#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								13559	SO:0001628	intergenic_variant	4540																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	13559		Missense_Mutation	SNP	HMMPfam_Oxidored_q1_N,HMMPfam_Oxidored_q1,HMMPfam_NADH5_C	p.A408T		37	c.1222		MT																																																																																			-	NULL	0	0					MT-ND5			G			13559	+1	no_errors	ENST00000361567	ensembl	human	known	54_36p	missense	SNP	NULL	A
DEFB129	140881	genome.wustl.edu	37	20	210326	210326	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr20:210326G>T	ENST00000246105.4	+	2	497	c.466G>T	c.(466-468)Gcc>Tcc	p.A156S		NM_080831.3	NP_543021.1	Q9H1M3	DB129_HUMAN	defensin, beta 129	156					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|stomach(1)	9		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			CAGAGATTCTGCCACTGCCTC	0.512																																																0			20											125.0	112.0	116.0					20																	210326		2203	4300	6503	158326	SO:0001583	missense	140881			AY358186	CCDS12992.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125903	ENSG00000125903		"""Defensins, beta"""	16218	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 87"""	C20orf87		11854508	Standard	NM_080831		Approved	bA530N10.3, DEFB-29	uc002wda.3	Q9H1M3	OTTHUMG00000031618	ENST00000246105.4:c.466G>T	20.37:g.210326G>T	ENSP00000246105:p.Ala156Ser	Somatic		Capture	Illumina GAIIx	4	158326	Q8NES7	Missense_Mutation	SNP	NULL	p.A156S	ENST00000246105.4	37	c.466	CCDS12992.1	20	.	.	.	.	.	.	.	.	.	.	G	13.31	2.198543	0.38806	.	.	ENSG00000125903	ENST00000246105	T	0.43688	0.94	4.26	2.27	0.28462	.	0.891435	0.09560	N	0.785724	T	0.30665	0.0772	L	0.32530	0.975	0.09310	N	1	P	0.46987	0.888	B	0.41571	0.36	T	0.10965	-1.0607	10	0.39692	T	0.17	-1.1742	6.0935	0.20007	0.1032:0.1901:0.7067:0.0	.	156	Q9H1M3	DB129_HUMAN	S	156	ENSP00000246105:A156S	ENSP00000246105:A156S	A	+	1	0	DEFB129	158326	0.002000	0.14202	0.001000	0.08648	0.040000	0.13550	0.768000	0.26590	0.732000	0.32470	0.462000	0.41574	GCC	-	NULL		0.512	DEFB129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB129	protein_coding	OTTHUMT00000077430.2	G	NM_080831		158326	+1	no_errors	NM_080831	genbank	human	validated	54_36p	missense	SNP	0.000	T
C20orf194	25943	genome.wustl.edu	37	20	3298935	3298935	+	Splice_Site	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr20:3298935C>A	ENST00000252032.9	-	17	1536		c.e17+1		C20orf194_ENST00000453730.2_Splice_Site|C20orf194_ENST00000498079.1_5'Flank	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194											NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						CATATACTTACCCTTTTCTTT	0.333																																																0			20											80.0	78.0	79.0					20																	3298935		1813	4076	5889	3246935	SO:0001630	splice_region_variant	25943			AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.1468+1G>T	20.37:g.3298935C>A		Somatic		Capture	Illumina GAIIx	4	3246935	Q66K86|Q6P2R9|Q9UFX9	Splice_Site	SNP	-	e17+1	ENST00000252032.9	37	c.1468+1	CCDS42851.1	20	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195139	0.58017	.	.	ENSG00000088854	ENST00000252032;ENST00000453730	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4594	0.90734	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C20orf194	3246935	1.000000	0.71417	0.998000	0.56505	0.615000	0.37417	5.962000	0.70364	2.639000	0.89480	0.650000	0.86243	.	-	-		0.333	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf194	protein_coding	OTTHUMT00000077734.1	C	NM_001009984	Intron	3246935	-1	no_errors	NM_001009984	genbank	human	validated	54_36p	splice_site	SNP	0.998	A
RASSF2	9770	genome.wustl.edu	37	20	4768359	4768359	+	Nonsense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr20:4768359G>A	ENST00000379400.3	-	10	928	c.733C>T	c.(733-735)Cga>Tga	p.R245*	RASSF2_ENST00000379376.2_Nonsense_Mutation_p.R245*|RASSF2_ENST00000478553.1_Intron	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	245	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						TGGAGGATTCGGGCAATCAGC	0.542																																					Melanoma(158;1891 3343 50738)											0			20											138.0	115.0	123.0					20																	4768359		2203	4300	6503	4716359	SO:0001587	stop_gained	9770			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.733C>T	20.37:g.4768359G>A	ENSP00000368710:p.Arg245*	Somatic		Capture	Illumina GAIIx	4	4716359	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Nonsense_Mutation	SNP	HMMSmart_RA,HMMPfam_RA	p.R245*	ENST00000379400.3	37	c.733	CCDS13083.1	20	.	.	.	.	.	.	.	.	.	.	G	37	6.172061	0.97348	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	.	.	.	5.41	4.42	0.53409	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4701	0.67512	0.0:0.0:0.8531:0.1469	.	.	.	.	X	245	.	ENSP00000368684:R245X	R	-	1	2	RASSF2	4716359	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.616000	0.54174	2.815000	0.96918	0.561000	0.74099	CGA	-	HMMSmart_RA,HMMPfam_RA		0.542	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	protein_coding	OTTHUMT00000077828.1	G	NM_014737		4716359	-1	no_errors	NM_014737	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
SAFB2	9667	genome.wustl.edu	37	19	5611182	5611182	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:5611182G>C	ENST00000252542.4	-	7	1358	c.1094C>G	c.(1093-1095)cCt>cGt	p.P365R	SAFB2_ENST00000591310.1_5'Flank	NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		AGGAGCCGGAGGGACTTCATT	0.493																																					Ovarian(127;888 1728 23957 44128 52668)											0			19											1.0	2.0	2.0					19																	5611182		1000	2134	3134	5562182	SO:0001583	missense	9667			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.1094C>G	19.37:g.5611182G>C	ENSP00000252542:p.Pro365Arg	Somatic		Capture	Illumina GAIIx	4	5562182	B4DKG3|Q8TB13	Missense_Mutation	SNP	superfamily_SSF68906,HMMPfam_SAP,HMMSmart_SAP,superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1	p.P365R	ENST00000252542.4	37	c.1094	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431575	0.62844	.	.	ENSG00000130254	ENST00000434962;ENST00000415313;ENST00000394625;ENST00000252542	T	0.08807	3.05	5.31	5.31	0.75309	.	0.118717	0.38436	N	0.001688	T	0.12561	0.0305	M	0.62723	1.935	0.48185	D	0.9996	P	0.45902	0.868	B	0.39068	0.289	T	0.06023	-1.0850	10	0.33940	T	0.23	-11.5625	18.9863	0.92771	0.0:0.0:1.0:0.0	.	365	Q14151	SAFB2_HUMAN	R	261;116;365;365	ENSP00000252542:P365R	ENSP00000252542:P365R	P	-	2	0	SAFB2	5562182	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.258000	0.89853	2.500000	0.84329	0.561000	0.74099	CCT	-	NULL		0.493	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	protein_coding	OTTHUMT00000451016.1	G	NM_014649		5562182	-1	no_errors	NM_014649	genbank	human	validated	54_36p	missense	SNP	1.000	C
OR52N1	79473	genome.wustl.edu	37	11	5810026	5810026	+	Silent	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:5810026G>A	ENST00000317078.1	-	1	20	c.21C>T	c.(19-21)acC>acT	p.T7T	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		GAGTTAGGCTGGTGCCATTTA	0.403																																																0			11											69.0	65.0	66.0					11																	5810026		2201	4296	6497	5766602	SO:0001819	synonymous_variant	79473			AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.21C>T	11.37:g.5810026G>A		Somatic		Capture	Illumina GAIIx	4	5766602	Q6IFF6	Silent	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.T7	ENST00000317078.1	37	c.21	CCDS31398.1	11																																																																																			-	superfamily_SSF81321		0.403	OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N1	protein_coding	OTTHUMT00000401142.1	G	NM_001001913		5766602	-1	no_errors	NM_001001913	genbank	human	provisional	54_36p	silent	SNP	0.000	A
RANBP3	8498	genome.wustl.edu	37	19	5914436	5914436	+	IGR	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:5914436A>G	ENST00000340578.6	-	0	3233				AC104532.2_ENST00000588891.1_3'UTR|CAPS_ENST00000588776.1_Missense_Mutation_p.T93A|CAPS_ENST00000452990.2_Missense_Mutation_p.T7A|CAPS_ENST00000222125.5_Missense_Mutation_p.T7A|AC104532.4_ENST00000591109.1_RNA	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3						intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CGTGGATGCCACCATGGAGAA	0.692																																																0			19											56.0	58.0	57.0					19																	5914436		2203	4300	6503	5865436	SO:0001628	intergenic_variant	828			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4			19.37:g.5914436A>G		Somatic		Capture	Illumina GAIIx	4	5865436	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1	p.T7A	ENST00000340578.6	37	c.19	CCDS42478.1	19	.	.	.	.	.	.	.	.	.	.	A	5.245	0.230743	0.09969	.	.	ENSG00000105519	ENST00000394521;ENST00000222125;ENST00000452990	T;T	0.50813	0.73;0.99	4.83	2.7	0.31948	.	0.470871	0.20293	N	0.095196	T	0.24314	0.0589	N	0.16743	0.435	0.23946	N	0.99639	B;B	0.12013	0.005;0.0	B;B	0.11329	0.006;0.0	T	0.21008	-1.0258	10	0.10902	T	0.67	-11.0005	4.9104	0.13820	0.715:0.1868:0.0981:0.0	.	140;7	Q8NF12;Q13938	.;CAYP1_HUMAN	A	140;7;7	ENSP00000222125:T7A;ENSP00000403263:T7A	ENSP00000222125:T7A	T	+	1	0	CAPS	5865436	0.965000	0.33210	0.197000	0.23402	0.043000	0.13939	1.784000	0.38674	0.315000	0.23110	0.459000	0.35465	ACC	-	NULL		0.692	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAPS	protein_coding	OTTHUMT00000452304.1	A	NM_007322		5865436	+1	no_errors	NM_004058	genbank	human	validated	54_36p	missense	SNP	0.362	G
VWF	7450	genome.wustl.edu	37	12	6094775	6094775	+	Silent	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:6094775G>A	ENST00000261405.5	-	39	7109	c.6855C>T	c.(6853-6855)agC>agT	p.S2285S		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2285	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CCTTCCGCCCGCTGAGGCATG	0.622																																																0			12											61.0	54.0	56.0					12																	6094775		2203	4300	6503	5965036	SO:0001819	synonymous_variant	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.6855C>T	12.37:g.6094775G>A		Somatic		Capture	Illumina GAIIx	4	5965036	Q8TCE8|Q99806	Silent	SNP	HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMPfam_TIL,HMMSmart_SM00214,HMMSmart_SM00215,superfamily_PMP inhibitors,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_VWC,PatternScan_VWFC_1,HMMSmart_SM00041,PatternScan_CTCK_1	p.S2285	ENST00000261405.5	37	c.6855	CCDS8539.1	12																																																																																			-	HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1		0.622	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	protein_coding	OTTHUMT00000399020.1	G	NM_000552		5965036	-1	no_errors	NM_000552	genbank	human	reviewed	54_36p	silent	SNP	0.652	A
CRLS1	54675	genome.wustl.edu	37	20	6017787	6017787	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr20:6017787C>T	ENST00000378863.4	+	7	1046	c.889C>T	c.(889-891)Cag>Tag	p.Q297*	CRLS1_ENST00000378868.4_Nonsense_Mutation_p.Q198*|CRLS1_ENST00000452938.1_3'UTR	NM_019095.4	NP_061968.1	Q9UJA2	CRLS1_HUMAN	cardiolipin synthase 1	297					cardiolipin biosynthetic process (GO:0032049)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			lung(3)|ovary(1)	4						GAAGACTGTTCAGGTGATAAA	0.398																																																0			20											113.0	106.0	109.0					20																	6017787		2203	4300	6503	5965787	SO:0001587	stop_gained	54675			AF241784	CCDS13096.1, CCDS46578.1	20p13-p12.3	2006-04-04	2006-04-04	2006-04-04	ENSG00000088766	ENSG00000088766			16148	protein-coding gene	gene with protein product	"""GCD10 homolog (S. cerevisiae)"""	608188	"""chromosome 20 open reading frame 155"""	C20orf155		16547353	Standard	NM_019095		Approved	dJ967N21.6, CLS1, GCD10	uc002wmn.4	Q9UJA2	OTTHUMG00000031823	ENST00000378863.4:c.889C>T	20.37:g.6017787C>T	ENSP00000368140:p.Gln297*	Somatic		Capture	Illumina GAIIx	4	5965787	D3DW09|E9PAT4|Q27RP0|Q69YQ5	Nonsense_Mutation	SNP	PatternScan_CDP_ALCOHOL_P_TRANSF,HMMPfam_CDP-OH_P_transf	p.Q297*	ENST00000378863.4	37	c.889	CCDS13096.1	20	.	.	.	.	.	.	.	.	.	.	C	32	5.128497	0.94473	.	.	ENSG00000088766	ENST00000378863;ENST00000378868	.	.	.	5.68	5.68	0.88126	.	0.376325	0.31922	N	0.006849	.	.	.	.	.	.	0.50039	D	0.99984	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.2456	12.2598	0.54645	0.1696:0.8304:0.0:0.0	.	.	.	.	X	297;198	.	ENSP00000368140:Q297X	Q	+	1	0	CRLS1	5965787	0.997000	0.39634	1.000000	0.80357	0.974000	0.67602	2.582000	0.46085	2.680000	0.91292	0.655000	0.94253	CAG	-	NULL		0.398	CRLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRLS1	protein_coding	OTTHUMT00000077902.2	C	NM_019095		5965787	+1	no_errors	NM_019095	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
POLR2A	5430	genome.wustl.edu	37	17	7416196	7416196	+	Silent	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:7416196C>G	ENST00000322644.6	+	28	5109	c.4710C>G	c.(4708-4710)ggC>ggG	p.G1570G		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1570					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				CCACACCGGGCTCCCCGGGGT	0.637																																																0			17											60.0	72.0	68.0					17																	7416196		2203	4300	6503	7356920	SO:0001819	synonymous_variant	5430					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.4710C>G	17.37:g.7416196C>G		Somatic		Capture	Illumina GAIIx	4	7356920	A6NN93|B9EH88|Q6NX41	Silent	SNP	superfamily_SSF64484,HMMPfam_RNA_pol_Rpb1_1,HMMPfam_RNA_pol_Rpb1_2,HMMPfam_RNA_pol_Rpb1_3,HMMPfam_RNA_pol_Rpb1_4,HMMPfam_RNA_pol_Rpb1_5,HMMPfam_RNA_pol_Rpb1_6,HMMPfam_RNA_pol_Rpb1_7,HMMPfam_RNA_pol_Rpb1_R,PatternScan_RNA_POL_II_REPEAT	p.G1570	ENST00000322644.6	37	c.4710	CCDS32548.1	17																																																																																			-	NULL		0.637	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2A	protein_coding	OTTHUMT00000437967.1	C	NM_000937		7356920	+1	no_errors	NM_000937	genbank	human	provisional	54_36p	silent	SNP	1.000	G
UTS2	10911	genome.wustl.edu	37	1	7910899	7910899	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:7910899C>G	ENST00000361696.5	-	2	218	c.187G>C	c.(187-189)Gaa>Caa	p.E63Q	UTS2_ENST00000054668.5_Missense_Mutation_p.E78Q|UTS2_ENST00000377516.2_Missense_Mutation_p.E63Q	NM_006786.3	NP_006777.1	O95399	UTS2_HUMAN	urotensin 2	63					muscle contraction (GO:0006936)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of heart rate (GO:0010459)|negative regulation of insulin secretion (GO:0046676)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell differentiation (GO:0045597)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of heart rate (GO:0010460)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to testosterone (GO:0033574)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			kidney(1)|lung(4)|urinary_tract(1)	6	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)		TCCCCTCTTTCTGCACCCAGC	0.453																																																0			1											139.0	133.0	135.0					1																	7910899		2203	4300	6503	7833486	SO:0001583	missense	10911			AF104118	CCDS90.1, CCDS91.1	1p36	2013-02-28			ENSG00000049247	ENSG00000049247		"""Endogenous ligands"""	12636	protein-coding gene	gene with protein product	"""prepro U-II"""	604097				9861051, 10499587	Standard	NM_021995		Approved	UII, U-II, UCN2, PRO1068	uc001aos.3	O95399	OTTHUMG00000001218	ENST00000361696.5:c.187G>C	1.37:g.7910899C>G	ENSP00000355163:p.Glu63Gln	Somatic		Capture	Illumina GAIIx	4	7833486	Q5H8X7|Q6UXF6|Q9UKP7	Missense_Mutation	SNP	HMMPfam_Urotensin_II,PatternScan_UROTENSIN_II	p.E78Q	ENST00000361696.5	37	c.232	CCDS91.1	1	.	.	.	.	.	.	.	.	.	.	C	10.47	1.360008	0.24598	.	.	ENSG00000049247	ENST00000377516;ENST00000400910;ENST00000361696;ENST00000054668	T;T;T	0.35605	1.3;1.37;1.34	5.6	2.37	0.29283	.	1.123880	0.06622	N	0.757552	T	0.32164	0.0820	L	0.47716	1.5	0.09310	N	1	B;B;B	0.28850	0.225;0.144;0.112	B;B;B	0.26517	0.07;0.021;0.032	T	0.27872	-1.0061	10	0.42905	T	0.14	-0.008	8.0004	0.30293	0.0:0.4852:0.4216:0.0932	.	78;63;63	O95399-2;O95399;Q5H8X8	.;UTS2_HUMAN;.	Q	63;63;63;78	ENSP00000366738:E63Q;ENSP00000355163:E63Q;ENSP00000054668:E78Q	ENSP00000054668:E78Q	E	-	1	0	UTS2	7833486	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.060000	0.14342	0.755000	0.32990	0.650000	0.86243	GAA	-	NULL		0.453	UTS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UTS2	protein_coding	OTTHUMT00000003612.1	C	NM_006786		7833486	-1	no_errors	NM_021995	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
ACOX3	8310	genome.wustl.edu	37	4	8407685	8407685	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr4:8407685T>A	ENST00000356406.5	-	7	850	c.773A>T	c.(772-774)aAt>aTt	p.N258I	ACOX3_ENST00000503233.1_Missense_Mutation_p.N258I|ACOX3_ENST00000413009.2_Missense_Mutation_p.N258I	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	258					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						CACTCACCCATTATCCAGACC	0.562																																																0			4											175.0	161.0	166.0					4																	8407685		2203	4300	6503	8458585	SO:0001583	missense	8310			Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.773A>T	4.37:g.8407685T>A	ENSP00000348775:p.Asn258Ile	Somatic		Capture	Illumina GAIIx	4	8458585	Q96AJ8	Missense_Mutation	SNP	superfamily_Acyl-CoA dehydrogenase NM domain-like,HMMPfam_Acyl-CoA_dh_M,HMMPfam_Acyl-CoA_dh_1,superfamily_Acyl-CoA dehydrogenase C-terminal domain-like,HMMPfam_ACOX	p.N258I	ENST00000356406.5	37	c.773	CCDS3401.1	4	.	.	.	.	.	.	.	.	.	.	T	15.74	2.922308	0.52653	.	.	ENSG00000087008	ENST00000413009;ENST00000356406;ENST00000503233	T;T;T	0.64260	-0.09;-0.09;-0.09	4.5	4.5	0.54988	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.117381	0.56097	D	0.000027	T	0.81069	0.4746	M	0.88640	2.97	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.972;0.988;0.972	D	0.85000	0.0899	10	0.87932	D	0	.	13.1964	0.59740	0.0:0.0:0.0:1.0	.	258;258;258	B2R856;O15254-2;O15254	.;.;ACOX3_HUMAN	I	258	ENSP00000413994:N258I;ENSP00000348775:N258I;ENSP00000421625:N258I	ENSP00000348775:N258I	N	-	2	0	ACOX3	8458585	1.000000	0.71417	0.963000	0.40424	0.079000	0.17450	5.137000	0.64789	2.013000	0.59113	0.383000	0.25322	AAT	-	superfamily_Acyl-CoA dehydrogenase NM domain-like		0.562	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOX3	protein_coding	OTTHUMT00000206997.4	T			8458585	-1	no_errors	NM_003501	genbank	human	validated	54_36p	missense	SNP	1.000	A
COL5A3	50509	genome.wustl.edu	37	19	10099829	10099829	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:10099829G>T	ENST00000264828.3	-	27	2201	c.2116C>A	c.(2116-2118)Ccg>Acg	p.P706T		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	706	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GGATAGCCCGGAGGGCCTGCC	0.552																																																0			19											70.0	75.0	73.0					19																	10099829		2203	4300	6503	9960829	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2116C>A	19.37:g.10099829G>T	ENSP00000264828:p.Pro706Thr	Somatic		Capture	Illumina GAIIx	4	9960829	Q9NZQ6	Missense_Mutation	SNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2,HMMPfam_Collagen,HMMSmart_SM00038,HMMPfam_COLFI	p.P706T	ENST00000264828.3	37	c.2116	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	G	0.094	-1.162808	0.01673	.	.	ENSG00000080573	ENST00000264828	D	0.97041	-4.22	3.73	-0.0253	0.13935	.	0.863558	0.10039	N	0.723725	D	0.93096	0.7802	L	0.55743	1.74	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.81607	-0.0856	10	0.13853	T	0.58	.	3.6924	0.08351	0.097:0.1336:0.5419:0.2275	.	706	P25940	CO5A3_HUMAN	T	706	ENSP00000264828:P706T	ENSP00000264828:P706T	P	-	1	0	COL5A3	9960829	0.000000	0.05858	0.213000	0.23690	0.163000	0.22366	0.597000	0.24059	0.047000	0.15862	-1.268000	0.01426	CCG	-	NULL		0.552	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	protein_coding	OTTHUMT00000315788.1	G	NM_015719		9960829	-1	no_errors	NM_015719	genbank	human	reviewed	54_36p	missense	SNP	0.087	T
C3P1	388503	genome.wustl.edu	37	19	10163254	10163254	+	RNA	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:10163254A>G	ENST00000495140.1	+	0	1513							Q6ZMU1	C3P1_HUMAN	complement component 3 precursor pseudogene							extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)			endometrium(4)|large_intestine(2)|lung(6)|urinary_tract(1)	13						TGAACATGGTACCCGACACGG	0.562																																																0			19											104.0	106.0	105.0					19																	10163254		1983	4161	6144	10024254			0			AK131489		19p13.2	2009-04-08			ENSG00000167798	ENSG00000167798			34414	pseudogene	pseudogene							Standard	NR_027300		Approved	CPLP	uc010dwx.2	Q6ZMU1	OTTHUMG00000158555		19.37:g.10163254A>G		Somatic		Capture	Illumina GAIIx	4	10024254		Silent	SNP	HMMPfam_A2M,superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_A2M_comp	p.V156	ENST00000495140.1	37	c.468		19																																																																																			-	NULL		0.562	C3P1-002	KNOWN	basic	processed_transcript	uc010dwx.1	pseudogene	OTTHUMT00000351284.1	A	NR_027300		10024254	+1	no_errors	ENST00000333905	ensembl	human	known	54_36p	silent	SNP	0.299	G
TYK2	7297	genome.wustl.edu	37	19	10464312	10464312	+	Silent	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:10464312C>T	ENST00000525621.1	-	21	3400	c.2919G>A	c.(2917-2919)tcG>tcA	p.S973S	TYK2_ENST00000529422.1_5'Flank|TYK2_ENST00000264818.6_Silent_p.S973S|TYK2_ENST00000524462.1_Silent_p.S788S	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	973	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CCAGCTGCAGCGACTTCTCGC	0.711																																																0			19											12.0	15.0	14.0					19																	10464312		2190	4282	6472	10325312	SO:0001819	synonymous_variant	7297				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.2919G>A	19.37:g.10464312C>T		Somatic		Capture	Illumina GAIIx	4	10325312	Q6QB10|Q96CH0	Silent	SNP	PatternScan_FERM_1,PatternScan_FERM_2,HMMSmart_B41,superfamily_SSF55550,HMMSmart_SH2,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.S973	ENST00000525621.1	37	c.2919	CCDS12236.1	19																																																																																			-	superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc		0.711	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	protein_coding	OTTHUMT00000389443.1	C			10325312	-1	no_errors	NM_003331	genbank	human	reviewed	54_36p	silent	SNP	0.878	T
MYH1	4619	genome.wustl.edu	37	17	10415997	10415997	+	Splice_Site	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:10415997C>T	ENST00000226207.5	-	11	1103		c.e11+1		CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult						muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GTATAACTTACATCTGTAGCC	0.393																																																0			17											161.0	156.0	158.0					17																	10415997		2203	4300	6503	10356722	SO:0001630	splice_region_variant	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.1008+1G>A	17.37:g.10415997C>T		Somatic		Capture	Illumina GAIIx	4	10356722	Q14CA4|Q9Y622	Splice_Site	SNP	-	e9+1	ENST00000226207.5	37	c.1008+1	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	C	16.73	3.204498	0.58234	.	.	ENSG00000109061	ENST00000226207;ENST00000379814	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH1	10356722	1.000000	0.71417	1.000000	0.80357	0.440000	0.31957	7.787000	0.85759	2.941000	0.99782	0.655000	0.94253	.	-	-		0.393	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	C	NM_005963	Intron	10356722	-1	no_errors	NM_005963	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
CTR9	9646	genome.wustl.edu	37	11	10795601	10795601	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:10795601G>T	ENST00000361367.2	+	22	3196	c.2770G>T	c.(2770-2772)Gac>Tac	p.D924Y		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	924	Lys-rich.				cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TGTCAATGATGACACTGATGA	0.403																																																0			11											189.0	172.0	178.0					11																	10795601		2201	4294	6495	10752177	SO:0001583	missense	9646			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2770G>T	11.37:g.10795601G>T	ENSP00000355013:p.Asp924Tyr	Somatic		Capture	Illumina GAIIx	4	10752177	D3DQV8|Q15015	Missense_Mutation	SNP	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR	p.D924Y	ENST00000361367.2	37	c.2770	CCDS7805.1	11	.	.	.	.	.	.	.	.	.	.	G	27.4	4.824304	0.90955	.	.	ENSG00000198730	ENST00000361367	T	0.50548	0.74	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.55970	0.1954	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.62134	-0.6918	10	0.87932	D	0	-28.6423	20.3539	0.98825	0.0:0.0:1.0:0.0	.	924	Q6PD62	CTR9_HUMAN	Y	924	ENSP00000355013:D924Y	ENSP00000355013:D924Y	D	+	1	0	CTR9	10752177	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.810000	0.91950	2.826000	0.97356	0.655000	0.94253	GAC	-	NULL		0.403	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	protein_coding	OTTHUMT00000386215.1	G	NM_014633		10752177	+1	no_errors	NM_014633	genbank	human	provisional	54_36p	missense	SNP	1.000	T
GNAL	2774	genome.wustl.edu	37	18	11753861	11753861	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr18:11753861G>T	ENST00000423027.3	+	4	631	c.310G>T	c.(310-312)Gtt>Ttt	p.V104F	GNAL_ENST00000590972.1_3'UTR|GNAL_ENST00000269162.5_Missense_Mutation_p.V104F|GNAL_ENST00000535121.1_Missense_Mutation_p.V104F|GNAL_ENST00000334049.6_Missense_Mutation_p.V181F			P38405	GNAL_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type	104			Missing (in DYT25). {ECO:0000269|PubMed:23222958}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|response to amphetamine (GO:0001975)|response to caffeine (GO:0031000)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)	12						AATACCTCCAGTTCCGCTGGC	0.363																																																0			18											96.0	95.0	96.0					18																	11753861		2203	4300	6503	11743861	SO:0001583	missense	2774			AF493893	CCDS11851.1, CCDS11852.1, CCDS58614.1	18p11.22-p11.21	2003-12-17			ENSG00000141404	ENSG00000141404			4388	protein-coding gene	gene with protein product		139312				1302014	Standard	NM_182978		Approved		uc002kqc.3	P38405	OTTHUMG00000131660	ENST00000423027.3:c.310G>T	18.37:g.11753861G>T	ENSP00000408489:p.Val104Phe	Somatic		Capture	Illumina GAIIx	4	11743861	B7ZA26|Q86XU3	Missense_Mutation	SNP	HMMPfam_G-alpha,superfamily_SSF52540,superfamily_Transducn_insert	p.V181F	ENST00000423027.3	37	c.541	CCDS11852.1	18	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064267	0.76187	.	.	ENSG00000141404	ENST00000540217;ENST00000334049;ENST00000535121;ENST00000269162;ENST00000423027	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.69	4.82	0.62117	G protein alpha subunit, helical insertion (2);	0.052237	0.85682	D	0.000000	T	0.60261	0.2255	M	0.72118	2.19	0.80722	D	1	D;D	0.64830	0.975;0.994	P;D	0.69307	0.847;0.963	T	0.58222	-0.7674	10	0.20046	T	0.44	.	14.7598	0.69596	0.0693:0.0:0.9307:0.0	.	104;181	P38405;Q86XU3	GNAL_HUMAN;.	F	43;181;104;104;104	ENSP00000334051:V181F;ENSP00000439023:V104F;ENSP00000269162:V104F;ENSP00000408489:V104F	ENSP00000269162:V104F	V	+	1	0	GNAL	11743861	1.000000	0.71417	0.976000	0.42696	0.801000	0.45260	4.478000	0.60230	1.419000	0.47118	0.561000	0.74099	GTT	-	HMMPfam_G-alpha,superfamily_SSF52540,superfamily_Transducn_insert		0.363	GNAL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAL	protein_coding	OTTHUMT00000254561.2	G	NM_182978, NM_002071		11743861	+1	no_errors	NM_182978	genbank	human	validated	54_36p	missense	SNP	1.000	T
PRDM2	7799	genome.wustl.edu	37	1	14107062	14107062	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:14107062T>A	ENST00000235372.7	+	8	3628	c.2772T>A	c.(2770-2772)gaT>gaA	p.D924E	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000413440.1_Missense_Mutation_p.D723E|PRDM2_ENST00000311066.5_Missense_Mutation_p.D924E|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.D723E	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	924					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		CTCAGCCAGATCCTGACCTCG	0.512																																																0			1											91.0	90.0	90.0					1																	14107062		2203	4300	6503	13979649	SO:0001583	missense	7799			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.2772T>A	1.37:g.14107062T>A	ENSP00000235372:p.Asp924Glu	Somatic		Capture	Illumina GAIIx	4	13979649	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.D924E	ENST00000235372.7	37	c.2772	CCDS150.1	1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.904277	0.33628	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01464	4.99;4.86;4.88;4.88	5.97	-11.5	0.00074	.	0.272317	0.42172	N	0.000755	T	0.00524	0.0017	N	0.05124	-0.11	0.21897	N	0.99949	B;B;B	0.29136	0.001;0.15;0.234	B;B;B	0.25506	0.002;0.027;0.061	T	0.43766	-0.9371	10	0.08599	T	0.76	.	3.6231	0.08103	0.1247:0.4519:0.2543:0.1692	.	782;924;924	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	E	924;924;924;723;723	ENSP00000235372:D924E;ENSP00000312352:D924E;ENSP00000411103:D723E;ENSP00000341621:D723E	ENSP00000235372:D924E	D	+	3	2	PRDM2	13979649	0.000000	0.05858	0.261000	0.24466	0.995000	0.86356	-2.219000	0.01218	-1.613000	0.01577	0.533000	0.62120	GAT	-	NULL		0.512	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM2	protein_coding	OTTHUMT00000021792.2	T	NM_012231		13979649	+1	no_errors	NM_012231	genbank	human	reviewed	54_36p	missense	SNP	0.015	A
BFAR	51283	genome.wustl.edu	37	16	14738296	14738296	+	Silent	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr16:14738296A>G	ENST00000261658.2	+	2	370	c.93A>G	c.(91-93)gaA>gaG	p.E31E	RNU7-125P_ENST00000458760.1_RNA|BFAR_ENST00000426842.2_5'UTR|BFAR_ENST00000563971.1_Silent_p.E31E	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	31					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						CTGTTAGTGAATTTTCTTGCC	0.493																																																0			16											146.0	142.0	143.0					16																	14738296		2197	4300	6497	14645797	SO:0001819	synonymous_variant	51283			AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.93A>G	16.37:g.14738296A>G		Somatic		Capture	Illumina GAIIx	4	14645797	A8K4Z9|B4DUT0|D3DUG8	Silent	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_1	p.E31	ENST00000261658.2	37	c.93	CCDS10554.1	16																																																																																			-	superfamily_RING/U-box		0.493	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFAR	protein_coding	OTTHUMT00000252088.1	A	NM_016561		14645797	+1	no_errors	NM_016561	genbank	human	provisional	54_36p	silent	SNP	0.994	G
OR7A15P	26335	genome.wustl.edu	37	19	15038059	15038059	+	IGR	SNP	A	A	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:15038059A>C								OR7A17 (45795 upstream) : OR7C2 (14241 downstream)																							CTTGCTTATCATCCTGGTTAT	0.408																																																0			19																																								14899059	SO:0001628	intergenic_variant	0																															19.37:g.15038059A>C		Somatic		Capture	Illumina GAIIx	4	14899059		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.I13L		37	c.37		19																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1	0	0.408					ENSG00000176923			A			14899059	+1	no_errors	ENST00000321415	ensembl	human	known	54_36p	missense	SNP	0.000	C
MRGPRX2	117194	genome.wustl.edu	37	11	19077724	19077724	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:19077724A>C	ENST00000329773.2	-	2	313	c.226T>G	c.(226-228)Ttc>Gtc	p.F76V		NM_054030.2	NP_473371.1	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	76					positive regulation of cytokinesis (GO:0032467)|sensory perception of pain (GO:0019233)|sleep (GO:0030431)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide binding (GO:0042923)			NS(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	15						AGGAAGAGGAAGTCGGCCCCG	0.542																																					GBM(198;1966 2199 4849 37227 49954)											0			11											91.0	99.0	96.0					11																	19077724		2199	4293	6492	19034300	SO:0001583	missense	117194				CCDS7847.1	11p15.1	2013-10-10			ENSG00000183695	ENSG00000183695		"""GPCR / Class A : Orphans"""	17983	protein-coding gene	gene with protein product		607228				11551509	Standard	NM_054030		Approved	MRGX2	uc001mph.3	Q96LB1	OTTHUMG00000166098	ENST00000329773.2:c.226T>G	11.37:g.19077724A>C	ENSP00000333800:p.Phe76Val	Somatic		Capture	Illumina GAIIx	4	19034300	B5B0C7|Q4QXW4|Q4QXW7|Q4QXX0|Q4QXX2|Q4QXX3|Q4QXX4|Q4QXX6|Q4QXX7	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.F76V	ENST00000329773.2	37	c.226	CCDS7847.1	11	.	.	.	.	.	.	.	.	.	.	.	18.26	3.584232	0.65992	.	.	ENSG00000183695	ENST00000329773	T	0.21543	2.0	5.14	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.168676	0.42682	D	0.000664	T	0.45657	0.1353	M	0.82323	2.585	0.26395	N	0.976513	D	0.76494	0.999	D	0.73380	0.98	T	0.38542	-0.9656	10	0.87932	D	0	.	9.2464	0.37529	0.9145:0.0:0.0855:0.0	.	76	Q96LB1	MRGX2_HUMAN	V	76	ENSP00000333800:F76V	ENSP00000333800:F76V	F	-	1	0	MRGPRX2	19034300	0.961000	0.32948	0.198000	0.23420	0.088000	0.18126	0.465000	0.22004	1.093000	0.41377	0.533000	0.62120	TTC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.542	MRGPRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX2	protein_coding	OTTHUMT00000387819.1	A	NM_054030		19034300	-1	no_errors	NM_054030	genbank	human	provisional	54_36p	missense	SNP	0.988	C
OR4K2	390431	genome.wustl.edu	37	14	20344506	20344506	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr14:20344506T>C	ENST00000298642.2	+	1	116	c.80T>C	c.(79-81)tTc>tCc	p.F27S		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CAGATGTTTTTCTTTATGGTG	0.413																																																0			14											250.0	265.0	260.0					14																	20344506		2203	4300	6503	19414346	SO:0001583	missense	390431				CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.80T>C	14.37:g.20344506T>C	ENSP00000298642:p.Phe27Ser	Somatic		Capture	Illumina GAIIx	4	19414346	B2RNK8|Q6IFA5	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.F27S	ENST00000298642.2	37	c.80	CCDS32023.1	14	.	.	.	.	.	.	.	.	.	.	.	13.06	2.123776	0.37436	.	.	ENSG00000165762	ENST00000298642	T	0.03065	4.06	5.4	1.67	0.24075	.	0.263390	0.27155	N	0.020664	T	0.05044	0.0135	M	0.65677	2.01	0.32579	N	0.528701	B	0.10296	0.003	B	0.18561	0.022	T	0.05053	-1.0909	10	0.72032	D	0.01	.	5.1114	0.14811	0.2789:0.0778:0.0:0.6434	.	27	Q8NGD2	OR4K2_HUMAN	S	27	ENSP00000298642:F27S	ENSP00000298642:F27S	F	+	2	0	OR4K2	19414346	0.000000	0.05858	0.998000	0.56505	0.959000	0.62525	0.218000	0.17622	0.124000	0.18369	-0.301000	0.09380	TTC	-	superfamily_Family A G protein-coupled receptor-like		0.413	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K2	protein_coding	OTTHUMT00000409864.1	T			19414346	+1	no_errors	NM_001005501	genbank	human	provisional	54_36p	missense	SNP	0.060	C
IGHV4OR15-8	28317	genome.wustl.edu	37	15	22472947	22472947	+	RNA	SNP	C	C	T	rs552821433	byFrequency	TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr15:22472947C>T	ENST00000557788.2	-	0	323							A6NJ16	IV4F8_HUMAN	immunoglobulin heavy variable 4/OR15-8 (non-functional)							extracellular region (GO:0005576)											CGGCCCTGTCCGCGGCGGTCA	0.602																																																0			15																																								19974311			0			Z29598		15q11.2	2012-02-20	2008-09-15		ENSG00000259261	ENSG00000259261		"""Immunoglobulins / IGH orphons"""	5658	other	immunoglobulin gene			"""immunoglobulin heavy variable 4/OR15-8"", ""V-set and immunoglobulin domain containing 6"""	VSIG6		7951227	Standard			Approved	IGHV4/OR15-8, IGHV4OR158		A6NJ16	OTTHUMG00000171934		15.37:g.22472947C>T		Somatic		Capture	Illumina GAIIx	4	19974311		Silent	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406	p.A115	ENST00000557788.2	37	c.345		15																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406		0.602	IGHV4OR15-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	LOC642131	IG_V_gene	OTTHUMT00000415968.2	C			19974311	-1	no_errors	XM_001716834	genbank	human	model	54_36p	silent	SNP	0.541	T
MATN3	4148	genome.wustl.edu	37	2	20206050	20206050	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:20206050A>C	ENST00000407540.3	-	2	307	c.245T>G	c.(244-246)tTg>tGg	p.L82W	AC079145.4_ENST00000416575.1_RNA|MATN3_ENST00000421259.2_Missense_Mutation_p.L82W	NM_002381.4	NP_002372.1	O15232	MATN3_HUMAN	matrilin 3	82					extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCAGGTCCAAGGGTCTGCT	0.458																																																0			2											22.0	22.0	22.0					2																	20206050		1925	4136	6061	20069531	SO:0001583	missense	4148			AJ001047	CCDS46226.1	2p24-p23	2008-06-03			ENSG00000132031	ENSG00000132031			6909	protein-coding gene	gene with protein product		602109				9287130, 9350998	Standard	NM_002381		Approved	EDM5, HOA	uc002rdl.3	O15232	OTTHUMG00000151788	ENST00000407540.3:c.245T>G	2.37:g.20206050A>C	ENSP00000383894:p.Leu82Trp	Somatic		Capture	Illumina GAIIx	4	20069531	B2CPU0|Q4ZG02	Missense_Mutation	SNP	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_2,HMMPfam_Matrilin_ccoil	p.L82W	ENST00000407540.3	37	c.245	CCDS46226.1	2	.	.	.	.	.	.	.	.	.	.	A	21.7	4.183118	0.78677	.	.	ENSG00000132031	ENST00000407540;ENST00000421259	T;T	0.80738	-1.41;-1.41	5.93	5.93	0.95920	von Willebrand factor, type A (1);	0.139707	0.47852	D	0.000215	D	0.90184	0.6932	M	0.82433	2.59	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.77557	0.981;0.99	D	0.91391	0.5135	10	0.72032	D	0.01	-18.9431	15.5755	0.76380	1.0:0.0:0.0:0.0	.	82;82	B2CPU0;O15232	.;MATN3_HUMAN	W	82	ENSP00000383894:L82W;ENSP00000398753:L82W	ENSP00000383894:L82W	L	-	2	0	MATN3	20069531	0.977000	0.34250	0.970000	0.41538	0.696000	0.40369	9.297000	0.96120	2.281000	0.76405	0.533000	0.62120	TTG	-	superfamily_vWA-like,HMMSmart_SM00327		0.458	MATN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN3	protein_coding	OTTHUMT00000323925.1	A	NM_002381		20069531	-1	no_errors	NM_002381	genbank	human	reviewed	54_36p	missense	SNP	0.994	C
