#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SDK1	221935	genome.wustl.edu	37	7	3990602	3990602	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr7:3990602C>A	ENST00000404826.2	+	6	1034	c.895C>A	c.(895-897)Ccg>Acg	p.P299T	SDK1_ENST00000389531.3_Missense_Mutation_p.P299T	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	299	Ig-like C2-type 3.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TGTGGTTCCCCCGGGCAACAG	0.532																																																0			7											103.0	79.0	87.0					7																	3990602		2203	4300	6503	3957128	SO:0001583	missense	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.895C>A	7.37:g.3990602C>A	ENSP00000385899:p.Pro299Thr	Somatic		Capture	Illumina GAIIx	4	3957128	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_I-set,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.P299T	ENST00000404826.2	37	c.895	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	20.3	3.959055	0.74016	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.34667	1.35;1.35	5.51	5.51	0.81932	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	T	0.66458	0.2791	M	0.86953	2.85	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.70824	-0.4767	10	0.54805	T	0.06	.	17.5848	0.87978	0.0:1.0:0.0:0.0	.	299	Q7Z5N4	SDK1_HUMAN	T	299	ENSP00000385899:P299T;ENSP00000374182:P299T	ENSP00000374182:P299T	P	+	1	0	SDK1	3957128	0.997000	0.39634	0.933000	0.37362	0.852000	0.48524	5.306000	0.65756	2.574000	0.86865	0.655000	0.94253	CCG	-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.532	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	protein_coding	OTTHUMT00000323702.1	C	NM_152744		3957128	+1	no_errors	NM_152744	genbank	human	validated	54_36p	missense	SNP	0.997	A
C17orf74	201243	genome.wustl.edu	37	17	7329550	7329550	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr17:7329550C>G	ENST00000333870.3	+	3	314	c.240C>G	c.(238-240)gaC>gaG	p.D80E	C17orf74_ENST00000574034.1_Intron|RP11-104H15.7_ENST00000575310.1_RNA	NM_175734.4	NP_783861.3	Q0P670	CQ074_HUMAN	chromosome 17 open reading frame 74	80						integral component of membrane (GO:0016021)				cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	22		Prostate(122;0.157)				GTCCCCCAGACAAGGCTCAGG	0.547																																																0			17											94.0	94.0	94.0					17																	7329550		2008	4174	6182	7270274	SO:0001583	missense	201243			BC044816	CCDS42255.1	17p13.1	2012-05-30			ENSG00000184560	ENSG00000184560			27315	protein-coding gene	gene with protein product						12477932	Standard	NM_175734		Approved		uc002ggw.3	Q0P670	OTTHUMG00000178190	ENST00000333870.3:c.240C>G	17.37:g.7329550C>G	ENSP00000328061:p.Asp80Glu	Somatic		Capture	Illumina GAIIx	4	7270274		Missense_Mutation	SNP	NULL	p.D80E	ENST00000333870.3	37	c.240	CCDS42255.1	17	.	.	.	.	.	.	.	.	.	.	C	0.156	-1.086279	0.01873	.	.	ENSG00000184560	ENST00000333870	T	0.47177	0.85	2.86	1.73	0.24493	.	0.519385	0.15847	N	0.241739	T	0.21674	0.0522	N	0.14661	0.345	0.09310	N	1	B	0.21071	0.051	B	0.17098	0.017	T	0.28364	-1.0046	10	0.02654	T	1	-10.6272	6.2894	0.21051	0.2959:0.7041:0.0:0.0	.	80	Q0P670	CQ074_HUMAN	E	80	ENSP00000328061:D80E	ENSP00000328061:D80E	D	+	3	2	C17orf74	7270274	0.633000	0.27181	0.373000	0.26003	0.066000	0.16364	1.841000	0.39240	1.607000	0.50170	0.491000	0.48974	GAC	-	NULL		0.547	C17orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf74	protein_coding	OTTHUMT00000440933.2	C	NM_175734		7270274	+1	no_errors	NM_175734	genbank	human	validated	54_36p	missense	SNP	0.000	G
TP53	7157	genome.wustl.edu	37	17	7577551	7577551	+	Missense_Mutation	SNP	C	C	T	rs397516437		TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr17:7577551C>T	ENST00000269305.4	-	7	919	c.730G>A	c.(730-732)Ggc>Agc	p.G244S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.G244S|TP53_ENST00000445888.2_Missense_Mutation_p.G244S|TP53_ENST00000359597.4_Missense_Mutation_p.G244S|TP53_ENST00000413465.2_Missense_Mutation_p.G244S|TP53_ENST00000455263.2_Missense_Mutation_p.G244S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	244	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934572).|G -> E (in a sporadic cancer; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G244C(45)|p.G244S(38)|p.0?(8)|p.G244R(6)|p.?(5)|p.G244fs*3(4)|p.G151C(4)|p.G244fs*4(3)|p.M243_G244>IC(1)|p.G244fs*19(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.G151S(1)|p.G151fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.G151R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCATGCCGCCCATGCAGGAA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	125	Substitution - Missense(95)|Deletion - Frameshift(8)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(4)|Deletion - In frame(3)|Complex - deletion inframe(1)|Complex - compound substitution(1)	lung(23)|upper_aerodigestive_tract(11)|large_intestine(10)|liver(10)|stomach(9)|endometrium(8)|oesophagus(8)|kidney(7)|breast(7)|biliary_tract(6)|urinary_tract(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|bone(4)|central_nervous_system(3)|skin(2)|adrenal_gland(1)|soft_tissue(1)|pancreas(1)|prostate(1)	17											147.0	111.0	123.0					17																	7577551		2203	4300	6503	7518276	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.730G>A	17.37:g.7577551C>T	ENSP00000269305:p.Gly244Ser	Somatic		Capture	Illumina GAIIx	4	7518276	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.G244S	ENST00000269305.4	37	c.730	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.204381	0.95033	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.995;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.946;1.0;1.0;1.0;1.0	D	0.96039	0.9023	10	0.87932	D	0	-29.0146	15.3618	0.74483	0.0:1.0:0.0:0.0	.	244;244;151;244;244;244	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	244;244;244;244;244;244;233;151;112;151	ENSP00000410739:G244S;ENSP00000352610:G244S;ENSP00000269305:G244S;ENSP00000398846:G244S;ENSP00000391127:G244S;ENSP00000391478:G244S;ENSP00000425104:G112S;ENSP00000423862:G151S	ENSP00000269305:G244S	G	-	1	0	TP53	7518276	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	-	HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7518276	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9047206	9047206	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr19:9047206G>C	ENST00000397910.4	-	5	34628	c.34425C>G	c.(34423-34425)ttC>ttG	p.F11475L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11477	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TCAGTGTTGGGAAAGTTGTAG	0.507																																																0			19											174.0	169.0	170.0					19																	9047206		2038	4197	6235	8908206	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34425C>G	19.37:g.9047206G>C	ENSP00000381008:p.Phe11475Leu	Somatic		Capture	Illumina GAIIx	4	8908206	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	PatternScan_ATPASE_ALPHA_BETA,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.F11475L	ENST00000397910.4	37	c.34425	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	5.509	0.278917	0.10458	.	.	ENSG00000181143	ENST00000397910	T	0.03124	4.04	2.05	0.995	0.19838	.	.	.	.	.	T	0.04272	0.0118	L	0.38175	1.15	.	.	.	B	0.31730	0.337	B	0.39379	0.298	T	0.31916	-0.9926	8	0.87932	D	0	.	3.5662	0.07900	0.7741:0.0:0.2259:0.0	.	11475	B5ME49	.	L	11475	ENSP00000381008:F11475L	ENSP00000381008:F11475L	F	-	3	2	MUC16	8908206	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	-0.345000	0.07770	0.239000	0.21243	-0.382000	0.06688	TTC	-	NULL		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690		8908206	-1	no_errors	NM_024690	genbank	human	validated	54_36p	missense	SNP	0.000	C
JAG1	182	genome.wustl.edu	37	20	10620363	10620363	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr20:10620363G>C	ENST00000254958.5	-	26	3955	c.3440C>G	c.(3439-3441)tCt>tGt	p.S1147C	JAG1_ENST00000423891.2_Missense_Mutation_p.S988C	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	1147					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						CCTTATTTTAGACATTTTGGA	0.493									Alagille Syndrome																																							0			20											160.0	160.0	160.0					20																	10620363		2203	4300	6503	10568363	SO:0001583	missense	182	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.3440C>G	20.37:g.10620363G>C	ENSP00000254958:p.Ser1147Cys	Somatic		Capture	Illumina GAIIx	4	10568363	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	HMMPfam_MNNL,HMMPfam_DSL,HMMSmart_DSL,HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_EGF_CA,HMMPfam_EGF,superfamily_SSF57196,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,HMMSmart_VWC	p.S1147C	ENST00000254958.5	37	c.3440	CCDS13112.1	20	.	.	.	.	.	.	.	.	.	.	G	13.75	2.331295	0.41297	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.86432	-2.1;-2.12	5.52	5.52	0.82312	.	0.050061	0.85682	D	0.000000	D	0.83344	0.5234	N	0.14661	0.345	0.54753	D	0.999989	B	0.32543	0.375	B	0.41299	0.353	T	0.82750	-0.0303	10	0.52906	T	0.07	.	19.8041	0.96521	0.0:0.0:1.0:0.0	.	1147	P78504	JAG1_HUMAN	C	1147;988	ENSP00000254958:S1147C;ENSP00000389519:S988C	ENSP00000254958:S1147C	S	-	2	0	JAG1	10568363	1.000000	0.71417	0.969000	0.41365	0.990000	0.78478	9.420000	0.97426	2.756000	0.94617	0.563000	0.77884	TCT	-	NULL		0.493	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG1	protein_coding		G	NM_000214		10568363	-1	no_errors	NM_000214	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
SAMSN1	64092	genome.wustl.edu	37	21	15872915	15872915	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr21:15872915T>G	ENST00000400566.1	-	6	784	c.703A>C	c.(703-705)Aac>Cac	p.N235H	SAMSN1_ENST00000285670.2_Missense_Mutation_p.N303H|SAMSN1_ENST00000400564.1_Missense_Mutation_p.N67H|SAMSN1_ENST00000463807.1_5'UTR	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	235					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		CTCCTTCGGTTTGCCTTTATT	0.423																																																0			21											155.0	140.0	144.0					21																	15872915		1837	4081	5918	14794786	SO:0001583	missense	64092			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.703A>C	21.37:g.15872915T>G	ENSP00000383411:p.Asn235His	Somatic		Capture	Illumina GAIIx	4	14794786	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_2	p.N235H	ENST00000400566.1	37	c.703	CCDS42906.1	21	.	.	.	.	.	.	.	.	.	.	T	0.390	-0.923782	0.02377	.	.	ENSG00000155307	ENST00000285670;ENST00000400566;ENST00000400564	T;T	0.42513	0.99;0.97	5.63	3.81	0.43845	Src homology-3 domain (1);Sterile alpha motif/pointed domain (1);	0.945927	0.09010	N	0.861687	T	0.11324	0.0276	N	0.00308	-1.67	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.21449	-1.0245	10	0.05436	T	0.98	-0.2001	8.3562	0.32331	0.0709:0.0:0.641:0.288	.	67;303;235	Q9NSI8-2;F8WAA1;Q9NSI8	.;.;SAMN1_HUMAN	H	303;235;67	ENSP00000285670:N303H;ENSP00000383411:N235H	ENSP00000285670:N303H	N	-	1	0	SAMSN1	14794786	0.320000	0.24616	0.016000	0.15963	0.065000	0.16274	3.016000	0.49607	0.728000	0.32382	-0.219000	0.12488	AAC	-	superfamily_SAM/Pointed domain		0.423	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMSN1	protein_coding	OTTHUMT00000157914.1	T			14794786	-1	no_errors	NM_022136	genbank	human	validated	54_36p	missense	SNP	0.020	G
