#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chrUnknown:0G>T								None (None upstream) : None (None downstream)																								0.0																																																0			NT_113923																																								96020	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>T		Somatic		Capture	Illumina GAIIx	4	96020		Silent	SNP	HMMPfam_G_glu_transpept,PatternScan_G_GLU_TRANSPEPTIDASE	p.R107		37	c.321		NT_113923																																																																																			-	HMMPfam_G_glu_transpept	0	0					ENSG00000216522			G			96020	-1	no_errors	ENST00000402757	ensembl	human	known	54_36p	silent	SNP	NULL	T
DLGAP2	9228	genome.wustl.edu	37	8	1514032	1514032	+	Missense_Mutation	SNP	G	G	A	rs545241585		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr8:1514032G>A	ENST00000421627.2	+	3	1308	c.1174G>A	c.(1174-1176)Gga>Aga	p.G392R	RP11-666I19.2_ENST00000518063.1_RNA	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	471					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GAAGTCCATCGGACAGAGACC	0.577													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16800	0.0		0.0	False		,,,				2504	0.0															0			8											31.0	35.0	34.0					8																	1514032		2131	4265	6396	1501439	SO:0001583	missense	9228			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1174G>A	8.37:g.1514032G>A	ENSP00000400258:p.Gly392Arg	Somatic		Capture	Illumina GAIIx	4	1501439	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	HMMPfam_GKAP	p.G392R	ENST00000421627.2	37	c.1174	CCDS47760.1	8	.	.	.	.	.	.	.	.	.	.	G	4.429	0.079276	0.08533	.	.	ENSG00000198010	ENST00000356067;ENST00000421627	D	0.89123	-2.47	4.55	2.71	0.32032	.	0.548695	0.20937	N	0.082981	T	0.75568	0.3867	N	0.17674	0.51	0.25849	N	0.983969	P;B	0.36837	0.571;0.357	B;B	0.26969	0.075;0.05	T	0.63075	-0.6718	10	0.23891	T	0.37	0.001	10.0446	0.42180	0.1689:0.0:0.8311:0.0	.	471;471	Q9P1A6-2;Q9P1A6	.;DLGP2_HUMAN	R	437;392	ENSP00000400258:G392R	ENSP00000348366:G437R	G	+	1	0	DLGAP2	1501439	0.574000	0.26684	0.001000	0.08648	0.483000	0.33249	1.411000	0.34702	0.448000	0.26722	0.585000	0.79938	GGA	-	NULL		0.577	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	protein_coding	OTTHUMT00000374478.1	G	NM_004745		1501439	+1	no_errors	NM_004745	genbank	human	reviewed	54_36p	missense	SNP	0.992	A
CSMD1	64478	genome.wustl.edu	37	8	2910123	2910123	+	Silent	SNP	G	G	A	rs367730492	byFrequency	TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr8:2910123G>A	ENST00000520002.1	-	51	8079	c.7524C>T	c.(7522-7524)acC>acT	p.T2508T	CSMD1_ENST00000537824.1_Silent_p.T2507T|CSMD1_ENST00000602723.1_Silent_p.T2508T|CSMD1_ENST00000400186.3_Silent_p.T2508T|CSMD1_ENST00000542608.1_Silent_p.T2507T|CSMD1_ENST00000602557.1_Silent_p.T2508T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2508	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACTCGTTCCCGGTAAATGAAC	0.438													G|||	4	0.000798722	0.0023	0.0	5008	,	,		16766	0.0		0.0	False		,,,				2504	0.001															0			8						G		11,3703		0,11,1846	53.0	50.0	51.0		7521	-4.3	0.0	8		51	0,8226		0,0,4113	no	coding-synonymous	CSMD1	NM_033225.5		0,11,5959	AA,AG,GG		0.0,0.2962,0.0921		2507/3565	2910123	11,11929	1857	4113	5970	2897530	SO:0001819	synonymous_variant	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7524C>T	8.37:g.2910123G>A		Somatic		Capture	Illumina GAIIx	4	2897530	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.R2509W	ENST00000520002.1	37	c.7525		8	.	.	.	.	.	.	.	.	.	.	G	0.035	-1.310422	0.01342	0.002962	0.0	ENSG00000183117	ENST00000335551	.	.	.	5.13	-4.26	0.03755	.	.	.	.	.	T	0.35307	0.0927	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32851	-0.9891	4	.	.	.	.	0.2498	0.00204	0.2276:0.2456:0.1963:0.3305	.	.	.	.	W	1925	.	.	R	-	1	2	CSMD1	2897530	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-3.202000	0.00560	-1.264000	0.02452	-0.171000	0.13296	CGG	-	NULL		0.438	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	G	NM_033225		2897530	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225	genbank	human	validated	54_36p	missense	SNP	0.001	A
C17orf49	124944	genome.wustl.edu	37	17	6920967	6920967	+	IGR	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr17:6920967G>C	ENST00000439424.2	+	0	850				RP11-589P10.7_ENST00000572547.1_RNA|MIR497HG_ENST00000385056.1_RNA|MIR497HG_ENST00000572453.1_RNA|MIR497HG_ENST00000385194.1_RNA|MIR497HG_ENST00000443997.1_RNA	NM_001142798.2|NM_174893.3	NP_001136270.1|NP_777553.1	Q8IXM2	BAP18_HUMAN	chromosome 17 open reading frame 49						chromatin modification (GO:0016568)	MLL1 complex (GO:0071339)|NURF complex (GO:0016589)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|ovary(1)	4						AGCCAATATTGGCAGACTCGC	0.567																																																0			17											22.0	21.0	21.0					17																	6920967		1568	3582	5150	6861691	SO:0001628	intergenic_variant	0			AK055800	CCDS32542.1, CCDS45595.1, CCDS45596.1	17p13.1	2013-02-11			ENSG00000258315	ENSG00000258315			28737	protein-coding gene	gene with protein product	"""BPTF associated protein of 18 kDa"", ""human embryo lung cellular protein interacting with SARS-CoV nsp-10"""						Standard	NM_174893		Approved	MGC49942, BAP18, HEPIS		Q8IXM2	OTTHUMG00000170147		17.37:g.6920967G>C		Somatic		Capture	Illumina GAIIx	4	6861691	B4DIV3|C9J4G0|E9PB29	RNA	SNP	-	NULL	ENST00000439424.2	37	NULL	CCDS32542.1	17																																																																																			-	-		0.567	C17orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIRN195	protein_coding	OTTHUMT00000407666.1	G	NM_174893		6861691	-1	no_errors	ENST00000385194	ensembl	human	known	54_36p	rna	SNP	1.000	C
OR2D2	120776	genome.wustl.edu	37	11	6913259	6913259	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr11:6913259A>C	ENST00000299459.2	-	1	571	c.473T>G	c.(472-474)gTa>gGa	p.V158G		NM_003700.1	NP_003691.1	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D, member 2	158					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	18		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GGTGGTGTCTACCACAGACAC	0.502																																																0			11											124.0	93.0	104.0					11																	6913259		2201	4296	6497	6869835	SO:0001583	missense	120776			AB065824	CCDS31416.1	11p15.4	2012-08-09			ENSG00000166368	ENSG00000166368		"""GPCR / Class A : Olfactory receptors"""	8244	protein-coding gene	gene with protein product		608494		OR2D1		9787077	Standard	NM_003700		Approved	OR11-610, hg27	uc010rau.2	Q9H210	OTTHUMG00000165741	ENST00000299459.2:c.473T>G	11.37:g.6913259A>C	ENSP00000299459:p.Val158Gly	Somatic		Capture	Illumina GAIIx	4	6869835	B9EIL5|O95224|Q6IF28|Q8NGH4|Q96R52	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.V158G	ENST00000299459.2	37	c.473	CCDS31416.1	11	.	.	.	.	.	.	.	.	.	.	a	22.1	4.249239	0.80024	.	.	ENSG00000166368	ENST00000299459	T	0.38722	1.12	5.12	5.12	0.69794	GPCR, rhodopsin-like superfamily (1);	0.152816	0.30492	N	0.009505	T	0.49064	0.1535	N	0.21142	0.635	0.58432	D	0.999998	D	0.64830	0.994	D	0.69824	0.966	T	0.52510	-0.8566	10	0.66056	D	0.02	-19.968	13.2293	0.59933	1.0:0.0:0.0:0.0	.	158	Q9H210	OR2D2_HUMAN	G	158	ENSP00000299459:V158G	ENSP00000299459:V158G	V	-	2	0	OR2D2	6869835	0.002000	0.14202	0.996000	0.52242	0.984000	0.73092	2.038000	0.41184	2.291000	0.77112	0.524000	0.50904	GTA	-	superfamily_SSF81321,HMMPfam_7tm_1		0.502	OR2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2D2	protein_coding	OTTHUMT00000385986.1	A	NM_003700		6869835	-1	no_errors	NM_003700	genbank	human	provisional	54_36p	missense	SNP	0.968	C
CAMTA1	23261	genome.wustl.edu	37	1	7111498	7111498	+	Intron	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:7111498C>A	ENST00000303635.7	+	4	441				CAMTA1_ENST00000439411.2_Intron	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CCTGGAGCTGCGTGGGGTGGG	0.627			T	WWTR1	epitheliod hemangioendothelioma																																		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0			1																																								7034085	SO:0001627	intron_variant	0			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.235-39866C>A	1.37:g.7111498C>A		Somatic		Capture	Illumina GAIIx	4	7034085	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	NULL	p.T89	ENST00000303635.7	37	c.267	CCDS30576.1	1																																																																																			-	NULL		0.627	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC100129476	protein_coding	OTTHUMT00000003588.3	C	NM_015215		7034085	-1	no_errors	XM_001718470	genbank	human	model	54_36p	silent	SNP	0.000	A
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	17	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	7518937	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic		Capture	Illumina GAIIx	4	7518937	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7518937	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.380	A
DNAH2	146754	genome.wustl.edu	37	17	7623126	7623126	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr17:7623126C>T	ENST00000572933.1	+	2	1534	c.74C>T	c.(73-75)gCc>gTc	p.A25V	DNAH2_ENST00000082259.3_Missense_Mutation_p.A25V|DNAH2_ENST00000570791.1_Missense_Mutation_p.A25V|DNAH2_ENST00000389173.2_Missense_Mutation_p.A25V			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	25	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCAGGGCGGGCCACTCGGGCT	0.622																																																0			17											24.0	24.0	24.0					17																	7623126		2202	4298	6500	7563851	SO:0001583	missense	146754			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.74C>T	17.37:g.7623126C>T	ENSP00000458355:p.Ala25Val	Somatic		Capture	Illumina GAIIx	4	7563851	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	HMMPfam_DHC_N1,superfamily_Spectrin repeat,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.A25V	ENST00000572933.1	37	c.74	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829537	0.32329	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.41400	1.0;1.0	4.33	-8.04	0.01110	.	11.847000	0.00357	N	0.000025	T	0.17534	0.0421	N	0.08118	0	0.09310	N	1	B;B	0.13145	0.0;0.007	B;B	0.10450	0.0;0.005	T	0.08868	-1.0701	10	0.39692	T	0.17	.	0.9456	0.01365	0.2318:0.1852:0.343:0.2399	.	25;25	Q9P225;Q9P225-3	DYH2_HUMAN;.	V	25	ENSP00000373825:A25V;ENSP00000082259:A25V	ENSP00000082259:A25V	A	+	2	0	DNAH2	7563851	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.255000	0.00538	-1.096000	0.03046	-1.108000	0.02087	GCC	-	NULL		0.622	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	protein_coding	OTTHUMT00000440241.1	C	NM_020877		7563851	+1	no_errors	NM_020877	genbank	human	validated	54_36p	missense	SNP	0.003	T
NRIP3	56675	genome.wustl.edu	37	11	9005441	9005441	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr11:9005441C>G	ENST00000309166.3	-	6	804	c.691G>C	c.(691-693)Gtc>Ctc	p.V231L	NRIP3_ENST00000531090.1_3'UTR	NM_020645.2	NP_065696.1	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3	231							aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|lung(4)|skin(1)|stomach(1)	7				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		TTCAAAGAGACTGTCTCCACA	0.468																																																0			11											168.0	157.0	161.0					11																	9005441		2201	4296	6497	8962017	SO:0001583	missense	56675			AJ400877	CCDS31422.1	11p15.3	2008-02-05	2003-09-03	2003-09-05	ENSG00000175352	ENSG00000175352			1167	protein-coding gene	gene with protein product		613125	"""chromosome 11 open reading frame 14"""	C11orf14		11528127	Standard	NM_020645		Approved		uc001mhg.2	Q9NQ35	OTTHUMG00000165680	ENST00000309166.3:c.691G>C	11.37:g.9005441C>G	ENSP00000310205:p.Val231Leu	Somatic		Capture	Illumina GAIIx	4	8962017	Q86WD9	Missense_Mutation	SNP	HMMPfam_Asp_protease,superfamily_Pept_Aspartic	p.V231L	ENST00000309166.3	37	c.691	CCDS31422.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.53|12.53	1.964914|1.964914	0.34659|0.34659	.|.	.|.	ENSG00000175352|ENSG00000175352	ENST00000534759|ENST00000309166;ENST00000531142	.|T	.|0.44881	.|0.91	5.92|5.92	-0.633|-0.633	0.11519|0.11519	.|.	.|0.688144	.|0.15049	.|N	.|0.283430	T|T	0.21962|0.21962	0.0529|0.0529	L|L	0.32530|0.32530	0.975|0.975	0.27449|0.27449	N|N	0.953485|0.953485	.|B	.|0.16166	.|0.016	.|B	.|0.15052	.|0.012	T|T	0.19778|0.19778	-1.0295|-1.0295	5|10	.|0.13853	.|T	.|0.58	.|.	1.6245|1.6245	0.02720|0.02720	0.1375:0.3813:0.1207:0.3605|0.1375:0.3813:0.1207:0.3605	.|.	.|231	.|Q9NQ35	.|NRIP3_HUMAN	H|L	36|231;59	.|ENSP00000310205:V231L	.|ENSP00000310205:V231L	Q|V	-|-	3|1	2|0	NRIP3|NRIP3	8962017|8962017	0.028000|0.028000	0.19301|0.19301	0.823000|0.823000	0.32752|0.32752	0.897000|0.897000	0.52465|0.52465	-0.157000|-0.157000	0.10085|0.10085	-0.374000|-0.374000	0.07967|0.07967	-0.284000|-0.284000	0.09977|0.09977	CAG|GTC	-	NULL		0.468	NRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRIP3	protein_coding	OTTHUMT00000385774.1	C	NM_020645		8962017	-1	no_errors	NM_020645	genbank	human	validated	54_36p	missense	SNP	0.273	G
PHACTR1	221692	genome.wustl.edu	37	6	13185108	13185108	+	Silent	SNP	C	C	T	rs541413328		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr6:13185108C>T	ENST00000379345.2	+	5	548	c.307C>T	c.(307-309)Ctg>Ttg	p.L103L	PHACTR1_ENST00000379350.1_Intron|PHACTR1_ENST00000332995.7_Intron|PHACTR1_ENST00000457702.2_Intron			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	42					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			AGTCCTGCTACTGCCCCCCAA	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		18788	0.0		0.001	False		,,,				2504	0.0															0			6											153.0	148.0	149.0					6																	13185108		876	1991	2867	13293087	SO:0001819	synonymous_variant	221692			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379345.2:c.307C>T	6.37:g.13185108C>T		Somatic		Capture	Illumina GAIIx	4	13293087	A8K1V2|Q3MJ93|Q5JSJ2	Silent	SNP	HMMPfam_RPEL,HMMSmart_SM00707	p.L156	ENST00000379345.2	37	c.466		6																																																																																			-	NULL		0.582	PHACTR1-202	KNOWN	basic|appris_candidate	protein_coding	PHACTR1	protein_coding		C	XM_166420		13293087	+1	no_errors	ENST00000379345	ensembl	human	known	54_36p	silent	SNP	1.000	T
ITGA8	8516	genome.wustl.edu	37	10	15634228	15634228	+	Nonsense_Mutation	SNP	T	T	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr10:15634228T>A	ENST00000378076.3	-	22	2640	c.2287A>T	c.(2287-2289)Aga>Tga	p.R763*		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	763					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TCTAACCTTCTGATTTGGAGA	0.393																																																0			10											138.0	122.0	127.0					10																	15634228		2203	4300	6503	15674234	SO:0001587	stop_gained	8516			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2287A>T	10.37:g.15634228T>A	ENSP00000367316:p.Arg763*	Somatic		Capture	Illumina GAIIx	4	15674234	B0YJ31|Q5VX94	Nonsense_Mutation	SNP	superfamily_SSF69318,HMMSmart_Int_alpha,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_SSF69179,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.R763*	ENST00000378076.3	37	c.2287	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	T	44	11.047667	0.99508	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	.	.	.	5.48	4.32	0.51571	.	0.258372	0.48286	D	0.000196	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	.	11.2107	0.48797	0.0:0.0:0.1537:0.8463	.	.	.	.	X	763;748	.	ENSP00000367316:R763X	R	-	1	2	ITGA8	15674234	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.006000	0.63978	0.981000	0.38548	0.482000	0.46254	AGA	-	HMMPfam_Integrin_alpha2,superfamily_SSF69179		0.393	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	protein_coding	OTTHUMT00000046987.1	T	NM_003638		15674234	-1	no_errors	NM_003638	genbank	human	provisional	54_36p	nonsense	SNP	1.000	A