PUM2	23369	genome.wustl.edu	37	2	20490532	20490532	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:20490532C>G	ENST00000361078.2	-	9	1194	c.1172G>C	c.(1171-1173)gGt>gCt	p.G391A	PUM2_ENST00000403432.1_Missense_Mutation_p.G391A|PUM2_ENST00000338086.5_Missense_Mutation_p.G391A|PUM2_ENST00000536417.1_Missense_Mutation_p.G335A|PUM2_ENST00000319801.5_Missense_Mutation_p.G391A			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	391	Ala-rich.|Gln-rich.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGACGCTGACCTGCTCCAGC	0.413																																																0			2											65.0	59.0	61.0					2																	20490532		2203	4300	6503	20354013	SO:0001583	missense	23369			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.1172G>C	2.37:g.20490532C>G	ENSP00000354370:p.Gly391Ala	Somatic		Capture	Illumina GAIIx	4	20354013	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_PUF,HMMSmart_SM00025	p.G391A	ENST00000361078.2	37	c.1172		2	.	.	.	.	.	.	.	.	.	.	C	12.58	1.981547	0.34942	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417	T;T;T;T;T;T	0.19669	2.16;2.42;2.5;2.22;2.16;2.13	5.26	4.38	0.52667	.	0.178473	0.64402	D	0.000014	T	0.08891	0.0220	N	0.03608	-0.345	0.25780	N	0.984737	B;B;B	0.12013	0.0;0.005;0.0	B;B;B	0.10450	0.001;0.005;0.003	T	0.28776	-1.0033	10	0.11485	T	0.65	-6.31	12.0611	0.53562	0.128:0.733:0.139:0.0	.	335;391;391	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	A	391;391;391;282;391;335	ENSP00000338173:G391A;ENSP00000354370:G391A;ENSP00000326746:G391A;ENSP00000409905:G282A;ENSP00000385992:G391A;ENSP00000440093:G335A	ENSP00000326746:G391A	G	-	2	0	PUM2	20354013	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.088000	0.50175	1.336000	0.45506	0.591000	0.81541	GGT	-	NULL		0.413	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	PUM2	protein_coding		C	NM_015317		20354013	-1	no_errors	NM_015317	genbank	human	provisional	54_36p	missense	SNP	1.000	G
APOB	338	genome.wustl.edu	37	2	21233086	21233086	+	Silent	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:21233086G>A	ENST00000233242.1	-	26	6781	c.6654C>T	c.(6652-6654)atC>atT	p.I2218I		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2218				I -> T (in Ref. 4; AAB04636). {ECO:0000305}.	artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATTTACACGGATATGATAGT	0.254																																																0			2											33.0	35.0	34.0					2																	21233086		2200	4291	6491	21086591	SO:0001819	synonymous_variant	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6654C>T	2.37:g.21233086G>A		Somatic		Capture	Illumina GAIIx	4	21086591	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	superfamily_Lipovitellin-phosvitin complex beta-sheet shell regions,HMMPfam_Vitellogenin_N,HMMSmart_SM00638,superfamily_Lipovitellin-phosvitin complex superhelical domain,HMMPfam_DUF1943,HMMPfam_DUF1081	p.I2218	ENST00000233242.1	37	c.6654	CCDS1703.1	2																																																																																			-	NULL		0.254	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	G			21086591	-1	no_errors	NM_000384	genbank	human	reviewed	54_36p	silent	SNP	0.294	A
ZP2	7783	genome.wustl.edu	37	16	21213476	21213476	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr16:21213476C>A	ENST00000574002.1	-	12	1718	c.1236G>T	c.(1234-1236)caG>caT	p.Q412H	ZP2_ENST00000219593.4_Missense_Mutation_p.Q412H|ZP2_ENST00000574091.1_Missense_Mutation_p.Q412H|AF001550.7_ENST00000572747.1_RNA			Q05996	ZP2_HUMAN	zona pellucida glycoprotein 2 (sperm receptor)	412	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|intracellular protein transport (GO:0006886)|multicellular organism reproduction (GO:0032504)|prevention of polyspermy (GO:0060468)|signal transduction (GO:0007165)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|coreceptor activity (GO:0015026)	p.Q412H(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(16)|ovary(1)|prostate(1)|stomach(1)	41				GBM - Glioblastoma multiforme(48;0.0573)		GTACCAGCCCCTGAGACTGAG	0.507																																																1	Substitution - Missense(1)	lung(1)	16											86.0	77.0	80.0					16																	21213476		2200	4300	6500	21120977	SO:0001583	missense	7783			M90366	CCDS10596.1, CCDS73843.1	16p12	2014-07-04			ENSG00000103310	ENSG00000103310		"""Zona pellucida glycoproteins"""	13188	protein-coding gene	gene with protein product		182888				8385033	Standard	XM_005255562		Approved	ZPA	uc002dii.2	Q05996	OTTHUMG00000090681	ENST00000574002.1:c.1236G>T	16.37:g.21213476C>A	ENSP00000460971:p.Gln412His	Somatic		Capture	Illumina GAIIx	4	21120977	B2R7J2|Q4VAN9|Q4VAP0|Q4VAP1	Missense_Mutation	SNP	HMMPfam_Zona_pellucida,HMMSmart_SM00241,PatternScan_ZP_1	p.Q412H	ENST00000574002.1	37	c.1236	CCDS10596.1	16	.	.	.	.	.	.	.	.	.	.	C	14.11	2.439047	0.43326	.	.	ENSG00000103310	ENST00000219593	D	0.82081	-1.57	5.83	1.04	0.20106	Zona pellucida sperm-binding protein (3);	0.727375	0.13155	N	0.409533	D	0.83229	0.5209	L	0.52905	1.665	0.09310	N	1	P;P	0.52316	0.952;0.952	P;P	0.60682	0.878;0.878	T	0.69921	-0.5014	10	0.15499	T	0.54	0.0627	5.2858	0.15700	0.1372:0.4938:0.0:0.369	.	412;412	Q4VAP1;Q05996	.;ZP2_HUMAN	H	412	ENSP00000219593:Q412H	ENSP00000219593:Q412H	Q	-	3	2	ZP2	21120977	0.003000	0.15002	0.000000	0.03702	0.778000	0.44026	-0.027000	0.12371	0.034000	0.15491	0.467000	0.42956	CAG	-	HMMPfam_Zona_pellucida,HMMSmart_SM00241		0.507	ZP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZP2	protein_coding	OTTHUMT00000207365.2	C			21120977	-1	no_errors	NM_003460	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
TRAV18	28665	genome.wustl.edu	37	14	22471649	22471649	+	RNA	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr14:22471649C>A	ENST00000390446.3	+	0	177									T cell receptor alpha variable 18																		ACTCGGTTACCCAGACAGAAG	0.458																																																0			14											84.0	85.0	85.0					14																	22471649		1901	4136	6037	21541489			0			AE000660		14q11.2	2012-02-07			ENSG00000211798	ENSG00000211798		"""T cell receptors / TRA locus"""	12114	other	T cell receptor gene						8188290	Standard	NG_001332		Approved	TCRAV18S1			OTTHUMG00000170644		14.37:g.22471649C>A		Somatic		Capture	Illumina GAIIx	4	21541489		Silent	SNP	HMMPfam_V-set,superfamily_SSF48726	p.T24	ENST00000390446.3	37	c.72		14																																																																																			-	HMMPfam_V-set,superfamily_SSF48726		0.458	TRAV18-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	uc001wct.2	TR_V_gene	OTTHUMT00000409892.1	C	NG_001332		21541489	+1	no_stop_codon	ENST00000390446	ensembl	human	known	54_36p	silent	SNP	1.000	A
CD93	22918	genome.wustl.edu	37	20	23065155	23065155	+	Missense_Mutation	SNP	G	G	T	rs373765657		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr20:23065155G>T	ENST00000246006.4	-	1	1822	c.1675C>A	c.(1675-1677)Cag>Aag	p.Q559K		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	559					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCAGGCTCCTGGGGGCCAGAG	0.627																																																0			20											62.0	66.0	65.0					20																	23065155		2203	4300	6503	23013155	SO:0001583	missense	22918			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1675C>A	20.37:g.23065155G>T	ENSP00000246006:p.Gln559Lys	Somatic		Capture	Illumina GAIIx	4	23013155	O00274	Missense_Mutation	SNP	PatternScan_C_TYPE_LECTIN_1,HMMSmart_CLECT,superfamily_C-type_lectin_fold,HMMPfam_Lectin_C,HMMSmart_EGF,superfamily_SSF57196,PatternScan_EGF_2,HMMPfam_EGF,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL	p.Q559K	ENST00000246006.4	37	c.1675	CCDS13149.1	20	.	.	.	.	.	.	.	.	.	.	G	2.601	-0.293082	0.05568	.	.	ENSG00000125810	ENST00000246006	T	0.79454	-1.27	5.88	0.694	0.18062	.	3.672290	0.00896	N	0.002295	T	0.59865	0.2225	N	0.22421	0.69	0.09310	N	1	B	0.12013	0.005	B	0.01281	0.0	T	0.48127	-0.9062	10	0.05833	T	0.94	-0.0426	3.0003	0.06011	0.106:0.3275:0.3582:0.2083	.	559	Q9NPY3	C1QR1_HUMAN	K	559	ENSP00000246006:Q559K	ENSP00000246006:Q559K	Q	-	1	0	CD93	23013155	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.528000	0.06193	-0.077000	0.12752	-0.136000	0.14681	CAG	-	NULL		0.627	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD93	protein_coding	OTTHUMT00000078312.2	G	NM_012072		23013155	-1	no_errors	NM_012072	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
GPNMB	10457	genome.wustl.edu	37	7	23309694	23309694	+	Silent	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:23309694A>G	ENST00000381990.2	+	9	1526	c.1365A>G	c.(1363-1365)agA>agG	p.R455R	GPNMB_ENST00000453162.2_Silent_p.R397R|GPNMB_ENST00000258733.4_Silent_p.R443R|GPNMB_ENST00000539136.1_Silent_p.R344R	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	455					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			TGACTGTGAGACGAACCTTCA	0.552																																																0			7											197.0	148.0	165.0					7																	23309694		2203	4300	6503	23276219	SO:0001819	synonymous_variant	10457			X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.1365A>G	7.37:g.23309694A>G		Somatic		Capture	Illumina GAIIx	4	23276219	A4D155|Q6UVX1|Q8N1A1	Silent	SNP	superfamily_PKD domain,HMMSmart_SM00089,HMMPfam_PKD	p.R455	ENST00000381990.2	37	c.1365	CCDS34610.1	7																																																																																			-	NULL		0.552	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPNMB	protein_coding	OTTHUMT00000327152.1	A	NM_001005340		23276219	+1	no_errors	NM_001005340	genbank	human	reviewed	54_36p	silent	SNP	0.963	G
PRDM9	56979	genome.wustl.edu	37	5	23521258	23521258	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr5:23521258A>T	ENST00000296682.3	+	6	660	c.478A>T	c.(478-480)Acc>Tcc	p.T160S		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	160					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AGAAGCAAGTACCTCTGGACA	0.428										HNSCC(3;0.000094)																																						0			5											110.0	108.0	108.0					5																	23521258		1853	4105	5958	23557015	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.478A>T	5.37:g.23521258A>T	ENSP00000296682:p.Thr160Ser	Somatic		Capture	Illumina GAIIx	4	23557015	B4DX22|Q27Q50	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMSmart_KRAB,HMMPfam_KRAB,HMMPfam_SSXRD,superfamily_SSF82199,HMMSmart_SET,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667,HMMPfam_zf-C2H2	p.T160S	ENST00000296682.3	37	c.478	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	A	10.65	1.408440	0.25378	.	.	ENSG00000164256	ENST00000296682	T	0.09073	3.02	3.31	-4.05	0.03998	.	.	.	.	.	T	0.07728	0.0194	L	0.59436	1.845	0.09310	N	1	B	0.22800	0.075	B	0.15870	0.014	T	0.36648	-0.9739	9	0.87932	D	0	-3.9736	4.536	0.12032	0.3597:0.0:0.4607:0.1796	.	160	Q9NQV7	PRDM9_HUMAN	S	160	ENSP00000296682:T160S	ENSP00000296682:T160S	T	+	1	0	PRDM9	23557015	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.548000	0.06048	-0.803000	0.04415	-0.430000	0.05897	ACC	-	NULL		0.428	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	protein_coding	OTTHUMT00000366375.1	A	NM_020227		23557015	+1	no_errors	NM_020227	genbank	human	provisional	54_36p	missense	SNP	0.000	T
ADAM28	10863	genome.wustl.edu	37	8	24208817	24208817	+	Silent	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr8:24208817C>A	ENST00000265769.4	+	20	2282	c.2172C>A	c.(2170-2172)ccC>ccA	p.P724P	RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000397649.3_Missense_Mutation_p.P473T	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	724					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		CTGTTCAACCCCAAGAGGTGA	0.463																																					NSCLC(193;488 2149 22258 34798 40734)											0			8											136.0	126.0	129.0					8																	24208817		2203	4300	6503	24264762	SO:0001819	synonymous_variant	10863			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.2172C>A	8.37:g.24208817C>A		Somatic		Capture	Illumina GAIIx	4	24264762	B2RMV5|Q9Y339|Q9Y3S0	Silent	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMPfam_Disintegrin,HMMSmart_SM00050,superfamily_Blood coagulation inhibitor (disintegrin),PatternScan_DISINTEGRIN_1,HMMSmart_SM00608,HMMPfam_ADAM_CR,PatternScan_EGF_2"	p.P724	ENST00000265769.4	37	c.2172	CCDS34865.1	8	.	.	.	.	.	.	.	.	.	.	C	16.30	3.084474	0.55861	.	.	ENSG00000042980	ENST00000397649;ENST00000521629;ENST00000518326	T;T;T	0.16597	4.65;4.03;2.33	4.46	0.425	0.16473	.	.	.	.	.	T	0.14141	0.0342	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32107	-0.9919	6	0.87932	D	0	.	1.2073	0.01897	0.1757:0.4447:0.1707:0.2089	.	.	.	.	T	473;357;150	ENSP00000380770:P473T;ENSP00000429484:P357T;ENSP00000430094:P150T	ENSP00000380770:P473T	P	+	1	0	ADAM28	24264762	0.000000	0.05858	0.095000	0.20976	0.397000	0.30659	-1.830000	0.01699	0.065000	0.16485	-0.253000	0.11424	CCA	-	NULL		0.463	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	protein_coding	OTTHUMT00000375441.2	C	NM_021778		24264762	+1	no_errors	NM_014265	genbank	human	reviewed	54_36p	silent	SNP	0.349	A
CCDC149	91050	genome.wustl.edu	37	4	24839787	24839787	+	Silent	SNP	A	A	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr4:24839787A>C	ENST00000389609.4	-	6	623	c.480T>G	c.(478-480)gcT>gcG	p.A160A	CCDC149_ENST00000428116.2_Intron|CCDC149_ENST00000502801.1_Intron|CCDC149_ENST00000504487.1_Silent_p.A160A	NM_173463.4	NP_775734.2	Q6ZUS6	CC149_HUMAN	coiled-coil domain containing 149	105										cervix(1)|endometrium(1)|large_intestine(2)|lung(3)	7		Breast(46;0.173)				CCTGTTCCTTAGCTCGCTCTA	0.522																																																0			4											208.0	196.0	200.0					4																	24839787		2203	4300	6503	24448885	SO:0001819	synonymous_variant	91050				CCDS33967.1, CCDS47036.1, CCDS33967.2	4p15.2	2008-03-03				ENSG00000181982			25405	protein-coding gene	gene with protein product						17457313	Standard	NM_173463		Approved	DKFZp761B107	uc003grc.3	Q6ZUS6		ENST00000389609.4:c.480T>G	4.37:g.24839787A>C		Somatic		Capture	Illumina GAIIx	4	24448885	A6NJE7|B4DK90|B4DZG3|G5EA04|Q6NW41|Q8N3K8	Silent	SNP	HMMPfam_DUF2353	p.A105	ENST00000389609.4	37	c.315	CCDS33967.2	4																																																																																			-	HMMPfam_DUF2353		0.522	CCDC149-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	CCDC149	protein_coding	OTTHUMT00000360157.1	A	NM_173463		24448885	-1	no_errors	NM_173463	genbank	human	validated	54_36p	silent	SNP	0.141	C
NOVA1	4857	genome.wustl.edu	37	14	26917862	26917862	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr14:26917862G>T	ENST00000539517.2	-	5	1144	c.827C>A	c.(826-828)gCt>gAt	p.A276D	NOVA1_ENST00000465357.2_Missense_Mutation_p.A252D|NOVA1_ENST00000267422.7_Missense_Mutation_p.A154D	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	279	Ala-rich.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		TAACACTTCAGCAGTGTTTGC	0.498																																																0			14											120.0	111.0	114.0					14																	26917862		2203	4300	6503	25987702	SO:0001583	missense	4857			U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.827C>A	14.37:g.26917862G>T	ENSP00000438875:p.Ala276Asp	Somatic		Capture	Illumina GAIIx	4	25987702	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Missense_Mutation	SNP	HMMSmart_SM00322,superfamily_Eukaryotic type KH-domain (KH-domain type I),HMMPfam_KH_1	p.A276D	ENST00000539517.2	37	c.827	CCDS32061.1	14	.	.	.	.	.	.	.	.	.	.	G	19.77	3.888910	0.72524	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000267422;ENST00000449198	T;T;T;T	0.33865	1.44;1.45;1.4;1.39	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.37237	0.0996	L	0.40543	1.245	0.80722	D	1	P;P;P	0.52842	0.956;0.745;0.904	B;B;P	0.46718	0.444;0.247;0.525	T	0.04454	-1.0950	10	0.11794	T	0.64	-1.2449	19.8956	0.96956	0.0:0.0:1.0:0.0	.	279;252;276	P51513;D3DS81;P51513-4	NOVA1_HUMAN;.;.	D	252;276;154;235	ENSP00000447391:A252D;ENSP00000438875:A276D;ENSP00000267422:A154D;ENSP00000408914:A235D	ENSP00000267422:A154D	A	-	2	0	NOVA1	25987702	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.918000	0.87506	2.708000	0.92522	0.563000	0.77884	GCT	-	NULL		0.498	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOVA1	protein_coding	OTTHUMT00000073261.3	G	NM_006491		25987702	-1	no_errors	NM_002515	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
APBB1IP	54518	genome.wustl.edu	37	10	26822423	26822423	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr10:26822423T>C	ENST00000376236.4	+	9	1324	c.869T>C	c.(868-870)aTg>aCg	p.M290T		NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	290					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						AATGAGAAAATGAATGCTAAG	0.328																																																0			10											82.0	81.0	82.0					10																	26822423		2203	4300	6503	26862429	SO:0001583	missense	54518			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.869T>C	10.37:g.26822423T>C	ENSP00000365411:p.Met290Thr	Somatic		Capture	Illumina GAIIx	4	26862429	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	HMMPfam_RA,HMMSmart_RA,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.M290T	ENST00000376236.4	37	c.869	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	T	15.50	2.853375	0.51270	.	.	ENSG00000077420	ENST00000445780;ENST00000376236	T	0.34472	1.36	5.63	5.63	0.86233	.	0.036010	0.85682	D	0.000000	T	0.44623	0.1302	M	0.63843	1.955	0.80722	D	1	D;P	0.57257	0.979;0.94	P;P	0.48304	0.573;0.514	T	0.36407	-0.9749	10	0.35671	T	0.21	.	15.8336	0.78778	0.0:0.0:0.0:1.0	.	290;290	B4E100;Q7Z5R6	.;AB1IP_HUMAN	T	290	ENSP00000365411:M290T	ENSP00000365411:M290T	M	+	2	0	APBB1IP	26862429	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.873000	0.69644	2.151000	0.67156	0.528000	0.53228	ATG	-	NULL		0.328	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	protein_coding	OTTHUMT00000047270.1	T	NM_019043		26862429	+1	no_errors	NM_019043	genbank	human	validated	54_36p	missense	SNP	1.000	C
DSC1	1823	genome.wustl.edu	37	18	28714539	28714539	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr18:28714539C>A	ENST00000257198.5	-	12	2133	c.1872G>T	c.(1870-1872)aaG>aaT	p.K624N	RP11-408H20.2_ENST00000581836.1_RNA|RP11-408H20.3_ENST00000582307.1_RNA|DSC1_ENST00000257197.3_Missense_Mutation_p.K624N	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	624	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			ACATACCATCCTTTTCTTCTA	0.333																																																0			18											85.0	82.0	83.0					18																	28714539		2201	4300	6501	26968537	SO:0001583	missense	1823			AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.1872G>T	18.37:g.28714539C>A	ENSP00000257198:p.Lys624Asn	Somatic		Capture	Illumina GAIIx	4	26968537	Q9HB01	Missense_Mutation	SNP	HMMPfam_Cadherin_pro,superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1	p.K624N	ENST00000257198.5	37	c.1872	CCDS11894.1	18	.	.	.	.	.	.	.	.	.	.	C	9.324	1.058849	0.19987	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.59772	0.24;0.24	5.42	-2.46	0.06461	Cadherin (2);Cadherin-like (1);	0.469836	0.19436	N	0.114309	T	0.35278	0.0926	N	0.21097	0.63	0.09310	N	0.999999	P;P	0.50066	0.682;0.931	B;B	0.44224	0.205;0.444	T	0.40739	-0.9547	10	0.23891	T	0.37	.	5.0214	0.14363	0.2299:0.2996:0.0:0.4704	.	624;624	Q08554;Q9HB00	DSC1_HUMAN;.	N	624	ENSP00000257197:K624N;ENSP00000257198:K624N	ENSP00000257197:K624N	K	-	3	2	DSC1	26968537	0.026000	0.19158	0.127000	0.21898	0.615000	0.37417	-1.515000	0.02252	-0.451000	0.07097	0.591000	0.81541	AAG	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.333	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC1	protein_coding	OTTHUMT00000254946.1	C	NM_004948, NM_024421		26968537	-1	no_errors	NM_024421	genbank	human	reviewed	54_36p	missense	SNP	0.015	A
Unknown	0	genome.wustl.edu	37	15	31746312	31746312	+	IGR	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr15:31746312C>G								KLF13 (50199 upstream) : OTUD7A (29016 downstream)																							TCGGGGCGCGCTTGGAGGTGG	0.662																																																0			15																																								29533604	SO:0001628	intergenic_variant	400347																															15.37:g.31746312C>G		Somatic		Capture	Illumina GAIIx	4	29533604		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.662					LOC400347			C			29533604	-1	pseudogene	XR_016518	genbank	human	model	54_36p	rna	SNP	0.864	G
ASXL3	80816	genome.wustl.edu	37	18	31323118	31323118	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr18:31323118C>G	ENST00000269197.5	+	12	3306	c.3306C>G	c.(3304-3306)atC>atG	p.I1102M		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGGCACACATCAAAGAGCAGA	0.557																																																0			18											49.0	50.0	50.0					18																	31323118		1956	4144	6100	29577116	SO:0001583	missense	80816			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3306C>G	18.37:g.31323118C>G	ENSP00000269197:p.Ile1102Met	Somatic		Capture	Illumina GAIIx	4	29577116	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	NULL	p.I1102M	ENST00000269197.5	37	c.3306	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109883	0.56398	.	.	ENSG00000141431	ENST00000269197	T	0.52754	0.65	5.9	5.9	0.94986	.	0.839144	0.10428	N	0.675884	T	0.63271	0.2497	L	0.44542	1.39	0.39361	D	0.965918	D	0.76494	0.999	D	0.85130	0.997	T	0.57596	-0.7784	10	0.62326	D	0.03	.	13.4796	0.61328	0.0:0.9289:0.0:0.0711	.	1102	Q9C0F0	ASXL3_HUMAN	M	1102	ENSP00000269197:I1102M	ENSP00000269197:I1102M	I	+	3	3	ASXL3	29577116	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.392000	0.59659	2.786000	0.95864	0.650000	0.86243	ATC	-	NULL		0.557	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	protein_coding	OTTHUMT00000441865.2	C			29577116	+1	no_errors	NM_030632	genbank	human	validated	54_36p	missense	SNP	1.000	G
EHD3	30845	genome.wustl.edu	37	2	31489355	31489355	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:31489355G>C	ENST00000322054.5	+	6	1678	c.1393G>C	c.(1393-1395)Gct>Cct	p.A465P	EHD3_ENST00000541626.1_3'UTR	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	465	EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					GATCACAGGCGCTAATGCCAA	0.562																																																0			2											106.0	88.0	94.0					2																	31489355		2203	4300	6503	31342859	SO:0001583	missense	30845			AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1393G>C	2.37:g.31489355G>C	ENSP00000327116:p.Ala465Pro	Somatic		Capture	Illumina GAIIx	4	31342859	B4DFR5|D6W574|Q8N514|Q9NZB3	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N,superfamily_EF-hand,HMMSmart_SM00027,PatternScan_EF_HAND_1	p.A465P	ENST00000322054.5	37	c.1393	CCDS1774.1	2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.974448	0.74246	.	.	ENSG00000013016	ENST00000322054	T	0.31247	1.5	5.71	5.71	0.89125	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.044640	0.85682	D	0.000000	T	0.50905	0.1643	L	0.59436	1.845	0.80722	D	1	D	0.53619	0.961	P	0.59643	0.861	T	0.37454	-0.9705	10	0.45353	T	0.12	-17.9785	19.8586	0.96775	0.0:0.0:1.0:0.0	.	465	Q9NZN3	EHD3_HUMAN	P	465	ENSP00000327116:A465P	ENSP00000327116:A465P	A	+	1	0	EHD3	31342859	1.000000	0.71417	0.947000	0.38551	0.991000	0.79684	8.004000	0.88535	2.701000	0.92244	0.462000	0.41574	GCT	-	superfamily_EF-hand,HMMSmart_SM00027		0.562	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD3	protein_coding	OTTHUMT00000216810.1	G	NM_014600		31342859	+1	no_errors	NM_014600	genbank	human	provisional	54_36p	missense	SNP	0.999	C
RYR3	6263	genome.wustl.edu	37	15	33842382	33842382	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr15:33842382A>T	ENST00000389232.4	+	10	907	c.837A>T	c.(835-837)agA>agT	p.R279S	RYR3_ENST00000415757.3_Missense_Mutation_p.R279S	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	279	MIR 4. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTAACATCAGATGGGGCCAGG	0.468																																																0			15											38.0	41.0	40.0					15																	33842382		2184	4290	6474	31629674	SO:0001583	missense	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.837A>T	15.37:g.33842382A>T	ENSP00000373884:p.Arg279Ser	Somatic		Capture	Illumina GAIIx	4	31629674	O15175|Q15412	Missense_Mutation	SNP	HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_RYDR_ITPR,HMMPfam_SPRY,HMMSmart_SM00449,HMMPfam_RyR,HMMPfam_RIH_assoc,HMMPfam_efhand,superfamily_EF-hand,HMMPfam_RR_TM4-6,HMMPfam_Ion_trans	p.R279S	ENST00000389232.4	37	c.837	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	A	15.11	2.736723	0.49045	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.86366	-2.11;-2.11	5.38	-1.27	0.09347	MIR motif (2);MIR (2);	0.000000	0.85682	D	0.000000	T	0.80449	0.4625	L	0.47716	1.5	0.46927	D	0.99925	P;P	0.52692	0.873;0.955	B;P	0.51615	0.306;0.675	T	0.75337	-0.3353	10	0.09843	T	0.71	.	1.7667	0.03003	0.437:0.2262:0.226:0.1107	.	279;279	Q15413-2;Q15413	.;RYR3_HUMAN	S	279	ENSP00000373884:R279S;ENSP00000399610:R279S	ENSP00000354735:R279S	R	+	3	2	RYR3	31629674	0.977000	0.34250	0.997000	0.53966	0.979000	0.70002	0.240000	0.18042	-0.105000	0.12132	0.533000	0.62120	AGA	-	HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMSmart_SM00472		0.468	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	protein_coding	OTTHUMT00000417514.1	A			31629674	+1	no_errors	NM_001036	genbank	human	validated	54_36p	missense	SNP	0.995	T
ZBTB12	221527	genome.wustl.edu	37	6	31868786	31868786	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr6:31868786G>C	ENST00000375527.2	-	2	472	c.297C>G	c.(295-297)gaC>gaG	p.D99E	C2_ENST00000452323.2_5'UTR|C2_ENST00000469372.1_Intron	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	99					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						AGTTGACGATGTCCCTAACAG	0.587																																																0			6											83.0	77.0	79.0					6																	31868786		2203	4300	6503	31976765	SO:0001583	missense	221527			BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.297C>G	6.37:g.31868786G>C	ENSP00000364677:p.Asp99Glu	Somatic		Capture	Illumina GAIIx	4	31976765	B0UY00|Q5JQ98	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.D99E	ENST00000375527.2	37	c.297	CCDS4727.1	6	.	.	.	.	.	.	.	.	.	.	G	5.998	0.368058	0.11352	.	.	ENSG00000204366	ENST00000375527	T	0.67345	-0.26	4.44	1.6	0.23607	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.059546	0.64402	U	0.000004	T	0.19604	0.0471	N	0.03238	-0.38	0.36057	D	0.841167	B	0.32245	0.361	B	0.43728	0.429	T	0.27502	-1.0072	10	0.02654	T	1	.	4.6355	0.12523	0.2634:0.0:0.5826:0.154	.	99	Q9Y330	ZBT12_HUMAN	E	99	ENSP00000364677:D99E	ENSP00000364677:D99E	D	-	3	2	ZBTB12	31976765	0.986000	0.35501	0.999000	0.59377	0.943000	0.58893	0.224000	0.17738	0.011000	0.14865	-0.347000	0.07816	GAC	-	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225		0.587	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB12	protein_coding	OTTHUMT00000076315.2	G	NM_181842		31976765	-1	no_errors	NM_181842	genbank	human	validated	54_36p	missense	SNP	0.988	C
HERC2P4	100289574	genome.wustl.edu	37	16	32163280	32163280	+	IGR	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr16:32163280C>T								RP11-1166P10.6 (67174 upstream) : HERC2P4 (18024 downstream)																							GTGAGACAGGCCCTGCTCACC	0.502																																																0			16																																								32070781	SO:0001628	intergenic_variant	440362																															16.37:g.32163280C>T		Somatic		Capture	Illumina GAIIx	4	32070781		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.502					HERC2P4			C			32070781	-1	pseudogene	NR_002827	genbank	human	provisional	54_36p	rna	SNP	0.050	T
ANXA2P2	304	genome.wustl.edu	37	9	33624424	33624424	+	IGR	SNP	G	G	T	rs574230189		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr9:33624424G>T								TRBV20OR9-2 (5920 upstream) : TRBV21OR9-2 (4694 downstream)																							CCAAAGGTGTGGATGAGGTCA	0.468											OREG0019140	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			9																																								33614424	SO:0001628	intergenic_variant	0																															9.37:g.33624424G>T		Somatic	841	Capture	Illumina GAIIx	4	33614424		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.468					ANXA2P2			G			33614424	+1	pseudogene	NR_003573	genbank	human	validated	54_36p	rna	SNP	0.998	T
DSN1	79980	genome.wustl.edu	37	20	35390885	35390885	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr20:35390885T>A	ENST00000426836.1	-	6	941	c.569A>T	c.(568-570)aAa>aTa	p.K190I	DSN1_ENST00000373734.4_Missense_Mutation_p.K83I|DSN1_ENST00000373740.3_Missense_Mutation_p.K118I|DSN1_ENST00000373745.3_Missense_Mutation_p.K190I|DSN1_ENST00000473615.1_5'UTR|DSN1_ENST00000373750.4_Missense_Mutation_p.K190I|DSN1_ENST00000448110.2_Missense_Mutation_p.K174I	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component	190					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				TTCAAAACATTTTTGTAGAGT	0.393																																																0			20											84.0	79.0	81.0					20																	35390885		2201	4300	6501	34824299	SO:0001583	missense	79980			AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.569A>T	20.37:g.35390885T>A	ENSP00000389810:p.Lys190Ile	Somatic		Capture	Illumina GAIIx	4	34824299	B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	Missense_Mutation	SNP	HMMPfam_Mis12_component	p.K190I	ENST00000426836.1	37	c.569	CCDS13286.1	20	.	.	.	.	.	.	.	.	.	.	T	17.47	3.398649	0.62177	.	.	ENSG00000149636	ENST00000426836;ENST00000373745;ENST00000448110;ENST00000373733;ENST00000373750;ENST00000373740;ENST00000373734;ENST00000449595;ENST00000447406;ENST00000438549	.	.	.	4.82	3.73	0.42828	.	0.245286	0.39909	N	0.001224	T	0.46718	0.1407	L	0.34521	1.04	0.29605	N	0.847402	D;D	0.69078	0.997;0.997	D;D	0.65573	0.936;0.93	T	0.42189	-0.9466	9	0.72032	D	0.01	-2.3263	7.1225	0.25453	0.0:0.101:0.0:0.899	.	83;190	Q5JW55;Q9H410	.;DSN1_HUMAN	I	190;190;174;123;190;118;83;174;190;90	.	ENSP00000362838:K123I	K	-	2	0	DSN1	34824299	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	1.714000	0.37961	0.990000	0.38787	0.402000	0.26972	AAA	-	HMMPfam_Mis12_component		0.393	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSN1	protein_coding	OTTHUMT00000079043.2	T	NM_024918		34824299	-1	no_errors	NM_024918	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TRANK1	9881	genome.wustl.edu	37	3	36874172	36874172	+	Missense_Mutation	SNP	C	C	G	rs533442931		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr3:36874172C>G	ENST00000429976.2	-	21	7017	c.6770G>C	c.(6769-6771)cGg>cCg	p.R2257P	TRANK1_ENST00000301807.6_Missense_Mutation_p.R1707P|TRANK1_ENST00000428977.2_Missense_Mutation_p.R1707P	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2257							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TCTGTAGAACCGGAAGGATTT	0.453																																																0			3											90.0	88.0	89.0					3																	36874172		1846	4091	5937	36849176	SO:0001583	missense	9881			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.6770G>C	3.37:g.36874172C>G	ENSP00000416168:p.Arg2257Pro	Somatic		Capture	Illumina GAIIx	4	36849176	Q8N8K0	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R1707P	ENST00000429976.2	37	c.5120	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	C	9.906	1.208143	0.22205	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.30714	1.52;1.93;1.52	4.92	4.03	0.46877	.	0.184033	0.26224	N	0.025614	T	0.25419	0.0618	L	0.27053	0.805	0.09310	N	1	D	0.69078	0.997	P	0.50659	0.647	T	0.10917	-1.0609	10	0.56958	D	0.05	.	4.9064	0.13800	0.0:0.6924:0.0:0.3076	.	2257	O15050	TRNK1_HUMAN	P	1707;2257;1707	ENSP00000416826:R1707P;ENSP00000416168:R2257P;ENSP00000301807:R1707P	ENSP00000301807:R1707P	R	-	2	0	TRANK1	36849176	0.165000	0.22948	0.119000	0.21687	0.116000	0.19942	2.332000	0.43903	2.433000	0.82419	0.462000	0.41574	CGG	-	NULL		0.453	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LBA1	protein_coding		C	NM_014831		36849176	-1	no_errors	NM_014831	genbank	human	validated	54_36p	missense	SNP	0.016	G
TTC6	319089	genome.wustl.edu	37	14	38311492	38311492	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr14:38311492T>C	ENST00000476979.1	+	13	1846	c.1559T>C	c.(1558-1560)aTa>aCa	p.I520T	TTC6_ENST00000267368.7_Missense_Mutation_p.I520T|TTC6_ENST00000553443.1_Missense_Mutation_p.I1886T|TTC6_ENST00000382320.3_3'UTR			Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	520										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		GCCTCAGTTATATGATTACAT	0.348																																																0			14											115.0	104.0	108.0					14																	38311492		2203	4300	6503	37381243	SO:0001583	missense	115669			BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000476979.1:c.1559T>C	14.37:g.38311492T>C	ENSP00000417788:p.Ile520Thr	Somatic		Capture	Illumina GAIIx	4	37381243	Q3SY88|Q96CE6	Missense_Mutation	SNP	superfamily_TPR-like,HMMSmart_SM00028,HMMPfam_TPR_1	p.I617T	ENST00000476979.1	37	c.1850		14	.	.	.	.	.	.	.	.	.	.	T	10.67	1.416133	0.25552	.	.	ENSG00000139865	ENST00000553443;ENST00000476979;ENST00000267368	T;T;T	0.72725	-0.68;-0.43;-0.43	5.53	-3.78	0.04333	.	1.565850	0.03343	N	0.195017	T	0.59211	0.2177	L	0.44542	1.39	0.30974	N	0.7227589999999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.44298	-0.9337	9	0.62326	D	0.03	.	3.9693	0.09446	0.2648:0.2855:0.0:0.4497	.	1886;520	G3V3A5;Q86TZ1	.;TTC6_HUMAN	T	1886;520;520	ENSP00000451131:I1886T;ENSP00000417788:I520T;ENSP00000267368:I520T	ENSP00000267368:I520T	I	+	2	0	TTC6	37381243	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.657000	0.05335	-0.866000	0.04068	-1.039000	0.02377	ATA	-	NULL		0.348	TTC6-002	KNOWN	basic	protein_coding	TTC6	protein_coding	OTTHUMT00000348621.2	T	XM_002343299		37381243	+1	no_errors	ENST00000382320	ensembl	human	known	54_36p	missense	SNP	0.000	C
CCR10	2826	genome.wustl.edu	37	17	40832615	40832615	+	Silent	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:40832615A>G	ENST00000332438.4	-	2	64	c.45T>C	c.(43-45)tcT>tcC	p.S15S	CCR10_ENST00000591765.1_5'UTR|CTD-3193K9.3_ENST00000592440.1_RNA|CNTNAP1_ENST00000264638.4_5'Flank|CTD-3193K9.4_ENST00000593139.1_RNA	NM_016602.2	NP_057686.2	P46092	CCR10_HUMAN	chemokine (C-C motif) receptor 10	15					chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|G-protein coupled receptor activity (GO:0004930)			lung(1)|ovary(1)|skin(1)	3		Breast(137;0.000153)		BRCA - Breast invasive adenocarcinoma(366;0.14)		CTTCATCCCCAGAGTAATGGC	0.592																																																0			17											40.0	37.0	38.0					17																	40832615		2163	4228	6391	38086141	SO:0001819	synonymous_variant	2826			AF215981	CCDS11435.1	17q21.1-q21.3	2012-08-08	2004-11-12	2004-11-12	ENSG00000184451	ENSG00000184451		"""GPCR / Class A : Chemokine receptors : C-C motif"""	4474	protein-coding gene	gene with protein product		600240	"""G protein-coupled receptor 2"""	GPR2		7851889	Standard	NM_016602		Approved		uc002iax.4	P46092	OTTHUMG00000132301	ENST00000332438.4:c.45T>C	17.37:g.40832615A>G		Somatic		Capture	Illumina GAIIx	4	38086141	Q4V749|Q6T7X2|Q9NZG2	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S15	ENST00000332438.4	37	c.45	CCDS11435.1	17																																																																																			-	superfamily_SSF81321		0.592	CCR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR10	protein_coding	OTTHUMT00000255406.1	A	NM_016602		38086141	-1	no_errors	NM_016602	genbank	human	validated	54_36p	silent	SNP	0.004	G
TEF	7008	genome.wustl.edu	37	22	41791848	41791848	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr22:41791848G>C	ENST00000266304.4	+	4	912	c.796G>C	c.(796-798)Gcc>Ccc	p.A266P	TEF_ENST00000406644.3_Missense_Mutation_p.A236P	NM_003216.3	NP_003207.1	Q10587	TEF_HUMAN	thyrotrophic embryonic factor	266	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						CATCCGGGCAGCCTTCCTGGA	0.567																																																0			22											117.0	101.0	107.0					22																	41791848		2203	4300	6503	40121794	SO:0001583	missense	7008				CCDS14014.1, CCDS46716.1	22q13.2	2013-01-10			ENSG00000167074	ENSG00000167074		"""basic leucine zipper proteins"""	11722	protein-coding gene	gene with protein product		188595				7835883, 15665112	Standard	NM_001145398		Approved	KIAA1655	uc003azy.4	Q10587	OTTHUMG00000150968	ENST00000266304.4:c.796G>C	22.37:g.41791848G>C	ENSP00000266304:p.Ala266Pro	Somatic		Capture	Illumina GAIIx	4	40121794	B0QYS8|B2RC22|Q15729|Q7Z3J7|Q8IU94|Q96TG4	Missense_Mutation	SNP	HMMSmart_SM00338,HMMPfam_bZIP_2	p.A266P	ENST00000266304.4	37	c.796	CCDS14014.1	22	.	.	.	.	.	.	.	.	.	.	G	36	5.718035	0.96839	.	.	ENSG00000167074	ENST00000406644;ENST00000433913;ENST00000266304	T;T	0.44083	0.93;0.93	5.8	5.8	0.92144	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.108387	0.64402	D	0.000008	T	0.70859	0.3272	M	0.84683	2.71	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.85130	0.985;0.997;0.994	T	0.73780	-0.3875	10	0.66056	D	0.02	-20.0085	20.0693	0.97712	0.0:0.0:1.0:0.0	.	271;266;236	B4DIH3;Q10587;Q10587-2	.;TEF_HUMAN;.	P	236;236;266	ENSP00000385256:A236P;ENSP00000266304:A266P	ENSP00000266304:A266P	A	+	1	0	TEF	40121794	1.000000	0.71417	0.967000	0.41034	0.961000	0.63080	9.414000	0.97362	2.758000	0.94735	0.563000	0.77884	GCC	-	HMMSmart_SM00338,HMMPfam_bZIP_2		0.567	TEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEF	protein_coding	OTTHUMT00000320692.1	G	NM_003216		40121794	+1	no_errors	NM_003216	genbank	human	reviewed	54_36p	missense	SNP	0.991	C
PDZRN4	29951	genome.wustl.edu	37	12	41966724	41966724	+	Missense_Mutation	SNP	G	G	C	rs187126321		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:41966724G>C	ENST00000402685.2	+	10	2151	c.2143G>C	c.(2143-2145)Gat>Cat	p.D715H	PDZRN4_ENST00000298919.7_Missense_Mutation_p.D455H|PDZRN4_ENST00000539469.2_Missense_Mutation_p.D457H	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	715							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CACCAGCATAGATATGCAAAG	0.458																																																0			12											106.0	110.0	108.0					12																	41966724		2203	4300	6503	40252991	SO:0001583	missense	29951			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2143G>C	12.37:g.41966724G>C	ENSP00000384197:p.Asp715His	Somatic		Capture	Illumina GAIIx	4	40252991	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ	p.D457H	ENST00000402685.2	37	c.1369	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	G	2.171	-0.389838	0.04932	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.73575	-0.76;3.72;3.71	4.64	3.75	0.43078	.	0.073915	0.56097	D	0.000037	T	0.75752	0.3892	M	0.74647	2.275	0.09310	N	0.999997	B;B;B	0.23377	0.084;0.08;0.039	B;B;B	0.35727	0.021;0.209;0.099	T	0.71083	-0.4695	10	0.87932	D	0	-31.7412	9.6222	0.39727	0.1634:0.0:0.8366:0.0	.	715;455;457	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	H	715;457;455	ENSP00000384197:D715H;ENSP00000439990:D457H;ENSP00000298919:D455H	ENSP00000298919:D455H	D	+	1	0	PDZRN4	40252991	0.997000	0.39634	0.015000	0.15790	0.030000	0.12068	3.591000	0.53986	1.272000	0.44329	0.650000	0.86243	GAT	-	NULL		0.458	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	protein_coding	OTTHUMT00000403701.1	G	NM_013377		40252991	+1	no_errors	NM_013377	genbank	human	validated	54_36p	missense	SNP	0.008	C