ACSM2A	123876	genome.wustl.edu	37	16	20494411	20494411	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr16:20494411A>T	ENST00000573854.1	+	13	1655	c.1541A>T	c.(1540-1542)cAg>cTg	p.Q514L	ACSM2A_ENST00000536134.1_Missense_Mutation_p.Q286L|ACSM2A_ENST00000219054.6_Missense_Mutation_p.Q514L|ACSM2A_ENST00000575690.1_Missense_Mutation_p.Q514L|ACSM2A_ENST00000396104.2_Missense_Mutation_p.Q514L|ACSM2A_ENST00000417235.2_Missense_Mutation_p.Q435L	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	514					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						CTGGCCTCGCAGTTCCTGTCC	0.498																																																0			16											198.0	177.0	184.0					16																	20494411		2203	4300	6503	20401912	SO:0001583	missense	123876			AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1541A>T	16.37:g.20494411A>T	ENSP00000459451:p.Gln514Leu	Somatic		Capture	Illumina GAIIx	4	20401912	B3KTT9|O75202	Missense_Mutation	SNP	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding,PatternScan_AMP_BINDING	p.Q514L	ENST00000573854.1	37	c.1541	CCDS32401.1	16	.	.	.	.	.	.	.	.	.	.	A	9.369	1.070118	0.20147	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	3.26	2.0	0.26442	.	1.118710	0.06804	N	0.789235	T	0.36826	0.0981	L	0.37697	1.125	0.09310	N	0.999999	B	0.12013	0.005	B	0.08055	0.003	T	0.34004	-0.9846	10	0.66056	D	0.02	-1.0929	5.0371	0.14440	0.4337:0.4431:0.1233:0.0	.	514	Q08AH3	ACS2A_HUMAN	L	435;514;286;514	ENSP00000392169:Q435L;ENSP00000219054:Q514L;ENSP00000445082:Q286L;ENSP00000379411:Q514L	ENSP00000219054:Q514L	Q	+	2	0	ACSM2A	20401912	0.000000	0.05858	0.968000	0.41197	0.920000	0.55202	0.627000	0.24506	1.234000	0.43709	0.254000	0.18369	CAG	-	superfamily_Acetyl-CoA synthetase-like		0.498	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2A	protein_coding	OTTHUMT00000436764.1	A	NM_001010845		20401912	+1	no_errors	NM_001010845	genbank	human	validated	54_36p	missense	SNP	0.001	T
ZP2	7783	genome.wustl.edu	37	16	21218272	21218272	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr16:21218272T>A	ENST00000574002.1	-	6	852	c.370A>T	c.(370-372)Agt>Tgt	p.S124C	ZP2_ENST00000574091.1_Missense_Mutation_p.S124C|AF001550.7_ENST00000572747.1_RNA|ZP2_ENST00000219593.4_Missense_Mutation_p.S124C			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	124					binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		AAGGCAGCACTGTTGTTCATG	0.478																																																0			16											234.0	190.0	205.0					16																	21218272		2199	4300	6499	21125773	SO:0001583	missense	7783			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.370A>T	16.37:g.21218272T>A	ENSP00000460971:p.Ser124Cys	Somatic		Capture	Illumina GAIIx	4	21125773	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	HMMPfam_Zona_pellucida,HMMSmart_SM00241,PatternScan_ZP_1	p.S124C	ENST00000574002.1	37	c.370	CCDS10596.1	16	.	.	.	.	.	.	.	.	.	.	T	14.86	2.661968	0.47572	.	.	ENSG00000103310	ENST00000219593	T	0.32272	1.46	4.21	1.86	0.25419	.	1.245830	0.05242	N	0.512327	T	0.44540	0.1298	L	0.48642	1.525	0.09310	N	1	D;D;D	0.76494	0.999;0.991;0.991	D;P;P	0.65443	0.935;0.784;0.706	T	0.15178	-1.0446	10	0.72032	D	0.01	-1.939	4.1822	0.10381	0.0:0.1101:0.208:0.682	.	124;124;124	B4DEV1;Q4VAP1;Q05996	.;.;ZP2_HUMAN	C	124	ENSP00000219593:S124C	ENSP00000219593:S124C	S	-	1	0	ZP2	21125773	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.216000	0.17585	0.247000	0.21414	0.482000	0.46254	AGT	-	NULL		0.478	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	protein_coding	OTTHUMT00000207365.2	T			21125773	-1	no_errors	NM_003460	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
GSG1L	146395	genome.wustl.edu	37	16	27974490	27974490	+	Silent	SNP	C	C	A	rs189933895	byFrequency	TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr16:27974490C>A	ENST00000447459.2	-	2	468	c.384G>T	c.(382-384)ccG>ccT	p.P128P	GSG1L_ENST00000380898.2_5'UTR|GSG1L_ENST00000395724.3_Silent_p.P128P	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	128					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P128P(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						TCTCCGATGCCGGGGCCAGGT	0.542																																																1	Substitution - coding silent(1)	endometrium(1)	16											74.0	81.0	79.0					16																	27974490		2001	4165	6166	27881991	SO:0001819	synonymous_variant	146395			AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.384G>T	16.37:g.27974490C>A		Somatic		Capture	Illumina GAIIx	4	27881991	Q7Z6F8|Q8TB81	Silent	SNP	HMMPfam_GSG-1	p.P128	ENST00000447459.2	37	c.384	CCDS45450.1	16																																																																																			-	HMMPfam_GSG-1		0.542	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GSG1L	protein_coding	OTTHUMT00000433832.2	C	NM_144675		27881991	-1	no_errors	NM_001109763	genbank	human	validated	54_36p	silent	SNP	0.984	A
SLFN12	55106	genome.wustl.edu	37	17	33738675	33738675	+	Silent	SNP	A	A	G			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr17:33738675A>G	ENST00000394562.1	-	6	1942	c.1419T>C	c.(1417-1419)acT>acC	p.T473T	RP11-686D22.8_ENST00000587012.1_RNA|SLFN12_ENST00000460530.1_5'UTR|SLFN12_ENST00000304905.5_Silent_p.T473T|SLFN12_ENST00000452764.3_Silent_p.T473T			Q8IYM2	SLN12_HUMAN	schlafen family member 12	473							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGGTTAGGGCAGTTTGTGTAG	0.438																																																0			17											138.0	131.0	134.0					17																	33738675		2203	4300	6503	30762788	SO:0001819	synonymous_variant	55106			AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.1419T>C	17.37:g.33738675A>G		Somatic		Capture	Illumina GAIIx	4	30762788	A8K711|Q9NP47	Silent	SNP	HMMPfam_AAA_4	p.T473	ENST00000394562.1	37	c.1419	CCDS11295.1	17																																																																																			-	NULL		0.438	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLFN12	protein_coding	OTTHUMT00000256491.1	A	NM_018042		30762788	-1	no_errors	NM_018042	genbank	human	validated	54_36p	silent	SNP	0.137	G
CSMD2	114784	genome.wustl.edu	37	1	34401476	34401476	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr1:34401476G>T	ENST00000373381.4	-	4	773	c.597C>A	c.(595-597)gaC>gaA	p.D199E		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	159						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AGCGGACCTTGTCACCGAGGT	0.607																																																0			1											123.0	113.0	116.0					1																	34401476		2203	4300	6503	34174063	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.597C>A	1.37:g.34401476G>T	ENSP00000362479:p.Asp199Glu	Somatic		Capture	Illumina GAIIx	4	34174063	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,PatternScan_GLYCOSYL_HYDROL_F10,PatternScan_IG_MHC	p.D159E	ENST00000373381.4	37	c.477		1	.	.	.	.	.	.	.	.	.	.	G	16.09	3.025542	0.54683	.	.	ENSG00000121904	ENST00000373381	T	0.62941	-0.01	5.27	4.15	0.48705	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.54631	0.1870	L	0.56199	1.76	0.80722	D	1	B;B	0.23735	0.002;0.09	B;B	0.31191	0.029;0.125	T	0.46317	-0.9200	10	0.14656	T	0.56	.	10.3969	0.44207	0.1687:0.0:0.8313:0.0	.	159;199	Q7Z408;E7EUA6	CSMD2_HUMAN;.	E	199	ENSP00000362479:D199E	ENSP00000241312:D159E	D	-	3	2	CSMD2	34174063	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.467000	0.53078	2.439000	0.82584	0.563000	0.77884	GAC	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.607	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	protein_coding		G	NM_052896		34174063	-1	no_errors	NM_052896	genbank	human	validated	54_36p	missense	SNP	1.000	T
RNF38	152006	genome.wustl.edu	37	9	36353241	36353241	+	Missense_Mutation	SNP	G	G	C	rs145433267		TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr9:36353241G>C	ENST00000259605.6	-	7	1104	c.997C>G	c.(997-999)Cca>Gca	p.P333A	RNF38_ENST00000357058.3_Missense_Mutation_p.P250A|RNF38_ENST00000377877.4_Missense_Mutation_p.P257A|RNF38_ENST00000353739.4_Missense_Mutation_p.P283A|RNF38_ENST00000377885.2_Missense_Mutation_p.P250A|RNF38_ENST00000350199.4_Missense_Mutation_p.P250A	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	333	Pro-rich.				male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			GGTAATGTTGGGGGGTGGGCT	0.463																																																0			9						G	ALA/PRO,ALA/PRO,ALA/PRO,ALA/PRO,ALA/PRO	0,4406		0,0,2203	104.0	94.0	98.0		997,748,847,748,748	2.9	1.0	9	dbSNP_134	98	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense,missense,missense	RNF38	NM_022781.4,NM_194328.2,NM_194329.2,NM_194330.2,NM_194332.2	27,27,27,27,27	0,3,6500	CC,CG,GG		0.0349,0.0,0.0231	benign,benign,benign,benign,benign	333/516,250/433,283/466,250/433,250/433	36353241	3,13003	2203	4300	6503	36343241	SO:0001583	missense	152006				CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.997C>G	9.37:g.36353241G>C	ENSP00000259605:p.Pro333Ala	Somatic		Capture	Illumina GAIIx	4	36343241	A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4	p.P333A	ENST00000259605.6	37	c.997	CCDS6603.1	9	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.46	1.356464	0.24598	0.0	3.49E-4	ENSG00000137075	ENST00000259605;ENST00000353739;ENST00000377885;ENST00000357058;ENST00000350199;ENST00000377876;ENST00000377870;ENST00000377877	T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	5.84	2.93	0.34026	.	0.206471	0.51477	D	0.000085	T	0.47002	0.1422	N	0.14661	0.345	0.37810	D	0.928017	B;B;B	0.22909	0.077;0.0;0.002	B;B;B	0.19666	0.026;0.007;0.008	T	0.37079	-0.9721	10	0.36615	T	0.2	-1.7763	10.9736	0.47452	0.0:0.2625:0.6013:0.1361	.	257;283;333	B1AM81;Q9H0F5-2;Q9H0F5	.;.;RNF38_HUMAN	A	333;283;250;250;250;150;257;257	ENSP00000259605:P333A;ENSP00000335239:P283A;ENSP00000367117:P250A;ENSP00000349566:P250A;ENSP00000343947:P250A;ENSP00000367109:P257A	ENSP00000259605:P333A	P	-	1	0	RNF38	36343241	1.000000	0.71417	0.999000	0.59377	0.920000	0.55202	5.057000	0.64294	0.348000	0.23949	-0.266000	0.10368	CCA	-	NULL		0.463	RNF38-001	KNOWN	basic|CCDS	protein_coding	RNF38	protein_coding	OTTHUMT00000052422.3	G	NM_022781		36343241	-1	no_errors	NM_022781	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