PRDM9	56979	genome.wustl.edu	37	5	23527052	23527052	+	Missense_Mutation	SNP	C	C	T	rs111393391		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr5:23527052C>T	ENST00000296682.3	+	11	2037	c.1855C>T	c.(1855-1857)Cgg>Tgg	p.R619W		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	619					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.R619W(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGGCTTTAGCCGGCAGTCAGT	0.622										HNSCC(3;0.000094)																																						1	Substitution - Missense(1)	large_intestine(1)	5											24.0	25.0	24.0					5																	23527052		1631	3494	5125	23562809	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1855C>T	5.37:g.23527052C>T	ENSP00000296682:p.Arg619Trp	Somatic		Capture	Illumina GAIIx	4	23562809	B4DX22|Q27Q50	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMSmart_KRAB,HMMPfam_KRAB,HMMPfam_SSXRD,superfamily_SSF82199,HMMSmart_SET,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667,HMMPfam_zf-C2H2	p.R619W	ENST00000296682.3	37	c.1855	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	c	0.010	-1.750750	0.00663	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.36520	1.25	1.89	-3.45	0.04781	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	153.359000	0.00166	N	0.000000	T	0.35364	0.0929	L	0.60957	1.885	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.24728	-1.0152	10	0.37606	T	0.19	.	9.0349	0.36282	0.1506:0.2553:0.5941:0.0	.	619	Q9NQV7	PRDM9_HUMAN	W	619;385	ENSP00000296682:R619W	ENSP00000253473:R385W	R	+	1	2	PRDM9	23562809	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.201000	0.00560	-1.195000	0.02680	-5.417000	0.00001	CGG	-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.622	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	protein_coding	OTTHUMT00000366375.1	C	NM_020227		23562809	+1	no_errors	NM_020227	genbank	human	provisional	54_36p	missense	SNP	0.000	T
ADCY3	109	genome.wustl.edu	37	2	25045456	25045456	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:25045456G>A	ENST00000260600.5	-	18	3778	c.2927C>T	c.(2926-2928)aCc>aTc	p.T976I	ADCY3_ENST00000405392.1_Missense_Mutation_p.T563I	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	976					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GCTGCCAATGGTTTTGATCTT	0.527																																																0			2											139.0	119.0	126.0					2																	25045456		2203	4300	6503	24898960	SO:0001583	missense	109			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.2927C>T	2.37:g.25045456G>A	ENSP00000260600:p.Thr976Ile	Somatic		Capture	Illumina GAIIx	4	24898960	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	HMMSmart_CYCc,superfamily_A/G_cyclase,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.T976I	ENST00000260600.5	37	c.2927	CCDS1715.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.217845	0.95104	.	.	ENSG00000138031	ENST00000260600;ENST00000405392;ENST00000415879	T;T	0.34667	1.35;1.35	5.55	5.55	0.83447	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.68366	0.2993	M	0.88181	2.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.962	D;D;P	0.97110	1.0;1.0;0.884	T	0.73375	-0.4002	10	0.87932	D	0	.	19.2909	0.94098	0.0:0.0:1.0:0.0	.	977;976;563	B7ZLX9;O60266;B3KT86	.;ADCY3_HUMAN;.	I	976;563;951	ENSP00000260600:T976I;ENSP00000384484:T563I	ENSP00000260600:T976I	T	-	2	0	ADCY3	24898960	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.555000	0.98123	2.894000	0.99253	0.655000	0.94253	ACC	-	HMMSmart_CYCc,HMMPfam_Guanylate_cyc,superfamily_A/G_cyclase		0.527	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY3	protein_coding	OTTHUMT00000211574.2	G			24898960	-1	no_errors	NM_004036	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GAD2	2572	genome.wustl.edu	37	10	26575274	26575274	+	Splice_Site	SNP	G	G	T	rs185111133	byFrequency	TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr10:26575274G>T	ENST00000376261.3	+	13	1740	c.1237G>T	c.(1237-1239)Gga>Tga	p.G413*	GAD2_ENST00000259271.3_Splice_Site_p.G413*	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	413					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TCTCTTGTAGGGATTGATGCA	0.348																																																0			10											98.0	88.0	91.0					10																	26575274		2203	4300	6503	26615280	SO:0001630	splice_region_variant	2572			AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.1237-1G>T	10.37:g.26575274G>T		Somatic		Capture	Illumina GAIIx	4	26615280	Q9UD87	Nonsense_Mutation	SNP	superfamily_PLP-dependent transferases,HMMPfam_Pyridoxal_deC,PatternScan_DDC_GAD_HDC_YDC	p.G413*	ENST00000376261.3	37	c.1237	CCDS7149.1	10	.	.	.	.	.	.	.	.	.	.	G	38	6.893681	0.97916	.	.	ENSG00000136750	ENST00000376261;ENST00000259271	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.948	18.27	0.90065	0.0:0.0:1.0:0.0	.	.	.	.	X	413	.	.	G	+	1	0	GAD2	26615280	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	9.438000	0.97539	2.306000	0.77630	0.655000	0.94253	GGA	-	superfamily_PLP-dependent transferases,HMMPfam_Pyridoxal_deC		0.348	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	GAD2	protein_coding	OTTHUMT00000047255.1	G	NM_000818	Nonsense_Mutation	26615280	+1	no_errors	NM_000818	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
IL1RAPL1	11141	genome.wustl.edu	37	X	29935617	29935617	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chrX:29935617G>C	ENST00000378993.1	+	7	1488	c.815G>C	c.(814-816)gGg>gCg	p.G272A	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.G272A	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	272	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						GCTTTCTTTGGGTACAGCGGA	0.368																																																0			X											56.0	52.0	53.0					X																	29935617		2202	4300	6502	29845538	SO:0001583	missense	11141			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.815G>C	X.37:g.29935617G>C	ENSP00000368278:p.Gly272Ala	Somatic		Capture	Illumina GAIIx	4	29845538	A0AVG4|Q9UJ53	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.G272A	ENST00000378993.1	37	c.815	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	G	23.7	4.441642	0.83993	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.05786	3.39;3.39	5.97	5.97	0.96955	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.28699	0.0711	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00385	-1.1773	9	.	.	.	.	19.371	0.94484	0.0:0.0:1.0:0.0	.	272	Q9NZN1	IRPL1_HUMAN	A	272	ENSP00000368278:G272A;ENSP00000305200:G272A	.	G	+	2	0	IL1RAPL1	29845538	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.431000	0.97494	2.527000	0.85204	0.600000	0.82982	GGG	-	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig		0.368	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	protein_coding	OTTHUMT00000056155.1	G	NM_014271		29845538	+1	no_errors	NM_014271	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
BRCA2	675	genome.wustl.edu	37	13	32950890	32950890	+	Nonsense_Mutation	SNP	G	G	T	rs397508003|rs80359726		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr13:32950890G>T	ENST00000380152.3	+	21	8949	c.8716G>T	c.(8716-8718)Gaa>Taa	p.E2906*	BRCA2_ENST00000544455.1_Nonsense_Mutation_p.E2906*			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2906					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AGAGCTTTATGAAGCAGTGAA	0.403			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0			13											100.0	90.0	93.0					13																	32950890		2203	4300	6503	31848890	SO:0001587	stop_gained	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.8716G>T	13.37:g.32950890G>T	ENSP00000369497:p.Glu2906*	Somatic		Capture	Illumina GAIIx	4	31848890	O00183|O15008|Q13879|Q5TBJ7	Nonsense_Mutation	SNP	HMMPfam_BRCA2,superfamily_BRCA2_helical,HMMPfam_BRCA-2_helical,superfamily_Nucleic_acid_OB,HMMPfam_BRCA-2_OB1,HMMPfam_Tower,superfamily_SSF81878,HMMPfam_BRCA-2_OB3	p.E2906*	ENST00000380152.3	37	c.8716	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	G	51	18.316770	0.99903	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	5.32	4.48	0.54585	.	0.051661	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	13.9278	0.63972	0.0734:0.0:0.9266:0.0	.	.	.	.	X	2906	.	ENSP00000369497:E2906X	E	+	1	0	BRCA2	31848890	1.000000	0.71417	0.884000	0.34674	0.972000	0.66771	7.923000	0.87546	1.230000	0.43646	0.655000	0.94253	GAA	-	superfamily_Nucleic_acid_OB,superfamily_SSF81878		0.403	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	protein_coding	OTTHUMT00000046000.2	G	NM_000059		31848890	+1	no_errors	NM_000059	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	32536137	32536137	+	Silent	SNP	T	T	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chrX:32536137T>C	ENST00000357033.4	-	18	2486	c.2280A>G	c.(2278-2280)aaA>aaG	p.K760K	DMD_ENST00000378677.2_Silent_p.K756K|DMD_ENST00000288447.4_Silent_p.K752K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	760					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGACTTTTTCTTTTAAGTCTG	0.368																																																0			X											67.0	61.0	63.0					X																	32536137		2202	4300	6502	32446058	SO:0001819	synonymous_variant	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2280A>G	X.37:g.32536137T>C		Somatic		Capture	Illumina GAIIx	4	32446058	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,HMMPfam_Spectrin,superfamily_Spectrin repeat,HMMSmart_SM00150,superfamily_t-snare proteins,superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_EF-hand,HMMPfam_efhand_1,HMMPfam_efhand_2,HMMPfam_ZZ,HMMSmart_SM00291,PatternScan_ZF_ZZ_1,superfamily_Prefoldin	p.K760	ENST00000357033.4	37	c.2280	CCDS14233.1	X																																																																																			-	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	T	NM_004006		32446058	-1	no_errors	NM_004006	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
SYT10	341359	genome.wustl.edu	37	12	33579107	33579107	+	Nonsense_Mutation	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr12:33579107G>A	ENST00000228567.3	-	2	771	c.475C>T	c.(475-477)Caa>Taa	p.Q159*	SYT10_ENST00000567656.1_5'Flank|SYT10_ENST00000535526.1_5'UTR	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	159					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					ATTTGTCTTTGCACACGTGCA	0.413																																																0			12											186.0	194.0	191.0					12																	33579107		2203	4300	6503	33470374	SO:0001587	stop_gained	341359			AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.475C>T	12.37:g.33579107G>A	ENSP00000228567:p.Gln159*	Somatic		Capture	Illumina GAIIx	4	33470374	Q495U2	Nonsense_Mutation	SNP	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.Q159*	ENST00000228567.3	37	c.475	CCDS8732.1	12	.	.	.	.	.	.	.	.	.	.	G	41	8.820291	0.98966	.	.	ENSG00000110975	ENST00000228567	.	.	.	3.78	3.78	0.43462	.	0.000000	0.39615	U	0.001310	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	15.8987	0.79356	0.0:0.0:1.0:0.0	.	.	.	.	X	159	.	ENSP00000228567:Q159X	Q	-	1	0	SYT10	33470374	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.728000	0.74769	2.390000	0.81377	0.655000	0.94253	CAA	-	NULL		0.413	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYT10	protein_coding	OTTHUMT00000403222.1	G	NM_198992		33470374	-1	no_errors	NM_198992	genbank	human	provisional	54_36p	nonsense	SNP	1.000	A
CXorf22	170063	genome.wustl.edu	37	X	35985745	35985745	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chrX:35985745C>A	ENST00000297866.5	+	10	1676	c.1610C>A	c.(1609-1611)cCt>cAt	p.P537H		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	537										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						GGTATATTGCCTTCGATCCGT	0.333																																																0			X											78.0	68.0	72.0					X																	35985745		2202	4299	6501	35895666	SO:0001583	missense	170063			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.1610C>A	X.37:g.35985745C>A	ENSP00000297866:p.Pro537His	Somatic		Capture	Illumina GAIIx	4	35895666	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	NULL	p.P537H	ENST00000297866.5	37	c.1610	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	C	10.58	1.390804	0.25118	.	.	ENSG00000165164	ENST00000297866	T	0.37411	1.2	4.89	4.03	0.46877	.	0.058966	0.64402	D	0.000002	T	0.56834	0.2012	M	0.75264	2.295	0.25126	N	0.990605	D	0.89917	1.0	D	0.79784	0.993	T	0.50964	-0.8765	10	0.59425	D	0.04	-8.4957	10.5122	0.44868	0.0:0.9011:0.0:0.0989	.	537	Q6ZTR5	CX022_HUMAN	H	537	ENSP00000297866:P537H	ENSP00000297866:P537H	P	+	2	0	CXorf22	35895666	0.981000	0.34729	0.291000	0.24904	0.005000	0.04900	4.666000	0.61554	0.976000	0.38417	0.513000	0.50165	CCT	-	NULL		0.333	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	protein_coding	OTTHUMT00000056216.2	C	NM_152632		35895666	+1	no_errors	NM_152632	genbank	human	validated	54_36p	missense	SNP	0.990	A
Unknown	0	genome.wustl.edu	37	1	39175075	39175075	+	IGR	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:39175075G>C								RP11-329N22.1 (232919 upstream) : RRAGC (128794 downstream)																							AGGCTTATTTGGGAAAGGTTA	0.413																																																0			1																																								38947662	SO:0001628	intergenic_variant	0																															1.37:g.39175075G>C		Somatic		Capture	Illumina GAIIx	4	38947662		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.413					LOC400750			G			38947662	+1	pseudogene	XR_039444	genbank	human	model	54_36p	rna	SNP	1.000	C
KLB	152831	genome.wustl.edu	37	4	39435960	39435960	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr4:39435960G>A	ENST00000257408.4	+	2	1053	c.956G>A	c.(955-957)tGt>tAt	p.C319Y		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	319	Glycosyl hydrolase-1 1.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						ATATTCAAATGTCAACAATCC	0.473																																																0			4											129.0	115.0	120.0					4																	39435960		2203	4300	6503	39112355	SO:0001583	missense	152831			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.956G>A	4.37:g.39435960G>A	ENSP00000257408:p.Cys319Tyr	Somatic		Capture	Illumina GAIIx	4	39112355	Q2M3K8	Missense_Mutation	SNP	PatternScan_GLYCOSYL_HYDROL_F1_1,PatternScan_GLYCOSYL_HYDROL_F1_2,HMMPfam_Glyco_hydro_1,superfamily_Glyco_hydro_cat	p.C319Y	ENST00000257408.4	37	c.956	CCDS3451.1	4	.	.	.	.	.	.	.	.	.	.	G	17.14	3.314282	0.60414	.	.	ENSG00000134962	ENST00000257408	T	0.28895	1.59	6.17	6.17	0.99709	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61299	0.2336	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60964	-0.7158	10	0.87932	D	0	-34.6854	20.8794	0.99867	0.0:0.0:1.0:0.0	.	319;319	B7ZL50;Q86Z14	.;KLOTB_HUMAN	Y	319	ENSP00000257408:C319Y	ENSP00000257408:C319Y	C	+	2	0	KLB	39112355	1.000000	0.71417	0.998000	0.56505	0.058000	0.15608	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	TGT	-	HMMPfam_Glyco_hydro_1,superfamily_Glyco_hydro_cat		0.473	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	protein_coding	OTTHUMT00000250429.1	G	NM_175737		39112355	+1	no_errors	NM_175737	genbank	human	validated	54_36p	missense	SNP	1.000	A
XIRP1	165904	genome.wustl.edu	37	3	39227280	39227280	+	Silent	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr3:39227280G>A	ENST00000340369.3	-	2	3885	c.3657C>T	c.(3655-3657)ctC>ctT	p.L1219L	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1219					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CTGCAGCTTGGAGGCCCCCTG	0.677																																																0			3											29.0	33.0	31.0					3																	39227280		2203	4300	6503	39202284	SO:0001819	synonymous_variant	165904			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.3657C>T	3.37:g.39227280G>A		Somatic		Capture	Illumina GAIIx	4	39202284	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Silent	SNP	HMMPfam_Xin	p.L1219	ENST00000340369.3	37	c.3657	CCDS2683.1	3																																																																																			-	NULL		0.677	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	protein_coding	OTTHUMT00000254065.1	G	XM_093522		39202284	-1	no_errors	NM_194293	genbank	human	provisional	54_36p	silent	SNP	0.834	A
