#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	19	90854	90854	+	IGR	SNP	A	A	G	rs200254023		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:90854A>G								FAM138F (13164 upstream) : OR4F17 (16616 downstream)																							tccttagcaaactaaggcagg	0.398																																																0			19																																								41854	SO:0001628	intergenic_variant	0																															19.37:g.90854A>G		Somatic		Capture	Illumina GAIIx	4	41854		Missense_Mutation	SNP	NULL	p.V112A		37	c.335		19																																																																																			-	NULL	0	0.398					LOC100133841			A			41854	-1	no_start_codon:pseudogene	XM_001715845	genbank	human	model	54_36p	missense	SNP	0.000	G
SMARCA2	6595	genome.wustl.edu	37	9	2076321	2076321	+	Silent	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr9:2076321G>A	ENST00000382203.1	+	13	2237	c.2028G>A	c.(2026-2028)caG>caA	p.Q676Q	SMARCA2_ENST00000382194.1_Silent_p.Q676Q|SMARCA2_ENST00000357248.2_Silent_p.Q676Q|SMARCA2_ENST00000349721.2_Silent_p.Q676Q			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	676					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		ATGCTAAGCAGATCATTGAGT	0.393																																																0			9											130.0	132.0	131.0					9																	2076321		2203	4300	6503	2066321	SO:0001819	synonymous_variant	6595			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.2028G>A	9.37:g.2076321G>A		Somatic		Capture	Illumina GAIIx	4	2066321	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	HMMPfam_QLQ,HMMPfam_HSA,HMMSmart_SM00573,HMMPfam_BRK,HMMSmart_SM00592,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_SNF2_N,HMMSmart_SM00490,HMMPfam_Helicase_C,superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.Q676	ENST00000382203.1	37	c.2028	CCDS34977.1	9																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.393	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	protein_coding	OTTHUMT00000051505.1	G	NM_003070		2066321	+1	no_errors	NM_003070	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
TRPV3	162514	genome.wustl.edu	37	17	3436187	3436187	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr17:3436187T>A	ENST00000576742.1	-	8	1150	c.829A>T	c.(829-831)Att>Ttt	p.I277F	TRPV3_ENST00000572519.1_Missense_Mutation_p.I277F|TRPV3_ENST00000301365.4_Missense_Mutation_p.I277F	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	277					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	AGCTGCACAATCTCGGGCTGG	0.637																																																0			17											122.0	91.0	101.0					17																	3436187		2203	4300	6503	3382937	SO:0001583	missense	162514			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.829A>T	17.37:g.3436187T>A	ENSP00000461518:p.Ile277Phe	Somatic		Capture	Illumina GAIIx	4	3382937	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,HMMPfam_Ion_trans	p.I277F	ENST00000576742.1	37	c.829	CCDS11029.1	17	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785216	0.70337	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D;T	0.86366	-2.11;-0.46	5.05	5.05	0.67936	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000001	D	0.92724	0.7687	M	0.77616	2.38	0.54753	D	0.999983	P;D;P;D;D;D;P	0.71674	0.949;0.976;0.942;0.976;0.998;0.998;0.928	P;P;P;P;P;D;B	0.68943	0.747;0.905;0.543;0.905;0.905;0.961;0.408	D	0.93669	0.6988	10	0.87932	D	0	-8.3445	14.2773	0.66189	0.0:0.0:0.0:1.0	.	261;261;277;261;277;277;277	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	F	277;277;261	ENSP00000371338:I277F;ENSP00000301365:I277F	ENSP00000301365:I277F	I	-	1	0	TRPV3	3382937	1.000000	0.71417	0.997000	0.53966	0.467000	0.32768	3.130000	0.50508	2.023000	0.59567	0.459000	0.35465	ATT	-	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank		0.637	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPV3	protein_coding	OTTHUMT00000207379.2	T	NM_145068		3382937	-1	no_errors	NM_145068	genbank	human	reviewed	54_36p	missense	SNP	0.996	A
ART1	417	genome.wustl.edu	37	11	3680838	3680838	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr11:3680838G>A	ENST00000250693.1	+	3	190	c.89G>A	c.(88-90)cGa>cAa	p.R30Q	ART1_ENST00000529556.1_3'UTR	NM_004314.2	NP_004305.2	P52961	NAR1_HUMAN	ADP-ribosyltransferase 1	30					innate immune response (GO:0045087)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|skin(1)	8		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)		ATCACACGACGAGACCTCTTC	0.607																																																0			11											54.0	54.0	54.0					11																	3680838		2201	4298	6499	3637414	SO:0001583	missense	417			S74683	CCDS7744.1	11p15	2006-02-23			ENSG00000129744	ENSG00000129744		"""CD molecules"""	723	protein-coding gene	gene with protein product		601625				8812442	Standard	NM_004314		Approved	ART2, CD296	uc001lye.1	P52961	OTTHUMG00000011845	ENST00000250693.1:c.89G>A	11.37:g.3680838G>A	ENSP00000250693:p.Arg30Gln	Somatic		Capture	Illumina GAIIx	4	3637414	Q6NTD2|Q96KT9	Missense_Mutation	SNP	superfamily_SSF56399,HMMPfam_ART,PatternScan_ART	p.R30Q	ENST00000250693.1	37	c.89	CCDS7744.1	11	.	.	.	.	.	.	.	.	.	.	G	14.77	2.633244	0.47049	.	.	ENSG00000129744	ENST00000250693	T	0.08458	3.09	5.53	1.36	0.22044	.	0.456848	0.17733	N	0.163824	T	0.05318	0.0141	L	0.34521	1.04	0.09310	N	1	D	0.60160	0.987	B	0.42087	0.375	T	0.35425	-0.9789	10	0.13108	T	0.6	.	6.2419	0.20795	0.1272:0.0:0.5816:0.2912	.	30	P52961	NAR1_HUMAN	Q	30	ENSP00000250693:R30Q	ENSP00000250693:R30Q	R	+	2	0	ART1	3637414	0.446000	0.25665	0.562000	0.28370	0.860000	0.49131	1.139000	0.31504	0.628000	0.30357	0.467000	0.42956	CGA	-	NULL		0.607	ART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ART1	protein_coding	OTTHUMT00000032765.1	G	NM_004314		3637414	+1	no_errors	NM_004314	genbank	human	reviewed	54_36p	missense	SNP	0.728	A
DNM2	1785	genome.wustl.edu	37	19	10916607	10916607	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:10916607C>G	ENST00000355667.6	+	13	1589	c.1509C>G	c.(1507-1509)agC>agG	p.S503R	DNM2_ENST00000408974.4_Missense_Mutation_p.S503R|DNM2_ENST00000314646.5_Missense_Mutation_p.S503R|DNM2_ENST00000585892.1_Missense_Mutation_p.S503R|DNM2_ENST00000359692.6_Missense_Mutation_p.S503R|DNM2_ENST00000389253.4_Missense_Mutation_p.S503R	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	503					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			AGCAGAGGAGCACGCAGCTGA	0.597			"""F, N, Splice, Mis, O"""		ETP ALL																																		Rec	yes		19	19p13.2	1785	dynamin 2		L	0			19											174.0	137.0	150.0					19																	10916607		2203	4300	6503	10777607	SO:0001583	missense	1785				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.1509C>G	19.37:g.10916607C>G	ENSP00000347890:p.Ser503Arg	Somatic		Capture	Illumina GAIIx	4	10777607	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Missense_Mutation	SNP	HMMSmart_SM00053,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N,PatternScan_DYNAMIN,HMMPfam_Dynamin_M,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMPfam_GED,HMMSmart_SM00302	p.S503R	ENST00000355667.6	37	c.1509	CCDS45968.1	19	.	.	.	.	.	.	.	.	.	.	C	13.07	2.126198	0.37533	.	.	ENSG00000079805	ENST00000408974;ENST00000355667;ENST00000359692;ENST00000389253;ENST00000314646	T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69	5.64	4.6	0.57074	Dynamin central domain (1);Pleckstrin homology-type (1);	0.204052	0.41938	D	0.000786	T	0.71937	0.3399	M	0.65498	2.005	0.41845	D	0.990148	P;P;B;B;B;B	0.45986	0.87;0.598;0.143;0.313;0.369;0.379	P;B;B;B;B;B	0.45794	0.493;0.392;0.281;0.361;0.281;0.241	T	0.72616	-0.4239	10	0.36615	T	0.2	-17.8985	13.6609	0.62366	0.0:0.9241:0.0:0.0759	.	97;236;503;503;503;503	Q8N1K8;B4DJ53;A8K1B6;P50570-2;P50570;E9PEQ4	.;.;.;.;DYN2_HUMAN;.	R	503	ENSP00000386192:S503R;ENSP00000347890:S503R;ENSP00000352721:S503R;ENSP00000373905:S503R;ENSP00000313164:S503R	ENSP00000313164:S503R	S	+	3	2	DNM2	10777607	0.264000	0.24093	0.993000	0.49108	0.579000	0.36224	1.385000	0.34408	1.383000	0.46405	0.650000	0.86243	AGC	-	HMMPfam_Dynamin_M		0.597	DNM2-001	KNOWN	basic|CCDS	protein_coding	DNM2	protein_coding	OTTHUMT00000452592.1	C	NM_004945		10777607	+1	no_errors	NM_001005360	genbank	human	reviewed	54_36p	missense	SNP	0.959	G
ATP6V1C2	245973	genome.wustl.edu	37	2	10912036	10912036	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:10912036T>C	ENST00000272238.4	+	7	651	c.542T>C	c.(541-543)cTc>cCc	p.L181P	ATP6V1C2_ENST00000381661.3_Missense_Mutation_p.L181P|RP11-791G15.2_ENST00000606907.1_lincRNA	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	181					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		TCTGAATATCTCGTCACACTT	0.547																																					NSCLC(188;1042 2136 10807 16813 47705)											0			2											177.0	162.0	167.0					2																	10912036		2203	4300	6503	10829487	SO:0001583	missense	245973			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.542T>C	2.37:g.10912036T>C	ENSP00000272238:p.Leu181Pro	Somatic		Capture	Illumina GAIIx	4	10829487	Q96EL8	Missense_Mutation	SNP	HMMPfam_V-ATPase_C	p.L181P	ENST00000272238.4	37	c.542	CCDS42653.1	2	.	.	.	.	.	.	.	.	.	.	T	17.14	3.313790	0.60414	.	.	ENSG00000143882	ENST00000272238;ENST00000381661	T;T	0.68903	-0.36;-0.36	5.21	4.03	0.46877	.	0.122356	0.56097	D	0.000027	D	0.85248	0.5653	H	0.94385	3.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.87212	0.2248	10	0.87932	D	0	-0.0822	11.2299	0.48905	0.0:0.0:0.1541:0.8459	.	181;181	Q8NEY4-2;Q8NEY4	.;VATC2_HUMAN	P	181	ENSP00000272238:L181P;ENSP00000371077:L181P	ENSP00000272238:L181P	L	+	2	0	ATP6V1C2	10829487	1.000000	0.71417	0.009000	0.14445	0.606000	0.37113	7.680000	0.84062	0.794000	0.33899	0.459000	0.35465	CTC	-	HMMPfam_V-ATPase_C		0.547	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ATP6V1C2	protein_coding	OTTHUMT00000323555.1	T	NM_144583		10829487	+1	no_errors	NM_001039362	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
ECSIT	51295	genome.wustl.edu	37	19	11623906	11623906	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:11623906C>G	ENST00000270517.7	-	4	838	c.703G>C	c.(703-705)Gag>Cag	p.E235Q	ECSIT_ENST00000588998.1_Intron|ECSIT_ENST00000417981.2_Intron|ECSIT_ENST00000591104.1_Missense_Mutation_p.E235Q|ECSIT_ENST00000591352.1_Intron|ECSIT_ENST00000592312.1_Missense_Mutation_p.E119Q|ECSIT_ENST00000252440.7_Missense_Mutation_p.E235Q|RN7SL833P_ENST00000498758.2_RNA	NM_016581.4	NP_057665.2	Q9BQ95	ECSIT_HUMAN	ECSIT signalling integrator	235					BMP signaling pathway (GO:0030509)|innate immune response (GO:0045087)|mesoderm formation (GO:0001707)|oxidation-reduction process (GO:0055114)|regulation of oxidoreductase activity (GO:0051341)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	oxidoreductase activity, acting on NAD(P)H (GO:0016651)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	11						AGGTCAGGCTCCATGTGCCGC	0.642																																																0			19											52.0	48.0	49.0					19																	11623906		2203	4300	6503	11484906	SO:0001583	missense	51295			BC005119	CCDS12262.1, CCDS45979.1, CCDS45980.1, CCDS59353.1	19p13.2	2013-05-24	2013-05-24			ENSG00000130159		"""Mitochondrial respiratory chain complex assembly factors"""	29548	protein-coding gene	gene with protein product	"""signaling intermediate in Toll pathway evolutionarily conserved ortholog (mouse)"""	608388	"""ECSIT homolog (Drosophila)"""			10465784, 22982022	Standard	NM_001142464		Approved	SITPEC	uc002msb.3	Q9BQ95		ENST00000270517.7:c.703G>C	19.37:g.11623906C>G	ENSP00000270517:p.Glu235Gln	Somatic		Capture	Illumina GAIIx	4	11484906	E9PAN9|K7EMM0|Q96HQ7|Q9NYI1	Missense_Mutation	SNP	HMMPfam_ECSIT	p.E235Q	ENST00000270517.7	37	c.703	CCDS12262.1	19	.	.	.	.	.	.	.	.	.	.	c	14.11	2.438649	0.43326	.	.	ENSG00000130159	ENST00000270517;ENST00000252440	T;T	0.77489	-1.1;-1.1	4.91	3.86	0.44501	.	0.055115	0.64402	D	0.000001	D	0.82444	0.5038	M	0.63428	1.95	0.36749	D	0.882674	B;D	0.59767	0.222;0.986	B;P	0.55545	0.11;0.778	D	0.86368	0.1721	10	0.51188	T	0.08	-15.5773	14.5645	0.68165	0.0:0.8524:0.1476:0.0	.	235;235	Q9BQ95-2;Q9BQ95	.;ECSIT_HUMAN	Q	235	ENSP00000270517:E235Q;ENSP00000252440:E235Q	ENSP00000252440:E235Q	E	-	1	0	ECSIT	11484906	1.000000	0.71417	0.998000	0.56505	0.025000	0.11179	6.970000	0.76099	1.199000	0.43173	-0.191000	0.12829	GAG	-	HMMPfam_ECSIT		0.642	ECSIT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECSIT	protein_coding	OTTHUMT00000442603.2	C	NM_016581		11484906	-1	no_errors	NM_016581	genbank	human	validated	54_36p	missense	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	8	12237768	12237768	+	IGR	SNP	C	C	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr8:12237768C>T								FAM66A (11644 upstream) : RP11-351I21.11 (32567 downstream)																							GTGAGTCGTCCTCCATGTCGC	0.502																																																0			8																																								12282139	SO:0001628	intergenic_variant	649352																															8.37:g.12237768C>T		Somatic		Capture	Illumina GAIIx	4	12282139		RNA	SNP	-	NULL		37	NULL		8																																																																																			-	-	0	0.502					LOC649352			C			12282139	-1	pseudogene	XR_042361	genbank	human	model	54_36p	rna	SNP	0.973	T
ARNTL	406	genome.wustl.edu	37	11	13407320	13407320	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr11:13407320G>C	ENST00000403290.1	+	19	2057	c.1702G>C	c.(1702-1704)Gat>Cat	p.D568H	ARNTL_ENST00000361003.4_Missense_Mutation_p.D450H|ARNTL_ENST00000389707.4_Missense_Mutation_p.D567H|ARNTL_ENST00000396441.3_Missense_Mutation_p.D567H|ARNTL_ENST00000403482.3_Missense_Mutation_p.D566H|ARNTL_ENST00000403510.3_Missense_Mutation_p.D524H|ARNTL_ENST00000401424.1_Missense_Mutation_p.D525H|ARNTL_ENST00000389708.3_3'UTR			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	568	Interaction with CIART. {ECO:0000250|UniProtKB:Q9WTL8}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		TCCATATTCTGATAGTTCTTC	0.398																																																0			11											150.0	133.0	139.0					11																	13407320		2200	4294	6494	13363896	SO:0001583	missense	406			D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.1702G>C	11.37:g.13407320G>C	ENSP00000384517:p.Asp568His	Somatic		Capture	Illumina GAIIx	4	13363896	A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	Missense_Mutation	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH,HMMSmart_PAS,HMMPfam_PAS,superfamily_SSF55785,HMMPfam_PAS_3,HMMSmart_PAC	p.D567H	ENST00000403290.1	37	c.1699		11	.	.	.	.	.	.	.	.	.	.	G	14.10	2.435696	0.43224	.	.	ENSG00000133794	ENST00000396441;ENST00000389707;ENST00000401424;ENST00000403290;ENST00000361003;ENST00000403510;ENST00000339640;ENST00000403482	T;T;T;T;T;T;T	0.11385	3.13;3.13;3.13;3.13;2.78;3.13;3.12	5.13	5.13	0.70059	.	0.496393	0.19779	N	0.106280	T	0.17492	0.0420	L	0.29908	0.895	0.80722	D	1	B;P;P;P;B	0.46512	0.018;0.603;0.664;0.879;0.396	B;B;B;P;B	0.51385	0.015;0.366;0.388;0.668;0.125	T	0.00888	-1.1526	10	0.62326	D	0.03	.	18.3479	0.90328	0.0:0.0:1.0:0.0	.	566;525;568;567;524	O00327-7;O00327-1;O00327;O00327-8;A2I2N6	.;.;BMAL1_HUMAN;.;.	H	567;567;525;568;450;524;524;566	ENSP00000379718:D567H;ENSP00000374357:D567H;ENSP00000385915:D525H;ENSP00000384517:D568H;ENSP00000354278:D450H;ENSP00000385581:D524H;ENSP00000385897:D566H	ENSP00000340289:D524H	D	+	1	0	ARNTL	13363896	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.638000	0.67861	2.662000	0.90505	0.491000	0.48974	GAT	-	NULL		0.398	ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	ARNTL	protein_coding	OTTHUMT00000319173.1	G	NM_001178		13363896	+1	no_errors	NM_001030272	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
C3orf20	84077	genome.wustl.edu	37	3	14763290	14763290	+	Splice_Site	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr3:14763290G>T	ENST00000253697.3	+	10	2017	c.1565G>T	c.(1564-1566)cGg>cTg	p.R522L	C3orf20_ENST00000495387.1_3'UTR|C3orf20_ENST00000412910.1_Splice_Site_p.R400L|C3orf20_ENST00000435614.1_Splice_Site_p.R400L	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	522						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						TATGACAAACGGGTAAGGCAA	0.537																																																0			3											180.0	134.0	150.0					3																	14763290		2203	4300	6503	14738294	SO:0001630	splice_region_variant	84077			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.1566+1G>T	3.37:g.14763290G>T		Somatic		Capture	Illumina GAIIx	4	14738294	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	NULL	p.R522L	ENST00000253697.3	37	c.1565	CCDS33706.1	3	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147499	0.57151	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.12465	2.68;2.68;2.68	5.63	3.83	0.44106	.	0.469084	0.16313	N	0.219894	T	0.29389	0.0732	M	0.68317	2.08	0.39422	D	0.96693	D	0.71674	0.998	D	0.64237	0.923	T	0.03957	-1.0989	10	0.56958	D	0.05	-14.1332	7.9964	0.30271	0.1812:0.0:0.8188:0.0	.	522	Q8ND61	CC020_HUMAN	L	522;400;400	ENSP00000253697:R522L;ENSP00000402933:R400L;ENSP00000396081:R400L	ENSP00000253697:R522L	R	+	2	0	C3orf20	14738294	1.000000	0.71417	0.967000	0.41034	0.274000	0.26718	1.718000	0.38001	1.518000	0.48934	0.591000	0.81541	CGG	-	NULL		0.537	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf20	protein_coding	OTTHUMT00000340586.1	G	NM_032137	Missense_Mutation	14738294	+1	no_errors	NM_032137	genbank	human	predicted	54_36p	missense	SNP	0.957	T
INSC	387755	genome.wustl.edu	37	11	15222481	15222481	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr11:15222481C>A	ENST00000379554.3	+	7	992	c.946C>A	c.(946-948)Cac>Aac	p.H316N	INSC_ENST00000528567.1_Missense_Mutation_p.H269N|INSC_ENST00000525218.1_Intron|INSC_ENST00000447214.2_Intron|INSC_ENST00000379556.3_Missense_Mutation_p.H269N|INSC_ENST00000530161.1_Missense_Mutation_p.H269N|INSC_ENST00000424273.1_Intron	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	316					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						AGAGGGTGTCCACCAGCTGGA	0.612																																																0			11											34.0	35.0	34.0					11																	15222481		2102	4220	6322	15179057	SO:0001583	missense	387755			AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.946C>A	11.37:g.15222481C>A	ENSP00000368872:p.His316Asn	Somatic		Capture	Illumina GAIIx	4	15179057	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	PatternScan_PA2_HIS,superfamily_ARM repeat,HMMSmart_SM00185	p.H316N	ENST00000379554.3	37	c.946	CCDS41621.1	11	.	.	.	.	.	.	.	.	.	.	C	8.874	0.949903	0.18431	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000416761;ENST00000528567;ENST00000530161	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.04	5.04	0.67666	Armadillo-like helical (1);Armadillo-type fold (1);	0.434755	0.26812	N	0.022380	T	0.37320	0.0999	L	0.40543	1.245	0.80722	D	1	B;B;B	0.16396	0.017;0.001;0.013	B;B;B	0.15052	0.012;0.001;0.008	T	0.20505	-1.0273	10	0.40728	T	0.16	-18.0896	9.5019	0.39022	0.0:0.9036:0.0:0.0964	.	304;269;316	Q1MX18-5;A0PJX5;Q1MX18	.;.;INSC_HUMAN	N	316;269;304;269;269	ENSP00000368872:H316N;ENSP00000368874:H269N;ENSP00000435022:H269N;ENSP00000436194:H269N	ENSP00000368872:H316N	H	+	1	0	INSC	15179057	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.880000	0.39628	2.342000	0.79632	0.462000	0.41574	CAC	-	superfamily_ARM repeat,HMMSmart_SM00185		0.612	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSC	protein_coding	OTTHUMT00000386590.1	C	NM_001031853		15179057	+1	no_errors	NM_001031853	genbank	human	provisional	54_36p	missense	SNP	0.989	A
SLC9B1P4	644768	genome.wustl.edu	37	22	16915166	16915166	+	IGR	SNP	A	A	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr22:16915166A>T								AP000539.2 (338975 upstream) : KB-67B5.17 (86782 downstream)																							GTGGTTGAAAAATATCCCATA	0.254																																																0			22																																								15295166	SO:0001628	intergenic_variant	644768																															22.37:g.16915166A>T		Somatic		Capture	Illumina GAIIx	4	15295166		RNA	SNP	-	NULL		37	NULL		22																																																																																			-	-	0	0.254					LOC644768			A			15295166	-1	pseudogene	XR_016834	genbank	human	model	54_36p	rna	SNP	0.993	T
ABHD8	79575	genome.wustl.edu	37	19	17411733	17411733	+	Silent	SNP	A	A	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:17411733A>T	ENST00000247706.3	-	2	932	c.693T>A	c.(691-693)gcT>gcA	p.A231A	MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000595444.1_Intron|MRPL34_ENST00000594999.1_5'Flank	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	231							hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						GCATGTCCTCAGCCAGCGCAT	0.617																																					Ovarian(156;1368 2543 15275 41187)											0			19											74.0	80.0	78.0					19																	17411733		2203	4299	6502	17272733	SO:0001819	synonymous_variant	79575			AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.693T>A	19.37:g.17411733A>T		Somatic		Capture	Illumina GAIIx	4	17272733	Q9HAE9	Silent	SNP	superfamily_alpha/beta-Hydrolases,HMMPfam_Abhydrolase_1	p.A231	ENST00000247706.3	37	c.693	CCDS12355.1	19																																																																																			-	superfamily_alpha/beta-Hydrolases,HMMPfam_Abhydrolase_1		0.617	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD8	protein_coding	OTTHUMT00000462937.1	A	NM_024527		17272733	-1	no_errors	NM_024527	genbank	human	validated	54_36p	silent	SNP	0.241	T
CTAGE1	64693	genome.wustl.edu	37	18	19997133	19997133	+	5'Flank	SNP	T	T	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr18:19997133T>A	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.R214S			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					CTTCAAATGTTCTTTTCTGTT	0.363																																																0			18											110.0	107.0	108.0					18																	19997133		2198	4299	6497	18251131	SO:0001631	upstream_gene_variant	64693			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19997133T>A	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	18251131	B0YIZ3	Missense_Mutation	SNP	NULL	p.R214S	ENST00000525417.1	37	c.642		18	.	.	.	.	.	.	.	.	.	.	T	5.501	0.277450	0.10403	.	.	ENSG00000212710	ENST00000391403	T	0.30182	1.54	0.909	-0.548	0.11833	.	.	.	.	.	T	0.19087	0.0458	L	0.38175	1.15	0.09310	N	1	B	0.15930	0.015	B	0.19666	0.026	T	0.29518	-1.0009	8	.	.	.	.	3.0397	0.06134	0.0:0.3179:0.0:0.6821	.	214	Q96RT6	CTGE2_HUMAN	S	214	ENSP00000375220:R214S	.	R	-	3	2	CTAGE1	18251131	0.103000	0.21917	0.157000	0.22605	0.180000	0.23129	-0.350000	0.07721	-0.173000	0.10761	0.369000	0.22263	AGA	-	NULL		0.363	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	CTAGE1	protein_coding	OTTHUMT00000386767.1	T	NM_022663, NM_172241		18251131	-1	no_errors	NM_172241	genbank	human	validated	54_36p	missense	SNP	0.037	A
HAUS6	54801	genome.wustl.edu	37	9	19050426	19050426	+	IGR	SNP	T	T	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr9:19050426T>A	ENST00000380502.3	-	0	6536				RRAGA_ENST00000380527.1_Missense_Mutation_p.S257T	NM_001270890.1|NM_017645.4	NP_001257819.1|NP_060115.3	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6						centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						AGTTAGGAATTCCAACTTCGC	0.488																																																0			9											120.0	105.0	110.0					9																	19050426		2203	4300	6503	19040426	SO:0001628	intergenic_variant	10670			AL832495	CCDS6489.1	9p22.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000147874	ENSG00000147874		"""HAUS augmin-like complex subunits"""	25948	protein-coding gene	gene with protein product		613433	"""family with sequence similarity 29, member A"""	FAM29A		10997877, 19427217	Standard	NM_001270890		Approved	FLJ20060, KIAA1574, dgt6	uc003znk.4	Q7Z4H7	OTTHUMG00000019622		9.37:g.19050426T>A		Somatic		Capture	Illumina GAIIx	4	19040426	B3KPK4|B4DX82|Q05CG1|Q14CB6|Q14CD9|Q2TA91|Q6IQ10|Q6NZX5|Q8IZQ4|Q96FN0|Q9H950|Q9H998|Q9HCJ8|Q9NXT8	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Gtr1_RagA	p.S257T	ENST00000380502.3	37	c.769	CCDS6489.1	9	.	.	.	.	.	.	.	.	.	.	T	13.43	2.233453	0.39498	.	.	ENSG00000155876	ENST00000380527	T	0.65364	-0.15	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.57021	0.2025	L	0.59967	1.855	0.80722	D	1	B	0.10296	0.003	B	0.14023	0.01	T	0.53322	-0.8455	10	0.25751	T	0.34	-26.4788	12.9658	0.58483	0.0:0.0:0.0:1.0	.	257	Q7L523	RRAGA_HUMAN	T	257	ENSP00000369899:S257T	ENSP00000369899:S257T	S	+	1	0	RRAGA	19040426	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.306000	0.78905	2.236000	0.73375	0.533000	0.62120	TCC	-	HMMPfam_Gtr1_RagA		0.488	HAUS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRAGA	protein_coding	OTTHUMT00000051825.1	T	NM_017645		19040426	+1	no_errors	NM_006570	genbank	human	validated	54_36p	missense	SNP	1.000	A