XRCC6	2547	genome.wustl.edu	37	22	42043031	42043031	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr22:42043031C>T	ENST00000359308.4	+	6	1560	c.905C>T	c.(904-906)aCc>aTc	p.T302I	XRCC6_ENST00000360079.3_Missense_Mutation_p.T302I|XRCC6_ENST00000405878.1_Missense_Mutation_p.T302I|XRCC6_ENST00000428575.2_Missense_Mutation_p.T169I|XRCC6_ENST00000405506.1_Missense_Mutation_p.T252I|Y_RNA_ENST00000363462.1_RNA|XRCC6_ENST00000402580.3_Missense_Mutation_p.T261I			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	302	Ku.				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						AAGACCCGGACCTTTAATACA	0.458								Non-homologous end-joining																																								0			22											124.0	134.0	131.0					22																	42043031		2203	4300	6503	40372977	SO:0001583	missense	2547			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.905C>T	22.37:g.42043031C>T	ENSP00000352257:p.Thr302Ile	Somatic		Capture	Illumina GAIIx	4	40372977	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	superfamily_SSF53300,HMMPfam_Ku_N,superfamily_SPOC-like,HMMPfam_Ku,HMMSmart_Ku78,HMMPfam_Ku_C,superfamily_SSF68906,HMMPfam_SAP,HMMSmart_SAP	p.T302I	ENST00000359308.4	37	c.905	CCDS14021.1	22	.	.	.	.	.	.	.	.	.	.	C	9.620	1.133525	0.21041	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	4.97	3.96	0.45880	Spen Paralogue and Orthologue SPOC, C-terminal-like (1);DNA helicase, ATP-dependent, Ku type (1);	0.292569	0.41001	N	0.000966	T	0.40619	0.1124	N	0.25060	0.705	0.41085	D	0.985559	B;B;B;B	0.23990	0.042;0.023;0.095;0.023	B;B;B;B	0.28784	0.028;0.028;0.094;0.028	T	0.21143	-1.0254	9	0.26408	T	0.33	-6.5064	8.1951	0.31392	0.0:0.7432:0.0:0.2568	.	252;302;261;302	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	I	302;261;169;302;302;302;252	.	ENSP00000352257:T302I	T	+	2	0	XRCC6	40372977	0.909000	0.30893	1.000000	0.80357	0.731000	0.41821	1.478000	0.35442	1.227000	0.43598	0.655000	0.94253	ACC	-	superfamily_SPOC-like,HMMPfam_Ku		0.458	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	protein_coding	OTTHUMT00000321688.1	C	NM_001469		40372977	+1	no_errors	NM_001469	genbank	human	reviewed	54_36p	missense	SNP	0.979	T
SLC14A2	8170	genome.wustl.edu	37	18	43249422	43249422	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr18:43249422G>A	ENST00000255226.6	+	16	3004	c.2188G>A	c.(2188-2190)Gcc>Acc	p.A730T	RP11-116O18.3_ENST00000589510.1_RNA|SLC14A2_ENST00000589658.1_Missense_Mutation_p.A207T|SLC14A2_ENST00000586448.1_Missense_Mutation_p.A730T	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	730					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCCTGCATCCGCCATGCCCAA	0.542																																																0			18											170.0	145.0	153.0					18																	43249422		2203	4300	6503	41503420	SO:0001583	missense	8170			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.2188G>A	18.37:g.43249422G>A	ENSP00000255226:p.Ala730Thr	Somatic		Capture	Illumina GAIIx	4	41503420	A8K8Q7|Q2TBD6|Q96PH5	Missense_Mutation	SNP	HMMPfam_UT,PatternScan_MULTICOPPER_OXIDASE1	p.A730T	ENST00000255226.6	37	c.2188	CCDS11924.1	18	.	.	.	.	.	.	.	.	.	.	G	1.890	-0.455797	0.04540	.	.	ENSG00000132874	ENST00000255226	T	0.49720	0.77	5.76	-1.42	0.08913	.	0.385759	0.22284	N	0.062100	T	0.18923	0.0454	N	0.08118	0	0.37073	D	0.898633	B	0.12630	0.006	B	0.13407	0.009	T	0.39542	-0.9609	10	0.02654	T	1	-17.884	9.073	0.36504	0.1931:0.0:0.4714:0.3355	.	730	Q15849	UT2_HUMAN	T	730	ENSP00000255226:A730T	ENSP00000255226:A730T	A	+	1	0	SLC14A2	41503420	0.002000	0.14202	0.001000	0.08648	0.000000	0.00434	-0.035000	0.12205	-0.176000	0.10707	-1.268000	0.01426	GCC	-	HMMPfam_UT		0.542	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC14A2	protein_coding	OTTHUMT00000255858.1	G			41503420	+1	no_errors	NM_007163	genbank	human	validated	54_36p	missense	SNP	0.002	A
KANSL1	284058	genome.wustl.edu	37	17	44172038	44172038	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:44172038G>C	ENST00000262419.6	-	3	1789	c.1319C>G	c.(1318-1320)gCa>gGa	p.A440G	KANSL1_ENST00000572904.1_Missense_Mutation_p.A440G|KANSL1_ENST00000393476.3_5'UTR|KANSL1_ENST00000574590.1_Missense_Mutation_p.A440G|KANSL1_ENST00000432791.1_Missense_Mutation_p.A440G|KANSL1_ENST00000575318.1_Missense_Mutation_p.A440G	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	440					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TGCCCGGTCTGCAGCCCATTT	0.458																																																0			17											94.0	115.0	108.0					17																	44172038		2203	4300	6503	41527855	SO:0001583	missense	284058			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.1319C>G	17.37:g.44172038G>C	ENSP00000262419:p.Ala440Gly	Somatic		Capture	Illumina GAIIx	4	41527855	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	NULL	p.A440G	ENST00000262419.6	37	c.1319	CCDS11503.1	17	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312372	0.81358	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	T;T	0.12465	2.68;2.68	4.95	4.95	0.65309	.	0.248699	0.41001	D	0.000971	T	0.26122	0.0637	L	0.44542	1.39	0.80722	D	1	D;P	0.56968	0.978;0.952	D;P	0.69142	0.962;0.859	T	0.00529	-1.1687	10	0.30854	T	0.27	-6.0154	12.2817	0.54767	0.0:0.0:0.8303:0.1697	.	440;440	C9JHY2;Q7Z3B3	.;K1267_HUMAN	G	440	ENSP00000262419:A440G;ENSP00000387393:A440G	ENSP00000262419:A440G	A	-	2	0	KIAA1267	41527855	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.517000	0.67061	2.449000	0.82847	0.655000	0.94253	GCA	-	NULL		0.458	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KIAA1267	protein_coding	OTTHUMT00000440274.1	G	NM_015443		41527855	-1	no_errors	NM_015443	genbank	human	validated	54_36p	missense	SNP	1.000	C
ANK1	286	genome.wustl.edu	37	8	41615636	41615636	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr8:41615636A>T	ENST00000347528.4	-	2	130	c.47T>A	c.(46-48)tTt>tAt	p.F16Y	ANK1_ENST00000352337.4_Missense_Mutation_p.F16Y|ANK1_ENST00000396945.1_Missense_Mutation_p.F16Y|ANK1_ENST00000379758.2_Missense_Mutation_p.F16Y|ANK1_ENST00000396942.1_Missense_Mutation_p.F16Y|ANK1_ENST00000289734.7_Missense_Mutation_p.F16Y|ANK1_ENST00000265709.8_Missense_Mutation_p.F49Y	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	16	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGCTCTCAGAAAGCTGGTAGC	0.522																																																0			8											239.0	230.0	233.0					8																	41615636		2203	4300	6503	41734793	SO:0001583	missense	286			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.47T>A	8.37:g.41615636A>T	ENSP00000339620:p.Phe16Tyr	Somatic		Capture	Illumina GAIIx	4	41734793	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,HMMPfam_ZU5,HMMSmart_SM00218,HMMSmart_SM00005,superfamily_DEATH domain,HMMPfam_Death	p.F16Y	ENST00000347528.4	37	c.47	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	A	18.62	3.662810	0.67700	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.70986	-0.52;-0.52;-0.5;-0.53;-0.49;-0.52;-0.51	5.54	5.54	0.83059	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	D	0.82637	0.5080	M	0.72624	2.21	0.80722	D	1	D;D;B;D;D	0.76494	0.998;0.999;0.185;0.964;0.999	D;D;B;D;D	0.87578	0.998;0.996;0.062;0.955;0.998	T	0.81280	-0.1004	10	0.32370	T	0.25	.	15.9708	0.80019	1.0:0.0:0.0:0.0	.	49;16;16;16;16	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	Y	16;16;16;16;16;16;49;16	ENSP00000339620:F16Y;ENSP00000289734:F16Y;ENSP00000369082:F16Y;ENSP00000380149:F16Y;ENSP00000380147:F16Y;ENSP00000309131:F16Y;ENSP00000265709:F49Y	ENSP00000265709:F49Y	F	-	2	0	ANK1	41734793	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.675000	0.74493	2.234000	0.73211	0.460000	0.39030	TTT	-	superfamily_Ankyrin repeat,HMMSmart_SM00248		0.522	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	protein_coding	OTTHUMT00000317297.1	A	NM_020475		41734793	-1	no_errors	NM_020476	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CDC20	991	genome.wustl.edu	37	1	43825491	43825491	+	Splice_Site	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:43825491G>C	ENST00000372462.1	+	3	629	c.426G>C	c.(424-426)gaG>gaC	p.E142D	CDC20_ENST00000478882.1_3'UTR|CDC20_ENST00000310955.6_Splice_Site_p.E142D|RP1-92O14.3_ENST00000424948.1_RNA			Q12834	CDC20_HUMAN	cell division cycle 20	142					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATGCGCCAGAGGGTAAGACCC	0.512																																					Esophageal Squamous(137;1154 1759 10362 10401 46925)											0			1											75.0	82.0	80.0					1																	43825491		2203	4300	6503	43598078	SO:0001630	splice_region_variant	991			U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.427+1G>C	1.37:g.43825491G>C		Somatic		Capture	Illumina GAIIx	4	43598078	B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.E142D	ENST00000372462.1	37	c.426	CCDS484.1	1	.	.	.	.	.	.	.	.	.	.	G	13.46	2.245078	0.39697	.	.	ENSG00000117399	ENST00000437896;ENST00000310955;ENST00000372462	T;T	0.57107	0.42;0.42	5.44	-2.9	0.05648	.	0.000000	0.85682	D	0.000000	T	0.47911	0.1471	M	0.69248	2.105	0.54753	D	0.999989	B	0.25390	0.125	B	0.27262	0.078	T	0.45116	-0.9283	10	0.49607	T	0.09	-14.7601	13.8617	0.63564	0.8065:0.0:0.1935:0.0	.	142	Q12834	CDC20_HUMAN	D	118;142;142	ENSP00000308450:E142D;ENSP00000361540:E142D	ENSP00000308450:E142D	E	+	3	2	CDC20	43598078	1.000000	0.71417	0.810000	0.32431	0.780000	0.44128	1.659000	0.37387	-0.500000	0.06614	-0.150000	0.13652	GAG	-	superfamily_WD40_like		0.512	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDC20	protein_coding	OTTHUMT00000019488.1	G	NM_001255	Missense_Mutation	43598078	+1	no_errors	NM_001255	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MAP4K1	11184	genome.wustl.edu	37	19	39086298	39086298	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:39086298C>T	ENST00000591517.1	-	28	2279	c.2251G>A	c.(2251-2253)Gaa>Aaa	p.E751K	MAP4K1_ENST00000586296.1_Intron|CTB-186G2.1_ENST00000589557.1_RNA|MAP4K1_ENST00000589130.1_Missense_Mutation_p.E747K|MAP4K1_ENST00000396857.2_Missense_Mutation_p.E751K	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	751	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TCCACCGCTTCGGTCATGGGG	0.607																																																0			19											48.0	51.0	50.0					19																	39086298		1938	4134	6072	43778138	SO:0001583	missense	11184			U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.2251G>A	19.37:g.39086298C>T	ENSP00000465039:p.Glu751Lys	Somatic		Capture	Illumina GAIIx	4	43778138		Missense_Mutation	SNP	PatternScan_PROTEIN_KINASE_ST,superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,HMMSmart_CNH,HMMPfam_CNH	p.E751K	ENST00000591517.1	37	c.2251	CCDS59385.1	19	.	.	.	.	.	.	.	.	.	.	C	16.67	3.188267	0.57909	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	T	0.04862	3.54	4.89	4.89	0.63831	Citron-like (3);	0.156319	0.43747	D	0.000522	T	0.17492	0.0420	L	0.44542	1.39	0.35577	D	0.805923	D;D	0.89917	1.0;1.0	D;D	0.81914	0.992;0.995	T	0.02736	-1.1117	10	0.87932	D	0	.	13.4953	0.61421	0.0:1.0:0.0:0.0	.	751;751	Q92918-2;Q92918	.;M4K1_HUMAN	K	751	ENSP00000380066:E751K	ENSP00000221409:E751K	E	-	1	0	MAP4K1	43778138	0.292000	0.24362	0.183000	0.23137	0.570000	0.35934	2.032000	0.41127	2.550000	0.86006	0.644000	0.83932	GAA	-	HMMSmart_CNH,HMMPfam_CNH		0.607	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	MAP4K1	protein_coding	OTTHUMT00000453390.1	C	NM_001042600		43778138	-1	no_errors	NM_007181	genbank	human	validated	54_36p	missense	SNP	0.060	T
AEBP1	165	genome.wustl.edu	37	7	44153303	44153303	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:44153303G>A	ENST00000223357.3	+	21	3225	c.2920G>A	c.(2920-2922)Ggg>Agg	p.G974R	AEBP1_ENST00000450684.2_Missense_Mutation_p.G549R|MIR4649_ENST00000582839.1_RNA	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	974	Interaction with PTEN. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CTATGACATCGGGGCCACTCA	0.592																																																0			7											119.0	110.0	113.0					7																	44153303		2203	4300	6503	44119828	SO:0001583	missense	165			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2920G>A	7.37:g.44153303G>A	ENSP00000223357:p.Gly974Arg	Somatic		Capture	Illumina GAIIx	4	44119828	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	superfamily_Galactose-binding domain-like,HMMSmart_SM00231,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2,superfamily_Zn-dependent exopeptidases,HMMSmart_SM00631,HMMPfam_Peptidase_M14,PatternScan_CARBOXYPEPT_ZN_1,superfamily_Carboxypeptidase regulatory domain	p.G974R	ENST00000223357.3	37	c.2920	CCDS5476.1	7	.	.	.	.	.	.	.	.	.	.	g	24.2	4.501898	0.85176	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.14391	2.51;2.51	4.96	4.96	0.65561	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.000000	0.85682	D	0.000000	T	0.33585	0.0868	L	0.49350	1.555	0.53688	D	0.999977	D;D	0.89917	1.0;1.0	D;D	0.87578	0.947;0.998	T	0.02202	-1.1196	10	0.54805	T	0.06	-60.2493	18.2071	0.89858	0.0:0.0:1.0:0.0	.	549;974	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	R	974;549	ENSP00000223357:G974R;ENSP00000398878:G549R	ENSP00000223357:G974R	G	+	1	0	AEBP1	44119828	1.000000	0.71417	0.996000	0.52242	0.837000	0.47467	6.507000	0.73717	2.482000	0.83794	0.552000	0.68991	GGG	-	HMMSmart_SM00631,superfamily_Carboxypeptidase regulatory domain		0.592	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	protein_coding	OTTHUMT00000250993.2	G	NM_001129		44119828	+1	no_errors	NM_001129	genbank	human	reviewed	54_36p	missense	SNP	0.960	A
PRDM11	56981	genome.wustl.edu	37	11	45246143	45246143	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:45246143A>T	ENST00000530656.1	+	7	1220	c.1220A>T	c.(1219-1221)aAg>aTg	p.K407M	PRDM11_ENST00000424263.2_Missense_Mutation_p.K373M|CTD-2560E9.3_ENST00000527450.1_RNA|PRDM11_ENST00000528980.1_Intron|PRDM11_ENST00000263765.4_Missense_Mutation_p.K407M			Q9NQV5	PRD11_HUMAN	PR domain containing 11	407							methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						GGGGTCTCCAAGGAGCCAGGC	0.582																																					NSCLC(118;1511 1736 6472 36603 43224)											0			11											77.0	85.0	82.0					11																	45246143		2203	4299	6502	45202719	SO:0001583	missense	56981			AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.1220A>T	11.37:g.45246143A>T	ENSP00000435976:p.Lys407Met	Somatic		Capture	Illumina GAIIx	4	45202719	Q8N9F1	Missense_Mutation	SNP	NULL	p.K407M	ENST00000530656.1	37	c.1220		11	.	.	.	.	.	.	.	.	.	.	A	14.10	2.434620	0.43224	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000424263	T;T;T	0.32515	1.45;1.45;1.47	5.68	3.34	0.38264	.	0.732918	0.12568	N	0.457602	T	0.33556	0.0867	L	0.27053	0.805	0.28253	N	0.92519	P	0.46220	0.874	P	0.55999	0.789	T	0.16335	-1.0406	10	0.87932	D	0	-14.7643	5.9721	0.19359	0.7053:0.154:0.1407:0.0	.	407	Q9NQV5	PRD11_HUMAN	M	407;407;373	ENSP00000263765:K407M;ENSP00000435976:K407M;ENSP00000394314:K373M	ENSP00000263765:K407M	K	+	2	0	PRDM11	45202719	1.000000	0.71417	0.960000	0.40013	0.334000	0.28698	3.334000	0.52097	0.418000	0.25898	-0.290000	0.09829	AAG	-	NULL		0.582	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	PRDM11	protein_coding	OTTHUMT00000389928.1	A	NM_020229		45202719	+1	no_errors	NM_020229	genbank	human	validated	54_36p	missense	SNP	0.997	T
XYLT2	64132	genome.wustl.edu	37	17	48434131	48434131	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:48434131G>C	ENST00000017003.2	+	8	1791	c.1742G>C	c.(1741-1743)tGc>tCc	p.C581S	XYLT2_ENST00000507602.1_Missense_Mutation_p.C581S	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	581					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					ACCCCACTCTGCAGGTGAGAC	0.642																																																0			17											67.0	79.0	75.0					17																	48434131		2191	4286	6477	45789130	SO:0001583	missense	64132			AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.1742G>C	17.37:g.48434131G>C	ENSP00000017003:p.Cys581Ser	Somatic		Capture	Illumina GAIIx	4	45789130	Q6UY41|Q86V00	Missense_Mutation	SNP	HMMPfam_Branch	p.C581S	ENST00000017003.2	37	c.1742	CCDS11563.1	17	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802481	0.70682	.	.	ENSG00000015532	ENST00000017003;ENST00000507602	T;T	0.49139	0.79;0.79	4.84	4.84	0.62591	.	0.097290	0.64402	D	0.000001	T	0.66489	0.2794	M	0.74881	2.28	0.80722	D	1	D	0.60575	0.988	P	0.62014	0.897	T	0.70945	-0.4734	10	0.72032	D	0.01	-27.7197	16.3165	0.82930	0.0:0.0:1.0:0.0	.	581	Q9H1B5	XYLT2_HUMAN	S	581	ENSP00000017003:C581S;ENSP00000426501:C581S	ENSP00000017003:C581S	C	+	2	0	XYLT2	45789130	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	8.263000	0.89864	2.516000	0.84829	0.655000	0.94253	TGC	-	NULL		0.642	XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT2	protein_coding	OTTHUMT00000367046.1	G	NM_022167		45789130	+1	no_errors	NM_022167	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RAB4B	53916	genome.wustl.edu	37	19	41289958	41289958	+	Silent	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:41289958C>T	ENST00000594800.1	+	5	568	c.408C>T	c.(406-408)gcC>gcT	p.A136A	MIA-RAB4B_ENST00000600729.1_3'UTR|RAB4B-EGLN2_ENST00000594136.1_Silent_p.A136A|RAB4B-EGLN2_ENST00000601949.1_Intron|RAB4B_ENST00000602069.1_3'UTR|RAB4B_ENST00000357052.2_Silent_p.A136A			P61018	RAB4B_HUMAN	RAB4B, member RAS oncogene family	136					glucose import (GO:0046323)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	insulin-responsive compartment (GO:0032593)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	11			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TCCTGGAGGCCTCCCGCTTTG	0.627																																																0			19											42.0	37.0	39.0					19																	41289958		2203	4300	6503	45981798	SO:0001819	synonymous_variant	53916			AF165522	CCDS33030.1	19q13.2	2012-10-15			ENSG00000167578	ENSG00000167578		"""RAB, member RAS oncogene"""	9782	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein 4b"", ""small GTP binding protein RAB4B"""	612945					Standard	NM_016154		Approved	FLJ78649, MGC52123	uc002opd.2	P61018		ENST00000594800.1:c.408C>T	19.37:g.41289958C>T		Somatic		Capture	Illumina GAIIx	4	45981798	P22750|Q7Z514|Q9HBR6	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176	p.A136	ENST00000594800.1	37	c.408	CCDS33030.1	19																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176		0.627	RAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB4B	protein_coding	OTTHUMT00000463168.1	C	NM_016154		45981798	+1	no_errors	NM_016154	genbank	human	validated	54_36p	silent	SNP	0.989	T
CACNA1G	8913	genome.wustl.edu	37	17	48703921	48703921	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:48703921C>G	ENST00000359106.5	+	38	6943	c.6943C>G	c.(6943-6945)Ccc>Gcc	p.P2315A	CACNA1G_ENST00000515765.1_Missense_Mutation_p.P2259A|CACNA1G_ENST00000515411.1_Missense_Mutation_p.P2252A|CACNA1G_ENST00000514181.1_Missense_Mutation_p.P2197A|CACNA1G_ENST00000505165.1_Missense_Mutation_p.P2143A|CACNA1G_ENST00000510366.1_Missense_Mutation_p.P2170A|CTB-22K21.2_ENST00000502435.1_RNA|CACNA1G_ENST00000514079.1_Missense_Mutation_p.P2229A|CACNA1G_ENST00000507609.1_Missense_Mutation_p.P2215A|CACNA1G_ENST00000513689.2_Missense_Mutation_p.P2225A|CACNA1G_ENST00000507336.1_Missense_Mutation_p.P2304A|CACNA1G_ENST00000507896.1_Missense_Mutation_p.P2132A|CACNA1G_ENST00000510115.1_Missense_Mutation_p.P2236A|CACNA1G_ENST00000429973.2_Missense_Mutation_p.P2204A|CACNA1G_ENST00000514717.1_Missense_Mutation_p.P2165A|CACNA1G_ENST00000358244.5_Missense_Mutation_p.P2109A|CACNA1G_ENST00000515165.1_Missense_Mutation_p.P2222A|CACNA1G_ENST00000513964.1_Missense_Mutation_p.P2177A|CACNA1G_ENST00000502264.1_Missense_Mutation_p.P2244A|CACNA1G_ENST00000360761.4_Missense_Mutation_p.P2199A|CACNA1G_ENST00000512389.1_Missense_Mutation_p.P2211A|CACNA1G_ENST00000354983.4_Missense_Mutation_p.P2281A|CACNA1G_ENST00000507510.2_Missense_Mutation_p.P2270A|CACNA1G_ENST00000503485.1_Missense_Mutation_p.P2188A|CACNA1G_ENST00000442258.2_Missense_Mutation_p.P2181A|CACNA1G_ENST00000352832.5_Missense_Mutation_p.P2188A	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	2315					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CACCATAGACCCCCCCGAGAG	0.672											OREG0024569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			17											18.0	24.0	22.0					17																	48703921		1824	4062	5886	46058920	SO:0001583	missense	8913			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.6943C>G	17.37:g.48703921C>G	ENSP00000352011:p.Pro2315Ala	Somatic	956	Capture	Illumina GAIIx	4	46058920	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.P2315A	ENST00000359106.5	37	c.6943	CCDS45730.1	17	.	.	.	.	.	.	.	.	.	.	C	21.9	4.209665	0.79240	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.5	5.5	0.81552	.	0.889113	0.09830	N	0.750393	D	0.82604	0.5073	M	0.63843	1.955	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;P;D;D;B;D	0.89917	0.998;1.0;0.999;0.998;1.0;0.997;0.997;1.0;0.997;0.999;0.999;1.0;1.0;0.786;0.997;1.0;0.999;0.996;1.0;1.0;0.862;1.0;1.0;0.125;0.98	D;D;D;D;D;D;D;D;D;D;D;D;D;B;D;D;D;D;D;D;B;D;D;B;D	0.91635	0.991;0.999;0.998;0.993;0.998;0.993;0.993;0.998;0.993;0.991;0.991;0.999;0.999;0.374;0.993;0.998;0.998;0.959;0.998;0.999;0.398;0.998;0.997;0.075;0.966	T	0.79720	-0.1685	10	0.87932	D	0	.	19.3874	0.94563	0.0:1.0:0.0:0.0	.	2165;2177;2170;2252;2225;2197;2229;2188;2215;2132;2143;2244;2211;2304;2204;2259;2222;2292;2270;2188;2181;2236;2199;2315;2109	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.	A	2199;2188;2281;2181;2244;2211;2177;2165;2170;2188;2270;2304;2225;2215;2236;2222;2197;2259;2229;2109;2315;2204;2252;2143;2132	ENSP00000353990:P2199A;ENSP00000339302:P2188A;ENSP00000347078:P2281A;ENSP00000409759:P2181A;ENSP00000425522:P2244A;ENSP00000426261:P2211A;ENSP00000425451:P2177A;ENSP00000422407:P2165A;ENSP00000426814:P2170A;ENSP00000427238:P2188A;ENSP00000423112:P2270A;ENSP00000420918:P2304A;ENSP00000426172:P2225A;ENSP00000423045:P2215A;ENSP00000427173:P2236A;ENSP00000426098:P2222A;ENSP00000425698:P2197A;ENSP00000426232:P2259A;ENSP00000423317:P2229A;ENSP00000350979:P2109A;ENSP00000352011:P2315A;ENSP00000414388:P2204A;ENSP00000423155:P2252A;ENSP00000422268:P2143A;ENSP00000421518:P2132A	ENSP00000339302:P2188A	P	+	1	0	CACNA1G	46058920	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.509000	0.67012	2.590000	0.87494	0.561000	0.74099	CCC	-	NULL		0.672	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	protein_coding	OTTHUMT00000367895.1	C	NM_018896		46058920	+1	no_errors	NM_018896	genbank	human	validated	54_36p	missense	SNP	1.000	G
ZNF574	64763	genome.wustl.edu	37	19	42584235	42584235	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:42584235C>G	ENST00000600245.1	+	2	2132	c.1477C>G	c.(1477-1479)Cgg>Ggg	p.R493G	ZNF574_ENST00000359044.4_Missense_Mutation_p.R493G|ZNF574_ENST00000222339.7_Missense_Mutation_p.R583G|CTB-59C6.3_ENST00000594531.1_RNA			Q6ZN55	ZN574_HUMAN	zinc finger protein 574	493					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20		Prostate(69;0.059)				TCGGCTGGAGCGGCGCCATAA	0.612																																																0			19											88.0	100.0	96.0					19																	42584235		2203	4299	6502	47276075	SO:0001583	missense	64763			AK074788	CCDS12596.1	19q13.2	2013-09-20			ENSG00000105732	ENSG00000105732		"""Zinc fingers, C2H2-type"""	26166	protein-coding gene	gene with protein product						12477932	Standard	NM_022752		Approved	FLJ22059	uc002osm.4	Q6ZN55	OTTHUMG00000182751	ENST00000600245.1:c.1477C>G	19.37:g.42584235C>G	ENSP00000469029:p.Arg493Gly	Somatic		Capture	Illumina GAIIx	4	47276075	Q6IPE0|Q6ZN10|Q7L5Z5|Q8NCE3|Q9H6N0	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.R493G	ENST00000600245.1	37	c.1477	CCDS12596.1	19	.	.	.	.	.	.	.	.	.	.	c	13.66	2.303248	0.40795	.	.	ENSG00000105732	ENST00000222339;ENST00000359044;ENST00000535775	T;T	0.35789	1.29;1.29	4.48	3.45	0.39498	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000002	T	0.49745	0.1575	M	0.72118	2.19	0.32656	N	0.518734	P;D	0.62365	0.938;0.991	P;P	0.60345	0.686;0.873	T	0.62286	-0.6886	10	0.87932	D	0	-18.0937	6.7659	0.23566	0.1748:0.7325:0.0:0.0927	.	493;582	Q6ZN55;Q6ZN55-2	ZN574_HUMAN;.	G	583;493;100	ENSP00000222339:R583G;ENSP00000351939:R493G	ENSP00000222339:R583G	R	+	1	2	ZNF574	47276075	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	1.294000	0.33365	1.118000	0.41863	0.645000	0.84053	CGG	-	superfamily_C2H2 and C2HC zinc fingers		0.612	ZNF574-002	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ZNF574	protein_coding	OTTHUMT00000463458.1	C	NM_022752		47276075	+1	no_errors	NM_022752	genbank	human	validated	54_36p	missense	SNP	1.000	G
KANSL2	54934	genome.wustl.edu	37	12	49072874	49072874	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:49072874C>G	ENST00000420613.2	-	4	537	c.490G>C	c.(490-492)Ggt>Cgt	p.G164R	KANSL2_ENST00000550347.1_Missense_Mutation_p.G347R|KANSL2_ENST00000357861.3_5'UTR|KANSL2_ENST00000553086.1_Missense_Mutation_p.G164R	NM_017822.3	NP_060292.3	Q9H9L4	KANL2_HUMAN	KAT8 regulatory NSL complex subunit 2	164					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)											TCAGGGTCACCTCTCCATGTC	0.468																																																0			12											111.0	108.0	108.0					12																	49072874		2041	4204	6245	47359141	SO:0001583	missense	54934			AK094528	CCDS44869.1	12q13.11	2011-10-31	2011-10-31	2011-10-31	ENSG00000139620	ENSG00000139620			26024	protein-coding gene	gene with protein product		615488	"""chromosome 12 open reading frame 41"""	C12orf41		12477932	Standard	NM_017822		Approved	FLJ20436, NSL2	uc001rrz.2	Q9H9L4	OTTHUMG00000170392	ENST00000420613.2:c.490G>C	12.37:g.49072874C>G	ENSP00000415436:p.Gly164Arg	Somatic		Capture	Illumina GAIIx	4	47359141	Q8N3B5|Q96CV0|Q9NX51	Missense_Mutation	SNP	NULL	p.G164R	ENST00000420613.2	37	c.490	CCDS44869.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.297875	0.95574	.	.	ENSG00000139620	ENST00000550347;ENST00000420613;ENST00000553086;ENST00000550931	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.87700	0.6243	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.976	D	0.87838	0.2649	10	0.72032	D	0.01	-4.8654	18.9699	0.92711	0.0:1.0:0.0:0.0	.	347;164	F8VX10;Q9H9L4	.;CL041_HUMAN	R	347;164;164;101	ENSP00000449747:G347R;ENSP00000415436:G164R;ENSP00000448833:G164R;ENSP00000448129:G101R	ENSP00000415436:G164R	G	-	1	0	C12orf41	47359141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.715000	0.84713	2.767000	0.95098	0.563000	0.77884	GGT	-	NULL		0.468	KANSL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf41	protein_coding	OTTHUMT00000408841.1	C	NM_017822		47359141	-1	no_errors	NM_017822	genbank	human	validated	54_36p	missense	SNP	1.000	G
ABCA13	154664	genome.wustl.edu	37	7	48313393	48313393	+	Missense_Mutation	SNP	C	C	T	rs527278126		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:48313393C>T	ENST00000435803.1	+	17	4154	c.4130C>T	c.(4129-4131)aCg>aTg	p.T1377M		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1377					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATTCTAGACACGTTAAATTCC	0.338																																																0			7											52.0	49.0	50.0					7																	48313393		1868	4094	5962	48283939	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.4130C>T	7.37:g.48313393C>T	ENSP00000411096:p.Thr1377Met	Somatic		Capture	Illumina GAIIx	4	48283939	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	PatternScan_SERPIN	p.R1323C	ENST00000435803.1	37	c.3967	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	T	0	-2.733058	0.00089	.	.	ENSG00000179869	ENST00000435803	D	0.84660	-1.88	5.38	-0.0583	0.13797	.	0.482604	0.19331	N	0.116882	T	0.48519	0.1504	N	0.00368	-1.59	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.53085	-0.8488	9	.	.	.	.	4.6183	0.12437	0.1357:0.3105:0.0:0.5539	.	1377	Q86UQ4	ABCAD_HUMAN	M	1377	ENSP00000411096:T1377M	.	T	+	2	0	ABCA13	48283939	0.001000	0.12720	0.001000	0.08648	0.020000	0.10135	-0.039000	0.12124	-0.109000	0.12044	-0.360000	0.07572	ACG	-	NULL		0.338	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	protein_coding	OTTHUMT00000341964.2	C	NM_152701		48283939	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_152701	genbank	human	reviewed	54_36p	missense	SNP	0.009	T
RARG	5916	genome.wustl.edu	37	12	53607361	53607361	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:53607361C>G	ENST00000425354.2	-	8	1424	c.937G>C	c.(937-939)Gcc>Ccc	p.A313P	RARG_ENST00000394426.1_Missense_Mutation_p.A313P|RARG_ENST00000543762.1_5'UTR|RARG_ENST00000327550.3_Missense_Mutation_p.A241P|RARG_ENST00000338561.5_Missense_Mutation_p.A302P|RARG_ENST00000543726.1_Missense_Mutation_p.A291P	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	313	Ligand-binding.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	CCAGCAAAGGCAAAGACAAGG	0.657											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			12											73.0	67.0	69.0					12																	53607361		2203	4300	6503	51893628	SO:0001583	missense	5916			M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.937G>C	12.37:g.53607361C>G	ENSP00000388510:p.Ala313Pro	Somatic	993	Capture	Illumina GAIIx	4	51893628	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMSmart_SM00399,HMMPfam_zf-C4,PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.A313P	ENST00000425354.2	37	c.937	CCDS8850.1	12	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988657	0.53934	.	.	ENSG00000172819	ENST00000425354;ENST00000394426;ENST00000538479;ENST00000327550;ENST00000338561;ENST00000543726;ENST00000550265	D;D;D;D;D	0.96651	-4.08;-4.08;-4.08;-4.08;-4.08	5.21	4.31	0.51392	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.96911	0.8991	L	0.58583	1.82	0.80722	D	1	B;D;D;B	0.71674	0.033;0.996;0.998;0.012	B;P;P;B	0.60117	0.032;0.865;0.869;0.04	D	0.96915	0.9670	10	0.56958	D	0.05	.	15.057	0.71921	0.0:0.8568:0.1431:0.0	.	350;291;313;302	F8VR45;B7Z4F1;P13631;F1D8P1	.;.;RARG_HUMAN;.	P	313;313;75;241;302;291;350	ENSP00000388510:A313P;ENSP00000377947:A313P;ENSP00000332695:A241P;ENSP00000343698:A302P;ENSP00000444335:A291P	ENSP00000332695:A241P	A	-	1	0	RARG	51893628	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.214000	0.42853	1.314000	0.45095	0.467000	0.42956	GCC	-	superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep		0.657	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RARG	protein_coding	OTTHUMT00000109404.2	C	NM_000966		51893628	-1	no_errors	NM_000966	genbank	human	validated	54_36p	missense	SNP	1.000	G
ORC1	4998	genome.wustl.edu	37	1	52838908	52838908	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:52838908C>T	ENST00000371568.3	-	17	2749	c.2531G>A	c.(2530-2532)cGg>cAg	p.R844Q	ORC1_ENST00000371566.1_Missense_Mutation_p.R844Q	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	844	Necessary and sufficient for ORC complex assembly.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GAGCCGCACCCGAAGGAGCAG	0.567																																																0			1											99.0	103.0	102.0					1																	52838908		2203	4300	6503	52611496	SO:0001583	missense	4998				CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.2531G>A	1.37:g.52838908C>T	ENSP00000360623:p.Arg844Gln	Somatic		Capture	Illumina GAIIx	4	52611496	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	HMMPfam_BAH,HMMSmart_BAH,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA,superfamily_SSF46785,HMMPfam_Cdc6_C	p.R844Q	ENST00000371568.3	37	c.2531	CCDS566.1	1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243518	0.79912	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.42131	0.98;0.98	5.25	5.25	0.73442	CDC6, C-terminal (1);	0.058688	0.64402	D	0.000002	T	0.65698	0.2716	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.66152	-0.5995	10	0.54805	T	0.06	-12.06	19.0315	0.92959	0.0:1.0:0.0:0.0	.	839;844	B7Z8H0;Q13415	.;ORC1_HUMAN	Q	844	ENSP00000360623:R844Q;ENSP00000360621:R844Q	ENSP00000360621:R844Q	R	-	2	0	ORC1	52611496	1.000000	0.71417	0.340000	0.25575	0.119000	0.20118	4.962000	0.63687	2.728000	0.93425	0.650000	0.86243	CGG	-	superfamily_SSF46785,HMMPfam_Cdc6_C		0.567	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC1L	protein_coding	OTTHUMT00000022202.1	C	NM_004153		52611496	-1	no_errors	NM_004153	genbank	human	reviewed	54_36p	missense	SNP	0.989	T
SMC1A	8243	genome.wustl.edu	37	X	53432034	53432034	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chrX:53432034C>G	ENST00000322213.4	-	13	2233	c.2106G>C	c.(2104-2106)caG>caC	p.Q702H	SMC1A_ENST00000375340.6_Missense_Mutation_p.Q468H	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	702					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						GGGCCTGAGACTGCACCTGAC	0.562																																																0			X											105.0	68.0	81.0					X																	53432034		2203	4300	6503	53448759	SO:0001583	missense	8243			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.2106G>C	X.37:g.53432034C>G	ENSP00000323421:p.Gln702His	Somatic		Capture	Illumina GAIIx	4	53448759	O14995|Q16351|Q2M228	Missense_Mutation	SNP	HMMPfam_SMC_N,superfamily_SSF52540,superfamily_SMC_hinge,HMMPfam_SMC_hinge	p.Q702H	ENST00000322213.4	37	c.2106	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	C	19.40	3.819993	0.71028	.	.	ENSG00000072501	ENST00000322213;ENST00000375340	T;D	0.85861	-1.19;-2.04	5.28	5.28	0.74379	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.91270	0.7248	M	0.80616	2.505	0.58432	D	0.999999	D;D;D	0.58620	0.98;0.964;0.983	D;P;P	0.66979	0.948;0.737;0.838	D	0.91851	0.5491	10	0.66056	D	0.02	.	11.219	0.48844	0.0:0.9084:0.0:0.0916	.	468;680;702	B7Z709;Q6MZR8;Q14683	.;.;SMC1A_HUMAN	H	702;468	ENSP00000323421:Q702H;ENSP00000364489:Q468H	ENSP00000323421:Q702H	Q	-	3	2	SMC1A	53448759	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.422000	0.44696	2.362000	0.80069	0.600000	0.82982	CAG	-	HMMPfam_SMC_N,superfamily_SSF52540		0.562	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	protein_coding	OTTHUMT00000056756.2	C	NM_006306		53448759	-1	no_errors	NM_006306	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MKS1	54903	genome.wustl.edu	37	17	56290438	56290438	+	Missense_Mutation	SNP	C	C	T	rs201237547		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:56290438C>T	ENST00000393119.2	-	8	837	c.763G>A	c.(763-765)Ggg>Agg	p.G255R	MKS1_ENST00000546108.1_Missense_Mutation_p.G52R|MKS1_ENST00000313863.6_Missense_Mutation_p.G255R|MKS1_ENST00000537529.2_Missense_Mutation_p.G245R|MKS1_ENST00000337050.7_Missense_Mutation_p.G255R	NM_017777.3	NP_060247.2	Q9NXB0	MKS1_HUMAN	Meckel syndrome, type 1	255					branching morphogenesis of an epithelial tube (GO:0048754)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				endometrium(5)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						TGCTTCTCCCCCTCCGTCTCA	0.547																																																0			17											76.0	78.0	78.0					17																	56290438		1949	4142	6091	53645437	SO:0001583	missense	54903			DQ185029	CCDS11603.2, CCDS54148.1	17q21-q24	2014-09-17			ENSG00000011143	ENSG00000011143			7121	protein-coding gene	gene with protein product	"""POC12 centriolar protein homolog (Chlamydomonas)"""	609883		MKS		7550354, 16415886, 18327255	Standard	NM_017777		Approved	FLJ20345, POC12, BBS13	uc002ivr.2	Q9NXB0	OTTHUMG00000133714	ENST00000393119.2:c.763G>A	17.37:g.56290438C>T	ENSP00000376827:p.Gly255Arg	Somatic		Capture	Illumina GAIIx	4	53645437	B7WNX4|F5H885|Q284T0|Q96G13	Missense_Mutation	SNP	HMMPfam_B9	p.G255R	ENST00000393119.2	37	c.763	CCDS11603.2	17	.	.	.	.	.	.	.	.	.	.	C	17.29	3.351277	0.61183	.	.	ENSG00000011143	ENST00000537529;ENST00000393120;ENST00000393119;ENST00000337050;ENST00000546108	T;T;T;T	0.75589	-0.53;-0.5;-0.26;-0.95	5.9	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.82692	0.5092	M	0.73598	2.24	0.58432	D	0.999999	D;P	0.58620	0.983;0.561	P;B	0.56823	0.807;0.326	D	0.83659	0.0160	9	.	.	.	-17.8958	15.3052	0.73987	0.1411:0.8589:0.0:0.0	.	255;255	A8MPP8;Q9NXB0	.;MKS1_HUMAN	R	245;255;255;255;52	ENSP00000442096:G245R;ENSP00000376827:G255R;ENSP00000338407:G255R;ENSP00000443012:G52R	.	G	-	1	0	MKS1	53645437	1.000000	0.71417	0.991000	0.47740	0.140000	0.21249	3.903000	0.56318	1.490000	0.48466	-0.165000	0.13383	GGG	-	NULL		0.547	MKS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MKS1	protein_coding	OTTHUMT00000258015.2	C	NM_017777		53645437	-1	no_errors	NM_017777	genbank	human	validated	54_36p	missense	SNP	1.000	T
ALPK2	115701	genome.wustl.edu	37	18	56246759	56246759	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr18:56246759C>A	ENST00000361673.3	-	4	1462	c.1249G>T	c.(1249-1251)Gtc>Ttc	p.V417F	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	417						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TGCTTGGAGACTCTGCTGCTC	0.557											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			18											72.0	74.0	74.0					18																	56246759		2203	4300	6503	54397739	SO:0001583	missense	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1249G>T	18.37:g.56246759C>A	ENSP00000354991:p.Val417Phe	Somatic	1014	Capture	Illumina GAIIx	4	54397739	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00811,HMMPfam_Alpha_kinase	p.V417F	ENST00000361673.3	37	c.1249	CCDS11966.2	18	.	.	.	.	.	.	.	.	.	.	C	7.861	0.726104	0.15439	.	.	ENSG00000198796	ENST00000361673	T	0.45668	0.89	5.39	3.47	0.39725	.	0.249962	0.20938	N	0.082962	T	0.20373	0.0490	N	0.08118	0	0.09310	N	1	B	0.33448	0.412	B	0.29267	0.1	T	0.12142	-1.0559	10	0.59425	D	0.04	-0.9536	7.775	0.29033	0.0:0.5467:0.3563:0.097	.	417	Q86TB3	ALPK2_HUMAN	F	417	ENSP00000354991:V417F	ENSP00000354991:V417F	V	-	1	0	ALPK2	54397739	0.569000	0.26643	0.055000	0.19348	0.011000	0.07611	0.716000	0.25836	1.261000	0.44149	0.561000	0.74099	GTC	-	NULL		0.557	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	protein_coding	OTTHUMT00000256126.1	C	NM_052947		54397739	-1	no_errors	NM_052947	genbank	human	validated	54_36p	missense	SNP	0.257	A
SPTBN1	6711	genome.wustl.edu	37	2	54785974	54785974	+	Intron	SNP	A	A	C	rs143125321		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:54785974A>C	ENST00000356805.4	+	2	429				SPTBN1_ENST00000333896.5_Missense_Mutation_p.Q20P	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1						actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			TACACGGGGCAGGTGCCTTAC	0.627																																																0			2											80.0	84.0	83.0					2																	54785974		2203	4300	6503	54639478	SO:0001627	intron_variant	6711				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.148+32271A>C	2.37:g.54785974A>C		Somatic		Capture	Illumina GAIIx	4	54639478	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150	p.Q20P	ENST00000356805.4	37	c.59	CCDS33198.1	2	.	.	.	.	.	.	.	.	.	.	A	14.47	2.546231	0.45383	.	.	ENSG00000115306	ENST00000333896	T	0.70045	-0.45	5.01	5.01	0.66863	.	.	.	.	.	T	0.57417	0.2052	.	.	.	0.26151	N	0.980142	B	0.02656	0.0	B	0.01281	0.0	T	0.52909	-0.8512	8	0.56958	D	0.05	.	11.3955	0.49838	0.8487:0.1513:0.0:0.0	.	20	Q01082-3	.	P	20	ENSP00000334156:Q20P	ENSP00000334156:Q20P	Q	+	2	0	SPTBN1	54639478	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.686000	0.61700	1.864000	0.54056	0.459000	0.35465	CAG	-	NULL		0.627	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN1	protein_coding	OTTHUMT00000258115.3	A			54639478	+1	no_errors	NM_178313	genbank	human	reviewed	54_36p	missense	SNP	0.997	C