KIF21A	55605	genome.wustl.edu	37	12	39760843	39760843	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr12:39760843G>T	ENST00000361418.5	-	5	739	c.724C>A	c.(724-726)Caa>Aaa	p.Q242K	KIF21A_ENST00000395670.3_Missense_Mutation_p.Q242K|KIF21A_ENST00000361961.3_Missense_Mutation_p.Q242K|KIF21A_ENST00000544797.2_Missense_Mutation_p.Q242K|KIF21A_ENST00000541463.2_Missense_Mutation_p.Q242K			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	242	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				GCATCTATTTGGGGACACACT	0.373																																																0			12											118.0	110.0	113.0					12																	39760843		2203	4300	6503	38047110	SO:0001583	missense	55605			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.724C>A	12.37:g.39760843G>T	ENSP00000354878:p.Gln242Lys	Somatic		Capture	Illumina GAIIx	4	38047110	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00129,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,superfamily_WD40 repeat-like,superfamily_Prefoldin,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.Q242K	ENST00000361418.5	37	c.724	CCDS53776.1	12	.	.	.	.	.	.	.	.	.	.	G	1.813	-0.474076	0.04414	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418;ENST00000541463;ENST00000552908	T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	5.33	4.35	0.52113	Kinesin, motor domain (4);	0.481093	0.17943	N	0.156780	T	0.57460	0.2055	N	0.20881	0.62	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.0;0.001;0.001;0.002;0.001	T	0.32613	-0.9900	10	0.13470	T	0.59	.	11.2374	0.48949	0.0:0.1163:0.6853:0.1984	.	242;242;242;242;242	F5H219;B9EGE4;F5H0C3;Q7Z4S6;Q7Z4S6-2	.;.;.;KI21A_HUMAN;.	K	242;242;242;242;242;242;65	ENSP00000354851:Q242K;ENSP00000379029:Q242K;ENSP00000445606:Q242K;ENSP00000354878:Q242K;ENSP00000438075:Q242K;ENSP00000449700:Q65K	ENSP00000344501:Q242K	Q	-	1	0	KIF21A	38047110	0.057000	0.20700	0.773000	0.31616	0.952000	0.60782	2.376000	0.44292	2.498000	0.84270	0.655000	0.94253	CAA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00129,HMMPfam_Kinesin		0.373	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	protein_coding	OTTHUMT00000403581.1	G	NM_017641		38047110	-1	no_errors	NM_017641	genbank	human	validated	54_36p	missense	SNP	0.481	T
DUOXA1	90527	genome.wustl.edu	37	15	45411477	45411477	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr15:45411477C>T	ENST00000560572.1	-	6	864	c.859G>A	c.(859-861)Gtg>Atg	p.V287M	DUOXA1_ENST00000559014.1_Missense_Mutation_p.V287M|DUOXA1_ENST00000430224.2_Missense_Mutation_p.V242M|DUOXA1_ENST00000267803.4_Missense_Mutation_p.V287M|DUOXA1_ENST00000558422.1_Missense_Mutation_p.V242M|DUOXA1_ENST00000558996.1_Missense_Mutation_p.V242M	NM_001276266.1	NP_001263195.1	Q1HG43	DOXA1_HUMAN	dual oxidase maturation factor 1	287					hydrogen peroxide metabolic process (GO:0042743)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(109;6.02e-08)|all_epithelial(112;1.83e-06)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.82e-18)|GBM - Glioblastoma multiforme(94;4.39e-07)|COAD - Colon adenocarcinoma(120;0.0676)|Colorectal(133;0.0686)		TCTTCATCCACACTCTGGTTG	0.612																																																0			15											51.0	47.0	48.0					15																	45411477		2198	4298	6496	43198769	SO:0001583	missense	90527			BC029819	CCDS10119.1, CCDS61619.1, CCDS61620.1, CCDS61621.1	15q21.1	2006-11-29	2006-01-23	2006-07-25	ENSG00000140254	ENSG00000140254			26507	protein-coding gene	gene with protein product		612771				16651268	Standard	NM_144565		Approved	FLJ32334, NUMBIP, NIP, mol	uc010bec.4	Q1HG43	OTTHUMG00000131352	ENST00000560572.1:c.859G>A	15.37:g.45411477C>T	ENSP00000454084:p.Val287Met	Somatic		Capture	Illumina GAIIx	4	43198769	Q8N6K9|Q96MI4	Missense_Mutation	SNP	HMMPfam_DuoxA	p.V287M	ENST00000560572.1	37	c.859		15	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123406	0.37436	.	.	ENSG00000140254	ENST00000267803;ENST00000430224	T;T	0.55760	0.5;0.5	5.31	-1.26	0.09376	.	1.778230	0.02588	N	0.099651	T	0.56529	0.1991	L	0.35854	1.095	0.09310	N	1	D;P;P;D	0.64830	0.994;0.915;0.915;0.991	P;P;P;P	0.61201	0.885;0.663;0.663;0.814	T	0.43523	-0.9386	10	0.42905	T	0.14	0.0981	4.1511	0.10238	0.4067:0.3689:0.0:0.2244	.	242;242;287;287	B5M0C0;B5M0B8;Q1HG43;A8K9Q6	.;.;DOXA1_HUMAN;.	M	287;242	ENSP00000267803:V287M;ENSP00000415512:V242M	ENSP00000267803:V287M	V	-	1	0	DUOXA1	43198769	0.000000	0.05858	0.001000	0.08648	0.326000	0.28443	0.118000	0.15605	-0.401000	0.07644	-0.136000	0.14681	GTG	-	HMMPfam_DuoxA		0.612	DUOXA1-005	KNOWN	basic|appris_principal	protein_coding	DUOXA1	protein_coding	OTTHUMT00000416242.1	C	NM_144565		43198769	-1	no_errors	NM_144565	genbank	human	provisional	54_36p	missense	SNP	0.032	T
PCIF1	63935	genome.wustl.edu	37	20	44574847	44574847	+	Silent	SNP	C	C	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr20:44574847C>T	ENST00000372409.3	+	14	1801	c.1437C>T	c.(1435-1437)ttC>ttT	p.F479F	PCIF1_ENST00000479348.1_3'UTR	NM_022104.3	NP_071387.1	Q9H4Z3	PCIF1_HUMAN	PDX1 C-terminal inhibiting factor 1	479					negative regulation of phosphatase activity (GO:0010923)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	20						AGATGATGTTCGGCGTGGGCC	0.657																																																0			20											79.0	77.0	78.0					20																	44574847		2203	4300	6503	44008254	SO:0001819	synonymous_variant	63935			AB050014	CCDS13388.1	20q13.12	2014-06-13	2008-04-29	2008-04-29	ENSG00000100982	ENSG00000100982			16200	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 121"""		"""chromosome 20 open reading frame 67"""	C20orf67		12565871, 15121856	Standard	NM_022104		Approved	bA465L10.1, PPP1R121	uc002xqs.3	Q9H4Z3	OTTHUMG00000032635	ENST00000372409.3:c.1437C>T	20.37:g.44574847C>T		Somatic		Capture	Illumina GAIIx	4	44008254	E1P5P1|Q54AB9|Q9NT85	Silent	SNP	PatternScan_WW_DOMAIN_1,superfamily_WW_Rsp5_WWP,HMMSmart_WW,HMMPfam_WW	p.F479	ENST00000372409.3	37	c.1437	CCDS13388.1	20																																																																																			-	NULL		0.657	PCIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCIF1	protein_coding	OTTHUMT00000079550.1	C	NM_022104		44008254	+1	no_errors	NM_022104	genbank	human	validated	54_36p	silent	SNP	0.994	T
PCED1B	91523	genome.wustl.edu	37	12	47472383	47472383	+	5'Flank	SNP	C	C	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr12:47472383C>T	ENST00000546455.1	+	0	0				AMIGO2_ENST00000550413.1_Missense_Mutation_p.A135T|AMIGO2_ENST00000321382.3_Missense_Mutation_p.A135T|AMIGO2_ENST00000429635.1_Missense_Mutation_p.A135T|AMIGO2_ENST00000266581.4_Missense_Mutation_p.A135T			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B								hydrolase activity (GO:0016787)										TGGAATACAGCATTTTTCACC	0.433																																																0			12											130.0	130.0	130.0					12																	47472383		2203	4300	6503	45758650	SO:0001631	upstream_gene_variant	347902			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617		12.37:g.47472383C>T	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	45758650	Q96B20	Missense_Mutation	SNP	HMMSmart_LRRNT,superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMSmart_LRRCT,superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig	p.A135T	ENST00000546455.1	37	c.403	CCDS8752.1	12	.	.	.	.	.	.	.	.	.	.	C	10.16	1.272681	0.23221	.	.	ENSG00000139211	ENST00000266581;ENST00000550413;ENST00000429635;ENST00000321382	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	4.83	3.85	0.44370	.	0.494238	0.22692	N	0.056813	T	0.34454	0.0898	N	0.12637	0.245	0.27649	N	0.947479	P	0.42584	0.784	B	0.43225	0.412	T	0.11203	-1.0597	10	0.16896	T	0.51	-12.4877	11.7845	0.52034	0.0:0.6606:0.3394:0.0	.	135	Q86SJ2	AMGO2_HUMAN	T	135	ENSP00000266581:A135T;ENSP00000449034:A135T;ENSP00000406020:A135T;ENSP00000320848:A135T	ENSP00000266581:A135T	A	-	1	0	AMIGO2	45758650	1.000000	0.71417	0.407000	0.26434	0.935000	0.57460	3.736000	0.55052	2.611000	0.88343	0.655000	0.94253	GCT	-	superfamily_SSF52058,HMMPfam_LRR_1		0.433	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMIGO2	protein_coding	OTTHUMT00000405079.1	C	NM_138371		45758650	-1	no_errors	NM_181847	genbank	human	validated	54_36p	missense	SNP	0.339	T
COL7A1	1294	genome.wustl.edu	37	3	48629339	48629339	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr3:48629339C>T	ENST00000328333.8	-	10	1456	c.1349G>A	c.(1348-1350)cGt>cAt	p.R450H	COL7A1_ENST00000454817.1_Missense_Mutation_p.R450H	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	450	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R450L(1)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACCAGTCTCACGCCGCCATTC	0.637																																																1	Substitution - Missense(1)	lung(1)	3											63.0	72.0	69.0					3																	48629339		2203	4300	6503	48604343	SO:0001583	missense	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.1349G>A	3.37:g.48629339C>T	ENSP00000332371:p.Arg450His	Somatic		Capture	Illumina GAIIx	4	48604343	Q14054|Q16507	Missense_Mutation	SNP	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III,HMMPfam_Collagen,superfamily_BPTI-like,HMMPfam_Kunitz_BPTI,PatternScan_BPTI_KUNITZ_1	p.R450H	ENST00000328333.8	37	c.1349	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	C	11.10	1.539551	0.27563	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.56941	0.43;0.43	4.76	3.85	0.44370	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.156131	0.29861	N	0.011007	T	0.61426	0.2346	L	0.51422	1.61	0.33661	D	0.609735	D	0.76494	0.999	D	0.67231	0.95	T	0.70876	-0.4753	10	0.66056	D	0.02	.	7.9498	0.30008	0.0:0.7512:0.1625:0.0863	.	450	Q02388	CO7A1_HUMAN	H	450	ENSP00000332371:R450H;ENSP00000412569:R450H	ENSP00000332371:R450H	R	-	2	0	COL7A1	48604343	0.995000	0.38212	1.000000	0.80357	0.911000	0.54048	1.247000	0.32815	1.072000	0.40860	0.462000	0.41574	CGT	-	HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III		0.637	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	protein_coding	OTTHUMT00000257519.1	C	NM_000094		48604343	-1	no_errors	NM_000094	genbank	human	reviewed	54_36p	missense	SNP	0.876	T