NF1P1	100419006	genome.wustl.edu	37	15	21138099	21138099	+	IGR	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr15:21138099C>A								POTEB2 (66456 upstream) : MIR5701-1 (7481 downstream)																							TCTAGACCCACCAGGTCCTTA	0.433																																																0			15																																								19402758	SO:0001628	intergenic_variant	440225																															15.37:g.21138099C>A		Somatic		Capture	Illumina GAIIx	4	19402758		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.433					LOC440225			C			19402758	-1	pseudogene	XR_042334	genbank	human	model	54_36p	rna	SNP	1.000	A
SAP18	10284	genome.wustl.edu	37	13	21715102	21715102	+	Silent	SNP	T	T	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr13:21715102T>C	ENST00000607003.1	+	2	182	c.150T>C	c.(148-150)aaT>aaC	p.N50N	SAP18_ENST00000382533.4_Silent_p.N69N|SAP18_ENST00000485646.1_3'UTR|RN7SL80P_ENST00000580631.1_RNA|SNORD27_ENST00000516319.1_RNA			O00422	SAP18_HUMAN	Sin3A-associated protein, 18kDa	50					mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)			kidney(1)|large_intestine(1)|lung(4)	6		all_cancers(29;2.16e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.79e-05)|Epithelial(112;0.000292)|OV - Ovarian serous cystadenocarcinoma(117;0.00276)|Lung(94;0.0941)		CCCGGGGAAATGTACCGTCCA	0.587																																																0			13											102.0	99.0	100.0					13																	21715102		2203	4300	6503	20613102	SO:0001819	synonymous_variant	10284			U96915	CCDS9295.2	13q12.11	2008-02-05	2006-02-02		ENSG00000150459	ENSG00000150459			10530	protein-coding gene	gene with protein product		602949	"""sin3A-associated protein, 18kDa"""			9150135	Standard	NM_005870		Approved	SAP18p, 2HOR0202, MGC27131	uc001uns.3	O00422	OTTHUMG00000016535	ENST00000607003.1:c.150T>C	13.37:g.21715102T>C		Somatic		Capture	Illumina GAIIx	4	20613102	B2R494|Q2TTR4|Q6IAW9|Q8N606|Q9UF14	Silent	SNP	HMMPfam_SAP18	p.N50	ENST00000607003.1	37	c.150		13	.	.	.	.	.	.	.	.	.	.	T	15.87	2.961601	0.53400	.	.	ENSG00000150459	ENST00000450573	.	.	.	4.67	3.78	0.43462	.	.	.	.	.	T	0.60117	0.2244	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56968	-0.7891	4	.	.	.	-24.2742	10.3442	0.43897	0.0:0.8369:0.0:0.1631	.	.	.	.	R	64	.	.	C	+	1	0	SAP18	20613102	0.999000	0.42202	1.000000	0.80357	0.787000	0.44495	0.677000	0.25262	1.083000	0.41159	-0.608000	0.04076	TGT	-	HMMPfam_SAP18		0.587	SAP18-009	PUTATIVE	basic|appris_candidate	protein_coding	SAP18	protein_coding	OTTHUMT00000470725.1	T	NM_005870		20613102	+1	no_errors	NM_005870	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
APOB	338	genome.wustl.edu	37	2	21259975	21259975	+	Silent	SNP	G	G	T	rs151096846		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:21259975G>T	ENST00000233242.1	-	6	817	c.690C>A	c.(688-690)ggC>ggA	p.G230G	APOB_ENST00000399256.4_Silent_p.G230G	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	230	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACTTACCATGCCTTTGATGA	0.502																																																0			2						G		0,4406		0,0,2203	146.0	118.0	128.0		690	4.7	1.0	2	dbSNP_134	128	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	APOB	NM_000384.2		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		230/4564	21259975	1,13005	2203	4300	6503	21113480	SO:0001819	synonymous_variant	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.690C>A	2.37:g.21259975G>T		Somatic		Capture	Illumina GAIIx	4	21113480	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	superfamily_Lipovitellin-phosvitin complex beta-sheet shell regions,HMMPfam_Vitellogenin_N,HMMSmart_SM00638,superfamily_Lipovitellin-phosvitin complex superhelical domain,HMMPfam_DUF1943,HMMPfam_DUF1081	p.G230	ENST00000233242.1	37	c.690	CCDS1703.1	2																																																																																			-	superfamily_Lipovitellin-phosvitin complex beta-sheet shell regions,HMMPfam_Vitellogenin_N,HMMSmart_SM00638		0.502	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	G			21113480	-1	no_errors	NM_000384	genbank	human	reviewed	54_36p	silent	SNP	0.995	T
RECQL	5965	genome.wustl.edu	37	12	21643149	21643149	+	Silent	SNP	T	T	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr12:21643149T>G	ENST00000444129.2	-	4	846	c.378A>C	c.(376-378)ccA>ccC	p.P126P	RECQL_ENST00000421138.2_Silent_p.P126P	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	126	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						AACATAATGCTGGTAACTGGT	0.318								Other identified genes with known or suspected DNA repair function																																								0			12											103.0	99.0	100.0					12																	21643149		2203	4300	6503	21534416	SO:0001819	synonymous_variant	5965			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.378A>C	12.37:g.21643149T>G		Somatic		Capture	Illumina GAIIx	4	21534416	A8K6G2	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,HMMSmart_SM00490,HMMPfam_Helicase_C	p.P126	ENST00000444129.2	37	c.378	CCDS31756.1	12																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD		0.318	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	protein_coding	OTTHUMT00000402371.1	T	NM_002907		21534416	-1	no_errors	NM_002907	genbank	human	reviewed	54_36p	silent	SNP	0.979	G
CDH12	1010	genome.wustl.edu	37	5	21752143	21752143	+	Missense_Mutation	SNP	G	G	T	rs149905162		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr5:21752143G>T	ENST00000382254.1	-	15	3174	c.2088C>A	c.(2086-2088)gaC>gaA	p.D696E	CDH12_ENST00000522262.1_Missense_Mutation_p.D656E|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.D696E	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	696					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AACAGAGAGAGTCTGGTTTTA	0.458										HNSCC(59;0.17)																																						0			5											219.0	189.0	199.0					5																	21752143		2203	4300	6503	21787900	SO:0001583	missense	1010			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2088C>A	5.37:g.21752143G>T	ENSP00000371689:p.Asp696Glu	Somatic		Capture	Illumina GAIIx	4	21787900	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.D696E	ENST00000382254.1	37	c.2088	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	G	0.393	-0.922637	0.02396	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.75477	-0.94;-0.94;-0.94	5.12	3.17	0.36434	Cadherin, cytoplasmic domain (1);	0.246892	0.47852	N	0.000210	T	0.32556	0.0833	N	0.00277	-1.72	0.38585	D	0.950286	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.49322	-0.8952	10	0.02654	T	1	.	10.5257	0.44948	0.0:0.3832:0.4827:0.1341	.	656;696	B7Z2U6;P55289	.;CAD12_HUMAN	E	696;696;656	ENSP00000423577:D696E;ENSP00000371689:D696E;ENSP00000428786:D656E	ENSP00000371689:D696E	D	-	3	2	CDH12	21787900	.	.	0.996000	0.52242	0.967000	0.64934	.	.	1.133000	0.42147	0.467000	0.42956	GAC	-	HMMPfam_Cadherin_C		0.458	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	protein_coding	OTTHUMT00000207139.1	G	NM_004061		21787900	-1	no_errors	NM_004061	genbank	human	reviewed	54_36p	missense	SNP	0.017	T
Unknown	0	genome.wustl.edu	37	9	22162548	22162548	+	IGR	SNP	G	G	A	rs117980864	byFrequency	TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr9:22162548G>A								CDKN2B-AS1 (41452 upstream) : RP11-408N14.1 (41440 downstream)																							CTGCATATTTGATCCTTAATA	0.348													G|||	15	0.00299521	0.0	0.0029	5008	,	,		16295	0.0		0.0129	False		,,,				2504	0.0															0			9																																								22152548	SO:0001628	intergenic_variant	0																															9.37:g.22162548G>A		Somatic		Capture	Illumina GAIIx	4	22152548		Missense_Mutation	SNP	NULL	p.D94N		37	c.280		9																																																																																			-	NULL	0	0.348					LOC100133412			G			22152548	+1	no_start_codon:pseudogene:no_stop_codon	XM_001716309	genbank	human	model	54_36p	missense	SNP	0.000	A
MYO18B	84700	genome.wustl.edu	37	22	26422587	26422587	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr22:26422587A>T	ENST00000407587.2	+	43	6819	c.6650A>T	c.(6649-6651)aAg>aTg	p.K2217M	MYO18B_ENST00000335473.7_Missense_Mutation_p.K2216M|MYO18B_ENST00000536101.1_Missense_Mutation_p.K2216M			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2216						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GTCCAGAGAAAGTCCACAGAG	0.557																																																0			22											33.0	36.0	35.0					22																	26422587		1927	4123	6050	24752587	SO:0001583	missense	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.6650A>T	22.37:g.26422587A>T	ENSP00000386096:p.Lys2217Met	Somatic		Capture	Illumina GAIIx	4	24752587	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMPfam_IQ	p.K2216M	ENST00000407587.2	37	c.6647		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.41|14.41	2.527592|2.527592	0.44969|0.44969	.|.	.|.	ENSG00000133454|ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587|ENST00000543971	D;D;D|.	0.88201|.	-2.33;-2.33;-2.35|.	4.5|4.5	2.3|2.3	0.28687|0.28687	.|.	0.184196|.	0.26594|.	N|.	0.023506|.	T|T	0.40645|0.40645	0.1125|0.1125	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	D;D;D;D;D|.	0.89917|.	0.987;0.998;0.998;1.0;0.999|.	P;P;P;D;D|.	0.70016|.	0.821;0.818;0.818;0.967;0.912|.	T|T	0.31166|0.31166	-0.9953|-0.9953	10|5	0.87932|.	D|.	0|.	.|.	4.2088|4.2088	0.10502|0.10502	0.7214:0.0:0.0988:0.1798|0.7214:0.0:0.0988:0.1798	.|.	1729;2218;2216;2217;2216|.	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7|.	.;.;MY18B_HUMAN;.;.|.	M|C	2216;2216;2217|166	ENSP00000441229:K2216M;ENSP00000334563:K2216M;ENSP00000386096:K2217M|.	ENSP00000334563:K2216M|.	K|S	+|+	2|1	0|0	MYO18B|MYO18B	24752587|24752587	0.033000|0.033000	0.19621|0.19621	0.118000|0.118000	0.21660|0.21660	0.012000|0.012000	0.07955|0.07955	2.294000|2.294000	0.43567|0.43567	0.673000|0.673000	0.31224|0.31224	-0.468000|-0.468000	0.05107|0.05107	AAG|AGT	-	NULL		0.557	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	protein_coding	OTTHUMT00000400691.1	A	NM_032608		24752587	+1	no_errors	NM_032608	genbank	human	reviewed	54_36p	missense	SNP	0.004	T
ZKSCAN2	342357	genome.wustl.edu	37	16	25255398	25255398	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr16:25255398C>G	ENST00000328086.7	-	6	2492	c.1689G>C	c.(1687-1689)aaG>aaC	p.K563N		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	563					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		CATTTTTCACCTTGCGGTAAC	0.552																																																0			16											95.0	93.0	94.0					16																	25255398		2197	4300	6497	25162899	SO:0001583	missense	342357			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.1689G>C	16.37:g.25255398C>G	ENSP00000331626:p.Lys563Asn	Somatic		Capture	Illumina GAIIx	4	25162899	A1L3B4|Q6ZN77	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.K563N	ENST00000328086.7	37	c.1689	CCDS32410.1	16	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577936	0.65878	.	.	ENSG00000155592	ENST00000328086;ENST00000536768	T	0.49720	0.77	5.48	2.03	0.26663	.	0.095606	0.46442	D	0.000281	T	0.64616	0.2614	M	0.82323	2.585	0.35115	D	0.766487	D;D	0.89917	1.0;1.0	D;D	0.72982	0.979;0.979	T	0.70831	-0.4765	10	0.87932	D	0	-31.5886	6.463	0.21966	0.0:0.2934:0.0:0.7066	.	359;563	B4DYF0;Q63HK3	.;ZKSC2_HUMAN	N	563	ENSP00000331626:K563N	ENSP00000331626:K563N	K	-	3	2	ZKSCAN2	25162899	0.943000	0.32029	1.000000	0.80357	0.995000	0.86356	-0.333000	0.07894	0.463000	0.27118	-0.302000	0.09304	AAG	-	NULL		0.552	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN2	protein_coding	OTTHUMT00000435739.1	C	NM_001012981		25162899	-1	no_errors	NM_001012981	genbank	human	validated	54_36p	missense	SNP	1.000	G
KIAA0556	23247	genome.wustl.edu	37	16	27760950	27760950	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr16:27760950G>T	ENST00000261588.4	+	16	2688	c.2669G>T	c.(2668-2670)aGt>aTt	p.S890I		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	890						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AGGTGGCGCAGTGAGCAGGAG	0.617																																																0			16											107.0	102.0	103.0					16																	27760950		2197	4300	6497	27668451	SO:0001583	missense	23247			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.2669G>T	16.37:g.27760950G>T	ENSP00000261588:p.Ser890Ile	Somatic		Capture	Illumina GAIIx	4	27668451	A7E2C2	Missense_Mutation	SNP	superfamily_Galactose-binding domain-like,PatternScan_AKH	p.S890I	ENST00000261588.4	37	c.2669	CCDS32415.1	16	.	.	.	.	.	.	.	.	.	.	G	19.97	3.925012	0.73213	.	.	ENSG00000047578	ENST00000261588	T	0.12255	2.7	4.7	2.66	0.31614	.	0.147232	0.64402	D	0.000014	T	0.14614	0.0353	L	0.53249	1.67	0.20196	N	0.999924	P	0.49090	0.919	P	0.46718	0.525	T	0.08576	-1.0715	10	0.45353	T	0.12	-6.285	4.3987	0.11376	0.207:0.3871:0.4059:0.0	.	890	O60303	K0556_HUMAN	I	890	ENSP00000261588:S890I	ENSP00000261588:S890I	S	+	2	0	KIAA0556	27668451	0.960000	0.32886	0.045000	0.18777	0.576000	0.36127	1.649000	0.37281	1.063000	0.40649	0.655000	0.94253	AGT	-	NULL		0.617	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0556	protein_coding	OTTHUMT00000433724.1	G	NM_015202		27668451	+1	no_errors	NM_015202	genbank	human	validated	54_36p	missense	SNP	0.837	T
XPO6	23214	genome.wustl.edu	37	16	28167688	28167688	+	Silent	SNP	T	T	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr16:28167688T>A	ENST00000304658.5	-	7	1304	c.804A>T	c.(802-804)ccA>ccT	p.P268P	XPO6_ENST00000565698.1_Silent_p.P254P|XPO6_ENST00000561488.1_5'Flank	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	268					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						TAAGGAGGGATGGGGTGATGC	0.537																																																0			16											102.0	108.0	106.0					16																	28167688		2047	4194	6241	28075189	SO:0001819	synonymous_variant	23214			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.804A>T	16.37:g.28167688T>A		Somatic		Capture	Illumina GAIIx	4	28075189	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Silent	SNP	superfamily_ARM repeat,HMMPfam_IBN_N,HMMPfam_Xpo1	p.P268	ENST00000304658.5	37	c.804	CCDS42135.1	16																																																																																			-	superfamily_ARM repeat		0.537	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	protein_coding	OTTHUMT00000433732.1	T	XM_055195		28075189	-1	no_errors	NM_015171	genbank	human	provisional	54_36p	silent	SNP	0.750	A
HSD3B7	80270	genome.wustl.edu	37	16	30997959	30997959	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr16:30997959C>G	ENST00000297679.5	+	5	558	c.465C>G	c.(463-465)caC>caG	p.H155Q	AC135048.1_ENST00000602217.1_5'Flank|HSD3B7_ENST00000353250.5_Missense_Mutation_p.H155Q|HSD3B7_ENST00000262520.6_Missense_Mutation_p.H155Q	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	155					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						AAGCAGTGCACAGGCACCCCT	0.612																																																0			16											81.0	82.0	82.0					16																	30997959		2197	4300	6497	30905460	SO:0001583	missense	80270			AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.465C>G	16.37:g.30997959C>G	ENSP00000297679:p.His155Gln	Somatic		Capture	Illumina GAIIx	4	30905460	Q96M28|Q9BSN9	Missense_Mutation	SNP	superfamily_NAD(P)-bd,HMMPfam_3Beta_HSD	p.H155Q	ENST00000297679.5	37	c.465	CCDS10698.1	16	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127127	0.77549	.	.	ENSG00000099377	ENST00000262520;ENST00000353250;ENST00000297679	D;D;T	0.88046	-2.33;-2.33;-0.01	5.65	2.64	0.31445	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.095052	0.64402	D	0.000001	D	0.90024	0.6885	M	0.69463	2.115	0.50632	D	0.999887	P;P	0.52577	0.589;0.954	B;P	0.62491	0.405;0.903	D	0.87621	0.2510	10	0.39692	T	0.17	-36.0312	9.4153	0.38517	0.0:0.7606:0.0:0.2394	.	155;155	Q96M28;Q9H2F3	.;3BHS7_HUMAN	Q	155	ENSP00000262520:H155Q;ENSP00000370662:H155Q;ENSP00000297679:H155Q	ENSP00000262520:H155Q	H	+	3	2	HSD3B7	30905460	0.040000	0.19996	0.131000	0.22000	0.921000	0.55340	0.296000	0.19083	0.756000	0.33013	0.561000	0.74099	CAC	-	superfamily_NAD(P)-bd,HMMPfam_3Beta_HSD		0.612	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B7	protein_coding	OTTHUMT00000255554.2	C			30905460	+1	no_errors	NM_025193	genbank	human	reviewed	54_36p	missense	SNP	0.965	G
PEX12	5193	genome.wustl.edu	37	17	33904543	33904543	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr17:33904543A>G	ENST00000225873.4	-	2	801	c.194T>C	c.(193-195)cTg>cCg	p.L65P	RP11-1094M14.11_ENST00000592381.1_lincRNA	NM_000286.2	NP_000277.1	O00623	PEX12_HUMAN	peroxisomal biogenesis factor 12	65					peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(8)	18				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AAGATCTAGCAGAGTAAAGAT	0.393																																																0			17											125.0	139.0	134.0					17																	33904543		2199	4298	6497	30928656	SO:0001583	missense	5193			U91521	CCDS11296.1	17q21.1	2011-02-10			ENSG00000108733	ENSG00000108733			8854	protein-coding gene	gene with protein product		601758				9090384	Standard	NM_000286		Approved		uc002hjp.3	O00623	OTTHUMG00000132951	ENST00000225873.4:c.194T>C	17.37:g.33904543A>G	ENSP00000225873:p.Leu65Pro	Somatic		Capture	Illumina GAIIx	4	30928656	B2R6M2	Missense_Mutation	SNP	HMMPfam_Pex2_Pex12,superfamily_RING/U-box	p.L65P	ENST00000225873.4	37	c.194	CCDS11296.1	17	.	.	.	.	.	.	.	.	.	.	A	23.2	4.383471	0.82792	.	.	ENSG00000108733	ENST00000424525;ENST00000225873	D	0.86366	-2.11	5.63	5.63	0.86233	Pex, N-terminal (1);	0.301547	0.31589	N	0.007381	D	0.90645	0.7066	M	0.72118	2.19	0.80722	D	1	P	0.46912	0.886	P	0.52710	0.707	D	0.91407	0.5148	10	0.62326	D	0.03	0.0568	15.0234	0.71650	1.0:0.0:0.0:0.0	.	65	O00623	PEX12_HUMAN	P	65	ENSP00000225873:L65P	ENSP00000225873:L65P	L	-	2	0	PEX12	30928656	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.702000	0.74628	2.142000	0.66516	0.528000	0.53228	CTG	-	HMMPfam_Pex2_Pex12		0.393	PEX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX12	protein_coding	OTTHUMT00000256489.2	A	NM_000286		30928656	-1	no_errors	NM_000286	genbank	human	reviewed	54_36p	missense	SNP	0.990	G
DDX58	23586	genome.wustl.edu	37	9	32493809	32493809	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr9:32493809A>G	ENST00000379883.2	-	3	530	c.373T>C	c.(373-375)Tct>Cct	p.S125P	DDX58_ENST00000379882.1_Missense_Mutation_p.S80P|DDX58_ENST00000379868.1_5'UTR|DDX58_ENST00000542096.1_Missense_Mutation_p.S54P|DDX58_ENST00000545044.1_5'UTR	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	125	CARD 2.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		GACAGATCAGAAATGATATCG	0.284																																																0			9											54.0	59.0	58.0					9																	32493809		2200	4293	6493	32483809	SO:0001583	missense	23586			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.373T>C	9.37:g.32493809A>G	ENSP00000369213:p.Ser125Pro	Somatic		Capture	Illumina GAIIx	4	32483809	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,HMMSmart_SM00490,HMMPfam_Helicase_C	p.S125P	ENST00000379883.2	37	c.373	CCDS6526.1	9	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.135652	0.00335	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000542096;ENST00000542960	T;T;T	0.37411	1.2;1.2;1.2	4.33	0.697	0.18081	.	0.613938	0.15067	N	0.282450	T	0.12689	0.0308	N	0.03948	-0.315	0.54753	D	0.999981	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.12041	-1.0563	10	0.18710	T	0.47	-2.2755	4.1575	0.10268	0.3383:0.0:0.5064:0.1553	.	80;54;125	O95786-2;B3KWW1;O95786	.;.;DDX58_HUMAN	P	80;125;54;125	ENSP00000369212:S80P;ENSP00000369213:S125P;ENSP00000442160:S54P	ENSP00000369212:S80P	S	-	1	0	DDX58	32483809	0.999000	0.42202	0.676000	0.29932	0.105000	0.19272	1.120000	0.31271	0.175000	0.19841	-0.973000	0.02599	TCT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.284	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX58	protein_coding	OTTHUMT00000052011.1	A	NM_014314		32483809	-1	no_errors	NM_014314	genbank	human	reviewed	54_36p	missense	SNP	0.075	G
TTC27	55622	genome.wustl.edu	37	2	32903968	32903968	+	Silent	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:32903968G>A	ENST00000317907.4	+	9	1329	c.1098G>A	c.(1096-1098)gtG>gtA	p.V366V		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	366										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						TAACTGAAGTGGAGCTTCTGG	0.328																																																0			2											129.0	121.0	124.0					2																	32903968		2203	4300	6503	32757472	SO:0001819	synonymous_variant	55622			BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.1098G>A	2.37:g.32903968G>A		Somatic		Capture	Illumina GAIIx	4	32757472	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Silent	SNP	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR,HMMPfam_TPR_2	p.V366	ENST00000317907.4	37	c.1098	CCDS33176.1	2																																																																																			-	NULL		0.328	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC27	protein_coding	OTTHUMT00000325395.1	G	NM_017735		32757472	+1	no_errors	NM_017735	genbank	human	provisional	54_36p	silent	SNP	1.000	A
ITPR3	3710	genome.wustl.edu	37	6	33632726	33632726	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr6:33632726G>A	ENST00000374316.5	+	13	2288	c.1228G>A	c.(1228-1230)Gag>Aag	p.E410K	ITPR3_ENST00000605930.1_Missense_Mutation_p.E410K			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	410	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CATCGAGGAGGAGCGGCCCAT	0.662																																																0			6											60.0	56.0	57.0					6																	33632726		2203	4300	6503	33740704	SO:0001583	missense	3710			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.1228G>A	6.37:g.33632726G>A	ENSP00000363435:p.Glu410Lys	Somatic		Capture	Illumina GAIIx	4	33740704	Q14649|Q5TAQ2	Missense_Mutation	SNP	HMMPfam_Ins145_P3_rec,superfamily_MIR,HMMSmart_MIR,HMMPfam_MIR,superfamily_SSF100909,HMMPfam_RYDR_ITPR,HMMPfam_RIH_assoc,HMMPfam_Ion_trans	p.E410K	ENST00000374316.5	37	c.1228	CCDS4783.1	6	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901883	0.72754	.	.	ENSG00000096433	ENST00000374316	D	0.89746	-2.56	4.97	4.97	0.65823	MIR motif (1);MIR (2);	0.117370	0.64402	D	0.000020	D	0.92990	0.7769	M	0.83953	2.67	0.58432	D	0.999995	D	0.57899	0.981	D	0.64237	0.923	D	0.91633	0.5320	10	0.30854	T	0.27	-17.6412	17.8168	0.88637	0.0:0.0:1.0:0.0	.	410	Q14573	ITPR3_HUMAN	K	410	ENSP00000363435:E410K	ENSP00000363435:E410K	E	+	1	0	ITPR3	33740704	1.000000	0.71417	1.000000	0.80357	0.284000	0.27059	7.755000	0.85180	2.303000	0.77524	0.460000	0.39030	GAG	-	HMMPfam_MIR,superfamily_MIR		0.662	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	protein_coding	OTTHUMT00000040204.2	G	NM_002224		33740704	+1	no_errors	NM_002224	genbank	human	validated	54_36p	missense	SNP	1.000	A