ZNF473	25888	genome.wustl.edu	37	19	50548196	50548196	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:50548196G>A	ENST00000595661.1	+	6	991	c.496G>A	c.(496-498)Gaa>Aaa	p.E166K	ZNF473_ENST00000270617.3_Missense_Mutation_p.E166K|ZNF473_ENST00000391821.2_Missense_Mutation_p.E166K|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000445728.3_Missense_Mutation_p.E154K|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000601364.1_Intron			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	166					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		TTCCACGGGAGAAGATTCCAT	0.483																																																0			19											60.0	59.0	59.0					19																	50548196		2203	4300	6503	55240008	SO:0001583	missense	25888			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.496G>A	19.37:g.50548196G>A	ENSP00000472808:p.Glu166Lys	Somatic		Capture	Illumina GAIIx	4	55240008	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.E166K	ENST00000595661.1	37	c.496	CCDS33077.1	19	.	.	.	.	.	.	.	.	.	.	G	15.11	2.736766	0.49045	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.13538	2.7;2.7;2.58	4.36	4.36	0.52297	.	0.356990	0.20300	N	0.095041	T	0.09862	0.0242	L	0.27053	0.805	0.18873	N	0.999989	B	0.34200	0.441	B	0.28638	0.092	T	0.22977	-1.0201	10	0.26408	T	0.33	-9.1503	15.2018	0.73142	0.0:0.0:1.0:0.0	.	166	Q8WTR7	ZN473_HUMAN	K	166;166;154	ENSP00000270617:E166K;ENSP00000375697:E166K;ENSP00000388961:E154K	ENSP00000270617:E166K	E	+	1	0	ZNF473	55240008	0.000000	0.05858	0.024000	0.17045	0.176000	0.22953	0.086000	0.14935	2.715000	0.92844	0.655000	0.94253	GAA	-	NULL		0.483	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF473	protein_coding	OTTHUMT00000464833.1	G	XM_046390		55240008	+1	no_errors	NM_001006656	genbank	human	validated	54_36p	missense	SNP	0.131	A
OR5D16	390144	genome.wustl.edu	37	11	55606374	55606374	+	Silent	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:55606374G>A	ENST00000378396.1	+	1	147	c.147G>A	c.(145-147)gtG>gtA	p.V49V		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				GGATGATAGTGATCATCAAAA	0.433																																																0			11											166.0	159.0	162.0					11																	55606374		2201	4296	6497	55362950	SO:0001819	synonymous_variant	390144			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.147G>A	11.37:g.55606374G>A		Somatic		Capture	Illumina GAIIx	4	55362950	Q6IF65|Q96RB4	Silent	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.V49	ENST00000378396.1	37	c.147	CCDS31512.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.433	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D16	protein_coding	OTTHUMT00000334506.1	G	NM_001005496		55362950	+1	no_errors	NM_001005496	genbank	human	provisional	54_36p	silent	SNP	0.000	A
TRIM51	84767	genome.wustl.edu	37	11	55655589	55655589	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:55655589C>T	ENST00000449290.2	+	4	681	c.589C>T	c.(589-591)Cac>Tac	p.H197Y	TRIM51_ENST00000244891.3_Missense_Mutation_p.H54Y	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	197						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										AGAGCAACATCACTTGGAAAG	0.423																																																0			11											54.0	52.0	53.0					11																	55655589		2201	4296	6497	55412165	SO:0001583	missense	84767			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.589C>T	11.37:g.55655589C>T	ENSP00000395086:p.His197Tyr	Somatic		Capture	Illumina GAIIx	4	55412165	A6NMG2	Missense_Mutation	SNP	HMMPfam_SPRY	p.H38Y	ENST00000449290.2	37	c.112		11	.	.	.	.	.	.	.	.	.	.	.	0.685	-0.796734	0.02862	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	T;T	0.09445	2.98;2.98	0.757	-0.564	0.11774	.	.	.	.	.	T	0.06645	0.0170	N	0.26092	0.79	0.09310	N	1	B	0.17038	0.02	B	0.16722	0.016	T	0.37979	-0.9682	9	0.46703	T	0.11	.	3.0822	0.06266	0.0:0.6202:0.0:0.3798	.	197	Q9BSJ1	SPRY5_HUMAN	Y	197;54	ENSP00000395086:H197Y;ENSP00000244891:H54Y	ENSP00000244891:H54Y	H	+	1	0	SPRYD5	55412165	0.000000	0.05858	0.002000	0.10522	0.453000	0.32348	0.087000	0.14958	-0.144000	0.11314	0.152000	0.16155	CAC	-	NULL		0.423	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	SPRYD5	protein_coding	OTTHUMT00000391522.1	C	NM_032681		55412165	+1	no_errors	NM_032681	genbank	human	validated	54_36p	missense	SNP	0.000	T
OR7E5P	219445	genome.wustl.edu	37	11	55747321	55747321	+	IGR	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:55747321G>T								OR10AG1 (11331 upstream) : OR5F1 (13835 downstream)																							ATCATCTTGGGGACCGTGGCC	0.522																																																0			11																																								55503897	SO:0001628	intergenic_variant	0																															11.37:g.55747321G>T		Somatic		Capture	Illumina GAIIx	4	55503897		Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.P46T		37	c.136		11																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	0	0.522					OR7E5P			G			55503897	-1	no_errors	ENST00000399170	ensembl	human	known	54_36p	missense	SNP	0.782	T
GPR32	2854	genome.wustl.edu	37	19	51274382	51274382	+	Silent	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:51274382G>A	ENST00000270590.4	+	1	662	c.525G>A	c.(523-525)gcG>gcA	p.A175A		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	175					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TGTGCTCTGCGCACCTGAAAT	0.597																																					Esophageal Squamous(113;152 1581 5732 15840 44398)											0			19											48.0	49.0	49.0					19																	51274382		2203	4300	6503	55966194	SO:0001819	synonymous_variant	2854			AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.525G>A	19.37:g.51274382G>A		Somatic		Capture	Illumina GAIIx	4	55966194	Q502U7|Q6NWS5	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A175	ENST00000270590.4	37	c.525	CCDS12801.1	19																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.597	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR32	protein_coding	OTTHUMT00000465016.1	G			55966194	+1	no_errors	NM_001506	genbank	human	provisional	54_36p	silent	SNP	0.012	A
Unknown	0	genome.wustl.edu	37	11	56458189	56458189	+	IGR	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:56458189T>A								OR5AR1 (26026 upstream) : OR9G1 (9674 downstream)																							TTCCAGACTTTGATGACTAGC	0.458																																																0			11																																								56214765	SO:0001628	intergenic_variant	642975																															11.37:g.56458189T>A		Somatic		Capture	Illumina GAIIx	4	56214765		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.458					LOC642975			T			56214765	+1	pseudogene	XR_016156	genbank	human	model	54_36p	rna	SNP	1.000	A
OR5AK3P	81228	genome.wustl.edu	37	11	56738912	56738912	+	IGR	SNP	C	C	A	rs544376025		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:56738912C>A								AP000479.1 (93358 upstream) : OR5AK2 (17434 downstream)																							CTGTAAGCCCCTTCGCTATCC	0.408																																																0			11																																								56495488	SO:0001628	intergenic_variant	0																															11.37:g.56738912C>A		Somatic		Capture	Illumina GAIIx	4	56495488		Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.L130I		37	c.388		11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1	0	0.408					OR5AK3P			C			56495488	+1	no_errors	ENST00000326876	ensembl	human	known	54_36p	missense	SNP	0.941	A
ZNF610	162963	genome.wustl.edu	37	19	52869968	52869968	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr19:52869968A>G	ENST00000403906.3	+	6	1793	c.1337A>G	c.(1336-1338)cAt>cGt	p.H446R	ZNF610_ENST00000327920.8_Missense_Mutation_p.H446R|ZNF610_ENST00000601151.1_Missense_Mutation_p.H403R|ZNF610_ENST00000321287.8_Missense_Mutation_p.H446R	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	446					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		CTTTCACGACATCGGAAAATT	0.403																																																0			19											78.0	76.0	77.0					19																	52869968		2203	4300	6503	57561780	SO:0001583	missense	162963			AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.1337A>G	19.37:g.52869968A>G	ENSP00000383922:p.His446Arg	Somatic		Capture	Illumina GAIIx	4	57561780	A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.H446R	ENST00000403906.3	37	c.1337	CCDS12851.1	19	.	.	.	.	.	.	.	.	.	.	A	14.30	2.493724	0.44352	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	D;D	0.96200	-3.94;-3.94	1.71	1.71	0.24356	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.97904	0.9311	H	0.94503	3.545	0.23036	N	0.9984	D;D	0.89917	1.0;1.0	D;D	0.76575	0.979;0.988	D	0.91757	0.5417	9	0.87932	D	0	.	8.2022	0.31432	1.0:0.0:0.0:0.0	.	403;446	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	R	446;403;446	ENSP00000383922:H446R;ENSP00000327597:H446R	ENSP00000324441:H403R	H	+	2	0	ZNF610	57561780	0.989000	0.36119	0.005000	0.12908	0.006000	0.05464	5.385000	0.66231	0.762000	0.33152	0.383000	0.25322	CAT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.403	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	protein_coding	OTTHUMT00000462880.1	A	NM_173530		57561780	+1	no_errors	NM_173530	genbank	human	provisional	54_36p	missense	SNP	0.810	G
PSMA3	5684	genome.wustl.edu	37	14	58711653	58711653	+	Silent	SNP	C	C	G	rs368712816		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr14:58711653C>G	ENST00000216455.4	+	1	105	c.15C>G	c.(13-15)ggC>ggG	p.G5G	PSMA3_ENST00000412908.2_Silent_p.G5G|PSMA3_ENST00000557508.1_5'UTR|PSMA3_ENST00000554456.1_3'UTR	NM_002788.3|NM_152132.2	NP_002779.1|NP_687033.1	P25788	PSA3_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 3	5					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(2)	12						GCTCAATCGGCACTGGGGTGA	0.572																																																0			14											130.0	119.0	123.0					14																	58711653		2203	4300	6503	57781406	SO:0001819	synonymous_variant	5684				CCDS9731.1, CCDS45113.1	14q23	2008-08-29			ENSG00000100567	ENSG00000100567		"""Proteasome (prosome, macropain) subunits"""	9532	protein-coding gene	gene with protein product		176843				2025653, 8811196	Standard	NM_002788		Approved	HC8	uc001xdj.2	P25788	OTTHUMG00000140319	ENST00000216455.4:c.15C>G	14.37:g.58711653C>G		Somatic		Capture	Illumina GAIIx	4	57781406	B2RCK6|Q86U83|Q8N1D8|Q9BS70	Silent	SNP	superfamily_N-terminal nucleophile aminohydrolases (Ntn hydrolases),HMMPfam_Proteasome_A_N,PatternScan_PROTEASOME_A,HMMPfam_Proteasome	p.G5	ENST00000216455.4	37	c.15	CCDS9731.1	14																																																																																			-	superfamily_N-terminal nucleophile aminohydrolases (Ntn hydrolases)		0.572	PSMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA3	protein_coding	OTTHUMT00000276923.1	C	NM_002788		57781406	+1	no_errors	NM_002788	genbank	human	reviewed	54_36p	silent	SNP	0.994	G
PLK2	10769	genome.wustl.edu	37	5	57754578	57754578	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr5:57754578T>C	ENST00000274289.3	-	3	769	c.469A>G	c.(469-471)Att>Gtt	p.I157V	PLK2_ENST00000502671.1_5'Flank	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	157	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		TCCAAGAGAATGTAAATGTTT	0.348																																																0			5											81.0	81.0	81.0					5																	57754578		2203	4300	6503	57790335	SO:0001583	missense	10769				CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.469A>G	5.37:g.57754578T>C	ENSP00000274289:p.Ile157Val	Somatic		Capture	Illumina GAIIx	4	57790335	O60679|Q96CV7|Q9UE61	Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,superfamily_SSF82615,HMMPfam_POLO_box	p.I157V	ENST00000274289.3	37	c.469	CCDS3974.1	5	.	.	.	.	.	.	.	.	.	.	T	21.8	4.203883	0.79127	.	.	ENSG00000145632	ENST00000274289;ENST00000537944;ENST00000442330	T	0.27890	1.64	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.087080	0.85682	D	0.000000	T	0.48466	0.1501	L	0.45051	1.395	0.80722	D	1	D;D	0.65815	0.995;0.97	D;P	0.66716	0.946;0.868	T	0.41592	-0.9500	10	0.59425	D	0.04	-19.8333	16.8222	0.85835	0.0:0.0:0.0:1.0	.	59;157	B7Z9B4;Q9NYY3	.;PLK2_HUMAN	V	157;157;143	ENSP00000274289:I157V	ENSP00000274289:I157V	I	-	1	0	PLK2	57790335	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.687000	0.84139	2.371000	0.80710	0.533000	0.62120	ATT	-	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase		0.348	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK2	protein_coding	OTTHUMT00000214150.1	T	NM_006622		57790335	-1	no_errors	NM_006622	genbank	human	validated	54_36p	missense	SNP	1.000	C
OR5B2	390190	genome.wustl.edu	37	11	58190229	58190229	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:58190229G>A	ENST00000302581.2	-	1	557	c.506C>T	c.(505-507)tCc>tTc	p.S169F		NM_001005566.2	NP_001005566.1	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B, member 2	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TACCAGATTGGATTTACAGAA	0.458																																																0			11											62.0	57.0	59.0					11																	58190229		2201	4295	6496	57946805	SO:0001583	missense	390190			AB065852	CCDS31550.1	11q12.1	2012-08-09			ENSG00000172365	ENSG00000172365		"""GPCR / Class A : Olfactory receptors"""	8323	protein-coding gene	gene with protein product							Standard	NM_001005566		Approved	OST073	uc010rkg.2	Q96R09	OTTHUMG00000167517	ENST00000302581.2:c.506C>T	11.37:g.58190229G>A	ENSP00000303076:p.Ser169Phe	Somatic		Capture	Illumina GAIIx	4	57946805	B2RNJ6|B9EGY7|Q6IEV7|Q8NGF5	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S169F	ENST00000302581.2	37	c.506	CCDS31550.1	11	.	.	.	.	.	.	.	.	.	.	G	4.985	0.182974	0.09495	.	.	ENSG00000172365	ENST00000302581	T	0.38887	1.11	3.73	2.81	0.32909	GPCR, rhodopsin-like superfamily (1);	0.232106	0.22100	N	0.064624	T	0.44350	0.1289	M	0.81239	2.535	0.19775	N	0.999955	B	0.23990	0.095	B	0.30316	0.114	T	0.47275	-0.9130	10	0.62326	D	0.03	-6.1343	7.1028	0.25346	0.1034:0.1753:0.7212:0.0	.	169	Q96R09	OR5B2_HUMAN	F	169	ENSP00000303076:S169F	ENSP00000303076:S169F	S	-	2	0	OR5B2	57946805	0.927000	0.31430	0.041000	0.18516	0.001000	0.01503	5.302000	0.65733	0.925000	0.37094	-0.225000	0.12378	TCC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.458	OR5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B2	protein_coding	OTTHUMT00000394887.2	G	NM_001005566		57946805	-1	no_errors	NM_001005566	genbank	human	provisional	54_36p	missense	SNP	0.789	A
OR4D9	390199	genome.wustl.edu	37	11	59282496	59282496	+	Silent	SNP	A	A	T	rs142030077	byFrequency	TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:59282496A>T	ENST00000329328.3	+	1	111	c.111A>T	c.(109-111)acA>acT	p.T37T		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						TGTACATGACAACTCTAATGG	0.433																																																0			11											210.0	205.0	207.0					11																	59282496		2201	4295	6496	59039072	SO:0001819	synonymous_variant	390199			AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.111A>T	11.37:g.59282496A>T		Somatic		Capture	Illumina GAIIx	4	59039072	Q6IFF3	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T37	ENST00000329328.3	37	c.111	CCDS31564.1	11																																																																																			-	superfamily_SSF81321		0.433	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D9	protein_coding	OTTHUMT00000394237.1	A	NM_001004711		59039072	+1	no_errors	NM_001004711	genbank	human	provisional	54_36p	silent	SNP	0.000	T
MS4A4E	643680	genome.wustl.edu	37	11	59992462	59992462	+	Silent	SNP	C	C	T	rs562944261		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:59992462C>T	ENST00000528394.1	-	2	248	c.249G>A	c.(247-249)gcG>gcA	p.A83A	MS4A4E_ENST00000425663.1_Intron|MS4A4E_ENST00000398986.2_Intron|MS4A4E_ENST00000526086.1_Intron|MS4A4E_ENST00000398984.2_Silent_p.A83A|MS4A4E_ENST00000427611.2_Silent_p.A70A			Q96PG1	M4A4E_HUMAN	membrane-spanning 4-domains, subfamily A, member 4E	83						integral component of membrane (GO:0016021)				ovary(1)	1						AAATTGTGTACGCAACATACA	0.353																																																0			11																																								59749038	SO:0001819	synonymous_variant	643680			AF354936		11q12.2	2012-04-20			ENSG00000214787	ENSG00000214787			14284	protein-coding gene	gene with protein product		608401				11486273	Standard	XM_005275707		Approved		uc001noy.2	Q96PG1	OTTHUMG00000167354	ENST00000528394.1:c.249G>A	11.37:g.59992462C>T		Somatic		Capture	Illumina GAIIx	4	59749038	Q3C1W1|Q3C1W3|Q3C1W4	Silent	SNP	HMMPfam_CD20	p.A70	ENST00000528394.1	37	c.210		11																																																																																			-	HMMPfam_CD20		0.353	MS4A4E-003	NOVEL	basic|appris_candidate	protein_coding	LOC643680	protein_coding	OTTHUMT00000394290.1	C	XM_003119183		59749038	-1	no_errors	XM_931901	genbank	human	model	54_36p	silent	SNP	0.001	T
TLN2	83660	genome.wustl.edu	37	15	63029165	63029165	+	Silent	SNP	C	C	T	rs376384348		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr15:63029165C>T	ENST00000561311.1	+	28	3677	c.3447C>T	c.(3445-3447)gcC>gcT	p.A1149A	TLN2_ENST00000559908.1_3'UTR|TLN2_ENST00000306829.6_Silent_p.A1149A			Q9Y4G6	TLN2_HUMAN	talin 2	1149	Ala-rich.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						ACCCCGCGGCCGCCCATGCCA	0.622																																																0			15						T		1,4405	2.1+/-5.4	0,1,2202	37.0	39.0	39.0		3447	-9.3	0.0	15		39	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	TLN2	NM_015059.2		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		1149/2543	63029165	3,13003	2203	4300	6503	60816457	SO:0001819	synonymous_variant	83660			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3447C>T	15.37:g.63029165C>T		Somatic		Capture	Illumina GAIIx	4	60816457	A6NLB8	Silent	SNP	PatternScan_FERM_1,HMMSmart_B41,HMMPfam_FERM_N,superfamily_FERM_3-hlx,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_SSF50729,superfamily_Talin_cent,HMMPfam_Talin_middle,superfamily_SSF109885,HMMPfam_VBS,HMMSmart_ILWEQ,HMMPfam_I_LWEQ	p.A1149	ENST00000561311.1	37	c.3447	CCDS32261.1	15																																																																																			-	NULL		0.622	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	protein_coding	OTTHUMT00000257878.2	C			60816457	+1	no_errors	NM_015059	genbank	human	reviewed	54_36p	silent	SNP	0.302	T
FAM161A	84140	genome.wustl.edu	37	2	62067425	62067425	+	Silent	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:62067425T>A	ENST00000405894.3	-	3	815	c.714A>T	c.(712-714)gtA>gtT	p.V238V	FAM161A_ENST00000404929.1_Silent_p.V238V	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	238					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAGGCTCCGGTACTGTAATTG	0.368																																																0			2											151.0	135.0	140.0					2																	62067425		1840	4083	5923	61920929	SO:0001819	synonymous_variant	84140				CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.714A>T	2.37:g.62067425T>A		Somatic		Capture	Illumina GAIIx	4	61920929	B4DJV7|Q9H8R2	Silent	SNP	HMMPfam_UPF0564	p.V129	ENST00000405894.3	37	c.387	CCDS42687.2	2																																																																																			-	HMMPfam_UPF0564		0.368	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM161A	protein_coding	OTTHUMT00000325537.2	T	NM_032180		61920929	-1	no_errors	NM_032180	genbank	human	validated	54_36p	silent	SNP	0.990	A
STIP1	10963	genome.wustl.edu	37	11	63970358	63970358	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:63970358A>T	ENST00000305218.4	+	11	1403	c.1256A>T	c.(1255-1257)gAa>gTa	p.E419V	STIP1_ENST00000538945.1_Missense_Mutation_p.E395V|STIP1_ENST00000358794.5_Missense_Mutation_p.E466V	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	419					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						GACTGTGAGGAATGTATCCAG	0.478																																																0			11											227.0	207.0	214.0					11																	63970358		2201	4297	6498	63726934	SO:0001583	missense	10963			BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.1256A>T	11.37:g.63970358A>T	ENSP00000305958:p.Glu419Val	Somatic		Capture	Illumina GAIIx	4	63726934	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	HMMPfam_TPR_1,HMMSmart_TPR,superfamily_SSF48452,HMMSmart_STI1	p.E419V	ENST00000305218.4	37	c.1256	CCDS8058.1	11	.	.	.	.	.	.	.	.	.	.	A	18.29	3.592016	0.66219	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945;ENST00000540887	T;T;T;T	0.62364	0.19;0.19;0.19;0.03	5.0	5.0	0.66597	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.105127	0.64402	D	0.000007	T	0.57621	0.2066	L	0.50333	1.59	0.80722	D	1	P;P	0.37276	0.534;0.589	B;B	0.36766	0.149;0.232	T	0.63897	-0.6533	10	0.72032	D	0.01	-29.7222	13.9993	0.64424	1.0:0.0:0.0:0.0	.	395;419	F5H0T1;P31948	.;STIP1_HUMAN	V	466;419;395;18	ENSP00000351646:E466V;ENSP00000305958:E419V;ENSP00000445957:E395V;ENSP00000443416:E18V	ENSP00000305958:E419V	E	+	2	0	STIP1	63726934	1.000000	0.71417	0.977000	0.42913	0.994000	0.84299	6.474000	0.73578	2.027000	0.59764	0.459000	0.35465	GAA	-	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR		0.478	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STIP1	protein_coding	OTTHUMT00000396289.2	A	NM_006819		63726934	+1	no_errors	NM_006819	genbank	human	validated	54_36p	missense	SNP	1.000	T
TANGO6	79613	genome.wustl.edu	37	16	68894361	68894361	+	Silent	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr16:68894361C>T	ENST00000261778.1	+	2	681	c.669C>T	c.(667-669)atC>atT	p.I223I		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	223						integral component of membrane (GO:0016021)											TTGGGGATATCGCAGCAGGTC	0.488																																																0			16											104.0	102.0	103.0					16																	68894361		1977	4157	6134	67451862	SO:0001819	synonymous_variant	79613				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.669C>T	16.37:g.68894361C>T		Somatic		Capture	Illumina GAIIx	4	67451862	Q569F9|Q9H9K1	Silent	SNP	superfamily_ARM repeat,HMMPfam_DUF2435,HMMPfam_HEAT,HMMPfam_DUF2411	p.I223	ENST00000261778.1	37	c.669	CCDS45516.1	16																																																																																			-	NULL		0.488	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO7	protein_coding	OTTHUMT00000433471.2	C	XM_928235.2		67451862	+1	no_errors	NM_024562	genbank	human	validated	54_36p	silent	SNP	0.826	T
HYDIN	54768	genome.wustl.edu	37	16	71065635	71065635	+	Silent	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr16:71065635A>G	ENST00000393567.2	-	19	2865	c.2715T>C	c.(2713-2715)acT>acC	p.T905T	HYDIN_ENST00000321489.5_Silent_p.T905T|HYDIN_ENST00000541601.1_Silent_p.T922T|HYDIN_ENST00000538248.1_Silent_p.T932T|HYDIN_ENST00000448691.1_Silent_p.T905T|HYDIN_ENST00000448089.2_Silent_p.T905T	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	905					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CTGAAACAATAGTGGAACCAG	0.403																																																0			16											11.0	13.0	12.0					16																	71065635		2091	4233	6324	69623136	SO:0001819	synonymous_variant	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2715T>C	16.37:g.71065635A>G		Somatic		Capture	Illumina GAIIx	4	69623136	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_PapD-like,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.T905	ENST00000393567.2	37	c.2715	CCDS59269.1	16																																																																																			-	NULL		0.403	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	A			69623136	-1	no_errors	NM_032821	genbank	human	validated	54_36p	silent	SNP	1.000	G
UGT2B4	7363	genome.wustl.edu	37	4	70346447	70346447	+	Silent	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr4:70346447G>A	ENST00000305107.6	-	6	1538	c.1492C>T	c.(1492-1494)Ctg>Ttg	p.L498L	AC108078.1_ENST00000583573.1_RNA|UGT2B4_ENST00000512583.1_3'UTR|UGT2B4_ENST00000381096.3_Silent_p.L362L|UGT2B4_ENST00000506580.1_5'UTR	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	498					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.L498M(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	ACACAGGCCAGCAGGAACCCA	0.468																																																1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	4											144.0	139.0	141.0					4																	70346447		2203	4300	6503	70381036	SO:0001819	synonymous_variant	7363			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.1492C>T	4.37:g.70346447G>A		Somatic		Capture	Illumina GAIIx	4	70381036	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Silent	SNP	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_UDPGT,PatternScan_UDPGT	p.L498	ENST00000305107.6	37	c.1492	CCDS43234.1	4																																																																																			-	HMMPfam_UDPGT		0.468	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B4	protein_coding	OTTHUMT00000365526.1	G	NM_021139		70381036	-1	no_errors	NM_021139	genbank	human	validated	54_36p	silent	SNP	0.881	A
SMR3B	10879	genome.wustl.edu	37	4	71255388	71255388	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr4:71255388G>C	ENST00000304915.3	+	3	212	c.63G>C	c.(61-63)gaG>gaC	p.E21D	SMR3B_ENST00000504825.1_Missense_Mutation_p.E21D	NM_006685.3	NP_006676.1	P02814	SMR3B_HUMAN	submaxillary gland androgen regulated protein 3B	21						extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				large_intestine(2)|lung(3)|skin(2)	7		all_hematologic(202;0.196)				AGCCTGGTGAGAGTCAAAGAG	0.468																																																0			4											63.0	68.0	66.0					4																	71255388		2203	4300	6503	71289977	SO:0001583	missense	10879			D29833	CCDS3540.1	4q13.3	2008-02-27	2008-02-27	2005-02-07	ENSG00000171201	ENSG00000171201			17326	protein-coding gene	gene with protein product		611593	"""proline rich 3"", ""submaxillary gland androgen regulated protein 3 homolog B (mouse)"""	PROL3		7982889, 479131	Standard	NM_006685		Approved	P-B, PRL3		P02814	OTTHUMG00000129396	ENST00000304915.3:c.63G>C	4.37:g.71255388G>C	ENSP00000302400:p.Glu21Asp	Somatic		Capture	Illumina GAIIx	4	71289977	B7ZMG7|Q9UBN0|Q9UCT0	Missense_Mutation	SNP	NULL	p.E21D	ENST00000304915.3	37	c.63	CCDS3540.1	4	.	.	.	.	.	.	.	.	.	.	G	4.950	0.176427	0.09443	.	.	ENSG00000171201	ENST00000504825;ENST00000304915;ENST00000381030	T;T	0.50548	0.74;0.74	1.58	1.58	0.23477	.	.	.	.	.	T	0.57755	0.2075	.	.	.	0.09310	N	1	D	0.60575	0.988	P	0.62184	0.899	T	0.42137	-0.9469	8	0.87932	D	0	.	6.5984	0.22687	0.0:0.0:1.0:0.0	.	21	P02814	SMR3B_HUMAN	D	21	ENSP00000423138:E21D;ENSP00000302400:E21D	ENSP00000302400:E21D	E	+	3	2	SMR3B	71289977	1.000000	0.71417	0.117000	0.21633	0.179000	0.23085	0.995000	0.29706	1.188000	0.43014	0.205000	0.17691	GAG	-	NULL		0.468	SMR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMR3B	protein_coding	OTTHUMT00000251552.2	G	NM_006685		71289977	+1	no_errors	NM_006685	genbank	human	validated	54_36p	missense	SNP	0.227	C
NEGR1	257194	genome.wustl.edu	37	1	72076721	72076721	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:72076721T>A	ENST00000357731.5	-	5	1015	c.776A>T	c.(775-777)aAa>aTa	p.K259I	NEGR1_ENST00000306821.3_Missense_Mutation_p.K131I|NEGR1_ENST00000434200.1_Missense_Mutation_p.K213I	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	259	Ig-like C2-type 3.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		CTTCTCTCCTTTGTACCATTC	0.443																																																0			1											120.0	122.0	121.0					1																	72076721		2203	4300	6503	71849309	SO:0001583	missense	257194			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.776A>T	1.37:g.72076721T>A	ENSP00000350364:p.Lys259Ile	Somatic		Capture	Illumina GAIIx	4	71849309	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG,HMMPfam_I-set,HMMSmart_IGc2,HMMPfam_ig	p.K259I	ENST00000357731.5	37	c.776	CCDS661.1	1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.619533	0.87460	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.75821	-0.97;-0.97;-0.97	6.07	6.07	0.98685	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.049640	0.85682	D	0.000000	D	0.85643	0.5744	M	0.87038	2.855	0.53688	D	0.999974	D;D	0.56968	0.978;0.978	D;D	0.71184	0.972;0.949	D	0.88240	0.2909	10	0.87932	D	0	-15.7356	15.6114	0.76721	0.0:0.0:0.0:1.0	.	213;259	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	I	259;131;213	ENSP00000350364:K259I;ENSP00000305938:K131I;ENSP00000413294:K213I	ENSP00000305938:K131I	K	-	2	0	NEGR1	71849309	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.498000	0.53302	2.326000	0.78906	0.533000	0.62120	AAA	-	superfamily_SSF48726,HMMSmart_IGc2,HMMPfam_ig		0.443	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEGR1	protein_coding	OTTHUMT00000026722.4	T	NM_173808		71849309	-1	no_errors	NM_173808	genbank	human	validated	54_36p	missense	SNP	1.000	A
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72685591	72685591	+	RNA	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:72685591G>T	ENST00000425256.1	-	0	67									GTF2I repeat domain containing 2 pseudogene 1																		TTTCCGTTTCGCCCGAGTGGA	0.438																																																0			7																																								72323527			401375			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72685591G>T		Somatic		Capture	Illumina GAIIx	4	72323527		RNA	SNP	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			-	-		0.438	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P	pseudogene	OTTHUMT00000345921.1	G	NR_002164		72323527	-1	pseudogene	NR_002164	genbank	human	provisional	54_36p	rna	SNP	0.246	T
TRPM3	80036	genome.wustl.edu	37	9	73233960	73233960	+	Silent	SNP	G	G	A	rs371313289		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr9:73233960G>A	ENST00000377111.2	-	16	2388	c.2145C>T	c.(2143-2145)gaC>gaT	p.D715D	TRPM3_ENST00000357533.2_Silent_p.D719D|TRPM3_ENST00000396280.5_Silent_p.D564D|TRPM3_ENST00000377110.3_Silent_p.D715D|TRPM3_ENST00000377106.1_Silent_p.D587D|TRPM3_ENST00000360823.2_Silent_p.D577D|TRPM3_ENST00000396285.1_Silent_p.D562D|TRPM3_ENST00000377105.1_Silent_p.D574D|TRPM3_ENST00000396292.4_Silent_p.D587D|TRPM3_ENST00000358082.3_Silent_p.D577D|TRPM3_ENST00000423814.3_Silent_p.D742D|TRPM3_ENST00000408909.2_Silent_p.D574D	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	740					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CCAGCTGTTCGTCCTGCTTGT	0.562																																																0			9						G	,,,,,,	0,4406		0,0,2203	85.0	60.0	68.0		2145,1686,1722,1656,1692,1761,1731	-3.1	1.0	9		68	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TRPM3	NM_001007471.2,NM_020952.4,NM_024971.5,NM_206944.3,NM_206945.3,NM_206946.3,NM_206947.3	,,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,	715/1708,562/1555,574/1567,552/1545,564/1557,587/1580,577/1570	73233960	1,13005	2203	4300	6503	72423780	SO:0001819	synonymous_variant	80036			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.2145C>T	9.37:g.73233960G>A		Somatic		Capture	Illumina GAIIx	4	72423780	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	HMMPfam_Ion_trans	p.D715	ENST00000377111.2	37	c.2145		9	.	.	.	.	.	.	.	.	.	.	G	9.322	1.058246	0.19987	0.0	1.16E-4	ENSG00000083067	ENST00000396280	.	.	.	5.55	-3.14	0.05250	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-24.2404	14.2483	0.66001	0.7395:0.0:0.2605:0.0	.	.	.	.	X	564	.	.	R	-	1	2	TRPM3	72423780	0.512000	0.26186	0.983000	0.44433	0.964000	0.63967	-0.072000	0.11486	-0.388000	0.07797	-0.137000	0.14449	CGA	-	NULL		0.562	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	protein_coding	OTTHUMT00000214157.5	G	NM_206945		72423780	-1	no_errors	NM_001007471	genbank	human	reviewed	54_36p	silent	SNP	0.994	A
TMEM174	134288	genome.wustl.edu	37	5	72469089	72469089	+	Missense_Mutation	SNP	C	C	T	rs375705483		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr5:72469089C>T	ENST00000296776.5	+	1	68	c.19C>T	c.(19-21)Cgc>Tgc	p.R7C		NM_153217.2	NP_694949.1	Q8WUU8	TM174_HUMAN	transmembrane protein 174	7						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		Lung NSC(167;0.0378)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-54)		GGGCAGCGGCCGCTTGGAGGA	0.547																																																0			5						C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	115.0	115.0	115.0		19	3.0	0.0	5		115	0,8600		0,0,4300	no	missense	TMEM174	NM_153217.2	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	7/244	72469089	1,13005	2203	4300	6503	72504845	SO:0001583	missense	134288			BC019346	CCDS4018.1	5q13.2	2008-02-05			ENSG00000164325	ENSG00000164325			28187	protein-coding gene	gene with protein product		614909				12477932	Standard	NM_153217		Approved	MGC13034, FLJ31268	uc010izc.3	Q8WUU8	OTTHUMG00000131268	ENST00000296776.5:c.19C>T	5.37:g.72469089C>T	ENSP00000296776:p.Arg7Cys	Somatic		Capture	Illumina GAIIx	4	72504845	B2RDA0|Q96N81	Missense_Mutation	SNP	NULL	p.R7C	ENST00000296776.5	37	c.19	CCDS4018.1	5	.	.	.	.	.	.	.	.	.	.	C	6.138	0.393666	0.11638	2.27E-4	0.0	ENSG00000164325	ENST00000296776	.	.	.	5.82	3.04	0.35103	.	0.684499	0.14830	N	0.295888	T	0.16981	0.0408	N	0.08118	0	0.21020	N	0.999803	B	0.16396	0.017	B	0.12156	0.007	T	0.17228	-1.0376	9	0.46703	T	0.11	-7.4656	4.1011	0.10014	0.1588:0.5924:0.1074:0.1414	.	7	Q8WUU8	TM174_HUMAN	C	7	.	ENSP00000296776:R7C	R	+	1	0	TMEM174	72504845	0.000000	0.05858	0.001000	0.08648	0.177000	0.22998	0.375000	0.20518	0.359000	0.24239	0.591000	0.81541	CGC	-	NULL		0.547	TMEM174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM174	protein_coding	OTTHUMT00000254036.1	C	NM_153217		72504845	+1	no_errors	NM_153217	genbank	human	validated	54_36p	missense	SNP	0.405	T
TSIX	9383	genome.wustl.edu	37	X	73041840	73041840	+	lincRNA	SNP	A	A	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chrX:73041840A>T	ENST00000604411.1	+	0	29801				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		TTTCTGAAAGAGATCTATTTA	0.353																																																0			X											40.0	39.0	39.0					X																	73041840		876	1991	2867	72958565			7503					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73041840A>T		Somatic		Capture	Illumina GAIIx	4	72958565		RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			-	-		0.353	TSIX-001	KNOWN	basic	lincRNA	XIST	lincRNA	OTTHUMT00000469120.1	A	NR_003255		72958565	-1	no_errors	NR_001564	genbank	human	reviewed	54_36p	rna	SNP	0.000	T
PGS1	9489	genome.wustl.edu	37	17	76420173	76420173	+	3'UTR	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:76420173C>T	ENST00000262764.6	+	0	1739				AC061992.1_ENST00000600087.1_5'Flank|PGS1_ENST00000329897.7_3'UTR|DNAH17_ENST00000585328.1_Silent_p.P4396P|DNAH17_ENST00000586052.1_5'UTR|PGS1_ENST00000588281.1_3'UTR|DNAH17_ENST00000389840.5_Silent_p.P4424P	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			CAGGCATGGCCGGGGTCAGCT	0.597																																					Esophageal Squamous(45;182 1126 10685 43198)											0			17											77.0	76.0	77.0					17																	76420173		2203	4300	6503	73931768	SO:0001624	3_prime_UTR_variant	9489				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.*42C>T	17.37:g.76420173C>T		Somatic		Capture	Illumina GAIIx	4	73931768	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	NULL	p.R252W	ENST00000262764.6	37	c.754	CCDS42391.1	17																																																																																			-	NULL		0.597	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGS1	protein_coding	OTTHUMT00000437301.1	C	NM_024419		73931768	+1	no_errors	ENST00000335081	ensembl	human	known	54_36p	missense	SNP	0.132	T
GCNT4	51301	genome.wustl.edu	37	5	74325204	74325204	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr5:74325204C>A	ENST00000322348.4	-	1	1520	c.659G>T	c.(658-660)tGg>tTg	p.W220L		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	220					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		AACATATTTCCACTGGATTGA	0.398																																																0			5											69.0	73.0	72.0					5																	74325204		2197	4299	6496	74360960	SO:0001583	missense	51301			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.659G>T	5.37:g.74325204C>A	ENSP00000317027:p.Trp220Leu	Somatic		Capture	Illumina GAIIx	4	74360960		Missense_Mutation	SNP	HMMPfam_Branch	p.W220L	ENST00000322348.4	37	c.659	CCDS4026.1	5	.	.	.	.	.	.	.	.	.	.	.	25.0	4.588143	0.86851	.	.	ENSG00000176928	ENST00000322348	T	0.21191	2.02	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.60392	0.2265	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67252	-0.5717	10	0.87932	D	0	-12.7228	20.8598	0.99761	0.0:1.0:0.0:0.0	.	220	Q9P109	GCNT4_HUMAN	L	220	ENSP00000317027:W220L	ENSP00000317027:W220L	W	-	2	0	GCNT4	74360960	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.807000	0.86032	2.937000	0.99478	0.650000	0.86243	TGG	-	HMMPfam_Branch		0.398	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT4	protein_coding	OTTHUMT00000254040.1	C	NM_016591		74360960	-1	no_errors	NM_016591	genbank	human	validated	54_36p	missense	SNP	1.000	A