BIN2	51411	genome.wustl.edu	37	12	51692990	51692990	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr12:51692990T>C	ENST00000267012.4	-	7	660	c.599A>G	c.(598-600)aAt>aGt	p.N200S	BIN2_ENST00000604560.1_Missense_Mutation_p.N173S|BIN2_ENST00000452142.2_Missense_Mutation_p.N168S|BIN2_ENST00000544402.1_Missense_Mutation_p.N174S	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	200	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						TCATTACCTATTATAAAGAAT	0.398																																																0			12											95.0	91.0	92.0					12																	51692990		2203	4300	6503	49979257	SO:0001583	missense	51411			AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.599A>G	12.37:g.51692990T>C	ENSP00000267012:p.Asn200Ser	Somatic		Capture	Illumina GAIIx	4	49979257	Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	HMMSmart_SM00721,HMMPfam_BAR	p.N200S	ENST00000267012.4	37	c.599	CCDS8811.1	12	.	.	.	.	.	.	.	.	.	.	T	12.53	1.964470	0.34659	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	T;T;T	0.58210	0.35;0.35;0.35	4.46	4.46	0.54185	BAR (3);	0.210022	0.41294	D	0.000908	T	0.27205	0.0667	N	0.11201	0.11	0.28523	N	0.912965	B;B;B	0.25772	0.007;0.134;0.015	B;B;B	0.23275	0.006;0.045;0.011	T	0.15549	-1.0433	10	0.10111	T	0.7	.	8.2928	0.31967	0.0:0.091:0.0:0.909	.	174;168;200	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	S	168;200;174	ENSP00000410217:N168S;ENSP00000267012:N200S;ENSP00000445874:N174S	ENSP00000267012:N200S	N	-	2	0	BIN2	49979257	0.979000	0.34478	0.934000	0.37439	0.906000	0.53458	2.649000	0.46656	2.228000	0.72767	0.533000	0.62120	AAT	-	HMMSmart_SM00721,HMMPfam_BAR		0.398	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIN2	protein_coding	OTTHUMT00000469800.1	T			49979257	-1	no_errors	NM_016293	genbank	human	validated	54_36p	missense	SNP	0.034	C
Unknown	0	genome.wustl.edu	37	5	54153294	54153294	+	IGR	SNP	A	A	G			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr5:54153294A>G								AC112198.2 (4518 upstream) : RP11-45H22.3 (98768 downstream)																							AATGGAGGGAACACTTCTGAG	0.438																																																0			5																																								54189051	SO:0001628	intergenic_variant	0																															5.37:g.54153294A>G		Somatic		Capture	Illumina GAIIx	4	54189051		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.438					LOC100130990			A			54189051	+1	pseudogene	XR_042331	genbank	human	model	54_36p	rna	SNP	0.100	G
CACNA2D3	55799	genome.wustl.edu	37	3	54660603	54660603	+	Intron	SNP	C	C	G			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr3:54660603C>G	ENST00000474759.1	+	10	1011				CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000490478.1_Intron|CACNA2D3_ENST00000288197.5_Intron	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3							integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TTCTCCATCACCTACAAGCCC	0.597																																																0			3																																								54635643	SO:0001627	intron_variant	729789			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.964-1211C>G	3.37:g.54660603C>G		Somatic		Capture	Illumina GAIIx	4	54635643	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	HMMPfam_Ribosomal_S19,superfamily_Ribosomal protein S19,PatternScan_RIBOSOMAL_S19	p.T121S	ENST00000474759.1	37	c.362	CCDS54598.1	3																																																																																			-	HMMPfam_Ribosomal_S19,superfamily_Ribosomal protein S19,PatternScan_RIBOSOMAL_S19		0.597	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729789	protein_coding	OTTHUMT00000351402.1	C			54635643	+1	pseudogene	XM_001134147	genbank	human	model	54_36p	missense	SNP	1.000	G
OR5AS1	219447	genome.wustl.edu	37	11	55798420	55798420	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr11:55798420C>A	ENST00000313555.1	+	1	526	c.526C>A	c.(526-528)Cat>Aat	p.H176N		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					TATCGTCAATCATTTTTTCTG	0.443																																																0			11											264.0	259.0	260.0					11																	55798420		2201	4296	6497	55554996	SO:0001583	missense	219447			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.526C>A	11.37:g.55798420C>A	ENSP00000324111:p.His176Asn	Somatic		Capture	Illumina GAIIx	4	55554996	Q6IFB8	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.H176N	ENST00000313555.1	37	c.526	CCDS31516.1	11	.	.	.	.	.	.	.	.	.	.	C	10.83	1.461436	0.26248	.	.	ENSG00000181785	ENST00000313555	T	0.00164	8.64	5.46	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.218239	0.23045	U	0.052580	T	0.00412	0.0013	M	0.83953	2.67	0.09310	N	1	D	0.57571	0.98	P	0.57846	0.828	T	0.36890	-0.9729	10	0.72032	D	0.01	.	12.8884	0.58057	0.2949:0.7051:0.0:0.0	.	176	Q8N127	O5AS1_HUMAN	N	176	ENSP00000324111:H176N	ENSP00000324111:H176N	H	+	1	0	OR5AS1	55554996	0.620000	0.27068	0.072000	0.20136	0.020000	0.10135	1.778000	0.38614	1.279000	0.44446	-0.195000	0.12781	CAT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.443	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AS1	protein_coding	OTTHUMT00000391538.1	C	NM_001001921		55554996	+1	no_errors	NM_001001921	genbank	human	provisional	54_36p	missense	SNP	0.751	A
TMC4	147798	genome.wustl.edu	37	19	54667557	54667557	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr19:54667557G>C	ENST00000376591.4	-	8	1325	c.1194C>G	c.(1192-1194)atC>atG	p.I398M	TMC4_ENST00000476013.2_5'Flank|TMC4_ENST00000416963.1_5'Flank|TMC4_ENST00000301187.4_Missense_Mutation_p.I392M	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	398					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CAGCGATGAAGATGGACGGAA	0.562											OREG0003641	type=REGULATORY REGION|Gene=AK124406|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			19											102.0	96.0	98.0					19																	54667557		2203	4300	6503	59359369	SO:0001583	missense	147798			AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.1194C>G	19.37:g.54667557G>C	ENSP00000365776:p.Ile398Met	Somatic	1002	Capture	Illumina GAIIx	4	59359369	Q7Z5M3|Q8N5E4|Q8TBS7	Missense_Mutation	SNP	HMMPfam_TMC	p.I392M	ENST00000376591.4	37	c.1176	CCDS46174.1	19	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842469	0.51057	.	.	ENSG00000167608	ENST00000301187;ENST00000376591	T;T	0.59906	0.23;0.23	4.88	1.32	0.21799	.	0.165634	0.53938	D	0.000055	T	0.61602	0.2360	M	0.78916	2.43	0.80722	D	1	D;P	0.54772	0.968;0.863	P;P	0.55222	0.656;0.771	T	0.59279	-0.7484	10	0.46703	T	0.11	-18.3228	1.7749	0.03019	0.195:0.171:0.4602:0.1738	.	398;392	Q7Z404;Q7Z404-1	TMC4_HUMAN;.	M	392;398	ENSP00000301187:I392M;ENSP00000365776:I398M	ENSP00000301187:I392M	I	-	3	3	TMC4	59359369	0.999000	0.42202	1.000000	0.80357	0.819000	0.46315	0.289000	0.18957	0.515000	0.28320	0.511000	0.50034	ATC	-	NULL		0.562	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TMC4	protein_coding	OTTHUMT00000156164.2	G			59359369	-1	no_errors	NM_144686	genbank	human	validated	54_36p	missense	SNP	1.000	C
ZNF471	57573	genome.wustl.edu	37	19	57036249	57036249	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr19:57036249C>G	ENST00000308031.5	+	5	946	c.813C>G	c.(811-813)ttC>ttG	p.F271L	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_Nonsense_Mutation_p.S131*	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	271					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		GGAAAGCCTTCAAACAAAGTG	0.393																																					Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)											0			19											124.0	136.0	132.0					19																	57036249		2203	4300	6503	61728061	SO:0001583	missense	57573			AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.813C>G	19.37:g.57036249C>G	ENSP00000309161:p.Phe271Leu	Somatic		Capture	Illumina GAIIx	4	61728061	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.F271L	ENST00000308031.5	37	c.813	CCDS12945.1	19	.	.	.	.	.	.	.	.	.	.	C	15.93	2.978156	0.53720	.	.	ENSG00000196263	ENST00000308031	T	0.46063	0.88	4.09	3.05	0.35203	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.62913	0.2467	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.63821	-0.6550	9	0.87932	D	0	.	5.7171	0.17966	0.0:0.6844:0.0:0.3156	.	271	Q9BX82	ZN471_HUMAN	L	271	ENSP00000309161:F271L	ENSP00000309161:F271L	F	+	3	2	ZNF471	61728061	0.004000	0.15560	0.955000	0.39395	0.956000	0.61745	-0.015000	0.12634	0.930000	0.37217	0.462000	0.41574	TTC	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.393	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF471	protein_coding	OTTHUMT00000458405.1	C	NM_020813		61728061	+1	no_errors	NM_020813	genbank	human	validated	54_36p	missense	SNP	0.989	G
CDH5	1003	genome.wustl.edu	37	16	66420760	66420760	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr16:66420760G>A	ENST00000341529.3	+	3	407	c.259G>A	c.(259-261)Gaa>Aaa	p.E87K	CDH5_ENST00000563425.2_Missense_Mutation_p.E87K	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	87	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	GCTCAAAGGAGAATATGTGGG	0.537																																																0			16											78.0	66.0	70.0					16																	66420760		2202	4300	6502	64978261	SO:0001583	missense	1003			X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.259G>A	16.37:g.66420760G>A	ENSP00000344115:p.Glu87Lys	Somatic		Capture	Illumina GAIIx	4	64978261	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.E87K	ENST00000341529.3	37	c.259	CCDS10804.1	16	.	.	.	.	.	.	.	.	.	.	G	14.98	2.696783	0.48202	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.61274	0.12	5.89	2.65	0.31530	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.54663	0.1872	L	0.55213	1.73	0.80722	D	1	B	0.29955	0.263	B	0.36464	0.225	T	0.61083	-0.7134	9	0.72032	D	0.01	.	10.5159	0.44889	0.0704:0.2487:0.6809:0.0	.	87	P33151	CADH5_HUMAN	K	87	ENSP00000344115:E87K	ENSP00000344115:E87K	E	+	1	0	CDH5	64978261	1.000000	0.71417	0.726000	0.30738	0.053000	0.15095	3.533000	0.53561	1.497000	0.48584	-0.150000	0.13652	GAA	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.537	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH5	protein_coding	OTTHUMT00000268767.1	G	NM_001795		64978261	+1	no_errors	NM_001795	genbank	human	reviewed	54_36p	missense	SNP	0.908	A