MLLT6	4302	genome.wustl.edu	37	17	36873089	36873089	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr17:36873089G>T	ENST00000325718.7	+	10	1597	c.1506G>T	c.(1504-1506)caG>caT	p.Q502H	MIR4726_ENST00000577947.1_RNA|CTB-58E17.9_ENST00000579499.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6	502					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					CCAGTGCCCAGCTGGCTGGCT	0.672			T	MLL	AL																																		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	0			17											20.0	23.0	22.0					17																	36873089		2203	4300	6503	34126615	SO:0001583	missense	4302				CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.1506G>T	17.37:g.36873089G>T	ENSP00000316426:p.Gln502His	Somatic		Capture	Illumina GAIIx	4	34126615	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Missense_Mutation	SNP	superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1	p.Q502H	ENST00000325718.7	37	c.1506	CCDS11327.1	17	.	.	.	.	.	.	.	.	.	.	G	18.04	3.535221	0.64972	.	.	ENSG00000108292	ENST00000325718	T	0.14391	2.51	5.17	4.2	0.49525	.	0.335332	0.29730	N	0.011359	T	0.25827	0.0629	L	0.44542	1.39	0.34560	D	0.712324	D	0.57571	0.98	D	0.69654	0.965	T	0.31420	-0.9944	10	0.72032	D	0.01	.	9.4944	0.38980	0.0947:0.0:0.9053:0.0	.	502	P55198	AF17_HUMAN	H	502	ENSP00000316426:Q502H	ENSP00000316426:Q502H	Q	+	3	2	MLLT6	34126615	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.011000	0.29911	1.421000	0.47157	0.561000	0.74099	CAG	-	NULL		0.672	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLLT6	protein_coding	OTTHUMT00000256799.1	G	NM_005937		34126615	+1	no_errors	NM_005937	genbank	human	validated	54_36p	missense	SNP	1.000	T
GJB5	2709	genome.wustl.edu	37	1	35223210	35223210	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:35223210G>T	ENST00000338513.1	+	2	452	c.279G>T	c.(277-279)atG>atT	p.M93I	GJB4_ENST00000339480.1_5'Flank	NM_005268.3	NP_005259.1	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	93					cell communication (GO:0007154)|epidermis development (GO:0008544)|labyrinthine layer morphogenesis (GO:0060713)|spongiotrophoblast differentiation (GO:0060708)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)	10		Myeloproliferative disorder(586;0.0393)				TCGTGGTCATGCACGTGGCCT	0.622																																																0			1											96.0	93.0	94.0					1																	35223210		2203	4300	6503	34995797	SO:0001583	missense	2709			BC004379	CCDS382.1	1p34.3	2008-05-14	2007-11-06		ENSG00000189280	ENSG00000189280		"""Ion channels / Gap junction proteins (connexins)"""	4287	protein-coding gene	gene with protein product	"""connexin 31.1"""	604493	"""gap junction protein, beta 5 (connexin 31.1)"", ""gap junction protein, beta 5"""			9843209	Standard	NM_005268		Approved	CX31.1	uc001bxu.4	O95377	OTTHUMG00000004053	ENST00000338513.1:c.279G>T	1.37:g.35223210G>T	ENSP00000340811:p.Met93Ile	Somatic		Capture	Illumina GAIIx	4	34995797	Q9UPA3	Missense_Mutation	SNP	HMMPfam_Connexin,HMMSmart_CNX,PatternScan_CONNEXINS_1,HMMPfam_Connexin_CCC,PatternScan_CONNEXINS_2	p.M93I	ENST00000338513.1	37	c.279	CCDS382.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.108401	0.77096	.	.	ENSG00000189280	ENST00000338513	D	0.99023	-5.34	5.89	5.89	0.94794	Connexin, N-terminal (1);	0.039914	0.85682	D	0.000000	D	0.98507	0.9502	L	0.49126	1.545	0.50632	D	0.999882	P	0.45078	0.85	P	0.50934	0.654	D	0.98448	1.0590	10	0.32370	T	0.25	.	20.2566	0.98424	0.0:0.0:1.0:0.0	.	93	O95377	CXB5_HUMAN	I	93	ENSP00000340811:M93I	ENSP00000340811:M93I	M	+	3	0	GJB5	34995797	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	5.629000	0.67798	2.793000	0.96121	0.561000	0.74099	ATG	-	HMMPfam_Connexin		0.622	GJB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB5	protein_coding	OTTHUMT00000011561.1	G	NM_005268		34995797	+1	no_errors	NM_005268	genbank	human	provisional	54_36p	missense	SNP	1.000	T
STARD3	10948	genome.wustl.edu	37	17	37809927	37809927	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr17:37809927A>C	ENST00000336308.5	+	2	361	c.143A>C	c.(142-144)gAt>gCt	p.D48A	STARD3_ENST00000578232.1_3'UTR|STARD3_ENST00000544210.2_Missense_Mutation_p.D48A|STARD3_ENST00000394250.4_Missense_Mutation_p.D48A|STARD3_ENST00000580611.1_Missense_Mutation_p.D48A	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	48	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GCCATCTCTGATGTCCGCCGC	0.632											OREG0024381	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			17											123.0	96.0	105.0					17																	37809927		2203	4300	6503	35063453	SO:0001583	missense	10948				CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.143A>C	17.37:g.37809927A>C	ENSP00000337446:p.Asp48Ala	Somatic	873	Capture	Illumina GAIIx	4	35063453	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Missense_Mutation	SNP	HMMPfam_MENTAL,superfamily_SSF55961,HMMPfam_START,HMMSmart_START	p.D48A	ENST00000336308.5	37	c.143	CCDS11341.1	17	.	.	.	.	.	.	.	.	.	.	A	9.659	1.143541	0.21205	.	.	ENSG00000131748	ENST00000336308;ENST00000544210;ENST00000394250;ENST00000443521	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.48	3.3	0.37823	MENTAL domain (2);	0.000000	0.85682	D	0.000000	T	0.58452	0.2123	M	0.66939	2.045	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;1.0	T	0.58640	-0.7601	10	0.42905	T	0.14	-10.0803	10.8982	0.47036	0.8427:0.1573:0.0:0.0	.	48;48;48;48	F5H0G2;B4DWG5;A8MXA4;Q14849	.;.;.;STAR3_HUMAN	A	48	ENSP00000337446:D48A;ENSP00000439869:D48A;ENSP00000377794:D48A;ENSP00000411710:D48A	ENSP00000337446:D48A	D	+	2	0	STARD3	35063453	1.000000	0.71417	0.966000	0.40874	0.137000	0.21094	6.981000	0.76166	1.798000	0.52647	0.260000	0.18958	GAT	-	HMMPfam_MENTAL		0.632	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3	protein_coding	OTTHUMT00000256933.1	A			35063453	+1	no_errors	NM_006804	genbank	human	provisional	54_36p	missense	SNP	1.000	C
CHDC2	286464	genome.wustl.edu	37	X	36162690	36162690	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chrX:36162690G>A	ENST00000313548.4	+	11	1459	c.1273G>A	c.(1273-1275)Gtg>Atg	p.V425M		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	425	CH.					integral component of membrane (GO:0016021)											gtgtctgagggtgtttccaaa	0.458																																																0			X											120.0	122.0	122.0					X																	36162690		2202	4300	6502	36072611	SO:0001583	missense	286464			AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.1273G>A	X.37:g.36162690G>A	ENSP00000324767:p.Val425Met	Somatic		Capture	Illumina GAIIx	4	36072611		Missense_Mutation	SNP	superfamily_Calponin-homology	p.V425M	ENST00000313548.4	37	c.1273	CCDS14238.1	X	.	.	.	.	.	.	.	.	.	.	G	4.655	0.121808	0.08931	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	0.694	0.694	0.18062	.	2.567330	0.04998	U	0.468523	T	0.35856	0.0946	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	D	0.65684	0.937	T	0.44406	-0.9330	8	0.33940	T	0.23	.	.	.	.	.	425	Q8N9S7	CX059_HUMAN	M	425	.	ENSP00000324767:V425M	V	+	1	0	CXorf59	36072611	0.356000	0.24930	0.048000	0.18961	0.046000	0.14306	0.529000	0.23019	0.595000	0.29777	0.600000	0.82982	GTG	-	NULL		0.458	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf59	protein_coding		G	NM_173695		36072611	+1	no_errors	NM_173695	genbank	human	predicted	54_36p	missense	SNP	0.228	A
LMBRD2	92255	genome.wustl.edu	37	5	36104193	36104193	+	Silent	SNP	T	T	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr5:36104193T>G	ENST00000296603.4	-	18	2505	c.2043A>C	c.(2041-2043)ggA>ggC	p.G681G		NM_001007527.1	NP_001007528.1	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	681						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGAGATATCGTCCACCAGGCT	0.373																																																0			5											95.0	85.0	88.0					5																	36104193		2203	4300	6503	36139950	SO:0001819	synonymous_variant	92255				CCDS34145.1	5p13.2	2008-02-05			ENSG00000164187	ENSG00000164187			25287	protein-coding gene	gene with protein product							Standard	NM_001007527		Approved	DKFZp434H2226	uc003jkb.1	Q68DH5	OTTHUMG00000162150	ENST00000296603.4:c.2043A>C	5.37:g.36104193T>G		Somatic		Capture	Illumina GAIIx	4	36139950	B3KRB6|Q9NTC7	Silent	SNP	HMMPfam_LMBR1	p.G681	ENST00000296603.4	37	c.2043	CCDS34145.1	5																																																																																			-	NULL		0.373	LMBRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBRD2	protein_coding	OTTHUMT00000367552.1	T	NM_001007527		36139950	-1	no_errors	NM_001007527	genbank	human	validated	54_36p	silent	SNP	1.000	G
INPP5B	3633	genome.wustl.edu	37	1	38397490	38397490	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:38397490C>A	ENST00000373026.1	-	6	627	c.627G>T	c.(625-627)aaG>aaT	p.K209N	INPP5B_ENST00000373027.1_5'Flank|INPP5B_ENST00000373024.3_Intron|INPP5B_ENST00000373023.2_Missense_Mutation_p.K209N|INPP5B_ENST00000373021.1_Missense_Mutation_p.K209N			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	209					in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GAAAGCCTGTCTTCTCCATCG	0.687																																																0			1																																								38170077	SO:0001583	missense	3633			M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.627G>T	1.37:g.38397490C>A	ENSP00000362117:p.Lys209Asn	Somatic		Capture	Illumina GAIIx	4	38170077	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	PatternScan_LECTIN_LEGUME_BETA,superfamily_DNase I-like,HMMSmart_SM00128,HMMPfam_Exo_endo_phos,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.K209N	ENST00000373026.1	37	c.627		1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.752847	0.31046	.	.	ENSG00000204084	ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373021	D;D;T	0.92699	-3.09;-3.09;0.86	4.56	-8.56	0.00904	.	3.813010	0.00447	N	0.000089	D	0.83353	0.5236	.	.	.	0.09310	N	0.999996	B	0.25169	0.119	B	0.21917	0.037	T	0.69939	-0.5009	9	0.66056	D	0.02	.	0.7436	0.00978	0.4137:0.1616:0.2043:0.2204	.	209	B1ARF3	.	N	209	ENSP00000362114:K209N;ENSP00000362117:K209N;ENSP00000362112:K209N	ENSP00000362112:K209N	K	-	3	2	INPP5B	38170077	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.240000	0.01197	-2.041000	0.00915	-0.222000	0.12452	AAG	-	NULL		0.687	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	INPP5B	protein_coding	OTTHUMT00000012968.1	C	NM_005540		38170077	-1	no_errors	ENST00000373023	ensembl	human	known	54_36p	missense	SNP	0.000	A
MACF1	23499	genome.wustl.edu	37	1	39908237	39908237	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:39908237C>G	ENST00000372915.3	+	76	18886	c.18799C>G	c.(18799-18801)Cat>Gat	p.H6267D	MACF1_ENST00000317713.7_Missense_Mutation_p.H4309D|MACF1_ENST00000539005.1_Missense_Mutation_p.H4179D|MACF1_ENST00000545844.1_Missense_Mutation_p.H4309D|MACF1_ENST00000567887.1_Missense_Mutation_p.H6405D|MACF1_ENST00000361689.2_Missense_Mutation_p.H4309D|MACF1_ENST00000564288.1_Missense_Mutation_p.H6368D|MACF1_ENST00000289893.4_Missense_Mutation_p.H4811D			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6267					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CGCAAAGCACCATGTAAGTAT	0.408																																																0			1											56.0	56.0	56.0					1																	39908237		2203	4300	6503	39680824	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18799C>G	1.37:g.39908237C>G	ENSP00000362006:p.His6267Asp	Somatic		Capture	Illumina GAIIx	4	39680824	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	superfamily_SSF75399,HMMSmart_PLEC,HMMPfam_Plectin,HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC,PatternScan_GLYCOSYL_HYDROL_F5,superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1,HMMPfam_GAS2,HMMSmart_GAS2	p.H4811D	ENST00000372915.3	37	c.14431		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.0|22.0	4.231287|4.231287	0.79688|0.79688	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.48836|.	1.44;0.8;1.44;1.44;1.44;0.8|.	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	0.000000|.	0.64402|.	D|.	0.000005|.	T|T	0.78168|0.78168	0.4241|0.4241	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.85130|.	0.997;0.982|.	T|T	0.75317|0.75317	-0.3360|-0.3360	10|5	0.87932|.	D|.	0|.	.|.	20.5568|20.5568	0.99304|0.99304	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	6267;4309|.	Q9UPN3;F8W8Q1|.	MACF1_HUMAN;.|.	D|R	4309;6267;4309;4309;4179;4811|3312	ENSP00000439537:H4309D;ENSP00000362006:H6267D;ENSP00000354573:H4309D;ENSP00000313438:H4309D;ENSP00000444364:H4179D;ENSP00000289893:H4811D|.	ENSP00000289893:H4811D|.	H|P	+|+	1|2	0|0	MACF1|MACF1	39680824|39680824	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	4.781000|4.781000	0.62389|0.62389	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	CAT|CCA	-	superfamily_Spectrin,HMMPfam_Spectrin,HMMSmart_SPEC		0.408	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	C	NM_033044		39680824	+1	no_errors	NM_033044	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CDK13	8621	genome.wustl.edu	37	7	40102476	40102476	+	Silent	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr7:40102476G>T	ENST00000181839.4	+	8	3257	c.2652G>T	c.(2650-2652)ctG>ctT	p.L884L	CDK13_ENST00000340829.5_Silent_p.L884L|CDK13_ENST00000484589.1_3'UTR	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	884	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						CACCTGAACTGCTACTGGGAG	0.388																																																0			7											300.0	308.0	305.0					7																	40102476		2203	4300	6503	40069001	SO:0001819	synonymous_variant	8621			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.2652G>T	7.37:g.40102476G>T		Somatic		Capture	Illumina GAIIx	4	40069001	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.L884	ENST00000181839.4	37	c.2652	CCDS5461.1	7																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.388	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDC2L5	protein_coding	OTTHUMT00000250726.2	G	NM_003718		40069001	+1	no_errors	NM_003718	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
CAPN3	825	genome.wustl.edu	37	15	42703146	42703146	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr15:42703146C>A	ENST00000397163.3	+	22	2547	c.2328C>A	c.(2326-2328)aaC>aaA	p.N776K	CAPN3_ENST00000397200.4_Missense_Mutation_p.N264K|CAPN3_ENST00000562199.1_3'UTR|CAPN3_ENST00000356316.3_Missense_Mutation_p.N683K|CAPN3_ENST00000349748.3_Missense_Mutation_p.N684K|CAPN3_ENST00000318023.7_Missense_Mutation_p.N770K|CAPN3_ENST00000561817.1_Missense_Mutation_p.N111K|CAPN3_ENST00000357568.3_Missense_Mutation_p.N770K|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000337571.4_Missense_Mutation_p.N111K|CAPN3_ENST00000397204.4_Missense_Mutation_p.N111K|CAPN3_ENST00000569136.1_Missense_Mutation_p.N111K	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	776	Domain IV.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		AACACATGAACATCGACTTTG	0.537																																																0			15											241.0	191.0	208.0					15																	42703146		2203	4299	6502	40490438	SO:0001583	missense	825			X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.2328C>A	15.37:g.42703146C>A	ENSP00000380349:p.Asn776Lys	Somatic		Capture	Illumina GAIIx	4	40490438	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMSmart_SM00230,HMMPfam_Peptidase_C2,PatternScan_THIOL_PROTEASE_CYS,HMMPfam_Calpain_III,HMMSmart_SM00720,superfamily_Calpain large subunit middle domain (domain III),superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1	p.N776K	ENST00000397163.3	37	c.2328	CCDS45245.1	15	.	.	.	.	.	.	.	.	.	.	C	15.02	2.710577	0.48517	.	.	ENSG00000092529	ENST00000356316;ENST00000337522;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023;ENST00000397200;ENST00000337571;ENST00000397204	D;D;D;D;D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36;-3.36	5.4	3.54	0.40534	EF-hand-like domain (1);	0.056895	0.64402	U	0.000002	D	0.90793	0.7109	N	0.26092	0.79	0.58432	D	0.999994	P;P;P;P;D;D;P	0.58268	0.85;0.919;0.886;0.94;0.982;0.97;0.588	P;P;B;P;P;P;B	0.59115	0.589;0.589;0.437;0.687;0.852;0.715;0.206	D	0.86574	0.1849	10	0.05959	T	0.93	.	11.7405	0.51790	0.0:0.8588:0.0:0.1412	.	641;689;111;684;770;776;683	C6EVS4;C6EVS3;A4FTZ9;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;.;CAN3_HUMAN;.	K	683;264;776;770;684;770;264;111;111	ENSP00000348667:N683K;ENSP00000380349:N776K;ENSP00000350181:N770K;ENSP00000183936:N684K;ENSP00000326281:N770K;ENSP00000380384:N264K;ENSP00000336840:N111K;ENSP00000380387:N111K	ENSP00000326281:N770K	N	+	3	2	CAPN3	40490438	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.608000	0.36847	0.865000	0.35603	0.655000	0.94253	AAC	-	superfamily_EF-hand		0.537	CAPN3-009	KNOWN	basic|CCDS	protein_coding	CAPN3	protein_coding	OTTHUMT00000421075.1	C			40490438	+1	no_errors	NM_000070	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
LINC01531	100128682	genome.wustl.edu	37	19	35899217	35899217	+	lincRNA	SNP	G	G	C	rs112268455	byFrequency	TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:35899217G>C	ENST00000536898.1	+	0	1806					NR_040046.1																						tcaggctggtgtcaaactcct	0.537													C|||	418	0.0834665	0.1415	0.0908	5008	,	,		17818	0.001		0.1272	False		,,,				2504	0.0399															0			19																																								40591057			0																															19.37:g.35899217G>C		Somatic		Capture	Illumina GAIIx	4	40591057		Missense_Mutation	SNP	NULL	p.V190L	ENST00000536898.1	37	c.568		19	201	0.09203296703296704	63	0.12804878048780488	38	0.10497237569060773	0	0.0	100	0.13192612137203166	C	0.024	-1.385279	0.01194	.	.	ENSG00000205786	ENST00000536898	.	.	.	0.475	-0.95	0.10372	.	.	.	.	.	T	0.00210	0.0006	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20042	-1.0287	2	.	.	.	.	.	.	.	.	.	.	.	L	190	.	.	V	+	1	0	AC002511.1	40591057	.	.	0.002000	0.10522	0.013000	0.08279	.	.	-1.707000	0.01402	-0.980000	0.02579	GTC	-	NULL		0.537	AC002511.1-002	KNOWN	basic	lincRNA	LOC100128682	lincRNA	OTTHUMT00000466118.1	G			40591057	+1	no_errors	XM_001719567	genbank	human	model	54_36p	missense	SNP	0.002	C
HPDL	84842	genome.wustl.edu	37	1	45793631	45793631	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:45793631G>C	ENST00000334815.3	+	1	1087	c.811G>C	c.(811-813)Gag>Cag	p.E271Q		NM_032756.2	NP_116145.1	Q96IR7	HPDL_HUMAN	4-hydroxyphenylpyruvate dioxygenase-like	271					aromatic amino acid family metabolic process (GO:0009072)		4-hydroxyphenylpyruvate dioxygenase activity (GO:0003868)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(166;0.155)					GGAGGCCACTGAGGGGGTGGC	0.652																																																0			1											57.0	61.0	60.0					1																	45793631		2203	4300	6503	45566218	SO:0001583	missense	84842			BC007293	CCDS519.1	1p34.1	2008-02-05	2007-03-14	2007-03-14	ENSG00000186603	ENSG00000186603			28242	protein-coding gene	gene with protein product			"""glyoxalase domain containing 1"""	GLOXD1		12477932	Standard	NM_032756		Approved	MGC15668, 4-HPPD-L	uc001cne.3	Q96IR7	OTTHUMG00000007681	ENST00000334815.3:c.811G>C	1.37:g.45793631G>C	ENSP00000335060:p.Glu271Gln	Somatic		Capture	Illumina GAIIx	4	45566218	B2R9B0	Missense_Mutation	SNP	superfamily_Glyoxalase/Bleomycin resistance protein/Dihydroxybiphenyl dioxygenase	p.E271Q	ENST00000334815.3	37	c.811	CCDS519.1	1	.	.	.	.	.	.	.	.	.	.	G	1.225	-0.625760	0.03610	.	.	ENSG00000186603	ENST00000334815	T	0.65178	-0.14	5.14	0.936	0.19488	.	0.991402	0.08220	N	0.979380	T	0.50137	0.1598	L	0.49640	1.575	0.09310	N	1	B	0.15141	0.012	B	0.16289	0.015	T	0.40232	-0.9574	10	0.36615	T	0.2	-10.2424	1.919	0.03303	0.3109:0.14:0.4215:0.1277	.	271	Q96IR7	HPDL_HUMAN	Q	271	ENSP00000335060:E271Q	ENSP00000335060:E271Q	E	+	1	0	HPDL	45566218	0.000000	0.05858	0.002000	0.10522	0.079000	0.17450	0.188000	0.17018	0.328000	0.23435	0.561000	0.74099	GAG	-	superfamily_Glyoxalase/Bleomycin resistance protein/Dihydroxybiphenyl dioxygenase		0.652	HPDL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPDL	protein_coding	OTTHUMT00000020527.1	G	NM_032756		45566218	+1	no_errors	NM_032756	genbank	human	validated	54_36p	missense	SNP	0.000	C
AXL	558	genome.wustl.edu	37	19	41727909	41727909	+	Silent	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:41727909C>A	ENST00000301178.4	+	4	724	c.534C>A	c.(532-534)gtC>gtA	p.V178V	CTD-2195B23.3_ENST00000598541.1_RNA|AXL_ENST00000359092.3_Silent_p.V178V	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	178	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						AGGATGCTGTCCCCCTGGCCA	0.682																																																0			19											21.0	21.0	21.0					19																	41727909		2203	4300	6503	46419749	SO:0001819	synonymous_variant	558			M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.534C>A	19.37:g.41727909C>A		Somatic		Capture	Illumina GAIIx	4	46419749	Q8N5L2|Q9UD27	Silent	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.V178	ENST00000301178.4	37	c.534	CCDS12575.1	19																																																																																			-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.682	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	protein_coding	OTTHUMT00000463323.2	C			46419749	+1	no_errors	NM_021913	genbank	human	reviewed	54_36p	silent	SNP	0.532	A
DCC	1630	genome.wustl.edu	37	18	50683756	50683756	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr18:50683756C>A	ENST00000442544.2	+	8	1908	c.1292C>A	c.(1291-1293)gCt>gAt	p.A431D	DCC_ENST00000581580.1_Missense_Mutation_p.A86D|DCC_ENST00000412726.1_Missense_Mutation_p.A279D|DCC_ENST00000580146.1_3'UTR	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	431	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CTCCCTTCGGCTCCCAGAGAT	0.542																																																0			18											186.0	172.0	177.0					18																	50683756		2203	4300	6503	48937754	SO:0001583	missense	1630			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1292C>A	18.37:g.50683756C>A	ENSP00000389140:p.Ala431Asp	Somatic		Capture	Illumina GAIIx	4	48937754		Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_I-set,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMPfam_Neogenin_C	p.A431D	ENST00000442544.2	37	c.1292	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152260	0.57259	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.61742	0.08;0.08	5.34	5.34	0.76211	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.149420	0.42682	D	0.000663	D	0.82545	0.5060	H	0.95504	3.68	0.52501	D	0.999954	P;P;D	0.58970	0.956;0.956;0.984	P;P;D	0.66351	0.874;0.874;0.943	D	0.86541	0.1828	10	0.48119	T	0.1	.	17.8248	0.88661	0.0:1.0:0.0:0.0	.	279;279;431	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	D	431;364;279	ENSP00000389140:A431D;ENSP00000397322:A279D	ENSP00000304146:A364D	A	+	2	0	DCC	48937754	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.027000	0.76463	2.510000	0.84645	0.561000	0.74099	GCT	-	HMMSmart_SM00409,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3		0.542	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	protein_coding	OTTHUMT00000255996.3	C	NM_005215		48937754	+1	no_errors	NM_005215	genbank	human	validated	54_36p	missense	SNP	1.000	A
ADNP	23394	genome.wustl.edu	37	20	49509563	49509563	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr20:49509563T>C	ENST00000396029.3	-	5	2255	c.1688A>G	c.(1687-1689)cAt>cGt	p.H563R	ADNP_ENST00000349014.3_Missense_Mutation_p.H563R|ADNP_ENST00000396032.3_Missense_Mutation_p.H563R|ADNP_ENST00000371602.4_Missense_Mutation_p.H563R	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	563					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						TACCAGGAGATGGATGTTAGT	0.448																																																0			20											146.0	138.0	140.0					20																	49509563		2203	4300	6503	48942970	SO:0001583	missense	23394			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.1688A>G	20.37:g.49509563T>C	ENSP00000379346:p.His563Arg	Somatic		Capture	Illumina GAIIx	4	48942970	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	PatternScan_HOMEOBOX_1,HMMSmart_ZnF_C2H2,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox	p.H563R	ENST00000396029.3	37	c.1688	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	T	15.48	2.846197	0.51164	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.75	5.75	0.90469	.	0.045175	0.85682	D	0.000000	T	0.46521	0.1397	L	0.38175	1.15	0.53688	D	0.99997	P	0.37864	0.61	B	0.31191	0.125	T	0.46803	-0.9165	9	0.39692	T	0.17	-9.7608	16.0576	0.80816	0.0:0.0:0.0:1.0	.	563	Q9H2P0	ADNP_HUMAN	R	563	.	ENSP00000342905:H563R	H	-	2	0	ADNP	48942970	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.683000	0.84093	2.188000	0.69820	0.528000	0.53228	CAT	-	NULL		0.448	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	protein_coding	OTTHUMT00000079705.2	T	NM_181442		48942970	-1	no_errors	NM_015339	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