CCR8	1237	genome.wustl.edu	37	3	39374805	39374805	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr3:39374805G>A	ENST00000326306.4	+	2	1121	c.983G>A	c.(982-984)aGa>aAa	p.R328K	CCR8_ENST00000545843.1_Missense_Mutation_p.R245K|CCR8_ENST00000414803.1_3'UTR	NM_005201.3	NP_005192.1	P51685	CCR8_HUMAN	chemokine (C-C motif) receptor 8	328					cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)			NS(3)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0504)|Kidney(284;0.0635)		TACCTAGGAAGACAAATGCCT	0.443																																																0			3											61.0	67.0	65.0					3																	39374805		2203	4300	6503	39349809	SO:0001583	missense	1237			D49919	CCDS2684.1	3p22	2012-08-08			ENSG00000179934	ENSG00000179934		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1609	protein-coding gene	gene with protein product		601834		CMKBRL2, CMKBR8		8816377, 8886020	Standard	NM_005201		Approved	CY6, TER1, CKR-L1, GPR-CY6, CDw198	uc010hhr.2	P51685	OTTHUMG00000131290	ENST00000326306.4:c.983G>A	3.37:g.39374805G>A	ENSP00000326432:p.Arg328Lys	Somatic		Capture	Illumina GAIIx	4	39349809	B2RC64|Q3KNQ8|Q3KNR3|Q9BYX5	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R328K	ENST00000326306.4	37	c.983	CCDS2684.1	3	.	.	.	.	.	.	.	.	.	.	G	2.855	-0.237479	0.05944	.	.	ENSG00000179934	ENST00000326306;ENST00000545843	T;T	0.66815	1.21;-0.23	4.35	1.19	0.21007	.	0.441289	0.19469	N	0.113506	T	0.53834	0.1821	L	0.43152	1.355	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.50021	-0.8876	10	0.59425	D	0.04	.	7.7676	0.28988	0.33:0.0:0.67:0.0	.	328;245	P51685;Q3KNR3	CCR8_HUMAN;.	K	328;245	ENSP00000326432:R328K;ENSP00000440474:R245K	ENSP00000326432:R328K	R	+	2	0	CCR8	39349809	0.000000	0.05858	0.002000	0.10522	0.339000	0.28857	0.095000	0.15127	0.363000	0.24346	0.591000	0.81541	AGA	-	superfamily_Family A G protein-coupled receptor-like		0.443	CCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR8	protein_coding	OTTHUMT00000254058.2	G	NM_005201		39349809	+1	no_errors	NM_005201	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
INTS6P1	285634	genome.wustl.edu	37	5	39719575	39719575	+	IGR	SNP	C	C	T	rs150070088	byFrequency	TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr5:39719575C>T								CTD-2078B5.2 (194765 upstream) : LINC00603 (332817 downstream)																							TAATGTCTGACGAAAGTTGGT	0.388													T|||	60	0.0119808	0.0408	0.0043	5008	,	,		20659	0.002		0.0	False		,,,				2504	0.001															0			5																																								39755332	SO:0001628	intergenic_variant	285634																															5.37:g.39719575C>T		Somatic		Capture	Illumina GAIIx	4	39755332		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.388					LOC285634			C			39755332	-1	pseudogene	XR_017261	genbank	human	model	54_36p	rna	SNP	0.989	T
SNRK	54861	genome.wustl.edu	37	3	43389559	43389559	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr3:43389559C>A	ENST00000296088.7	+	7	2112	c.1808C>A	c.(1807-1809)gCt>gAt	p.A603D	SNRK-AS1_ENST00000422681.1_RNA|RP11-188P20.3_ENST00000607513.1_RNA|SNRK_ENST00000454177.1_Missense_Mutation_p.A603D|SNRK_ENST00000429705.2_Missense_Mutation_p.A603D|SNRK_ENST00000437827.1_Missense_Mutation_p.A397D	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		GAGAACAATGCTGGTGGGGGC	0.682																																																0			3											17.0	21.0	20.0					3																	43389559		1936	4131	6067	43364563	SO:0001583	missense	54861			D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1808C>A	3.37:g.43389559C>A	ENSP00000296088:p.Ala603Asp	Somatic		Capture	Illumina GAIIx	4	43364563		Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.A603D	ENST00000296088.7	37	c.1808	CCDS43075.1	3	.	.	.	.	.	.	.	.	.	.	C	12.72	2.021762	0.35701	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088;ENST00000437827	T;T;T;T	0.64085	-0.08;-0.08;-0.08;2.84	4.97	3.96	0.45880	.	0.619767	0.17301	N	0.179258	T	0.45577	0.1349	L	0.29908	0.895	0.09310	N	1	B	0.14438	0.01	B	0.12156	0.007	T	0.15780	-1.0425	10	0.12430	T	0.62	.	10.585	0.45278	0.4226:0.5774:0.0:0.0	.	603	Q9NRH2	SNRK_HUMAN	D	603;603;603;397	ENSP00000401246:A603D;ENSP00000411375:A603D;ENSP00000296088:A603D;ENSP00000409516:A397D	ENSP00000296088:A603D	A	+	2	0	SNRK	43364563	0.018000	0.18449	0.177000	0.23020	0.977000	0.68977	2.748000	0.47483	2.476000	0.83614	0.557000	0.71058	GCT	-	NULL		0.682	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRK	protein_coding	OTTHUMT00000344325.1	C	NM_017719		43364563	+1	no_errors	NM_001100594	genbank	human	validated	54_36p	missense	SNP	0.076	A
ATRIP	84126	genome.wustl.edu	37	3	48501765	48501765	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr3:48501765G>C	ENST00000320211.3	+	8	1425	c.1312G>C	c.(1312-1314)Gca>Cca	p.A438P	ATRIP_ENST00000346691.4_Missense_Mutation_p.A438P|ATRIP_ENST00000357105.6_Missense_Mutation_p.A311P|ATRIP_ENST00000412052.1_Missense_Mutation_p.A345P	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	438					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCAGGACTTGGCAGCTGCTAA	0.592								Other conserved DNA damage response genes																																								0			3											78.0	78.0	78.0					3																	48501765		2203	4300	6503	48476769	SO:0001583	missense	84126			AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.1312G>C	3.37:g.48501765G>C	ENSP00000323099:p.Ala438Pro	Somatic		Capture	Illumina GAIIx	4	48476769	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Missense_Mutation	SNP	NULL	p.A438P	ENST00000320211.3	37	c.1312	CCDS2768.1	3	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098924	0.56183	.	.	ENSG00000164053	ENST00000320211;ENST00000346691;ENST00000357105;ENST00000412052	T;T;T;T	0.48201	1.39;1.39;0.82;1.4	5.55	4.66	0.58398	.	0.510022	0.22842	N	0.054973	T	0.60431	0.2268	L	0.60455	1.87	0.09310	N	1	D;D	0.67145	0.996;0.996	D;D	0.64410	0.925;0.925	T	0.53165	-0.8477	9	.	.	.	-5.0599	11.0477	0.47867	0.0874:0.0:0.9126:0.0	.	438;438	Q8WXE1-2;Q8WXE1	.;ATRIP_HUMAN	P	438;438;311;345	ENSP00000323099:A438P;ENSP00000302338:A438P;ENSP00000349620:A311P;ENSP00000400930:A345P	.	A	+	1	0	ATRIP	48476769	0.002000	0.14202	0.240000	0.24138	0.692000	0.40212	1.146000	0.31589	1.449000	0.47699	0.655000	0.94253	GCA	-	NULL		0.592	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRIP	protein_coding	OTTHUMT00000257507.2	G	NM_130384		48476769	+1	no_errors	NM_130384	genbank	human	reviewed	54_36p	missense	SNP	0.043	C
SERPINE3	647174	genome.wustl.edu	37	13	51918552	51918552	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr13:51918552C>A	ENST00000521255.1	+	2	481	c.421C>A	c.(421-423)Cca>Aca	p.P141T	SERPINE3_ENST00000400389.4_Missense_Mutation_p.P141T|SERPINE3_ENST00000524365.1_Missense_Mutation_p.P141T	NM_001101320.1	NP_001094790.1	A8MV23	SERP3_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3	141					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(2)	2						CAGCCTGGAACCAGCCGACCT	0.567																																																0			13											38.0	40.0	39.0					13																	51918552		2037	4187	6224	50816553	SO:0001583	missense	0			AX772926	CCDS53870.1	13q14.3	2014-02-18			ENSG00000253309	ENSG00000253309		"""Serine (or cysteine) peptidase inhibitors"""	24774	protein-coding gene	gene with protein product						24172014	Standard	NM_001101320		Approved		uc001vfh.2	A8MV23	OTTHUMG00000016943	ENST00000521255.1:c.421C>A	13.37:g.51918552C>A	ENSP00000428316:p.Pro141Thr	Somatic		Capture	Illumina GAIIx	4	50816553	B1V8P3	Missense_Mutation	SNP	superfamily_Serpins,HMMPfam_Serpin,HMMSmart_SM00093,PatternScan_SERPIN	p.P141T	ENST00000521255.1	37	c.421	CCDS53870.1	13	.	.	.	.	.	.	.	.	.	.	C	0.346	-0.947594	0.02304	.	.	ENSG00000253309	ENST00000524365;ENST00000521255;ENST00000400389	D;D;D	0.84298	-1.83;-1.83;-1.83	4.88	0.704	0.18121	Serpin domain (3);	1.271190	0.06476	N	0.731988	T	0.78097	0.4230	L	0.31476	0.935	0.09310	N	1	B;B	0.17465	0.022;0.013	B;B	0.12837	0.004;0.008	T	0.63611	-0.6598	10	0.46703	T	0.11	.	10.5664	0.45175	0.2399:0.5455:0.2146:0.0	.	141;141	A8MV23-2;A8MV23	.;SERP3_HUMAN	T	141	ENSP00000430755:P141T;ENSP00000428316:P141T;ENSP00000441468:P141T	ENSP00000441468:P141T	P	+	1	0	SERPINE3	50816553	0.197000	0.23362	0.565000	0.28409	0.862000	0.49288	0.365000	0.20348	0.241000	0.21283	0.655000	0.94253	CCA	-	superfamily_Serpins,HMMPfam_Serpin,HMMSmart_SM00093		0.567	SERPINE3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SERPINE3	protein_coding	OTTHUMT00000045021.2	C	NM_001101320		50816553	+1	no_errors	NM_001101320	genbank	human	validated	54_36p	missense	SNP	0.388	A
Unknown	0	genome.wustl.edu	37	7	56358360	56358360	+	IGR	SNP	T	T	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr7:56358360T>C								AC073136.1 (20816 upstream) : RNU6-1335P (49563 downstream)																							GTACTTTCCTTCATCGAATGG	0.463																																																0			7																																								56325854	SO:0001628	intergenic_variant	441228																															7.37:g.56358360T>C		Somatic		Capture	Illumina GAIIx	4	56325854		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.463					LOC441228			T			56325854	+1	no_errors	XR_016387	genbank	human	model	54_36p	rna	SNP	1.000	C
ZNF552	79818	genome.wustl.edu	37	19	58319667	58319667	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr19:58319667C>G	ENST00000391701.1	-	3	1134	c.965G>C	c.(964-966)aGg>aCg	p.R322T	ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000599802.1_Intron	NM_024762.3	NP_079038.2	Q9H707	ZN552_HUMAN	zinc finger protein 552	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		TTCATATGGCCTTTCTCCAGT	0.443																																																0			19											93.0	86.0	89.0					19																	58319667		2203	4300	6503	63011479	SO:0001583	missense	79818			AK097041	CCDS12963.1	19q13.43	2013-09-20			ENSG00000178935	ENSG00000178935		"""Zinc fingers, C2H2-type"", ""-"""	26135	protein-coding gene	gene with protein product							Standard	XM_005259267		Approved	FLJ21603	uc002qqg.3	Q9H707	OTTHUMG00000183478	ENST00000391701.1:c.965G>C	19.37:g.58319667C>G	ENSP00000375582:p.Arg322Thr	Somatic		Capture	Illumina GAIIx	4	63011479	B3KUE9|Q6P5A6	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.R322T	ENST00000391701.1	37	c.965	CCDS12963.1	19	.	.	.	.	.	.	.	.	.	.	C	15.76	2.928600	0.52759	.	.	ENSG00000178935	ENST00000391701	T	0.17854	2.25	1.74	-2.43	0.06522	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31670	0.0804	M	0.73372	2.23	0.25182	N	0.990195	P;D	0.60575	0.761;0.988	B;D	0.64877	0.419;0.93	T	0.16541	-1.0399	9	0.87932	D	0	.	6.2029	0.20585	0.0:0.3052:0.0:0.6948	.	318;322	B7Z1H1;Q9H707	.;ZN552_HUMAN	T	322	ENSP00000375582:R322T	ENSP00000375582:R322T	R	-	2	0	ZNF552	63011479	0.005000	0.15991	0.121000	0.21740	0.516000	0.34256	0.050000	0.14120	-0.391000	0.07763	0.205000	0.17691	AGG	-	superfamily_C2H2 and C2HC zinc fingers		0.443	ZNF552-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF552	protein_coding	OTTHUMT00000466829.1	C	NM_024762		63011479	-1	no_errors	NM_024762	genbank	human	validated	54_36p	missense	SNP	0.773	G
ZNF418	147686	genome.wustl.edu	37	19	58439072	58439072	+	Silent	SNP	A	A	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr19:58439072A>T	ENST00000396147.1	-	4	768	c.477T>A	c.(475-477)tcT>tcA	p.S159S	ZNF418_ENST00000595830.1_Silent_p.S159S|ZNF418_ENST00000599852.1_Silent_p.S74S|ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000425570.3_Silent_p.S180S	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		GAATGAAGATAGATGACTCCT	0.478																																																0			19											124.0	128.0	127.0					19																	58439072		2188	4294	6482	63130884	SO:0001819	synonymous_variant	147686			AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.477T>A	19.37:g.58439072A>T		Somatic		Capture	Illumina GAIIx	4	63130884	Q2M1S2|Q670L5|Q96N18	Silent	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667,HMMPfam_zf-C2H2	p.S159	ENST00000396147.1	37	c.477	CCDS42642.1	19																																																																																			-	NULL		0.478	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZNF418	protein_coding	OTTHUMT00000466693.1	A	NM_133460		63130884	-1	no_errors	NM_133460	genbank	human	provisional	54_36p	silent	SNP	0.000	T
ATG2A	23130	genome.wustl.edu	37	11	64677175	64677175	+	Silent	SNP	T	T	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr11:64677175T>C	ENST00000377264.3	-	14	2197	c.2085A>G	c.(2083-2085)gaA>gaG	p.E695E	ATG2A_ENST00000421419.2_Silent_p.E695E	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	695					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						AGCAGGTGAGTTCCAGGTGGG	0.647																																																0			11											52.0	60.0	57.0					11																	64677175		2201	4297	6498	64433751	SO:0001819	synonymous_variant	23130				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.2085A>G	11.37:g.64677175T>C		Somatic		Capture	Illumina GAIIx	4	64433751	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Silent	SNP	PatternScan_OX2_COVAL_FAD,HMMPfam_ATG_C,PatternScan_ADH_ZINC	p.E695	ENST00000377264.3	37	c.2085	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	T	5.664	0.307139	0.10733	.	.	ENSG00000110046	ENST00000418259	.	.	.	4.28	-1.84	0.07809	.	.	.	.	.	T	0.54143	0.1840	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50136	-0.8863	4	.	.	.	.	9.1378	0.36886	0.0:0.603:0.0:0.397	.	.	.	.	A	497	.	.	T	-	1	0	ATG2A	64433751	0.999000	0.42202	0.995000	0.50966	0.569000	0.35902	0.584000	0.23864	-0.229000	0.09854	0.459000	0.35465	ACT	-	NULL		0.647	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	protein_coding	OTTHUMT00000143224.1	T	NM_015104		64433751	-1	no_errors	NM_015104	genbank	human	provisional	54_36p	silent	SNP	1.000	C
VPS51	738	genome.wustl.edu	37	11	64877957	64877957	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr11:64877957G>C	ENST00000279281.3	+	8	1974	c.1882G>C	c.(1882-1884)Ggg>Cgg	p.G628R	TM7SF2_ENST00000540748.1_5'Flank|VPS51_ENST00000527646.1_3'UTR|AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000279263.7_5'Flank|TM7SF2_ENST00000345348.5_5'Flank	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	628					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CCACCAGGTGGGGCTCCTGTA	0.597											OREG0021071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			11											97.0	105.0	102.0					11																	64877957		2201	4297	6498	64634533	SO:0001583	missense	738			AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.1882G>C	11.37:g.64877957G>C	ENSP00000279281:p.Gly628Arg	Somatic	1079	Capture	Illumina GAIIx	4	64634533	Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Missense_Mutation	SNP	HMMPfam_Vps51	p.G628R	ENST00000279281.3	37	c.1882	CCDS8093.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.602636|4.602636	0.87157|0.87157	.|.	.|.	ENSG00000149823|ENSG00000149823	ENST00000279281;ENST00000530673|ENST00000526856	.|.	.|.	.|.	4.79|4.79	4.79|4.79	0.61399|0.61399	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77765|0.77765	0.4179|0.4179	M|M	0.82517|0.82517	2.595|2.595	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.75484|.	0.986|.	T|T	0.79546|0.79546	-0.1759|-0.1759	9|5	0.62326|.	D|.	0.03|.	-1.8534|-1.8534	15.712|15.712	0.77635|0.77635	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	628|.	Q9UID3|.	FFR_HUMAN|.	R|C	628;2|125	.|.	ENSP00000279281:G628R|.	G|W	+|+	1|3	0|0	C11orf2|C11orf2	64634533|64634533	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.662000|0.662000	0.39071|0.39071	7.521000|7.521000	0.81832|0.81832	2.651000|2.651000	0.90000|0.90000	0.491000|0.491000	0.48974|0.48974	GGG|TGG	-	NULL		0.597	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf2	protein_coding	OTTHUMT00000385217.1	G	NM_013265		64634533	+1	no_errors	NM_013265	genbank	human	provisional	54_36p	missense	SNP	1.000	C