MAN2C1	4123	genome.wustl.edu	37	15	75654986	75654986	+	Silent	SNP	G	G	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr15:75654986G>A	ENST00000267978.5	-	7	940	c.894C>T	c.(892-894)tcC>tcT	p.S298S	MAN2C1_ENST00000563539.1_5'Flank|MAN2C1_ENST00000563622.1_Intron|MAN2C1_ENST00000569482.1_Silent_p.S298S|MAN2C1_ENST00000565683.1_Silent_p.S298S	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	298					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						CTCTGACCTGGGAGCAGGCAA	0.637																																																0			15											53.0	55.0	54.0					15																	75654986		2197	4294	6491	73442039	SO:0001819	synonymous_variant	4123			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.894C>T	15.37:g.75654986G>A		Somatic		Capture	Illumina GAIIx	4	73442039	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Silent	SNP	superfamily_Glyco_hydro/deAcase_b/a-brl,HMMPfam_Glyco_hydro_38,superfamily_SSF88688,HMMPfam_Alpha-mann_mid,HMMPfam_Glyco_hydro_38C	p.S298	ENST00000267978.5	37	c.894	CCDS32298.1	15																																																																																			-	superfamily_Glyco_hydro/deAcase_b/a-brl,HMMPfam_Glyco_hydro_38		0.637	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2C1	protein_coding	OTTHUMT00000419965.1	G			73442039	-1	no_errors	NM_006715	genbank	human	validated	54_36p	silent	SNP	1.000	A
WDFY3	23001	genome.wustl.edu	37	4	85598394	85598394	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr4:85598394C>A	ENST00000295888.4	-	67	10822	c.10415G>T	c.(10414-10416)aGa>aTa	p.R3472I	WDFY3_ENST00000322366.6_Missense_Mutation_p.R3455I	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	3472	Interaction with ATG5.|Interaction with SQSTM1.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		ATGGTGTCGTCTTTCTGTGAG	0.468																																																0			4											91.0	88.0	89.0					4																	85598394		2203	4300	6503	85817418	SO:0001583	missense	23001			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.10415G>T	4.37:g.85598394C>A	ENSP00000295888:p.Arg3472Ile	Somatic		Capture	Illumina GAIIx	4	85817418	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	superfamily_ARM repeat,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Cyclin-like,superfamily_PH domain-like,superfamily_BEACH domain,HMMPfam_Beach,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1,HMMSmart_SM00064,HMMPfam_FYVE,superfamily_FYVE/PHD zinc finger	p.R3472I	ENST00000295888.4	37	c.10415	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	26.4	4.729545	0.89390	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.81247	-1.47;-1.47	5.39	5.39	0.77823	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.94255	0.8155	H	0.98629	4.285	0.80722	D	1	D	0.67145	0.996	D	0.77557	0.99	D	0.96202	0.9146	10	0.87932	D	0	.	19.4989	0.95085	0.0:1.0:0.0:0.0	.	3472	Q8IZQ1	WDFY3_HUMAN	I	3455;3472	ENSP00000318466:R3455I;ENSP00000295888:R3472I	ENSP00000295888:R3472I	R	-	2	0	WDFY3	85817418	0.959000	0.32827	0.152000	0.22495	0.729000	0.41735	7.438000	0.80431	2.678000	0.91216	0.655000	0.94253	AGA	-	HMMSmart_SM00064,HMMPfam_FYVE,superfamily_FYVE/PHD zinc finger		0.468	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	protein_coding	OTTHUMT00000252811.2	C	NM_014991		85817418	-1	no_errors	NM_014991	genbank	human	reviewed	54_36p	missense	SNP	0.530	A
CLCA4	22802	genome.wustl.edu	37	1	87025928	87025928	+	Missense_Mutation	SNP	G	G	T	rs377046751		TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr1:87025928G>T	ENST00000370563.3	+	3	377	c.335G>T	c.(334-336)gGt>gTt	p.G112V	CLCA4_ENST00000263723.5_5'UTR	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	112	Metalloprotease domain. {ECO:0000250|UniProtKB:A8K7I4}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)	p.P111_E115delPGRDE(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		ACACTCCCAGGTAGAGATGAA	0.368																																																1	Deletion - In frame(1)	breast(1)	1											137.0	120.0	126.0					1																	87025928		1875	4131	6006	86798516	SO:0001583	missense	22802			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.335G>T	1.37:g.87025928G>T	ENSP00000359594:p.Gly112Val	Somatic		Capture	Illumina GAIIx	4	86798516	A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	HMMPfam_CLCA_N,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,HMMPfam_DUF1973	p.G112V	ENST00000370563.3	37	c.335	CCDS41355.1	1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.861202	0.32884	.	.	ENSG00000016602	ENST00000370563	T	0.11495	2.77	5.75	3.89	0.44902	Chloride channel calcium-activated (1);	0.449602	0.24233	N	0.040335	T	0.13457	0.0326	M	0.83012	2.62	0.31917	N	0.613985	P	0.49447	0.924	P	0.60473	0.875	T	0.09729	-1.0661	10	0.19147	T	0.46	-10.5877	5.7203	0.17982	0.3577:0.0:0.6423:0.0	.	112	Q14CN2	CLCA4_HUMAN	V	112	ENSP00000359594:G112V	ENSP00000359594:G112V	G	+	2	0	CLCA4	86798516	0.963000	0.33076	0.342000	0.25602	0.924000	0.55760	3.071000	0.50041	1.430000	0.47334	0.655000	0.94253	GGT	-	HMMPfam_CLCA_N		0.368	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA4	protein_coding	OTTHUMT00000028292.1	G	NM_012128		86798516	+1	no_errors	NM_012128	genbank	human	reviewed	54_36p	missense	SNP	0.284	T
PCDH11X	27328	genome.wustl.edu	37	X	91132872	91132872	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chrX:91132872A>T	ENST00000373094.1	+	2	2478	c.1633A>T	c.(1633-1635)Aac>Tac	p.N545Y	PCDH11X_ENST00000406881.1_Missense_Mutation_p.N545Y|PCDH11X_ENST00000373097.1_Missense_Mutation_p.N545Y|PCDH11X_ENST00000373088.1_Missense_Mutation_p.N545Y|PCDH11X_ENST00000361655.2_Missense_Mutation_p.N545Y|PCDH11X_ENST00000298274.8_Missense_Mutation_p.N545Y|PCDH11X_ENST00000361724.1_Missense_Mutation_p.N545Y|PCDH11X_ENST00000504220.2_Missense_Mutation_p.N545Y|PCDH11X_ENST00000395337.2_Missense_Mutation_p.N545Y	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	545	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N545Y(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GGCAAAAGATAACGGGGTACC	0.378																																					NSCLC(38;925 1092 2571 38200 45895)											2	Substitution - Missense(2)	lung(2)	X											97.0	92.0	94.0					X																	91132872		2203	4300	6503	91019528	SO:0001583	missense	27328			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1633A>T	X.37:g.91132872A>T	ENSP00000362186:p.Asn545Tyr	Somatic		Capture	Illumina GAIIx	4	91019528	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Protocadherin	p.N545Y	ENST00000373094.1	37	c.1633	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	A	10.94	1.491513	0.26774	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61	5.38	5.38	0.77491	Cadherin (5);Cadherin-like (1);	0.046634	0.85682	D	0.000000	T	0.70962	0.3284	M	0.84585	2.705	0.52501	D	0.999954	D;D;D;D;D;D;D;D	0.89917	1.0;0.985;1.0;1.0;1.0;1.0;0.997;0.997	D;P;D;D;D;D;D;D	0.81914	0.979;0.689;0.978;0.986;0.986;0.995;0.967;0.967	T	0.76149	-0.3065	10	0.66056	D	0.02	.	13.5121	0.61519	1.0:0.0:0.0:0.0	.	545;545;545;545;545;545;545;545	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	Y	545	ENSP00000378746:N545Y;ENSP00000362186:N545Y;ENSP00000362189:N545Y;ENSP00000355040:N545Y;ENSP00000362180:N545Y;ENSP00000423762:N545Y;ENSP00000355105:N545Y;ENSP00000384758:N545Y;ENSP00000298274:N545Y	ENSP00000298274:N545Y	N	+	1	0	PCDH11X	91019528	1.000000	0.71417	0.994000	0.49952	0.299000	0.27559	6.982000	0.76173	1.786000	0.52430	0.441000	0.28932	AAC	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.378	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	protein_coding	OTTHUMT00000057436.1	A	NM_032969		91019528	+1	no_errors	NM_032968	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
AC008592.4	0	genome.wustl.edu	37	5	95170733	95170733	+	RNA	SNP	G	G	T	rs114507729	byFrequency	TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr5:95170733G>T	ENST00000509999.1	-	0	900																											GGACGTCCCTGCAGCCCAAGT	0.677													G|||	71	0.0141773	0.003	0.0187	5008	,	,		13983	0.001		0.0348	False		,,,				2504	0.0184															0			5																																								95196489			727938																															5.37:g.95170733G>T		Somatic		Capture	Illumina GAIIx	4	95196489		RNA	SNP	-	NULL	ENST00000509999.1	37	NULL		5																																																																																			-	-		0.677	AC008592.4-001	KNOWN	basic	antisense	LOC727938	antisense	OTTHUMT00000370276.1	G			95196489	-1	pseudogene	XR_037516	genbank	human	model	54_36p	rna	SNP	0.004	T
CERS3	204219	genome.wustl.edu	37	15	101016358	101016358	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr15:101016358T>A	ENST00000394113.1	-	10	1232	c.542A>T	c.(541-543)tAc>tTc	p.Y181F	CERS3_ENST00000538112.2_Missense_Mutation_p.Y181F|CERS3_ENST00000560944.1_Intron|CERS3_ENST00000284382.4_Missense_Mutation_p.Y181F			Q8IU89	CERS3_HUMAN	ceramide synthase 3	181	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										TAAAATGTAGTACCAGTACTG	0.353																																																0			15											66.0	73.0	71.0					15																	101016358		2203	4299	6502	98833881	SO:0001583	missense	204219				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.542A>T	15.37:g.101016358T>A	ENSP00000377672:p.Tyr181Phe	Somatic		Capture	Illumina GAIIx	4	98833881	Q8NE64|Q8NEN6	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMPfam_Homeobox,HMMSmart_SM00389,HMMSmart_SM00724,HMMPfam_TRAM_LAG1_CLN8	p.Y181F	ENST00000394113.1	37	c.542	CCDS10384.1	15	.	.	.	.	.	.	.	.	.	.	T	22.7	4.319082	0.81469	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	D;D	0.87412	-2.25;-2.25	5.46	4.32	0.51571	TRAM/LAG1/CLN8 homology domain (3);	0.000000	0.85682	D	0.000000	D	0.91713	0.7380	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91624	0.5313	10	0.54805	T	0.06	-14.6626	10.7797	0.46371	0.0:0.0778:0.0:0.9222	.	181	Q8IU89	CERS3_HUMAN	F	181;192;181	ENSP00000284382:Y181F;ENSP00000437640:Y181F	ENSP00000284382:Y181F	Y	-	2	0	CERS3	98833881	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.942000	0.75928	2.079000	0.62486	0.482000	0.46254	TAC	-	HMMSmart_SM00724,HMMPfam_TRAM_LAG1_CLN8		0.353	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	LASS3	protein_coding	OTTHUMT00000313594.4	T	NM_178842		98833881	-1	no_errors	NM_178842	genbank	human	validated	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	1	100797431	100797431	+	IGR	SNP	T	T	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr1:100797431T>A								RTCA (39106 upstream) : RP5-837M10.2 (12601 downstream)																							GGTATTCTACTGTTTTGGAAC	0.328																																																0			1																																								100570019	SO:0001628	intergenic_variant	646970																															1.37:g.100797431T>A		Somatic		Capture	Illumina GAIIx	4	100570019		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.328					LOC646970			T			100570019	-1	pseudogene	XR_017347	genbank	human	model	54_36p	rna	SNP	1.000	A