QRICH1	54870	genome.wustl.edu	37	3	49064165	49064165	+	IGR	SNP	A	A	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr3:49064165A>G	ENST00000395443.2	-	0	3549				IMPDH2_ENST00000326739.4_Silent_p.Y258Y|RP13-131K19.6_ENST00000607245.1_RNA	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1							nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		AGTCCAGCCTATACTTGTCAT	0.552																																																0			3											117.0	104.0	108.0					3																	49064165		2203	4300	6503	49039169	SO:0001628	intergenic_variant	3615				CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772		3.37:g.49064165A>G		Somatic		Capture	Illumina GAIIx	4	49039169	Q4G0F7|Q7L621|Q8TEA5	Silent	SNP	superfamily_SSF51412,HMMPfam_IMPDH,superfamily_SSF54631,HMMPfam_CBS,HMMSmart_CBS,PatternScan_IMP_DH_GMP_RED	p.Y258	ENST00000395443.2	37	c.774	CCDS2787.1	3	.	.	.	.	.	.	.	.	.	.	A	7.024	0.559346	0.13436	.	.	ENSG00000178035	ENST00000429182	.	.	.	5.97	-2.95	0.05564	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.0172	18.2366	0.89951	0.2147:0.0:0.7853:0.0	.	.	.	.	Q	190	.	.	X	-	1	0	IMPDH2	49039169	1.000000	0.71417	0.805000	0.32314	0.988000	0.76386	1.193000	0.32162	-0.986000	0.03498	-0.250000	0.11733	TAG	-	superfamily_SSF51412,HMMPfam_IMPDH		0.552	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPDH2	protein_coding	OTTHUMT00000345669.1	A	NM_017730		49039169	-1	no_errors	NM_000884	genbank	human	reviewed	54_36p	silent	SNP	0.999	G
ERO1L	30001	genome.wustl.edu	37	14	53119889	53119889	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr14:53119889A>G	ENST00000395686.3	-	12	1176	c.953T>C	c.(952-954)gTg>gCg	p.V318A		NM_014584.1	NP_055399.1	Q96HE7	ERO1A_HUMAN	ERO1-like (S. cerevisiae)	318					4-hydroxyproline metabolic process (GO:0019471)|brown fat cell differentiation (GO:0050873)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum unfolded protein response (GO:0030968)|extracellular matrix organization (GO:0030198)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to temperature stimulus (GO:0009266)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)		ERO1L/FERMT2(2)	breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12	Breast(41;0.226)					GAATGGTAACACTTTGGATAA	0.358																																																0			14											78.0	85.0	82.0					14																	53119889		2203	4300	6503	52189639	SO:0001583	missense	30001			AF081886	CCDS9709.1	14q22.1	2010-10-06	2001-11-28		ENSG00000197930	ENSG00000197930			13280	protein-coding gene	gene with protein product		615435	"""ERO1 (S. cerevisiae)-like"""			10671517	Standard	NM_014584		Approved	ERO1A, ERO1-alpha	uc001wzv.3	Q96HE7	OTTHUMG00000140301	ENST00000395686.3:c.953T>C	14.37:g.53119889A>G	ENSP00000379042:p.Val318Ala	Somatic		Capture	Illumina GAIIx	4	52189639	A8K9X4|A8MYW1|Q7LD45|Q9P1Q9|Q9UKV6	Missense_Mutation	SNP	superfamily_ERO1,HMMPfam_ERO1	p.V318A	ENST00000395686.3	37	c.953	CCDS9709.1	14	.	.	.	.	.	.	.	.	.	.	A	3.590	-0.083775	0.07141	.	.	ENSG00000197930	ENST00000395686	T	0.42131	0.98	5.37	5.37	0.77165	.	0.120339	0.56097	D	0.000025	T	0.18923	0.0454	N	0.02985	-0.445	0.43708	D	0.99617	B	0.15141	0.012	B	0.19148	0.024	T	0.15521	-1.0434	10	0.02654	T	1	-10.2778	15.3806	0.74651	1.0:0.0:0.0:0.0	.	318	Q96HE7	ERO1A_HUMAN	A	318	ENSP00000379042:V318A	ENSP00000379042:V318A	V	-	2	0	ERO1L	52189639	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	6.904000	0.75708	2.032000	0.59987	0.528000	0.53228	GTG	-	superfamily_ERO1,HMMPfam_ERO1		0.358	ERO1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERO1L	protein_coding	OTTHUMT00000276892.1	A	NM_014584		52189639	-1	no_errors	NM_014584	genbank	human	provisional	54_36p	missense	SNP	1.000	G
ITIH1	3697	genome.wustl.edu	37	3	52822272	52822272	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr3:52822272T>C	ENST00000273283.2	+	18	2054	c.2030T>C	c.(2029-2031)aTc>aCc	p.I677T	ITIH1_ENST00000537050.1_Missense_Mutation_p.I389T|ITIH1_ENST00000540715.1_Missense_Mutation_p.I535T|ITIH1_ENST00000405128.3_Missense_Mutation_p.I43T|ITIH1_ENST00000542827.1_Silent_p.H631H	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	677	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CACTTCATCATCCACGTGCCC	0.577																																																0			3											119.0	97.0	105.0					3																	52822272		2203	4299	6502	52797312	SO:0001583	missense	3697				CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2030T>C	3.37:g.52822272T>C	ENSP00000273283:p.Ile677Thr	Somatic		Capture	Illumina GAIIx	4	52797312	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	HMMSmart_SM00609,HMMPfam_VIT,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_ITI_HC_C	p.I677T	ENST00000273283.2	37	c.2030	CCDS2864.1	3	.	.	.	.	.	.	.	.	.	.	T	22.1	4.242378	0.79912	.	.	ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133;ENST00000405128	T;T;T;T;T	0.18657	4.44;4.32;4.14;3.56;2.2	5.39	5.39	0.77823	.	0.118515	0.56097	D	0.000039	T	0.51618	0.1685	M	0.86953	2.85	0.43808	D	0.996363	D;D;D;D	0.89917	0.998;1.0;0.999;1.0	D;D;D;D	0.91635	0.962;0.987;0.922;0.999	T	0.60131	-0.7323	10	0.87932	D	0	-27.5232	13.6539	0.62327	0.0:0.0:0.0:1.0	.	535;43;278;677	F5H165;B5MCP1;Q9P1C5;P19827	.;.;.;ITIH1_HUMAN	T	677;535;389;230;43	ENSP00000273283:I677T;ENSP00000443973:I535T;ENSP00000443847:I389T;ENSP00000395836:I230T;ENSP00000384589:I43T	ENSP00000273283:I677T	I	+	2	0	ITIH1	52797312	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	7.330000	0.79181	2.043000	0.60533	0.533000	0.62120	ATC	-	NULL		0.577	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	protein_coding	OTTHUMT00000317522.1	T	NM_002215		52797312	+1	no_errors	NM_002215	genbank	human	validated	54_36p	missense	SNP	0.970	C
LRRC1	55227	genome.wustl.edu	37	6	53787505	53787505	+	Missense_Mutation	SNP	C	C	T	rs538702416		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr6:53787505C>T	ENST00000370888.1	+	14	1766	c.1489C>T	c.(1489-1491)Cgg>Tgg	p.R497W	RP3-523E19.2_ENST00000474641.2_RNA	NM_018214.4	NP_060684.4	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	497						cytoplasm (GO:0005737)|membrane (GO:0016020)				cervix(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		GGAGAATTTACGGAATGACAT	0.443																																																0			6											231.0	231.0	231.0					6																	53787505		1940	4151	6091	53895464	SO:0001583	missense	55227			AF332199	CCDS4953.2	6p12.2	2014-07-30	2003-11-19		ENSG00000137269	ENSG00000137269			14307	protein-coding gene	gene with protein product		608195	"""leucine-rich repeat-containing 1"""				Standard	NM_018214		Approved	dJ523E19.1, LANO, FLJ10775, FLJ11834	uc003pcd.1	Q9BTT6	OTTHUMG00000014885	ENST00000370888.1:c.1489C>T	6.37:g.53787505C>T	ENSP00000359925:p.Arg497Trp	Somatic		Capture	Illumina GAIIx	4	53895464	Q5TGN3|Q9HAC0|Q9NVF1	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00364,HMMSmart_SM00369,HMMPfam_LRR_1	p.R497W	ENST00000370888.1	37	c.1489	CCDS4953.2	6	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756706	0.89843	.	.	ENSG00000137269	ENST00000370888	T	0.55930	0.49	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.67534	0.2903	M	0.66297	2.02	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.66416	-0.5929	10	0.54805	T	0.06	.	19.2934	0.94112	0.0:1.0:0.0:0.0	.	497	Q9BTT6	LRRC1_HUMAN	W	497	ENSP00000359925:R497W	ENSP00000359925:R497W	R	+	1	2	LRRC1	53895464	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.593000	0.61034	2.808000	0.96608	0.655000	0.94253	CGG	-	NULL		0.443	LRRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC1	protein_coding	OTTHUMT00000040970.2	C	NM_025168		53895464	+1	no_errors	NM_018214	genbank	human	validated	54_36p	missense	SNP	1.000	T
CCDC155	147872	genome.wustl.edu	37	19	49898432	49898432	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:49898432G>C	ENST00000447857.3	+	4	423	c.218G>C	c.(217-219)cGc>cCc	p.R73P		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	73						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						CAGGATGCACGCCTCCAAACA	0.622																																																0			19											56.0	60.0	59.0					19																	49898432		2023	4172	6195	54590244	SO:0001583	missense	147872				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.218G>C	19.37:g.49898432G>C	ENSP00000404220:p.Arg73Pro	Somatic		Capture	Illumina GAIIx	4	54590244	Q96MC3	Missense_Mutation	SNP	NULL	p.R73P	ENST00000447857.3	37	c.218	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596322	0.46318	.	.	ENSG00000161609	ENST00000447857	T	0.63255	-0.03	4.52	3.46	0.39613	EF-hand-like domain (1);	0.277348	0.33457	N	0.004886	T	0.70911	0.3278	M	0.73962	2.25	0.25460	N	0.987929	D;D;D	0.71674	0.993;0.993;0.998	P;P;P	0.61328	0.884;0.884;0.887	T	0.60105	-0.7328	10	0.25751	T	0.34	-6.9641	9.1061	0.36698	0.1112:0.0:0.8888:0.0	.	73;73;153	C9JGW3;Q8N6L0;Q6ZRK4	.;CC155_HUMAN;.	P	73	ENSP00000404220:R73P	ENSP00000404220:R73P	R	+	2	0	CCDC155	54590244	0.887000	0.30362	0.946000	0.38457	0.978000	0.69477	2.282000	0.43461	2.246000	0.74042	0.462000	0.41574	CGC	-	NULL		0.622	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	protein_coding	OTTHUMT00000465436.2	G	NM_144688		54590244	+1	no_errors	NM_144688	genbank	human	provisional	54_36p	missense	SNP	0.941	C
ZNF473	25888	genome.wustl.edu	37	19	50548294	50548294	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:50548294G>C	ENST00000595661.1	+	6	1089	c.594G>C	c.(592-594)caG>caC	p.Q198H	ZNF473_ENST00000270617.3_Missense_Mutation_p.Q198H|ZNF473_ENST00000391821.2_Missense_Mutation_p.Q198H|CTD-2126E3.3_ENST00000599914.1_RNA|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000601364.1_Intron|ZNF473_ENST00000445728.3_Missense_Mutation_p.Q186H			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	198					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		ACCACAGCCAGCAGGATTCTG	0.458																																																0			19											67.0	62.0	64.0					19																	50548294		2203	4300	6503	55240106	SO:0001583	missense	25888			AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.594G>C	19.37:g.50548294G>C	ENSP00000472808:p.Gln198His	Somatic		Capture	Illumina GAIIx	4	55240106	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.Q198H	ENST00000595661.1	37	c.594	CCDS33077.1	19	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025805	0.35701	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.09817	3.02;3.02;2.94	4.36	2.09	0.27110	.	0.398749	0.18559	N	0.137667	T	0.05547	0.0146	L	0.27053	0.805	0.21020	N	0.999809	B	0.30914	0.3	B	0.25405	0.06	T	0.31668	-0.9935	10	0.35671	T	0.21	-12.9547	1.8078	0.03084	0.1261:0.2:0.4673:0.2066	.	198	Q8WTR7	ZN473_HUMAN	H	198;198;186	ENSP00000270617:Q198H;ENSP00000375697:Q198H;ENSP00000388961:Q186H	ENSP00000270617:Q198H	Q	+	3	2	ZNF473	55240106	0.000000	0.05858	0.076000	0.20297	0.155000	0.21991	-0.083000	0.11286	0.648000	0.30732	0.655000	0.94253	CAG	-	NULL		0.458	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF473	protein_coding	OTTHUMT00000464833.1	G	XM_046390		55240106	+1	no_errors	NM_001006656	genbank	human	validated	54_36p	missense	SNP	0.005	C
OR5I1	10798	genome.wustl.edu	37	11	55703874	55703874	+	Start_Codon_SNP	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr11:55703874C>A	ENST00000301532.3	-	1	2	c.3G>T	c.(1-3)atG>atT	p.M1I		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	1					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CTGTAAATTCCATCTTCTGTG	0.313																																																0			11											31.0	31.0	31.0					11																	55703874		2198	4289	6487	55460450	SO:0001582	initiator_codon_variant	10798			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.3G>T	11.37:g.55703874C>A	ENSP00000301532:p.Met1Ile	Somatic		Capture	Illumina GAIIx	4	55460450	Q6IEU4	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.M1I	ENST00000301532.3	37	c.3	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	c	4.361	0.066475	0.08388	.	.	ENSG00000167825	ENST00000301532	T	0.00382	7.61	4.95	4.05	0.47172	.	0.141481	0.32852	N	0.005574	T	0.00210	0.0006	.	.	.	0.47511	D	0.999447	B	0.17038	0.02	B	0.14578	0.011	T	0.68678	-0.5345	9	0.26408	T	0.33	.	6.9759	0.24674	0.1698:0.7403:0.0:0.0899	.	1	Q13606	OR5I1_HUMAN	I	1	ENSP00000301532:M1I	ENSP00000301532:M1I	M	-	3	0	OR5I1	55460450	0.016000	0.18221	0.674000	0.29902	0.033000	0.12548	0.470000	0.22084	1.210000	0.43336	-0.150000	0.13652	ATG	-	superfamily_SSF81321		0.313	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	protein_coding	OTTHUMT00000391528.1	C	NM_006637	Missense_Mutation	55460450	-1	no_errors	NM_006637	genbank	human	reviewed	54_36p	missense	SNP	0.480	A
FPR3	2359	genome.wustl.edu	37	19	52327524	52327524	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:52327524T>A	ENST00000339223.4	+	2	702	c.523T>A	c.(523-525)Tac>Aac	p.Y175N	FPR3_ENST00000595991.1_Missense_Mutation_p.Y175N	NM_002030.3	NP_002021.3	P25089	FPR3_HUMAN	formyl peptide receptor 3	175					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)			NS(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)	35						TGGGGACACATACTGTATTTT	0.438																																																0			19											186.0	168.0	174.0					19																	52327524		2203	4300	6503	57019336	SO:0001583	missense	2359				CCDS12841.1	19q13.3-q13.4	2012-08-08	2008-04-17	2008-04-17		ENSG00000187474		"""GPCR / Class A : Formyl peptide receptors"""	3828	protein-coding gene	gene with protein product		136539	"""formyl peptide receptor-like 2"""	FPRL2		1612600, 8198572	Standard	NM_002030		Approved	FPRH1, FMLPY, RMLP-R-I	uc002pxt.1	P25089		ENST00000339223.4:c.523T>A	19.37:g.52327524T>A	ENSP00000341821:p.Tyr175Asn	Somatic		Capture	Illumina GAIIx	4	57019336		Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.Y175N	ENST00000339223.4	37	c.523	CCDS12841.1	19	.	.	.	.	.	.	.	.	.	.	.	4.236	0.042706	0.08196	.	.	ENSG00000187474	ENST00000339223	T	0.38401	1.14	2.34	0.0413	0.14213	GPCR, rhodopsin-like superfamily (1);	0.786233	0.11220	N	0.586799	T	0.35799	0.0944	L	0.56199	1.76	0.09310	N	1	B	0.27765	0.188	B	0.38755	0.281	T	0.43718	-0.9374	10	0.29301	T	0.29	.	7.3001	0.26415	0.0:0.2529:0.0:0.7471	.	175	P25089	FPR3_HUMAN	N	175	ENSP00000341821:Y175N	ENSP00000341821:Y175N	Y	+	1	0	FPR3	57019336	0.537000	0.26386	0.000000	0.03702	0.008000	0.06430	1.848000	0.39309	-0.649000	0.05430	-1.773000	0.00660	TAC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.438	FPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FPR3	protein_coding	OTTHUMT00000466914.1	T	NM_002030		57019336	+1	no_errors	NM_002030	genbank	human	validated	54_36p	missense	SNP	0.001	A
ANXA2	302	genome.wustl.edu	37	15	60653146	60653146	+	Silent	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr15:60653146G>T	ENST00000396024.3	-	6	510	c.351C>A	c.(349-351)tcC>tcA	p.S117S	ANXA2_ENST00000332680.4_Silent_p.S135S|ANXA2_ENST00000421017.2_Silent_p.S117S|ANXA2_ENST00000557937.1_5'Flank|ANXA2_ENST00000451270.2_Silent_p.S117S	NM_001136015.2	NP_001129487.1	P07355	ANXA2_HUMAN	annexin A2	117					angiogenesis (GO:0001525)|body fluid secretion (GO:0007589)|cellular response to acid chemical (GO:0071229)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|membrane budding (GO:0006900)|membrane raft assembly (GO:0001765)|negative regulation of catalytic activity (GO:0043086)|osteoclast development (GO:0036035)|positive regulation of binding (GO:0051099)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vesicle fusion (GO:0031340)|protein heterotetramerization (GO:0051290)|protein targeting to plasma membrane (GO:0072661)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell surface (GO:0009986)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|late endosome membrane (GO:0031902)|lipid particle (GO:0005811)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)|midbody (GO:0030496)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|sarcolemma (GO:0042383)|Schmidt-Lanterman incisure (GO:0043220)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phospholipase A2 inhibitor activity (GO:0019834)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			kidney(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)	9					Tenecteplase(DB00031)	TTACCTTCATGGAAGCTTTTA	0.413																																																0			15											67.0	62.0	64.0					15																	60653146		2203	4300	6503	58440438	SO:0001819	synonymous_variant	302			D00017	CCDS10175.1, CCDS32256.1	15q22.2	2012-10-02			ENSG00000182718	ENSG00000182718		"""Annexins"""	537	protein-coding gene	gene with protein product	"""annexin II"""	151740		ANX2, ANX2L4, CAL1H, LPC2D		7961821	Standard	NM_001136015		Approved	LIP2	uc002agm.3	P07355	OTTHUMG00000132763	ENST00000396024.3:c.351C>A	15.37:g.60653146G>T		Somatic		Capture	Illumina GAIIx	4	58440438	Q567R4|Q6N0B3|Q8TBV2|Q96DD5|Q9UDH8	Silent	SNP	superfamily_Annexin,HMMPfam_Annexin,PatternScan_ANNEXIN,HMMSmart_SM00335	p.S135	ENST00000396024.3	37	c.405	CCDS10175.1	15																																																																																			-	superfamily_Annexin,HMMPfam_Annexin		0.413	ANXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA2	protein_coding	OTTHUMT00000256135.1	G	NM_001002857		58440438	-1	no_errors	NM_001002858	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
RBBP4P4	727842	genome.wustl.edu	37	6	58446347	58446347	+	IGR	SNP	T	T	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr6:58446347T>C								XXbac-BPG55C20.7 (147851 upstream) : RP11-143A22.1 (42540 downstream)																							TATTTTATCCTTAAGTAATTC	0.398																																																0			6																																								58554306	SO:0001628	intergenic_variant	727842																															6.37:g.58446347T>C		Somatic		Capture	Illumina GAIIx	4	58554306		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.398					LOC727842			T			58554306	-1	pseudogene	XR_015140	genbank	human	model	54_36p	rna	SNP	0.999	C
CYP7A1	1581	genome.wustl.edu	37	8	59404924	59404924	+	Silent	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr8:59404924G>A	ENST00000301645.3	-	5	1340	c.1203C>T	c.(1201-1203)taC>taT	p.Y401Y		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	401					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				AAGGGTCTGGGTAGATTTCTG	0.393									Neonatal Giant Cell Hepatitis																																							0			8											159.0	141.0	147.0					8																	59404924		2203	4300	6503	59567478	SO:0001819	synonymous_variant	1581	Familial Cancer Database	Neonatal Hemochromatosis	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.1203C>T	8.37:g.59404924G>A		Somatic		Capture	Illumina GAIIx	4	59567478	P78454|Q3MIL8|Q7KZ19	Silent	SNP	HMMPfam_p450,superfamily_Cytochrome_P450,PatternScan_CYTOCHROME_P450	p.Y401	ENST00000301645.3	37	c.1203	CCDS6171.1	8																																																																																			-	HMMPfam_p450,superfamily_Cytochrome_P450		0.393	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7A1	protein_coding	OTTHUMT00000378190.1	G	NM_000780		59567478	-1	no_errors	NM_000780	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
NLRP2	55655	genome.wustl.edu	37	19	55501460	55501460	+	Silent	SNP	C	C	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr19:55501460C>T	ENST00000543010.1	+	9	2580	c.2437C>T	c.(2437-2439)Ctg>Ttg	p.L813L	NLRP2_ENST00000391721.4_Silent_p.L789L|NLRP2_ENST00000537859.1_Silent_p.L791L|NLRP2_ENST00000427260.2_Silent_p.L790L|NLRP2_ENST00000448584.2_Silent_p.L813L|NLRP2_ENST00000263437.6_Silent_p.L810L|NLRP2_ENST00000538819.1_Silent_p.L789L|NLRP2_ENST00000339757.7_Silent_p.L791L	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	813					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		CAACCAGTCCCTGACGTGCGT	0.512																																																0			19											134.0	114.0	121.0					19																	55501460		2203	4300	6503	60193272	SO:0001819	synonymous_variant	55655			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2437C>T	19.37:g.55501460C>T		Somatic		Capture	Illumina GAIIx	4	60193272	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Silent	SNP	superfamily_DEATH domain,HMMPfam_PAAD_DAPIN,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_NACHT,superfamily_RNI-like,HMMSmart_SM00368	p.L813	ENST00000543010.1	37	c.2437	CCDS12913.1	19																																																																																			-	superfamily_RNI-like,HMMSmart_SM00368		0.512	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	protein_coding	OTTHUMT00000396152.1	C	NM_017852		60193272	+1	no_errors	NM_017852	genbank	human	provisional	54_36p	silent	SNP	0.303	T
TNRC18P2	27320	genome.wustl.edu	37	7	63040701	63040701	+	IGR	SNP	A	A	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr7:63040701A>T								RP11-340I6.3 (158277 upstream) : RN7SL855P (31121 downstream)																							TCCAGACAGTAGATGTGGGGC	0.657																																																0			7																																								62678136	SO:0001628	intergenic_variant	27320																															7.37:g.63040701A>T		Somatic		Capture	Illumina GAIIx	4	62678136		Missense_Mutation	SNP	NULL	p.Y131N		37	c.391		7																																																																																			-	NULL	0	0.657					TNRC18			A			62678136	-1	pseudogene	XM_376618	genbank	human	model	54_36p	missense	SNP	1.000	T
BPTF	2186	genome.wustl.edu	37	17	65941680	65941680	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr17:65941680C>G	ENST00000321892.4	+	23	7295	c.7234C>G	c.(7234-7236)Cag>Gag	p.Q2412E	BPTF_ENST00000335221.5_Missense_Mutation_p.Q2412E|BPTF_ENST00000424123.3_Missense_Mutation_p.Q2273E|BPTF_ENST00000306378.6_Missense_Mutation_p.Q2286E			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2412					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			aacccagccccagtccccagc	0.577																																																0			17											51.0	50.0	50.0					17																	65941680		2203	4300	6503	63372142	SO:0001583	missense	2186			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.7234C>G	17.37:g.65941680C>G	ENSP00000315454:p.Gln2412Glu	Somatic		Capture	Illumina GAIIx	4	63372142	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	HMMPfam_FYDLN_acid,HMMPfam_DDT,HMMSmart_DDT,superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1,PatternScan_EGF_2,HMMSmart_BROMO,superfamily_Bromodomain,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.Q2286E	ENST00000321892.4	37	c.6856		17	.	.	.	.	.	.	.	.	.	.	C	4.791	0.147110	0.09134	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.65178	0.11;-0.14;0.06	5.36	0.953	0.19590	.	.	.	.	.	T	0.52386	0.1731	L	0.59436	1.845	0.20821	N	0.999845	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.08055	0.0;0.003;0.003	T	0.45687	-0.9244	9	0.46703	T	0.11	.	4.4108	0.11432	0.1292:0.6086:0.1247:0.1376	.	90;2286;2412	B4DJV8;Q12830-2;Q12830-4	.;.;.	E	2286;2412;2412	ENSP00000307208:Q2286E;ENSP00000334351:Q2412E;ENSP00000315454:Q2412E	ENSP00000307208:Q2286E	Q	+	1	0	BPTF	63372142	0.015000	0.18098	0.057000	0.19452	0.661000	0.39034	1.081000	0.30791	-0.023000	0.13963	-0.142000	0.14014	CAG	-	NULL		0.577	BPTF-201	KNOWN	basic	protein_coding	BPTF	protein_coding		C	NM_182641, NM_004459		63372142	+1	no_errors	NM_182641	genbank	human	reviewed	54_36p	missense	SNP	0.693	G
