP00000357129:p.Trp1097Cys	Somatic		Capture	Illumina GAIIx	4	156888965	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_EF-hand,HMMPfam_efhand_Ca_insen	p.W1097C	ENST00000368147.4	37	c.3291	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.929687	0.73327	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.70749	-0.51;-0.51	5.21	5.21	0.72293	.	0.000000	0.30410	N	0.009696	D	0.83478	0.5263	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85394	0.1127	10	0.87932	D	0	.	17.5012	0.87732	0.0:1.0:0.0:0.0	.	1097	P02549	SPTA1_HUMAN	C	1097	ENSP00000357130:W1097C;ENSP00000357129:W1097C	ENSP00000357129:W1097C	W	-	3	0	SPTA1	156888965	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	6.621000	0.74228	2.722000	0.93159	0.591000	0.81541	TGG	-	HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_Spectrin repeat		0.448	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	C	NM_003126		156888965	-1	no_errors	NM_003126	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
USP21	27005	genome.wustl.edu	37	1	161134407	161134407	+	Intron	SNP	C	C	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:161134407C>G	ENST00000289865.8	+	10	1605				PPOX_ENST00000352210.5_5'Flank|PPOX_ENST00000535223.1_5'Flank|USP21_ENST00000368001.1_Intron|PPOX_ENST00000367999.4_5'Flank|PPOX_ENST00000544598.1_5'Flank|USP21_ENST00000368002.3_Intron|USP21_ENST00000493054.1_Intron|PPOX_ENST00000432542.2_5'Flank	NM_012475.4	NP_036607.3	Q9UK80	UBP21_HUMAN	ubiquitin specific peptidase 21						histone deubiquitination (GO:0016578)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)|metal ion binding (GO:0046872)|NEDD8-specific protease activity (GO:0019784)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|prostate(3)	29	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TGCTCCATATCCTAATCTTCA	0.418																																																0			1											88.0	81.0	83.0					1																	161134407		2203	4300	6503	159401031	SO:0001627	intron_variant	27005			AF177758	CCDS30920.1	1q22	2008-04-11	2005-08-08		ENSG00000143258	ENSG00000143258		"""Ubiquitin-specific peptidases"""	12620	protein-coding gene	gene with protein product		604729	"""ubiquitin specific protease 21"""	USP23		12838346, 10799498	Standard	XM_006711273		Approved	USP16	uc010pkd.2	Q9UK80	OTTHUMG00000033154	ENST00000289865.8:c.1384+5C>G	1.37:g.161134407C>G		Somatic		Capture	Illumina GAIIx	4	159401031	Q59H60|Q5BKT5|Q5VTW9|Q5VTX0|Q9BTV1|Q9HBS2|Q9NYN4	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.I463M	ENST00000289865.8	37	c.1389	CCDS30920.1	1																																																																																			-	superfamily_Cysteine proteinases,HMMPfam_UCH		0.418	USP21-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	USP21	protein_coding	OTTHUMT00000080801.1	C			159401031	+1	no_errors	ENST00000289865	ensembl	human	known	54_36p	missense	SNP	1.000	G
SELP	6403	genome.wustl.edu	37	1	169572292	169572292	+	Silent	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:169572292G>A	ENST00000263686.6	-	10	1714	c.1677C>T	c.(1675-1677)cgC>cgT	p.R559R	SELP_ENST00000367788.2_Silent_p.R497R|SELP_ENST00000367793.2_Silent_p.R497R|SELP_ENST00000367786.2_Silent_p.R497R|SELP_ENST00000367791.2_Silent_p.R435R|SELP_ENST00000367792.2_Intron|SELP_ENST00000458599.2_Intron|SELP_ENST00000367794.2_Silent_p.R497R	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	559	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	AGTCTGTCCAGCGTCCCGATC	0.443																																																0			1											101.0	93.0	96.0					1																	169572292		2203	4300	6503	167838916	SO:0001819	synonymous_variant	6403			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.1677C>T	1.37:g.169572292G>A		Somatic		Capture	Illumina GAIIx	4	167838916	Q5R344|Q8IVD1	Silent	SNP	HMMSmart_SM00034,superfamily_C-type lectin-like,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1,superfamily_EGF/Laminin,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.R559	ENST00000263686.6	37	c.1677	CCDS1282.1	1																																																																																			-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.443	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	protein_coding	OTTHUMT00000083916.4	G	NM_003005		167838916	-1	no_errors	NM_003005	genbank	human	reviewed	54_36p	silent	SNP	0.932	A