MSANTD3	91283	genome.wustl.edu	37	9	103204231	103204231	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr9:103204231A>G	ENST00000395067.2	+	2	282	c.11A>G	c.(10-12)aAc>aGc	p.N4S	MSANTD3_ENST00000374885.1_Missense_Mutation_p.N4S|TMEFF1_ENST00000334943.6_5'Flank|MSANTD3-TMEFF1_ENST00000502978.1_5'Flank	NM_001198805.1|NM_001198806.1|NM_080655.2	NP_001185734.1|NP_001185735.1|NP_542386.1	Q96H12	MSD3_HUMAN	Myb/SANT-like DNA-binding domain containing 3	4										endometrium(2)|lung(2)	4						ATGCAAAACAACGAAATTATA	0.368																																																0			9											60.0	56.0	57.0					9																	103204231		2203	4300	6503	102244052	SO:0001583	missense	91283			BC008993	CCDS6749.1, CCDS56579.1	9q31.1	2012-03-13	2012-03-13	2012-03-13	ENSG00000066697	ENSG00000066697			23370	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 30"""	C9orf30			Standard	NM_080655		Approved	MGC17337		Q96H12	OTTHUMG00000020365	ENST00000395067.2:c.11A>G	9.37:g.103204231A>G	ENSP00000378506:p.Asn4Ser	Somatic		Capture	Illumina GAIIx	4	102244052	B2RC35|Q5T726|Q5T727|Q5T728	Missense_Mutation	SNP	NULL	p.N4S	ENST00000395067.2	37	c.11	CCDS6749.1	9	.	.	.	.	.	.	.	.	.	.	A	14.65	2.598424	0.46318	.	.	ENSG00000066697	ENST00000395067;ENST00000398977;ENST00000374885;ENST00000374886	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	T	0.50326	0.1609	L	0.38175	1.15	0.42812	D	0.993963	B	0.02656	0.0	B	0.06405	0.002	T	0.47886	-0.9082	8	0.08599	T	0.76	-1.0904	15.397	0.74805	1.0:0.0:0.0:0.0	.	4	Q96H12	CI030_HUMAN	S	4	.	ENSP00000364020:N4S	N	+	2	0	C9orf30	102244052	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.677000	0.61634	2.243000	0.73865	0.533000	0.62120	AAC	-	NULL		0.368	MSANTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf30	protein_coding	OTTHUMT00000053410.1	A	NM_080655		102244052	+1	no_errors	NM_080655	genbank	human	predicted	54_36p	missense	SNP	1.000	G
COL11A1	1301	genome.wustl.edu	37	1	103431048	103431048	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr1:103431048G>T	ENST00000370096.3	-	38	3223	c.2911C>A	c.(2911-2913)Cca>Aca	p.P971T	COL11A1_ENST00000358392.2_Missense_Mutation_p.P983T|COL11A1_ENST00000512756.1_Missense_Mutation_p.P855T|COL11A1_ENST00000353414.4_Missense_Mutation_p.P932T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	971	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CATACCTGTGGTCCAACCACT	0.373																																																0			1											99.0	114.0	109.0					1																	103431048		2203	4300	6503	103203636	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2911C>A	1.37:g.103431048G>T	ENSP00000359114:p.Pro971Thr	Somatic		Capture	Illumina GAIIx	4	103203636	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	HMMSmart_TSPN,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_Collagen,HMMSmart_COLFI,HMMPfam_COLFI	p.P983T	ENST00000370096.3	37	c.2947	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614289	0.66672	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.96856	-4.15;-4.15;-4.15;-4.15	5.3	5.3	0.74995	.	0.060366	0.64402	D	0.000002	D	0.97445	0.9164	L	0.59967	1.855	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.999;1.0;1.0;0.999	D;D;D;D;D	0.87578	0.987;0.994;0.998;0.994;0.994	D	0.98166	1.0449	10	0.72032	D	0.01	.	18.9633	0.92685	0.0:0.0:1.0:0.0	.	855;932;983;971;191	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	T	971;983;932;191;855	ENSP00000359114:P971T;ENSP00000351163:P983T;ENSP00000302551:P932T;ENSP00000426533:P855T	ENSP00000302551:P932T	P	-	1	0	COL11A1	103203636	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	9.734000	0.98822	2.485000	0.83878	0.557000	0.71058	CCA	-	HMMPfam_Collagen		0.373	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	protein_coding	OTTHUMT00000029997.1	G	NM_080630		103203636	-1	no_errors	NM_080629	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
RIMS2	9699	genome.wustl.edu	37	8	104922594	104922594	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr8:104922594T>C	ENST00000262231.10	+	3	1342	c.1094T>C	c.(1093-1095)tTg>tCg	p.L365S	RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000436393.2_Intron|RIMS2_ENST00000507740.1_Intron	NM_001282881.1	NP_001269810.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	588					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CAGGCAGTTTTGTCGGACTCT	0.393										HNSCC(12;0.0054)																																						0			8											178.0	172.0	174.0					8																	104922594		876	1991	2867	104991770	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000262231.10:c.1094T>C	8.37:g.104922594T>C	ENSP00000262231:p.Leu365Ser	Somatic		Capture	Illumina GAIIx	4	104991770	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	superfamily_FYVE/PHD zinc finger,HMMPfam_RPH3A_effector,HMMSmart_SM00228,superfamily_PDZ domain-like,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.L588S	ENST00000262231.10	37	c.1763		8	.	.	.	.	.	.	.	.	.	.	T	7.491	0.650709	0.14516	.	.	ENSG00000176406	ENST00000402998;ENST00000262231	T	0.15718	2.4	5.09	3.91	0.45181	.	.	.	.	.	T	0.11750	0.0286	.	.	.	0.80722	D	1	B	0.34290	0.447	B	0.34385	0.181	T	0.10917	-1.0609	8	0.14252	T	0.57	.	12.4514	0.55679	0.0:0.0:0.1398:0.8602	.	365	Q9UQ26-1	.	S	588;365	ENSP00000262231:L365S	ENSP00000262231:L365S	L	+	2	0	RIMS2	104991770	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.589000	0.61006	0.843000	0.35070	0.528000	0.53228	TTG	-	NULL		0.393	RIMS2-004	KNOWN	basic	protein_coding	RIMS2	protein_coding	OTTHUMT00000367214.5	T	NM_001100117		104991770	+1	no_errors	ENST00000402998	ensembl	human	known	54_36p	missense	SNP	1.000	C
IGHV2-5	28457	genome.wustl.edu	37	14	106494296	106494296	+	RNA	SNP	G	G	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr14:106494296G>T	ENST00000390597.2	-	0	215									immunoglobulin heavy variable 2-5																		AGCCACTCCAGGGCCTTTCCT	0.557																																																0			14											67.0	66.0	66.0					14																	106494296		1998	4147	6145	105565341			0			X62111		14q32.33	2012-02-08			ENSG00000211937	ENSG00000211937		"""Immunoglobulins / IGH locus"""	5576	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152287		14.37:g.106494296G>T		Somatic		Capture	Illumina GAIIx	4	105565341		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv	p.L66M	ENST00000390597.2	37	c.196		14																																																																																			-	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IGv		0.557	IGHV2-5-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211937	IG_V_gene	OTTHUMT00000325675.1	G	NG_001019		105565341	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390597	ensembl	human	known	54_36p	missense	SNP	0.998	T
MARCO	8685	genome.wustl.edu	37	2	119699963	119699963	+	Silent	SNP	C	C	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr2:119699963C>T	ENST00000327097.4	+	1	222	c.87C>T	c.(85-87)ttC>ttT	p.F29F	MARCO_ENST00000541757.1_5'UTR	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	29					apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						TGGAGCCTTTCGAAATCAATG	0.388																																					GBM(8;18 374 7467 11269 32796)											0			2											86.0	85.0	85.0					2																	119699963		2203	4300	6503	119416433	SO:0001819	synonymous_variant	8685			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.87C>T	2.37:g.119699963C>T		Somatic		Capture	Illumina GAIIx	4	119416433	B4DW79|Q9Y5S3	Silent	SNP	HMMPfam_Collagen,superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR,PatternScan_SRCR_1	p.F29	ENST00000327097.4	37	c.87	CCDS2124.1	2																																																																																			-	NULL		0.388	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCO	protein_coding	OTTHUMT00000254190.2	C	NM_006770		119416433	+1	no_errors	NM_006770	genbank	human	reviewed	54_36p	silent	SNP	0.850	T
THOC2	57187	genome.wustl.edu	37	X	122771930	122771930	+	Nonsense_Mutation	SNP	T	T	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chrX:122771930T>A	ENST00000245838.8	-	18	1916	c.1885A>T	c.(1885-1887)Aaa>Taa	p.K629*	THOC2_ENST00000491737.1_Nonsense_Mutation_p.K514*|THOC2_ENST00000355725.4_Nonsense_Mutation_p.K629*	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	629					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TCATCATGTTTCATTCTTTCC	0.308																																																0			X											138.0	114.0	121.0					X																	122771930		1843	4075	5918	122599611	SO:0001587	stop_gained	57187			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.1885A>T	X.37:g.122771930T>A	ENSP00000245838:p.Lys629*	Somatic		Capture	Illumina GAIIx	4	122599611	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Nonsense_Mutation	SNP	NULL	p.K629*	ENST00000245838.8	37	c.1885	CCDS43988.1	X	.	.	.	.	.	.	.	.	.	.	T	40	7.977493	0.98591	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.1818	14.7751	0.69726	0.0:0.0:0.0:1.0	.	.	.	.	X	629;629;514;554	.	ENSP00000245838:K629X	K	-	1	0	THOC2	122599611	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.793000	0.85851	1.938000	0.56188	0.441000	0.28932	AAA	-	NULL		0.308	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	protein_coding	OTTHUMT00000058153.3	T			122599611	-1	no_errors	NM_001081550	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