ZWILCH	55055	genome.wustl.edu	37	15	66824675	66824675	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr15:66824675C>T	ENST00000307897.5	+	13	1626	c.1246C>T	c.(1246-1248)Cca>Tca	p.P416S	ZWILCH_ENST00000535141.2_Missense_Mutation_p.P302S|ZWILCH_ENST00000446801.2_Missense_Mutation_p.P302S|ZWILCH_ENST00000565627.1_Missense_Mutation_p.P302S	NM_017975.3	NP_060445.3	Q9H900	ZWILC_HUMAN	zwilch kinetochore protein	416					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(1)|lung(6)|ovary(1)	18						TGGGACTATTCCAGTTCAAAT	0.338																																																0			15											92.0	90.0	91.0					15																	66824675		2201	4298	6499	64611729	SO:0001583	missense	55055			AK023175	CCDS10219.1, CCDS73746.1	15q22.31	2013-01-17	2012-12-13		ENSG00000174442	ENSG00000174442			25468	protein-coding gene	gene with protein product		609984	"""Zwilch, kinetochore associated, homolog (Drosophila)"""			12686595	Standard	NM_017975		Approved	FLJ10036, KNTC1AP	uc002aqb.3	Q9H900	OTTHUMG00000133194	ENST00000307897.5:c.1246C>T	15.37:g.66824675C>T	ENSP00000311429:p.Pro416Ser	Somatic		Capture	Illumina GAIIx	4	64611729	B3KVB8|Q6N049|Q8N404|Q96SY7|Q9NWG7	Missense_Mutation	SNP	HMMPfam_DUF2352	p.P416S	ENST00000307897.5	37	c.1246	CCDS10219.1	15	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125092	0.77436	.	.	ENSG00000174442	ENST00000307897;ENST00000446801;ENST00000535141	T;T;T	0.57752	0.38;0.38;0.38	5.55	4.64	0.57946	.	0.098066	0.64402	N	0.000001	T	0.66005	0.2746	M	0.74258	2.255	0.58432	D	0.999999	D	0.54601	0.967	P	0.54759	0.76	T	0.71080	-0.4696	10	0.66056	D	0.02	-4.1536	14.297	0.66321	0.0:0.9286:0.0:0.0714	.	416	Q9H900	ZWILC_HUMAN	S	416;302;302	ENSP00000311429:P416S;ENSP00000402217:P302S;ENSP00000437749:P302S	ENSP00000311429:P416S	P	+	1	0	ZWILCH	64611729	1.000000	0.71417	0.899000	0.35326	0.876000	0.50452	4.883000	0.63128	1.355000	0.45865	0.650000	0.86243	CCA	-	HMMPfam_DUF2352		0.338	ZWILCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZWILCH	protein_coding	OTTHUMT00000256904.4	C	NM_017975		64611729	+1	no_errors	NM_017975	genbank	human	validated	54_36p	missense	SNP	0.970	T
IL26	55801	genome.wustl.edu	37	12	68619490	68619490	+	Missense_Mutation	SNP	A	A	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr12:68619490A>C	ENST00000229134.4	-	1	111	c.47T>G	c.(46-48)cTg>cGg	p.L16R	IFNG-AS1_ENST00000536914.1_RNA	NM_018402.1	NP_060872.1	Q9NPH9	IL26_HUMAN	interleukin 26	16					cell-cell signaling (GO:0007267)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		GGCAAGAGACAGAGTGACTAA	0.468																																																0			12											274.0	236.0	249.0					12																	68619490		2203	4300	6503	66905757	SO:0001583	missense	55801			AJ251549	CCDS8981.1	12q15	2008-08-04			ENSG00000111536	ENSG00000111536		"""Interleukins and interleukin receptors"""	17119	protein-coding gene	gene with protein product		605679				10729163, 11528524	Standard	NM_018402		Approved	AK155, IL-26	uc001stx.1	Q9NPH9	OTTHUMG00000169114	ENST00000229134.4:c.47T>G	12.37:g.68619490A>C	ENSP00000229134:p.Leu16Arg	Somatic		Capture	Illumina GAIIx	4	66905757		Missense_Mutation	SNP	superfamily_4_helix_cytokine,HMMSmart_IL10,PatternScan_INTERLEUKIN_10,HMMPfam_IL10	p.L16R	ENST00000229134.4	37	c.47	CCDS8981.1	12	.	.	.	.	.	.	.	.	.	.	A	14.26	2.482766	0.44147	.	.	ENSG00000111536	ENST00000229134	T	0.62941	-0.01	4.54	3.33	0.38152	Four-helical cytokine, core (1);	0.000000	0.39407	N	0.001380	T	0.68879	0.3049	L	0.56769	1.78	0.09310	N	1	D	0.55800	0.973	P	0.60541	0.876	T	0.58685	-0.7593	9	.	.	.	.	8.4373	0.32795	0.8255:0.0:0.0:0.1745	.	16	Q9NPH9	IL26_HUMAN	R	16	ENSP00000229134:L16R	.	L	-	2	0	IL26	66905757	0.993000	0.37304	0.261000	0.24466	0.725000	0.41563	3.220000	0.51207	0.782000	0.33613	0.379000	0.24179	CTG	-	NULL		0.468	IL26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL26	protein_coding	OTTHUMT00000402302.1	A	NM_018402		66905757	-1	no_errors	NM_018402	genbank	human	reviewed	54_36p	missense	SNP	0.079	C
CYP26B1	56603	genome.wustl.edu	37	2	72371321	72371321	+	Silent	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:72371321G>T	ENST00000001146.2	-	2	429	c.226C>A	c.(226-228)Cgg>Agg	p.R76R	CYP26B1_ENST00000412253.1_5'Flank|CYP26B1_ENST00000546307.1_Intron	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	76					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						TTCTCCCTCCGCGACGACTGG	0.662																																																0			2											66.0	65.0	65.0					2																	72371321		2203	4300	6503	72224829	SO:0001819	synonymous_variant	56603				CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.226C>A	2.37:g.72371321G>T		Somatic		Capture	Illumina GAIIx	4	72224829	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Silent	SNP	HMMPfam_p450,superfamily_Cytochrome_P450,PatternScan_CYTOCHROME_P450	p.R76	ENST00000001146.2	37	c.226	CCDS1919.1	2																																																																																			-	HMMPfam_p450,superfamily_Cytochrome_P450		0.662	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP26B1	protein_coding	OTTHUMT00000251969.1	G	NM_019885		72224829	-1	no_errors	NM_019885	genbank	human	reviewed	54_36p	silent	SNP	0.945	T
TSIX	9383	genome.wustl.edu	37	X	73046938	73046938	+	lincRNA	SNP	C	C	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chrX:73046938C>T	ENST00000604411.1	+	0	34899				XIST_ENST00000429829.1_lincRNA	NR_003255.2				TSIX transcript, XIST antisense RNA																		GGCCTTCTATCCATATGAGCC	0.483																																																0			X											160.0	150.0	153.0					X																	73046938		876	1991	2867	72963663			7503					Xq13.2	2012-10-19	2012-08-15			ENSG00000270641		"""Long non-coding RNAs"", ""-"""	12377	non-coding RNA	RNA, long non-coding	"""XIST antisense RNA (non-protein coding)"", ""long intergenic non-protein coding RNA 13"""	300181	"""X (inactive)-specific transcript, antisense"", ""TSIX transcript, XIST antisense RNA (non-protein coding)"""			10192391	Standard	NR_003255		Approved	NCRNA00013, XIST-AS1, LINC00013	uc004ebn.2				X.37:g.73046938C>T		Somatic		Capture	Illumina GAIIx	4	72963663		RNA	SNP	-	NULL	ENST00000604411.1	37	NULL		X																																																																																			-	-		0.483	TSIX-001	KNOWN	basic	lincRNA	XIST	lincRNA	OTTHUMT00000469120.1	C	NR_003255		72963663	-1	no_errors	NR_001564	genbank	human	reviewed	54_36p	rna	SNP	0.022	T
SHROOM3	57619	genome.wustl.edu	37	4	77661479	77661479	+	Missense_Mutation	SNP	G	G	C	rs114419726	byFrequency	TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr4:77661479G>C	ENST00000296043.6	+	5	3106	c.2153G>C	c.(2152-2154)cGg>cCg	p.R718P		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	718					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CATCTGGACCGGCAGGTTTCC	0.677																																																0			4											42.0	52.0	49.0					4																	77661479		2166	4245	6411	77880503	SO:0001583	missense	57619			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2153G>C	4.37:g.77661479G>C	ENSP00000296043:p.Arg718Pro	Somatic		Capture	Illumina GAIIx	4	77880503	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,HMMPfam_ASD1,HMMPfam_ASD2	p.R717P	ENST00000296043.6	37	c.2150	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	g	11.62	1.692638	0.30052	.	.	ENSG00000138771	ENST00000296043	T	0.32515	1.45	5.65	3.92	0.45320	.	0.388239	0.22949	N	0.053685	T	0.26159	0.0638	L	0.53249	1.67	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.13361	-1.0512	10	0.30854	T	0.27	-18.5867	7.8735	0.29580	0.1508:0.141:0.7082:0.0	.	542;718;496	B4E244;Q8TF72;B3KY47	.;SHRM3_HUMAN;.	P	718	ENSP00000296043:R718P	ENSP00000296043:R718P	R	+	2	0	SHROOM3	77880503	0.068000	0.21057	0.946000	0.38457	0.004000	0.04260	1.107000	0.31110	1.397000	0.46682	-0.260000	0.10688	CGG	-	NULL		0.677	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	protein_coding	OTTHUMT00000252408.2	G	NM_020859		77880503	+1	no_errors	NM_020859	genbank	human	validated	54_36p	missense	SNP	0.100	C
LPAR3	23566	genome.wustl.edu	37	1	85331079	85331079	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:85331079A>G	ENST00000440886.1	-	1	763	c.725T>C	c.(724-726)aTg>aCg	p.M242T	LPAR3_ENST00000491034.1_5'UTR|LPAR3_ENST00000370611.3_Missense_Mutation_p.M242T			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	242					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						TAAGACAGTCATCACCGTCTT	0.498																																																0			1											61.0	47.0	52.0					1																	85331079		2203	4300	6503	85103667	SO:0001583	missense	23566			AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.725T>C	1.37:g.85331079A>G	ENSP00000395389:p.Met242Thr	Somatic		Capture	Illumina GAIIx	4	85103667	A0AVA3	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.M242T	ENST00000440886.1	37	c.725	CCDS700.1	1	.	.	.	.	.	.	.	.	.	.	A	14.66	2.601171	0.46423	.	.	ENSG00000171517	ENST00000440886;ENST00000370611	T;T	0.35236	1.32;1.32	5.2	5.2	0.72013	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.08846	0.0219	N	0.02011	-0.69	0.45762	D	0.998651	D	0.53312	0.959	P	0.46796	0.527	T	0.12656	-1.0539	10	0.10377	T	0.69	.	15.0929	0.72211	1.0:0.0:0.0:0.0	.	242	Q9UBY5	LPAR3_HUMAN	T	242	ENSP00000395389:M242T;ENSP00000359643:M242T	ENSP00000359643:M242T	M	-	2	0	LPAR3	85103667	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.339000	0.72969	1.974000	0.57490	0.528000	0.53228	ATG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.498	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR3	protein_coding	OTTHUMT00000027467.1	A	NM_012152		85103667	-1	no_errors	NM_012152	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	9	88801486	88801486	+	IGR	SNP	C	C	T	rs116880987	byFrequency	TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr9:88801486C>T								GOLM1 (86422 upstream) : C9orf153 (33693 downstream)																							gacagagcagcgtgtggagac	0.507													C|||	34	0.00678914	0.0008	0.0086	5008	,	,		19985	0.0		0.0268	False		,,,				2504	0.0															0			9																																								87991306	SO:0001628	intergenic_variant	0																															9.37:g.88801486C>T		Somatic		Capture	Illumina GAIIx	4	87991306		Missense_Mutation	SNP	NULL	p.R93C		37	c.277		9																																																																																			-	NULL	0	0.507					LOC100130433			C			87991306	+1	no_errors	XM_001723202	genbank	human	model	54_36p	missense	SNP	0.000	T
MDN1	23195	genome.wustl.edu	37	6	90463320	90463320	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr6:90463320T>C	ENST00000369393.3	-	22	3101	c.2986A>G	c.(2986-2988)Aca>Gca	p.T996A	MDN1_ENST00000428876.1_Missense_Mutation_p.T996A			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	996					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCAAGCTGTGTTAAGAAACCC	0.378																																																0			6											112.0	110.0	111.0					6																	90463320		2203	4300	6503	90520041	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.2986A>G	6.37:g.90463320T>C	ENSP00000358400:p.Thr996Ala	Somatic		Capture	Illumina GAIIx	4	90520041	O15019|Q5T794	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,superfamily_vWA-like,HMMSmart_SM00327	p.T996A	ENST00000369393.3	37	c.2986	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	T	18.40	3.615985	0.66672	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.21361	3.35;3.35;2.01	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.46132	0.1377	M	0.90369	3.11	0.58432	D	0.999999	D;D	0.65815	0.995;0.995	D;D	0.74023	0.925;0.982	T	0.56390	-0.7987	10	0.59425	D	0.04	.	14.9194	0.70826	0.0:0.0:0.0:1.0	.	923;996	Q5T795;Q9NU22	.;MDN1_HUMAN	A	996;996;923	ENSP00000358400:T996A;ENSP00000413970:T996A;ENSP00000409664:T923A	ENSP00000358400:T996A	T	-	1	0	MDN1	90520041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.106000	0.77039	2.254000	0.74563	0.533000	0.62120	ACA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.378	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	protein_coding	OTTHUMT00000041514.2	T			90520041	-1	no_errors	NM_014611	genbank	human	provisional	54_36p	missense	SNP	1.000	C
DICER1	23405	genome.wustl.edu	37	14	95592996	95592996	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr14:95592996T>G	ENST00000526495.1	-	9	1115	c.824A>C	c.(823-825)gAa>gCa	p.E275A	DICER1_ENST00000393063.1_Missense_Mutation_p.E275A|DICER1_ENST00000527414.1_Missense_Mutation_p.E275A|DICER1_ENST00000541352.1_Missense_Mutation_p.E275A|DICER1_ENST00000343455.3_Missense_Mutation_p.E275A			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	275	Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AAGTGCTTCTTCTAATTCCAT	0.338			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																													yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0			14											118.0	129.0	126.0					14																	95592996		2203	4299	6502	94662749	SO:0001583	missense	23405	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.824A>C	14.37:g.95592996T>G	ENSP00000437256:p.Glu275Ala	Somatic		Capture	Illumina GAIIx	4	94662749	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	HMMSmart_DEXDc,superfamily_SSF52540,HMMPfam_DEAD,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_dsRNA_bind,HMMPfam_PAZ,superfamily_SSF101690,superfamily_RNase_III,HMMSmart_RIBOc,HMMPfam_Ribonuclease_3,PatternScan_RNASE_3_1,superfamily_SSF54768,HMMSmart_DSRM,HMMPfam_dsrm	p.E275A	ENST00000526495.1	37	c.824	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	T	11.12	1.544680	0.27563	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.58210	0.35;0.35;0.35;0.35;0.66	5.39	5.39	0.77823	.	0.089843	0.85682	D	0.000000	T	0.40956	0.1138	L	0.34521	1.04	0.47994	D	0.999563	B	0.09022	0.002	B	0.10450	0.005	T	0.28299	-1.0048	10	0.10111	T	0.7	-26.58	15.4275	0.75065	0.0:0.0:0.0:1.0	.	275	Q9UPY3	DICER_HUMAN	A	275	ENSP00000343745:E275A;ENSP00000437256:E275A;ENSP00000376783:E275A;ENSP00000435681:E275A;ENSP00000444719:E275A	ENSP00000343745:E275A	E	-	2	0	DICER1	94662749	1.000000	0.71417	0.979000	0.43373	0.933000	0.57130	7.228000	0.78079	2.043000	0.60533	0.533000	0.62120	GAA	-	superfamily_SSF52540		0.338	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	protein_coding	OTTHUMT00000387997.1	T			94662749	-1	no_errors	NM_030621	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	X	95228185	95228185	+	IGR	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chrX:95228185G>A								RNA5SP510 (391024 upstream) : RN7SL379P (50173 downstream)																							CACAAAGATCGGAGCCAGGAC	0.507																																																0			X																																								95114841	SO:0001628	intergenic_variant	0																															X.37:g.95228185G>A		Somatic		Capture	Illumina GAIIx	4	95114841		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.507					LOC648927			G			95114841	-1	pseudogene	XR_038906	genbank	human	model	54_36p	rna	SNP	0.306	A
PTCH1	5727	genome.wustl.edu	37	9	98209217	98209217	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr9:98209217G>A	ENST00000331920.6	-	23	4620	c.4321C>T	c.(4321-4323)Ccc>Tcc	p.P1441S	PTCH1_ENST00000430669.2_Missense_Mutation_p.P1375S|PTCH1_ENST00000421141.1_Missense_Mutation_p.P1290S|PTCH1_ENST00000418258.1_Missense_Mutation_p.P1290S|PTCH1_ENST00000375274.2_Missense_Mutation_p.P1440S|PTCH1_ENST00000437951.1_Missense_Mutation_p.P1375S|PTCH1_ENST00000429896.2_Missense_Mutation_p.P1290S	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1441					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				CTTCCCCGGGGCCTCTCCTCG	0.602																																																0			9											89.0	91.0	90.0					9																	98209217		2203	4300	6503	97249038	SO:0001583	missense	5727			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.4321C>T	9.37:g.98209217G>A	ENSP00000332353:p.Pro1441Ser	Somatic		Capture	Illumina GAIIx	4	97249038	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	HMMPfam_Patched,superfamily_SSF82866	p.P1441S	ENST00000331920.6	37	c.4321	CCDS6714.1	9	.	.	.	.	.	.	.	.	.	.	G	12.78	2.039586	0.35989	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.89485	-2.5;-2.5;-2.48;-2.48;-2.5;-2.48;-2.52	5.06	0.565	0.17309	.	0.563069	0.20504	N	0.091021	T	0.72087	0.3417	N	0.14661	0.345	0.29734	N	0.837668	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.56685	-0.7938	10	0.12103	T	0.63	-5.1261	3.6175	0.08083	0.0872:0.1096:0.3106:0.4925	.	1375;1440;1441	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	S	1441;1375;1290;1290;1375;1290;1440	ENSP00000332353:P1441S;ENSP00000389744:P1375S;ENSP00000399981:P1290S;ENSP00000396135:P1290S;ENSP00000410287:P1375S;ENSP00000414823:P1290S;ENSP00000364423:P1440S	ENSP00000332353:P1441S	P	-	1	0	PTCH1	97249038	1.000000	0.71417	0.542000	0.28115	0.908000	0.53690	1.659000	0.37387	0.265000	0.21872	-0.140000	0.14226	CCC	-	NULL		0.602	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	protein_coding	OTTHUMT00000053229.2	G	NM_000264		97249038	-1	no_errors	NM_000264	genbank	human	reviewed	54_36p	missense	SNP	0.083	A
CERS3	204219	genome.wustl.edu	37	15	101019638	101019638	+	Nonsense_Mutation	SNP	T	T	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr15:101019638T>A	ENST00000394113.1	-	9	1201	c.511A>T	c.(511-513)Aaa>Taa	p.K171*	CERS3_ENST00000560944.1_Intron|CERS3_ENST00000284382.4_Nonsense_Mutation_p.K171*|CERS3_ENST00000538112.2_Nonsense_Mutation_p.K171*			Q8IU89	CERS3_HUMAN	ceramide synthase 3	171	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CTTACCTGTTTGGGATAGCCA	0.403																																																0			15											138.0	132.0	134.0					15																	101019638		2203	4300	6503	98837161	SO:0001587	stop_gained	204219				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.511A>T	15.37:g.101019638T>A	ENSP00000377672:p.Lys171*	Somatic		Capture	Illumina GAIIx	4	98837161	Q8NE64|Q8NEN6	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,HMMPfam_Homeobox,HMMSmart_SM00389,HMMSmart_SM00724,HMMPfam_TRAM_LAG1_CLN8	p.K171*	ENST00000394113.1	37	c.511	CCDS10384.1	15	.	.	.	.	.	.	.	.	.	.	T	37	6.095806	0.97276	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	.	.	.	5.18	4.04	0.47022	.	0.376195	0.29940	N	0.010817	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-0.9659	7.1421	0.25562	0.1457:0.0:0.1519:0.7024	.	.	.	.	X	171;182;171	.	ENSP00000284382:K171X	K	-	1	0	CERS3	98837161	0.069000	0.21087	0.901000	0.35422	0.333000	0.28666	1.817000	0.39002	0.787000	0.33731	-0.644000	0.03951	AAA	-	HMMSmart_SM00724,HMMPfam_TRAM_LAG1_CLN8		0.403	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	LASS3	protein_coding	OTTHUMT00000313594.4	T	NM_178842		98837161	-1	no_errors	NM_178842	genbank	human	validated	54_36p	nonsense	SNP	0.967	A
OR5H1	26341	genome.wustl.edu	37	3	97852250	97852250	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr3:97852250G>T	ENST00000354565.2	+	1	709	c.709G>T	c.(709-711)Gcc>Tcc	p.A237S	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						TGTAAGGAAAGCCTTTTCCAC	0.403																																																0			3											108.0	117.0	114.0					3																	97852250		2203	4299	6502	99334940	SO:0001583	missense	26341			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.709G>T	3.37:g.97852250G>T	ENSP00000346575:p.Ala237Ser	Somatic		Capture	Illumina GAIIx	4	99334940		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A237S	ENST00000354565.2	37	c.709	CCDS33797.1	3	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021643	0.35701	.	.	ENSG00000231192	ENST00000354565	T	0.00359	7.87	3.57	3.57	0.40892	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000264	T	0.00724	0.0024	M	0.92691	3.335	0.23346	N	0.997864	P	0.44195	0.828	P	0.50934	0.654	T	0.07597	-1.0764	10	0.72032	D	0.01	.	12.6623	0.56822	0.0:0.0:1.0:0.0	.	237	A6NKK0	OR5H1_HUMAN	S	237	ENSP00000346575:A237S	ENSP00000346575:A237S	A	+	1	0	OR5H1	99334940	1.000000	0.71417	0.894000	0.35097	0.034000	0.12701	6.794000	0.75135	1.818000	0.53035	0.195000	0.17529	GCC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.403	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H1	protein_coding	OTTHUMT00000359100.2	G	NM_001005338		99334940	+1	no_errors	NM_001005338	genbank	human	provisional	54_36p	missense	SNP	1.000	T
OR4F6	390648	genome.wustl.edu	37	15	102346155	102346155	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr15:102346155C>A	ENST00000328882.4	+	1	254	c.233C>A	c.(232-234)gCt>gAt	p.A78D		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TCCTCCACAGCTCCCAAGATG	0.463																																																0			15											252.0	242.0	245.0					15																	102346155		2203	4300	6503	100163678	SO:0001583	missense	390648			AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.233C>A	15.37:g.102346155C>A	ENSP00000327525:p.Ala78Asp	Somatic		Capture	Illumina GAIIx	4	100163678	B9EH28|Q6IF95	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A78D	ENST00000328882.4	37	c.233	CCDS32341.1	15	.	.	.	.	.	.	.	.	.	.	.	8.224	0.803172	0.16397	.	.	ENSG00000184140	ENST00000328882	T	0.02140	4.43	4.75	2.87	0.33458	GPCR, rhodopsin-like superfamily (1);	0.654033	0.14215	N	0.333793	T	0.04452	0.0122	M	0.82433	2.59	0.09310	N	1	P	0.37781	0.608	B	0.35182	0.197	T	0.25779	-1.0122	10	0.87932	D	0	.	6.8056	0.23777	0.0:0.7129:0.0:0.2871	.	78	Q8NGB9	OR4F6_HUMAN	D	78	ENSP00000327525:A78D	ENSP00000327525:A78D	A	+	2	0	OR4F6	100163678	0.000000	0.05858	0.053000	0.19242	0.384000	0.30261	0.308000	0.19314	0.712000	0.32039	-0.216000	0.12614	GCT	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.463	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F6	protein_coding	OTTHUMT00000417593.1	C			100163678	+1	no_errors	NM_001005326	genbank	human	provisional	54_36p	missense	SNP	0.000	A
HNRNPH2	3188	genome.wustl.edu	37	X	100667421	100667421	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chrX:100667421G>T	ENST00000316594.5	+	2	523	c.445G>T	c.(445-447)Ggg>Tgg	p.G149W		NM_001032393.2|NM_001199973.1|NM_001199974.1|NM_019597.4	NP_001027565.1|NP_001186902.1|NP_001186903.1|NP_062543.1	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2 (H')	149	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|large_intestine(2)|lung(6)|skin(1)	12						GGACTTTCAGGGGCGAAGCAC	0.473																																																0			X											87.0	81.0	83.0					X																	100667421		2203	4300	6503	100554077	SO:0001583	missense	3188			U01923	CCDS14485.1	Xq22	2013-02-12		2008-04-18	ENSG00000126945	ENSG00000126945		"""RNA binding motif (RRM) containing"""	5042	protein-coding gene	gene with protein product		300610		HNRPH2		7499401	Standard	NM_019597		Approved	hnRNPH', FTP3, HNRPH'	uc004ehn.3	P55795	OTTHUMG00000022029	ENST00000316594.5:c.445G>T	X.37:g.100667421G>T	ENSP00000361927:p.Gly149Trp	Somatic		Capture	Illumina GAIIx	4	100554077	A1L400|Q9HHA7	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1,HMMPfam_zf-RNPHF	p.G149W	ENST00000316594.5	37	c.445	CCDS14485.1	X	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095307	0.56075	.	.	ENSG00000126945	ENST00000457902;ENST00000316594	T	0.13901	2.55	4.73	4.73	0.59995	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.43787	0.1263	H	0.98005	4.125	0.80722	D	1	P	0.44429	0.835	P	0.49477	0.612	T	0.63972	-0.6516	10	0.87932	D	0	-5.5119	14.3235	0.66502	0.0:0.0:1.0:0.0	.	149	P55795	HNRH2_HUMAN	W	104;149	ENSP00000361927:G149W	ENSP00000361927:G149W	G	+	1	0	HNRNPH2	100554077	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.408000	0.97327	2.348000	0.79779	0.513000	0.50165	GGG	-	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1		0.473	HNRNPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPH2	protein_coding	OTTHUMT00000057556.1	G	NM_019597		100554077	+1	no_errors	NM_001032393	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