PIK3R1	5295	genome.wustl.edu	37	5	67591102	67591102	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr5:67591102C>A	ENST00000521381.1	+	13	2311	c.1695C>A	c.(1693-1695)agC>agA	p.S565R	PIK3R1_ENST00000523872.1_Missense_Mutation_p.S202R|PIK3R1_ENST00000396611.1_Missense_Mutation_p.S565R|PIK3R1_ENST00000521657.1_Missense_Mutation_p.S565R|PIK3R1_ENST00000274335.5_Missense_Mutation_p.S565R|PIK3R1_ENST00000320694.8_Missense_Mutation_p.S265R|PIK3R1_ENST00000336483.5_Missense_Mutation_p.S295R	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	565					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	GTATGAACAGCATTAAACCAG	0.373			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																													Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	5											151.0	149.0	150.0					5																	67591102		2203	4300	6503	67626858	SO:0001583	missense	5295			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1695C>A	5.37:g.67591102C>A	ENSP00000428056:p.Ser565Arg	Somatic		Capture	Illumina GAIIx	4	67626858	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP,superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2	p.S565R	ENST00000521381.1	37	c.1695	CCDS3993.1	5	.	.	.	.	.	.	.	.	.	.	C	20.9	4.071808	0.76301	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000336483;ENST00000523872	T;T;T;T;T;T;T	0.38560	1.13;1.13;1.13;1.13;1.13;1.13;1.13	4.7	2.89	0.33648	.	0.000000	0.85682	D	0.000000	T	0.61035	0.2315	M	0.76574	2.34	0.80722	D	1	D;P;P;D	0.89917	1.0;0.865;0.865;1.0	D;P;P;D	0.76071	0.967;0.642;0.642;0.987	T	0.62548	-0.6831	10	0.59425	D	0.04	-18.2259	11.2468	0.49002	0.0:0.8497:0.0:0.1503	.	235;295;265;565	B7Z2N8;P27986-2;P27986-3;P27986	.;.;.;P85A_HUMAN	R	565;565;565;565;265;295;202	ENSP00000428056:S565R;ENSP00000429277:S565R;ENSP00000379855:S565R;ENSP00000274335:S565R;ENSP00000323512:S265R;ENSP00000338554:S295R;ENSP00000430098:S202R	ENSP00000274335:S565R	S	+	3	2	PIK3R1	67626858	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.911000	0.56378	0.684000	0.31448	0.585000	0.79938	AGC	-	NULL		0.373	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	protein_coding	OTTHUMT00000254013.2	C	NM_181504		67626858	+1	no_errors	NM_181523	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ZNF638	27332	genome.wustl.edu	37	2	71653702	71653702	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:71653702C>G	ENST00000409544.1	+	24	5333	c.4703C>G	c.(4702-4704)aCt>aGt	p.T1568S	ZNF638_ENST00000264447.4_Missense_Mutation_p.T1568S|ZNF638_ENST00000355812.3_3'UTR|ZNF638_ENST00000409407.1_Missense_Mutation_p.T508S	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1568					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						AGGAAAGAAACTCTCAAAAAT	0.378																																																0			2											78.0	79.0	79.0					2																	71653702		2203	4300	6503	71507210	SO:0001583	missense	27332			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.4703C>G	2.37:g.71653702C>G	ENSP00000386433:p.Thr1568Ser	Somatic		Capture	Illumina GAIIx	4	71507210	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	HMMSmart_SM00451,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.T1568S	ENST00000409544.1	37	c.4703	CCDS1917.1	2	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799288	0.31869	.	.	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407;ENST00000462695	T;T;T	0.29142	1.58;1.58;1.99	5.53	4.64	0.57946	.	0.664334	0.14425	N	0.320366	T	0.13798	0.0334	N	0.08118	0	0.80722	D	1	B;B	0.11235	0.004;0.0	B;B	0.16289	0.015;0.0	T	0.05599	-1.0875	10	0.02654	T	1	-5.7705	10.7887	0.46419	0.0:0.9097:0.0:0.0903	.	1568;1568	Q14966-3;Q14966	.;ZN638_HUMAN	S	1568;1568;508;508	ENSP00000264447:T1568S;ENSP00000386433:T1568S;ENSP00000386813:T508S	ENSP00000264447:T1568S	T	+	2	0	ZNF638	71507210	0.000000	0.05858	0.991000	0.47740	0.792000	0.44763	0.275000	0.18698	2.594000	0.87642	0.655000	0.94253	ACT	-	NULL		0.378	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	protein_coding	OTTHUMT00000327431.1	C	NM_014497		71507210	+1	no_errors	NM_001014972	genbank	human	reviewed	54_36p	missense	SNP	0.431	G
LAT2	7462	genome.wustl.edu	37	7	73630370	73630370	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr7:73630370C>G	ENST00000460943.1	+	3	954	c.65C>G	c.(64-66)gCc>gGc	p.A22G	LAT2_ENST00000275635.7_Missense_Mutation_p.A22G|LAT2_ENST00000344995.5_Missense_Mutation_p.A22G|LAT2_ENST00000398475.1_Missense_Mutation_p.A22G	NM_032464.2	NP_115853.2	Q9UHI5	LAT2_HUMAN	linker for activation of T cells family, member 2	0					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6					L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GGGGTGGCAGCCAGTCTGTGT	0.632																																																0			7											41.0	52.0	49.0					7																	73630370		2155	4252	6407	73268306	SO:0001583	missense	7462			AF257135	CCDS5566.2	7q11.23	2011-11-01	2005-04-26	2005-04-26	ENSG00000086730	ENSG00000086730			12749	protein-coding gene	gene with protein product	"""linker for activation of B cells"", ""non-T cell activation linker"", ""linker for activation of T cells, transmembrane adaptor 2"""	605719	"""Williams-Beuren syndrome chromosome region 5"""	WBSCR15, WBSCR5		8812460, 12514734	Standard	NM_032464		Approved	WSCR5, HSPC046, LAB, NTAL	uc003uai.3	Q9GZY6	OTTHUMG00000130151	ENST00000460943.1:c.65C>G	7.37:g.73630370C>G	ENSP00000420494:p.Ala22Gly	Somatic		Capture	Illumina GAIIx	4	73268306	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Missense_Mutation	SNP	NULL	p.A22G	ENST00000460943.1	37	c.65	CCDS5566.2	7	.	.	.	.	.	.	.	.	.	.	C	11.92	1.783424	0.31593	.	.	ENSG00000086730	ENST00000465116;ENST00000344995;ENST00000460943;ENST00000475494;ENST00000398475;ENST00000361082;ENST00000275635;ENST00000470709	T;T;T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27;2.27;2.27	3.49	3.49	0.39957	.	0.158956	0.29009	N	0.013427	T	0.26122	0.0637	L	0.32530	0.975	0.09310	N	1	D	0.71674	0.998	D	0.65684	0.937	T	0.01591	-1.1317	10	0.59425	D	0.04	-11.2323	10.7933	0.46445	0.0:1.0:0.0:0.0	.	22	Q9GZY6	NTAL_HUMAN	G	22	ENSP00000420549:A22G;ENSP00000344881:A22G;ENSP00000420494:A22G;ENSP00000417533:A22G;ENSP00000381492:A22G;ENSP00000354374:A22G;ENSP00000275635:A22G;ENSP00000419150:A22G	ENSP00000275635:A22G	A	+	2	0	LAT2	73268306	0.599000	0.26891	0.016000	0.15963	0.002000	0.02628	2.761000	0.47589	2.256000	0.74724	0.561000	0.74099	GCC	-	NULL		0.632	LAT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LAT2	protein_coding	OTTHUMT00000277062.1	C			73268306	+1	no_errors	NM_014146	genbank	human	reviewed	54_36p	missense	SNP	0.006	G
COQ6	51004	genome.wustl.edu	37	14	74428239	74428239	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr14:74428239C>A	ENST00000334571.2	+	10	1216	c.1176C>A	c.(1174-1176)caC>caA	p.H392Q	ENTPD5_ENST00000557325.1_Intron|COQ6_ENST00000238709.4_Missense_Mutation_p.H317Q|COQ6_ENST00000554920.1_Intron|COQ6_ENST00000394026.4_Missense_Mutation_p.H367Q	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	392					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		TGGCCCATCACCTCAGTACGG	0.507																																																0			14											89.0	77.0	81.0					14																	74428239		2203	4300	6503	73497992	SO:0001583	missense	51004			AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.1176C>A	14.37:g.74428239C>A	ENSP00000333946:p.His392Gln	Somatic		Capture	Illumina GAIIx	4	73497992	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Missense_Mutation	SNP	superfamily_SSF51905,HMMPfam_FAD_binding_3,PatternScan_UBIH	p.H392Q	ENST00000334571.2	37	c.1176	CCDS9823.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.01|11.01	1.513566|1.513566	0.27123|0.27123	.|.	.|.	ENSG00000187097|ENSG00000119723	ENST00000555829|ENST00000394026;ENST00000555376;ENST00000238709;ENST00000334571;ENST00000557780;ENST00000556299	.|T;T;T	.|0.49720	.|0.77;0.77;0.77	5.33|5.33	2.35|2.35	0.29111|0.29111	.|Monooxygenase, FAD-binding (1);	.|0.259137	.|0.45126	.|D	.|0.000392	T|T	0.26702|0.26702	0.0653|0.0653	N|N	0.13198|0.13198	0.31|0.31	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.13145	.|0.005;0.001;0.007;0.003	.|B;B;B;B	.|0.19946	.|0.027;0.001;0.026;0.003	T|T	0.04005|0.04005	-1.0985|-1.0985	5|10	.|0.24483	.|T	.|0.36	-3.9602|-3.9602	7.6538|7.6538	0.28363|0.28363	0.0:0.5111:0.0:0.4889|0.0:0.5111:0.0:0.4889	.|.	.|367;392;317;317	.|B7Z3K8;Q9Y2Z9;G3XA86;Q86U30	.|.;COQ6_HUMAN;.;.	V|Q	80|367;317;317;392;80;80	.|ENSP00000377594:H367Q;ENSP00000238709:H317Q;ENSP00000333946:H392Q	.|ENSP00000238709:H317Q	G|H	-|+	2|3	0|2	ENTPD5|COQ6	73497992|73497992	0.979000|0.979000	0.34478|0.34478	0.998000|0.998000	0.56505|0.56505	0.996000|0.996000	0.88848|0.88848	0.232000|0.232000	0.17891|0.17891	0.299000|0.299000	0.22661|0.22661	0.655000|0.655000	0.94253|0.94253	GGT|CAC	-	superfamily_SSF51905,HMMPfam_FAD_binding_3		0.507	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ6	protein_coding	OTTHUMT00000412616.1	C			73497992	+1	no_errors	NM_182476	genbank	human	validated	54_36p	missense	SNP	0.994	A
ZNF592	9640	genome.wustl.edu	37	15	85341676	85341676	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr15:85341676C>T	ENST00000560079.2	+	7	2995	c.2707C>T	c.(2707-2709)Cag>Tag	p.Q903*	ZNF592_ENST00000299927.3_Nonsense_Mutation_p.Q903*	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	903					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTTGTTCGTGCAGAAGCCGGA	0.572																																																0			15											65.0	54.0	58.0					15																	85341676		2203	4299	6502	83142680	SO:0001587	stop_gained	9640			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.2707C>T	15.37:g.85341676C>T	ENSP00000452877:p.Gln903*	Somatic		Capture	Illumina GAIIx	4	83142680	Q2M1T2|Q504Y9	Nonsense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.Q903*	ENST00000560079.2	37	c.2707	CCDS32317.1	15	.	.	.	.	.	.	.	.	.	.	C	39	7.758149	0.98474	.	.	ENSG00000166716	ENST00000299927	.	.	.	5.65	5.65	0.86999	.	0.056951	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-19.5235	17.2346	0.86995	0.0:1.0:0.0:0.0	.	.	.	.	X	903	.	ENSP00000299927:Q903X	Q	+	1	0	ZNF592	83142680	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.829000	0.62737	2.671000	0.90904	0.650000	0.86243	CAG	-	HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.572	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	protein_coding	OTTHUMT00000418779.2	C	NM_014630		83142680	+1	no_errors	NM_014630	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
RAD54B	25788	genome.wustl.edu	37	8	95479690	95479690	+	Silent	SNP	A	A	G			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr8:95479690A>G	ENST00000336148.5	-	2	202	c.78T>C	c.(76-78)agT>agC	p.S26S	RAD54B_ENST00000297592.5_Silent_p.S26S	NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	26					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GACCTGGATTACTTCTTCCTG	0.363								Direct reversal of damage;Homologous recombination																																								0			8											133.0	129.0	130.0					8																	95479690		2203	4300	6503	95548866	SO:0001819	synonymous_variant	25788			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.78T>C	8.37:g.95479690A>G		Somatic		Capture	Illumina GAIIx	4	95548866	F6WBS8	Silent	SNP	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_SNF2_N,HMMSmart_HELICc,HMMPfam_Helicase_C	p.S26	ENST00000336148.5	37	c.78	CCDS6262.1	8																																																																																			-	NULL		0.363	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54B	protein_coding	OTTHUMT00000257806.3	A	NM_012415		95548866	-1	no_errors	NM_012415	genbank	human	reviewed	54_36p	silent	SNP	0.930	G
HIATL1	84641	genome.wustl.edu	37	9	97218544	97218544	+	Missense_Mutation	SNP	G	G	A	rs201761715		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr9:97218544G>A	ENST00000375344.3	+	10	1320	c.1051G>A	c.(1051-1053)Gtg>Atg	p.V351M	HIATL1_ENST00000428393.2_Intron	NM_032558.2	NP_115947.2	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1	351					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	11		Acute lymphoblastic leukemia(62;0.136)				AGCAGGGACCGTGGCTGCCAT	0.562																																					Pancreas(77;1260 1915 1973 10423)											0			9											107.0	82.0	91.0					9																	97218544		2203	4300	6503	96258365	SO:0001583	missense	84641			AK027659	CCDS6710.2	9q22.32	2009-12-04			ENSG00000148110	ENSG00000148110			23376	protein-coding gene	gene with protein product							Standard	XM_005252277		Approved	FLJ14753	uc004aur.3	Q5SR56	OTTHUMG00000020265	ENST00000375344.3:c.1051G>A	9.37:g.97218544G>A	ENSP00000364493:p.Val351Met	Somatic		Capture	Illumina GAIIx	4	96258365	B4DUE6|E9PD58|Q3KQT4|Q53GU5|Q8WU95|Q96SM4	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1,PatternScan_SUGAR_TRANSPORT_1	p.V351M	ENST00000375344.3	37	c.1051	CCDS6710.2	9	.	.	.	.	.	.	.	.	.	.	G	23.3	4.405282	0.83230	.	.	ENSG00000148110	ENST00000375344;ENST00000277183	D	0.82081	-1.57	5.05	5.05	0.67936	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.53938	D	0.000041	T	0.80014	0.4546	L	0.41573	1.285	0.80722	D	1	P	0.51791	0.948	P	0.45195	0.473	T	0.81364	-0.0966	10	0.49607	T	0.09	-8.3655	16.2969	0.82781	0.0:0.0:1.0:0.0	.	351	Q5SR56	HIAL1_HUMAN	M	351;56	ENSP00000364493:V351M	ENSP00000277183:V56M	V	+	1	0	HIATL1	96258365	1.000000	0.71417	0.991000	0.47740	0.954000	0.61252	5.178000	0.65037	2.804000	0.96469	0.655000	0.94253	GTG	-	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1		0.562	HIATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIATL1	protein_coding	OTTHUMT00000053184.1	G	NM_032558		96258365	+1	no_errors	NM_032558	genbank	human	validated	54_36p	missense	SNP	1.000	A
WARS	7453	genome.wustl.edu	37	14	100809636	100809636	+	Nonsense_Mutation	SNP	G	G	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr14:100809636G>T	ENST00000355338.2	-	8	1533	c.915C>A	c.(913-915)tgC>tgA	p.C305*	RP11-638I2.9_ENST00000556212.1_RNA|RP11-638I2.8_ENST00000557226.1_RNA|WARS_ENST00000358655.4_Nonsense_Mutation_p.C264*|WARS_ENST00000392882.2_Nonsense_Mutation_p.C305*|WARS_ENST00000556645.1_Nonsense_Mutation_p.C264*|WARS_ENST00000344102.5_Nonsense_Mutation_p.C264*|WARS_ENST00000557135.1_Nonsense_Mutation_p.C305*	NM_173701.1	NP_776049.1	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase	305					angiogenesis (GO:0001525)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|regulation of angiogenesis (GO:0045765)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)			breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	ATGGGATAAGGCACTGGATAT	0.522																																																0			14											114.0	93.0	101.0					14																	100809636		2203	4300	6503	99879389	SO:0001587	stop_gained	7453			M61715	CCDS9960.1, CCDS9961.1	14q32.2	2014-03-19			ENSG00000140105	ENSG00000140105	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12729	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 1, cytoplasmic"""	191050		IFI53		1537332, 1763065	Standard	NM_004184		Approved	IFP53	uc001yhl.1	P23381	OTTHUMG00000171572	ENST00000355338.2:c.915C>A	14.37:g.100809636G>T	ENSP00000347495:p.Cys305*	Somatic		Capture	Illumina GAIIx	4	99879389	A6NGN1|A6NID3|P78535|Q502Y0|Q53XB6|Q9UDI5|Q9UDL3	Nonsense_Mutation	SNP	superfamily_S15/NS1 RNA-binding domain,HMMPfam_WHEP-TRS,PatternScan_WHEP_TRS_1,superfamily_Nucleotidylyl transferase,PatternScan_AA_TRNA_LIGASE_I,HMMPfam_tRNA-synt_1b	p.C305*	ENST00000355338.2	37	c.915	CCDS9960.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.102374|5.102374	0.94245|0.94245	.|.	.|.	ENSG00000140105|ENSG00000140105	ENST00000554601|ENST00000392882;ENST00000358655;ENST00000355338;ENST00000344102;ENST00000557135;ENST00000556645	.|.	.|.	.|.	6.06|6.06	5.07|5.07	0.68467|0.68467	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.17959|.	0.0431|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.28364|.	-1.0046|.	3|.	.|0.02654	.|T	.|1	-5.5876|-5.5876	7.3754|7.3754	0.26825|0.26825	0.1786:0.0:0.8214:0.0|0.1786:0.0:0.8214:0.0	.|.	.|.	.|.	.|.	D|X	58|305;264;305;264;305;264	.|.	.|ENSP00000339485:C264X	A|C	-|-	2|3	0|2	WARS|WARS	99879389|99879389	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	4.024000|4.024000	0.57218|0.57218	2.879000|2.879000	0.98667|0.98667	0.650000|0.650000	0.86243|0.86243	GCC|TGC	-	superfamily_Nucleotidylyl transferase		0.522	WARS-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WARS	protein_coding	OTTHUMT00000414236.1	G	NM_004184		99879389	-1	no_errors	NM_004184	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