DNAH10	196385	genome.wustl.edu	37	12	124332518	124332518	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr12:124332518T>G	ENST00000409039.3	+	32	5496	c.5471T>G	c.(5470-5472)aTg>aGg	p.M1824R		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1824	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GCGCTGTCCATGTATCTAGGT	0.527																																																0			12											72.0	79.0	77.0					12																	124332518		1939	4153	6092	122898471	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5471T>G	12.37:g.124332518T>G	ENSP00000386770:p.Met1824Arg	Somatic		Capture	Illumina GAIIx	4	122898471	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.M1824R	ENST00000409039.3	37	c.5471	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	T	23.8	4.456227	0.84317	.	.	ENSG00000197653	ENST00000409039	T	0.09445	2.98	5.67	5.67	0.87782	.	0.055751	0.64402	U	0.000001	T	0.38532	0.1044	M	0.85945	2.785	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.37174	-0.9717	10	0.87932	D	0	.	15.9076	0.79442	0.0:0.0:0.0:1.0	.	1824	Q8IVF4	DYH10_HUMAN	R	1824	ENSP00000386770:M1824R	ENSP00000386770:M1824R	M	+	2	0	DNAH10	122898471	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	8.027000	0.88791	2.163000	0.67991	0.454000	0.30748	ATG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.527	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	T			122898471	+1	no_errors	ENST00000409039	ensembl	human	known	54_36p	missense	SNP	1.000	G
OR1J2	26740	genome.wustl.edu	37	9	125273804	125273804	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr9:125273804G>A	ENST00000335302.5	+	1	724	c.724G>A	c.(724-726)Ggc>Agc	p.G242S		NM_054107.1	NP_473448.1	Q8NGS2	OR1J2_HUMAN	olfactory receptor, family 1, subfamily J, member 2	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(7)|stomach(1)	26						GTCCACATGTGGCTCCCATCT	0.483																																																0			9											219.0	179.0	193.0					9																	125273804		2203	4300	6503	124313625	SO:0001583	missense	26740				CCDS35121.1	9q33.2	2013-09-20			ENSG00000197233	ENSG00000197233		"""GPCR / Class A : Olfactory receptors"""	8209	protein-coding gene	gene with protein product				OR1J3, OR1J5			Standard	XM_005251920		Approved	OST044	uc011lyv.2	Q8NGS2	OTTHUMG00000020604	ENST00000335302.5:c.724G>A	9.37:g.125273804G>A	ENSP00000335575:p.Gly242Ser	Somatic		Capture	Illumina GAIIx	4	124313625	A3KFL9|Q6IF14|Q96R90|Q9NZP1	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G242S	ENST00000335302.5	37	c.724	CCDS35121.1	9	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580329	0.46006	.	.	ENSG00000197233	ENST00000335302	T	0.35973	1.28	4.77	3.86	0.44501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40728	U	0.001028	T	0.33030	0.0849	N	0.12746	0.255	0.24330	N	0.995003	D	0.54207	0.965	D	0.64144	0.922	T	0.05716	-1.0868	10	0.54805	T	0.06	.	4.62	0.12445	0.1816:0.0:0.6443:0.1741	.	242	Q8NGS2	OR1J2_HUMAN	S	242	ENSP00000335575:G242S	ENSP00000335575:G242S	G	+	1	0	OR1J2	124313625	0.000000	0.05858	0.880000	0.34516	0.155000	0.21991	-0.464000	0.06688	1.224000	0.43551	0.545000	0.68477	GGC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.483	OR1J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1J2	protein_coding	OTTHUMT00000053932.1	G			124313625	+1	no_errors	NM_054107	genbank	human	provisional	54_36p	missense	SNP	0.941	A
GPR107	57720	genome.wustl.edu	37	9	132853178	132853178	+	Silent	SNP	T	T	C			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr9:132853178T>C	ENST00000372406.1	+	8	1152	c.645T>C	c.(643-645)gaT>gaC	p.D215D	GPR107_ENST00000372410.3_Silent_p.D215D|GPR107_ENST00000347136.6_Silent_p.D215D	NM_001136557.1	NP_001130029.1	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107	215						integral component of membrane (GO:0016021)				endometrium(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	11		Ovarian(14;0.000531)				TCAGCACTGATGACCAAGAAG	0.323																																																0			9											89.0	85.0	86.0					9																	132853178		2203	4299	6502	131892999	SO:0001819	synonymous_variant	57720			AF376725	CCDS35162.1, CCDS48041.1, CCDS48042.1	9q34.2	2014-01-30			ENSG00000148358	ENSG00000148358		"""GPCR / Unclassified : 7TM orphan receptors"""	17830	protein-coding gene	gene with protein product							Standard	NM_020960		Approved	KIAA1624, RP11-88G17, FLJ20998, LUSTR1	uc004bzd.2	Q5VW38	OTTHUMG00000020804	ENST00000372406.1:c.645T>C	9.37:g.132853178T>C		Somatic		Capture	Illumina GAIIx	4	131892999	A6NJ53|Q2TB81|Q5JPA3|Q5VW39|Q96T26|Q9H658|Q9HCE8	Silent	SNP	HMMPfam_Lung_7-TM_R	p.D215	ENST00000372406.1	37	c.645	CCDS48041.1	9																																																																																			-	HMMPfam_Lung_7-TM_R		0.323	GPR107-003	NOVEL	basic|CCDS	protein_coding	GPR107	protein_coding	OTTHUMT00000054643.2	T			131892999	+1	no_errors	NM_020960	genbank	human	validated	54_36p	silent	SNP	0.985	C
MOXD1	26002	genome.wustl.edu	37	6	132645226	132645226	+	Silent	SNP	A	A	G			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr6:132645226A>G	ENST00000367963.3	-	7	1075	c.957T>C	c.(955-957)gaT>gaC	p.D319D	MOXD1_ENST00000489128.1_5'UTR|MOXD1_ENST00000336749.3_Silent_p.D251D	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	319						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		GTCCAGAATTATCTATTAAGC	0.353																																																0			6											88.0	90.0	89.0					6																	132645226		2203	4300	6503	132686919	SO:0001819	synonymous_variant	26002			AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.957T>C	6.37:g.132645226A>G		Somatic		Capture	Illumina GAIIx	4	132686919	Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Silent	SNP	HMMSmart_SM00664,HMMPfam_DOMON,superfamily_PHM/PNGase F,HMMPfam_Cu2_monooxygen,HMMPfam_Cu2_monoox_C	p.D319	ENST00000367963.3	37	c.957	CCDS5152.2	6																																																																																			-	superfamily_PHM/PNGase F		0.353	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MOXD1	protein_coding	OTTHUMT00000125837.1	A	NM_015529		132686919	-1	no_errors	NM_015529	genbank	human	validated	54_36p	silent	SNP	0.999	G
POMT1	10585	genome.wustl.edu	37	9	134385308	134385308	+	Silent	SNP	G	G	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr9:134385308G>T	ENST00000372228.3	+	8	803	c.624G>T	c.(622-624)gtG>gtT	p.V208V	POMT1_ENST00000354713.4_Silent_p.V178V|POMT1_ENST00000341012.7_Silent_p.V154V|POMT1_ENST00000404875.2_Silent_p.V91V|POMT1_ENST00000423007.1_Silent_p.V208V|POMT1_ENST00000402686.3_Silent_p.V208V|POMT1_ENST00000419118.2_Silent_p.V56V|POMT1_ENST00000541219.1_Intron	NM_007171.3	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1	208					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|mannosylation (GO:0097502)|multicellular organismal development (GO:0007275)|protein O-linked glycosylation (GO:0006493)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|sarcoplasmic reticulum (GO:0016529)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannosyltransferase activity (GO:0000030)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	31		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		ACATGGGTGTGTTCACGTACG	0.512																																																0			9											261.0	218.0	232.0					9																	134385308		2203	4300	6503	133375129	SO:0001819	synonymous_variant	10585			AF095136	CCDS6943.1, CCDS43894.1, CCDS43895.1, CCDS48045.1	9q34.1	2014-09-17			ENSG00000130714	ENSG00000130714	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	9202	protein-coding gene	gene with protein product	"""dolichyl-phosphate-mannose-protein mannosyltransferase"""	607423				10366449	Standard	NM_001077366		Approved	LGMD2K	uc004cav.3	Q9Y6A1	OTTHUMG00000020826	ENST00000372228.3:c.624G>T	9.37:g.134385308G>T		Somatic		Capture	Illumina GAIIx	4	133375129	B3KQG0|B4DIF0|Q5JT01|Q5JT06|Q5JT08|Q8NC91|Q8TCA9|Q9NX32|Q9NX82|Q9UNT2	Silent	SNP	HMMPfam_PMT,superfamily_MIR domain (Pfam 02815),HMMSmart_SM00472,HMMPfam_MIR	p.V208	ENST00000372228.3	37	c.624	CCDS6943.1	9																																																																																			-	HMMPfam_PMT		0.512	POMT1-001	KNOWN	basic|CCDS	protein_coding	POMT1	protein_coding	OTTHUMT00000054737.1	G	NM_007171		133375129	+1	no_errors	NM_007171	genbank	human	reviewed	54_36p	silent	SNP	0.805	T
ADAMTSL2	9719	genome.wustl.edu	37	9	136405823	136405823	+	Silent	SNP	G	G	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr9:136405823G>A	ENST00000354484.4	+	6	1073	c.516G>A	c.(514-516)aaG>aaA	p.K172K	ADAMTSL2_ENST00000393061.3_Silent_p.K281K|ADAMTSL2_ENST00000393060.1_Silent_p.K172K	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	172					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		CATCCTGCAAGCTCACTGACC	0.597																																																0			9											75.0	62.0	66.0					9																	136405823		2203	4300	6503	135395644	SO:0001819	synonymous_variant	9719			AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.516G>A	9.37:g.136405823G>A		Somatic		Capture	Illumina GAIIx	4	135395644	B1B0D5|O60345	Silent	SNP	superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,HMMPfam_PLAC	p.K172	ENST00000354484.4	37	c.516	CCDS6976.1	9																																																																																			-	NULL		0.597	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL2	protein_coding	OTTHUMT00000254619.1	G	NM_014694		135395644	+1	no_errors	NM_014694	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
TAS2R41	259287	genome.wustl.edu	37	7	143175874	143175874	+	Silent	SNP	C	C	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr7:143175874C>T	ENST00000408916.1	+	1	909	c.909C>T	c.(907-909)ggC>ggT	p.G303G	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	303					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					TGGCAAGGGGCTTCTGGGTGG	0.522																																																0			7											80.0	72.0	74.0					7																	143175874		2025	4190	6215	142885996	SO:0001819	synonymous_variant	259287			AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.909C>T	7.37:g.143175874C>T		Somatic		Capture	Illumina GAIIx	4	142885996	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Silent	SNP	HMMPfam_TAS2R,superfamily_SSF81321	p.G303	ENST00000408916.1	37	c.909	CCDS43663.1	7																																																																																			-	NULL		0.522	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R41	protein_coding	OTTHUMT00000342149.1	C			142885996	+1	no_errors	NM_176883	genbank	human	provisional	54_36p	silent	SNP	0.040	T