COL11A1	1301	genome.wustl.edu	37	1	103355043	103355043	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:103355043T>A	ENST00000370096.3	-	59	4744	c.4432A>T	c.(4432-4434)Act>Tct	p.T1478S	COL11A1_ENST00000353414.4_Missense_Mutation_p.T1439S|COL11A1_ENST00000358392.2_Missense_Mutation_p.T1490S|COL11A1_ENST00000512756.1_Missense_Mutation_p.T1362S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1478	Collagen-like 7.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GATCCTTGAGTTCCAGGGAGC	0.438																																																0			1											82.0	81.0	81.0					1																	103355043		2203	4300	6503	103127631	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4432A>T	1.37:g.103355043T>A	ENSP00000359114:p.Thr1478Ser	Somatic		Capture	Illumina GAIIx	4	103127631	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	HMMSmart_TSPN,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_Collagen,HMMSmart_COLFI,HMMPfam_COLFI	p.T1490S	ENST00000370096.3	37	c.4468	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	T	10.89	1.479390	0.26511	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22	5.46	5.46	0.80206	.	0.180424	0.49305	D	0.000152	T	0.76579	0.4007	N	0.13272	0.32	0.28181	N	0.928177	B;B;B;B;B	0.24317	0.02;0.034;0.082;0.101;0.027	B;B;B;B;B	0.31946	0.027;0.059;0.085;0.138;0.037	T	0.64136	-0.6478	10	0.18710	T	0.47	.	7.6955	0.28592	0.1299:0.0:0.1523:0.7178	.	1362;1439;1490;1478;698	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	S	1478;1490;1439;698;1362	ENSP00000359114:T1478S;ENSP00000351163:T1490S;ENSP00000302551:T1439S;ENSP00000426533:T1362S	ENSP00000302551:T1439S	T	-	1	0	COL11A1	103127631	0.999000	0.42202	0.989000	0.46669	0.820000	0.46376	2.801000	0.47908	2.069000	0.61940	0.460000	0.39030	ACT	-	HMMPfam_Collagen		0.438	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	protein_coding	OTTHUMT00000029997.1	T	NM_080630		103127631	-1	no_errors	NM_080629	genbank	human	reviewed	54_36p	missense	SNP	0.941	A
PRPF38B	55119	genome.wustl.edu	37	1	109242326	109242326	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:109242326G>C	ENST00000370025.4	+	6	1594	c.1325G>C	c.(1324-1326)aGa>aCa	p.R442T	PRPF38B_ENST00000370021.1_Missense_Mutation_p.R331T	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	442	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		agtcgaagtagaaatgcaggg	0.373																																																0			1											72.0	70.0	70.0					1																	109242326		2203	4300	6503	109043849	SO:0001583	missense	55119			AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.1325G>C	1.37:g.109242326G>C	ENSP00000359042:p.Arg442Thr	Somatic		Capture	Illumina GAIIx	4	109043849	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Missense_Mutation	SNP	HMMPfam_PRP38	p.R442T	ENST00000370025.4	37	c.1325	CCDS788.1	1	.	.	.	.	.	.	.	.	.	.	G	11.73	1.725543	0.30593	.	.	ENSG00000134186	ENST00000370025;ENST00000370021	T;T	0.21734	1.99;2.6	5.56	5.56	0.83823	.	0.087755	0.49305	D	0.000142	T	0.05640	0.0148	N	0.14661	0.345	0.32956	D	0.520435	B	0.14438	0.01	B	0.11329	0.006	T	0.21449	-1.0245	10	0.32370	T	0.25	.	12.4854	0.55871	0.0775:0.0:0.9225:0.0	.	442	Q5VTL8	PR38B_HUMAN	T	442;331	ENSP00000359042:R442T;ENSP00000359038:R331T	ENSP00000359038:R331T	R	+	2	0	PRPF38B	109043849	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.696000	0.47052	2.629000	0.89072	0.491000	0.48974	AGA	-	NULL		0.373	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38B	protein_coding	OTTHUMT00000030231.1	G	NM_018061		109043849	+1	no_errors	NM_018061	genbank	human	validated	54_36p	missense	SNP	1.000	C
APC	324	genome.wustl.edu	37	5	112179672	112179672	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr5:112179672G>T	ENST00000457016.1	+	16	8761	c.8381G>T	c.(8380-8382)aGc>aTc	p.S2794I	APC_ENST00000257430.4_Missense_Mutation_p.S2794I|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Missense_Mutation_p.S2794I			P25054	APC_HUMAN	adenomatous polyposis coli	2794	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGGAAAAGCAGCGCAGATAGC	0.478		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	1	Unknown(1)	skin(1)	5											88.0	92.0	91.0					5																	112179672		2202	4300	6502	112207571	SO:0001583	missense	324	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.8381G>T	5.37:g.112179672G>T	ENSP00000413133:p.Ser2794Ile	Somatic		Capture	Illumina GAIIx	4	112207571	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	superfamily_ARM repeat,HMMSmart_SM00185,HMMPfam_Arm,HMMPfam_APC_15aa,HMMPfam_APC_crr,HMMPfam_SAMP,HMMPfam_APC_basic,HMMPfam_EB1_binding	p.S2794I	ENST00000457016.1	37	c.8381	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	G	16.47	3.132308	0.56828	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	T;T;T	0.79033	-1.23;-1.23;-1.23	5.92	5.92	0.95590	EB-1 binding (1);	0.118062	0.85682	D	0.000000	T	0.78836	0.4346	L	0.29908	0.895	0.50467	D	0.999872	D;D	0.58268	0.982;0.968	P;P	0.58077	0.832;0.637	T	0.76244	-0.3030	9	.	.	.	-13.9484	15.7672	0.78135	0.0:0.1356:0.8644:0.0	.	2796;2794	Q4LE70;P25054	.;APC_HUMAN	I	2794	ENSP00000413133:S2794I;ENSP00000257430:S2794I;ENSP00000427089:S2794I	.	S	+	2	0	APC	112207571	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.711000	0.74675	2.818000	0.97014	0.655000	0.94253	AGC	-	HMMPfam_EB1_binding		0.478	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	protein_coding	OTTHUMT00000250738.2	G	NM_000038		112207571	+1	no_errors	NM_000038	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	113308095	113308095	+	Missense_Mutation	SNP	G	G	T	rs139266832		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr8:113308095G>T	ENST00000297405.5	-	54	8825	c.8581C>A	c.(8581-8583)Cac>Aac	p.H2861N	CSMD3_ENST00000343508.3_Missense_Mutation_p.H2821N|CSMD3_ENST00000455883.2_Missense_Mutation_p.H2692N|CSMD3_ENST00000352409.3_Missense_Mutation_p.H2791N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2861	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GACCAATTGTGATCCTGTTGA	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						0			8											123.0	103.0	110.0					8																	113308095		2203	4300	6503	113377271	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8581C>A	8.37:g.113308095G>T	ENSP00000297405:p.His2861Asn	Somatic		Capture	Illumina GAIIx	4	113377271	Q96PZ3	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,PatternScan_GLYCOSYL_HYDROL_F10	p.H2861N	ENST00000297405.5	37	c.8581	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	15.15	2.748076	0.49257	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	5.31	5.31	0.75309	Complement control module (2);Sushi/SCR/CCP (3);	0.067418	0.64402	D	0.000018	T	0.58250	0.2109	L	0.28740	0.885	0.48975	D	0.999739	B;B;P	0.46859	0.008;0.005;0.885	B;B;P	0.44946	0.027;0.029;0.465	T	0.62110	-0.6923	10	0.52906	T	0.07	.	18.9718	0.92718	0.0:0.0:1.0:0.0	.	2692;2861;2821	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	N	2821;2861;2131;2692;2791	ENSP00000345799:H2821N;ENSP00000297405:H2861N;ENSP00000341558:H2131N;ENSP00000412263:H2692N;ENSP00000343124:H2791N	ENSP00000297405:H2861N	H	-	1	0	CSMD3	113377271	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	6.378000	0.73150	2.480000	0.83734	0.655000	0.94253	CAC	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	G	NM_052900		113377271	-1	no_errors	NM_198123	genbank	human	validated	54_36p	missense	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chrUnknown:0C>A								None (None upstream) : None (None downstream)																								0.0																																																0			13																																								113644732	SO:0001628	intergenic_variant	348013																															Unknown.37:g.0C>A		Somatic		Capture	Illumina GAIIx	4	113644732		Missense_Mutation	SNP	NULL	p.G57V		37	c.170		13																																																																																			-	NULL	0	0					FAM70B			C			113644732	-1	no_errors	NM_182614	genbank	human	provisional	54_36p	missense	SNP	1.000	A
AMPD1	270	genome.wustl.edu	37	1	115220125	115220125	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:115220125G>A	ENST00000520113.2	-	10	1349	c.1334C>T	c.(1333-1335)gCg>gTg	p.A445V	AMPD1_ENST00000369538.3_Missense_Mutation_p.A441V|AMPD1_ENST00000353928.6_Missense_Mutation_p.A412V			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	445					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CACCAGGTCCGCACCTACCTC	0.567																																																0			1											64.0	56.0	59.0					1																	115220125		2203	4300	6503	115021648	SO:0001583	missense	270			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1334C>T	1.37:g.115220125G>A	ENSP00000430075:p.Ala445Val	Somatic		Capture	Illumina GAIIx	4	115021648	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	superfamily_SSF51556,HMMPfam_A_deaminase,PatternScan_A_DEAMINASE	p.A412V	ENST00000520113.2	37	c.1235	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836495	0.71373	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.83075	-1.68;-1.68;-1.68	5.85	5.85	0.93711	Adenosine/AMP deaminase (1);	0.365246	0.35495	N	0.003176	T	0.66086	0.2754	N	0.24115	0.695	0.38358	D	0.944532	P;B	0.38455	0.632;0.06	B;B	0.31869	0.137;0.067	T	0.72478	-0.4281	10	0.52906	T	0.07	-0.4614	20.1775	0.98187	0.0:0.0:1.0:0.0	.	441;412	Q5TF02;P23109	.;AMPD1_HUMAN	V	445;441;412	ENSP00000430075:A445V;ENSP00000358551:A441V;ENSP00000316520:A412V	ENSP00000316520:A412V	A	-	2	0	AMPD1	115021648	0.710000	0.27896	0.979000	0.43373	0.992000	0.81027	2.477000	0.45180	2.771000	0.95319	0.561000	0.74099	GCG	-	superfamily_SSF51556,HMMPfam_A_deaminase		0.567	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	protein_coding	OTTHUMT00000032860.4	G			115021648	-1	no_errors	NM_000036	genbank	human	reviewed	54_36p	missense	SNP	0.649	A
RFX6	222546	genome.wustl.edu	37	6	117237423	117237423	+	Silent	SNP	C	C	T	rs138602597	byFrequency	TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr6:117237423C>T	ENST00000332958.2	+	9	934	c.918C>T	c.(916-918)ctC>ctT	p.L306L	RFX6_ENST00000471966.1_3'UTR	NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	306					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						TTCCCCTGCTCGAAAATCCTG	0.338																																																0			6						C		0,4406		0,0,2203	157.0	153.0	154.0		918	0.1	1.0	6	dbSNP_134	154	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RFX6	NM_173560.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		306/929	117237423	1,13005	2203	4300	6503	117344116	SO:0001819	synonymous_variant	222546			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.918C>T	6.37:g.117237423C>T		Somatic		Capture	Illumina GAIIx	4	117344116	Q5T6B3	Silent	SNP	HMMPfam_RFX_DNA_binding,superfamily_SSF46785	p.L306	ENST00000332958.2	37	c.918	CCDS5113.1	6																																																																																			-	NULL		0.338	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	protein_coding	OTTHUMT00000041970.2	C	NM_173560		117344116	+1	no_errors	NM_173560	genbank	human	provisional	54_36p	silent	SNP	1.000	T
PRLHR	2834	genome.wustl.edu	37	10	120354612	120354612	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr10:120354612G>T	ENST00000369169.1	-	1	144	c.145C>A	c.(145-147)Ccc>Acc	p.P49T	PRLHR_ENST00000239032.2_Missense_Mutation_p.P49T			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	49					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		CTCTGGAAGGGCGTGACGGCT	0.692																																																0			10											36.0	42.0	40.0					10																	120354612		2203	4299	6502	120344602	SO:0001583	missense	2834			AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.145C>A	10.37:g.120354612G>T	ENSP00000358167:p.Pro49Thr	Somatic		Capture	Illumina GAIIx	4	120344602	O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.P49T	ENST00000369169.1	37	c.145	CCDS7606.1	10	.	.	.	.	.	.	.	.	.	.	G	2.449	-0.326737	0.05350	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.62498	0.02;0.02	4.08	3.16	0.36331	.	0.318216	0.29152	N	0.012986	T	0.31734	0.0806	N	0.08118	0	0.24954	N	0.991773	B	0.27498	0.18	B	0.21917	0.037	T	0.17592	-1.0364	10	0.08599	T	0.76	.	5.8006	0.18412	0.1034:0.2:0.6965:0.0	.	49	P49683	PRLHR_HUMAN	T	49	ENSP00000239032:P49T;ENSP00000358167:P49T	ENSP00000239032:P49T	P	-	1	0	PRLHR	120344602	1.000000	0.71417	0.956000	0.39512	0.612000	0.37316	4.720000	0.61944	1.295000	0.44724	-0.182000	0.12963	CCC	-	superfamily_Family A G protein-coupled receptor-like		0.692	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	protein_coding	OTTHUMT00000050610.1	G	NM_004248		120344602	-1	no_errors	NM_004248	genbank	human	validated	54_36p	missense	SNP	0.046	T
CEP120	153241	genome.wustl.edu	37	5	122737809	122737809	+	Intron	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr5:122737809C>A	ENST00000306467.5	-	5	768				CEP120_ENST00000328236.5_Intron|CEP120_ENST00000306481.6_Intron|CEP120_ENST00000395431.2_Intron			Q8N960	CE120_HUMAN	centrosomal protein 120kDa						astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						ACCTCCAGGACAAGGGGGCTC	0.627																																																0			5																																								122765708	SO:0001627	intron_variant	647954			AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.464-2831G>T	5.37:g.122737809C>A		Somatic		Capture	Illumina GAIIx	4	122765708	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	RNA	SNP	-	NULL	ENST00000306467.5	37	NULL	CCDS4134.2	5																																																																																			-	-		0.627	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC647954	protein_coding	OTTHUMT00000250899.2	C	NM_153223		122765708	-1	pseudogene	XR_038441	genbank	human	model	54_36p	rna	SNP	1.000	A
CASR	846	genome.wustl.edu	37	3	122002555	122002555	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr3:122002555G>T	ENST00000490131.1	+	7	2126	c.1754G>T	c.(1753-1755)tGc>tTc	p.C585F	AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000296154.5_Missense_Mutation_p.C585F|CASR_ENST00000498619.1_Missense_Mutation_p.C595F	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	585					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TGTAACAAGTGCCCAGATGAC	0.502																																																0			3											106.0	92.0	97.0					3																	122002555		2203	4300	6503	123485245	SO:0001583	missense	846			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1754G>T	3.37:g.122002555G>T	ENSP00000418685:p.Cys585Phe	Somatic		Capture	Illumina GAIIx	4	123485245	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3	p.C585F	ENST00000490131.1	37	c.1754	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	G	19.26	3.794150	0.70452	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.95821	-3.82;-3.82;-3.82	5.91	5.91	0.95273	GPCR, family 3, conserved site (1);GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.98686	0.9559	H	0.96970	3.915	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.99316	1.0905	10	0.87932	D	0	.	19.2828	0.94058	0.0:0.0:1.0:0.0	.	595;585	E7ENE0;P41180	.;CASR_HUMAN	F	585;595;585	ENSP00000418685:C585F;ENSP00000420194:C595F;ENSP00000296154:C585F	ENSP00000296154:C585F	C	+	2	0	CASR	123485245	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.804000	0.96469	0.462000	0.41574	TGC	-	HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2		0.502	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	protein_coding	OTTHUMT00000355761.1	G	NM_000388		123485245	+1	no_errors	NM_000388	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SSMEM1	136263	genome.wustl.edu	37	7	129855967	129855967	+	Missense_Mutation	SNP	G	G	A	rs191908225		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr7:129855967G>A	ENST00000297819.3	+	3	443	c.392G>A	c.(391-393)cGc>cAc	p.R131H		NM_145268.3	NP_660311.1	Q8WWF3	SSMM1_HUMAN	serine-rich single-pass membrane protein 1	131						integral component of membrane (GO:0016021)											CGAGCCAGGCGCCAGTCTCAG	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		21108	0.001		0.0	False		,,,				2504	0.0															0			7						G	HIS/ARG	0,4406		0,0,2203	99.0	94.0	96.0		392	-7.6	0.0	7		96	2,8598	2.2+/-6.3	0,2,4298	no	missense	C7orf45	NM_145268.3	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	131/245	129855967	2,13004	2203	4300	6503	129643203	SO:0001583	missense	136263			AK097635	CCDS5816.1	7q32.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000165120	ENSG00000165120			29580	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 45"""	C7orf45		12477932	Standard	NM_145268		Approved	FLJ40316	uc003vpp.3	Q8WWF3	OTTHUMG00000157844	ENST00000297819.3:c.392G>A	7.37:g.129855967G>A	ENSP00000297819:p.Arg131His	Somatic		Capture	Illumina GAIIx	4	129643203		Missense_Mutation	SNP	NULL	p.R131H	ENST00000297819.3	37	c.392	CCDS5816.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	4.556	0.103219	0.08731	0.0	2.33E-4	ENSG00000165120	ENST00000297819	T	0.47869	0.83	5.84	-7.55	0.01327	.	1.183490	0.05924	N	0.634016	T	0.35740	0.0942	L	0.51422	1.61	0.09310	N	1	B	0.15473	0.013	B	0.08055	0.003	T	0.42649	-0.9439	10	0.56958	D	0.05	0.4352	6.7583	0.23526	0.333:0.0:0.1347:0.5323	.	131	Q8WWF3	CG045_HUMAN	H	131	ENSP00000297819:R131H	ENSP00000297819:R131H	R	+	2	0	C7orf45	129643203	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.153000	0.10144	-1.162000	0.02797	-0.229000	0.12294	CGC	-	NULL		0.478	SSMEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf45	protein_coding	OTTHUMT00000349768.1	G	NM_145268		129643203	+1	no_errors	NM_145268	genbank	human	validated	54_36p	missense	SNP	0.009	A
PLXNA4	91584	genome.wustl.edu	37	7	131870124	131870124	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr7:131870124T>A	ENST00000359827.3	-	16	4054	c.3092A>T	c.(3091-3093)gAc>gTc	p.D1031V	PLXNA4_ENST00000321063.4_Missense_Mutation_p.D1031V			Q9HCM2	PLXA4_HUMAN	plexin A4	1031	IPT/TIG 2.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AAAGACCAGGTCCTGGTGGAT	0.542																																																0			7											127.0	132.0	130.0					7																	131870124		2067	4194	6261	131520664	SO:0001583	missense	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.3092A>T	7.37:g.131870124T>A	ENSP00000352882:p.Asp1031Val	Somatic		Capture	Illumina GAIIx	4	131520664	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP	p.D1031V	ENST00000359827.3	37	c.3092	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	T	18.24	3.581066	0.65992	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.76839	-1.05;-1.05	5.6	5.6	0.85130	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	1.986320	0.01665	N	0.025320	T	0.80914	0.4715	M	0.66297	2.02	0.80722	D	1	B	0.26318	0.146	B	0.25506	0.061	T	0.52859	-0.8519	10	0.28530	T	0.3	.	15.7766	0.78224	0.0:0.0:0.0:1.0	.	1031	Q9HCM2	PLXA4_HUMAN	V	1031	ENSP00000323194:D1031V;ENSP00000352882:D1031V	ENSP00000323194:D1031V	D	-	2	0	PLXNA4	131520664	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.062000	0.71155	2.143000	0.66587	0.459000	0.35465	GAC	-	superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG		0.542	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	protein_coding	OTTHUMT00000338422.2	T	NM_181775		131520664	-1	no_errors	NM_020911	genbank	human	validated	54_36p	missense	SNP	1.000	A
CTGF	1490	genome.wustl.edu	37	6	132270547	132270547	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr6:132270547C>A	ENST00000367976.3	-	5	1107	c.907G>T	c.(907-909)Gtg>Ttg	p.V303L	RP11-69I8.3_ENST00000435287.1_RNA	NM_001901.2	NP_001892	P29279	CTGF_HUMAN	connective tissue growth factor	303	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.|Heparin-binding.				angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|chondrocyte proliferation (GO:0035988)|cytosolic calcium ion transport (GO:0060401)|DNA replication (GO:0006260)|epidermis development (GO:0008544)|extracellular matrix constituent secretion (GO:0070278)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|organ senescence (GO:0010260)|ossification (GO:0001503)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of cell activation (GO:0050867)|positive regulation of cell death (GO:0010942)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of chondrocyte differentiation (GO:0032330)|response to amino acid (GO:0043200)|response to anoxia (GO:0034059)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to mineralocorticoid (GO:0051385)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell cortex (GO:0005938)|cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|insulin-like growth factor binding (GO:0005520)	p.V303L(3)		breast(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	13	Breast(56;0.0602)			GBM - Glioblastoma multiforme(226;0.015)|OV - Ovarian serous cystadenocarcinoma(155;0.0169)		TTGAACTCCACCGGCAGGGTG	0.537																																					Esophageal Squamous(127;510 1660 12817 24400 38449)											3	Substitution - Missense(3)	endometrium(3)	6											151.0	146.0	148.0					6																	132270547		2203	4300	6503	132312240	SO:0001583	missense	1490			X78947	CCDS5151.1	6q23.2	2008-02-05			ENSG00000118523	ENSG00000118523			2500	protein-coding gene	gene with protein product		121009				1654338	Standard	NM_001901		Approved	IGFBP8, CCN2	uc003qcz.3	P29279	OTTHUMG00000015573	ENST00000367976.3:c.907G>T	6.37:g.132270547C>A	ENSP00000356954:p.Val303Leu	Somatic		Capture	Illumina GAIIx	4	132312240	E1P578|Q6LCY0|Q96A79|Q96QX2|Q9UDL6	Missense_Mutation	SNP	HMMSmart_SM00121,HMMPfam_IGFBP,PatternScan_IGFBP_N_1,HMMPfam_VWC,HMMSmart_SM00214,PatternScan_VWFC_1,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_Cys_knot,HMMSmart_SM00041,PatternScan_CTCK_1	p.V303L	ENST00000367976.3	37	c.907	CCDS5151.1	6	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064834	0.55432	.	.	ENSG00000118523	ENST00000367976	T	0.38077	1.16	5.55	5.55	0.83447	Cystine knot (1);Cystine knot, C-terminal (3);	0.054567	0.64402	D	0.000001	T	0.38585	0.1046	L	0.61218	1.895	0.54753	D	0.999989	P	0.44044	0.825	P	0.46299	0.511	T	0.32295	-0.9912	10	0.72032	D	0.01	.	19.8696	0.96845	0.0:1.0:0.0:0.0	.	303	P29279	CTGF_HUMAN	L	303	ENSP00000356954:V303L	ENSP00000356954:V303L	V	-	1	0	CTGF	132312240	1.000000	0.71417	0.965000	0.40720	0.956000	0.61745	4.542000	0.60677	2.773000	0.95371	0.585000	0.79938	GTG	-	HMMPfam_Cys_knot,HMMSmart_SM00041,PatternScan_CTCK_1		0.537	CTGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTGF	protein_coding	OTTHUMT00000042239.2	C	NM_001901		132312240	-1	no_errors	NM_001901	genbank	human	validated	54_36p	missense	SNP	0.995	A
NUP214	8021	genome.wustl.edu	37	9	134003075	134003075	+	Silent	SNP	A	A	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr9:134003075A>G	ENST00000359428.5	+	2	354	c.210A>G	c.(208-210)caA>caG	p.Q70Q	NUP214_ENST00000411637.2_Silent_p.Q70Q|RNU6-881P_ENST00000516813.1_RNA|NUP214_ENST00000451030.1_Silent_p.Q70Q			P35658	NU214_HUMAN	nucleoporin 214kDa	70	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		TTCTTATTCAAAATAAACCCG	0.443			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0			9											65.0	73.0	70.0					9																	134003075		2202	4299	6501	132992896	SO:0001819	synonymous_variant	8021			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.210A>G	9.37:g.134003075A>G		Somatic		Capture	Illumina GAIIx	4	132992896	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Silent	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320	p.Q70	ENST00000359428.5	37	c.210	CCDS6940.1	9																																																																																			-	NULL		0.443	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NUP214	protein_coding	OTTHUMT00000054694.2	A	NM_005085		132992896	+1	no_errors	NM_005085	genbank	human	reviewed	54_36p	silent	SNP	0.977	G