TCEB1	6921	genome.wustl.edu	37	8	74868223	74868223	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr8:74868223G>C	ENST00000522337.1	-	4	390	c.71C>G	c.(70-72)tCt>tGt	p.S24C	TCEB1_ENST00000284811.8_Missense_Mutation_p.S24C|TCEB1_ENST00000523815.1_Missense_Mutation_p.S24C|TCEB1_ENST00000519487.1_Missense_Mutation_p.S24C|TCEB1_ENST00000602840.1_Missense_Mutation_p.S24C|TCEB1_ENST00000518127.1_Missense_Mutation_p.S24C|TCEB1_ENST00000520242.1_Missense_Mutation_p.S24C|TCEB1_ENST00000520210.1_Missense_Mutation_p.S8C			Q15369	ELOC_HUMAN	transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)	24					cellular response to hypoxia (GO:0071456)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)				endometrium(2)|kidney(3)|lung(1)|prostate(1)	7	Breast(64;0.0311)		Epithelial(68;0.0136)|all cancers(69;0.0431)|BRCA - Breast invasive adenocarcinoma(89;0.0499)			ATGGCCATCAGATGATATCAA	0.388																																																0			8											80.0	73.0	75.0					8																	74868223		2203	4300	6503	75030777	SO:0001583	missense	6921			L34587	CCDS34910.1, CCDS56539.1	8q13.3	2010-04-21	2002-08-29		ENSG00000154582	ENSG00000154582			11617	protein-coding gene	gene with protein product		600788	"""transcription elongation factor B (SIII), polypeptide 1 (15kD, elongin C)"""			7821821, 7660122	Standard	NM_005648		Approved	SIII	uc003xzx.2	Q15369	OTTHUMG00000164501	ENST00000522337.1:c.71C>G	8.37:g.74868223G>C	ENSP00000429906:p.Ser24Cys	Somatic		Capture	Illumina GAIIx	4	75030777	E5RGD9|Q567Q6	Missense_Mutation	SNP	HMMSmart_SM00512,HMMPfam_Skp1_POZ,superfamily_POZ domain	p.S24C	ENST00000522337.1	37	c.71	CCDS34910.1	8	.	.	.	.	.	.	.	.	.	.	g	19.76	3.887323	0.72410	.	.	ENSG00000154582	ENST00000518127;ENST00000520210;ENST00000520242;ENST00000519487;ENST00000284811;ENST00000522337;ENST00000523815;ENST00000519082;ENST00000519021	T;T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.56	5.56	0.83823	BTB/POZ fold (2);SKP1 component, POZ (1);	0.000000	0.64402	D	0.000002	T	0.67878	0.2940	M	0.86573	2.825	0.80722	D	1	B	0.28933	0.228	B	0.38500	0.275	T	0.69774	-0.5054	10	0.56958	D	0.05	-5.4691	19.5334	0.95239	0.0:0.0:1.0:0.0	.	24	Q15369	ELOC_HUMAN	C	24;8;24;24;24;24;24;24;24	ENSP00000428334:S24C;ENSP00000430224:S8C;ENSP00000428171:S24C;ENSP00000429596:S24C;ENSP00000284811:S24C;ENSP00000429906:S24C;ENSP00000428074:S24C;ENSP00000429789:S24C	ENSP00000284811:S24C	S	-	2	0	TCEB1	75030777	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.192000	0.94947	2.616000	0.88540	0.650000	0.86243	TCT	-	HMMSmart_SM00512,HMMPfam_Skp1_POZ,superfamily_POZ domain		0.388	TCEB1-010	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TCEB1	protein_coding	OTTHUMT00000379020.1	G	NM_005648		75030777	-1	no_errors	NM_005648	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ATP9B	374868	genome.wustl.edu	37	18	77063608	77063608	+	Silent	SNP	C	C	G	rs373609399		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr18:77063608C>G	ENST00000426216.2	+	14	1433	c.1416C>G	c.(1414-1416)acC>acG	p.T472T	ATP9B_ENST00000307671.7_Silent_p.T472T	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	472					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T472T(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TCCTAGGAACCCTCACCCAGA	0.542													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17613	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	18						C		1,4405	2.1+/-5.4	0,1,2202	77.0	70.0	72.0		1416	-3.4	1.0	18		72	0,8600		0,0,4300	no	coding-synonymous	ATP9B	NM_198531.3		0,1,6502	GG,GC,CC		0.0,0.0227,0.0077		472/1148	77063608	1,13005	2203	4300	6503	75164596	SO:0001819	synonymous_variant	374868			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.1416C>G	18.37:g.77063608C>G		Somatic		Capture	Illumina GAIIx	4	75164596	O60872|Q08AD8|Q08AD9	Silent	SNP	HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N	p.T472	ENST00000426216.2	37	c.1416	CCDS12014.1	18																																																																																			-	superfamily_HAD-like,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2		0.542	ATP9B-001	KNOWN	basic|CCDS	protein_coding	ATP9B	protein_coding	OTTHUMT00000256402.3	C	NM_198531		75164596	+1	no_errors	NM_198531	genbank	human	validated	54_36p	silent	SNP	1.000	G
PEAK1	79834	genome.wustl.edu	37	15	77473079	77473079	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr15:77473079T>C	ENST00000560626.2	-	4	1665	c.1190A>G	c.(1189-1191)aAa>aGa	p.K397R	PEAK1_ENST00000558305.1_Missense_Mutation_p.K397R|PEAK1_ENST00000312493.4_Missense_Mutation_p.K397R			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	397	Ser-rich.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TGATGAATCTTTATCCTGATT	0.408																																																0			15											119.0	106.0	110.0					15																	77473079		1826	4083	5909	75260134	SO:0001583	missense	79834				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.1190A>G	15.37:g.77473079T>C	ENSP00000452796:p.Lys397Arg	Somatic		Capture	Illumina GAIIx	4	75260134	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	PatternScan_PROTEIN_KINASE_ATP,superfamily_Kinase_like,PatternScan_PROTEIN_KINASE_TYR	p.K397R	ENST00000560626.2	37	c.1190	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	T	6.809	0.518393	0.13005	.	.	ENSG00000173517	ENST00000312493	T	0.70869	-0.52	4.53	3.37	0.38596	.	0.835399	0.09037	U	0.857798	T	0.59689	0.2212	N	0.24115	0.695	0.31767	N	0.632561	B	0.27853	0.191	B	0.30943	0.122	T	0.60084	-0.7332	10	0.62326	D	0.03	.	9.8411	0.40999	0.0:0.0:0.1728:0.8272	.	397	Q9H792	PEAK1_HUMAN	R	397	ENSP00000309230:K397R	ENSP00000309230:K397R	K	-	2	0	AC087465.1	75260134	0.914000	0.31030	0.940000	0.37924	0.148000	0.21650	1.492000	0.35594	0.576000	0.29452	0.454000	0.30748	AAA	-	NULL		0.408	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SGK269	protein_coding	OTTHUMT00000419483.3	T			75260134	-1	no_errors	NM_024776	genbank	human	validated	54_36p	missense	SNP	0.452	C
EDNRB	1910	genome.wustl.edu	37	13	78474768	78474768	+	Missense_Mutation	SNP	C	C	T	rs201437745		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr13:78474768C>T	ENST00000334286.5	-	5	1209	c.973G>A	c.(973-975)Gtc>Atc	p.V325I	EDNRB_ENST00000377211.4_Missense_Mutation_p.V415I|EDNRB_ENST00000446573.1_Missense_Mutation_p.V325I	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	325					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)	p.V415I(1)|p.V325I(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	AGGCAAAAGACGGTTTTGGCC	0.418																																																2	Substitution - Missense(2)	lung(2)	13											90.0	97.0	95.0					13																	78474768		2203	4300	6503	77372769	SO:0001583	missense	1910			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.973G>A	13.37:g.78474768C>T	ENSP00000335311:p.Val325Ile	Somatic		Capture	Illumina GAIIx	4	77372769	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V325I	ENST00000334286.5	37	c.973	CCDS9461.1	13	.	.	.	.	.	.	.	.	.	.	C	33	5.196762	0.94960	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.36878	1.23;1.23;1.23	5.4	5.4	0.78164	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61825	0.2378	M	0.73753	2.245	0.80722	D	1	D;P;D	0.76494	0.998;0.87;0.999	D;B;D	0.67900	0.923;0.292;0.954	T	0.64445	-0.6406	10	0.72032	D	0.01	-17.6334	19.5514	0.95322	0.0:1.0:0.0:0.0	.	325;415;325	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	I	415;325;325	ENSP00000366416:V415I;ENSP00000403401:V325I;ENSP00000335311:V325I	ENSP00000335311:V325I	V	-	1	0	EDNRB	77372769	1.000000	0.71417	0.558000	0.28319	0.981000	0.71138	7.445000	0.80570	2.705000	0.92388	0.650000	0.86243	GTC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.418	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	protein_coding	OTTHUMT00000276505.1	C			77372769	-1	no_errors	NM_000115	genbank	human	reviewed	54_36p	missense	SNP	0.991	T
USP35	57558	genome.wustl.edu	37	11	77921373	77921373	+	Silent	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:77921373G>T	ENST00000529308.1	+	10	2733	c.2472G>T	c.(2470-2472)ctG>ctT	p.L824L	USP35_ENST00000441408.2_Silent_p.L410L|USP35_ENST00000530535.1_3'UTR|USP35_ENST00000526425.1_Silent_p.L555L|USP35_ENST00000530267.1_Silent_p.L392L	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	824	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			GCAAGATCCTGGATGACGTCT	0.637																																																0			11											86.0	93.0	91.0					11																	77921373		2127	4207	6334	77599021	SO:0001819	synonymous_variant	57558			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.2472G>T	11.37:g.77921373G>T		Somatic		Capture	Illumina GAIIx	4	77599021		Silent	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.L824	ENST00000529308.1	37	c.2472	CCDS41693.1	11																																																																																			-	superfamily_Cysteine proteinases,HMMPfam_UCH		0.637	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP35	protein_coding	OTTHUMT00000390026.1	G	XM_290527		77599021	+1	no_errors	NM_020798	genbank	human	validated	54_36p	silent	SNP	1.000	T
ZZZ3	26009	genome.wustl.edu	37	1	78098939	78098939	+	Missense_Mutation	SNP	G	G	A	rs200677861	byFrequency	TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:78098939G>A	ENST00000370801.3	-	5	576	c.101C>T	c.(100-102)gCg>gTg	p.A34V	ZZZ3_ENST00000476275.1_5'Flank|ZZZ3_ENST00000370798.1_Intron	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	34					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						TTCAGGATGCGCAATGCTACG	0.418													G|||	2	0.000399361	0.0	0.0	5008	,	,		18292	0.0		0.0	False		,,,				2504	0.002															0			1											113.0	115.0	114.0					1																	78098939		2203	4300	6503	77871527	SO:0001583	missense	26009			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.101C>T	1.37:g.78098939G>A	ENSP00000359837:p.Ala34Val	Somatic		Capture	Illumina GAIIx	4	77871527	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	HMMSmart_SM00717,HMMPfam_Myb_DNA-binding,superfamily_Homeodomain-like,HMMPfam_ZZ,PatternScan_ZF_ZZ_1	p.A34V	ENST00000370801.3	37	c.101	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.508513	0.85282	.	.	ENSG00000036549	ENST00000370801;ENST00000433749;ENST00000414381	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.73869	0.3642	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.996;0.998	T	0.75190	-0.3405	9	0.72032	D	0.01	.	19.6339	0.95722	0.0:0.0:1.0:0.0	.	34;34;34	Q8IYH5-4;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	V	34	.	ENSP00000359837:A34V	A	-	2	0	ZZZ3	77871527	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.476000	0.97823	2.701000	0.92244	0.650000	0.86243	GCG	-	NULL		0.418	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	protein_coding	OTTHUMT00000026615.1	G	NM_015534		77871527	-1	no_errors	NM_015534	genbank	human	provisional	54_36p	missense	SNP	1.000	A
RPL17P25	442232	genome.wustl.edu	37	6	81083997	81083997	+	IGR	SNP	T	T	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr6:81083997T>G								RP11-250B2.6 (17421 upstream) : RP11-250B2.3 (69063 downstream)																							ACTGTCTGCATTTTTAAGCAT	0.463																																																0			6																																								81140716	SO:0001628	intergenic_variant	442232																															6.37:g.81083997T>G		Somatic		Capture	Illumina GAIIx	4	81140716		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.463					LOC442232			T			81140716	-1	pseudogene	XR_016559	genbank	human	model	54_36p	rna	SNP	1.000	G
AGBL1	123624	genome.wustl.edu	37	15	86807739	86807739	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr15:86807739G>T	ENST00000441037.2	+	10	1294	c.1199G>T	c.(1198-1200)aGt>aTt	p.S400I	AGBL1_ENST00000389298.3_Missense_Mutation_p.S131I|AGBL1_ENST00000421325.2_Missense_Mutation_p.S400I	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	400					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CAATCCAATAGTCTCAGGAGA	0.478																																																0			15											63.0	66.0	65.0					15																	86807739		1919	4147	6066	84608743	SO:0001583	missense	123624			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1199G>T	15.37:g.86807739G>T	ENSP00000413001:p.Ser400Ile	Somatic		Capture	Illumina GAIIx	4	84608743	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	superfamily_ARM repeat,superfamily_Zn-dependent exopeptidases,HMMPfam_Peptidase_M14	p.S400I	ENST00000441037.2	37	c.1199	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	G	12.01	1.810754	0.32053	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.10382	2.89;2.88	5.71	0.603	0.17541	Armadillo-type fold (1);	0.847717	0.10648	N	0.650196	T	0.05868	0.0153	N	0.19112	0.55	0.09310	N	1	P;B;B	0.38420	0.63;0.418;0.044	B;B;B	0.31812	0.136;0.122;0.027	T	0.40403	-0.9565	10	0.22109	T	0.4	-6.4063	9.2564	0.37586	0.3832:0.0:0.6168:0.0	.	99;131;400	Q96MI9-2;Q96MI9-3;Q96MI9	.;.;CBPC4_HUMAN	I	429;400;131	ENSP00000397173:S400I;ENSP00000373949:S131I	ENSP00000373949:S131I	S	+	2	0	AGBL1	84608743	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.165000	0.16564	0.150000	0.19136	-0.143000	0.13931	AGT	-	NULL		0.478	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	protein_coding	OTTHUMT00000314929.5	G	NM_152336		84608743	+1	no_errors	NM_152336	genbank	human	validated	54_36p	missense	SNP	0.000	T
ABCB4	5244	genome.wustl.edu	37	7	87081108	87081108	+	Missense_Mutation	SNP	T	T	A	rs531217817		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:87081108T>A	ENST00000265723.4	-	7	650	c.539A>T	c.(538-540)gAc>gTc	p.D180V	ABCB4_ENST00000359206.3_Missense_Mutation_p.D180V|ABCB4_ENST00000545634.1_Missense_Mutation_p.D180V|ABCB4_ENST00000453593.1_Missense_Mutation_p.D180V|ABCB4_ENST00000358400.3_Missense_Mutation_p.D180V	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	180	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TTTGGAGATGTCACTAAAAAA	0.388																																																0			7											149.0	124.0	132.0					7																	87081108		2203	4300	6503	86919044	SO:0001583	missense	5244			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.539A>T	7.37:g.87081108T>A	ENSP00000265723:p.Asp180Val	Somatic		Capture	Illumina GAIIx	4	86919044	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.D180V	ENST00000265723.4	37	c.539	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	T	23.3	4.395576	0.83011	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.94862	-3.54;-3.54;-3.54;-3.54;-3.54	5.95	4.81	0.61882	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98009	0.9344	H	0.96833	3.89	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.996	D;D;D	0.83275	0.996;0.972;0.984	D	0.98554	1.0638	10	0.87932	D	0	-21.9701	11.4991	0.50426	0.0:0.0692:0.0:0.9308	.	180;180;180	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	V	180	ENSP00000352135:D180V;ENSP00000351172:D180V;ENSP00000265723:D180V;ENSP00000392983:D180V;ENSP00000437465:D180V	ENSP00000265723:D180V	D	-	2	0	ABCB4	86919044	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.950000	0.56676	2.282000	0.76494	0.533000	0.62120	GAC	-	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane		0.388	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	protein_coding	OTTHUMT00000336083.1	T	NM_000443		86919044	-1	no_errors	NM_018849	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
RGPD1	400966	genome.wustl.edu	37	2	87157746	87157746	+	Intron	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:87157746G>T	ENST00000559485.1	+	1	64				RGPD1_ENST00000398193.3_Intron|RGPD1_ENST00000409776.2_Intron	NM_001024457.3	NP_001019628.3	P0DJD0	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(1)|lung(1)	3						CAGTCTCCCCGCAGCAGTGAA	0.612																																																0			2																																								87011257	SO:0001627	intron_variant	729843				CCDS46358.1, CCDS46358.2	2p11.2	2013-09-24			ENSG00000187627	ENSG00000187627		"""Tetratricopeptide (TTC) repeat domain containing"""	32414	protein-coding gene	gene with protein product		612704				15710750, 15815621	Standard	NM_001024457		Approved	RGP1	uc021vkh.1	P0DJD0	OTTHUMG00000153248	ENST00000559485.1:c.48+12945G>T	2.37:g.87157746G>T		Somatic		Capture	Illumina GAIIx	4	87011257	P0C839|Q68DN6|Q6V1X0	RNA	SNP	-	NULL	ENST00000559485.1	37	NULL	CCDS46358.2	2																																																																																			-	-		0.612	RGPD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC729843	protein_coding	OTTHUMT00000330684.4	G	NM_001024457		87011257	-1	pseudogene	XR_016056	genbank	human	model	54_36p	rna	SNP	1.000	T
FANCA	2175	genome.wustl.edu	37	16	89877209	89877209	+	Splice_Site	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr16:89877209T>C	ENST00000389301.3	-	5	458	c.428A>G	c.(427-429)aAg>aGg	p.K143R	FANCA_ENST00000534992.1_Splice_Site_p.K143R|FANCA_ENST00000543736.1_Intron|FANCA_ENST00000563673.1_Splice_Site_p.K143R|FANCA_ENST00000389302.3_Splice_Site_p.K143R|FANCA_ENST00000568369.1_Splice_Site_p.K143R	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	143					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		AGACAGCTTCTTCTGAAAAGA	0.353			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0			16											98.0	102.0	101.0					16																	89877209		2198	4300	6498	88404710	SO:0001630	splice_region_variant	2175	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.427-1A>G	16.37:g.89877209T>C		Somatic		Capture	Illumina GAIIx	4	88404710	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	HMMPfam_Fanconi_A	p.K143R	ENST00000389301.3	37	c.428	CCDS32515.1	16	.	.	.	.	.	.	.	.	.	.	T	11.99	1.802827	0.31869	.	.	ENSG00000187741	ENST00000389301;ENST00000389302;ENST00000534992	T;T;T	0.45668	0.89;0.89;0.89	4.96	2.72	0.32119	.	0.390178	0.21489	N	0.073720	T	0.33498	0.0865	M	0.67953	2.075	0.25161	N	0.990358	B;P;P;P;B	0.36144	0.289;0.539;0.539;0.539;0.289	B;B;B;B;B	0.30782	0.045;0.12;0.12;0.12;0.045	T	0.15009	-1.0452	10	0.24483	T	0.36	-14.5278	6.982	0.24708	0.0:0.1841:0.0:0.8159	.	143;143;143;143;143	B4DRI7;A0PJU8;F5H8D5;O15360-2;O15360	.;.;.;.;FANCA_HUMAN	R	143	ENSP00000373952:K143R;ENSP00000373953:K143R;ENSP00000443675:K143R	ENSP00000373952:K143R	K	-	2	0	FANCA	88404710	1.000000	0.71417	0.997000	0.53966	0.719000	0.41307	2.522000	0.45572	0.357000	0.24183	0.529000	0.55759	AAG	-	NULL		0.353	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	protein_coding	OTTHUMT00000421927.1	T		Missense_Mutation	88404710	-1	no_errors	NM_000135	genbank	human	reviewed	54_36p	missense	SNP	0.920	C
MMP16	4325	genome.wustl.edu	37	8	89128811	89128811	+	Silent	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr8:89128811G>A	ENST00000286614.6	-	6	1289	c.1008C>T	c.(1006-1008)ccC>ccT	p.P336P	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	336					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GTTTGGCTCCGGGATAGGAGG	0.498																																																0			8											124.0	123.0	123.0					8																	89128811		2203	4300	6503	89197927	SO:0001819	synonymous_variant	4325			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1008C>T	8.37:g.89128811G>A		Somatic		Capture	Illumina GAIIx	4	89197927	B2RAN7|Q14824|Q52H48	Silent	SNP	"superfamily_PGBD-like,HMMPfam_PG_binding_1,PatternScan_CYSTEINE_SWITCH,HMMSmart_SM00235,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Peptidase_M10,superfamily_Hemopexin-like domain,HMMPfam_Hemopexin,HMMSmart_SM00120,PatternScan_HEMOPEXIN"	p.P336	ENST00000286614.6	37	c.1008	CCDS6246.1	8																																																																																			-	superfamily_Hemopexin-like domain		0.498	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	protein_coding	OTTHUMT00000375304.2	G	NM_005941		89197927	-1	no_errors	NM_005941	genbank	human	reviewed	54_36p	silent	SNP	0.989	A
IGKV2-28	28921	genome.wustl.edu	37	2	89521261	89521261	+	RNA	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:89521261C>T	ENST00000482769.1	-	0	307									immunoglobulin kappa variable 2-28																		AAAATCTGTGCCTGATCCACT	0.527																																																0			2											13.0	12.0	12.0					2																	89521261		1775	3988	5763	89302376			0			X63397		2p11.2	2012-02-08			ENSG00000244116	ENSG00000244116		"""Immunoglobulins / IGK locus"""	5783	other	immunoglobulin gene							Standard	NG_000834		Approved				OTTHUMG00000151652		2.37:g.89521261C>T		Somatic		Capture	Illumina GAIIx	4	89302376		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00406	p.G93D	ENST00000482769.1	37	c.278		2																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00406		0.527	IGKV2-28-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1-5	IG_V_gene	OTTHUMT00000323401.1	C	NG_000834		89302376	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390259	ensembl	human	known	54_36p	missense	SNP	0.998	T
GPR98	84059	genome.wustl.edu	37	5	89986770	89986770	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr5:89986770T>C	ENST00000405460.2	+	31	6959	c.6863T>C	c.(6862-6864)gTc>gCc	p.V2288A		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2288	Calx-beta 16. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTGCGAGTTGTCTCAGGTAAT	0.502																																																0			5											111.0	110.0	110.0					5																	89986770		1963	4162	6125	90022526	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.6863T>C	5.37:g.89986770T>C	ENSP00000384582:p.Val2288Ala	Somatic		Capture	Illumina GAIIx	4	90022526	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	HMMSmart_SM00237,HMMPfam_Calx-beta,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_EPTP,PatternScan_A_DEAMINASE,PatternScan_LIPOYL,HMMPfam_GPS	p.V2288A	ENST00000405460.2	37	c.6863	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	T	12.80	2.047936	0.36085	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.27256	1.68	5.94	5.94	0.96194	Na-Ca exchanger/integrin-beta4 (1);	0.221093	0.47093	D	0.000248	T	0.12689	0.0308	N	0.08118	0	0.80722	D	1	B	0.20887	0.049	B	0.22601	0.04	T	0.13683	-1.0500	10	0.39692	T	0.17	.	6.3533	0.21387	0.0:0.1887:0.0:0.8113	.	2288	Q8WXG9	GPR98_HUMAN	A	2288	ENSP00000384582:V2288A	ENSP00000296619:V2288A	V	+	2	0	GPR98	90022526	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.724000	0.38064	2.265000	0.75225	0.482000	0.46254	GTC	-	HMMSmart_SM00237		0.502	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	T	NM_032119		90022526	+1	no_errors	NM_032119	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CEP83	51134	genome.wustl.edu	37	12	94817918	94817918	+	Intron	SNP	C	C	T	rs545121719		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:94817918C>T	ENST00000397809.5	-	2	449				CCDC41_ENST00000547575.1_Intron|CCDC41_ENST00000339839.5_Intron|CCDC41_ENST00000397807.2_Intron	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN							cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						GAGTGCAGACCGAGCAAGCAT	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		21136	0.0		0.0	False		,,,				2504	0.001															0			12																																								93342049	SO:0001627	intron_variant	643427																														ENST00000397809.5:c.100+11132G>A	12.37:g.94817918C>T		Somatic		Capture	Illumina GAIIx	4	93342049	A4FVB1|Q08AP1	RNA	SNP	-	NULL	ENST00000397809.5	37	NULL	CCDS41820.1	12																																																																																			-	-		0.522	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBMS2P	protein_coding	OTTHUMT00000408147.3	C			93342049	-1	pseudogene	XR_016607	genbank	human	model	54_36p	rna	SNP	0.993	T
HEPHL1	341208	genome.wustl.edu	37	11	93796810	93796810	+	Missense_Mutation	SNP	G	G	C	rs373309363		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:93796810G>C	ENST00000315765.9	+	3	560	c.552G>C	c.(550-552)tgG>tgC	p.W184C		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	184	Plastocyanin-like 1.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GCCTGACCTGGGTGTACCATT	0.527																																																0			11											102.0	102.0	102.0					11																	93796810		1975	4164	6139	93436458	SO:0001583	missense	341208			BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.552G>C	11.37:g.93796810G>C	ENSP00000313699:p.Trp184Cys	Somatic		Capture	Illumina GAIIx	4	93436458	Q3C1W7	Missense_Mutation	SNP	superfamily_Cupredoxin,HMMPfam_Cu-oxidase_3,HMMPfam_Cu-oxidase_2,PatternScan_MULTICOPPER_OXIDASE1,PatternScan_MULTICOPPER_OXIDASE2	p.W184C	ENST00000315765.9	37	c.552	CCDS44710.1	11	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477430	0.84640	.	.	ENSG00000181333	ENST00000315765	D	0.99264	-5.65	5.42	5.42	0.78866	Cupredoxin (2);Multicopper oxidase, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99515	0.9827	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98565	1.0643	10	0.66056	D	0.02	.	19.2305	0.93836	0.0:0.0:1.0:0.0	.	184	Q6MZM0	HPHL1_HUMAN	C	184	ENSP00000313699:W184C	ENSP00000313699:W184C	W	+	3	0	HEPHL1	93436458	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.515000	0.98015	2.549000	0.85964	0.655000	0.94253	TGG	-	superfamily_Cupredoxin		0.527	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	protein_coding	OTTHUMT00000396103.2	G	XM_291947		93436458	+1	no_errors	NM_001098672	genbank	human	validated	54_36p	missense	SNP	1.000	C
TEKT4	150483	genome.wustl.edu	37	2	95537487	95537487	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:95537487G>A	ENST00000295201.4	+	1	300	c.163G>A	c.(163-165)Gcc>Acc	p.A55T	TEKT4_ENST00000427593.2_Missense_Mutation_p.A55T|AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	55					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CTACCACCAGGCCTTCGCCGA	0.687																																																0			2											29.0	35.0	33.0					2																	95537487		2185	4248	6433	94901214	SO:0001583	missense	150483			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.163G>A	2.37:g.95537487G>A	ENSP00000295201:p.Ala55Thr	Somatic		Capture	Illumina GAIIx	4	94901214		Missense_Mutation	SNP	HMMPfam_Tektin	p.A55T	ENST00000295201.4	37	c.163	CCDS2005.1	2	.	.	.	.	.	.	.	.	.	.	.	18.59	3.656459	0.67586	.	.	ENSG00000163060	ENST00000295201;ENST00000427593	T;T	0.03004	4.08;4.08	1.97	0.85	0.18980	.	0.000000	0.85682	D	0.000000	T	0.13970	0.0338	M	0.83312	2.635	0.51767	D	0.999936	D	0.67145	0.996	D	0.70935	0.971	T	0.01378	-1.1370	10	0.56958	D	0.05	-11.3315	7.1629	0.25675	0.0:0.0:0.7373:0.2627	.	55	Q8WW24	TEKT4_HUMAN	T	55	ENSP00000295201:A55T;ENSP00000407596:A55T	ENSP00000295201:A55T	A	+	1	0	TEKT4	94901214	1.000000	0.71417	0.997000	0.53966	0.643000	0.38383	3.553000	0.53713	1.094000	0.41399	0.558000	0.71614	GCC	-	HMMPfam_Tektin		0.687	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT4	protein_coding	OTTHUMT00000252777.1	G	NM_144705		94901214	+1	no_errors	NM_144705	genbank	human	provisional	54_36p	missense	SNP	1.000	A
DPY19L4	286148	genome.wustl.edu	37	8	95751649	95751649	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr8:95751649G>A	ENST00000414645.2	+	5	451	c.352G>A	c.(352-354)Gaa>Aaa	p.E118K		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	118						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					AGGTGTTTACGAACTGACACA	0.313																																																0			8											84.0	84.0	84.0					8																	95751649		2203	4299	6502	95820825	SO:0001583	missense	286148				CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.352G>A	8.37:g.95751649G>A	ENSP00000389630:p.Glu118Lys	Somatic		Capture	Illumina GAIIx	4	95820825	Q6ZW32|Q6ZW42|Q7Z329	Missense_Mutation	SNP	HMMPfam_DUF2211	p.E118K	ENST00000414645.2	37	c.352	CCDS34924.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.00|15.00	2.702224|2.702224	0.48307|0.48307	.|.	.|.	ENSG00000156162|ENSG00000156162	ENST00000522422;ENST00000414645;ENST00000519176|ENST00000519353	T;T;T|.	0.54279|.	0.58;0.58;0.58|.	5.98|5.98	5.98|5.98	0.97165|0.97165	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70430|0.70430	0.3223|0.3223	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999997|0.999997	D;D|.	0.63046|.	0.977;0.992|.	P;P|.	0.52856|.	0.5;0.711|.	T|T	0.66188|0.66188	-0.5986|-0.5986	10|5	0.06625|.	T|.	0.88|.	-18.4592|-18.4592	16.6714|16.6714	0.85268|0.85268	0.0:0.1294:0.8706:0.0|0.0:0.1294:0.8706:0.0	.|.	46;118|.	E5RGB7;Q7Z388|.	.;D19L4_HUMAN|.	K|Q	46;118;89|49	ENSP00000428762:E46K;ENSP00000389630:E118K;ENSP00000430417:E89K|.	ENSP00000389630:E118K|.	E|R	+|+	1|2	0|0	DPY19L4|DPY19L4	95820825|95820825	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.974000|0.974000	0.67602|0.67602	6.812000|6.812000	0.75226|0.75226	2.838000|2.838000	0.97847|0.97847	0.591000|0.591000	0.81541|0.81541	GAA|CGA	-	HMMPfam_DUF2211		0.313	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L4	protein_coding	OTTHUMT00000379339.1	G	NM_181787		95820825	+1	no_errors	NM_181787	genbank	human	validated	54_36p	missense	SNP	1.000	A
CNGA3	1261	genome.wustl.edu	37	2	99013682	99013682	+	Silent	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:99013682C>T	ENST00000272602.2	+	7	2088	c.2049C>T	c.(2047-2049)ccC>ccT	p.P683P	CNGA3_ENST00000409937.1_Silent_p.P687P|CNGA3_ENST00000393504.1_Silent_p.P683P|CNGA3_ENST00000436404.2_Silent_p.P665P			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	683					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GGGAAGTTCCCGGGGATGCTA	0.557																																																0			2																																								98380114	SO:0001819	synonymous_variant	1261			S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.2049C>T	2.37:g.99013682C>T		Somatic		Capture	Illumina GAIIx	4	98380114	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2	p.P683	ENST00000272602.2	37	c.2049	CCDS2034.1	2																																																																																			-	NULL		0.557	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	protein_coding	OTTHUMT00000252986.1	C	NM_001298		98380114	+1	no_errors	NM_001298	genbank	human	reviewed	54_36p	silent	SNP	0.652	T
SLC25A47	283600	genome.wustl.edu	37	14	100795855	100795855	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr14:100795855G>A	ENST00000361529.3	+	6	878	c.800G>A	c.(799-801)cGa>cAa	p.R267Q	SLC25A47_ENST00000557052.1_Missense_Mutation_p.R121Q	NM_207117.2	NP_997000.2	Q6Q0C1	S2547_HUMAN	solute carrier family 25, member 47	267					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	13						ACCAGCGTTCGAGAGGAGGGA	0.627																																					GBM(11;1289 1351)											0			14											60.0	64.0	63.0					14																	100795855		2203	4300	6503	99865608	SO:0001583	missense	283600				CCDS9959.1	14q32.2	2013-05-22	2010-07-19	2010-07-19	ENSG00000140107	ENSG00000140107		"""Solute carriers"""	20115	protein-coding gene	gene with protein product		609911	"""chromosome 14 open reading frame 68"""	C14orf68			Standard	NM_207117		Approved		uc001yhc.3	Q6Q0C1	OTTHUMG00000171571	ENST00000361529.3:c.800G>A	14.37:g.100795855G>A	ENSP00000354886:p.Arg267Gln	Somatic		Capture	Illumina GAIIx	4	99865608	B2RP39|Q68CL2|Q6PZD8|Q86U14	Missense_Mutation	SNP	HMMPfam_Mito_carr,superfamily_Mitochondrial carrier	p.R267Q	ENST00000361529.3	37	c.800	CCDS9959.1	14	.	.	.	.	.	.	.	.	.	.	G	11.25	1.584514	0.28268	.	.	ENSG00000140107	ENST00000361529;ENST00000557052	T;T	0.79749	-1.3;-1.3	5.38	3.21	0.36854	Mitochondrial carrier domain (2);	0.093578	0.64402	N	0.000002	D	0.84347	0.5452	L	0.52905	1.665	0.25873	N	0.98369	D	0.61697	0.99	D	0.63488	0.915	T	0.75986	-0.3124	10	0.29301	T	0.29	-8.3536	13.1159	0.59299	0.153:0.0:0.8469:0.0	.	267	Q6Q0C1	S2547_HUMAN	Q	267;121	ENSP00000354886:R267Q;ENSP00000451078:R121Q	ENSP00000354886:R267Q	R	+	2	0	SLC25A47	99865608	0.686000	0.27661	0.026000	0.17262	0.012000	0.07955	3.135000	0.50546	1.274000	0.44362	-0.234000	0.12200	CGA	-	superfamily_Mitochondrial carrier,HMMPfam_Mito_carr		0.627	SLC25A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf68	protein_coding	OTTHUMT00000414231.1	G			99865608	+1	no_errors	NM_207117	genbank	human	validated	54_36p	missense	SNP	0.910	A
PLOD3	8985	genome.wustl.edu	37	7	100855616	100855616	+	Nonsense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:100855616G>A	ENST00000223127.3	-	10	1443	c.1045C>T	c.(1045-1047)Cag>Tag	p.Q349*		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	349					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	TCCTGGAGCTGCGGCCAGGAG	0.662																																																0			7											56.0	58.0	57.0					7																	100855616		2203	4300	6503	100642336	SO:0001587	stop_gained	8985			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1045C>T	7.37:g.100855616G>A	ENSP00000223127:p.Gln349*	Somatic		Capture	Illumina GAIIx	4	100642336	B2R6W6|Q540C3	Nonsense_Mutation	SNP	HMMSmart_SM00702,HMMPfam_2OG-FeII_Oxy,PatternScan_LYS_HYDROXYLASE	p.Q349*	ENST00000223127.3	37	c.1045	CCDS5715.1	7	.	.	.	.	.	.	.	.	.	.	G	38	7.119413	0.98077	.	.	ENSG00000106397	ENST00000223127	.	.	.	4.44	3.54	0.40534	.	0.414773	0.23832	N	0.044122	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.0253	7.4951	0.27483	0.0:0.1845:0.6251:0.1904	.	.	.	.	X	349	.	ENSP00000223127:Q349X	Q	-	1	0	PLOD3	100642336	0.760000	0.28428	0.992000	0.48379	0.645000	0.38454	0.948000	0.29096	0.829000	0.34733	0.462000	0.41574	CAG	-	NULL		0.662	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	protein_coding	OTTHUMT00000347470.1	G			100642336	-1	no_errors	NM_001084	genbank	human	reviewed	54_36p	nonsense	SNP	0.653	A
GLT8D2	83468	genome.wustl.edu	37	12	104393203	104393203	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:104393203T>A	ENST00000360814.4	-	6	779	c.374A>T	c.(373-375)gAc>gTc	p.D125V	GLT8D2_ENST00000546436.1_Missense_Mutation_p.D125V|GLT8D2_ENST00000548660.1_Missense_Mutation_p.D125V	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	125						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						CCTCGATGAGTCTGGTCTGAT	0.448																																																0			12											203.0	186.0	192.0					12																	104393203		2203	4300	6503	102917333	SO:0001583	missense	83468			BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.374A>T	12.37:g.104393203T>A	ENSP00000354053:p.Asp125Val	Somatic		Capture	Illumina GAIIx	4	102917333	Q96KA2	Missense_Mutation	SNP	superfamily_SSF53448,HMMPfam_Glyco_transf_8	p.D125V	ENST00000360814.4	37	c.374	CCDS9096.1	12	.	.	.	.	.	.	.	.	.	.	T	22.2	4.257158	0.80246	.	.	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660;ENST00000546851	T;T;T	0.44881	0.91;0.91;0.91	5.79	5.79	0.91817	.	0.043969	0.85682	D	0.000000	T	0.66187	0.2764	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67948	-0.5538	10	0.48119	T	0.1	.	16.1252	0.81386	0.0:0.0:0.0:1.0	.	125	Q9H1C3	GL8D2_HUMAN	V	125;125;125;64	ENSP00000354053:D125V;ENSP00000449750:D125V;ENSP00000447450:D125V	ENSP00000354053:D125V	D	-	2	0	GLT8D2	102917333	1.000000	0.71417	0.892000	0.35008	0.716000	0.41182	5.409000	0.66374	2.214000	0.71695	0.533000	0.62120	GAC	-	superfamily_SSF53448,HMMPfam_Glyco_transf_8		0.448	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT8D2	protein_coding	OTTHUMT00000407371.1	T	NM_031302		102917333	-1	no_errors	NM_031302	genbank	human	provisional	54_36p	missense	SNP	1.000	A
NFKB1	4790	genome.wustl.edu	37	4	103488217	103488217	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr4:103488217C>T	ENST00000505458.1	+	6	606	c.329C>T	c.(328-330)gCc>gTc	p.A110V	NFKB1_ENST00000510638.1_3'UTR|AF213884.3_ENST00000458904.1_RNA|NFKB1_ENST00000394820.4_Missense_Mutation_p.A110V|NFKB1_ENST00000226574.4_Missense_Mutation_p.A111V			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	110	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	CACCTGCATGCCCACAGCCTG	0.463																																																0			4											165.0	143.0	150.0					4																	103488217		2203	4300	6503	103707253	SO:0001583	missense	4790			M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.329C>T	4.37:g.103488217C>T	ENSP00000424790:p.Ala110Val	Somatic		Capture	Illumina GAIIx	4	103707253	A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	superfamily_P53_like_DNA_bnd,HMMPfam_RHD,PatternScan_REL_1,superfamily_ANK,superfamily_Ig_E-set,HMMSmart_IPT,HMMPfam_TIG,HMMPfam_Ank,HMMSmart_ANK,superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death	p.A111V	ENST00000505458.1	37	c.332	CCDS54783.1	4	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002408	0.93227	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000507079;ENST00000505458;ENST00000509165	T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79	5.62	5.62	0.85841	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.058870	0.64402	D	0.000003	T	0.61299	0.2336	L	0.43757	1.38	0.80722	D	1	D;D	0.71674	0.998;0.995	P;P	0.61533	0.89;0.793	T	0.62868	-0.6763	10	0.87932	D	0	.	19.69	0.95996	0.0:1.0:0.0:0.0	.	110;111	P19838;P19838-2	NFKB1_HUMAN;.	V	111;110;119;110;111	ENSP00000226574:A111V;ENSP00000378297:A110V;ENSP00000426147:A119V;ENSP00000424790:A110V;ENSP00000423877:A111V	ENSP00000226574:A111V	A	+	2	0	NFKB1	103707253	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	6.364000	0.73086	2.648000	0.89879	0.650000	0.86243	GCC	-	superfamily_P53_like_DNA_bnd,HMMPfam_RHD,superfamily_ANK		0.463	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	NFKB1	protein_coding	OTTHUMT00000363411.1	C			103707253	+1	no_errors	NM_003998	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BTBD11	121551	genome.wustl.edu	37	12	108012053	108012053	+	Missense_Mutation	SNP	G	G	A	rs202066069	byFrequency	TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:108012053G>A	ENST00000280758.5	+	10	2878	c.2350G>A	c.(2350-2352)Gcc>Acc	p.A784T	BTBD11_ENST00000490090.2_Missense_Mutation_p.A784T|RP11-128P10.1_ENST00000548473.1_RNA|BTBD11_ENST00000420571.2_Intron|BTBD11_ENST00000357167.4_Missense_Mutation_p.A321T	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	784						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CCCCTTGTGCGCCAGCCGCAA	0.607																																																0			12											47.0	45.0	46.0					12																	108012053		2203	4300	6503	106536183	SO:0001583	missense	121551			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2350G>A	12.37:g.108012053G>A	ENSP00000280758:p.Ala784Thr	Somatic		Capture	Illumina GAIIx	4	106536183	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	superfamily_Histone-fold,superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225	p.A784T	ENST00000280758.5	37	c.2350	CCDS31893.1	12	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021582	0.54576	.	.	ENSG00000151136	ENST00000280758;ENST00000490090;ENST00000357167	T;T;T	0.39406	1.31;1.34;1.08	5.07	5.07	0.68467	.	0.445655	0.26734	N	0.022777	T	0.16514	0.0397	N	0.03324	-0.35	0.80722	D	1	B;P;P	0.36465	0.203;0.458;0.554	B;B;B	0.22753	0.028;0.041;0.026	T	0.17501	-1.0367	10	0.15066	T	0.55	.	13.7435	0.62862	0.0:0.0:0.8461:0.1539	.	321;784;784	E9PHS4;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	T	784;784;321	ENSP00000280758:A784T;ENSP00000447319:A784T;ENSP00000349690:A321T	ENSP00000280758:A784T	A	+	1	0	BTBD11	106536183	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.920000	0.40025	2.509000	0.84616	0.563000	0.77884	GCC	-	NULL		0.607	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	protein_coding	OTTHUMT00000318003.1	G	NM_152322		106536183	+1	no_errors	NM_001018072	genbank	human	validated	54_36p	missense	SNP	0.995	A
SEPT10	151011	genome.wustl.edu	37	2	110301779	110301779	+	3'UTR	SNP	A	A	C	rs200598502	byFrequency	TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:110301779A>C	ENST00000397712.2	-	0	1850				SEPT10_ENST00000334001.6_3'UTR|SEPT10_ENST00000468616.1_5'Flank|SEPT10_ENST00000356688.4_Missense_Mutation_p.F519V|SEPT10_ENST00000397714.2_3'UTR	NM_144710.3	NP_653311.1	Q9P0V9	SEP10_HUMAN	septin 10						cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(3)|large_intestine(4)|lung(8)|prostate(1)	18						TGTTCACCAAATATAGAAGTG	0.338																																																0			2																																								109659068	SO:0001624	3_prime_UTR_variant	151011			AF146760	CCDS42726.1, CCDS46383.1	2q13	2013-01-21			ENSG00000186522	ENSG00000186522		"""Septins"""	14349	protein-coding gene	gene with protein product	"""sept1-like"""	611737				12711328	Standard	NM_144710		Approved	FLJ11619	uc002tew.4	Q9P0V9	OTTHUMG00000154957	ENST00000397712.2:c.*107T>G	2.37:g.110301779A>C		Somatic		Capture	Illumina GAIIx	4	109659068	B3KRQ9|Q86VP5|Q9HAH6	Missense_Mutation	SNP	superfamily_SSF52540,HMMPfam_Septin	p.F490V	ENST00000397712.2	37	c.1468	CCDS46383.1	2	.	.	.	.	.	.	.	.	.	.	A	8.972	0.973228	0.18736	.	.	ENSG00000186522	ENST00000356688	T	0.54279	0.58	5.37	1.66	0.24008	.	1.901300	0.02724	N	0.114273	T	0.40645	0.1125	.	.	.	0.20638	N	0.999879	B	0.06786	0.001	B	0.08055	0.003	T	0.31194	-0.9952	9	0.87932	D	0	.	2.1719	0.03852	0.5923:0.1635:0.0874:0.1567	.	519	B5ME97	.	V	519	ENSP00000349116:F519V	ENSP00000349116:F519V	F	-	1	0	SEPT10	109659068	0.087000	0.21565	0.491000	0.27477	0.028000	0.11728	0.685000	0.25378	0.099000	0.17552	0.482000	0.46254	TTT	-	NULL		0.338	SEPT10-001	KNOWN	basic|CCDS	protein_coding	SEPT10	protein_coding	OTTHUMT00000337804.1	A	NM_144710		109659068	-1	no_start_codon	ENST00000356688	ensembl	human	known	54_36p	missense	SNP	0.062	C