STC2	8614	genome.wustl.edu	37	5	172750418	172750418	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr5:172750418T>C	ENST00000265087.4	-	3	1619	c.310A>G	c.(310-312)Aaa>Gaa	p.K104E	STC2_ENST00000520593.1_5'UTR	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	104					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AAGGCGTCTTTGATGAATGAC	0.567																																																0			5											29.0	25.0	26.0					5																	172750418		2203	4300	6503	172683024	SO:0001583	missense	8614			AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.310A>G	5.37:g.172750418T>C	ENSP00000265087:p.Lys104Glu	Somatic		Capture	Illumina GAIIx	4	172683024		Missense_Mutation	SNP	HMMPfam_Stanniocalcin	p.K104E	ENST00000265087.4	37	c.310	CCDS4388.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.5|26.5	4.748085|4.748085	0.89663|0.89663	.|.	.|.	ENSG00000113739|ENSG00000113739	ENST00000265087;ENST00000518455|ENST00000520648	.|.	.|.	.|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76870|0.76870	0.4048|0.4048	M|M	0.79926|0.79926	2.475|2.475	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.67145|.	0.996|.	D|.	0.67900|.	0.954|.	T|T	0.78548|0.78548	-0.2162|-0.2162	9|5	0.72032|.	D|.	0.01|.	-23.0401|-23.0401	15.4834|15.4834	0.75545|0.75545	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	104|.	O76061|.	STC2_HUMAN|.	E|R	104;19|57	.|.	ENSP00000265087:K104E|.	K|Q	-|-	1|2	0|0	STC2|STC2	172683024|172683024	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.778000|0.778000	0.44026|0.44026	7.698000|7.698000	0.84413|0.84413	2.064000|2.064000	0.61679|0.61679	0.533000|0.533000	0.62120|0.62120	AAA|CAA	-	HMMPfam_Stanniocalcin		0.567	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STC2	protein_coding	OTTHUMT00000252965.1	T	NM_003714		172683024	-1	no_errors	NM_003714	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CFH	3075	genome.wustl.edu	37	1	196709865	196709865	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:196709865G>T	ENST00000367429.4	+	18	3139	c.2899G>T	c.(2899-2901)Ggg>Tgg	p.G967W		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	967	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TGGAATTGATGGGCCTGCAAT	0.363																																																0			1											149.0	140.0	143.0					1																	196709865		2203	4300	6503	194976488	SO:0001583	missense	3075			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2899G>T	1.37:g.196709865G>T	ENSP00000356399:p.Gly967Trp	Somatic		Capture	Illumina GAIIx	4	194976488	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.G967W	ENST00000367429.4	37	c.2899	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	.	14.58	2.577279	0.45902	.	.	ENSG00000000971	ENST00000367429	T	0.73469	-0.75	6.16	6.16	0.99307	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.92143	0.7509	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94488	0.7699	9	0.87932	D	0	.	16.3599	0.83257	0.0:0.0:1.0:0.0	.	967	P08603	CFAH_HUMAN	W	967	ENSP00000356399:G967W	ENSP00000356399:G967W	G	+	1	0	CFH	194976488	0.998000	0.40836	0.262000	0.24481	0.012000	0.07955	4.617000	0.61204	2.937000	0.99478	0.650000	0.86243	GGG	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.363	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	protein_coding	OTTHUMT00000086412.2	G	NM_000186		194976488	+1	no_errors	NM_000186	genbank	human	reviewed	54_36p	missense	SNP	0.827	T