LRRTM2	26045	genome.wustl.edu	37	5	138209536	138209536	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr5:138209536C>T	ENST00000274711.6	-	2	1092	c.714G>A	c.(712-714)tgG>tgA	p.W238*	CTNNA1_ENST00000355078.5_Intron|LRRTM2_ENST00000523537.1_5'Flank|LRRTM2_ENST00000518785.1_3'UTR|CTNNA1_ENST00000540387.1_5'Flank|CTNNA1_ENST00000518825.1_Intron|CTNNA1_ENST00000302763.7_Intron|CTNNA1_ENST00000520400.1_Intron|LRRTM2_ENST00000521094.2_Intron	NM_015564.2	NP_056379.1	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	238					long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|synapse organization (GO:0050808)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|urinary_tract(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGATTTTGTTCCATTGTAAGA	0.448																																																0			5											305.0	295.0	298.0					5																	138209536		1944	4146	6090	138237435	SO:0001587	stop_gained	26045			AB007876	CCDS47272.1	5q31	2008-02-05				ENSG00000146006			19409	protein-coding gene	gene with protein product		610868				12676565	Standard	NM_015564		Approved	KIAA0416	uc011cyz.1	O43300		ENST00000274711.6:c.714G>A	5.37:g.138209536C>T	ENSP00000274711:p.Trp238*	Somatic		Capture	Illumina GAIIx	4	138237435	A0AVL3|A8K4U9|B7ZLN8|Q7L770	Nonsense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1	p.W238*	ENST00000274711.6	37	c.714	CCDS47272.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.031447	0.97221	.	.	ENSG00000146006	ENST00000274711	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	19.1486	0.93479	0.0:1.0:0.0:0.0	.	.	.	.	X	238	.	ENSP00000274711:W238X	W	-	3	0	LRRTM2	138237435	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.814000	0.62627	2.861000	0.98227	0.650000	0.86243	TGG	-	superfamily_L domain-like,HMMSmart_SM00369		0.448	LRRTM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM2	protein_coding	OTTHUMT00000374043.2	C			138237435	-1	no_errors	NM_015564	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
KIAA0141	9812	genome.wustl.edu	37	5	141318134	141318134	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr5:141318134G>A	ENST00000432126.2	+	12	1492	c.1358G>A	c.(1357-1359)aGc>aAc	p.S453N	KIAA0141_ENST00000194118.4_Missense_Mutation_p.S453N	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	453					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTTCTCCAGCCCCTCCCTC	0.562																																																0			5											109.0	108.0	108.0					5																	141318134		2203	4300	6503	141298318	SO:0001583	missense	9812			BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.1358G>A	5.37:g.141318134G>A	ENSP00000396225:p.Ser453Asn	Somatic		Capture	Illumina GAIIx	4	141298318	Q969R4|Q96EU9	Missense_Mutation	SNP	superfamily_SSF81901,HMMSmart_SEL1,HMMPfam_Sel1	p.S453N	ENST00000432126.2	37	c.1358	CCDS4268.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.326130|4.326130	0.81580|0.81580	.|.	.|.	ENSG00000081791|ENSG00000081791	ENST00000507481|ENST00000432126;ENST00000194118	.|T;T	.|0.12879	.|2.64;2.64	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	.|0.196730	.|0.43416	.|D	.|0.000574	T|T	0.33990|0.33990	0.0882|0.0882	M|M	0.65975|0.65975	2.015|2.015	0.31833|0.31833	N|N	0.624444|0.624444	.|D	.|0.71674	.|0.998	.|D	.|0.78314	.|0.991	T|T	0.22730|0.22730	-1.0208|-1.0208	5|10	.|0.40728	.|T	.|0.16	-24.2241|-24.2241	13.9073|13.9073	0.63843|0.63843	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|453	.|Q14154	.|DELE_HUMAN	T|N	155|453	.|ENSP00000396225:S453N;ENSP00000194118:S453N	.|ENSP00000194118:S453N	A|S	+|+	1|2	0|0	KIAA0141|KIAA0141	141298318|141298318	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.235000|4.235000	0.58666|0.58666	2.665000|2.665000	0.90641|0.90641	0.655000|0.655000	0.94253|0.94253	GCC|AGC	-	NULL		0.562	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0141	protein_coding	OTTHUMT00000251863.2	G	NM_014773		141298318	+1	no_errors	NM_014773	genbank	human	validated	54_36p	missense	SNP	1.000	A
GJA8	2703	genome.wustl.edu	37	1	147380316	147380316	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:147380316G>T	ENST00000369235.1	+	1	234	c.234G>T	c.(232-234)tgG>tgT	p.W78C	GJA8_ENST00000240986.4_Missense_Mutation_p.W78C			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	78					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					TTCGCCTCTGGGTGCTGCAGA	0.627																																					Melanoma(76;1255 1795 8195 52096)											0			1											144.0	111.0	122.0					1																	147380316		2203	4300	6503	145846940	SO:0001583	missense	2703			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.234G>T	1.37:g.147380316G>T	ENSP00000358238:p.Trp78Cys	Somatic		Capture	Illumina GAIIx	4	145846940	A7L5M5|Q5VVN9|Q9NP25	Missense_Mutation	SNP	HMMPfam_Connexin,HMMSmart_CNX,PatternScan_CONNEXINS_1,HMMPfam_Connexin_CCC,PatternScan_CONNEXINS_2,HMMPfam_Connexin50	p.W78C	ENST00000369235.1	37	c.234	CCDS30834.1	1	.	.	.	.	.	.	.	.	.	.	g	21.0	4.088145	0.76642	.	.	ENSG00000121634	ENST00000240986;ENST00000369235	D;D	0.99545	-6.13;-6.13	5.2	5.2	0.72013	Connexin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99819	0.9920	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96823	0.9605	10	0.87932	D	0	.	18.721	0.91692	0.0:0.0:1.0:0.0	.	78	P48165	CXA8_HUMAN	C	78	ENSP00000240986:W78C;ENSP00000358238:W78C	ENSP00000240986:W78C	W	+	3	0	GJA8	145846940	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.787000	0.99055	2.409000	0.81822	0.491000	0.48974	TGG	-	HMMPfam_Connexin		0.627	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA8	protein_coding	OTTHUMT00000060647.1	G	NM_005267		145846940	+1	no_errors	NM_005267	genbank	human	validated	54_36p	missense	SNP	1.000	T
NCAPG2	54892	genome.wustl.edu	37	7	158472735	158472735	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr7:158472735C>T	ENST00000409423.1	-	12	1235	c.1063G>A	c.(1063-1065)Gtt>Att	p.V355I	NCAPG2_ENST00000409339.3_Missense_Mutation_p.V355I|NCAPG2_ENST00000356309.3_Missense_Mutation_p.V355I|NCAPG2_ENST00000449727.2_Missense_Mutation_p.V355I|NCAPG2_ENST00000275830.10_Missense_Mutation_p.V147I	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	355					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		AATGCTTCAACAAACAACAAT	0.373																																																0			7											143.0	131.0	135.0					7																	158472735		1858	4110	5968	158165496	SO:0001583	missense	54892			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.1063G>A	7.37:g.158472735C>T	ENSP00000386569:p.Val355Ile	Somatic		Capture	Illumina GAIIx	4	158165496	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	superfamily_ARM repeat	p.V355I	ENST00000409423.1	37	c.1063	CCDS43686.1	7	.	.	.	.	.	.	.	.	.	.	C	11.75	1.731234	0.30684	.	.	ENSG00000146918	ENST00000356309;ENST00000409423;ENST00000275830;ENST00000409339;ENST00000449727	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	6.06	2.91	0.33838	Armadillo-like helical (1);Armadillo-type fold (1);	0.307319	0.36167	N	0.002751	T	0.23410	0.0566	N	0.16602	0.42	0.23309	N	0.997935	B;B;B	0.17465	0.018;0.014;0.022	B;B;B	0.17979	0.019;0.017;0.02	T	0.22138	-1.0225	10	0.13108	T	0.6	-17.9022	9.8635	0.41129	0.0:0.6138:0.0:0.3862	.	355;147;355	Q86XI2-2;E7EUH9;Q86XI2	.;.;CNDG2_HUMAN	I	355;355;147;355;355	ENSP00000348657:V355I;ENSP00000386569:V355I;ENSP00000275830:V147I;ENSP00000387007:V355I;ENSP00000388326:V355I	ENSP00000275830:V147I	V	-	1	0	NCAPG2	158165496	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	1.521000	0.35910	0.277000	0.22141	0.655000	0.94253	GTT	-	superfamily_ARM repeat		0.373	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NCAPG2	protein_coding	OTTHUMT00000327111.1	C	NM_017760		158165496	-1	no_errors	NM_017760	genbank	human	validated	54_36p	missense	SNP	1.000	T
FNIP2	57600	genome.wustl.edu	37	4	159790382	159790382	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr4:159790382T>G	ENST00000264433.6	+	13	2669	c.2594T>G	c.(2593-2595)gTg>gGg	p.V865G	FNIP2_ENST00000379346.3_Missense_Mutation_p.V888G	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	865	Interaction with PRKAA1.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CCTGGCCTCGTGGCTGGTGCG	0.592																																																0			4											33.0	37.0	36.0					4																	159790382		2027	4184	6211	160009832	SO:0001583	missense	0			AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.2594T>G	4.37:g.159790382T>G	ENSP00000264433:p.Val865Gly	Somatic		Capture	Illumina GAIIx	4	160009832	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	NULL	p.V865G	ENST00000264433.6	37	c.2594	CCDS47155.1	4	.	.	.	.	.	.	.	.	.	.	T	8.005	0.756328	0.15846	.	.	ENSG00000052795	ENST00000264433;ENST00000379346	T;T	0.23348	1.91;1.91	5.09	-6.09	0.02145	.	1.889870	0.02002	N	0.046398	T	0.10981	0.0268	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.18871	0.023	T	0.17289	-1.0374	9	.	.	.	.	5.2007	0.15262	0.1119:0.1282:0.1116:0.6482	.	865	Q9P278	FNIP2_HUMAN	G	865;888	ENSP00000264433:V865G;ENSP00000368651:V888G	.	V	+	2	0	FNIP2	160009832	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.731000	0.04862	-0.904000	0.02843	GTG	-	NULL		0.592	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNIP2	protein_coding	OTTHUMT00000366602.1	T	NM_020840		160009832	+1	no_errors	NM_020840	genbank	human	validated	54_36p	missense	SNP	0.000	G
SLC4A10	57282	genome.wustl.edu	37	2	162719515	162719515	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:162719515C>A	ENST00000446997.1	+	6	802	c.709C>A	c.(709-711)Cgt>Agt	p.R237S	SLC4A10_ENST00000375514.5_Missense_Mutation_p.R248S|SLC4A10_ENST00000535165.1_Missense_Mutation_p.R237S|SLC4A10_ENST00000421911.1_Missense_Mutation_p.R237S|SLC4A10_ENST00000415876.2_Missense_Mutation_p.R237S|SLC4A10_ENST00000272716.5_Missense_Mutation_p.R237S|SLC4A10_ENST00000493021.1_3'UTR	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	237					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TCCCATTGTTCGTTCCTTTGC	0.383																																																0			2											81.0	85.0	84.0					2																	162719515		1924	4151	6075	162427761	SO:0001583	missense	57282				CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.709C>A	2.37:g.162719515C>A	ENSP00000393066:p.Arg237Ser	Somatic		Capture	Illumina GAIIx	4	162427761	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	superfamily_Phoshotransferase/anion transport protein,HMMPfam_Band_3_cyto,HMMPfam_HCO3_cotransp,PatternScan_HTH_ARAC_FAMILY_1	p.R237S	ENST00000446997.1	37	c.709	CCDS54411.1	2	.	.	.	.	.	.	.	.	.	.	C	24.3	4.513263	0.85389	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000535165;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.81	5.81	0.92471	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.095553	0.64402	D	0.000001	D	0.85331	0.5672	M	0.93375	3.41	0.80722	D	1	P;B;P;D	0.57899	0.487;0.087;0.487;0.981	B;B;B;D	0.64506	0.313;0.123;0.313;0.926	D	0.88015	0.2765	10	0.59425	D	0.04	.	15.5645	0.76281	0.1385:0.8615:0.0:0.0	.	248;237;237;237	F8W675;E7EW28;Q6U841-2;Q6U841	.;.;.;S4A10_HUMAN	S	248;237;237;237;237;237;237;237	ENSP00000364664:R248S;ENSP00000395797:R237S;ENSP00000437527:R237S;ENSP00000272716:R237S;ENSP00000393066:R237S;ENSP00000404486:R237S	ENSP00000272716:R237S	R	+	1	0	SLC4A10	162427761	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	4.034000	0.57289	2.759000	0.94783	0.591000	0.81541	CGT	-	superfamily_Phoshotransferase/anion transport protein,HMMPfam_Band_3_cyto		0.383	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A10	protein_coding	OTTHUMT00000333090.1	C	NM_022058		162427761	+1	no_errors	NM_022058	genbank	human	validated	54_36p	missense	SNP	1.000	A
SCN7A	6332	genome.wustl.edu	37	2	167269579	167269579	+	Splice_Site	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:167269579G>A	ENST00000409855.1	-	21	3593	c.3467C>T	c.(3466-3468)gCt>gTt	p.A1156V		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1156					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TATACTTACAGCAACAGAATC	0.294																																																0			2											39.0	36.0	37.0					2																	167269579		1809	4064	5873	166977825	SO:0001630	splice_region_variant	6332			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3468+1C>T	2.37:g.167269579G>A		Somatic		Capture	Illumina GAIIx	4	166977825		Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc	p.A1156V	ENST00000409855.1	37	c.3467	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	G	11.39	1.623480	0.28889	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.96716	-4.1	5.32	-4.89	0.03103	Ion transport (1);	1.375840	0.04385	N	0.361482	D	0.92825	0.7718	L	0.33668	1.02	0.09310	N	1	P	0.43701	0.815	B	0.42738	0.396	D	0.87690	0.2553	10	0.56958	D	0.05	.	8.8561	0.35229	0.0:0.325:0.1867:0.4884	.	1156	Q01118	SCN7A_HUMAN	V	1156	ENSP00000386796:A1156V	ENSP00000259060:A1156V	A	-	2	0	SCN7A	166977825	0.000000	0.05858	0.000000	0.03702	0.549000	0.35272	-1.169000	0.03120	-0.782000	0.04541	-0.274000	0.10170	GCT	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.294	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	protein_coding	OTTHUMT00000333745.1	G		Missense_Mutation	166977825	-1	no_errors	NM_002976	genbank	human	validated	54_36p	missense	SNP	0.000	A
C4orf27	54969	genome.wustl.edu	37	4	170671822	170671822	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr4:170671822G>C	ENST00000393381.2	-	3	338	c.263C>G	c.(262-264)gCt>gGt	p.A88G		NM_017867.2	NP_060337.2	Q9NWY4	CD027_HUMAN	chromosome 4 open reading frame 27	88						nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	12		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)		ATGTTTTCCAGCAAGGATATC	0.358																																																0			4											122.0	131.0	128.0					4																	170671822		2203	4300	6503	170908397	SO:0001583	missense	54969			BC010367	CCDS3813.1	4q33	2011-01-25			ENSG00000056050	ENSG00000056050			26051	protein-coding gene	gene with protein product						11230166	Standard	NM_017867		Approved	FLJ20534	uc003isl.4	Q9NWY4	OTTHUMG00000160960	ENST00000393381.2:c.263C>G	4.37:g.170671822G>C	ENSP00000406598:p.Ala88Gly	Somatic		Capture	Illumina GAIIx	4	170908397		Missense_Mutation	SNP	HMMPfam_DUF2228	p.A88G	ENST00000393381.2	37	c.263	CCDS3813.1	4	.	.	.	.	.	.	.	.	.	.	G	22.5	4.302720	0.81136	.	.	ENSG00000056050	ENST00000393381	T	0.49139	0.79	5.1	5.1	0.69264	.	0.215085	0.47852	D	0.000206	T	0.67515	0.2901	M	0.80982	2.52	0.52501	D	0.99995	P	0.49358	0.923	P	0.57009	0.811	T	0.70550	-0.4841	10	0.49607	T	0.09	-16.4179	18.5748	0.91150	0.0:0.0:1.0:0.0	.	88	Q9NWY4	CD027_HUMAN	G	88	ENSP00000406598:A88G	ENSP00000406598:A88G	A	-	2	0	C4orf27	170908397	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	9.065000	0.93941	2.398000	0.81561	0.454000	0.30748	GCT	-	HMMPfam_DUF2228		0.358	C4orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf27	protein_coding	OTTHUMT00000363140.1	G	NM_017867		170908397	-1	no_errors	NM_017867	genbank	human	validated	54_36p	missense	SNP	1.000	C
TNFSF4	7292	genome.wustl.edu	37	1	173155805	173155805	+	Silent	SNP	A	A	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:173155805A>G	ENST00000281834.3	-	3	538	c.402T>C	c.(400-402)tcT>tcC	p.S134S	TNFSF4_ENST00000488053.1_5'Flank|TNFSF4_ENST00000367718.1_Silent_p.S84S	NM_003326.3	NP_003317.1	P23510	TNFL4_HUMAN	tumor necrosis factor (ligand) superfamily, member 4	134					acute inflammatory response (GO:0002526)|CD4-positive, alpha-beta T cell costimulation (GO:0035783)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nitrogen dioxide (GO:0035714)|cellular response to prostaglandin E stimulus (GO:0071380)|chemokine (C-C motif) ligand 11 production (GO:0071954)|cholesterol metabolic process (GO:0008203)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|memory T cell activation (GO:0035709)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell activation (GO:0050871)|positive regulation of CD4-positive, alpha-beta T cell costimulation (GO:1900281)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-4-dependent isotype switching to IgE isotypes (GO:2000572)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of memory T cell activation (GO:2000568)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T-helper 2 cell activation (GO:2000570)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of type 2 immune response (GO:0002830)|regulation of adaptive immune response (GO:0002819)|regulation of inflammatory response (GO:0050727)|response to nitrogen dioxide (GO:0035713)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation (GO:0042098)|T-helper 2 cell activation (GO:0035712)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor binding (GO:0005102)|tumor necrosis factor receptor superfamily binding (GO:0032813)			breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)|urinary_tract(1)	12						AGGAGTTGACAGACCTGACCT	0.483																																																0			1											92.0	90.0	91.0					1																	173155805		2203	4300	6503	171422428	SO:0001819	synonymous_variant	7292			D90224	CCDS1306.1, CCDS72985.1	1q25	2008-07-31	2008-07-31		ENSG00000117586	ENSG00000117586		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11934	protein-coding gene	gene with protein product		603594	"""tax-transcriptionally activated glycoprotein 1, 34kD"""	TXGP1		1996093, 8076595	Standard	XM_005245475		Approved	OX-40L, gp34, CD252	uc001giw.3	P23510	OTTHUMG00000034838	ENST00000281834.3:c.402T>C	1.37:g.173155805A>G		Somatic		Capture	Illumina GAIIx	4	171422428	Q5JZA5|Q8IV74|Q9HCN9	Silent	SNP	HMMSmart_SM00207,HMMPfam_TNF,superfamily_TNF-like,PatternScan_TNF_1	p.S134	ENST00000281834.3	37	c.402	CCDS1306.1	1																																																																																			-	HMMSmart_SM00207,HMMPfam_TNF,superfamily_TNF-like		0.483	TNFSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF4	protein_coding	OTTHUMT00000084271.1	A			171422428	-1	no_errors	NM_003326	genbank	human	reviewed	54_36p	silent	SNP	0.000	G
WIPF1	7456	genome.wustl.edu	37	2	175437114	175437114	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:175437114G>T	ENST00000392547.2	-	5	518	c.419C>A	c.(418-420)cCc>cAc	p.P140H	AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000409415.3_Missense_Mutation_p.P140H|WIPF1_ENST00000467149.1_5'Flank|AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000392546.2_Missense_Mutation_p.P140H|AC010894.5_ENST00000454203.1_RNA|WIPF1_ENST00000272746.5_Missense_Mutation_p.P140H|WIPF1_ENST00000409891.1_Missense_Mutation_p.P140H|WIPF1_ENST00000359761.3_Missense_Mutation_p.P140H	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	140					actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)			NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						GGGTGAAAAGGGTTTCGCAGA	0.557																																																0			2											43.0	52.0	49.0					2																	175437114		2202	4297	6499	175145360	SO:0001583	missense	7456			AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.419C>A	2.37:g.175437114G>T	ENSP00000376330:p.Pro140His	Somatic		Capture	Illumina GAIIx	4	175145360	B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	HMMPfam_WH2,HMMSmart_SM00246	p.P140H	ENST00000392547.2	37	c.419	CCDS2260.1	2	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006338	0.54361	.	.	ENSG00000115935	ENST00000392547;ENST00000392548;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891;ENST00000409415;ENST00000455428	T;T;T;T;T;T	0.58797	1.09;1.02;1.09;1.09;0.47;0.31	5.09	5.09	0.68999	.	0.053368	0.85682	D	0.000000	T	0.75953	0.3920	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.78314	0.991;0.98;0.991;0.972	T	0.78588	-0.2146	10	0.72032	D	0.01	.	18.4457	0.90682	0.0:0.0:1.0:0.0	.	140;140;140;140	O43516-3;E9PB87;O43516-2;O43516	.;.;.;WIPF1_HUMAN	H	140;140;140;140;140;140;140;137	ENSP00000376330:P140H;ENSP00000272746:P140H;ENSP00000352802:P140H;ENSP00000376329:P140H;ENSP00000386431:P140H;ENSP00000387150:P140H	ENSP00000272746:P140H	P	-	2	0	WIPF1	175145360	1.000000	0.71417	0.924000	0.36721	0.012000	0.07955	8.032000	0.88838	2.519000	0.84933	0.561000	0.74099	CCC	-	NULL		0.557	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIPF1	protein_coding	OTTHUMT00000255453.1	G	NM_003387		175145360	-1	no_errors	NM_001077269	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
SMG7	9887	genome.wustl.edu	37	1	183515372	183515372	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:183515372G>A	ENST00000347615.2	+	17	2761	c.2642G>A	c.(2641-2643)aGa>aAa	p.R881K	SMG7_ENST00000367537.3_Missense_Mutation_p.R864K|SMG7_ENST00000508461.1_Missense_Mutation_p.R839K|SMG7_ENST00000507469.1_Missense_Mutation_p.R835K|SMG7_ENST00000456731.2_Missense_Mutation_p.R793K|SMG7_ENST00000515829.2_Missense_Mutation_p.R835K	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	881					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						GCTGATAACAGATCTGTAATG	0.488																																																0			1											80.0	83.0	82.0					1																	183515372		2203	4300	6503	181781995	SO:0001583	missense	9887			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.2642G>A	1.37:g.183515372G>A	ENSP00000340766:p.Arg881Lys	Somatic		Capture	Illumina GAIIx	4	181781995	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	HMMPfam_EST1,superfamily_TPR-like	p.R881K	ENST00000347615.2	37	c.2642	CCDS1355.1	1	.	.	.	.	.	.	.	.	.	.	G	16.89	3.246796	0.59103	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T	0.20463	2.12;2.09;2.16;2.16;2.07;2.11	5.72	5.72	0.89469	.	0.168966	0.49916	D	0.000140	T	0.17831	0.0428	L	0.27053	0.805	0.41855	D	0.990198	P;B;B;B;B;P	0.39250	0.665;0.436;0.255;0.187;0.41;0.635	B;B;B;B;B;B	0.36464	0.169;0.121;0.104;0.152;0.104;0.225	T	0.02983	-1.1086	10	0.24483	T	0.36	-10.1623	19.8968	0.96969	0.0:0.0:1.0:0.0	.	839;864;793;835;881;835	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	K	793;864;839;881;835;835	ENSP00000407629:R793K;ENSP00000356507:R864K;ENSP00000426915:R839K;ENSP00000340766:R881K;ENSP00000425133:R835K;ENSP00000421358:R835K	ENSP00000340766:R881K	R	+	2	0	SMG7	181781995	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.302000	0.65733	2.691000	0.91804	0.655000	0.94253	AGA	-	NULL		0.488	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	protein_coding	OTTHUMT00000085432.1	G	NM_014837		181781995	+1	no_errors	NM_173156	genbank	human	validated	54_36p	missense	SNP	0.099	A
HMCN1	83872	genome.wustl.edu	37	1	186084058	186084058	+	Missense_Mutation	SNP	G	G	A	rs543213159	byFrequency	TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr1:186084058G>A	ENST00000271588.4	+	74	11613	c.11384G>A	c.(11383-11385)cGa>cAa	p.R3795Q	HMCN1_ENST00000367492.2_Missense_Mutation_p.R3795Q	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3795	Ig-like C2-type 36.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GATCGCAGGCGAATAGATTTA	0.418													G|||	2	0.000399361	0.0	0.0	5008	,	,		18816	0.0		0.0	False		,,,				2504	0.002															0			1											170.0	165.0	167.0					1																	186084058		2203	4300	6503	184350681	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11384G>A	1.37:g.186084058G>A	ENSP00000271588:p.Arg3795Gln	Somatic		Capture	Illumina GAIIx	4	184350681	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	superfamily_vWA-like,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,HMMPfam_I-set,HMMSmart_SM00406,PatternScan_CECROPIN,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00682,HMMPfam_G2F,superfamily_GFP-like,PatternScan_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,HMMPfam_EGF_CA,PatternScan_EGF_2	p.R3795Q	ENST00000271588.4	37	c.11384	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731410	0.48939	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66995	-0.24;-0.24	5.03	5.03	0.67393	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.167438	0.52532	D	0.000078	T	0.65217	0.2670	N	0.16478	0.41	0.41289	D	0.986969	D	0.76494	0.999	D	0.77557	0.99	T	0.59440	-0.7454	10	0.12430	T	0.62	.	12.405	0.55434	0.0812:0.0:0.9188:0.0	.	3795	Q96RW7	HMCN1_HUMAN	Q	3795	ENSP00000271588:R3795Q;ENSP00000356462:R3795Q	ENSP00000271588:R3795Q	R	+	2	0	HMCN1	184350681	1.000000	0.71417	0.952000	0.39060	0.972000	0.66771	5.346000	0.65992	2.480000	0.83734	0.563000	0.77884	CGA	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409		0.418	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	G	NM_031935		184350681	+1	no_errors	NM_031935	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PGAP1	80055	genome.wustl.edu	37	2	197757870	197757870	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:197757870A>T	ENST00000354764.4	-	8	1141	c.1027T>A	c.(1027-1029)Tta>Ata	p.L343I	PGAP1_ENST00000485830.1_5'UTR|PGAP1_ENST00000409475.1_Missense_Mutation_p.L343I|PGAP1_ENST00000409188.1_Missense_Mutation_p.L301I	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	343					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						CAACCTGTTAAGTCAGAAATT	0.279																																																0			2											116.0	118.0	117.0					2																	197757870		2203	4300	6503	197466115	SO:0001583	missense	80055				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.1027T>A	2.37:g.197757870A>T	ENSP00000346809:p.Leu343Ile	Somatic		Capture	Illumina GAIIx	4	197466115	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	HMMPfam_PGAP1,superfamily_alpha/beta-Hydrolases	p.L343I	ENST00000354764.4	37	c.1027	CCDS2318.1	2	.	.	.	.	.	.	.	.	.	.	A	10.34	1.323226	0.24080	.	.	ENSG00000197121	ENST00000422382;ENST00000354764;ENST00000409475;ENST00000409188;ENST00000374738	.	.	.	5.14	2.81	0.32909	.	0.344143	0.27080	N	0.021034	T	0.35970	0.0950	N	0.19112	0.55	0.28761	N	0.900924	D;B;D	0.69078	0.993;0.052;0.997	D;B;D	0.72625	0.952;0.033;0.978	T	0.15009	-1.0452	9	0.23891	T	0.37	-12.4948	5.9808	0.19405	0.6246:0.0:0.3754:0.0	.	301;343;343	B4DYY6;Q75T13-3;Q75T13	.;.;PGAP1_HUMAN	I	123;343;343;301;123	.	ENSP00000346809:L343I	L	-	1	2	PGAP1	197466115	0.999000	0.42202	0.999000	0.59377	0.969000	0.65631	0.824000	0.27379	0.447000	0.26695	0.460000	0.39030	TTA	-	NULL		0.279	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	protein_coding	OTTHUMT00000256103.5	A	NM_024989		197466115	-1	no_errors	NM_024989	genbank	human	validated	54_36p	missense	SNP	0.993	T