LRRN3	54674	genome.wustl.edu	37	7	110763677	110763677	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:110763677G>A	ENST00000422987.3	+	2	1680	c.849G>A	c.(847-849)atG>atA	p.M283I	IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000437687.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.M283I|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000331762.3_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.M283I	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	283					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		TTAGCAATATGCTACACTTAA	0.333																																																0			7											54.0	58.0	57.0					7																	110763677		2203	4300	6503	110550913	SO:0001583	missense	54674			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.849G>A	7.37:g.110763677G>A	ENSP00000412417:p.Met283Ile	Somatic		Capture	Illumina GAIIx	4	110550913	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00013,HMMSmart_SM00365,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_fn3,superfamily_Fibronectin type III	p.M283I	ENST00000422987.3	37	c.849	CCDS5754.1	7	.	.	.	.	.	.	.	.	.	.	G	19.77	3.888463	0.72524	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.24350	1.86;1.86;1.86	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000001	T	0.51329	0.1668	M	0.61703	1.905	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.45585	-0.9251	10	0.66056	D	0.02	.	20.1991	0.98252	0.0:0.0:1.0:0.0	.	283	Q9H3W5	LRRN3_HUMAN	I	283	ENSP00000312001:M283I;ENSP00000397312:M283I;ENSP00000412417:M283I	ENSP00000312001:M283I	M	+	3	0	LRRN3	110550913	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.775000	0.95449	0.650000	0.86243	ATG	-	superfamily_L domain-like,HMMPfam_LRR_1		0.333	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN3	protein_coding	OTTHUMT00000338171.2	G	NM_018334		110550913	+1	no_errors	NM_001099658	genbank	human	validated	54_36p	missense	SNP	1.000	A
SVEP1	79987	genome.wustl.edu	37	9	113173686	113173686	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr9:113173686A>T	ENST00000401783.2	-	37	6641	c.6305T>A	c.(6304-6306)tTt>tAt	p.F2102Y	SVEP1_ENST00000297826.5_Missense_Mutation_p.F28Y|SVEP1_ENST00000374469.1_Missense_Mutation_p.F2079Y	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2102	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GCCAGCTGCAAATTTTGCTTT	0.463																																																0			9											44.0	47.0	46.0					9																	113173686		1872	4112	5984	112213507	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6305T>A	9.37:g.113173686A>T	ENSP00000384917:p.Phe2102Tyr	Somatic		Capture	Illumina GAIIx	4	112213507	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,superfamily_Growth factor receptor domain,PatternScan_EGF_2,HMMPfam_GCC2_GCC3,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,HMMPfam_HYR,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,HMMSmart_SM00159,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Pentaxin,HMMPfam_EGF_CA,HMMPfam_EGF_2	p.F2102Y	ENST00000401783.2	37	c.6305	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	A	15.13	2.742683	0.49151	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.63913	-0.07;-0.07;-0.07	5.98	5.98	0.97165	Complement control module (2);Sushi/SCR/CCP (3);	0.049141	0.85682	D	0.000000	T	0.42899	0.1223	N	0.05351	-0.065	0.80722	D	1	B	0.31640	0.333	B	0.34991	0.193	T	0.42766	-0.9432	10	0.07644	T	0.81	.	16.4728	0.84119	1.0:0.0:0.0:0.0	.	2102	Q4LDE5	SVEP1_HUMAN	Y	2102;2079;28	ENSP00000384917:F2102Y;ENSP00000363593:F2079Y;ENSP00000297826:F28Y	ENSP00000297826:F28Y	F	-	2	0	SVEP1	112213507	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.531000	0.73820	2.296000	0.77279	0.482000	0.46254	TTT	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.463	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	protein_coding		A			112213507	-1	no_errors	NM_153366	genbank	human	validated	54_36p	missense	SNP	1.000	T
USP28	57646	genome.wustl.edu	37	11	113694327	113694327	+	Splice_Site	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:113694327C>G	ENST00000003302.4	-	12	1351	c.1283G>C	c.(1282-1284)aGg>aCg	p.R428T	USP28_ENST00000544967.1_Splice_Site_p.R136T|USP28_ENST00000260188.5_Splice_Site_p.R428T|USP28_ENST00000537706.1_Splice_Site_p.R428T|RP11-667M19.10_ENST00000399123.2_RNA|USP28_ENST00000545540.1_Splice_Site_p.R303T	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	428	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		CAAAACTCACCTTTCCAATTT	0.299																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)											0			11											97.0	88.0	91.0					11																	113694327		2200	4294	6494	113199537	SO:0001630	splice_region_variant	57646			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.1283+1G>C	11.37:g.113694327C>G		Somatic		Capture	Illumina GAIIx	4	113199537	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	superfamily_UBA-like,superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2,PatternScan_CPSASE_2	p.R428T	ENST00000003302.4	37	c.1283	CCDS31680.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.05|14.05	2.418436|2.418436	0.42918|0.42918	.|.	.|.	ENSG00000048028|ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540;ENST00000537706|ENST00000538475	T;T;T;T;T|T	0.74315|0.44881	1.4;1.39;0.8;1.41;-0.83|0.91	4.97|4.97	4.97|4.97	0.65823|0.65823	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);|.	0.140253|.	0.64402|.	D|.	0.000002|.	T|T	0.45498|0.45498	0.1345|0.1345	L|L	0.42245|0.42245	1.32|1.32	0.51482|0.51482	D|D	0.999925|0.999925	P;P;P;P|.	0.47910|.	0.746;0.902;0.804;0.702|.	B;P;P;B|.	0.50537|.	0.372;0.643;0.643;0.255|.	T|T	0.21621|0.21621	-1.0240|-1.0240	9|6	.|.	.|.	.|.	-19.4849|-19.4849	12.7991|12.7991	0.57576|0.57576	0.0:0.9217:0.0:0.0783|0.0:0.9217:0.0:0.0783	.|.	303;428;428;136|.	B4E3L3;Q6NZX9;Q96RU2;G3V1N5|.	.;.;UBP28_HUMAN;.|.	T|T	428;428;136;303;428|192	ENSP00000003302:R428T;ENSP00000260188:R428T;ENSP00000442431:R136T;ENSP00000444991:R303T;ENSP00000445743:R428T|ENSP00000442257:S192T	.|.	R|S	-|-	2|2	0|0	USP28|USP28	113199537|113199537	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.367000|0.367000	0.29736|0.29736	5.238000|5.238000	0.65366|0.65366	2.559000|2.559000	0.86315|0.86315	0.655000|0.655000	0.94253|0.94253	AGG|AGT	-	superfamily_Cysteine proteinases,HMMPfam_UCH		0.299	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	protein_coding	OTTHUMT00000398789.1	C		Missense_Mutation	113199537	-1	no_errors	NM_020886	genbank	human	validated	54_36p	missense	SNP	1.000	G
TBX5	6910	genome.wustl.edu	37	12	114823299	114823299	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:114823299C>A	ENST00000310346.4	-	7	1403	c.737G>T	c.(736-738)aGa>aTa	p.R246I	TBX5_ENST00000526441.1_Missense_Mutation_p.R246I|TBX5_ENST00000405440.2_Missense_Mutation_p.R246I|TBX5_ENST00000349716.5_Missense_Mutation_p.R196I	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	246					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		TCTTGACATTCTGTGCAGCTC	0.468																																					NSCLC(152;1358 1980 4050 23898 40356)											0			12											168.0	138.0	148.0					12																	114823299		2203	4300	6503	113307682	SO:0001583	missense	6910			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.737G>T	12.37:g.114823299C>A	ENSP00000309913:p.Arg246Ile	Somatic		Capture	Illumina GAIIx	4	113307682	A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	superfamily_p53-like transcription factors,HMMSmart_SM00425,HMMPfam_T-box,PatternScan_TBOX_1,PatternScan_TBOX_2	p.R246I	ENST00000310346.4	37	c.737	CCDS9173.1	12	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952601	0.92660	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440;ENST00000526441	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	5.27	5.27	0.74061	.	0.150287	0.64402	D	0.000012	D	0.91355	0.7273	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.971	D	0.92178	0.5749	10	0.72032	D	0.01	.	18.8883	0.92388	0.0:1.0:0.0:0.0	.	246;246	Q99593-2;Q99593	.;TBX5_HUMAN	I	196;246;143;246;246	ENSP00000337723:R196I;ENSP00000309913:R246I;ENSP00000384152:R246I;ENSP00000433292:R246I	ENSP00000309913:R246I	R	-	2	0	TBX5	113307682	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	7.400000	0.79949	2.472000	0.83506	0.563000	0.77884	AGA	-	NULL		0.468	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TBX5	protein_coding	OTTHUMT00000388297.1	C	NM_080717		113307682	-1	no_errors	NM_000192	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
AP4B1	10717	genome.wustl.edu	37	1	114438894	114438894	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:114438894A>G	ENST00000369569.1	-	8	1776	c.1496T>C	c.(1495-1497)tTg>tCg	p.L499S	AP4B1_ENST00000462591.1_5'UTR|AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000256658.4_Missense_Mutation_p.L499S|AP4B1_ENST00000369567.1_Missense_Mutation_p.L331S	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit	499					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGTAATACAACAAACGTCC	0.448																																																0			1											102.0	105.0	104.0					1																	114438894		2203	4300	6503	114240417	SO:0001583	missense	10717			AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.1496T>C	1.37:g.114438894A>G	ENSP00000358582:p.Leu499Ser	Somatic		Capture	Illumina GAIIx	4	114240417	B7Z4X3|Q59EJ4|Q96CL6	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_Adaptin_N,HMMPfam_B2-adapt-app_C	p.L499S	ENST00000369569.1	37	c.1496	CCDS865.1	1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.137128	0.77775	.	.	ENSG00000134262	ENST00000369567;ENST00000369569;ENST00000256658	T;T;T	0.21932	1.98;1.98;1.98	6.04	6.04	0.98038	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.202998	0.43110	D	0.000610	T	0.47469	0.1447	M	0.88105	2.93	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.996;0.998;0.996;0.997	T	0.57917	-0.7728	10	0.87932	D	0	.	16.5885	0.84745	1.0:0.0:0.0:0.0	.	499;331;499;400	B2RBF6;B1ALD0;Q9Y6B7;B4DTG3	.;.;AP4B1_HUMAN;.	S	331;499;499	ENSP00000358580:L331S;ENSP00000358582:L499S;ENSP00000256658:L499S	ENSP00000256658:L499S	L	-	2	0	AP4B1	114240417	1.000000	0.71417	0.009000	0.14445	0.888000	0.51559	9.300000	0.96151	2.317000	0.78254	0.460000	0.39030	TTG	-	superfamily_ARM-type_fold,HMMPfam_Adaptin_N		0.448	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP4B1	protein_coding	OTTHUMT00000033037.1	A	NM_006594		114240417	-1	no_errors	NM_006594	genbank	human	validated	54_36p	missense	SNP	0.993	G
C9orf43	257169	genome.wustl.edu	37	9	116185692	116185692	+	Silent	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr9:116185692C>G	ENST00000288462.4	+	7	1016	c.570C>G	c.(568-570)acC>acG	p.T190T	C9orf43_ENST00000374165.1_Silent_p.T190T	NM_152786.1	NP_689999.1	Q8TAL5	CI043_HUMAN	chromosome 9 open reading frame 43	190										breast(2)|large_intestine(6)|lung(2)|ovary(1)|pancreas(1)|prostate(3)	15						CTCCCCCAACCCCAGTGCAAT	0.478																																																0			9											123.0	108.0	113.0					9																	116185692		2203	4300	6503	115225513	SO:0001819	synonymous_variant	257169			BC026884	CCDS6796.1	9q33.1	2012-03-15			ENSG00000157653	ENSG00000157653			23570	protein-coding gene	gene with protein product						12477932	Standard	NM_152786		Approved	MGC17358	uc004bhp.3	Q8TAL5	OTTHUMG00000020526	ENST00000288462.4:c.570C>G	9.37:g.116185692C>G		Somatic		Capture	Illumina GAIIx	4	115225513		Silent	SNP	NULL	p.T190	ENST00000288462.4	37	c.570	CCDS6796.1	9																																																																																			-	NULL		0.478	C9orf43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C9orf43	protein_coding	OTTHUMT00000053739.1	C	NM_152786		115225513	+1	no_errors	NM_152786	genbank	human	predicted	54_36p	silent	SNP	0.065	G
RNFT2	84900	genome.wustl.edu	37	12	117193646	117193646	+	Intron	SNP	G	G	C	rs554006499		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:117193646G>C	ENST00000257575.4	+	5	860				RNFT2_ENST00000407967.3_Intron|RNFT2_ENST00000392549.2_Intron|RNFT2_ENST00000319176.7_Intron			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		aacatatatcgggtgcctctc	0.398													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18795	0.0		0.0	False		,,,				2504	0.0															0			12																																								115678029	SO:0001627	intron_variant	728693			AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.627+1781G>C	12.37:g.117193646G>C		Somatic		Capture	Illumina GAIIx	4	115678029	E9PAM7|Q96SU5	RNA	SNP	-	NULL	ENST00000257575.4	37	NULL	CCDS44987.1	12																																																																																			-	-		0.398	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC728693	protein_coding	OTTHUMT00000320417.1	G	NM_032814		115678029	-1	pseudogene	XR_015773	genbank	human	model	54_36p	rna	SNP	0.995	C
AMBP	259	genome.wustl.edu	37	9	116840374	116840374	+	Splice_Site	SNP	C	C	G	rs535072502		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr9:116840374C>G	ENST00000265132.3	-	1	378	c.116G>C	c.(115-117)cGg>cCg	p.R39P		NM_001633.3	NP_001624.1	P02760	AMBP_HUMAN	alpha-1-microglobulin/bikunin precursor	39					cell adhesion (GO:0007155)|female pregnancy (GO:0007565)|heme catabolic process (GO:0042167)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of JNK cascade (GO:0046329)|protein catabolic process (GO:0030163)|protein-chromophore linkage (GO:0018298)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|calcium oxalate binding (GO:0046904)|heme binding (GO:0020037)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)|small molecule binding (GO:0036094)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	11					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	CAGCCTTACCCGAGAGATATT	0.642																																																0			9											119.0	128.0	125.0					9																	116840374		2203	4300	6503	115880195	SO:0001630	splice_region_variant	259			X04494	CCDS6800.1	9q32-q33	2014-01-22			ENSG00000106927	ENSG00000106927		"""Lipocalins"""	453	protein-coding gene	gene with protein product	"""growth-inhibiting protein 19"", ""uristatin"", ""complex-forming glycoprotein heterogeneous in charge"", ""bikunin"", ""inter-alpha-trypsin inhibitor light chain"", ""protein HC"", ""uronic-acid-rich protein"", ""trypstatin"""	176870		ITI, ITIL		1708673, 1385302	Standard	NM_001633		Approved	UTI, HCP, EDC1, HI30, IATIL, ITILC	uc004bie.4	P02760	OTTHUMG00000020534	ENST00000265132.3:c.117+1G>C	9.37:g.116840374C>G		Somatic		Capture	Illumina GAIIx	4	115880195	P00977|P02759|P78491|Q2TU33|Q5TBD7|Q9UC58|Q9UDI8	Missense_Mutation	SNP	superfamily_Calycin,PatternScan_LIPOCALIN,HMMPfam_Lipocalin,superfamily_Prot_inh_Kunz-m,HMMSmart_KU,HMMPfam_Kunitz_BPTI,PatternScan_BPTI_KUNITZ_1	p.R39P	ENST00000265132.3	37	c.116	CCDS6800.1	9	.	.	.	.	.	.	.	.	.	.	C	17.66	3.443919	0.63067	.	.	ENSG00000106927	ENST00000265132	D	0.85339	-1.97	4.39	4.39	0.52855	Lipocalin conserved site (1);Calycin-like (1);Calycin (1);	0.265000	0.37095	N	0.002248	D	0.89911	0.6852	M	0.79475	2.455	0.80722	D	1	D	0.65815	0.995	P	0.58013	0.831	D	0.90925	0.4786	10	0.72032	D	0.01	.	12.6536	0.56776	0.0:1.0:0.0:0.0	.	39	P02760	AMBP_HUMAN	P	39	ENSP00000265132:R39P	ENSP00000265132:R39P	R	-	2	0	AMBP	115880195	0.986000	0.35501	0.967000	0.41034	0.465000	0.32709	2.633000	0.46519	2.428000	0.82296	0.563000	0.77884	CGG	-	superfamily_Calycin,PatternScan_LIPOCALIN		0.642	AMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBP	protein_coding	OTTHUMT00000053758.2	C	NM_001633	Missense_Mutation	115880195	-1	no_errors	NM_001633	genbank	human	reviewed	54_36p	missense	SNP	0.862	G
INSIG2	51141	genome.wustl.edu	37	2	118864312	118864312	+	Splice_Site	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:118864312G>T	ENST00000245787.4	+	4	575		c.e4-1		INSIG2_ENST00000485520.1_Splice_Site	NM_016133.2	NP_057217.2	Q9Y5U4	INSI2_HUMAN	insulin induced gene 2						cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						ACTGATCTCAGAAAGTGGATT	0.368																																																0			2											140.0	129.0	133.0					2																	118864312		2203	4300	6503	118580782	SO:0001630	splice_region_variant	51141			AF527632	CCDS2122.1	2q14.1	2008-02-05			ENSG00000125629	ENSG00000125629			20452	protein-coding gene	gene with protein product		608660				12242332	Standard	NM_016133		Approved		uc002tlk.3	Q9Y5U4	OTTHUMG00000058518	ENST00000245787.4:c.370-1G>T	2.37:g.118864312G>T		Somatic		Capture	Illumina GAIIx	4	118580782	A8K5W8|Q8TBI8	Splice_Site	SNP	-	e3-1	ENST00000245787.4	37	c.370-1	CCDS2122.1	2	.	.	.	.	.	.	.	.	.	.	G	16.94	3.259981	0.59321	.	.	ENSG00000125629	ENST00000245787	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.981	0.92755	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	INSIG2	118580782	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.202000	0.95026	2.717000	0.92951	0.585000	0.79938	.	-	-		0.368	INSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSIG2	protein_coding	OTTHUMT00000129624.1	G	NM_016133	Intron	118580782	+1	no_errors	NM_016133	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
SRFBP1	153443	genome.wustl.edu	37	5	121354998	121354998	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr5:121354998T>C	ENST00000339397.4	+	5	386	c.314T>C	c.(313-315)gTa>gCa	p.V105A		NM_152546.2	NP_689759.2			serum response factor binding protein 1											central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		AGACTAGCAGTACATCCTCTT	0.318																																																0			5											94.0	90.0	91.0					5																	121354998		1824	4077	5901	121382897	SO:0001583	missense	153443			AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.314T>C	5.37:g.121354998T>C	ENSP00000341324:p.Val105Ala	Somatic		Capture	Illumina GAIIx	4	121382897		Missense_Mutation	SNP	HMMPfam_BUD22	p.V105A	ENST00000339397.4	37	c.314	CCDS43354.1	5	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502086	0.26949	.	.	ENSG00000151304	ENST00000339397	.	.	.	6.07	-0.775	0.10988	.	0.552378	0.20254	N	0.096020	T	0.13286	0.0322	N	0.16478	0.41	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.18178	-1.0345	9	0.07325	T	0.83	-0.0433	1.1654	0.01814	0.1777:0.3621:0.1821:0.2782	.	105	Q8NEF9	SRFB1_HUMAN	A	105	.	ENSP00000341324:V105A	V	+	2	0	SRFBP1	121382897	0.001000	0.12720	0.006000	0.13384	0.825000	0.46686	0.349000	0.20055	-0.076000	0.12775	0.533000	0.62120	GTA	-	NULL		0.318	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRFBP1	protein_coding	OTTHUMT00000371200.1	T	NM_152546		121382897	+1	no_errors	NM_152546	genbank	human	validated	54_36p	missense	SNP	0.391	C
TBC1D32	221322	genome.wustl.edu	37	6	121613308	121613308	+	Silent	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr6:121613308T>C	ENST00000398212.2	-	12	1312	c.1263A>G	c.(1261-1263)ggA>ggG	p.G421G	TBC1D32_ENST00000275159.6_Silent_p.G421G	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	421					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										GTAATTCTTGTCCTAAGTAGT	0.299																																																0			6											84.0	89.0	87.0					6																	121613308		1796	4055	5851	121655007	SO:0001819	synonymous_variant	221322			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.1263A>G	6.37:g.121613308T>C		Somatic		Capture	Illumina GAIIx	4	121655007	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	superfamily_Ypt/Rab-GAP domain of gyp1p	p.G421	ENST00000398212.2	37	c.1263	CCDS43501.1	6																																																																																			-	NULL		0.299	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C6orf170	protein_coding	OTTHUMT00000380937.2	T	NM_152730		121655007	-1	no_errors	NM_152730	genbank	human	validated	54_36p	silent	SNP	1.000	C
GOLGB1	2804	genome.wustl.edu	37	3	121412666	121412666	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr3:121412666T>G	ENST00000340645.5	-	13	6814	c.6689A>C	c.(6688-6690)gAa>gCa	p.E2230A	GOLGB1_ENST00000393667.3_Missense_Mutation_p.E2235A	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2230					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		GCAATTATCTTCTTTGAGTCT	0.363																																																0			3											232.0	208.0	216.0					3																	121412666		2203	4300	6503	122895356	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.6689A>C	3.37:g.121412666T>G	ENSP00000341848:p.Glu2230Ala	Somatic		Capture	Illumina GAIIx	4	122895356	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Spectrin repeat,superfamily_Prefoldin,HMMSmart_SM00340	p.E2230A	ENST00000340645.5	37	c.6689	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	T	10.57	1.388314	0.25118	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.26067	1.77;1.76	5.75	5.75	0.90469	.	0.106278	0.41294	D	0.000912	T	0.33933	0.0880	M	0.68952	2.095	0.49299	D	0.999776	P;P;P;P	0.48503	0.911;0.675;0.675;0.911	B;B;B;P	0.46275	0.438;0.205;0.205;0.51	T	0.07102	-1.0790	10	0.30078	T	0.28	.	14.0228	0.64568	0.0:0.0:0.0:1.0	.	2155;2235;2235;2230	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	A	2230;2235	ENSP00000341848:E2230A;ENSP00000377275:E2235A	ENSP00000341848:E2230A	E	-	2	0	GOLGB1	122895356	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.450000	0.44943	2.194000	0.70268	0.533000	0.62120	GAA	-	NULL		0.363	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	protein_coding	OTTHUMT00000355159.1	T	NM_004487		122895356	-1	no_errors	NM_004487	genbank	human	validated	54_36p	missense	SNP	1.000	G
TENM1	10178	genome.wustl.edu	37	X	123517675	123517675	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chrX:123517675C>G	ENST00000371130.3	-	29	7148	c.7085G>C	c.(7084-7086)gGa>gCa	p.G2362A	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.G2369A	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2362					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATCATAGAGTCCTCCATGAAA	0.423																																																0			X											114.0	108.0	110.0					X																	123517675		2203	4300	6503	123345356	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7085G>C	X.37:g.123517675C>G	ENSP00000360171:p.Gly2362Ala	Somatic		Capture	Illumina GAIIx	4	123345356	B2RTR5|Q5JZ17	Missense_Mutation	SNP	HMMPfam_Ten_N,HMMSmart_EGF,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF,superfamily_SSF57196,superfamily_SSF101898,HMMPfam_NHL,superfamily_N2O_reductase_N,HMMPfam_RHS_repeat	p.G2362A	ENST00000371130.3	37	c.7085	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	20.8	4.053880	0.75960	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.88509	-2.39;-2.36	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.96093	0.8727	M	0.92412	3.305	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.91635	0.996;0.997;0.999	D	0.96715	0.9528	10	0.87932	D	0	.	19.1445	0.93459	0.0:1.0:0.0:0.0	.	2368;2369;2362	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	A	2362;2369	ENSP00000360171:G2362A;ENSP00000403954:G2369A	ENSP00000360171:G2362A	G	-	2	0	ODZ1	123345356	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.471000	0.83476	0.600000	0.82982	GGA	-	NULL		0.423	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	protein_coding	OTTHUMT00000058985.1	C	NM_014253		123345356	-1	no_errors	NM_014253	genbank	human	provisional	54_36p	missense	SNP	1.000	G
DERL1	79139	genome.wustl.edu	37	8	124054360	124054360	+	Start_Codon_SNP	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr8:124054360C>T	ENST00000259512.4	-	1	303	c.3G>A	c.(1-3)atG>atA	p.M1I	DERL1_ENST00000405944.3_Start_Codon_SNP_p.M1I|RNY4P5_ENST00000362808.1_RNA|DERL1_ENST00000419562.2_Start_Codon_SNP_p.M1I	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	1					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			CGATGTCCGACATCTTCGACC	0.647																																																0			8											86.0	59.0	68.0					8																	124054360		2203	4300	6503	124123541	SO:0001582	initiator_codon_variant	79139			BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.3G>A	8.37:g.124054360C>T	ENSP00000259512:p.Met1Ile	Somatic		Capture	Illumina GAIIx	4	124123541	B3KW41|E9PH19	Missense_Mutation	SNP	HMMPfam_DER1	p.M1I	ENST00000259512.4	37	c.3	CCDS6337.1	8	.	.	.	.	.	.	.	.	.	.	C	19.21	3.782927	0.70222	.	.	ENSG00000136986	ENST00000259512;ENST00000405944;ENST00000419562	T;T;T	0.36157	1.27;1.43;1.33	5.79	5.79	0.91817	.	0.037047	0.85682	D	0.000000	T	0.39989	0.1099	.	.	.	0.80722	D	1	P;P;P	0.48764	0.915;0.681;0.627	B;B;B	0.40825	0.341;0.319;0.142	T	0.39482	-0.9612	9	0.72032	D;D	0.01;0.01	.	20.039	0.97573	0.0:1.0:0.0:0.0	.	1;1;1	B4E1G1;Q9BUN8-2;Q9BUN8	.;.;DERL1_HUMAN	I	1	ENSP00000259512:M1I;ENSP00000384289:M1I;ENSP00000389965:M1I	ENSP00000259512:M1I;ENSP00000259512:M1I	M	-	3	0	DERL1	124123541	1.000000	0.71417	1.000000	0.80357	0.207000	0.24258	6.956000	0.76013	2.743000	0.94032	0.453000	0.30009	ATG	-	NULL		0.647	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERL1	protein_coding	OTTHUMT00000381714.2	C	NM_024295	Missense_Mutation	124123541	-1	no_errors	NM_024295	genbank	human	validated	54_36p	missense	SNP	1.000	T
HEPN1	641654	genome.wustl.edu	37	11	124789844	124789844	+	Silent	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:124789844C>T	ENST00000408930.5	+	1	699	c.198C>T	c.(196-198)ttC>ttT	p.F66F	HEPACAM_ENST00000298251.4_3'UTR	NM_001037558.2	NP_001032647.2	Q6WQI6	HEPN1_HUMAN	hepatocellular carcinoma, down-regulated 1	66						cytoplasm (GO:0005737)				large_intestine(1)|lung(1)|stomach(1)	3	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0287)		ATGAACTGTTCAATAGGCGGT	0.502																																																0			11											87.0	87.0	87.0					11																	124789844		1910	4134	6044	124295054	SO:0001819	synonymous_variant	641654			BC148521	CCDS41729.1	11q24	2013-07-02	2011-02-11		ENSG00000221932	ENSG00000221932			34400	protein-coding gene	gene with protein product	"""cancer susceptibility gene HEPN1"""	611641	"""HEPACAM opposite strand 1"""			12971969, 23548416	Standard	NM_001037558		Approved		uc001qbj.1	Q6WQI6	OTTHUMG00000165939	ENST00000408930.5:c.198C>T	11.37:g.124789844C>T		Somatic		Capture	Illumina GAIIx	4	124295054		Silent	SNP	NULL	p.F66	ENST00000408930.5	37	c.198	CCDS41729.1	11																																																																																			-	NULL		0.502	HEPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPN1	protein_coding	OTTHUMT00000387129.1	C	NM_001037558		124295054	+1	no_errors	NM_001037558	genbank	human	provisional	54_36p	silent	SNP	0.000	T
ALDH1L1	10840	genome.wustl.edu	37	3	125873436	125873436	+	Missense_Mutation	SNP	G	G	T	rs374387532		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr3:125873436G>T	ENST00000393434.2	-	6	1030	c.681C>A	c.(679-681)aaC>aaA	p.N227K	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.N227K|ALDH1L1_ENST00000413612.1_5'UTR|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.N227K|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.N237K|ALDH1L1_ENST00000455064.2_Missense_Mutation_p.N52K|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.N126K	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	227					10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GCACCTTGTCGTTCCCGCGGA	0.597																																																0			3											130.0	109.0	116.0					3																	125873436		2203	4300	6503	127356126	SO:0001583	missense	10840			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.681C>A	3.37:g.125873436G>T	ENSP00000377083:p.Asn227Lys	Somatic		Capture	Illumina GAIIx	4	127356126	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	PatternScan_PHOSPHOPANTETHEINE,HMMPfam_Formyl_trans_N,superfamily_formyl_transf,PatternScan_GART,superfamily_FMT_C_like,HMMPfam_Formyl_trans_C,superfamily_ACP_like,superfamily_Aldehyde_DH/Histidinol_DH,HMMPfam_Aldedh,PatternScan_ALDEHYDE_DEHYDR_GLU,PatternScan_ALDEHYDE_DEHYDR_CYS	p.N227K	ENST00000393434.2	37	c.681	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	g	13.68	2.310499	0.40895	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431;ENST00000455064	T;T;T;T;T;T	0.76186	1.0;1.0;-1.0;1.0;1.0;1.0	4.54	-9.09	0.00717	Formyl transferase, C-terminal-like (1);Formyl transferase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.80314	0.4600	M	0.65498	2.005	0.44515	D	0.997464	D;D;P;D;P	0.89917	1.0;0.998;0.942;0.999;0.942	D;D;P;D;P	0.77557	0.99;0.983;0.73;0.973;0.852	D	0.87899	0.2689	10	0.62326	D	0.03	.	16.7966	0.85603	0.8772:0.0:0.1228:0.0	.	52;126;279;132;227	B4DGC8;E9PBX3;Q59G10;Q9UFA9;O75891	.;.;.;.;AL1L1_HUMAN	K	237;227;126;227;227;52	ENSP00000273450:N237K;ENSP00000420293:N227K;ENSP00000395881:N126K;ENSP00000377083:N227K;ENSP00000377081:N227K;ENSP00000414126:N52K	ENSP00000273450:N237K	N	-	3	2	ALDH1L1	127356126	0.189000	0.23263	0.537000	0.28052	0.228000	0.25075	-0.379000	0.07437	-2.356000	0.00613	-2.384000	0.00231	AAC	-	superfamily_FMT_C_like,HMMPfam_Formyl_trans_C		0.597	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	protein_coding	OTTHUMT00000354391.1	G	NM_012190		127356126	-1	no_errors	NM_012190	genbank	human	reviewed	54_36p	missense	SNP	0.996	T
ETS1	2113	genome.wustl.edu	37	11	128359375	128359375	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:128359375C>A	ENST00000319397.6	-	3	522	c.213G>T	c.(211-213)caG>caT	p.Q71H	ETS1_ENST00000392668.4_Missense_Mutation_p.Q115H|ETS1_ENST00000535549.1_Intron|ETS1_ENST00000531611.1_Missense_Mutation_p.Q71H|ETS1_ENST00000345075.4_Missense_Mutation_p.Q71H|ETS1_ENST00000526145.2_Missense_Mutation_p.Q71H	NM_005238.3	NP_005229.1	P14921	ETS1_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog 1	71	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				angiogenesis involved in wound healing (GO:0060055)|cell motility (GO:0048870)|cellular response to hydrogen peroxide (GO:0070301)|estrous cycle phase (GO:0060206)|female pregnancy (GO:0007565)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|pituitary gland development (GO:0021983)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of apoptotic process (GO:0042981)|regulation of extracellular matrix disassembly (GO:0010715)|response to antibiotic (GO:0046677)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to laminar fluid shear stress (GO:0034616)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|pleura(1)|prostate(1)|upper_aerodigestive_tract(3)	35	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		TTTCTGTCCACTGCCGGGGGT	0.507																																																0			11											60.0	63.0	62.0					11																	128359375		2201	4297	6498	127864585	SO:0001583	missense	2113				CCDS8475.1, CCDS44767.1, CCDS53724.1	11q23.3	2013-07-09	2013-07-09		ENSG00000134954	ENSG00000134954			3488	protein-coding gene	gene with protein product	"""Avian erythroblastosis virus E26 (v-ets) oncogene homolog-1"", ""ets protein"""	164720		EWSR2		1522903	Standard	NM_005238		Approved	FLJ10768, ETS-1	uc001qej.2	P14921	OTTHUMG00000165799	ENST00000319397.6:c.213G>T	11.37:g.128359375C>A	ENSP00000324578:p.Gln71His	Somatic		Capture	Illumina GAIIx	4	127864585	A9UL17|F5GYX9|Q14278|Q16080|Q6N087|Q96AC5	Missense_Mutation	SNP	"superfamily_SAM/Pointed domain,HMMPfam_SAM_PNT,HMMSmart_SM00251,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Ets,HMMSmart_SM00413,PatternScan_ETS_DOMAIN_1,PatternScan_ETS_DOMAIN_2"	p.Q71H	ENST00000319397.6	37	c.213	CCDS8475.1	11	.	.	.	.	.	.	.	.	.	.	C	14.87	2.664183	0.47572	.	.	ENSG00000134954	ENST00000345075;ENST00000392668;ENST00000531611;ENST00000319397;ENST00000526145	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	5.57	4.46	0.54185	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.118924	0.56097	D	0.000021	T	0.30386	0.0763	L	0.46741	1.465	0.80722	D	1	P;B;P	0.44734	0.617;0.388;0.842	B;B;B	0.44108	0.348;0.329;0.441	T	0.02075	-1.1218	10	0.40728	T	0.16	.	11.7871	0.52049	0.0:0.8494:0.0:0.1506	.	71;71;115	P14921;Q96AC5;Q6N087	ETS1_HUMAN;.;.	H	71;115;71;71;71	ENSP00000340485:Q71H;ENSP00000376436:Q115H;ENSP00000435666:Q71H;ENSP00000324578:Q71H;ENSP00000433500:Q71H	ENSP00000324578:Q71H	Q	-	3	2	ETS1	127864585	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.698000	0.37794	2.618000	0.88619	0.655000	0.94253	CAG	-	superfamily_SAM/Pointed domain,HMMPfam_SAM_PNT,HMMSmart_SM00251		0.507	ETS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ETS1	protein_coding	OTTHUMT00000386269.2	C	NM_005238		127864585	-1	no_errors	NM_005238	genbank	human	validated	54_36p	missense	SNP	1.000	A
PLXNA4	91584	genome.wustl.edu	37	7	131912327	131912327	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:131912327C>G	ENST00000359827.3	-	7	2727	c.1765G>C	c.(1765-1767)Gct>Cct	p.A589P	PLXNA4_ENST00000321063.4_Missense_Mutation_p.A589P			Q9HCM2	PLXA4_HUMAN	plexin A4	589					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TTGACGCCAGCTGACAGCTCC	0.592																																																0			7											66.0	68.0	67.0					7																	131912327		2064	4203	6267	131562867	SO:0001583	missense	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1765G>C	7.37:g.131912327C>G	ENSP00000352882:p.Ala589Pro	Somatic		Capture	Illumina GAIIx	4	131562867	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP	p.A589P	ENST00000359827.3	37	c.1765	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.529102	0.96446	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.00976	5.48;5.48	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.03053	0.0090	L	0.59912	1.85	0.80722	D	1	P	0.50156	0.932	P	0.51701	0.677	T	0.65590	-0.6131	10	0.30078	T	0.28	.	19.9025	0.96993	0.0:1.0:0.0:0.0	.	589	Q9HCM2	PLXA4_HUMAN	P	589	ENSP00000323194:A589P;ENSP00000352882:A589P	ENSP00000323194:A589P	A	-	1	0	PLXNA4	131562867	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.731000	0.84895	2.722000	0.93159	0.655000	0.94253	GCT	-	NULL		0.592	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	protein_coding	OTTHUMT00000338422.2	C	NM_181775		131562867	-1	no_errors	NM_020911	genbank	human	validated	54_36p	missense	SNP	1.000	G
TG	7038	genome.wustl.edu	37	8	133885425	133885425	+	Silent	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr8:133885425C>T	ENST00000220616.4	+	5	637	c.597C>T	c.(595-597)acC>acT	p.T199T	TG_ENST00000377869.1_Silent_p.T199T	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	199	Thyroglobulin type-1 3. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TTGTCAACACCACAGACATGA	0.532																																																0			8											160.0	122.0	135.0					8																	133885425		2203	4300	6503	133954607	SO:0001819	synonymous_variant	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.597C>T	8.37:g.133885425C>T		Somatic		Capture	Illumina GAIIx	4	133954607	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Silent	SNP	superfamily_Thyroglobulin type-1 domain,HMMPfam_Thyroglobulin_1,PatternScan_THYROGLOBULIN_1_1,HMMSmart_SM00211,superfamily_TNF receptor-like,HMMPfam_GCC2_GCC3,HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases,PatternScan_CARBOXYLESTERASE_B_2	p.T199	ENST00000220616.4	37	c.597	CCDS34944.1	8																																																																																			-	superfamily_Thyroglobulin type-1 domain		0.532	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	protein_coding	OTTHUMT00000379606.1	C	NM_003235		133954607	+1	no_errors	NM_003235	genbank	human	validated	54_36p	silent	SNP	1.000	T
SETX	23064	genome.wustl.edu	37	9	135203568	135203568	+	Silent	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr9:135203568T>C	ENST00000224140.5	-	10	3599	c.3417A>G	c.(3415-3417)gaA>gaG	p.E1139E	SETX_ENST00000393220.1_Silent_p.E1139E|SETX_ENST00000372169.2_Silent_p.E1139E	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1139					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTGTGTGTTCTTCAATGCCCT	0.368																																																0			9											108.0	112.0	111.0					9																	135203568		2202	4299	6501	134193389	SO:0001819	synonymous_variant	23064			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.3417A>G	9.37:g.135203568T>C		Somatic		Capture	Illumina GAIIx	4	134193389	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.E1139	ENST00000224140.5	37	c.3417	CCDS6947.1	9																																																																																			-	NULL		0.368	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	protein_coding	OTTHUMT00000054774.3	T	NM_015046		134193389	-1	no_errors	NM_015046	genbank	human	reviewed	54_36p	silent	SNP	0.031	C
FAM135B	51059	genome.wustl.edu	37	8	139144851	139144851	+	Silent	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr8:139144851G>T	ENST00000395297.1	-	20	4376	c.4206C>A	c.(4204-4206)ctC>ctA	p.L1402L		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1402								p.L1402L(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TGAAGTAGTTGAGTCCTGCCA	0.517										HNSCC(54;0.14)																																						2	Substitution - coding silent(2)	ovary(2)	8											147.0	154.0	152.0					8																	139144851		1951	4155	6106	139214033	SO:0001819	synonymous_variant	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.4206C>A	8.37:g.139144851G>T		Somatic		Capture	Illumina GAIIx	4	139214033	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	superfamily_alpha/beta-Hydrolases,HMMPfam_DUF676	p.L1402	ENST00000395297.1	37	c.4206	CCDS6375.2	8																																																																																			-	NULL		0.517	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	protein_coding	OTTHUMT00000313590.3	G	NM_015912		139214033	-1	no_errors	NM_015912	genbank	human	validated	54_36p	silent	SNP	1.000	T
TSNARE1	203062	genome.wustl.edu	37	8	143381980	143381980	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr8:143381980A>G	ENST00000307180.3	-	10	1274	c.1157T>C	c.(1156-1158)cTg>cCg	p.L386P	TSNARE1_ENST00000520166.1_Missense_Mutation_p.L386P|TSNARE1_ENST00000518928.1_5'UTR|TSNARE1_ENST00000519651.1_Missense_Mutation_p.L167P|TSNARE1_ENST00000524325.1_Missense_Mutation_p.L385P	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	386					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					ATCATCAGCCAGCTCGGCAAA	0.572																																																0			8											79.0	76.0	77.0					8																	143381980		2203	4300	6503	143379887	SO:0001583	missense	203062					8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.1157T>C	8.37:g.143381980A>G	ENSP00000303437:p.Leu386Pro	Somatic		Capture	Illumina GAIIx	4	143379887	B7ZLB0|Q14D03	Missense_Mutation	SNP	superfamily_t-snare,HMMSmart_t_SNARE,HMMPfam_SNARE	p.L386P	ENST00000307180.3	37	c.1157	CCDS6384.1	8	.	.	.	.	.	.	.	.	.	.	A	13.41	2.229949	0.39399	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000519651	T;T;T;T	0.32988	2.61;2.64;2.65;1.43	4.76	4.76	0.60689	t-SNARE (1);	0.000000	0.27240	U	0.020278	T	0.29914	0.0748	M	0.65975	2.015	0.53005	D	0.999964	P;B;P;P	0.37330	0.59;0.013;0.59;0.59	B;B;B;B	0.33196	0.159;0.015;0.159;0.159	T	0.08493	-1.0719	10	0.33141	T	0.24	-23.0293	11.6678	0.51383	1.0:0.0:0.0:0.0	.	385;167;386;387	B7ZLB0;E5RHT3;Q96NA8;A0AVG3	.;.;TSNA1_HUMAN;.	P	385;386;386;167	ENSP00000428763:L385P;ENSP00000303437:L386P;ENSP00000427770:L386P;ENSP00000429679:L167P	ENSP00000303437:L386P	L	-	2	0	TSNARE1	143379887	0.998000	0.40836	0.846000	0.33378	0.704000	0.40688	2.855000	0.48333	1.778000	0.52293	0.533000	0.62120	CTG	-	superfamily_t-snare		0.572	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSNARE1	protein_coding		A	NM_145003		143379887	-1	no_errors	NM_145003	genbank	human	validated	54_36p	missense	SNP	0.995	G