SLC26A9	115019	genome.wustl.edu	37	1	205897033	205897033	+	Silent	SNP	G	G	A			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:205897033G>A	ENST00000367135.3	-	9	1211	c.1098C>T	c.(1096-1098)aaC>aaT	p.N366N	SLC26A9_ENST00000367134.2_Silent_p.N366N|SLC26A9_ENST00000340781.4_Silent_p.N366N	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	366					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			GAGCTACCTGGTTCGAATCCA	0.602																																																0			1											116.0	100.0	106.0					1																	205897033		2203	4300	6503	204163656	SO:0001819	synonymous_variant	115019			AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1098C>T	1.37:g.205897033G>A		Somatic		Capture	Illumina GAIIx	4	204163656	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Silent	SNP	HMMPfam_Sulfate_transp,superfamily_STAS,HMMPfam_STAS	p.N366	ENST00000367135.3	37	c.1098	CCDS30990.1	1																																																																																			-	HMMPfam_Sulfate_transp		0.602	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	protein_coding	OTTHUMT00000087742.1	G	NM_052934		204163656	-1	no_errors	NM_134325	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
MDH1B	130752	genome.wustl.edu	37	2	207622016	207622016	+	Missense_Mutation	SNP	C	C	T	rs374638364		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr2:207622016C>T	ENST00000374412.3	-	3	490	c.215G>A	c.(214-216)cGt>cAt	p.R72H	MDH1B_ENST00000449792.1_De_novo_Start_OutOfFrame|MDH1B_ENST00000392214.2_Missense_Mutation_p.R72H|MDH1B_ENST00000454776.2_Missense_Mutation_p.R72H	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	72					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		CTTTCCTCCACGATCCAACAG	0.388																																					Pancreas(76;29 1355 28675 37177 51207)											0			2						T	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	125.0	123.0	123.0		215	5.0	1.0	2		123	0,8600		0,0,4300	no	missense	MDH1B	NM_001039845.1	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	72/519	207622016	1,13005	2203	4300	6503	207330261	SO:0001583	missense	130752				CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.215G>A	2.37:g.207622016C>T	ENSP00000363533:p.Arg72His	Somatic		Capture	Illumina GAIIx	4	207330261	A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	superfamily_NAD(P)-binding Rossmann-fold domains,superfamily_LDH C-terminal domain-like	p.R72H	ENST00000374412.3	37	c.215	CCDS33365.1	2	.	.	.	.	.	.	.	.	.	.	c	22.0	4.228269	0.79576	2.27E-4	0.0	ENSG00000138400	ENST00000374412;ENST00000454776;ENST00000392214	T;T;T	0.61040	0.14;0.14;0.14	5.84	4.97	0.65823	.	0.112129	0.64402	N	0.000007	T	0.76898	0.4052	M	0.81497	2.545	0.34038	D	0.654688	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.98	D	0.86099	0.1555	10	0.87932	D	0	-15.1723	15.2034	0.73159	0.0:0.9328:0.0:0.0672	.	72;72	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	H	72	ENSP00000363533:R72H;ENSP00000389916:R72H;ENSP00000376049:R72H	ENSP00000363533:R72H	R	-	2	0	MDH1B	207330261	1.000000	0.71417	0.998000	0.56505	0.877000	0.50540	3.405000	0.52630	1.506000	0.48736	-0.119000	0.15052	CGT	-	NULL		0.388	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDH1B	protein_coding	OTTHUMT00000256429.2	C	NM_001039845		207330261	-1	no_errors	NM_001039845	genbank	human	validated	54_36p	missense	SNP	1.000	T
SUSD4	55061	genome.wustl.edu	37	1	223441997	223441997	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:223441997C>T	ENST00000343846.3	-	3	1015	c.382G>A	c.(382-384)Gaa>Aaa	p.E128K	SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000344029.6_Missense_Mutation_p.E128K|SUSD4_ENST00000366878.4_Missense_Mutation_p.E128K|SUSD4_ENST00000484758.2_Missense_Mutation_p.E57K|SUSD4_ENST00000494793.2_Missense_Mutation_p.E128K			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	128	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		TCAGCATCTTCGATTTGAGGG	0.383																																																0			1											185.0	159.0	168.0					1																	223441997		2203	4300	6503	221508620	SO:0001583	missense	55061			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.382G>A	1.37:g.223441997C>T	ENSP00000344219:p.Glu128Lys	Somatic		Capture	Illumina GAIIx	4	221508620	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.E128K	ENST00000343846.3	37	c.382	CCDS41471.1	1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186341	0.78789	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000271787;ENST00000344029	T;T;T	0.63913	-0.07;-0.07;-0.07	5.91	5.91	0.95273	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.49916	D	0.000140	T	0.73442	0.3587	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.91635	0.999;0.98;0.998	T	0.73569	-0.3941	10	0.59425	D	0.04	-24.9472	19.2811	0.94053	0.0:1.0:0.0:0.0	.	