AFF2	2334	genome.wustl.edu	37	X	147743677	147743677	+	Silent	SNP	A	A	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chrX:147743677A>T	ENST00000370460.2	+	3	908	c.429A>T	c.(427-429)atA>atT	p.I143I	AFF2_ENST00000342251.3_Silent_p.I139I|AFF2_ENST00000370457.5_Silent_p.I139I|AFF2_ENST00000370458.1_Silent_p.I139I	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	143					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CTGTTGTGATACTGAATTCAA	0.438																																																0			X											213.0	207.0	209.0					X																	147743677		2203	4300	6503	147551369	SO:0001819	synonymous_variant	2334			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.429A>T	X.37:g.147743677A>T		Somatic		Capture	Illumina GAIIx	4	147551369	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	HMMPfam_AF-4	p.I143	ENST00000370460.2	37	c.429	CCDS14684.1	X																																																																																			-	HMMPfam_AF-4		0.438	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	protein_coding	OTTHUMT00000058673.2	A	NM_002025		147551369	+1	no_errors	NM_002025	genbank	human	validated	54_36p	silent	SNP	0.960	T
KMT2C	58508	genome.wustl.edu	37	7	151904429	151904429	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr7:151904429C>A	ENST00000262189.6	-	24	4015	c.3797G>T	c.(3796-3798)gGa>gTa	p.G1266V	KMT2C_ENST00000355193.2_Missense_Mutation_p.G1266V	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1266					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ACCATCTGTTCCTTCCACTCC	0.383																																																0			7											106.0	97.0	100.0					7																	151904429		2203	4300	6503	151535362	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3797G>T	7.37:g.151904429C>A	ENSP00000262189:p.Gly1266Val	Somatic		Capture	Illumina GAIIx	4	151535362	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	PatternScan_HMGI_Y,HMMPfam_AT_hook,HMMSmart_SM00249,superfamily_FYVE/PHD zinc finger,HMMPfam_PHD,HMMSmart_SM00184,PatternScan_ZF_PHD_1,PatternScan_ATPASE_ALPHA_BETA,HMMSmart_SM00398,HMMPfam_HMG_box,HMMPfam_FYRN,HMMSmart_SM00541,HMMPfam_FYRC,HMMSmart_SM00542,superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00508	p.G1266V	ENST00000262189.6	37	c.3797	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	11.75	1.731343	0.30684	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.83163	-1.69;-1.69	5.73	5.73	0.89815	.	0.000000	0.41500	U	0.000875	T	0.79446	0.4447	L	0.60455	1.87	0.80722	D	1	B;B	0.34103	0.071;0.437	B;B	0.28011	0.039;0.085	T	0.79584	-0.1743	10	0.52906	T	0.07	.	14.7207	0.69302	0.1448:0.8552:0.0:0.0	.	1266;327	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	V	1266	ENSP00000262189:G1266V;ENSP00000347325:G1266V	ENSP00000262189:G1266V	G	-	2	0	MLL3	151535362	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.875000	0.39578	2.712000	0.92718	0.557000	0.71058	GGA	-	NULL		0.383	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	protein_coding	OTTHUMT00000318887.3	C			151535362	-1	no_errors	NM_170606	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
SPRY3	10251	genome.wustl.edu	37	X	155003962	155003962	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chrX:155003962C>A	ENST00000302805.2	+	2	860	c.429C>A	c.(427-429)caC>caA	p.H143Q		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	143					multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)						all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTAGTGAGCACCTCTTCATCT	0.602																																																0			X											107.0	111.0	110.0					X																	155003962		2203	4296	6499	154657156	SO:0001583	missense	10251			AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.429C>A	X.37:g.155003962C>A	ENSP00000302978:p.His143Gln	Somatic		Capture	Illumina GAIIx	4	154657156	A8K0H8	Missense_Mutation	SNP	HMMPfam_Sprouty	p.H143Q	ENST00000302805.2	37	c.429	CCDS14769.4	X	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827551	0.32329	.	.	ENSG00000168939	ENST00000302805	T	0.57907	0.37	2.71	2.71	0.32032	.	0.060393	0.64402	D	0.000003	T	0.57770	0.2076	.	.	.	0.09310	N	1	D	0.58970	0.984	P	0.59595	0.86	T	0.45454	-0.9260	9	0.51188	T	0.08	-3.628	5.1726	0.15118	0.0:0.8247:0.0:0.1753	.	143	O43610	SPY3_HUMAN	Q	143	ENSP00000302978:H143Q	ENSP00000302978:H143Q	H	+	3	2	SPRY3	154657156	0.996000	0.38824	1.000000	0.80357	0.477000	0.33069	1.031000	0.30165	1.366000	0.46076	0.279000	0.19357	CAC	-	NULL		0.602	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY3	protein_coding	OTTHUMT00000058823.2	C	NM_005840		154657156	+1	no_errors	NM_005840	genbank	human	validated	54_36p	missense	SNP	1.000	A
BAZ2B	29994	genome.wustl.edu	37	2	160255377	160255377	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr2:160255377G>T	ENST00000392783.2	-	18	3422	c.2927C>A	c.(2926-2928)gCa>gAa	p.A976E	AC008277.1_ENST00000594921.1_RNA|AC008277.1_ENST00000608714.1_RNA|AC008277.1_ENST00000420020.1_RNA|BAZ2B_ENST00000392782.1_Missense_Mutation_p.A940E|BAZ2B_ENST00000355831.2_Missense_Mutation_p.A942E|BAZ2B_ENST00000343439.5_Missense_Mutation_p.A876E	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	976	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TTTGGCATTTGCCGCTTCTTC	0.353																																																0			2											122.0	116.0	118.0					2																	160255377		1827	4087	5914	159963623	SO:0001583	missense	29994			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.2927C>A	2.37:g.160255377G>T	ENSP00000376534:p.Ala976Glu	Somatic		Capture	Illumina GAIIx	4	159963623	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	superfamily_DNA-binding domain,HMMPfam_MBD,HMMSmart_SM00391,HMMPfam_DDT,HMMSmart_SM00571,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.A976E	ENST00000392783.2	37	c.2927	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	G	14.36	2.512098	0.44660	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.02236	4.38;4.38;4.38;4.38	6.07	6.07	0.98685	.	0.000000	0.36740	U	0.002430	T	0.06917	0.0176	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.994	T	0.59236	-0.7492	10	0.26408	T	0.33	-15.72	20.6593	0.99626	0.0:0.0:1.0:0.0	.	876;940;976	Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;BAZ2B_HUMAN	E	940;976;942;876	ENSP00000376533:A940E;ENSP00000376534:A976E;ENSP00000348087:A942E;ENSP00000339670:A876E	ENSP00000339670:A876E	A	-	2	0	BAZ2B	159963623	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.804000	0.99143	2.885000	0.99019	0.655000	0.94253	GCA	-	NULL		0.353	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	protein_coding	OTTHUMT00000255037.2	G			159963623	-1	no_errors	NM_013450	genbank	human	validated	54_36p	missense	SNP	1.000	T
UNC5A	90249	genome.wustl.edu	37	5	176297378	176297378	+	Silent	SNP	C	C	T			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr5:176297378C>T	ENST00000329542.4	+	6	1003	c.729C>T	c.(727-729)ggC>ggT	p.G243G	UNC5A_ENST00000261961.3_Silent_p.G203G	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	243	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TAGTGGACGGCAGCTGGAGCC	0.682																																																0			5											33.0	33.0	33.0					5																	176297378		2202	4293	6495	176229984	SO:0001819	synonymous_variant	90249			AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.729C>T	5.37:g.176297378C>T		Somatic		Capture	Illumina GAIIx	4	176229984	B2RXE6|Q8TF26|Q96GP4	Silent	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IG,superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1,HMMPfam_ZU5,HMMSmart_ZU5,superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death	p.G243	ENST00000329542.4	37	c.729	CCDS34299.1	5	.	.	.	.	.	.	.	.	.	.	C	8.841	0.942351	0.18281	.	.	ENSG00000113763	ENST00000509580	.	.	.	4.45	2.33	0.28932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-39.5248	3.2995	0.06978	0.2446:0.522:0.1293:0.1041	.	.	.	.	X	265	.	.	Q	+	1	0	UNC5A	176229984	0.954000	0.32549	1.000000	0.80357	0.724000	0.41520	0.171000	0.16685	0.822000	0.34565	0.289000	0.19496	CAG	-	superfamily_TSP1		0.682	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5A	protein_coding	OTTHUMT00000372166.1	C	XM_030300		176229984	+1	no_errors	NM_133369	genbank	human	validated	54_36p	silent	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	3	180042799	180042799	+	IGR	SNP	A	A	C			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr3:180042799A>C								RNA5SP149 (163034 upstream) : RP11-420J11.2 (89162 downstream)																							AAAGGCAGGCAAAGAGCCGGT	0.632																																																0			3																																								181525493	SO:0001628	intergenic_variant	131054																															3.37:g.180042799A>C		Somatic		Capture	Illumina GAIIx	4	181525493		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.632					LOC131054			A			181525493	+1	pseudogene	XR_017452	genbank	human	model	54_36p	rna	SNP	0.996	C
TMEM44	93109	genome.wustl.edu	37	3	194313777	194313777	+	Intron	SNP	G	G	A			TCGA-29-1707-01A-01W-0633-09	TCGA-29-1707-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db789a5f-7121-4c07-9318-69b20a09b845	b8634be5-d88b-44bc-8b90-2ace472f3a2a	g.chr3:194313777G>A	ENST00000392432.2	-	11	1523				TMEM44-AS1_ENST00000453671.1_RNA|TMEM44_ENST00000381975.3_Intron|TMEM44_ENST00000273580.7_Missense_Mutation_p.S401L|TMEM44_ENST00000473092.1_Missense_Mutation_p.S400L|TMEM44-AS1_ENST00000447982.1_RNA|TMEM44_ENST00000347147.4_Intron|TMEM44-AS1_ENST00000419571.1_RNA	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44							integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		TACCTGCTCCGAGTTTAGGGC	0.468																																																0			3											144.0	145.0	145.0					3																	194313777		2203	4300	6503	195795066	SO:0001627	intron_variant	93109			AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.1318-4409C>T	3.37:g.194313777G>A		Somatic		Capture	Illumina GAIIx	4	195795066	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	Missense_Mutation	SNP	NULL	p.S401L	ENST00000392432.2	37	c.1202	CCDS54699.1	3	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148761	0.57151	.	.	ENSG00000145014	ENST00000273580;ENST00000432352;ENST00000473092	T;T	0.33216	1.42;1.42	4.42	1.58	0.23477	.	.	.	.	.	T	0.23249	0.0562	L	0.40543	1.245	0.22745	N	0.998782	B;B	0.22983	0.078;0.078	B;B	0.15052	0.012;0.012	T	0.20806	-1.0264	9	0.66056	D	0.02	.	7.1761	0.25744	0.3036:0.0:0.6964:0.0	.	400;401	E9PGA9;Q2T9K0-6	.;.	L	401;159;400	ENSP00000273580:S401L;ENSP00000418674:S400L	ENSP00000273580:S401L	S	-	2	0	TMEM44	195795066	1.000000	0.71417	0.962000	0.40283	0.953000	0.61014	0.838000	0.27572	0.186000	0.20125	0.591000	0.81541	TCG	-	NULL		0.468	TMEM44-002	KNOWN	basic|CCDS	protein_coding	TMEM44	protein_coding	OTTHUMT00000342750.1	G	NM_138399		195795066	-1	no_errors	NM_138399	genbank	human	validated	54_36p	missense	SNP	0.997	A