TRPC1	7220	genome.wustl.edu	37	3	142511756	142511756	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr3:142511756T>A	ENST00000476941.1	+	9	2014	c.1528T>A	c.(1528-1530)Tat>Aat	p.Y510N	TRPC1_ENST00000273482.6_Missense_Mutation_p.Y476N	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	510					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						TGTTCTAAGTTATCTTCGTCT	0.343																																																0			3											148.0	133.0	138.0					3																	142511756		2203	4300	6503	143994446	SO:0001583	missense	7220			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1528T>A	3.37:g.142511756T>A	ENSP00000419313:p.Tyr510Asn	Somatic		Capture	Illumina GAIIx	4	143994446	Q14CE4	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_TRP_2,HMMPfam_Ion_trans	p.Y476N	ENST00000476941.1	37	c.1426	CCDS58856.1	3	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601362	0.87055	.	.	ENSG00000144935	ENST00000476941;ENST00000273482	D;D	0.98455	-4.94;-4.94	5.28	5.28	0.74379	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98166	0.9394	L	0.43152	1.355	0.80722	D	1	D;D	0.71674	0.998;0.98	D;P	0.68621	0.959;0.815	D	0.99809	1.1040	10	0.87932	D	0	-33.6702	15.5066	0.75745	0.0:0.0:0.0:1.0	.	510;476	P48995;P48995-2	TRPC1_HUMAN;.	N	510;476	ENSP00000419313:Y510N;ENSP00000273482:Y476N	ENSP00000273482:Y476N	Y	+	1	0	TRPC1	143994446	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.997000	0.88414	2.119000	0.64992	0.455000	0.32223	TAT	-	HMMPfam_Ion_trans		0.343	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC1	protein_coding	OTTHUMT00000354520.1	T	NM_003304		143994446	+1	no_errors	NM_003304	genbank	human	validated	54_36p	missense	SNP	1.000	A
ANKRD35	148741	genome.wustl.edu	37	1	145560175	145560175	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:145560175G>A	ENST00000355594.4	+	8	748	c.661G>A	c.(661-663)Gat>Aat	p.D221N	ANKRD35_ENST00000544626.1_3'UTR	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	221										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CACAGGGCATGATGCTCTGCA	0.632																																					Melanoma(9;127 754 22988 51047)											0			1											75.0	70.0	72.0					1																	145560175		2203	4300	6503	144271532	SO:0001583	missense	148741			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.661G>A	1.37:g.145560175G>A	ENSP00000347802:p.Asp221Asn	Somatic		Capture	Illumina GAIIx	4	144271532	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.D221N	ENST00000355594.4	37	c.661	CCDS919.1	1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.981821	0.34942	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.52295	0.67	5.55	3.25	0.37280	Ankyrin repeat-containing domain (3);	0.246388	0.28393	N	0.015503	T	0.07593	0.0191	N	0.03177	-0.4	0.23396	N	0.997762	B	0.18013	0.025	B	0.20184	0.028	T	0.31503	-0.9941	10	0.19590	T	0.45	-10.4273	6.4684	0.21995	0.2651:0.0:0.7349:0.0	.	221	Q8N283	ANR35_HUMAN	N	130;221	ENSP00000347802:D221N	ENSP00000347802:D221N	D	+	1	0	ANKRD35	144271532	0.964000	0.33143	0.023000	0.16930	0.007000	0.05969	2.612000	0.46343	1.132000	0.42129	0.655000	0.94253	GAT	-	superfamily_ANK		0.632	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	protein_coding	OTTHUMT00000038515.1	G	NM_144698		144271532	+1	no_errors	NM_144698	genbank	human	validated	54_36p	missense	SNP	0.437	A
ZEB2	9839	genome.wustl.edu	37	2	145162423	145162423	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:145162423G>C	ENST00000558170.2	-	5	1756	c.572C>G	c.(571-573)gCc>gGc	p.A191G	ZEB2_ENST00000409487.3_Missense_Mutation_p.A191G|ZEB2_ENST00000539609.3_Missense_Mutation_p.A167G|ZEB2_ENST00000303660.4_Missense_Mutation_p.A191G	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	191					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TTGCCCATTGGCCTCTGGCGT	0.512																																					Melanoma(33;1235 1264 5755 16332)											0			2											57.0	50.0	52.0					2																	145162423		2203	4300	6503	144878893	SO:0001583	missense	9839			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.572C>G	2.37:g.145162423G>C	ENSP00000454157:p.Ala191Gly	Somatic		Capture	Illumina GAIIx	4	144878893	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	PatternScan_HOMEOBOX_1,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_HOX	p.A191G	ENST00000558170.2	37	c.572	CCDS2186.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.11|15.11	2.737013|2.737013	0.49045|0.49045	.|.	.|.	ENSG00000169554|ENSG00000169554	ENST00000392860;ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902;ENST00000392861|ENST00000431672	D;D;D;D;D|.	0.81499|.	-1.5;-1.5;-1.5;-1.5;-1.5|.	5.62|5.62	4.73|4.73	0.59995|0.59995	.|.	0.048979|.	0.85682|.	D|.	0.000000|.	T|T	0.51534|0.51534	0.1680|0.1680	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	P;P;B;B|.	0.47545|.	0.897;0.487;0.149;0.149|.	P;B;B;B|.	0.48089|.	0.566;0.229;0.086;0.086|.	T|T	0.42032|0.42032	-0.9475|-0.9475	10|5	0.72032|.	D|.	0.01|.	-8.6837|-8.6837	14.2952|14.2952	0.66308|0.66308	0.0715:0.0:0.9285:0.0|0.0715:0.0:0.9285:0.0	.|.	167;56;190;191|.	F5H814;Q53TD9;A0JP08;O60315|.	.;.;.;ZEB2_HUMAN|.	G|A	186;167;191;191;191;191|157	ENSP00000443792:A167G;ENSP00000302501:A191G;ENSP00000386854:A191G;ENSP00000395496:A191G;ENSP00000376601:A191G|.	ENSP00000302501:A191G|.	A|P	-|-	2|1	0|0	ZEB2|ZEB2	144878893|144878893	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	1.000000|1.000000	0.99986|0.99986	6.741000|6.741000	0.74837|0.74837	2.795000|2.795000	0.96236|0.96236	0.655000|0.655000	0.94253|0.94253	GCC|CCA	-	NULL		0.512	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	protein_coding	OTTHUMT00000254778.5	G	NM_014795		144878893	-1	no_errors	NM_014795	genbank	human	validated	54_36p	missense	SNP	1.000	C
GJA8	2703	genome.wustl.edu	37	1	147380442	147380442	+	Silent	SNP	T	T	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:147380442T>G	ENST00000369235.1	+	1	360	c.360T>G	c.(358-360)acT>acG	p.T120T	GJA8_ENST00000240986.4_Silent_p.T120T			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	120					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					AGGCGGGGACTAACGGCGGCC	0.667																																					Melanoma(76;1255 1795 8195 52096)											0			1											45.0	51.0	49.0					1																	147380442		2203	4300	6503	145847066	SO:0001819	synonymous_variant	2703			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.360T>G	1.37:g.147380442T>G		Somatic		Capture	Illumina GAIIx	4	145847066	A7L5M5|Q5VVN9|Q9NP25	Silent	SNP	HMMPfam_Connexin,HMMSmart_CNX,PatternScan_CONNEXINS_1,HMMPfam_Connexin_CCC,PatternScan_CONNEXINS_2,HMMPfam_Connexin50	p.T120	ENST00000369235.1	37	c.360	CCDS30834.1	1																																																																																			-	HMMPfam_Connexin		0.667	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA8	protein_coding	OTTHUMT00000060647.1	T	NM_005267		145847066	+1	no_errors	NM_005267	genbank	human	validated	54_36p	silent	SNP	0.375	G
CNTNAP2	26047	genome.wustl.edu	37	7	146536934	146536934	+	Silent	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:146536934C>A	ENST00000361727.3	+	3	856	c.340C>A	c.(340-342)Cgg>Agg	p.R114R		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	114	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.		R -> Q (in dbSNP:rs189731792). {ECO:0000269|PubMed:18179895}.		adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.R114W(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			GACCCAATACCGGATGCTCTA	0.473										HNSCC(39;0.1)																																						1	Substitution - Missense(1)	large_intestine(1)	7											97.0	88.0	91.0					7																	146536934		2203	4300	6503	146167867	SO:0001819	synonymous_variant	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.340C>A	7.37:g.146536934C>A		Somatic		Capture	Illumina GAIIx	4	146167867	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00181,HMMPfam_EGF,superfamily_Fibrinogen C-terminal domain-like,PatternScan_GLYCO_HORMONE_BETA_1,HMMSmart_SM00294	p.R114	ENST00000361727.3	37	c.340	CCDS5889.1	7																																																																																			-	HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C		0.473	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	protein_coding	OTTHUMT00000327668.1	C			146167867	+1	no_errors	NM_014141	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
TM4SF1	4071	genome.wustl.edu	37	3	149095273	149095273	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr3:149095273C>G	ENST00000305366.3	-	1	379	c.62G>C	c.(61-63)tGc>tCc	p.C21S	TM4SF1_ENST00000472441.1_5'Flank|TM4SF1-AS1_ENST00000484046.1_RNA|TM4SF1-AS1_ENST00000496491.1_RNA	NM_014220.2	NP_055035.1	P30408	T4S1_HUMAN	transmembrane 4 L six family member 1	21						integral component of plasma membrane (GO:0005887)				endometrium(3)|large_intestine(1)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			AGCCGCGATGCACAGGAGGGC	0.512																																																0			3											113.0	111.0	112.0					3																	149095273		2203	4300	6503	150577963	SO:0001583	missense	4071			M90657	CCDS3143.1	3q21-q25	2005-03-21	2005-03-21		ENSG00000169908	ENSG00000169908			11853	protein-coding gene	gene with protein product		191155	"""transmembrane 4 superfamily member 1"""	M3S1		1565644	Standard	NM_014220		Approved	L6	uc003exb.1	P30408	OTTHUMG00000159597	ENST00000305366.3:c.62G>C	3.37:g.149095273C>G	ENSP00000304277:p.Cys21Ser	Somatic		Capture	Illumina GAIIx	4	150577963	Q6IB51	Missense_Mutation	SNP	HMMPfam_L6_membrane	p.C21S	ENST00000305366.3	37	c.62	CCDS3143.1	3	.	.	.	.	.	.	.	.	.	.	C	2.283	-0.364209	0.05103	.	.	ENSG00000169908	ENST00000305366;ENST00000383054	T	0.29397	1.57	5.5	4.62	0.57501	.	0.215518	0.41605	N	0.000843	T	0.23094	0.0558	N	0.25992	0.78	0.80722	D	1	B	0.16166	0.016	B	0.27076	0.076	T	0.04216	-1.0968	10	0.07482	T	0.82	-20.2895	16.3478	0.83151	0.0:0.8678:0.1322:0.0	.	21	P30408	T4S1_HUMAN	S	21	ENSP00000304277:C21S	ENSP00000304277:C21S	C	-	2	0	TM4SF1	150577963	1.000000	0.71417	0.994000	0.49952	0.025000	0.11179	4.529000	0.60588	1.312000	0.45043	0.655000	0.94253	TGC	-	HMMPfam_L6_membrane		0.512	TM4SF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF1	protein_coding	OTTHUMT00000356368.1	C			150577963	-1	no_errors	NM_014220	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FLG2	388698	genome.wustl.edu	37	1	152328055	152328055	+	Missense_Mutation	SNP	C	C	T	rs572992221		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:152328055C>T	ENST00000388718.5	-	3	2279	c.2207G>A	c.(2206-2208)gGa>gAa	p.G736E	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	736	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGCCTGATCCATGTTGGCC	0.502													C|||	1	0.000199681	0.0008	0.0	5008	,	,		28408	0.0		0.0	False		,,,				2504	0.0															0			1											318.0	313.0	315.0					1																	152328055		2203	4300	6503	150594679	SO:0001583	missense	388698			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2207G>A	1.37:g.152328055C>T	ENSP00000373370:p.Gly736Glu	Somatic		Capture	Illumina GAIIx	4	150594679	Q9H4U1	Missense_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,HMMPfam_efhand,PatternScan_S100_CABP,PatternScan_EF_HAND_1,HMMPfam_SVS_QK,HMMPfam_Filaggrin	p.G736E	ENST00000388718.5	37	c.2207	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	6.876	0.531003	0.13127	.	.	ENSG00000143520	ENST00000388718	T	0.21031	2.03	4.98	4.07	0.47477	.	.	.	.	.	T	0.10680	0.0261	M	0.66939	2.045	0.09310	N	1	P	0.41673	0.759	B	0.43052	0.406	T	0.19289	-1.0310	9	0.25751	T	0.34	-1.5319	6.1764	0.20447	0.185:0.7188:0.0:0.0962	.	736	Q5D862	FILA2_HUMAN	E	736	ENSP00000373370:G736E	ENSP00000373370:G736E	G	-	2	0	FLG2	150594679	0.000000	0.05858	0.001000	0.08648	0.075000	0.17131	-0.018000	0.12568	1.075000	0.40932	0.511000	0.50034	GGA	-	HMMPfam_SVS_QK		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	protein_coding	OTTHUMT00000034018.5	C	NM_001014342		150594679	-1	no_errors	NM_001014342	genbank	human	provisional	54_36p	missense	SNP	0.191	T
LRBA	987	genome.wustl.edu	37	4	151186888	151186888	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr4:151186888G>C	ENST00000357115.3	-	58	8821	c.8578C>G	c.(8578-8580)Caa>Gaa	p.Q2860E	LRBA_ENST00000535741.1_Missense_Mutation_p.Q2849E|LRBA_ENST00000510413.1_Missense_Mutation_p.Q2848E|LRBA_ENST00000503716.1_5'UTR	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2860						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TAGCGGGTTTGGTATTCATGA	0.463																																																0			4											132.0	122.0	125.0					4																	151186888		2203	4300	6503	151406338	SO:0001583	missense	987			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.8578C>G	4.37:g.151186888G>C	ENSP00000349629:p.Gln2860Glu	Somatic		Capture	Illumina GAIIx	4	151406338	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	superfamily_ARM repeat,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_DUF1088,superfamily_PH domain-like,superfamily_BEACH domain,HMMPfam_Beach,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.Q2860E	ENST00000357115.3	37	c.8578	CCDS3773.1	4	.	.	.	.	.	.	.	.	.	.	G	29.0	4.971922	0.92919	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115	T;T;T	0.52983	0.65;0.8;0.64	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.69700	0.3140	M	0.67953	2.075	0.80722	D	1	D;D;P;D	0.64830	0.982;0.994;0.955;0.989	D;D;P;D	0.79108	0.952;0.992;0.725;0.983	T	0.70260	-0.4921	10	0.87932	D	0	.	20.2422	0.98381	0.0:0.0:1.0:0.0	.	2860;2849;2848;755	P50851;F5H1X8;P50851-2;Q68D03	LRBA_HUMAN;.;.;.	E	2849;2848;2860	ENSP00000446299:Q2849E;ENSP00000421552:Q2848E;ENSP00000349629:Q2860E	ENSP00000349629:Q2860E	Q	-	1	0	LRBA	151406338	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.782000	0.95742	0.655000	0.94253	CAA	-	superfamily_WD40 repeat-like		0.463	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	protein_coding	OTTHUMT00000364939.1	G			151406338	-1	no_errors	NM_006726	genbank	human	validated	54_36p	missense	SNP	1.000	C
RIF1	55183	genome.wustl.edu	37	2	152322281	152322281	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:152322281A>T	ENST00000243326.5	+	29	6730	c.6247A>T	c.(6247-6249)Aat>Tat	p.N2083Y	RIF1_ENST00000453091.2_Missense_Mutation_p.N2083Y|RIF1_ENST00000444746.2_Missense_Mutation_p.N2083Y|RIF1_ENST00000428287.2_Missense_Mutation_p.N2083Y|RIF1_ENST00000430328.2_Missense_Mutation_p.N2083Y			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		CATTGACGCTAATAAAACTGA	0.333																																																0			2											71.0	71.0	71.0					2																	152322281		2203	4300	6503	152030527	SO:0001583	missense	55183			AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.6247A>T	2.37:g.152322281A>T	ENSP00000243326:p.Asn2083Tyr	Somatic		Capture	Illumina GAIIx	4	152030527	A0AVS0|Q9NS16	Missense_Mutation	SNP	superfamily_ARM repeat,PatternScan_ABC_TRANSPORTER_1	p.N2083Y	ENST00000243326.5	37	c.6247	CCDS2194.1	2	.	.	.	.	.	.	.	.	.	.	A	11.26	1.585718	0.28268	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9	4.77	1.09	0.20402	.	1.454800	0.03650	N	0.240849	T	0.06962	0.0177	N	0.19112	0.55	0.09310	N	1	B;B	0.30439	0.183;0.279	B;B	0.26969	0.034;0.075	T	0.32929	-0.9888	10	0.54805	T	0.06	-0.015	1.0854	0.01651	0.5134:0.1587:0.1745:0.1533	.	2083;2083	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	Y	2083	ENSP00000390181:N2083Y;ENSP00000414615:N2083Y;ENSP00000415691:N2083Y;ENSP00000243326:N2083Y;ENSP00000416123:N2083Y	ENSP00000243326:N2083Y	N	+	1	0	RIF1	152030527	0.000000	0.05858	0.002000	0.10522	0.100000	0.18952	-0.494000	0.06451	0.354000	0.24105	0.528000	0.53228	AAT	-	superfamily_ARM repeat		0.333	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RIF1	protein_coding	OTTHUMT00000254836.3	A			152030527	+1	no_errors	NM_018151	genbank	human	validated	54_36p	missense	SNP	0.000	T
SYNE1	23345	genome.wustl.edu	37	6	152576848	152576848	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr6:152576848C>G	ENST00000367255.5	-	103	19739	c.19138G>C	c.(19138-19140)Gag>Cag	p.E6380Q	SYNE1_ENST00000448038.1_Missense_Mutation_p.E6309Q|SYNE1_ENST00000341594.5_Missense_Mutation_p.E5992Q|SYNE1_ENST00000265368.4_Missense_Mutation_p.E6380Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.E6309Q|SYNE1_ENST00000356820.4_Missense_Mutation_p.E904Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6380					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AACTTCTGCTCCAAGTGTATA	0.418										HNSCC(10;0.0054)																																						0			6											143.0	116.0	126.0					6																	152576848		2203	4300	6503	152618541	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.19138G>C	6.37:g.152576848C>G	ENSP00000356224:p.Glu6380Gln	Somatic		Capture	Illumina GAIIx	4	152618541	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMSmart_SM00150,HMMPfam_Spectrin,HMMPfam_KASH	p.E6380Q	ENST00000367255.5	37	c.19138	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	18.46	3.629776	0.67015	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.57595	0.48;0.47;0.39;0.47;0.59;2.57	5.04	5.04	0.67666	.	0.000000	0.56097	D	0.000026	T	0.43500	0.1250	L	0.43757	1.38	0.54753	D	0.999983	P;P;P	0.52692	0.874;0.874;0.955	B;B;P	0.49047	0.395;0.395;0.599	T	0.17961	-1.0352	10	0.23302	T	0.38	.	18.7568	0.91836	0.0:1.0:0.0:0.0	.	6380;6380;6309	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	Q	6380;6309;6380;6309;5992;904	ENSP00000356224:E6380Q;ENSP00000396024:E6309Q;ENSP00000265368:E6380Q;ENSP00000390975:E6309Q;ENSP00000341887:E5992Q;ENSP00000349276:E904Q	ENSP00000265368:E6380Q	E	-	1	0	SYNE1	152618541	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.900000	0.69853	2.510000	0.84645	0.563000	0.77884	GAG	-	superfamily_Spectrin repeat		0.418	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	C	NM_182961		152618541	-1	no_errors	NM_182961	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
F8	2157	genome.wustl.edu	37	X	154134847	154134847	+	Splice_Site	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chrX:154134847C>T	ENST00000360256.4	-	15	5421	c.5221G>A	c.(5221-5223)Gct>Act	p.A1741T		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1741	F5/8 type A 3.|Plastocyanin-like 5.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CCACTCTGAGCCCTGGAGAAA	0.428																																																0			X											71.0	67.0	68.0					X																	154134847		2203	4300	6503	153788041	SO:0001630	splice_region_variant	2157			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.5220-1G>A	X.37:g.154134847C>T		Somatic		Capture	Illumina GAIIx	4	153788041	Q14286|Q5HY69	Missense_Mutation	SNP	superfamily_Cupredoxins,HMMPfam_Cu-oxidase_3,HMMPfam_Cu-oxidase,PatternScan_MULTICOPPER_OXIDASE1,HMMPfam_Cu-oxidase_2,HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2	p.A1741T	ENST00000360256.4	37	c.5221	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	C	11.96	1.793887	0.31777	.	.	ENSG00000185010	ENST00000360256	D	0.99226	-5.59	5.5	3.66	0.41972	Cupredoxin (2);	0.835010	0.10986	N	0.612199	D	0.96543	0.8872	N	0.14661	0.345	0.22066	N	0.999385	B	0.20459	0.045	B	0.16722	0.016	D	0.92382	0.5914	10	0.33141	T	0.24	-1.8611	10.1804	0.42963	0.3614:0.6386:0.0:0.0	.	1741	P00451	FA8_HUMAN	T	1741	ENSP00000353393:A1741T	ENSP00000353393:A1741T	A	-	1	0	F8	153788041	0.350000	0.24878	0.244000	0.24202	0.942000	0.58702	1.170000	0.31883	0.460000	0.27045	0.600000	0.82982	GCT	-	superfamily_Cupredoxins		0.428	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	protein_coding	OTTHUMT00000058869.4	C		Missense_Mutation	153788041	-1	no_errors	NM_000132	genbank	human	reviewed	54_36p	missense	SNP	0.741	T
TLR2	7097	genome.wustl.edu	37	4	154625206	154625206	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr4:154625206G>A	ENST00000260010.6	+	1	2555	c.1147G>A	c.(1147-1149)Gag>Aag	p.E383K		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	383					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	TTCAGCCTGTGAGGATGCCTG	0.358																																																0			4											35.0	38.0	37.0					4																	154625206		2202	4300	6502	154844656	SO:0001583	missense	7097			U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.1147G>A	4.37:g.154625206G>A	ENSP00000260010:p.Glu383Lys	Somatic		Capture	Illumina GAIIx	4	154844656	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMSmart_LRRCT,HMMPfam_LRRCT,superfamily_TIR,HMMSmart_TIR,HMMPfam_TIR	p.E383K	ENST00000260010.6	37	c.1147	CCDS3784.1	4	.	.	.	.	.	.	.	.	.	.	G	2.962	-0.214345	0.06101	.	.	ENSG00000137462	ENST00000260010	T	0.00848	5.62	6.06	2.43	0.29744	.	0.666605	0.15640	N	0.251952	T	0.00936	0.0031	L	0.35644	1.08	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.48281	-0.9049	10	0.23302	T	0.38	.	6.701	0.23225	0.2543:0.2299:0.5158:0.0	.	383	O60603	TLR2_HUMAN	K	383	ENSP00000260010:E383K	ENSP00000260010:E383K	E	+	1	0	TLR2	154844656	0.006000	0.16342	0.489000	0.27452	0.945000	0.59286	0.088000	0.14979	0.142000	0.18901	0.655000	0.94253	GAG	-	superfamily_SSF52058		0.358	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	protein_coding	OTTHUMT00000365205.1	G			154844656	+1	no_errors	NM_003264	genbank	human	reviewed	54_36p	missense	SNP	0.265	A
COPA	1314	genome.wustl.edu	37	1	160293228	160293228	+	Silent	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:160293228G>T	ENST00000241704.7	-	8	928	c.699C>A	c.(697-699)cgC>cgA	p.R233R	Y_RNA_ENST00000365208.1_RNA|COPA_ENST00000368069.3_Silent_p.R233R	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	233					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CACCATTCATGCGCCAGATCT	0.488																																																0			1											97.0	81.0	86.0					1																	160293228		2203	4300	6503	158559852	SO:0001819	synonymous_variant	1314			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.699C>A	1.37:g.160293228G>T		Somatic		Capture	Illumina GAIIx	4	158559852	Q5T201|Q8IXZ9	Silent	SNP	HMMSmart_WD40,HMMPfam_WD40,superfamily_WD40_like,PatternScan_WD_REPEATS_1,HMMPfam_Coatomer_WDAD,HMMPfam_COPI_C,superfamily_Calret_calnex_P	p.R233	ENST00000241704.7	37	c.699	CCDS1202.1	1																																																																																			-	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40		0.488	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	protein_coding	OTTHUMT00000080638.1	G	NM_004371		158559852	-1	no_errors	NM_001098398	genbank	human	reviewed	54_36p	silent	SNP	0.993	T
IFIH1	64135	genome.wustl.edu	37	2	163144770	163144770	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:163144770T>A	ENST00000263642.2	-	5	1365	c.970A>T	c.(970-972)Aat>Tat	p.N324Y		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	324	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						ATGATGATATTCTTCCCTTCC	0.498																																																0			2											105.0	100.0	102.0					2																	163144770		2203	4300	6503	162853016	SO:0001583	missense	64135			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.970A>T	2.37:g.163144770T>A	ENSP00000263642:p.Asn324Tyr	Somatic		Capture	Illumina GAIIx	4	162853016	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	superfamily_DEATH domain,HMMPfam_CARD,HMMSmart_SM00487,HMMPfam_ResIII,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00490,HMMPfam_Helicase_C	p.N324Y	ENST00000263642.2	37	c.970	CCDS2217.1	2	.	.	.	.	.	.	.	.	.	.	T	26.4	4.737520	0.89482	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.37411	1.2	5.92	5.92	0.95590	DEAD-like helicase (2);Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	T	0.72930	0.3522	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82474	-0.0439	10	0.87932	D	0	-32.9991	16.3655	0.83319	0.0:0.0:0.0:1.0	.	324	Q9BYX4	IFIH1_HUMAN	Y	324	ENSP00000263642:N324Y	ENSP00000263642:N324Y	N	-	1	0	IFIH1	162853016	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.694000	0.84235	2.257000	0.74773	0.455000	0.32223	AAT	-	HMMSmart_SM00487,HMMPfam_ResIII,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.498	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIH1	protein_coding	OTTHUMT00000255078.2	T	NM_022168		162853016	-1	no_errors	NM_022168	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ILDR2	387597	genome.wustl.edu	37	1	166896322	166896322	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:166896322T>C	ENST00000271417.3	-	7	1031	c.976A>G	c.(976-978)Aga>Gga	p.R326G	ILDR2_ENST00000525740.1_Missense_Mutation_p.R199G|ILDR2_ENST00000529071.1_Missense_Mutation_p.R307G|ILDR2_ENST00000469934.2_Missense_Mutation_p.R326G|ILDR2_ENST00000528703.1_Missense_Mutation_p.R267G|ILDR2_ENST00000526687.1_Missense_Mutation_p.R218G|ILDR2_ENST00000529387.1_Intron	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	326					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						CTCATCCTTCTGGCTGGATCA	0.478																																																0			1											141.0	133.0	136.0					1																	166896322		2203	4300	6503	165162946	SO:0001583	missense	387597			AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.976A>G	1.37:g.166896322T>C	ENSP00000271417:p.Arg326Gly	Somatic		Capture	Illumina GAIIx	4	165162946		Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,HMMPfam_V-set,HMMPfam_LSR	p.R326G	ENST00000271417.3	37	c.976	CCDS1256.1	1	.	.	.	.	.	.	.	.	.	.	T	18.47	3.631359	0.67015	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000469934;ENST00000529071;ENST00000526687;ENST00000528703	T;D;T;T;D;T	0.84442	-0.07;-1.83;0.04;-0.11;-1.85;-0.77	5.8	3.43	0.39272	.	0.267150	0.39834	N	0.001248	D	0.88224	0.6379	M	0.75264	2.295	0.32313	N	0.563524	D	0.76494	0.999	D	0.78314	0.991	D	0.87684	0.2549	10	0.87932	D	0	.	12.7538	0.57323	0.0:0.0:0.3978:0.6022	.	326	Q71H61	ILDR2_HUMAN	G	326;199;326;307;218;267	ENSP00000271417:R326G;ENSP00000436120:R199G;ENSP00000437008:R326G;ENSP00000436882:R307G;ENSP00000434273:R218G;ENSP00000432750:R267G	ENSP00000271417:R326G	R	-	1	2	ILDR2	165162946	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.711000	0.25764	0.427000	0.26145	0.533000	0.62120	AGA	-	NULL		0.478	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILDR2	protein_coding	OTTHUMT00000082880.2	T	NM_199351		165162946	-1	no_errors	NM_199351	genbank	human	provisional	54_36p	missense	SNP	1.000	C
F5	2153	genome.wustl.edu	37	1	169515787	169515787	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:169515787T>A	ENST00000367797.3	-	11	1856	c.1655A>T	c.(1654-1656)gAt>gTt	p.D552V	F5_ENST00000367796.3_Missense_Mutation_p.D552V|F5_ENST00000546081.1_3'UTR	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	552	F5/8 type A 2.|Plastocyanin-like 4.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	TTTGTTCTCATCAAACACAGC	0.433																																																0			1											190.0	148.0	162.0					1																	169515787		2203	4300	6503	167782411	SO:0001583	missense	2153			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.1655A>T	1.37:g.169515787T>A	ENSP00000356771:p.Asp552Val	Somatic		Capture	Illumina GAIIx	4	167782411	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	superfamily_Cupredoxins,HMMPfam_Cu-oxidase_3,PatternScan_MULTICOPPER_OXIDASE1,HMMPfam_LSPR,superfamily_Galactose-binding domain-like,HMMSmart_SM00231,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2	p.D552V	ENST00000367797.3	37	c.1655	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	t	27.3	4.822920	0.90873	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.99298	-5.71;-5.71	6.17	6.17	0.99709	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99616	0.9860	H	0.94658	3.565	0.47065	D	0.999300	D	0.89917	1.0	D	0.91635	0.999	D	0.97837	1.0266	9	0.87932	D	0	-27.2616	16.8222	0.85835	0.0:0.0:0.0:1.0	.	552	P12259	FA5_HUMAN	V	552	ENSP00000356771:D552V;ENSP00000356770:D552V	ENSP00000356770:D552V	D	-	2	0	F5	167782411	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.552000	0.82192	2.371000	0.80710	0.533000	0.62120	GAT	-	superfamily_Cupredoxins		0.433	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	protein_coding	OTTHUMT00000083712.1	T	NM_000130		167782411	-1	no_errors	NM_000130	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PAPPA2	60676	genome.wustl.edu	37	1	176740242	176740242	+	Silent	SNP	C	C	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:176740242C>T	ENST00000367662.3	+	17	5805	c.4641C>T	c.(4639-4641)gaC>gaT	p.D1547D		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1547	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						ACAACCACGACGTGGGCACCA	0.498																																																0			1											120.0	113.0	115.0					1																	176740242		2066	4213	6279	175006865	SO:0001819	synonymous_variant	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4641C>T	1.37:g.176740242C>T		Somatic		Capture	Illumina GAIIx	4	175006865	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	"superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00560,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMSmart_SM00004,HMMPfam_Notch,PatternScan_ZINC_PROTEASE,HMMPfam_Peptidase_M43,PatternScan_N6_MTASE,superfamily_Complement control module/SCR domain,HMMSmart_SM00032,HMMPfam_Sushi,superfamily_Notch domain"	p.D1547	ENST00000367662.3	37	c.4641	CCDS41438.1	1																																																																																			-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.498	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	protein_coding	OTTHUMT00000084763.1	C			175006865	+1	no_errors	NM_020318	genbank	human	validated	54_36p	silent	SNP	0.888	T
GPR155	151556	genome.wustl.edu	37	2	175346663	175346663	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:175346663C>G	ENST00000392552.2	-	2	260	c.22G>C	c.(22-24)Gag>Cag	p.E8Q	GPR155_ENST00000295500.4_Missense_Mutation_p.E8Q|GPR155_ENST00000392551.2_Missense_Mutation_p.E8Q	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	8					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						GTTAAGTTCTCTGCAGGTAAA	0.393																																																0			2											144.0	144.0	144.0					2																	175346663		2203	4300	6503	175054909	SO:0001583	missense	151556			AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.22G>C	2.37:g.175346663C>G	ENSP00000376335:p.Glu8Gln	Somatic		Capture	Illumina GAIIx	4	175054909	B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	"HMMPfam_Mem_trans,superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00049,HMMPfam_DEP"	p.E8Q	ENST00000392552.2	37	c.22	CCDS2259.1	2	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845985	0.32606	.	.	ENSG00000163328	ENST00000392552;ENST00000392551;ENST00000295500	T;T;T	0.44083	0.93;0.93;0.93	5.79	-0.0408	0.13870	.	0.785897	0.12425	N	0.470115	T	0.21590	0.0520	N	0.08118	0	0.21697	N	0.999589	B	0.15473	0.013	B	0.16289	0.015	T	0.20605	-1.0270	10	0.56958	D	0.05	0.052	8.434	0.32775	0.0:0.2734:0.0:0.7266	.	8	Q7Z3F1	GP155_HUMAN	Q	8	ENSP00000376335:E8Q;ENSP00000376334:E8Q;ENSP00000295500:E8Q	ENSP00000295500:E8Q	E	-	1	0	GPR155	175054909	0.129000	0.22400	0.915000	0.36163	0.540000	0.34992	0.011000	0.13264	0.049000	0.15920	0.655000	0.94253	GAG	-	NULL		0.393	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR155	protein_coding	OTTHUMT00000255455.1	C	NM_152529		175054909	-1	no_errors	NM_001033045	genbank	human	validated	54_36p	missense	SNP	0.850	G
TTN	7273	genome.wustl.edu	37	2	179425763	179425763	+	Missense_Mutation	SNP	C	C	T	rs367800789		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:179425763C>T	ENST00000591111.1	-	276	80397	c.80173G>A	c.(80173-80175)Gtt>Att	p.V26725I	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V25798I|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V19426I|TTN_ENST00000460472.2_Missense_Mutation_p.V19301I|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V19493I|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V28366I|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26725	Ig-like 128.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAACAATAACGTCTCGGAAC	0.443																																																0			2						C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,3866		0,0,1933	181.0	172.0	175.0		58477,58276,77392,57901	2.7	0.1	2		175	1,8255		0,1,4127	no	missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133378.4,NM_003319.4	29,29,29,29	0,1,6060	TT,TC,CC		0.0121,0.0,0.0082	benign,benign,benign,benign	19493/27119,19426/27052,25798/33424,19301/26927	179425763	1,12121	1933	4128	6061	179134009	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80173G>A	2.37:g.179425763C>T	ENSP00000465570:p.Val26725Ile	Somatic		Capture	Illumina GAIIx	4	179134009	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,HMMPfam_Titin_Z,HMMSmart_SM00406,PatternScan_IG_MHC,HMMPfam_PPAK,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_TYR	p.V24347I	ENST00000591111.1	37	c.73039		2	.	.	.	.	.	.	.	.	.	.	C	16.01	3.000898	0.54254	0.0	1.21E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	5.97	2.72	0.32119	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.40297	0.1111	M	0.62016	1.91	0.34288	D	0.682904	B;B;B;B	0.13594	0.008;0.008;0.008;0.008	B;B;B;B	0.12156	0.007;0.007;0.007;0.005	T	0.52472	-0.8571	9	0.87932	D	0	.	10.5641	0.45163	0.0:0.7498:0.1138:0.1364	.	19301;19426;19493;26725	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	25798;19301;19493;19426;19299	ENSP00000343764:V25798I;ENSP00000434586:V19301I;ENSP00000340554:V19493I;ENSP00000352154:V19426I	ENSP00000340554:V19493I	V	-	1	0	TTN	179134009	0.033000	0.19621	0.053000	0.19242	0.232000	0.25224	0.625000	0.24477	0.834000	0.34852	0.655000	0.94253	GTT	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409		0.443	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179134009	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	0.912	T
TTN	7273	genome.wustl.edu	37	2	179476676	179476676	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:179476676A>C	ENST00000591111.1	-	218	45661	c.45437T>G	c.(45436-45438)gTc>gGc	p.V15146G	TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V14219G|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V7847G|TTN_ENST00000460472.2_Missense_Mutation_p.V7722G|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V7914G|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V16787G			Q8WZ42	TITIN_HUMAN	titin	15146	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTCTCAATGACATATCTATT	0.353																																																0			2											76.0	68.0	70.0					2																	179476676		1848	4112	5960	179184921	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.45437T>G	2.37:g.179476676A>C	ENSP00000465570:p.Val15146Gly	Somatic		Capture	Illumina GAIIx	4	179184921	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_IG_MHC,HMMSmart_SM00406,HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_fn3,HMMSmart_SM00060,HMMPfam_PPAK,PatternScan_PROTEIN_KINASE_TYR,superfamily_Fibronectin type III,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Protein kinase-like (PK-like),superfamily_WD40 repeat-like,HMMPfam_I-set,HMMPfam_ig,HMMPfam_Titin_Z,HMMPfam_Pkinase,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses	p.V12769G	ENST00000591111.1	37	c.38306		2	.	.	.	.	.	.	.	.	.	.	A	7.704	0.693787	0.15039	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	6.06	6.06	0.98353	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.63212	0.2492	M	0.83118	2.625	0.80722	D	1	B;B;B;B	0.25048	0.117;0.117;0.117;0.117	B;B;B;B	0.33295	0.065;0.065;0.119;0.161	T	0.64643	-0.6359	9	0.87932	D	0	.	16.6127	0.84892	1.0:0.0:0.0:0.0	.	7722;7847;7914;15146	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	14219;7722;7914;7847;7722	ENSP00000343764:V14219G;ENSP00000434586:V7722G;ENSP00000340554:V7914G;ENSP00000352154:V7847G	ENSP00000340554:V7914G	V	-	2	0	TTN	179184921	1.000000	0.71417	0.966000	0.40874	0.434000	0.31775	5.989000	0.70587	2.322000	0.78497	0.528000	0.53228	GTC	-	HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,superfamily_Concanavalin A-like lectins/glucanases,superfamily_WD40 repeat-like,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses		0.353	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179184921	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179496983	179496983	+	Silent	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:179496983G>A	ENST00000591111.1	-	186	38939	c.38715C>T	c.(38713-38715)gaC>gaT	p.D12905D	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.D11978D|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Silent_p.D5606D|TTN_ENST00000460472.2_Silent_p.D5481D|TTN_ENST00000342175.6_Silent_p.D5673D|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Silent_p.D14546D			Q8WZ42	TITIN_HUMAN	titin	12905					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTCCCTTCGTCTTGCATTG	0.433																																																0			2											123.0	112.0	115.0					2																	179496983		1939	4155	6094	179205228	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.38715C>T	2.37:g.179496983G>A		Somatic		Capture	Illumina GAIIx	4	179205228	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_IG_MHC,HMMSmart_SM00406,HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_fn3,HMMSmart_SM00060,HMMPfam_PPAK,PatternScan_PROTEIN_KINASE_TYR,superfamily_Fibronectin type III,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Protein kinase-like (PK-like),superfamily_WD40 repeat-like,HMMPfam_I-set,HMMPfam_ig,HMMPfam_Titin_Z,HMMPfam_Pkinase,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses	p.D10528	ENST00000591111.1	37	c.31584		2																																																																																			-	HMMSmart_SM00409,superfamily_Concanavalin A-like lectins/glucanases,superfamily_WD40 repeat-like,HMMPfam_I-set,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179205228	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	silent	SNP	0.966	A