57;128;128	B7Z369;Q5VX71-3;Q5VX71	.;.;SUSD4_HUMAN	K	128;128;57;128;128	ENSP00000344219:E128K;ENSP00000355843:E128K;ENSP00000339926:E128K	ENSP00000271787:E128K	E	-	1	0	SUSD4	221508620	1.000000	0.71417	0.965000	0.40720	0.982000	0.71751	5.924000	0.70054	2.802000	0.96397	0.650000	0.86243	GAA	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.383	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	protein_coding	OTTHUMT00000092592.2	C	NM_017982		221508620	-1	no_errors	NM_017982	genbank	human	validated	54_36p	missense	SNP	0.983	T
SUSD4	55061	genome.wustl.edu	37	1	223465980	223465980	+	Silent	SNP	A	A	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:223465980A>G	ENST00000343846.3	-	2	795	c.162T>C	c.(160-162)ctT>ctC	p.L54L	SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000454695.2_5'UTR|SUSD4_ENST00000344029.6_Silent_p.L54L|SUSD4_ENST00000366878.4_Silent_p.L54L|SUSD4_ENST00000484758.2_Intron|SUSD4_ENST00000494793.2_Silent_p.L54L			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	54						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		CACACACTTGAAGGTCATCGA	0.517																																																0			1											54.0	60.0	58.0					1																	223465980		2203	4300	6503	221532603	SO:0001819	synonymous_variant	55061			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.162T>C	1.37:g.223465980A>G		Somatic		Capture	Illumina GAIIx	4	221532603	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Silent	SNP	HMMPfam_Sushi,HMMSmart_SM00032,superfamily_Complement control module/SCR domain	p.L54	ENST00000343846.3	37	c.162	CCDS41471.1	1																																																																																			-	superfamily_Complement control module/SCR domain		0.517	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	protein_coding	OTTHUMT00000092592.2	A	NM_017982		221532603	-1	no_errors	NM_017982	genbank	human	validated	54_36p	silent	SNP	0.011	G
CDC42BPA	8476	genome.wustl.edu	37	1	227261714	227261714	+	Splice_Site	SNP	C	C	G			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr1:227261714C>G	ENST00000366769.3	-	19	3878		c.e19-1		CDC42BPA_ENST00000488131.1_Splice_Site|CDC42BPA_ENST00000366764.2_Splice_Site|CDC42BPA_ENST00000366766.2_Splice_Site|CDC42BPA_ENST00000535525.1_Splice_Site|CDC42BPA_ENST00000366767.3_Splice_Site|CDC42BPA_ENST00000366765.3_Splice_Site|CDC42BPA_ENST00000334218.5_Splice_Site	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				AGGGCATATCCTATGAAATAA	0.378																																																0			1											121.0	120.0	120.0					1																	227261714		2203	4300	6503	225328337	SO:0001630	splice_region_variant	8476			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2587-1G>C	1.37:g.227261714C>G		Somatic		Capture	Illumina GAIIx	4	225328337		Splice_Site	SNP	-	e19-1	ENST00000366769.3	37	c.2587-1	CCDS1558.1	1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353069	0.82132	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000448940;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000442054;ENST00000535525;ENST00000366765;ENST00000441725	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8411	0.96685	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDC42BPA	225328337	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.378000	0.79679	2.683000	0.91414	0.655000	0.94253	.	-	-		0.378	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	protein_coding	OTTHUMT00000091696.1	C	NM_014826	Intron	225328337	-1	no_errors	NM_003607	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	G