FBXL13	222235	genome.wustl.edu	37	7	102518012	102518012	+	Nonsense_Mutation	SNP	G	G	A	rs368775610		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr7:102518012G>A	ENST00000313221.4	-	16	1963	c.1537C>T	c.(1537-1539)Cga>Tga	p.R513*	FBXL13_ENST00000379306.3_Intron|FBXL13_ENST00000379305.3_Nonsense_Mutation_p.R513*|FBXL13_ENST00000455112.2_Nonsense_Mutation_p.R513*|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000393772.2_Nonsense_Mutation_p.R513*|FBXL13_ENST00000379308.3_Nonsense_Mutation_p.R513*|FBXL13_ENST00000436908.1_Nonsense_Mutation_p.R513*	NM_145032.3	NP_659469.3	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13	513								p.R513*(2)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|skin(3)|stomach(1)	27						TCACAATTTCGTAAACTCAAG	0.323													G|||	1	0.000199681	0.0	0.0	5008	,	,		16359	0.001		0.0	False		,,,				2504	0.0															2	Substitution - Nonsense(2)	endometrium(2)	7						G	stop/ARG,stop/ARG	0,4406		0,0,2203	75.0	79.0	78.0		1537,1537	0.2	1.0	7		78	1,8579	1.2+/-3.3	0,1,4289	no	stop-gained,stop-gained	FBXL13	NM_001111038.1,NM_145032.3	,	0,1,6492	AA,AG,GG		0.0117,0.0,0.0077	,	513/691,513/736	102518012	1,12985	2203	4290	6493	102305248	SO:0001587	stop_gained	222235			BC031285	CCDS5726.1, CCDS47678.1, CCDS75649.1	7q22.1	2014-07-18			ENSG00000161040	ENSG00000161040		"""F-boxes / Leucine-rich repeats"""	21658	protein-coding gene	gene with protein product		609080					Standard	NM_145032		Approved	MGC21636, Fbl13	uc003vaq.2	Q8NEE6	OTTHUMG00000157224	ENST00000313221.4:c.1537C>T	7.37:g.102518012G>A	ENSP00000321927:p.Arg513*	Somatic		Capture	Illumina GAIIx	4	102305248	C9J565|C9J566|Q6UVW7|Q6UVW8|Q75MN5|Q86UJ5|Q8N7Y4|Q8TCL2|Q8WUF9|Q8WUG0	Nonsense_Mutation	SNP	HMMPfam_F-box,superfamily_RNI-like,HMMSmart_SM00367	p.R513*	ENST00000313221.4	37	c.1537	CCDS5726.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.576611	0.98368	0.0	1.17E-4	ENSG00000161040	ENST00000393772;ENST00000379308;ENST00000349747;ENST00000379305;ENST00000436908;ENST00000313221;ENST00000455112	.	.	.	5.55	0.15	0.14883	.	0.151243	0.42172	D	0.000753	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	8.9248	0.35634	0.0687:0.0:0.4301:0.5013	.	.	.	.	X	513;513;234;513;513;513;513	.	ENSP00000321927:R513X	R	-	1	2	FBXL13	102305248	0.991000	0.36638	0.988000	0.46212	0.538000	0.34931	0.541000	0.23207	-0.177000	0.10690	-0.321000	0.08615	CGA	-	superfamily_RNI-like,HMMSmart_SM00367		0.323	FBXL13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXL13	protein_coding	OTTHUMT00000348001.1	G	NM_145032		102305248	-1	no_errors	NM_145032	genbank	human	validated	54_36p	nonsense	SNP	0.995	A
HPS6	79803	genome.wustl.edu	37	10	103826236	103826236	+	Silent	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr10:103826236G>C	ENST00000299238.5	+	1	1090	c.1005G>C	c.(1003-1005)ctG>ctC	p.L335L		NM_024747.5	NP_079023.2	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome 6	335					blood coagulation (GO:0007596)|melanocyte differentiation (GO:0030318)|organelle organization (GO:0006996)|protein localization to membrane (GO:0072657)	BLOC-2 complex (GO:0031084)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|Rab GTPase binding (GO:0017137)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)	11		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		TGGAACTGCTGGACATGGGCA	0.622									Hermansky-Pudlak syndrome																																							0			10											66.0	67.0	67.0					10																	103826236		2203	4300	6503	103816226	SO:0001819	synonymous_variant	79803	Familial Cancer Database	HPS, HPS1-8	BC009258	CCDS7527.1	10q24.32	2014-06-18			ENSG00000166189	ENSG00000166189			18817	protein-coding gene	gene with protein product		607522				12548288	Standard	NM_024747		Approved	FLJ22501	uc001kuj.3	Q86YV9	OTTHUMG00000018945	ENST00000299238.5:c.1005G>C	10.37:g.103826236G>C		Somatic		Capture	Illumina GAIIx	4	103816226	Q5VV69|Q9H685	Silent	SNP	NULL	p.L335	ENST00000299238.5	37	c.1005	CCDS7527.1	10																																																																																			-	NULL		0.622	HPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS6	protein_coding	OTTHUMT00000050018.2	G	NM_024747		103816226	+1	no_errors	NM_024747	genbank	human	reviewed	54_36p	silent	SNP	0.908	C
C14orf79	122616	genome.wustl.edu	37	14	105457851	105457851	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr14:105457851G>T	ENST00000547315.1	+	3	1232	c.593G>T	c.(592-594)aGa>aTa	p.R198I	C14orf79_ENST00000550614.1_5'UTR|C14orf79_ENST00000549240.1_5'UTR|C14orf79_ENST00000549584.1_3'UTR	NM_174891.3	NP_777551.2	Q96F83	CN079_HUMAN	chromosome 14 open reading frame 79	198										breast(1)|endometrium(1)|lung(1)	3		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00326)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0181)			AAACTCTGGAGAGCCCTTCAG	0.522																																																0			14											95.0	92.0	93.0					14																	105457851		1910	4129	6039	104528896	SO:0001583	missense	122616				CCDS42000.1	14q32.33	2012-09-25			ENSG00000140104	ENSG00000140104			20126	protein-coding gene	gene with protein product							Standard	NM_174891		Approved		uc001ypy.1	Q96F83	OTTHUMG00000170474	ENST00000547315.1:c.593G>T	14.37:g.105457851G>T	ENSP00000450114:p.Arg198Ile	Somatic		Capture	Illumina GAIIx	4	104528896	B2RPK9|Q9BTP4	Missense_Mutation	SNP	NULL	p.R198I	ENST00000547315.1	37	c.593	CCDS42000.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.41|14.41	2.527907|2.527907	0.44969|0.44969	.|.	.|.	ENSG00000140104|ENSG00000140104	ENST00000551606|ENST00000547315	.|.	.|.	.|.	3.79|3.79	2.87|2.87	0.33458|0.33458	.|.	.|0.151830	.|0.29631	.|N	.|0.011601	.|T	.|0.69637	.|0.3133	M|M	0.67953|0.67953	2.075|2.075	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.70935	.|0.971	.|T	.|0.69548	.|-0.5116	.|9	.|0.87932	.|D	.|0	-1.8403|-1.8403	9.1773|9.1773	0.37120|0.37120	0.0:0.2243:0.7757:0.0|0.0:0.2243:0.7757:0.0	.|.	.|198	.|Q96F83	.|CN079_HUMAN	X|I	92|198	.|.	.|ENSP00000450114:R198I	E|R	+|+	1|2	0|0	C14orf79|C14orf79	104528896|104528896	0.999000|0.999000	0.42202|0.42202	0.846000|0.846000	0.33378|0.33378	0.415000|0.415000	0.31203|0.31203	2.015000|2.015000	0.40961|0.40961	0.561000|0.561000	0.29186|0.29186	0.586000|0.586000	0.80456|0.80456	GAG|AGA	-	NULL		0.522	C14orf79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf79	protein_coding	OTTHUMT00000409318.1	G	NM_174891		104528896	+1	no_errors	NM_174891	genbank	human	validated	54_36p	missense	SNP	0.988	T
IGHG3	3502	genome.wustl.edu	37	14	106236011	106236011	+	RNA	SNP	G	G	A	rs200351257		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr14:106236011G>A	ENST00000390551.2	-	0	792							P01860	IGHG3_HUMAN	immunoglobulin heavy constant gamma 3 (G3m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										TTTGGAGATGGTTTTCTCGAT	0.612																																																0			14											172.0	162.0	165.0					14																	106236011		2013	4155	6168	105307056			0			M12958		14q32.33	2012-10-02			ENSG00000211897	ENSG00000211897		"""Immunoglobulins / IGH locus"""	5527	other	immunoglobulin gene		147120				6808505	Standard	NG_001019		Approved			P01860	OTTHUMG00000152539		14.37:g.106236011G>A		Somatic		Capture	Illumina GAIIx	4	105307056	A2NU35	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407,PatternScan_IG_MHC	p.P265S	ENST00000390551.2	37	c.793		14																																																																																			-	superfamily_Immunoglobulin		0.612	IGHG3-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHG3	IG_C_gene	OTTHUMT00000326654.1	G	NG_001019		105307056	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390550	ensembl	human	known	54_36p	missense	SNP	0.092	A
FRMPD3	84443	genome.wustl.edu	37	X	106845307	106845307	+	Silent	SNP	C	C	G			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chrX:106845307C>G	ENST00000276185.4	+	16	4137	c.4137C>G	c.(4135-4137)ccC>ccG	p.P1379P				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1379						cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						TCAGCAGCCCCATCAATGTCC	0.657																																																0			X											47.0	48.0	48.0					X																	106845307		876	1991	2867	106731963	SO:0001819	synonymous_variant	84443			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.4137C>G	X.37:g.106845307C>G		Somatic		Capture	Illumina GAIIx	4	106731963	Q96JK8	Silent	SNP	PatternScan_FERM_1,PatternScan_FERM_2,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,HMMSmart_B41,superfamily_FERM_3-hlx,HMMPfam_FERM_M	p.P1379	ENST00000276185.4	37	c.4137		X																																																																																			-	NULL		0.657	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	protein_coding		C	XM_042978		106731963	+1	no_errors	XM_042978	genbank	human	model	54_36p	silent	SNP	1.000	G
LAMB4	22798	genome.wustl.edu	37	7	107743486	107743486	+	Intron	SNP	C	C	T	rs183507230		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr7:107743486C>T	ENST00000388781.3	-	10	1264				LAMB4_ENST00000414450.2_Intron|LAMB4_ENST00000205386.4_Intron|LAMB4_ENST00000418464.1_Intron|LAMB4_ENST00000388780.3_Intron	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4						cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CCCGGGGACTCACGAATGCAC	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19221	0.0		0.0	False		,,,				2504	0.0															0			7						C		1,4405	2.1+/-5.4	0,1,2202	58.0	52.0	54.0			2.2	0.5	7		54	0,8600		0,0,4300	no	intron	LAMB4	NM_007356.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077			107743486	1,13005	2203	4300	6503	107530722	SO:0001627	intron_variant	22798			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.1180+2G>A	7.37:g.107743486C>T		Somatic		Capture	Illumina GAIIx	4	107530722	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	HMMSmart_SM00136,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_LAM_1,PatternScan_EGF_2	p.E395K	ENST00000388781.3	37	c.1183	CCDS34732.1	7																																																																																			-	NULL		0.577	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	protein_coding	OTTHUMT00000337442.1	C	XM_209857		107530722	-1	no_errors	ENST00000388781	ensembl	human	known	54_36p	missense	SNP	1.000	T
SULT1C4	27233	genome.wustl.edu	37	2	108998879	108998879	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:108998879C>A	ENST00000272452.2	+	3	660	c.334C>A	c.(334-336)Ctg>Atg	p.L112M	SULT1C4_ENST00000409309.3_Intron	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	112					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						ACCACGGATCCTGAAAACACA	0.388																																																0			2											257.0	242.0	247.0					2																	108998879		2203	4300	6503	108365311	SO:0001583	missense	27233			AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.334C>A	2.37:g.108998879C>A	ENSP00000272452:p.Leu112Met	Somatic		Capture	Illumina GAIIx	4	108365311	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Sulfotransfer_1	p.L112M	ENST00000272452.2	37	c.334	CCDS2077.1	2	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683374	0.47991	.	.	ENSG00000198075	ENST00000272452	D	0.84070	-1.8	4.44	1.63	0.23807	Sulfotransferase domain (1);	0.000000	0.39274	N	0.001416	T	0.75722	0.3888	N	0.20530	0.585	0.80722	D	1	P	0.51933	0.949	P	0.54346	0.749	T	0.70364	-0.4892	10	0.42905	T	0.14	.	5.1354	0.14932	0.1538:0.5907:0.0:0.2555	.	112	O75897	ST1C4_HUMAN	M	112	ENSP00000272452:L112M	ENSP00000272452:L112M	L	+	1	2	SULT1C4	108365311	0.480000	0.25933	0.399000	0.26333	0.980000	0.70556	0.787000	0.26858	0.228000	0.21019	-0.208000	0.12717	CTG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Sulfotransfer_1		0.388	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1C4	protein_coding	OTTHUMT00000253561.1	C	NM_006588		108365311	+1	no_errors	NM_006588	genbank	human	reviewed	54_36p	missense	SNP	0.314	A
CHRDL1	91851	genome.wustl.edu	37	X	109931919	109931919	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chrX:109931919C>G	ENST00000372045.1	-	9	1001	c.870G>C	c.(868-870)gaG>gaC	p.E290D	CHRDL1_ENST00000372042.1_Missense_Mutation_p.E297D|CHRDL1_ENST00000434224.1_Missense_Mutation_p.E217D|CHRDL1_ENST00000394797.4_Missense_Mutation_p.E296D|CHRDL1_ENST00000218054.4_Missense_Mutation_p.E296D|CHRDL1_ENST00000444321.2_Missense_Mutation_p.E296D|CHRDL1_ENST00000482160.1_Missense_Mutation_p.E217D			Q9BU40	CRDL1_HUMAN	chordin-like 1	290	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						TTTTCTTACACTCTTGCTTGG	0.463																																																0			X											198.0	179.0	185.0					X																	109931919		2203	4300	6503	109818575	SO:0001583	missense	91851			AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.870G>C	X.37:g.109931919C>G	ENSP00000361115:p.Glu290Asp	Somatic		Capture	Illumina GAIIx	4	109818575	B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	superfamily_Fibronectin type I module,HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1	p.E296D	ENST00000372045.1	37	c.888		X	.	.	.	.	.	.	.	.	.	.	c	7.985	0.752079	0.15778	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66;-0.66;-0.66	5.02	4.14	0.48551	von Willebrand factor, type C (4);	0.052608	0.85682	D	0.000000	T	0.65637	0.2710	N	0.10945	0.07	0.46061	D	0.99884	D;D;D;D;D;P	0.69078	0.995;0.997;0.992;0.992;0.997;0.573	D;D;D;D;D;P	0.80764	0.994;0.992;0.989;0.989;0.992;0.599	T	0.63216	-0.6687	9	.	.	.	-18.5962	8.0123	0.30361	0.0:0.6641:0.0:0.3359	.	217;296;276;290;297;217	B4DMP3;E9PGS5;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;CRDL1_HUMAN;.;.	D	290;217;296;296;297;217;296	ENSP00000361115:E290D;ENSP00000389627:E217D;ENSP00000218054:E296D;ENSP00000378276:E296D;ENSP00000361112:E297D;ENSP00000418443:E217D;ENSP00000399739:E296D	.	E	-	3	2	CHRDL1	109818575	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.033000	0.30191	1.170000	0.42753	0.597000	0.82753	GAG	-	superfamily_Fibronectin type I module,HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1		0.463	CHRDL1-001	KNOWN	basic	protein_coding	CHRDL1	protein_coding	OTTHUMT00000057912.1	C	NM_145234		109818575	-1	no_errors	NM_145234	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PHLDB2	90102	genome.wustl.edu	37	3	111688589	111688589	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr3:111688589G>A	ENST00000431670.2	+	16	3779	c.3368G>A	c.(3367-3369)cGg>cAg	p.R1123Q	PHLDB2_ENST00000495180.1_Missense_Mutation_p.R614Q|PHLDB2_ENST00000481953.1_Missense_Mutation_p.R1080Q|PHLDB2_ENST00000393925.3_Missense_Mutation_p.R1123Q|PHLDB2_ENST00000393923.3_Missense_Mutation_p.R1107Q|PHLDB2_ENST00000412622.1_Missense_Mutation_p.R1080Q	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	1123						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TTTGATTTGCGGAGCCATGTA	0.458																																																0			3											88.0	92.0	91.0					3																	111688589		2203	4300	6503	113171279	SO:0001583	missense	90102				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.3368G>A	3.37:g.111688589G>A	ENSP00000405405:p.Arg1123Gln	Somatic		Capture	Illumina GAIIx	4	113171279	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.R1080Q	ENST00000431670.2	37	c.3239	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058724	0.76074	.	.	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.86615	0.5975	M	0.78456	2.415	0.53688	D	0.999976	D;D;D;D;D	0.89917	0.998;0.997;0.992;1.0;1.0	P;P;P;D;D	0.72625	0.534;0.801;0.777;0.978;0.978	D	0.87526	0.2449	10	0.66056	D	0.02	.	18.3611	0.90375	0.0:0.0:1.0:0.0	.	235;614;1123;1080;1107	Q658P8;E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;.;PHLB2_HUMAN;.;.	Q	1107;1123;1080;1080;1123;1080;614	ENSP00000377500:R1107Q;ENSP00000405405:R1123Q;ENSP00000405292:R1080Q;ENSP00000418296:R1080Q;ENSP00000377502:R1123Q;ENSP00000418319:R1080Q;ENSP00000420303:R614Q	ENSP00000377500:R1107Q	R	+	2	0	PHLDB2	113171279	0.993000	0.37304	0.998000	0.56505	0.253000	0.25986	3.862000	0.56009	2.632000	0.89209	0.585000	0.79938	CGG	-	NULL		0.458	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	protein_coding	OTTHUMT00000354337.1	G	NM_145753		113171279	+1	no_errors	NM_145753	genbank	human	validated	54_36p	missense	SNP	1.000	A
LRCH2	57631	genome.wustl.edu	37	X	114404879	114404879	+	Silent	SNP	T	T	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chrX:114404879T>C	ENST00000317135.8	-	6	1011	c.981A>G	c.(979-981)tcA>tcG	p.S327S	LRCH2_ENST00000538422.1_Silent_p.S327S	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	327										breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						TGAGAGGCTGTGAGGGCATTC	0.358																																																0			X											99.0	90.0	93.0					X																	114404879		1894	4103	5997	114311135	SO:0001819	synonymous_variant	57631			AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.981A>G	X.37:g.114404879T>C		Somatic		Capture	Illumina GAIIx	4	114311135	F5H2T1|Q08AD5|Q9HA88|Q9P233	Silent	SNP	superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRR_TYP,superfamily_Calponin-homology,HMMPfam_CH,HMMSmart_CH	p.S327	ENST00000317135.8	37	c.981	CCDS48155.1	X																																																																																			-	NULL		0.358	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRCH2	protein_coding	OTTHUMT00000057971.2	T	NM_020871		114311135	-1	no_errors	NM_020871	genbank	human	validated	54_36p	silent	SNP	0.941	C