HNRNPA1P51	729366	genome.wustl.edu	37	2	207284051	207284051	+	IGR	SNP	A	A	T			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:207284051A>T								AC017081.1 (63208 upstream) : ADAM23 (24211 downstream)																							CTACTGGAACAGCCATAGCCA	0.498																																																0			2																																								206992296	SO:0001628	intergenic_variant	729366																															2.37:g.207284051A>T		Somatic		Capture	Illumina GAIIx	4	206992296		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.498					LOC729366			A			206992296	-1	pseudogene	XR_015958	genbank	human	model	54_36p	rna	SNP	0.945	T
DYTN	391475	genome.wustl.edu	37	2	207516607	207516607	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:207516607C>G	ENST00000452335.2	-	12	1788	c.1672G>C	c.(1672-1674)Gct>Cct	p.A558P	AC010731.4_ENST00000543490.1_lincRNA	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	558						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		ACTCGCTGAGCTCCACTGTAC	0.468																																																0			2											65.0	69.0	68.0					2																	207516607		2025	4199	6224	207224852	SO:0001583	missense	0			ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1672G>C	2.37:g.207516607C>G	ENSP00000396593:p.Ala558Pro	Somatic		Capture	Illumina GAIIx	4	207224852		Missense_Mutation	SNP	HMMPfam_efhand_1,superfamily_SSF47473,HMMPfam_efhand_2,HMMPfam_ZZ,HMMSmart_ZnF_ZZ,PatternScan_ZF_ZZ_1	p.A558P	ENST00000452335.2	37	c.1672	CCDS46502.1	2	.	.	.	.	.	.	.	.	.	.	C	16.64	3.180360	0.57800	.	.	ENSG00000232125	ENST00000452335	T	0.38077	1.16	5.33	5.33	0.75918	.	.	.	.	.	T	0.49253	0.1546	L	0.29908	0.895	0.35471	D	0.79733	D	0.89917	1.0	D	0.91635	0.999	T	0.58956	-0.7544	9	0.87932	D	0	-5.9583	15.8736	0.79145	0.0:1.0:0.0:0.0	.	558	A2CJ06	DYTN_HUMAN	P	558	ENSP00000396593:A558P	ENSP00000396593:A558P	A	-	1	0	DYTN	207224852	0.993000	0.37304	0.989000	0.46669	0.141000	0.21300	3.673000	0.54591	2.777000	0.95525	0.655000	0.94253	GCT	-	NULL		0.468	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYTN	protein_coding	OTTHUMT00000336799.1	C			207224852	-1	no_errors	NM_001093730	genbank	human	provisional	54_36p	missense	SNP	0.497	G
COL6A3	1293	genome.wustl.edu	37	2	238290094	238290094	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:238290094G>A	ENST00000295550.4	-	5	1813	c.1361C>T	c.(1360-1362)tCt>tTt	p.S454F	COL6A3_ENST00000392004.3_Missense_Mutation_p.S248F|COL6A3_ENST00000353578.4_Missense_Mutation_p.S248F|COL6A3_ENST00000347401.3_Missense_Mutation_p.S253F|COL6A3_ENST00000392003.2_Missense_Mutation_p.S47F|COL6A3_ENST00000409809.1_Missense_Mutation_p.S248F|COL6A3_ENST00000472056.1_Missense_Mutation_p.S47F|COL6A3_ENST00000346358.4_Missense_Mutation_p.S454F	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	454	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TCCCAGTGCAGATGAGCCATC	0.483																																																0			2											40.0	38.0	39.0					2																	238290094		2203	4299	6502	237954833	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.1361C>T	2.37:g.238290094G>A	ENSP00000295550:p.Ser454Phe	Somatic		Capture	Illumina GAIIx	4	237954833	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	HMMSmart_SM00327,superfamily_vWA-like,HMMPfam_VWA,HMMPfam_Collagen,superfamily_Fibronectin type III,superfamily_BPTI-like,HMMSmart_SM00131,HMMPfam_Kunitz_BPTI,PatternScan_BPTI_KUNITZ_1	p.S454F	ENST00000295550.4	37	c.1361	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858660	0.51376	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003;ENST00000433762	D;D;D;D;D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82	5.53	5.53	0.82687	von Willebrand factor, type A (3);	0.265792	0.26971	N	0.021578	D	0.92573	0.7641	M	0.77712	2.385	0.09310	N	1	P;D;D;B;D;P	0.67145	0.939;0.996;0.976;0.022;0.991;0.939	P;D;D;B;D;P	0.72982	0.776;0.979;0.934;0.049;0.965;0.776	D	0.86682	0.1917	10	0.66056	D	0.02	.	19.472	0.94966	0.0:0.0:1.0:0.0	.	454;47;47;248;248;454	E9PCV6;E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;.;CO6A3_HUMAN	F	454;253;248;47;248;454;248;47;454	ENSP00000295550:S454F;ENSP00000315609:S253F;ENSP00000315873:S248F;ENSP00000418285:S47F;ENSP00000386844:S248F;ENSP00000295546:S454F;ENSP00000375861:S248F;ENSP00000375860:S47F;ENSP00000389539:S454F	ENSP00000295550:S454F	S	-	2	0	COL6A3	237954833	0.564000	0.26602	0.026000	0.17262	0.704000	0.40688	4.170000	0.58229	2.585000	0.87301	0.655000	0.94253	TCT	-	HMMSmart_SM00327,superfamily_vWA-like,HMMPfam_VWA		0.483	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	protein_coding	OTTHUMT00000315790.2	G	NM_004369		237954833	-1	no_errors	NM_004369	genbank	human	reviewed	54_36p	missense	SNP	0.245	A
LPCAT3	10162	genome.wustl.edu	37	12	7084446	7084448	+	IGR	DEL	CTT	CTT	-			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	CTT	CTT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr12:7084446_7084448delCTT	ENST00000261407.4	-	0	2268				LPCAT3_ENST00000535021.1_5'Flank|EMG1_ENST00000261406.6_In_Frame_Del_p.S176del|EMG1_ENST00000546220.1_3'UTR	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						AAAGTTGGCACTTCTTTTTCCAT	0.453																																																0			12																																								6954709	SO:0001628	intergenic_variant	10436			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970		12.37:g.7084449_7084451delCTT		Somatic		Capture	Illumina GAIIx	4	6954707	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	In_Frame_Del	DEL	HMMPfam_EMG1	p.S176in_frame_del	ENST00000261407.4	37	c.524_526	CCDS8572.1	12																																																																																			(deletion:cds_exon[6954652,6954801])	HMMPfam_EMG1		0.453	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMG1	protein_coding	OTTHUMT00000401812.1	CTT	NM_005768		6954709	+1	no_errors	ENST00000261406	ensembl	human	known	54_36p	in_frame_del	DEL	1.000:0.978:1.000	-
TP53	7157	genome.wustl.edu	37	17	7577558	7577558	+	Frame_Shift_Del	DEL	G	G	-	rs397516437		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr17:7577558delG	ENST00000269305.4	-	7	912	c.723delC	c.(721-723)tccfs	p.S241fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.S241fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.S241fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.S241fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C242fs*5(9)|p.0?(8)|p.?(5)|p.S241del(5)|p.S241F(5)|p.N239_C242delNSSC(3)|p.S241S(3)|p.N239_C242>S(1)|p.S241_C242insX(1)|p.C238fs*21(1)|p.C242fs*20(1)|p.C242fs*23(1)|p.S241fs*22(1)|p.N239_C242del(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCCCATGCAGGAACTGTTAC	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	50	Deletion - In frame(13)|Deletion - Frameshift(13)|Whole gene deletion(8)|Unknown(5)|Substitution - Missense(5)|Substitution - coding silent(3)|Insertion - Frameshift(1)|Insertion - In frame(1)|Complex - deletion inframe(1)	large_intestine(8)|biliary_tract(6)|breast(5)|upper_aerodigestive_tract(4)|stomach(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|central_nervous_system(2)|urinary_tract(2)|oesophagus(2)|skin(2)|eye(2)|pancreas(2)|liver(1)	17											138.0	107.0	117.0					17																	7577558		2203	4300	6503	7518283	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.723delC	17.37:g.7577558delG	ENSP00000269305:p.Ser241fs	Somatic		Capture	Illumina GAIIx	4	7518283	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.C242fs	ENST00000269305.4	37	c.723	CCDS11118.1	17																																																																																			(deletion:cds_exon[7518224,7518333])	HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7518283	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
APEX1	328	genome.wustl.edu	37	14	20925577	20925578	+	Frame_Shift_Del	DEL	CT	CT	-	rs565835054		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	CT	CT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr14:20925577_20925578delCT	ENST00000216714.3	+	5	1135_1136	c.867_868delCT	c.(865-870)cactctfs	p.S290fs	OSGEP_ENST00000206542.4_5'Flank|OSGEP_ENST00000556252.1_5'Flank|APEX1_ENST00000557054.1_3'UTR|APEX1_ENST00000398030.4_Frame_Shift_Del_p.S290fs|APEX1_ENST00000555414.1_Frame_Shift_Del_p.S290fs	NM_001244249.1|NM_001641.3	NP_001231178.1|NP_001632.2	P27695	APEX1_HUMAN	APEX nuclease (multifunctional DNA repair enzyme) 1	290	Mitochondrial targeting sequence (MTS).				aging (GO:0007568)|base-excision repair (GO:0006284)|cell redox homeostasis (GO:0045454)|cellular response to cAMP (GO:0071320)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to peptide hormone stimulus (GO:0071375)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA demethylation (GO:0080111)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|negative regulation of smooth muscle cell migration (GO:0014912)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oxidation-reduction process (GO:0055114)|positive regulation of DNA repair (GO:0045739)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribosome (GO:0005840)|transcription factor complex (GO:0005667)	3'-5' exonuclease activity (GO:0008408)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|phosphodiesterase I activity (GO:0004528)|phosphoric diester hydrolase activity (GO:0008081)|poly(A) RNA binding (GO:0044822)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|uracil DNA N-glycosylase activity (GO:0004844)			breast(2)|endometrium(1)|large_intestine(4)|ovary(2)	9	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	Lucanthone(DB04967)	TGTTGTCCCACTCTCTGTTACC	0.485								Other BER factors																																								0			14																																								19995418	SO:0001589	frameshift_variant	328			X59764	CCDS9550.1	14q11.2	2008-02-05	2002-09-11	2002-09-13	ENSG00000100823	ENSG00000100823	4.2.99.18		587	protein-coding gene	gene with protein product		107748	"""APEX nuclease (multifunctional DNA repair enzyme)"""	APEX			Standard	NM_001641		Approved	APE, REF1, HAP1, APX, APEN, REF-1, APE-1	uc021rnr.1	P27695	OTTHUMG00000029544	ENST00000216714.3:c.867_868delCT	14.37:g.20925581_20925582delCT	ENSP00000216714:p.Ser290fs	Somatic		Capture	Illumina GAIIx	4	19995417	Q969L5|Q99775	Frame_Shift_Del	DEL	superfamily_DNase I-like,HMMPfam_Exo_endo_phos,PatternScan_AP_NUCLEASE_F1_1,PatternScan_AP_NUCLEASE_F1_2,PatternScan_AP_NUCLEASE_F1_3	p.L291fs	ENST00000216714.3	37	c.867_868	CCDS9550.1	14																																																																																			(deletion:cds_exon[19994990,19995507])	superfamily_DNase I-like,HMMPfam_Exo_endo_phos		0.485	APEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX1	protein_coding	OTTHUMT00000073641.3	CT	NM_001641		19995418	+1	no_errors	NM_001641	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.000:0.084	-
CDC25A	993	genome.wustl.edu	37	3	48207180	48207205	+	Frame_Shift_Del	DEL	CTCTTTAATGAGGTTGGCAAACTTGC	CTCTTTAATGAGGTTGGCAAACTTGC	-	rs143460181|rs565583599|rs529680138		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	CTCTTTAATGAGGTTGGCAAACTTGC	CTCTTTAATGAGGTTGGCAAACTTGC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr3:48207180_48207205delCTCTTTAATGAGGTTGGCAAACTTGC	ENST00000302506.3	-	12	1520_1545	c.1112_1137delGCAAGTTTGCCAACCTCATTAAAGAG	c.(1111-1137)ggcaagtttgccaacctcattaaagagfs	p.GKFANLIKE371fs	CDC25A_ENST00000459900.1_5'UTR|CDC25A_ENST00000351231.3_Frame_Shift_Del_p.GKFANLIKE331fs	NM_001789.2	NP_001780.2	P30304	MPIP1_HUMAN	cell division cycle 25A	371					cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to radiation (GO:0009314)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.000685)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		TGATAACAAACTCTTTAATGAGGTTGGCAAACTTGCCATTCAAAAC	0.438																																																0			3																																								48182209	SO:0001589	frameshift_variant	993			M81933	CCDS2760.1, CCDS2761.1	3p21	2013-01-17	2013-01-17		ENSG00000164045	ENSG00000164045		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1725	protein-coding gene	gene with protein product		116947	"""cell division cycle 25A"", ""cell division cycle 25 homolog A (S. cerevisiae)"", ""cell division cycle 25 homolog A (S. pombe)"""			1836978	Standard	NM_001789		Approved		uc003csh.1	P30304	OTTHUMG00000133535	ENST00000302506.3:c.1112_1137delGCAAGTTTGCCAACCTCATTAAAGAG	3.37:g.48207180_48207205delCTCTTTAATGAGGTTGGCAAACTTGC	ENSP00000303706:p.Gly371fs	Somatic		Capture	Illumina GAIIx	4	48182184	Q8IZH5|Q96IL3|Q9H2F2	Frame_Shift_Del	DEL	HMMPfam_M-inducer_phosp,superfamily_Rhodanese/Cell cycle control phosphatase,HMMSmart_SM00450,HMMPfam_Rhodanese	p.G371fs	ENST00000302506.3	37	c.1137_1112	CCDS2760.1	3																																																																																			(deletion:cds_exon[48182130,48182228])	superfamily_Rhodanese/Cell cycle control phosphatase,HMMSmart_SM00450,HMMPfam_Rhodanese		0.438	CDC25A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25A	protein_coding	OTTHUMT00000257512.2	CTCTTTAATGAGGTTGGCAAACTTGC	NM_001789		48182209	-1	no_errors	NM_001789	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.979:0.991:0.994:0.994:1.000:1.000:0.999:1.000:0.992:0.738:0.736:0.629:0.420:0.388:0.390:0.443:0.651:0.665:0.938:0.999:1.000:1.000:1.000:0.998:0.991:0.993	-
MIR2052HG	441355	genome.wustl.edu	37	8	75664695	75664695	+	Frame_Shift_Del	DEL	A	A	-	rs201179583|rs34841297	byFrequency	TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr8:75664695delA	ENST00000523118.1	+	5	306	c.248delA	c.(247-249)cacfs	p.H83fs																								CAGTCCAGCCACCAGATCAAC	0.393													A|A|-|deletion	1334	0.266374	0.0439	0.2334	5008	,	,		15379	0.622		0.2753	False		,,,				2504	0.2147															0			8																																								75827250	SO:0001589	frameshift_variant	441355																														ENST00000523118.1:c.248delA	8.37:g.75664695delA	ENSP00000430470:p.His83fs	Somatic		Capture	Illumina GAIIx	4	75827250		Frame_Shift_Del	DEL	NULL	p.H83fs	ENST00000523118.1	37	c.248		8																																																																																			(deletion:cds_exon[75827231,75827308])	NULL		0.393	RP11-758M4.1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	FLJ39080	protein_coding	OTTHUMT00000379070.2	A			75827250	+1	no_errors	XM_499117	genbank	human	model	54_36p	frame_shift_del	DEL	0.024	-
ADAM6	8755	genome.wustl.edu	37	14	106437037	106437074	+	lincRNA	DEL	CATGGTTTCGTTATACACAGGAGCAAGTGTTTCAAAAA	CATGGTTTCGTTATACACAGGAGCAAGTGTTTCAAAAA	-	rs71405043|rs571004730	byFrequency	TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	CATGGTTTCGTTATACACAGGAGCAAGTGTTTCAAAAA	CATGGTTTCGTTATACACAGGAGCAAGTGTTTCAAAAA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr14:106437037_106437074delCATGGTTTCGTTATACACAGGAGCAAGTGTTTCAAAAA	ENST00000452053.1	-	0	586_623					NR_002224.2				ADAM metallopeptidase domain 6, pseudogene																		GAACCGTTGTCATGGTTTCGTTATACACAGGAGCAAGTGTTTCAAAAACACACCGGCC	0.462														1095	0.21865	0.0734	0.17	5008	,	,		14745	0.4226		0.0964	False		,,,				2504	0.365															0			14																																								105508119			8755			AI024595		14q32.33	2013-09-05	2012-08-22		ENSG00000233988	ENSG00000271968		"""ADAM metallopeptidase domain containing"""	213	pseudogene	pseudogene			"""chromosome 14 open reading frame 96"", ""a disintegrin and metalloproteinase domain 6"", ""ADAM metallopeptidase domain 6"""	C14orf96			Standard	NR_002224		Approved	tMDCIV	uc001ysu.1		OTTHUMG00000152319		14.37:g.106437037_106437074delCATGGTTTCGTTATACACAGGAGCAAGTGTTTCAAAAA		Somatic		Capture	Illumina GAIIx	4	105508082		RNA	DEL	-	NULL	ENST00000452053.1	37	NULL		14																																																																																			(deletion:rna[105506864,105508128])	-		0.462	ADAM6-001	KNOWN	basic	lincRNA	ADAM6	lincRNA	OTTHUMT00000325881.1	CATGGTTTCGTTATACACAGGAGCAAGTGTTTCAAAAA	NR_002224		105508119	-1	pseudogene	NR_002224	genbank	human	provisional	54_36p	rna	DEL	0.000:0.002:0.001:0.001:0.000:0.002:0.003:0.002:0.001:0.000:0.002:0.002:0.001:0.000:0.001:0.002:0.002:0.002:0.002:0.004:0.004:0.005:0.004:0.004:0.003:0.001:0.000:0.000:0.000:0.002:0.003:0.001:0.000:0.000:0.000:0.004:0.000:0.000	-
SDS	10993	genome.wustl.edu	37	12	113830787	113830817	+	Frame_Shift_Del	DEL	GCGCCCGCAGCTGGGCCAGGCTGATGTTGCT	GCGCCCGCAGCTGGGCCAGGCTGATGTTGCT	-	rs201627146|rs371260220		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	GCGCCCGCAGCTGGGCCAGGCTGATGTTGCT	GCGCCCGCAGCTGGGCCAGGCTGATGTTGCT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr12:113830787_113830817delGCGCCCGCAGCTGGGCCAGGCTGATGTTGCT	ENST00000257549.4	-	8	1038_1068	c.916_946delAGCAACATCAGCCTGGCCCAGCTGCGGGCGC	c.(916-948)agcaacatcagcctggcccagctgcgggcgctcfs	p.SNISLAQLRAL306fs		NM_006843.2	NP_006834.2	P20132	SDHL_HUMAN	serine dehydratase	306					gluconeogenesis (GO:0006094)|L-serine catabolic process (GO:0006565)|pyruvate biosynthetic process (GO:0042866)|response to amino acid (GO:0043200)|response to cobalamin (GO:0033590)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.R314P(1)		large_intestine(2)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(1)	11					L-Serine(DB00133)	TGTTCCTTGAGCGCCCGCAGCTGGGCCAGGCTGATGTTGCTGCCCCCGCAG	0.623																																																1	Substitution - Missense(1)	lung(1)	12																																								112315200	SO:0001589	frameshift_variant	10993			J05037	CCDS9169.1	12q24.13	2014-06-24			ENSG00000135094	ENSG00000135094	4.3.1.17		10691	protein-coding gene	gene with protein product	"""L-serine ammonia-lyase"""	182128				2674117	Standard	NM_006843		Approved	SDH	uc001tvg.3	P20132	OTTHUMG00000169554	ENST00000257549.4:c.916_946delAGCAACATCAGCCTGGCCCAGCTGCGGGCGC	12.37:g.113830787_113830817delGCGCCCGCAGCTGGGCCAGGCTGATGTTGCT	ENSP00000257549:p.Ser306fs	Somatic		Capture	Illumina GAIIx	4	112315170	A8K9P5	Frame_Shift_Del	DEL	superfamily_PyrdxlP-dep_enz_bsu,HMMPfam_PALP,PatternScan_DEHYDRATASE_SER_THR	p.N307fs	ENST00000257549.4	37	c.946_916	CCDS9169.1	12																																																																																			(deletion:cds_exon[112315129,112315337])	superfamily_PyrdxlP-dep_enz_bsu		0.623	SDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDS	protein_coding	OTTHUMT00000404790.1	GCGCCCGCAGCTGGGCCAGGCTGATGTTGCT	NM_006843		112315200	-1	no_errors	NM_006843	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.978:0.156:0.161:0.178:0.186:0.161:0.257:0.347:0.992:1.000:1.000:0.996:0.946:0.740:0.791:0.876:0.912:0.926:0.921:0.987:0.990:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
RN7SL335P	106480375	genome.wustl.edu	37	4	123008762	123008776	+	RNA	DEL	TCTGACCTGGGCCAG	TCTGACCTGGGCCAG	-	rs79491805|rs186276074|rs532830186	byFrequency	TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	TCTGACCTGGGCCAG	TCTGACCTGGGCCAG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr4:123008762_123008776delTCTGACCTGGGCCAG	ENST00000482790.2	-	0	190_204									RNA, 7SL, cytoplasmic 335, pseudogene																		actcactatttctgacctgggccagtctgacctgg	0.526														41	0.0081869	0.0015	0.0072	5008	,	,		20900	0.0		0.0209	False		,,,				2504	0.0133															0			4																																								123228226			0					4q27	2013-04-02			ENSG00000241037	ENSG00000241037		"""ncRNAs / Small cytoplasmic RNAs"""	46351	pseudogene	RNA, pseudogene							Standard			Approved						4.37:g.123008762_123008776delTCTGACCTGGGCCAG		Somatic		Capture	Illumina GAIIx	4	123228212		RNA	DEL	-	NULL	ENST00000482790.2	37	NULL		4																																																																																			(deletion:rna[123228118,123228416])	-		0.526	RN7SL335P-201	KNOWN	basic	misc_RNA	ENSG00000209231	misc_RNA		TCTGACCTGGGCCAG			123228226	-1	pseudogene	ENST00000386496	ensembl	human	novel	54_36p	rna	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
Unknown	0	genome.wustl.edu	37	2	133062222	133062223	+	IGR	INS	-	-	T	rs67130166|rs62167594|rs11481364		TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr2:133062222_133062223insT								AC097532.2 (10272 upstream) : RP11-725P16.2 (40965 downstream)																							AGACGAATGCACGAAGTCAAAG	0.401																																																0			2																																								132778693	SO:0001628	intergenic_variant	730085																															2.37:g.133062222_133062223insT		Somatic		Capture	Illumina GAIIx	4	132778692		Splice_Site	INS	-	e1+1		37	c.107+1_107+1		2																																																																																			-	-	0	0.401					LOC730085			-			132778693	-1	no_errors	XM_001132335	genbank	human	model	54_36p	splice_site_ins	INS	0.003:0.006	T
TBC1D9	23158	genome.wustl.edu	37	4	141600258	141600264	+	Frame_Shift_Del	DEL	TGCTCAC	TGCTCAC	-			TCGA-29-1781-01A-01W-0633-09	TCGA-29-1781-10A-01W-0634-09	TGCTCAC	TGCTCAC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	f3b7334f-80de-4485-8457-953d995beda5	07e9e4e5-441f-4b26-9beb-ca5c5f1ad74f	g.chr4:141600258_141600264delTGCTCAC	ENST00000442267.2	-	5	757_763	c.683_689delGTGAGCA	c.(682-690)agtgagcatfs	p.SEH228fs		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	228							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				AGAGAAGAAATGCTCACTGGACCGTGT	0.478																																																0			4																																								141819714	SO:0001589	frameshift_variant	23158			AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.683_689delGTGAGCA	4.37:g.141600258_141600264delTGCTCAC	ENSP00000411197:p.Ser228fs	Somatic		Capture	Illumina GAIIx	4	141819708	A6H8U8|D3DNZ1|O94958	Frame_Shift_Del	DEL	HMMPfam_GRAM,HMMSmart_SM00568,superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164,superfamily_EF-hand	p.S228fs	ENST00000442267.2	37	c.689_683	CCDS47136.1	4																																																																																			(deletion:cds_exon[141819546,141819807])	NULL		0.478	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D9	protein_coding	OTTHUMT00000364806.1	TGCTCAC	NM_015130		141819714	-1	no_errors	NM_015130	genbank	human	validated	54_36p	frame_shift_del	DEL	0.997:0.998:0.962:0.999:0.998:0.966:0.997	-