TTN	7273	genome.wustl.edu	37	2	179528784	179528784	+	Intron	SNP	A	A	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:179528784A>T	ENST00000591111.1	-	154	34489				TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S12108T			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCACCACCGACACTTTCTTT	0.378																																																0			2											120.0	116.0	117.0					2																	179528784		876	1991	2867	179237029	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34265-5263T>A	2.37:g.179528784A>T		Somatic		Capture	Illumina GAIIx	4	179237029	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	HMMPfam_PPAK	p.S382T	ENST00000591111.1	37	c.1144		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.24|11.24	1.580708|1.580708	0.28180|0.28180	.|.	.|.	ENSG00000155657|ENSG00000155657	ENST00000425332|ENST00000541862;ENST00000392423	.|.	.|.	.|.	4.88|4.88	-1.56|-1.56	0.08532|0.08532	.|.	.|.	.|.	.|.	.|.	.|T	.|0.14830	.|0.0358	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	.|T	.|0.26224	.|-1.0109	.|7	.|0.17369	.|T	.|0.5	.|.	0.7892|0.7892	0.01054|0.01054	0.3096:0.1124:0.3265:0.2515|0.3096:0.1124:0.3265:0.2515	.|.	.|382	.|Q71S18	.|.	X|T	171|382;234	.|.	.|ENSP00000376219:S234T	C|S	-|-	3|1	2|0	TTN|TTN	179237029|179237029	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.014000|0.014000	0.08584|0.08584	-1.785000|-1.785000	0.01767|0.01767	-0.309000|-0.309000	0.08779|0.08779	-0.242000|-0.242000	0.12053|0.12053	TGT|TCG	-	NULL		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179237029	-1	no_start_codon:no_stop_codon	ENST00000392423	ensembl	human	known	54_36p	missense	SNP	0.000	T
NCKAP1	10787	genome.wustl.edu	37	2	183795490	183795490	+	Silent	SNP	T	T	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:183795490T>C	ENST00000361354.4	-	27	3258	c.2886A>G	c.(2884-2886)tcA>tcG	p.S962S	NCKAP1_ENST00000360982.2_Silent_p.S968S|NCKAP1_ENST00000478449.1_5'UTR	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	962					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			CGGCAGCTGATGATAACTCAT	0.333																																																0			2											66.0	64.0	65.0					2																	183795490		2203	4300	6503	183503735	SO:0001819	synonymous_variant	10787			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.2886A>G	2.37:g.183795490T>C		Somatic		Capture	Illumina GAIIx	4	183503735	O60329|Q53QN5|Q53S94|Q53Y35	Silent	SNP	HMMPfam_Nckap1	p.S968	ENST00000361354.4	37	c.2904	CCDS2287.1	2																																																																																			-	HMMPfam_Nckap1		0.333	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	protein_coding	OTTHUMT00000255867.2	T	NM_205842		183503735	-1	no_errors	NM_205842	genbank	human	validated	54_36p	silent	SNP	0.729	C
FSIP2	401024	genome.wustl.edu	37	2	186671332	186671332	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:186671332A>G	ENST00000424728.1	+	17	17299	c.17299A>G	c.(17299-17301)Aaa>Gaa	p.K5767E	FSIP2_ENST00000343098.5_Missense_Mutation_p.K5856E			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5767										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TGAACCCAGTAAACCAGATGA	0.348																																																0			2											75.0	70.0	72.0					2																	186671332		1809	4067	5876	186379577	SO:0001583	missense	401024			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17299A>G	2.37:g.186671332A>G	ENSP00000401306:p.Lys5767Glu	Somatic		Capture	Illumina GAIIx	4	186379577	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.K465E	ENST00000424728.1	37	c.1393		2	.	.	.	.	.	.	.	.	.	.	A	16.10	3.027987	0.54790	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.49432	0.78;0.78	4.83	3.68	0.42216	.	.	.	.	.	T	0.33585	0.0868	L	0.29908	0.895	0.09310	N	1	.	.	.	.	.	.	T	0.22695	-1.0209	7	0.15066	T	0.55	.	7.0293	0.24958	0.8977:0.0:0.1023:0.0	.	.	.	.	E	5856;5767	ENSP00000344403:K5856E;ENSP00000401306:K5767E	ENSP00000344403:K5856E	K	+	1	0	FSIP2	186379577	0.002000	0.14202	0.005000	0.12908	0.149000	0.21700	1.033000	0.30191	0.867000	0.35654	0.482000	0.46254	AAA	-	NULL		0.348	FSIP2-001	KNOWN	basic	protein_coding	FLJ44048	protein_coding	OTTHUMT00000332778.3	A	NM_173651		186379577	+1	no_errors	NM_207482	genbank	human	validated	54_36p	missense	SNP	0.004	G
LRP2BP	55805	genome.wustl.edu	37	4	186299270	186299270	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr4:186299270T>A	ENST00000328559.7	-	1	882	c.71A>T	c.(70-72)aAc>aTc	p.N24I	LRP2BP_ENST00000510776.1_5'UTR|LRP2BP_ENST00000505916.1_Missense_Mutation_p.N24I|RP11-714G18.1_ENST00000514884.1_RNA|LRP2BP_ENST00000362004.3_Missense_Mutation_p.N24I	NM_018409.3	NP_060879.2	Q9P2M1	LR2BP_HUMAN	LRP2 binding protein	24						cytoplasm (GO:0005737)				breast(1)|endometrium(2)|large_intestine(6)|lung(3)|prostate(1)|skin(2)	15		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)		AAATTTTTGGTTTTTAGCAGC	0.368																																																0			4											144.0	146.0	146.0					4																	186299270		2203	4300	6503	186536264	SO:0001583	missense	55805			AB037746	CCDS3840.1	4q35.1	2011-05-03			ENSG00000109771	ENSG00000109771			25434	protein-coding gene	gene with protein product						10718198, 12508107	Standard	NM_018409		Approved	DKFZp761O0113	uc003ixj.2	Q9P2M1	OTTHUMG00000160460	ENST00000328559.7:c.71A>T	4.37:g.186299270T>A	ENSP00000332681:p.Asn24Ile	Somatic		Capture	Illumina GAIIx	4	186536264	A6NJR7|A7E219|B3KX83|Q9NSN6	Missense_Mutation	SNP	superfamily_HCP-like,HMMPfam_TPR_2,HMMSmart_SM00671,HMMPfam_Sel1	p.N24I	ENST00000328559.7	37	c.71	CCDS3840.1	4	.	.	.	.	.	.	.	.	.	.	T	5.419	0.262476	0.10294	.	.	ENSG00000109771	ENST00000362004;ENST00000328559;ENST00000505916;ENST00000511404	T;T;T	0.49139	0.84;0.79;0.79	4.99	2.56	0.30785	.	0.937434	0.09025	N	0.859641	T	0.30135	0.0755	N	0.19112	0.55	0.09310	N	1	B	0.17465	0.022	B	0.14023	0.01	T	0.19976	-1.0289	10	0.39692	T	0.17	-3.8955	4.6571	0.12622	0.0:0.1015:0.2117:0.6867	.	24	Q9P2M1	LR2BP_HUMAN	I	24	ENSP00000354846:N24I;ENSP00000332681:N24I;ENSP00000426203:N24I	ENSP00000332681:N24I	N	-	2	0	LRP2BP	186536264	0.001000	0.12720	0.026000	0.17262	0.010000	0.07245	0.298000	0.19120	0.938000	0.37419	0.533000	0.62120	AAC	-	NULL		0.368	LRP2BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRP2BP	protein_coding	OTTHUMT00000360679.2	T	NM_018409		186536264	-1	no_errors	NM_018409	genbank	human	validated	54_36p	missense	SNP	0.001	A
TRIML2	205860	genome.wustl.edu	37	4	189012738	189012738	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr4:189012738T>A	ENST00000512729.1	-	7	1327	c.953A>T	c.(952-954)gAc>gTc	p.D318V	TRIML2_ENST00000326754.3_Missense_Mutation_p.D343V	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	318	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GCCAACTGTGTCCAACTTCTT	0.517																																																0			4											136.0	154.0	148.0					4																	189012738		2203	4300	6503	189249732	SO:0001583	missense	205860			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.953A>T	4.37:g.189012738T>A	ENSP00000422581:p.Asp318Val	Somatic		Capture	Illumina GAIIx	4	189249732	B7Z6J6	Missense_Mutation	SNP	HMMSmart_PRY,HMMPfam_SPRY	p.D318V	ENST00000512729.1	37	c.953	CCDS3850.1	4	.	.	.	.	.	.	.	.	.	.	T	4.025	0.002034	0.07819	.	.	ENSG00000179046	ENST00000512729;ENST00000326754	T;T	0.74002	-0.8;-0.8	5.85	-2.65	0.06095	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	1.463750	0.04045	N	0.303820	T	0.59500	0.2198	L	0.32530	0.975	0.09310	N	1	B;B	0.17667	0.023;0.023	B;B	0.19666	0.026;0.026	T	0.33007	-0.9885	10	0.24483	T	0.36	.	3.7388	0.08521	0.3814:0.2165:0.0:0.402	.	343;318	B7ZLC3;Q8N7C3	.;TRIMM_HUMAN	V	318;343	ENSP00000422581:D318V;ENSP00000317498:D343V	ENSP00000317498:D343V	D	-	2	0	TRIML2	189249732	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.173000	0.16724	-0.312000	0.08741	0.533000	0.62120	GAC	-	HMMPfam_SPRY		0.517	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	protein_coding	OTTHUMT00000359733.1	T	NM_173553		189249732	-1	no_errors	NM_173553	genbank	human	provisional	54_36p	missense	SNP	0.002	A
CFH	3075	genome.wustl.edu	37	1	196712736	196712736	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:196712736G>T	ENST00000367429.4	+	20	3528	c.3288G>T	c.(3286-3288)tgG>tgT	p.W1096C		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1096	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ATGGAAACTGGACGGAACCAC	0.358																																																0			1											252.0	243.0	246.0					1																	196712736		2203	4300	6503	194979359	SO:0001583	missense	3075			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3288G>T	1.37:g.196712736G>T	ENSP00000356399:p.Trp1096Cys	Somatic		Capture	Illumina GAIIx	4	194979359	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.W1096C	ENST00000367429.4	37	c.3288	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	.	12.97	2.096256	0.36952	.	.	ENSG00000000971	ENST00000367429	D	0.92805	-3.11	4.96	4.03	0.46877	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.94430	0.8208	H	0.97983	4.12	0.80722	D	1	P	0.35124	0.485	B	0.32022	0.139	D	0.94169	0.7421	9	0.87932	D	0	.	11.9756	0.53089	0.0:0.0:0.826:0.174	.	1096	P08603	CFAH_HUMAN	C	1096	ENSP00000356399:W1096C	ENSP00000356399:W1096C	W	+	3	0	CFH	194979359	1.000000	0.71417	0.994000	0.49952	0.366000	0.29705	5.186000	0.65082	1.197000	0.43143	0.455000	0.32223	TGG	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.358	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	protein_coding	OTTHUMT00000086412.2	G	NM_000186		194979359	+1	no_errors	NM_000186	genbank	human	reviewed	54_36p	missense	SNP	0.944	T
AVPR1B	553	genome.wustl.edu	37	1	206225087	206225087	+	Missense_Mutation	SNP	C	C	T	rs200893536	byFrequency	TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:206225087C>T	ENST00000367126.4	+	1	1112	c.647C>T	c.(646-648)aCg>aTg	p.T216M	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	216					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	ACCATGCTCACGGCCTGCTAC	0.612													C|||	2	0.000399361	0.0	0.0	5008	,	,		16735	0.001		0.001	False		,,,				2504	0.0															0			1											53.0	53.0	53.0					1																	206225087		2199	4296	6495	204391710	SO:0001583	missense	553			D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.647C>T	1.37:g.206225087C>T	ENSP00000356094:p.Thr216Met	Somatic		Capture	Illumina GAIIx	4	204391710	B0M0J6|Q5TZ00	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T216M	ENST00000367126.4	37	c.647	CCDS30994.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.49	1.365873	0.24684	.	.	ENSG00000198049	ENST00000367126	T	0.72394	-0.65	5.66	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.249318	0.35555	N	0.003130	T	0.63260	0.2496	L	0.48877	1.53	0.32970	D	0.522166	B	0.30193	0.272	B	0.33521	0.165	T	0.70360	-0.4893	10	0.40728	T	0.16	-9.6728	10.6495	0.45640	0.0:0.7689:0.0:0.2311	.	216	P47901	V1BR_HUMAN	M	216	ENSP00000356094:T216M	ENSP00000356094:T216M	T	+	2	0	AVPR1B	204391710	0.825000	0.29262	0.926000	0.36857	0.754000	0.42855	1.556000	0.36288	1.396000	0.46663	0.563000	0.77884	ACG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.612	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVPR1B	protein_coding	OTTHUMT00000087996.1	C	NM_000707		204391710	+1	no_errors	NM_000707	genbank	human	reviewed	54_36p	missense	SNP	0.951	T
RASSF5	83593	genome.wustl.edu	37	1	206702861	206702861	+	Intron	SNP	A	A	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:206702861A>C	ENST00000355294.4	+	2	514				RASSF5_ENST00000367117.3_Intron	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5						apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			ACACAGGTTAACTCAGAAGAC	0.507																																					GBM(162;656 1984 11916 22872 31529)											0			1																																								204769484	SO:0001627	intron_variant	0			BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616	ENST00000355294.4:c.458-8640A>C	1.37:g.206702861A>C		Somatic		Capture	Illumina GAIIx	4	204769484	A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	RNA	SNP	-	NULL	ENST00000355294.4	37	NULL	CCDS30998.1	1																																																																																			-	-		0.507	RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100131192	protein_coding	OTTHUMT00000088469.1	A	NM_031437		204769484	-1	pseudogene	XR_037173	genbank	human	model	54_36p	rna	SNP	1.000	C
CPO	130749	genome.wustl.edu	37	2	207804356	207804356	+	Silent	SNP	G	G	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:207804356G>A	ENST00000272852.3	+	1	79	c.33G>A	c.(31-33)ttG>ttA	p.L11L		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	11						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		TTTATCTTTTGGGGATGCTGG	0.418																																																0			2											165.0	164.0	164.0					2																	207804356		2203	4300	6503	207512601	SO:0001819	synonymous_variant	130749				CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.33G>A	2.37:g.207804356G>A		Somatic		Capture	Illumina GAIIx	4	207512601	Q2M277|Q7RTW7	Silent	SNP	PatternScan_CARBOXYPEPT_ZN_2,superfamily_SSF53187,HMMSmart_Zn_pept,HMMPfam_Peptidase_M14,PatternScan_CARBOXYPEPT_ZN_1	p.L11	ENST00000272852.3	37	c.33	CCDS2372.1	2																																																																																			-	NULL		0.418	CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPO	protein_coding	OTTHUMT00000202040.2	G	NM_173077		207512601	+1	no_errors	NM_173077	genbank	human	validated	54_36p	silent	SNP	0.527	A
KCNK2	3776	genome.wustl.edu	37	1	215342541	215342541	+	Splice_Site	SNP	G	G	T			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:215342541G>T	ENST00000444842.2	+	4	625		c.e4-1		KCNK2_ENST00000391895.2_Splice_Site|KCNK2_ENST00000391894.2_Splice_Site	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2						G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	TTTTTTTAAAGGATTTGGAAA	0.333																																																0			1											90.0	94.0	92.0					1																	215342541		2202	4300	6502	213409164	SO:0001630	splice_region_variant	3776			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.476-1G>T	1.37:g.215342541G>T		Somatic		Capture	Illumina GAIIx	4	213409164	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Splice_Site	SNP	-	e4-1	ENST00000444842.2	37	c.476-1	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412923	0.83449	.	.	ENSG00000082482	ENST00000366948;ENST00000391895;ENST00000478774;ENST00000391894;ENST00000444842;ENST00000457122	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KCNK2	213409164	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	.	-	-		0.333	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	protein_coding	OTTHUMT00000089856.2	G	NM_014217	Intron	213409164	+1	no_errors	NM_001017425	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
ACTN2	88	genome.wustl.edu	37	1	236882206	236882206	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:236882206C>A	ENST00000366578.4	+	3	420	c.254C>A	c.(253-255)cCc>cAc	p.P85H	ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.P85H	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	85	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GAAAGGCTGCCCAAACCTGAC	0.453																																																0			1											106.0	102.0	104.0					1																	236882206		2203	4300	6503	234948829	SO:0001583	missense	88			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.254C>A	1.37:g.236882206C>A	ENSP00000355537:p.Pro85His	Somatic		Capture	Illumina GAIIx	4	234948829	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,HMMPfam_efhand_Ca_insen	p.P85H	ENST00000366578.4	37	c.254	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.754200	0.89843	.	.	ENSG00000077522	ENST00000542672;ENST00000366578	D;D	0.95205	-3.64;-3.64	5.56	5.56	0.83823	Calponin homology domain (5);	0.095525	0.85682	D	0.000000	D	0.97598	0.9213	M	0.90145	3.09	0.80722	D	1	D;P	0.59357	0.985;0.885	P;P	0.62813	0.907;0.499	D	0.98115	1.0422	10	0.87932	D	0	.	18.6602	0.91469	0.0:1.0:0.0:0.0	.	85;85	B2RCS5;P35609	.;ACTN2_HUMAN	H	85	ENSP00000443495:P85H;ENSP00000355537:P85H	ENSP00000355537:P85H	P	+	2	0	ACTN2	234948829	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.571000	0.82399	2.775000	0.95449	0.655000	0.94253	CCC	-	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033		0.453	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	protein_coding	OTTHUMT00000096628.1	C	NM_001103		234948829	+1	no_errors	NM_001103	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237837458	237837458	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:237837458G>C	ENST00000366574.2	+	59	8970	c.8653G>C	c.(8653-8655)Gat>Cat	p.D2885H	RYR2_ENST00000360064.6_Missense_Mutation_p.D2883H|RYR2_ENST00000542537.1_Missense_Mutation_p.D2869H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2885	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAAAGCCAAGGATAGAGAAAA	0.428																																																0			1											108.0	106.0	107.0					1																	237837458		1965	4157	6122	235904081	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8653G>C	1.37:g.237837458G>C	ENSP00000355533:p.Asp2885His	Somatic		Capture	Illumina GAIIx	4	235904081	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_RYDR_ITPR,HMMPfam_SPRY,HMMSmart_SM00449,HMMPfam_RyR,HMMPfam_RIH_assoc,superfamily_EF-hand,HMMPfam_RR_TM4-6,HMMPfam_Ion_trans	p.D2885H	ENST00000366574.2	37	c.8653	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130165	0.77549	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.92858	-3.12;-3.12;-3.12	5.32	5.32	0.75619	Ryanodine receptor Ryr (1);	0.000000	0.64402	D	0.000005	D	0.95796	0.8632	M	0.70787	2.145	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95648	0.8704	10	0.54805	T	0.06	.	19.0098	0.92868	0.0:0.0:1.0:0.0	.	2885	Q92736	RYR2_HUMAN	H	2885;2883;2869	ENSP00000355533:D2885H;ENSP00000353174:D2883H;ENSP00000443798:D2869H	ENSP00000353174:D2883H	D	+	1	0	RYR2	235904081	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.852000	0.86927	2.483000	0.83821	0.557000	0.71058	GAT	-	HMMPfam_RyR		0.428	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	G	NM_001035		235904081	+1	no_errors	NM_001035	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
GBX2	2637	genome.wustl.edu	37	2	237074829	237074829	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:237074829G>C	ENST00000306318.4	-	2	1172	c.775C>G	c.(775-777)Ctg>Gtg	p.L259V	GBX2_ENST00000465889.1_5'UTR|AC079135.1_ENST00000483218.1_RNA|GBX2_ENST00000551105.1_3'UTR|AC079135.1_ENST00000415226.1_RNA	NM_001485.2	NP_001476.2	P52951	GBX2_HUMAN	gastrulation brain homeobox 2	259					autonomic nervous system development (GO:0048483)|axon guidance (GO:0007411)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellum development (GO:0021549)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|patterning of blood vessels (GO:0001569)|rhombomere 2 development (GO:0021568)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)		AGCTCCAGCAGCTGCTCGCTG	0.662																																																0			2											37.0	43.0	41.0					2																	237074829		2203	4300	6503	236739568	SO:0001583	missense	2637			AF118452	CCDS2515.1	2q37.2	2012-03-09	2005-12-22		ENSG00000168505	ENSG00000168505		"""Homeoboxes / ANTP class : HOXL subclass"""	4186	protein-coding gene	gene with protein product		601135	"""gastrulation brain homeo box 2"""			9346236, 8838315	Standard	XM_005246071		Approved		uc002vvw.1	P52951	OTTHUMG00000133294	ENST00000306318.4:c.775C>G	2.37:g.237074829G>C	ENSP00000302251:p.Leu259Val	Somatic		Capture	Illumina GAIIx	4	236739568	B2RPH7|O43833|Q53RX5|Q9Y5Y1	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.L259V	ENST00000306318.4	37	c.775	CCDS2515.1	2	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500203	0.85176	.	.	ENSG00000168505	ENST00000306318	D	0.97066	-4.23	4.42	4.42	0.53409	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000006	D	0.97636	0.9225	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97742	1.0209	10	0.41790	T	0.15	-15.5736	17.0285	0.86454	0.0:0.0:1.0:0.0	.	259	P52951	GBX2_HUMAN	V	259	ENSP00000302251:L259V	ENSP00000302251:L259V	L	-	1	2	GBX2	236739568	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.871000	0.87180	2.013000	0.59113	0.561000	0.74099	CTG	-	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox		0.662	GBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBX2	protein_coding	OTTHUMT00000257078.3	G	NM_001485		236739568	-1	no_errors	NM_001485	genbank	human	validated	54_36p	missense	SNP	1.000	C
HSPA8P5	399988	genome.wustl.edu	37	12	4207952	4207952	+	IGR	DEL	T	T	-			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr12:4207952delT								RP11-320N7.2 (72128 upstream) : RP11-320N7.1 (11241 downstream)																							TTTCCCTTGGTATTGAAACTG	0.438																																																0			12																																								4078213	SO:0001628	intergenic_variant	399988																															12.37:g.4207952delT		Somatic		Capture	Illumina GAIIx	4	4078213		RNA	DEL	-	NULL		37	NULL		12																																																																																			(deletion:rna[4077632,4079033])	-	0	0.438					LOC399988			T			4078213	+1	pseudogene	XR_016353	genbank	human	model	54_36p	rna	DEL	0.996	-
TP53	7157	genome.wustl.edu	37	17	7579321	7579322	+	Frame_Shift_Del	DEL	CA	CA	-	rs587780067		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	CA	CA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:7579321_7579322delCA	ENST00000269305.4	-	4	554_555	c.365_366delTG	c.(364-366)gtgfs	p.V122fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.V122fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.V122fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	122	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.V122fs*26(5)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.V122fs*46(1)|p.Y107fs*44(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGTGCAAGTCACAGACTTGGC	0.554		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	23	Deletion - Frameshift(13)|Whole gene deletion(8)|Deletion - In frame(2)	upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|breast(2)|stomach(1)|liver(1)|ovary(1)	17	GRCh37	CM065494	TP53	M																																				7520047	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.365_366delTG	17.37:g.7579323_7579324delCA	ENSP00000269305:p.Val122fs	Somatic		Capture	Illumina GAIIx	4	7520046	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.V122fs	ENST00000269305.4	37	c.366_365	CCDS11118.1	17																																																																																			(deletion:cds_exon[7520037,7520315])	HMMPfam_P53,superfamily_p53-like transcription factors		0.554	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	CA	NM_000546		7520047	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.615:0.928	-
CTR9	9646	genome.wustl.edu	37	11	10795598	10795599	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	GA	GA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr11:10795598_10795599delGA	ENST00000361367.2	+	22	3193_3194	c.2767_2768delGA	c.(2767-2769)gatfs	p.D924fs		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	924	Lys-rich.				cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		ATTTGTCAATGATGACACTGAT	0.411																																																0			11																																								10752175	SO:0001589	frameshift_variant	9646			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2767_2768delGA	11.37:g.10795598_10795599delGA	ENSP00000355013:p.Asp924fs	Somatic		Capture	Illumina GAIIx	4	10752174	D3DQV8|Q15015	Frame_Shift_Del	DEL	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR	p.D923fs	ENST00000361367.2	37	c.2767_2768	CCDS7805.1	11																																																																																			(deletion:cds_exon[10752135,10752292])	NULL		0.411	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	protein_coding	OTTHUMT00000386215.1	GA	NM_014633		10752175	+1	no_errors	NM_014633	genbank	human	provisional	54_36p	frame_shift_del	DEL	1.000:1.000	-
CACNA2D2	9254	genome.wustl.edu	37	3	50404006	50404007	+	Intron	INS	-	-	A			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr3:50404006_50404007insA	ENST00000479441.1	-	31	2658				CACNA2D2_ENST00000435965.1_Intron|CACNA2D2_ENST00000395083.1_Intron|XXcos-LUCA11.4_ENST00000606259.1_RNA|CACNA2D2_ENST00000429770.1_Intron|CACNA2D2_ENST00000423994.2_Intron|CACNA2D2_ENST00000360963.3_Intron|CACNA2D2_ENST00000424201.2_Intron|XXcos-LUCA11.4_ENST00000606665.1_RNA|XXcos-LUCA11.4_ENST00000607121.1_RNA|XXcos-LUCA11.4_ENST00000607583.1_RNA|XXcos-LUCA11.4_ENST00000607362.1_RNA|XXcos-LUCA11.4_ENST00000607088.1_RNA|XXcos-LUCA11.5_ENST00000606589.1_Intron|CACNA2D2_ENST00000266039.3_Intron			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2						energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	AGGGCACACACACCTCATTGTT	0.594																																																0			3																																								50379011	SO:0001627	intron_variant	9254			AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.2658+1->T	3.37:g.50404007_50404007dupA		Somatic		Capture	Illumina GAIIx	4	50379010	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Splice_Site	INS	-	e30+2	ENST00000479441.1	37	c.2637+2_2637+1	CCDS54588.1	3																																																																																			-	-		0.594	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACNA2D2	protein_coding	OTTHUMT00000346457.1	-	NM_006030		50379011	-1	no_errors	NM_001005505	genbank	human	reviewed	54_36p	splice_site_ins	INS	0.155:0.989	A
RPSAP55	388122	genome.wustl.edu	37	15	53178406	53178413	+	IGR	DEL	AGAGACTG	AGAGACTG	-			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	AGAGACTG	AGAGACTG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr15:53178406_53178413delAGAGACTG								RP11-209K10.2 (81267 upstream) : RP11-209E8.1 (230148 downstream)																							GAGATCCTGAAGAGACTGAAAAAGAAAA	0.486																																																0			15																																								50965705	SO:0001628	intergenic_variant	388122																															15.37:g.53178406_53178413delAGAGACTG		Somatic		Capture	Illumina GAIIx	4	50965698		Frame_Shift_Del	DEL	superfamily_Ribosomal protein S2,HMMPfam_Ribosomal_S2,PatternScan_RIBOSOMAL_S2_2	p.E206fs		37	c.615_622		15																																																																																			(deletion:cds_exon[50965084,50965962])	NULL	0	0.486					LOC388122			AGAGACTG			50965705	+1	pseudogene	XM_370865	genbank	human	model	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
LINC00238	440184	genome.wustl.edu	37	14	66953309	66953310	+	lincRNA	DEL	TC	TC	-	rs147152268|rs10569333	byFrequency	TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	TC	TC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr14:66953309_66953310delTC	ENST00000556874.1	-	0	643				LINC00238_ENST00000389594.3_RNA																							GAAAAGAGGGtctctctctctc	0.416														1824	0.364217	0.7383	0.3487	5008	,	,		19252	0.1389		0.2386	False		,,,				2504	0.2311															0			14																																								66023063			440184																															14.37:g.66953319_66953320delTC		Somatic		Capture	Illumina GAIIx	4	66023062		Frame_Shift_Del	DEL	NULL	p.S11fs	ENST00000556874.1	37	c.21_22		14																																																																																			(deletion:cds_exon[66023042,66023280])	NULL		0.416	RP11-72M17.1-001	KNOWN	basic	lincRNA	C14orf53	lincRNA	OTTHUMT00000412209.1	TC			66023063	+1	no_errors	ENST00000389594	ensembl	human	known	54_36p	frame_shift_del	DEL	0.000:0.000	-
LLGL2	3993	genome.wustl.edu	37	17	73552202	73552208	+	Frame_Shift_Del	DEL	ACCCGTT	ACCCGTT	-	rs150649144		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	ACCCGTT	ACCCGTT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr17:73552202_73552208delACCCGTT	ENST00000392550.3	+	3	268_274	c.151_157delACCCGTT	c.(151-159)acccgttctfs	p.TRS51fs	LLGL2_ENST00000577200.1_Frame_Shift_Del_p.TRS51fs|LLGL2_ENST00000375227.4_Frame_Shift_Del_p.TRS51fs|LLGL2_ENST00000167462.5_Frame_Shift_Del_p.TRS51fs|LLGL2_ENST00000578363.1_Frame_Shift_Del_p.TRS51fs	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	51					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			GGCCATCGGCACCCGTTCTGGAGCCAT	0.657																																																0			17																																								71063803	SO:0001589	frameshift_variant	3993			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.151_157delACCCGTT	17.37:g.73552202_73552208delACCCGTT	ENSP00000376333:p.Thr51fs	Somatic		Capture	Illumina GAIIx	4	71063797	Q14521|Q9BR62	Frame_Shift_Del	DEL	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_LLGL,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.T51fs	ENST00000392550.3	37	c.151_157	CCDS32733.1	17																																																																																			(deletion:cds_exon[71063722,71063819])	HMMSmart_SM00320,superfamily_WD40 repeat-like		0.657	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LLGL2	protein_coding	OTTHUMT00000447633.1	ACCCGTT	NM_004524		71063803	+1	no_errors	NM_001031803	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.998:0.998:0.930:0.935:0.933:0.897:0.987	-
EEF1A1	1915	genome.wustl.edu	37	6	74229098	74229099	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	TG	TG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr6:74229098_74229099delTG	ENST00000316292.9	-	2	1276_1277	c.285_286delCA	c.(283-288)cacagafs	p.HR95fs	EEF1A1_ENST00000331523.2_Frame_Shift_Del_p.HR95fs|EEF1A1_ENST00000309268.6_Frame_Shift_Del_p.HR95fs|EEF1A1_ENST00000491404.1_5'UTR	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	95	tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						ATAAAGTCTCTGTGTCCTGGGG	0.406											OREG0003890	type=REGULATORY REGION|Gene=LOC477388|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			6																																								74285820	SO:0001589	frameshift_variant	1915			BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.285_286delCA	6.37:g.74229100_74229101delTG	ENSP00000339063:p.His95fs	Somatic	1151	Capture	Illumina GAIIx	4	74285819	P04719|P04720|Q6IQ15	Frame_Shift_Del	DEL	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GTP_EFTU,PatternScan_EFACTOR_GTP,superfamily_Translation proteins,HMMPfam_GTP_EFTU_D2,HMMPfam_GTP_EFTU_D3,superfamily_EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain	p.H95fs	ENST00000316292.9	37	c.286_285	CCDS4980.1	6																																																																																			(deletion:cds_exon[74285781,74285960])	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GTP_EFTU		0.406	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A1	protein_coding	OTTHUMT00000041210.2	TG	NM_001402		74285820	-1	no_errors	NM_001402	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000	-
CAMK4	814	genome.wustl.edu	37	5	110814081	110814088	+	Frame_Shift_Del	DEL	TTTGTGGA	TTTGTGGA	-			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	TTTGTGGA	TTTGTGGA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr5:110814081_110814088delTTTGTGGA	ENST00000282356.4	+	9	1102_1109	c.704_711delTTTGTGGA	c.(703-711)ctttgtggafs	p.LCG235fs	CAMK4_ENST00000512453.1_Frame_Shift_Del_p.LCG235fs	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	235	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		TCCTCTAGACTTTGTGGATTTGAACCAT	0.346																																																0			5																																								110841987	SO:0001589	frameshift_variant	814			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.704_711delTTTGTGGA	5.37:g.110814081_110814088delTTTGTGGA	ENSP00000282356:p.Leu235fs	Somatic		Capture	Illumina GAIIx	4	110841980	D3DSZ7	Frame_Shift_Del	DEL	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.C236fs	ENST00000282356.4	37	c.704_711	CCDS4103.1	5																																																																																			(deletion:cds_exon[110841978,110842104])	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase		0.346	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK4	protein_coding	OTTHUMT00000250719.2	TTTGTGGA	NM_001744		110841987	+1	no_errors	NM_001744	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:0.990:1.000:1.000:1.000:1.000:1.000:0.999	-
ENOX2	10495	genome.wustl.edu	37	X	129804016	129804016	+	Frame_Shift_Del	DEL	C	C	-			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chrX:129804016delC	ENST00000370927.1	-	5	725	c.704delG	c.(703-705)agafs	p.R235fs	ENOX2_ENST00000370935.1_Frame_Shift_Del_p.R206fs|ENOX2_ENST00000338144.3_Frame_Shift_Del_p.R235fs|ENOX2_ENST00000394363.1_Frame_Shift_Del_p.R206fs			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	235					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						TGGACGCAATCTTTCTTCTTC	0.468																																					Ovarian(101;828 1506 2951 9500 35258)											0			X											233.0	176.0	195.0					X																	129804016		2203	4300	6503	129631697	SO:0001589	frameshift_variant	10495			AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.704delG	X.37:g.129804016delC	ENSP00000359965:p.Arg235fs	Somatic		Capture	Illumina GAIIx	4	129631697	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Frame_Shift_Del	DEL	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.R235fs	ENST00000370927.1	37	c.704	CCDS14626.1	X																																																																																			(deletion:cds_exon[129631620,129631853])	NULL		0.468	ENOX2-004	KNOWN	basic|CCDS	protein_coding	ENOX2	protein_coding	OTTHUMT00000058277.1	C	NM_182314		129631697	-1	no_errors	NM_182314	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.993	-
RP11-725P16.2	0	genome.wustl.edu	37	2	133106844	133106845	+	lincRNA	INS	-	-	C	rs77987132|rs146963520		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr2:133106844_133106845insC	ENST00000608279.1	-	0	0																											AATGGTCCTTATTGAGGACGCT	0.431																																																0			2																																								132823315			339742																															2.37:g.133106844_133106845insC		Somatic		Capture	Illumina GAIIx	4	132823314		Frame_Shift_Ins	INS	NULL	p.I4fs	ENST00000608279.1	37	c.10_11		2																																																																																			-	NULL		0.431	RP11-725P16.2-001	KNOWN	basic	lincRNA	LOC339742	lincRNA	OTTHUMT00000472122.1	-			132823315	+1	no_errors	XM_929883	genbank	human	model	54_36p	frame_shift_ins	INS	0.008:0.007	C
TOPBP1	11073	genome.wustl.edu	37	3	133368715	133368715	+	Frame_Shift_Del	DEL	G	G	-	rs369433427		TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr3:133368715delG	ENST00000260810.5	-	9	1293	c.1162delC	c.(1162-1164)cgtfs	p.R388fs	TOPBP1_ENST00000511439.1_5'UTR	NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	388	BRCT 3. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)	p.R301C(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TGGTTAAAACGAACTCCACCT	0.338								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)											1	Substitution - Missense(1)	large_intestine(1)	3											70.0	67.0	68.0					3																	133368715		1847	4091	5938	134851405	SO:0001589	frameshift_variant	11073			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.1162delC	3.37:g.133368715delG	ENSP00000260810:p.Arg388fs	Somatic		Capture	Illumina GAIIx	4	134851405	B7Z7W8|Q7LGC1|Q9UEB9	Frame_Shift_Del	DEL	superfamily_BRCT,HMMPfam_BRCT,HMMSmart_BRCT,superfamily_Secretoglobin	p.R301fs	ENST00000260810.5	37	c.901	CCDS46919.1	3																																																																																			(deletion:cds_exon[134851314,134851477])	HMMPfam_BRCT,superfamily_BRCT,HMMSmart_BRCT		0.338	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	protein_coding	OTTHUMT00000357254.1	G	NM_007027		134851405	-1	no_errors	NM_007027	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
CNTNAP2	26047	genome.wustl.edu	37	7	147926852	147926854	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	AGA	AGA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr7:147926852_147926854delAGA	ENST00000361727.3	+	20	3878_3880	c.3362_3364delAGA	c.(3361-3366)gagaag>gag	p.K1122del	CNTNAP2_ENST00000538075.1_In_Frame_Del_p.K181del	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1122	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACCCGCCACGAGAAGACCATCTT	0.443										HNSCC(39;0.1)																																						0			7																																								147557787	SO:0001651	inframe_deletion	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3362_3364delAGA	7.37:g.147926855_147926857delAGA	ENSP00000354778:p.Lys1122del	Somatic		Capture	Illumina GAIIx	4	147557785	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	In_Frame_Del	DEL	HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00181,HMMPfam_EGF,superfamily_Fibrinogen C-terminal domain-like,PatternScan_GLYCO_HORMONE_BETA_1,HMMSmart_SM00294	p.K1122in_frame_del	ENST00000361727.3	37	c.3362_3364	CCDS5889.1	7																																																																																			(deletion:cds_exon[147557671,147557804])	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2		0.443	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	protein_coding	OTTHUMT00000327668.1	AGA			147557787	+1	no_errors	NM_014141	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.062:0.036:0.022	-
PROX1	5629	genome.wustl.edu	37	1	214170872	214170875	+	Frame_Shift_Del	DEL	AAAG	AAAG	-			TCGA-29-1761-01A-01W-0633-09	TCGA-29-1761-10A-01W-0633-09	AAAG	AAAG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	9cd97680-82f8-4827-bc49-f3bb5e413b0e	bebb3242-ccdf-4555-8153-5e66c94046e8	g.chr1:214170872_214170875delAAAG	ENST00000366958.4	+	2	1602_1605	c.994_997delAAAG	c.(994-999)aaagaafs	p.KE332fs	PROX1_ENST00000435016.1_Frame_Shift_Del_p.KE332fs|PROX1_ENST00000498508.2_Frame_Shift_Del_p.KE332fs|PROX1_ENST00000261454.4_Frame_Shift_Del_p.KE332fs	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	332					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		AGGCAACAACAAAGAAAGAGACCA	0.505																																																0			1																																								212237498	SO:0001589	frameshift_variant	5629			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.994_997delAAAG	1.37:g.214170876_214170879delAAAG	ENSP00000355925:p.Lys332fs	Somatic		Capture	Illumina GAIIx	4	212237495	A6NK29|A8K2B1|Q5SW76|Q8TB91	Frame_Shift_Del	DEL	HMMPfam_Prox1,superfamily_Homeodomain_like	p.R334fs	ENST00000366958.4	37	c.994_997	CCDS31021.1	1																																																																																			(deletion:cds_exon[212236502,212238226])	HMMPfam_Prox1		0.505	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROX1	protein_coding	OTTHUMT00000089727.6	AAAG	NM_002763		212237498	+1	no_errors	NM_002763	genbank	human	provisional	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