CASQ2	845	genome.wustl.edu	37	1	116283408	116283408	+	Missense_Mutation	SNP	G	G	T	rs570840019	byFrequency	TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:116283408G>T	ENST00000261448.5	-	3	600	c.361C>A	c.(361-363)Cgc>Agc	p.R121S	CASQ2_ENST00000456138.2_Intron	NM_001232.3	NP_001223.2	O14958	CASQ2_HUMAN	calsequestrin 2 (cardiac muscle)	121					cardiac muscle contraction (GO:0060048)|cellular response to caffeine (GO:0071313)|detection of calcium ion (GO:0005513)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|protein polymerization (GO:0051258)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of heart rate (GO:0002027)|regulation of membrane repolarization (GO:0060306)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|sequestering of calcium ion (GO:0051208)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|junctional sarcoplasmic reticulum membrane (GO:0014701)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	18	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TCTATTGTGCGATCACCCTTA	0.448																																																0			1											118.0	100.0	106.0					1																	116283408		2203	4300	6503	116084931	SO:0001583	missense	845			BC022288	CCDS884.1	1p13.1	2014-09-17			ENSG00000118729	ENSG00000118729		"""Protein disulfide isomerases"""	1513	protein-coding gene	gene with protein product		114251				8406504	Standard	NM_001232		Approved	PDIB2	uc001efx.4	O14958	OTTHUMG00000011970	ENST00000261448.5:c.361C>A	1.37:g.116283408G>T	ENSP00000261448:p.Arg121Ser	Somatic		Capture	Illumina GAIIx	4	116084931	B2R7M6|B4DIB0|Q5T1D2|Q8TBW8	Missense_Mutation	SNP	HMMPfam_Calsequestrin,PatternScan_CALSEQUESTRIN_1,superfamily_Thioredoxin-like,PatternScan_CALSEQUESTRIN_2	p.R121S	ENST00000261448.5	37	c.361	CCDS884.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994524	0.74703	.	.	ENSG00000118729	ENST00000261448;ENST00000446755	T	0.74421	-0.84	5.97	5.97	0.96955	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.70500	0.3231	M	0.76838	2.35	0.80722	D	1	P	0.47302	0.893	P	0.46659	0.523	T	0.69595	-0.5103	10	0.12103	T	0.63	-8.3492	17.3406	0.87294	0.0:0.0:1.0:0.0	.	121	O14958	CASQ2_HUMAN	S	121	ENSP00000261448:R121S	ENSP00000261448:R121S	R	-	1	0	CASQ2	116084931	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.200000	0.72118	2.828000	0.97474	0.655000	0.94253	CGC	-	HMMPfam_Calsequestrin,superfamily_Thioredoxin-like		0.448	CASQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASQ2	protein_coding	OTTHUMT00000033091.1	G	NM_001232		116084931	-1	no_errors	NM_001232	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TMPRSS4	56649	genome.wustl.edu	37	11	117984005	117984005	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr11:117984005C>G	ENST00000437212.3	+	9	979	c.765C>G	c.(763-765)aaC>aaG	p.N255K	TMPRSS4_ENST00000534111.1_Missense_Mutation_p.N253K|TMPRSS4_ENST00000522307.1_Missense_Mutation_p.N108K|TMPRSS4_ENST00000522824.1_Missense_Mutation_p.N250K|TMPRSS4_ENST00000523251.1_Missense_Mutation_p.N215K|TMPRSS4_ENST00000518413.2_3'UTR			Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4	255	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		ATGTGTTCAACTGGAAGGTGC	0.557																																																0			11											154.0	141.0	146.0					11																	117984005		2200	4296	6496	117489215	SO:0001583	missense	56649			AF179224	CCDS31684.1, CCDS44743.1, CCDS53716.1, CCDS53717.1	11q23.3	2010-04-13			ENSG00000137648	ENSG00000137648		"""Serine peptidases / Transmembrane"""	11878	protein-coding gene	gene with protein product	"""transmembrane serine protease 3"", ""membrane-type serine protease 2"", ""type II membrane serine protease"""	606565				10825129	Standard	NM_001083947		Approved	TMPRSS3, MT-SP2	uc021qrd.1	Q9NRS4	OTTHUMG00000164122	ENST00000437212.3:c.765C>G	11.37:g.117984005C>G	ENSP00000416037:p.Asn255Lys	Somatic		Capture	Illumina GAIIx	4	117489215	A8MU84|B0YJB0|B7Z8C5|E7ERX8|Q5XKQ6|Q6UX37|Q9NZA5	Missense_Mutation	SNP	superfamily_LDL receptor-like module,HMMSmart_SM00192,HMMPfam_Ldl_recept_a,superfamily_SRCR-like,HMMSmart_SM00202,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.N255K	ENST00000437212.3	37	c.765	CCDS31684.1	11	.	.	.	.	.	.	.	.	.	.	C	0.021	-1.421164	0.01126	.	.	ENSG00000137648	ENST00000534111;ENST00000522307;ENST00000523251;ENST00000437212;ENST00000522824	D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37	5.21	2.03	0.26663	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.886192	0.09843	N	0.748545	T	0.74749	0.3757	N	0.13140	0.3	0.28226	N	0.926301	B;B;B;B;B	0.32128	0.357;0.245;0.245;0.091;0.169	B;B;B;B;B	0.31101	0.124;0.124;0.124;0.124;0.079	T	0.64271	-0.6447	10	0.05436	T	0.98	.	8.2496	0.31708	0.0:0.6385:0.2673:0.0942	.	230;215;108;255;253	B7Z900;E7ERX8;E7ESG9;Q9NRS4;Q9NRS4-3	.;.;.;TMPS4_HUMAN;.	K	253;108;215;255;250	ENSP00000435184:N253K;ENSP00000428814:N108K;ENSP00000429209:N215K;ENSP00000416037:N255K;ENSP00000430547:N250K	ENSP00000416037:N255K	N	+	3	2	TMPRSS4	117489215	0.989000	0.36119	0.882000	0.34594	0.127000	0.20565	1.109000	0.31135	1.195000	0.43115	0.655000	0.94253	AAC	-	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin		0.557	TMPRSS4-004	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS4	protein_coding	OTTHUMT00000377328.2	C	NM_019894		117489215	+1	no_errors	NM_019894	genbank	human	reviewed	54_36p	missense	SNP	0.997	G
RALB	5899	genome.wustl.edu	37	2	121047205	121047205	+	Missense_Mutation	SNP	G	G	T	rs372920618		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:121047205G>T	ENST00000272519.5	+	4	643	c.373G>T	c.(373-375)Gtc>Ttc	p.V125F	RALB_ENST00000404963.3_Missense_Mutation_p.V146F|RALB_ENST00000474855.2_Missense_Mutation_p.V147F|RALB_ENST00000470417.1_3'UTR|RALB_ENST00000420510.1_Missense_Mutation_p.V125F	NM_002881.2	NP_002872.1	P11234	RALB_HUMAN	v-ral simian leukemia viral oncogene homolog B	125					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|regulation of exocyst assembly (GO:0001928)|regulation of exocyst localization (GO:0060178)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(3)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(154;0.122)				TCCACTGCTCGTCGTGGGAAA	0.507																																																0			2											124.0	131.0	129.0					2																	121047205		2203	4300	6503	120763675	SO:0001583	missense	5899				CCDS2131.1	2q14.2	2014-05-09	2013-07-09		ENSG00000144118	ENSG00000144118			9840	protein-coding gene	gene with protein product	"""ras related GTP binding protein B"""	179551					Standard	NM_002881		Approved		uc002tmk.3	P11234	OTTHUMG00000131435	ENST00000272519.5:c.373G>T	2.37:g.121047205G>T	ENSP00000272519:p.Val125Phe	Somatic		Capture	Illumina GAIIx	4	120763675	B4E040|Q53T32|Q6ZS74	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176	p.V125F	ENST00000272519.5	37	c.373	CCDS2131.1	2	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578096	0.45902	.	.	ENSG00000144118	ENST00000447591;ENST00000474855;ENST00000272519;ENST00000420510;ENST00000404963;ENST00000412383	T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.4	5.4	0.78164	Small GTP-binding protein domain (1);	0.151177	0.43747	D	0.000536	T	0.82139	0.4972	L	0.41027	1.25	0.33628	D	0.605664	P;P;P	0.48350	0.909;0.897;0.521	P;P;P	0.62560	0.904;0.749;0.772	D	0.86693	0.1924	10	0.87932	D	0	.	14.2223	0.65836	0.0:0.0:0.8509:0.1491	.	147;146;125	B4E040;Q6ZS74;P11234	.;.;RALB_HUMAN	F	147;147;125;125;146;125	ENSP00000402866:V147F;ENSP00000438764:V147F;ENSP00000272519:V125F;ENSP00000414224:V125F;ENSP00000384328:V146F;ENSP00000398162:V125F	ENSP00000272519:V125F	V	+	1	0	RALB	120763675	0.973000	0.33851	0.108000	0.21378	0.393000	0.30537	1.928000	0.40104	2.813000	0.96785	0.561000	0.74099	GTC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176		0.507	RALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALB	protein_coding	OTTHUMT00000254232.3	G	NM_002881		120763675	+1	no_errors	NM_002881	genbank	human	reviewed	54_36p	missense	SNP	0.243	T
GSK3B	2932	genome.wustl.edu	37	3	119747834	119747834	+	Intron	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr3:119747834G>C	ENST00000264235.8	-	2	1071				GSK3B_ENST00000316626.5_Intron	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta						axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	TCCTGTGGAAGAAACGGCCTT	0.423																																																0			3																																								121230524	SO:0001627	intron_variant	0			BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.89-26748C>G	3.37:g.119747834G>C		Somatic		Capture	Illumina GAIIx	4	121230524	D3DN89|Q9BWH3|Q9UL47	RNA	SNP	-	NULL	ENST00000264235.8	37	NULL	CCDS54628.1	3																																																																																			-	-		0.423	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100129707	protein_coding	OTTHUMT00000258240.2	G			121230524	+1	pseudogene	XR_038954	genbank	human	model	54_36p	rna	SNP	0.991	C
LRRC43	254050	genome.wustl.edu	37	12	122674832	122674832	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr12:122674832G>A	ENST00000339777.4	+	5	846	c.818G>A	c.(817-819)aGc>aAc	p.S273N	LRRC43_ENST00000425921.1_Missense_Mutation_p.S88N	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	273	LRRCT.									NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		ACCATCGACAGCCTGGCCCAG	0.637																																																0			12											78.0	87.0	84.0					12																	122674832		2162	4265	6427	121240785	SO:0001583	missense	254050			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.818G>A	12.37:g.122674832G>A	ENSP00000344233:p.Ser273Asn	Somatic		Capture	Illumina GAIIx	4	121240785	Q6ZVT9	Missense_Mutation	SNP	superfamily_Outer arm dynein light chain 1	p.S273N	ENST00000339777.4	37	c.818	CCDS45001.1	12	.	.	.	.	.	.	.	.	.	.	G	14.46	2.543394	0.45280	.	.	ENSG00000158113	ENST00000537729;ENST00000339777;ENST00000289014;ENST00000425921	T;T;T	0.23950	1.88;1.88;1.88	5.22	3.38	0.38709	.	0.278041	0.37955	N	0.001877	T	0.40448	0.1117	M	0.66939	2.045	0.30010	N	0.815227	D	0.60575	0.988	P	0.57911	0.829	T	0.37753	-0.9692	10	0.48119	T	0.1	-24.0656	10.3282	0.43807	0.0756:0.1434:0.781:0.0	.	273	Q8N309	LRC43_HUMAN	N	88;273;144;88	ENSP00000438751:S88N;ENSP00000344233:S273N;ENSP00000416628:S88N	ENSP00000289014:S144N	S	+	2	0	LRRC43	121240785	1.000000	0.71417	1.000000	0.80357	0.072000	0.16883	2.396000	0.44468	0.597000	0.29811	-0.258000	0.10820	AGC	-	superfamily_Outer arm dynein light chain 1		0.637	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC43	protein_coding	OTTHUMT00000401589.1	G	NM_152759		121240785	+1	no_errors	NM_001098519	genbank	human	validated	54_36p	missense	SNP	1.000	A
FAT4	79633	genome.wustl.edu	37	4	126372139	126372139	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr4:126372139G>C	ENST00000394329.3	+	9	9981	c.9968G>C	c.(9967-9969)aGc>aCc	p.S3323T	FAT4_ENST00000335110.5_Missense_Mutation_p.S1621T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3323	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GTGTTTGCTAGCGACCGTGAT	0.398																																																0			4											99.0	99.0	99.0					4																	126372139		2203	4300	6503	126591589	SO:0001583	missense	79633			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.9968G>C	4.37:g.126372139G>C	ENSP00000377862:p.Ser3323Thr	Somatic		Capture	Illumina GAIIx	4	126591589	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_EGF	p.S3323T	ENST00000394329.3	37	c.9968	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	7.401	0.632688	0.14322	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01323	5.01;5.01	5.42	5.42	0.78866	Cadherin (4);Cadherin-like (1);	0.000000	0.40222	U	0.001160	T	0.01489	0.0048	N	0.00493	-1.44	0.54753	D	0.99998	D;D;D	0.76494	0.99;0.999;0.996	D;D;D	0.87578	0.979;0.998;0.99	T	0.68569	-0.5374	10	0.02654	T	1	.	19.2521	0.93929	0.0:0.0:1.0:0.0	.	1621;3323;3323	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	T	3323;1621	ENSP00000377862:S3323T;ENSP00000335169:S1621T	ENSP00000335169:S1621T	S	+	2	0	FAT4	126591589	1.000000	0.71417	0.995000	0.50966	0.860000	0.49131	7.682000	0.84083	2.542000	0.85734	0.655000	0.94253	AGC	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.398	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	G	NM_024582		126591589	+1	no_errors	NM_024582	genbank	human	validated	54_36p	missense	SNP	1.000	C
MAP3K2	10746	genome.wustl.edu	37	2	128079651	128079651	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:128079651G>T	ENST00000409947.1	-	12	1298	c.1016C>A	c.(1015-1017)aCc>aAc	p.T339N	MAP3K2_ENST00000344908.5_Missense_Mutation_p.T339N			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	339					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	GTCCATTACGGTCAAAGTAGG	0.383																																																0			2											102.0	98.0	99.0					2																	128079651		1911	4107	6018	127796121	SO:0001583	missense	10746			AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.1016C>A	2.37:g.128079651G>T	ENSP00000387246:p.Thr339Asn	Somatic		Capture	Illumina GAIIx	4	127796121	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	HMMPfam_PB1,HMMSmart_SM00666,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP	p.T339N	ENST00000409947.1	37	c.1016	CCDS46404.1	2	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302334	0.60195	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	T;T	0.66815	-0.23;-0.23	5.5	5.5	0.81552	.	0.112212	0.64402	D	0.000009	T	0.55784	0.1942	N	0.19112	0.55	0.54753	D	0.999983	B	0.17852	0.024	B	0.20184	0.028	T	0.48811	-0.9002	10	0.33940	T	0.23	.	19.3906	0.94581	0.0:0.0:1.0:0.0	.	339	Q9Y2U5	M3K2_HUMAN	N	339	ENSP00000387246:T339N;ENSP00000343463:T339N	ENSP00000343463:T339N	T	-	2	0	MAP3K2	127796121	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	9.308000	0.96247	2.592000	0.87571	0.467000	0.42956	ACC	-	NULL		0.383	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K2	protein_coding	OTTHUMT00000331014.1	G	NM_006609		127796121	-1	no_errors	NM_006609	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
POTEKP	440915	genome.wustl.edu	37	2	132384731	132384731	+	IGR	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:132384731G>A								RNU6-617P (24262 upstream) : LINC01087 (9866 downstream)																							ACTCCGTGTGGGTCGGTGGCT	0.567																																																0			2											40.0	31.0	34.0					2																	132384731		692	1580	2272	132101201	SO:0001628	intergenic_variant	0																															2.37:g.132384731G>A		Somatic		Capture	Illumina GAIIx	4	132101201		Nonsense_Mutation	SNP	superfamily_SSF53067,HMMPfam_Actin,HMMSmart_ACTIN,PatternScan_ACTINS_ACT_LIKE,PatternScan_ACTINS_2	p.W340*		37	c.1020		2																																																																																			-	HMMPfam_Actin,HMMSmart_ACTIN,superfamily_SSF53067	0	0.567					ACTBL3			G			132101201	+1	no_errors	ENST00000329081	ensembl	human	known	54_36p	nonsense	SNP	1.000	A