PLEKHA7	144100	genome.wustl.edu	37	11	16823221	16823222	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr11:16823221_16823222delCT	ENST00000355661.3	-	16	2310_2311	c.2300_2301delAG	c.(2299-2301)gagfs	p.E767fs	PLEKHA7_ENST00000448080.2_Frame_Shift_Del_p.E767fs|PLEKHA7_ENST00000531066.1_Frame_Shift_Del_p.E767fs|PLEKHA7_ENST00000532079.1_Intron			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	767					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						GCACAGTGGACTCTCTGGAGAG	0.579																																																0			11																																								16779798	SO:0001589	frameshift_variant	144100			BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.2300_2301delAG	11.37:g.16823225_16823226delCT	ENSP00000347883:p.Glu767fs	Somatic		Capture	Illumina GAIIx	4	16779797	B4DK33|B4DWC3|Q86VZ7	Frame_Shift_Del	DEL	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.E767fs	ENST00000355661.3	37	c.2301_2300	CCDS31434.1	11																																																																																			(deletion:cds_exon[16779791,16779940])	NULL		0.579	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA7	protein_coding	OTTHUMT00000387242.2	CT	NM_175058		16779798	-1	no_errors	NM_175058	genbank	human	provisional	54_36p	frame_shift_del	DEL	0.966:1.000	-
RAB11FIP5	26056	genome.wustl.edu	37	2	73308224	73308229	+	Intron	DEL	TCCTCC	TCCTCC	-	rs376882769|rs72344675|rs562207853		TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	TCCTCC	TCCTCC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr2:73308224_73308229delTCCTCC	ENST00000258098.6	-	4	1809				RAB11FIP5_ENST00000493523.2_Intron	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)						cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						TCCCAcctcttcctcctcctcctcct	0.704																																																0			2																																								73161737	SO:0001627	intron_variant	26056			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.1569-4914GGAGGA>-	2.37:g.73308230_73308235delTCCTCC		Somatic		Capture	Illumina GAIIx	4	73161732	O94939|Q9P0M1	In_Frame_Del	DEL	PatternScan_ENOYL_COA_HYDRATASE,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,HMMPfam_RBD-FIP	p.GG713in_frame_del	ENST00000258098.6	37	c.2142_2137	CCDS1923.1	2																																																																																			(deletion:cds_exon[73160287,73162299])	NULL		0.704	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP5	protein_coding	OTTHUMT00000251995.1	TCCTCC	NM_015470		73161737	-1	no_start_codon	ENST00000389508	ensembl	human	known	54_36p	in_frame_del	DEL	0.207:0.212:0.205:0.113:0.056:0.011	-
TRIML1	339976	genome.wustl.edu	37	4	189068438	189068438	+	Frame_Shift_Del	DEL	C	C	-			TCGA-29-1703-01A-01W-0633-09	TCGA-29-1703-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	46e36fef-5bf6-467c-983d-2fc7396297a1	f13cee08-0d13-4bad-812c-cf44de94e731	g.chr4:189068438delC	ENST00000332517.3	+	6	1459	c.1319delC	c.(1318-1320)gccfs	p.A440fs	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	440	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		TTCCAAGAGGCCCTCAGGCCT	0.542																																					Melanoma(31;213 1036 16579 23968 32372)											0			4											82.0	83.0	83.0					4																	189068438		2203	4300	6503	189305432	SO:0001589	frameshift_variant	339976			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.1319delC	4.37:g.189068438delC	ENSP00000327738:p.Ala440fs	Somatic		Capture	Illumina GAIIx	4	189305432	Q96BE5	Frame_Shift_Del	DEL	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMSmart_PRY,HMMPfam_SPRY,HMMSmart_SPRY	p.L441fs	ENST00000332517.3	37	c.1319	CCDS3851.1	4																																																																																			(deletion:cds_exon[189304970,189305520])	HMMPfam_SPRY,HMMSmart_SPRY		0.542	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIML1	protein_coding	OTTHUMT00000359813.1	C	NM_178556		189305432	+1	no_errors	NM_178556	genbank	human	provisional	54_36p	frame_shift_del	DEL	0.003	-