PCDHGB1	56104	genome.wustl.edu	37	5	140731313	140731313	+	Missense_Mutation	SNP	G	G	C	rs370474605		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr5:140731313G>C	ENST00000523390.1	+	1	1486	c.1486G>C	c.(1486-1488)Gag>Cag	p.E496Q	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	496	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCCGCGGGAGCTGTTGTC	0.647																																																0			5											36.0	42.0	40.0					5																	140731313		1982	4175	6157	140711497	SO:0001583	missense	56104			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1486G>C	5.37:g.140731313G>C	ENSP00000429273:p.Glu496Gln	Somatic		Capture	Illumina GAIIx	4	140711497	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.E496Q	ENST00000523390.1	37	c.1486	CCDS54923.1	5	.	.	.	.	.	.	.	.	.	.	.	8.878	0.950953	0.18431	.	.	ENSG00000254221	ENST00000523390	T	0.61510	0.1	5.49	4.57	0.56435	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.46249	0.1383	N	0.20807	0.61	0.09310	N	1	B;B	0.16166	0.005;0.016	B;B	0.19666	0.026;0.026	T	0.44329	-0.9335	9	0.72032	D	0.01	.	14.89	0.70600	0.0:0.2682:0.7318:0.0	.	496;496	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	Q	496	ENSP00000429273:E496Q	ENSP00000429273:E496Q	E	+	1	0	PCDHGB1	140711497	0.000000	0.05858	0.491000	0.27477	0.249000	0.25844	-0.545000	0.06069	2.740000	0.93945	0.563000	0.77884	GAG	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.647	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	protein_coding	OTTHUMT00000374740.1	G	NM_018922		140711497	+1	no_errors	NM_018922	genbank	human	reviewed	54_36p	missense	SNP	0.634	C
MIR513B	100313822	genome.wustl.edu	37	X	146280624	146280624	+	RNA	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chrX:146280624C>A	ENST00000385136.2	-	0	21					NR_031708.1				microRNA 513b																		aatgacacctccttgtgaaag	0.418																																																0			X											101.0	82.0	88.0					X																	146280624		1568	3582	5150	146088316			0					Xq27.3	2011-09-12		2008-12-18	ENSG00000207871	ENSG00000207871		"""ncRNAs / Micro RNAs"""	33935	non-coding RNA	RNA, micro				MIRN513B			Standard	NR_031708		Approved	hsa-mir-513b					X.37:g.146280624C>A		Somatic		Capture	Illumina GAIIx	4	146088316		RNA	SNP	-	NULL	ENST00000385136.2	37	NULL		X																																																																																			-	-		0.418	MIR513B-201	KNOWN	basic	miRNA	MIRN513B	miRNA		C	NR_031708		146088316	-1	no_errors	ENST00000385136	ensembl	human	known	54_36p	rna	SNP	0.256	A
THEM5	284486	genome.wustl.edu	37	1	151824771	151824771	+	Silent	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:151824771C>A	ENST00000368817.5	-	2	419	c.288G>T	c.(286-288)cgG>cgT	p.R96R	AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5	96					cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GCTTGAGTCCCCGGATGTGGT	0.537																																																0			1											131.0	115.0	121.0					1																	151824771		2203	4300	6503	150091395	SO:0001819	synonymous_variant	284486			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.288G>T	1.37:g.151824771C>A		Somatic		Capture	Illumina GAIIx	4	150091395	Q5T1C3	Silent	SNP	superfamily_SSF54637,HMMPfam_4HBT	p.R96	ENST00000368817.5	37	c.288	CCDS1005.1	1	.	.	.	.	.	.	.	.	.	.	C	0.083	-1.180231	0.01633	.	.	ENSG00000196407	ENST00000453881	.	.	.	5.28	-2.92	0.05615	.	.	.	.	.	T	0.06508	0.0167	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.34502	-0.9826	4	.	.	.	-5.479	1.3525	0.02176	0.1451:0.3085:0.1424:0.4041	.	.	.	.	V	43	.	.	G	-	2	0	THEM5	150091395	0.004000	0.15560	0.020000	0.16555	0.021000	0.10359	-0.364000	0.07583	-0.154000	0.11118	0.655000	0.94253	GGG	-	NULL		0.537	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THEM5	protein_coding	OTTHUMT00000036678.2	C	NM_182578		150091395	-1	no_errors	NM_182578	genbank	human	validated	54_36p	silent	SNP	0.900	A
LCE1F	353137	genome.wustl.edu	37	1	152749037	152749037	+	Missense_Mutation	SNP	G	G	T	rs149277953	byFrequency	TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:152749037G>T	ENST00000334371.2	+	1	190	c.190G>T	c.(190-192)Ggt>Tgt	p.G64C		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	64	Poly-Gly.				keratinization (GO:0031424)			p.G64_G65delGG(1)		kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGCTCTGGGGGTGGTGGCTG	0.672																																																1	Deletion - In frame(1)	stomach(1)	1											30.0	33.0	32.0					1																	152749037		2201	4299	6500	151015661	SO:0001583	missense	353137				CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.190G>T	1.37:g.152749037G>T	ENSP00000334187:p.Gly64Cys	Somatic		Capture	Illumina GAIIx	4	151015661		Missense_Mutation	SNP	NULL	p.G64C	ENST00000334371.2	37	c.190	CCDS1023.1	1	.	.	.	.	.	.	.	.	.	.	G	0.313	-0.966748	0.02232	.	.	ENSG00000240386	ENST00000334371	T	0.03889	3.77	3.4	-6.78	0.01721	.	.	.	.	.	T	0.01661	0.0053	L	0.39245	1.2	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47649	-0.9101	9	0.87932	D	0	.	14.4444	0.67340	0.0:0.0:0.7696:0.2304	.	64	Q5T754	LCE1F_HUMAN	C	64	ENSP00000334187:G64C	ENSP00000334187:G64C	G	+	1	0	LCE1F	151015661	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.316000	0.08071	-0.746000	0.04766	-0.459000	0.05422	GGT	-	NULL		0.672	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1F	protein_coding	OTTHUMT00000034523.2	G	NM_178354		151015661	+1	no_errors	NM_178354	genbank	human	validated	54_36p	missense	SNP	0.019	T
NPR1	4881	genome.wustl.edu	37	1	153659203	153659203	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:153659203T>C	ENST00000368680.3	+	11	2312	c.1840T>C	c.(1840-1842)Tac>Cac	p.Y614H		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	614	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CCTCACAGAGTACTGTCCCCG	0.602																																					Pancreas(141;1349 1870 15144 15830 40702)											0			1											70.0	65.0	67.0					1																	153659203		2203	4300	6503	151925827	SO:0001583	missense	4881			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1840T>C	1.37:g.153659203T>C	ENSP00000357669:p.Tyr614His	Somatic		Capture	Illumina GAIIx	4	151925827	B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_ANF_RECEPTORS,HMMSmart_SM00219,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Pkinase,HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.Y614H	ENST00000368680.3	37	c.1840	CCDS1051.1	1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.950966	0.73787	.	.	ENSG00000169418	ENST00000368680;ENST00000428723	T	0.68903	-0.36	4.11	4.11	0.48088	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.74520	0.3727	M	0.80028	2.48	0.80722	D	1	D;D	0.71674	0.993;0.998	D;D	0.70016	0.914;0.967	T	0.76110	-0.3079	10	0.42905	T	0.14	.	11.4002	0.49866	0.0:0.0:0.0:1.0	.	93;614	B7Z4Y7;P16066	.;ANPRA_HUMAN	H	614;93	ENSP00000357669:Y614H	ENSP00000357669:Y614H	Y	+	1	0	NPR1	151925827	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.986000	0.70563	1.852000	0.53769	0.379000	0.24179	TAC	-	HMMSmart_SM00219,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Pkinase		0.602	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	protein_coding	OTTHUMT00000090034.1	T	NM_000906		151925827	+1	no_errors	NM_000906	genbank	human	validated	54_36p	missense	SNP	1.000	C
SUCNR1	56670	genome.wustl.edu	37	3	151599177	151599177	+	Silent	SNP	T	T	G			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr3:151599177T>G	ENST00000362032.5	+	3	951	c.846T>G	c.(844-846)ccT>ccG	p.P282P	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_033050.4	NP_149039.2	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	282						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	TGACACGGCCTTTGGCCTTTC	0.468																																																0			3											166.0	147.0	153.0					3																	151599177		2203	4300	6503	153081867	SO:0001819	synonymous_variant	56670			AF348078	CCDS3162.1	3q25.1	2012-08-21	2004-07-08	2004-07-09	ENSG00000198829	ENSG00000198829		"""GPCR / Class A : Orphans"""	4542	protein-coding gene	gene with protein product		606381	"""G protein-coupled receptor 91"""	GPR91		11273702, 15141213, 17192395	Standard	NM_033050		Approved		uc003ezf.2	Q9BXA5	OTTHUMG00000159880	ENST00000362032.5:c.846T>G	3.37:g.151599177T>G		Somatic		Capture	Illumina GAIIx	4	153081867	A8K305|Q8TDQ8	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.P282	ENST00000362032.5	37	c.846	CCDS3162.1	3																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.468	SUCNR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCNR1	protein_coding	OTTHUMT00000357897.2	T	NM_033050		153081867	+1	no_errors	NM_033050	genbank	human	provisional	54_36p	silent	SNP	0.008	G
FCGR3A	2214	genome.wustl.edu	37	1	161569434	161569434	+	Intron	SNP	A	A	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:161569434A>T	ENST00000540048.1	-	2	94				FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR2C_ENST00000543859.1_RNA|FCGR2C_ENST00000466542.2_RNA|RP11-25K21.6_ENST00000537821.2_RNA			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	ctggacgtcaaatgattgcca	0.448																																																0			1											51.0	50.0	51.0					1																	161569434		2189	4296	6485	159836058	SO:0001627	intron_variant	9103			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+30723T>A	1.37:g.161569434A>T		Somatic		Capture	Illumina GAIIx	4	159836058	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig	p.Q271H	ENST00000540048.1	37	c.813		1																																																																																			-	NULL		0.448	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	FCGR2C	protein_coding		A	NM_000569		159836058	+1	pseudogene	NM_201563	genbank	human	provisional	54_36p	missense	SNP	0.097	T
PLG	5340	genome.wustl.edu	37	6	161139775	161139775	+	Nonsense_Mutation	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr6:161139775G>A	ENST00000308192.9	+	9	1064	c.1001G>A	c.(1000-1002)tGg>tAg	p.W334*		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	334	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	AGGGCCCCATGGTGCCATACA	0.463																																																0			6											85.0	85.0	85.0					6																	161139775		2203	4300	6503	161059765	SO:0001587	stop_gained	5340			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1001G>A	6.37:g.161139775G>A	ENSP00000308938:p.Trp334*	Somatic		Capture	Illumina GAIIx	4	161059765	Q15146|Q5TEH4|Q6PA00	Nonsense_Mutation	SNP	HMMPfam_PAN_1,superfamily_SSF57414,HMMSmart_PAN_AP,superfamily_Kringle-like,HMMSmart_KR,HMMPfam_Kringle,PatternScan_KRINGLE_1,superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.W334*	ENST00000308192.9	37	c.1001	CCDS5279.1	6	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790860	0.90367	.	.	ENSG00000122194	ENST00000308192	.	.	.	5.2	5.2	0.72013	.	0.000000	0.37348	U	0.002123	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6707	0.88216	0.0:0.0:1.0:0.0	.	.	.	.	X	334	.	ENSP00000308938:W334X	W	+	2	0	PLG	161059765	1.000000	0.71417	1.000000	0.80357	0.150000	0.21749	8.492000	0.90471	2.708000	0.92522	0.563000	0.77884	TGG	-	HMMSmart_KR,superfamily_Kringle-like,HMMPfam_Kringle,PatternScan_KRINGLE_1		0.463	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	protein_coding	OTTHUMT00000042959.2	G	NM_000301		161059765	+1	no_errors	NM_000301	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
LAMC2	3918	genome.wustl.edu	37	1	183195831	183195831	+	Splice_Site	SNP	A	A	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:183195831A>C	ENST00000264144.4	+	9	1131		c.e9-1		LAMC2_ENST00000493293.1_Splice_Site	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2						cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						TCTCGATTGCAGGTACTGGGT	0.458																																																0			1											93.0	97.0	95.0					1																	183195831		2203	4300	6503	181462454	SO:0001630	splice_region_variant	3918			Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.1067-1A>C	1.37:g.183195831A>C		Somatic		Capture	Illumina GAIIx	4	181462454	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Splice_Site	SNP	-	e9-2	ENST00000264144.4	37	c.1067-2	CCDS1352.1	1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002529	0.74932	.	.	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4012	0.74843	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LAMC2	181462454	1.000000	0.71417	0.999000	0.59377	0.781000	0.44180	8.557000	0.90700	2.032000	0.59987	0.448000	0.29417	.	-	-		0.458	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC2	protein_coding	OTTHUMT00000086258.1	A	NM_005562	Intron	181462454	+1	no_errors	NM_005562	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
SSFA2	6744	genome.wustl.edu	37	2	182778598	182778598	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:182778598C>A	ENST00000431877.2	+	10	1692	c.1513C>A	c.(1513-1515)Cat>Aat	p.H505N	SSFA2_ENST00000409001.1_Missense_Mutation_p.H505N|SSFA2_ENST00000428267.2_Missense_Mutation_p.H352N|SSFA2_ENST00000320370.7_Missense_Mutation_p.H505N|SSFA2_ENST00000409136.1_Missense_Mutation_p.H14N	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	505						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TGCAAGTCAGCATTCCGATAG	0.328																																																0			2											118.0	109.0	112.0					2																	182778598		2202	4300	6502	182486843	SO:0001583	missense	6744			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.1513C>A	2.37:g.182778598C>A	ENSP00000388731:p.His505Asn	Somatic		Capture	Illumina GAIIx	4	182486843	A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	NULL	p.H505N	ENST00000431877.2	37	c.1513	CCDS46467.1	2	.	.	.	.	.	.	.	.	.	.	C	23.7	4.444086	0.83993	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136	T;T;T;T;T	0.17054	2.54;2.3;2.53;2.54;2.31	5.16	5.16	0.70880	.	0.110757	0.64402	D	0.000007	T	0.44456	0.1294	M	0.73598	2.24	0.51012	D	0.999906	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;D;D;D	0.81914	0.995;0.991;0.991;0.991	T	0.32851	-0.9891	10	0.49607	T	0.09	-13.6133	19.0221	0.92919	0.0:1.0:0.0:0.0	.	352;505;505;505	E7END2;E9PHV5;P28290;P28290-3	.;.;SSFA2_HUMAN;.	N	505;505;505;352;14	ENSP00000388731:H505N;ENSP00000314669:H505N;ENSP00000387319:H505N;ENSP00000409867:H352N;ENSP00000386916:H14N	ENSP00000314669:H505N	H	+	1	0	SSFA2	182486843	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.465000	0.73538	2.554000	0.86153	0.557000	0.71058	CAT	-	NULL		0.328	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	protein_coding	OTTHUMT00000255793.2	C	NM_006751		182486843	+1	no_errors	NM_006751	genbank	human	validated	54_36p	missense	SNP	1.000	A
EHHADH	1962	genome.wustl.edu	37	3	184910608	184910608	+	Silent	SNP	C	C	T	rs150207107		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr3:184910608C>T	ENST00000231887.3	-	7	1653	c.1578G>A	c.(1576-1578)ggG>ggA	p.G526G	EHHADH_ENST00000456310.1_Silent_p.G430G|EHHADH-AS1_ENST00000417720.1_RNA	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	526	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			CCACATCCAACCCAGCAAGAT	0.473																																																0			3						C	,	0,4406		0,0,2203	62.0	61.0	61.0		1290,1578	0.8	1.0	3	dbSNP_134	61	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	EHHADH	NM_001166415.1,NM_001966.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	430/628,526/724	184910608	1,13005	2203	4300	6503	186393302	SO:0001819	synonymous_variant	1962			L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1578G>A	3.37:g.184910608C>T		Somatic		Capture	Illumina GAIIx	4	186393302	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Silent	SNP	superfamily_SSF52096,HMMPfam_ECH,PatternScan_ENOYL_COA_HYDRATASE,superfamily_NAD(P)-bd,HMMPfam_3HCDH_N,PatternScan_3HCDH,superfamily_6DGDH_C_like,HMMPfam_3HCDH	p.G526	ENST00000231887.3	37	c.1578	CCDS33901.1	3																																																																																			-	superfamily_6DGDH_C_like,HMMPfam_3HCDH		0.473	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHHADH	protein_coding	OTTHUMT00000345326.1	C			186393302	-1	no_errors	NM_001966	genbank	human	validated	54_36p	silent	SNP	1.000	T
LIPH	200879	genome.wustl.edu	37	3	185252855	185252855	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr3:185252855G>C	ENST00000296252.4	-	2	256	c.115C>G	c.(115-117)Cta>Gta	p.L39V	LIPH_ENST00000424591.2_Missense_Mutation_p.L39V	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	39					lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CTCACATTTAGTCCCGTACCA	0.458																																																0			3											163.0	165.0	164.0					3																	185252855		2203	4300	6503	186735549	SO:0001583	missense	200879			AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.115C>G	3.37:g.185252855G>C	ENSP00000296252:p.Leu39Val	Somatic		Capture	Illumina GAIIx	4	186735549	A2IBA7|Q8TEC7	Missense_Mutation	SNP	PatternScan_LIPASE_SER,superfamily_SSF53474,HMMPfam_Lipase	p.L39V	ENST00000296252.4	37	c.115	CCDS3272.1	3	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835508	0.50951	.	.	ENSG00000163898	ENST00000296252;ENST00000424591	D;D	0.91124	-2.79;-2.79	6.08	6.08	0.98989	Lipase, N-terminal (1);	0.137199	0.50627	D	0.000120	D	0.92018	0.7471	L	0.35644	1.08	0.47308	D	0.999384	D;P	0.69078	0.997;0.938	P;P	0.62298	0.9;0.773	D	0.88632	0.3170	10	0.19590	T	0.45	-15.6121	19.6529	0.95825	0.0:0.0:1.0:0.0	.	39;39	A2IBA6;Q8WWY8	.;LIPH_HUMAN	V	39	ENSP00000296252:L39V;ENSP00000396384:L39V	ENSP00000296252:L39V	L	-	1	2	LIPH	186735549	1.000000	0.71417	0.135000	0.22099	0.367000	0.29736	4.192000	0.58378	2.890000	0.99128	0.655000	0.94253	CTA	-	superfamily_SSF53474,HMMPfam_Lipase		0.458	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPH	protein_coding	OTTHUMT00000345153.1	G			186735549	-1	no_errors	NM_139248	genbank	human	reviewed	54_36p	missense	SNP	0.980	C
MFSD6	54842	genome.wustl.edu	37	2	191301892	191301892	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:191301892G>T	ENST00000392328.1	+	3	1461	c.1137G>T	c.(1135-1137)atG>atT	p.M379I	MFSD6_ENST00000281416.7_Missense_Mutation_p.M379I	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	379					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						GCGTTCTCATGACCATGGCCT	0.507																																																0			2											84.0	71.0	75.0					2																	191301892		2203	4300	6503	191010137	SO:0001583	missense	54842				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.1137G>T	2.37:g.191301892G>T	ENSP00000376141:p.Met379Ile	Somatic		Capture	Illumina GAIIx	4	191010137	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.M379I	ENST00000392328.1	37	c.1137	CCDS2306.1	2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570077	0.86542	.	.	ENSG00000151690	ENST00000392328;ENST00000281416	T;T	0.80480	-1.38;-1.38	6.16	6.16	0.99307	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.83450	0.5257	L	0.34521	1.04	0.80722	D	1	D	0.55800	0.973	P	0.58780	0.845	T	0.80614	-0.1304	10	0.34782	T	0.22	-38.3478	19.848	0.96722	0.0:0.0:1.0:0.0	.	379	Q6ZSS7	MFSD6_HUMAN	I	379	ENSP00000376141:M379I;ENSP00000281416:M379I	ENSP00000281416:M379I	M	+	3	0	MFSD6	191010137	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	ATG	-	superfamily_MFS_gen_substrate_transporter		0.507	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6	protein_coding	OTTHUMT00000255931.1	G			191010137	+1	no_errors	NM_017694	genbank	human	validated	54_36p	missense	SNP	1.000	T
METTL21A	151194	genome.wustl.edu	37	2	208477946	208477946	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:208477946G>C	ENST00000411432.1	-	4	697	c.481C>G	c.(481-483)Cat>Gat	p.H161D	METTL21A_ENST00000442521.1_Missense_Mutation_p.H161D|METTL21A_ENST00000426075.1_Missense_Mutation_p.H161D|METTL21A_ENST00000458426.1_Intron|METTL21A_ENST00000272839.3_Missense_Mutation_p.H179D|METTL21A_ENST00000477919.1_5'Flank|METTL21A_ENST00000432416.1_Intron|METTL21A_ENST00000448823.2_3'UTR|METTL21A_ENST00000448007.2_Missense_Mutation_p.H161D|METTL21A_ENST00000425132.1_Intron|METTL21A_ENST00000406927.2_Missense_Mutation_p.H161D	NM_001127395.1	NP_001120867.1	Q8WXB1	MT21A_HUMAN	methyltransferase like 21A	161					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	cytoplasm (GO:0005737)	ATPase binding (GO:0051117)|Hsp70 protein binding (GO:0030544)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|stomach(1)	10						CTACAGAGATGTTCCAGTGTC	0.393																																																0			2											135.0	136.0	136.0					2																	208477946		2203	4300	6503	208186191	SO:0001583	missense	151194			AK093812, AF455817	CCDS2376.1	2q33.3	2013-09-30	2011-03-03	2011-03-03	ENSG00000144401	ENSG00000144401			30476	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 557b"", ""heat shock protein 70kDa lysine (K) methyltransferase"""	615257	"""family with sequence similarity 119, member A"""	FAM119A		23921388	Standard	NM_145280		Approved	LOC151194, HCA557b, HSPA-KMT	uc010fuk.1	Q8WXB1	OTTHUMG00000132934	ENST00000411432.1:c.481C>G	2.37:g.208477946G>C	ENSP00000415115:p.His161Asp	Somatic		Capture	Illumina GAIIx	4	208186191	Q53RV0|Q8N1Z9|Q96GH6	Missense_Mutation	SNP	HMMPfam_Methyltransf_16,superfamily_S-adenosyl-L-methionine-dependent methyltransferases	p.H161D	ENST00000411432.1	37	c.481	CCDS2376.1	2	.	.	.	.	.	.	.	.	.	.	G	13.23	2.173994	0.38413	.	.	ENSG00000144401	ENST00000411432;ENST00000448007;ENST00000272839;ENST00000406927;ENST00000426075;ENST00000442521	T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38	5.36	-0.601	0.11638	.	0.225765	0.53938	D	0.000054	T	0.11324	0.0276	L	0.28556	0.865	0.58432	D	0.999998	B	0.18610	0.029	B	0.26614	0.071	T	0.20306	-1.0279	10	0.23891	T	0.37	-4.1524	10.0857	0.42417	0.3952:0.0:0.6048:0.0	.	161	Q8WXB1	MT21A_HUMAN	D	161;161;179;161;161;161	ENSP00000415115:H161D;ENSP00000407622:H161D;ENSP00000272839:H179D;ENSP00000385481:H161D;ENSP00000403317:H161D;ENSP00000392062:H161D	ENSP00000272839:H179D	H	-	1	0	METTL21A	208186191	0.935000	0.31712	0.135000	0.22099	0.995000	0.86356	1.435000	0.34969	-0.307000	0.08804	0.561000	0.74099	CAT	-	HMMPfam_Methyltransf_16,superfamily_S-adenosyl-L-methionine-dependent methyltransferases		0.393	METTL21A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM119A	protein_coding	OTTHUMT00000337044.1	G	NM_145280		208186191	-1	no_errors	NM_145280	genbank	human	validated	54_36p	missense	SNP	0.975	C
FN1	2335	genome.wustl.edu	37	2	216226788	216226788	+	Missense_Mutation	SNP	G	G	T	rs150636748		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr2:216226788G>T	ENST00000359671.1	-	44	7258	c.6993C>A	c.(6991-6993)gaC>gaA	p.D2331E	FN1_ENST00000323926.6_Missense_Mutation_p.D2391E|FN1_ENST00000336916.4_Missense_Mutation_p.D2300E|FN1_ENST00000432072.2_Missense_Mutation_p.D2212E|FN1_ENST00000357867.4_Missense_Mutation_p.D2121E|FN1_ENST00000346544.3_Missense_Mutation_p.D2156E|FN1_ENST00000357009.2_3'UTR|FN1_ENST00000421182.1_Missense_Mutation_p.D2185E|FN1_ENST00000345488.5_Missense_Mutation_p.D2129E|FN1_ENST00000446046.1_Missense_Mutation_p.D2275E|FN1_ENST00000443816.1_Missense_Mutation_p.D2210E|FN1_ENST00000354785.4_Missense_Mutation_p.D2422E|FN1_ENST00000356005.4_Missense_Mutation_p.D2241E			P02751	FINC_HUMAN	fibronectin 1	2331	Fibrin-binding 2.|Fibronectin type-I 12. {ECO:0000255|PROSITE-ProRule:PRU00478}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TGCGGCAGTTGTCACAGCGCC	0.473																																																0			2						G	GLU/ASP,GLU/ASP,GLU/ASP,GLU/ASP,GLU/ASP	0,4406		0,0,2203	97.0	86.0	90.0		6900,6363,6723,6825,7266	4.2	1.0	2	dbSNP_134	90	1,8599		0,1,4299	no	missense,missense,missense,missense,missense	FN1	NM_002026.2,NM_212474.1,NM_212476.1,NM_212478.1,NM_212482.1	45,45,45,45,45	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	2300/2356,2121/2177,2241/2297,2275/2331,2422/2478	216226788	1,13005	2203	4300	6503	215935033	SO:0001583	missense	2335				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.6993C>A	2.37:g.216226788G>T	ENSP00000352696:p.Asp2331Glu	Somatic		Capture	Illumina GAIIx	4	215935033	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	superfamily_Fibronectin type I module,HMMPfam_fn1,PatternScan_FN1_1,HMMSmart_SM00058,PatternScan_EGF_1,superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,PatternScan_ALDEHYDE_DEHYDR_GLU	p.D2422E	ENST00000359671.1	37	c.7266		2	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406485	0.62399	0.0	1.16E-4	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T	0.43294	0.95;2.29;2.47;1.04;2.58;2.23;2.48;2.23;2.22;1.72;1.03;1.67;1.0	5.97	4.16	0.48862	Fibronectin, type I (2);	0.000000	0.64402	D	0.000001	T	0.37320	0.0999	N	0.03050	-0.425	0.80722	D	1	B;B;B;D;D;B;D;D;D;D;D	0.65815	0.165;0.141;0.165;0.995;0.992;0.052;0.992;0.995;0.995;0.995;0.992	B;B;B;D;D;B;D;D;D;D;D	0.85130	0.069;0.174;0.069;0.995;0.989;0.043;0.989;0.995;0.995;0.997;0.992	T	0.43130	-0.9410	10	0.31617	T	0.26	.	12.157	0.54083	0.1374:0.0:0.8626:0.0	.	2212;2391;2121;2241;2275;2300;2332;2185;2210;2422;2331	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15;P02751	.;.;.;.;.;.;.;.;.;.;FINC_HUMAN	E	2185;2391;2300;2121;2422;2332;2331;2156;2129;2275;2210;2212;2241;1048	ENSP00000394423:D2185E;ENSP00000323534:D2391E;ENSP00000338200:D2300E;ENSP00000350534:D2121E;ENSP00000346839:D2422E;ENSP00000352696:D2331E;ENSP00000265312:D2156E;ENSP00000273049:D2129E;ENSP00000410422:D2275E;ENSP00000415018:D2210E;ENSP00000399538:D2212E;ENSP00000348285:D2241E;ENSP00000416139:D1048E	ENSP00000265313:D2332E	D	-	3	2	FN1	215935033	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.335000	0.59298	1.528000	0.49103	0.650000	0.86243	GAC	-	superfamily_Fibronectin type I module,HMMSmart_SM00058		0.473	FN1-204	KNOWN	basic	protein_coding	FN1	protein_coding		G	NM_212476		215935033	-1	no_errors	NM_212482	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	1	220490783	220490783	+	IGR	SNP	C	C	T			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:220490783C>T								RAB3GAP2 (44987 upstream) : RP11-302I18.3 (42289 downstream)																							TGCCTAGCAGCACCATGGCCT	0.493																																																0			1																																								218557406	SO:0001628	intergenic_variant	643779																															1.37:g.220490783C>T		Somatic		Capture	Illumina GAIIx	4	218557406		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.493					LOC643779			C			218557406	-1	pseudogene	XR_016941	genbank	human	model	54_36p	rna	SNP	1.000	T
OR2W5	441932	genome.wustl.edu	37	1	247655327	247655327	+	RNA	SNP	G	G	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:247655327G>A	ENST00000522351.1	+	0	958							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			ATGTGAAGGGGACCATGAAGA	0.502																																																0			1											76.0	75.0	75.0					1																	247655327		2203	4300	6503	245721950			441932					1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655327G>A		Somatic		Capture	Illumina GAIIx	4	245721950	B9EH85	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.D300N	ENST00000522351.1	37	c.898		1																																																																																			-	NULL		0.502	OR2W5-002	KNOWN	basic	processed_transcript	OR2W5	pseudogene	OTTHUMT00000375789.1	G	NM_001004698		245721950	+1	no_errors	NM_001004698	genbank	human	provisional	54_36p	missense	SNP	0.440	A
RP11-1L9.1	0	genome.wustl.edu	37	X	13396633	13396634	+	lincRNA	INS	-	-	TTT	rs56342446|rs386416644		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chrX:13396633_13396634insTTT	ENST00000446964.1	+	0	148																											gcattcttttctTTTTTTTTTT	0.475																																																0			X																																								13306555			0																															X.37:g.13396640_13396642dupTTT		Somatic		Capture	Illumina GAIIx	4	13306554		RNA	INS	-	NULL	ENST00000446964.1	37	NULL		X																																																																																			-	-		0.475	RP11-1L9.1-002	KNOWN	basic|exp_conf	lincRNA	LOC441481	lincRNA	OTTHUMT00000055793.1	-			13306555	-1	pseudogene	XR_038530	genbank	human	model	54_36p	rna	INS	0.002:0.003	TTT
MST1L	11223	genome.wustl.edu	37	1	17084730	17084730	+	RNA	DEL	G	G	-	rs369371609		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:17084730delG	ENST00000455405.2	-	0	286							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.R494fs*37(1)									AAGCACTGCCGGGCAGTCAGT	0.582																																																1	Deletion - Frameshift(1)	large_intestine(1)	1																																								16957317			11223			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084730delG		Somatic		Capture	Illumina GAIIx	4	16957317	B7WPB1|Q13209	Frame_Shift_Del	DEL	HMMPfam_PAN_1,superfamily_Kringle-like,HMMSmart_SM00130,HMMPfam_Kringle,PatternScan_KRINGLE_1,superfamily_Trypsin-like serine proteases,HMMPfam_Trypsin	p.R494fs	ENST00000455405.2	37	c.1480		1																																																																																			(deletion:cds_exon[16957298,16957375])	superfamily_Trypsin-like serine proteases,HMMPfam_Trypsin		0.582	MST1L-002	KNOWN	basic	processed_transcript	MSTP9	pseudogene	OTTHUMT00000400328.1	G	NM_001271733		16957317	-1	no_stop_codon	ENST00000389184	ensembl	human	known	54_36p	frame_shift_del	DEL	1.000	-
XPO4	64328	genome.wustl.edu	37	13	21401226	21401227	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr13:21401226_21401227delCT	ENST00000255305.6	-	7	890_891	c.819_820delAG	c.(817-822)agagttfs	p.RV273fs	XPO4_ENST00000400602.2_Frame_Shift_Del_p.RV273fs			Q9C0E2	XPO4_HUMAN	exportin 4	273					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		AGCTCCATAACTCTGCTGTCCA	0.426																																																0			13																																								20299227	SO:0001589	frameshift_variant	64328			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.819_820delAG	13.37:g.21401228_21401229delCT	ENSP00000255305:p.Arg273fs	Somatic		Capture	Illumina GAIIx	4	20299226	Q5VUZ5|Q8N3V6|Q9H934	Frame_Shift_Del	DEL	superfamily_ARM-type_fold	p.R273fs	ENST00000255305.6	37	c.820_819	CCDS41872.1	13																																																																																			(deletion:cds_exon[20299206,20299318])	superfamily_ARM-type_fold		0.426	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	protein_coding	OTTHUMT00000044096.1	CT	NM_022459		20299227	-1	no_errors	NM_022459	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000	-
L1TD1	54596	genome.wustl.edu	37	1	62675857	62675865	+	In_Frame_Del	DEL	GACTCTGTA	GACTCTGTA	-	rs369089117		TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	GACTCTGTA	GACTCTGTA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:62675857_62675865delGACTCTGTA	ENST00000498273.1	+	4	1706_1714	c.1411_1419delGACTCTGTA	c.(1411-1419)gactctgtadel	p.DSV471del	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	471	Glu-rich.									breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						TACTTTCATTGACTCTGTAGAGGATTCTG	0.426																																																0			1																																								62448453	SO:0001651	inframe_deletion	54596			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1411_1419delGACTCTGTA	1.37:g.62675857_62675865delGACTCTGTA	ENSP00000419901:p.Asp471_Val473del	Somatic		Capture	Illumina GAIIx	4	62448445	Q8NDA1|Q9NUV8|Q9NV78	In_Frame_Del	DEL	HMMPfam_Transposase_22	p.DSV471in_frame_del	ENST00000498273.1	37	c.1411_1419	CCDS619.1	1																																																																																			(deletion:cds_exon[62448043,62449632])	NULL		0.426	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	protein_coding	OTTHUMT00000024688.1	GACTCTGTA	NM_019079		62448453	+1	no_errors	NM_019079	genbank	human	validated	54_36p	in_frame_del	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.001	-
OBSCN	84033	genome.wustl.edu	37	1	228459688	228459689	+	Intron	INS	-	-	A			TCGA-29-1762-01A-01W-0633-09	TCGA-29-1762-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a0f76764-35a0-43d3-aeb4-70e9a37830e8	39d64d91-ce06-4d19-a16b-f02329a5b4af	g.chr1:228459688_228459689insA	ENST00000422127.1	+	18	5181				RP5-1139B12.3_ENST00000602947.1_RNA|RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000359599.6_Frame_Shift_Ins_p.E390fs|RP5-1139B12.2_ENST00000602517.1_RNA|OBSCN_ENST00000570156.2_Frame_Shift_Ins_p.E1918fs|OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000284548.11_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGTGCACAGGGAGGTGCAGGCT	0.599																																																0			1																																								226526312	SO:0001627	intron_variant	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5138-1782->A	1.37:g.228459689_228459689dupA		Somatic		Capture	Illumina GAIIx	4	226526311	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Ins	INS	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_ig,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.V1827fs	ENST00000422127.1	37	c.5476_5477	CCDS58065.1	1																																																																																			-	superfamily_SSF48726,HMMSmart_IG		0.599	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		-	NM_052843		226526312	+1	no_stop_codon	ENST00000359599	ensembl	human	known	54_36p	frame_shift_ins	INS	0.866:0.958	A
