#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								12975	SO:0001628	intergenic_variant	4540																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	12975		Missense_Mutation	SNP	HMMPfam_Oxidored_q1_N,HMMPfam_Oxidored_q1,HMMPfam_NADH5_C	p.L213P		37	c.638		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND5			T			12975	+1	no_errors	ENST00000361567	ensembl	human	known	54_36p	missense	SNP	NULL	C
SDK1	221935	genome.wustl.edu	37	7	4308322	4308322	+	3'UTR	SNP	C	C	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr7:4308322C>T	ENST00000404826.2	+	0	10087					NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1						cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TAGCTATCCTCCTGACGAGCA	0.502																																																0			7											203.0	215.0	211.0					7																	4308322		2202	4294	6496	4274848	SO:0001624	3_prime_UTR_variant	221935			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.*3306C>T	7.37:g.4308322C>T		Somatic		Capture	Illumina GAIIx	4	4274848	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.L660	ENST00000404826.2	37	c.1980	CCDS34590.1	7																																																																																			-	NULL		0.502	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	protein_coding	OTTHUMT00000323702.1	C	NM_152744		4274848	+1	no_errors	NM_001079653	genbank	human	validated	54_36p	silent	SNP	0.004	T
EIF4A1	1973	genome.wustl.edu	37	17	7480153	7480153	+	Intron	SNP	T	T	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr17:7480153T>G	ENST00000293831.8	+	5	530				EIF4A1_ENST00000582746.1_Intron|SNORA48_ENST00000386847.1_RNA|EIF4A1_ENST00000577269.1_Intron|SENP3-EIF4A1_ENST00000579777.1_RNA|SNORA67_ENST00000384423.1_RNA|CD68_ENST00000250092.6_5'Flank|SNORD10_ENST00000459579.1_RNA|CD68_ENST00000380498.6_5'Flank	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						CCCATGCGTGTCATCTGAGCC	0.582																																					Melanoma(120;278 1668 15796 27423 46368)											0			17											75.0	68.0	71.0					17																	7480153		876	1991	2867	7420877	SO:0001627	intron_variant	0			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.514+143T>G	17.37:g.7480153T>G		Somatic		Capture	Illumina GAIIx	4	7420877	B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	RNA	SNP	-	NULL	ENST00000293831.8	37	NULL	CCDS11113.1	17																																																																																			-	-		0.582	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD10	protein_coding	OTTHUMT00000226952.6	T	NM_001416		7420877	+1	no_errors	NR_002604	genbank	human	provisional	54_36p	rna	SNP	1.000	G
AP1M2	10053	genome.wustl.edu	37	19	10694741	10694741	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr19:10694741C>G	ENST00000250244.6	-	2	130	c.48G>C	c.(46-48)ttG>ttC	p.L16F	AP1M2_ENST00000590923.1_Missense_Mutation_p.L16F	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	16					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			TGCGGCTGATCAATGGCTGAG	0.597																																																0			19											58.0	60.0	59.0					19																	10694741		2138	4255	6393	10555741	SO:0001583	missense	10053			AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.48G>C	19.37:g.10694741C>G	ENSP00000250244:p.Leu16Phe	Somatic		Capture	Illumina GAIIx	4	10555741	B2RDV5|Q9BSI8	Missense_Mutation	SNP	superfamily_SNARE-like,PatternScan_CLAT_ADAPTOR_M_1,HMMPfam_Adap_comp_sub,superfamily_Second domain of Mu2 adaptin subunit (ap50) of ap2 adaptor,PatternScan_CLAT_ADAPTOR_M_2	p.L16F	ENST00000250244.6	37	c.48	CCDS45964.1	19	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225898	0.58668	.	.	ENSG00000129354	ENST00000250244	T	0.74002	-0.8	4.36	4.36	0.52297	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.64402	D	0.000018	D	0.88385	0.6422	H	0.94925	3.6	0.80722	D	1	D;D	0.67145	0.995;0.996	D;D	0.70716	0.962;0.97	D	0.90625	0.4562	10	0.87932	D	0	-18.804	11.1165	0.48264	0.1851:0.8149:0.0:0.0	.	16;16	Q9Y6Q5-2;Q9Y6Q5	.;AP1M2_HUMAN	F	16	ENSP00000250244:L16F	ENSP00000250244:L16F	L	-	3	2	AP1M2	10555741	1.000000	0.71417	1.000000	0.80357	0.477000	0.33069	1.816000	0.38992	2.250000	0.74265	0.491000	0.48974	TTG	-	superfamily_SNARE-like		0.597	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP1M2	protein_coding	OTTHUMT00000452034.1	C			10555741	-1	no_errors	NM_005498	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ROCK2	9475	genome.wustl.edu	37	2	11356295	11356295	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr2:11356295G>C	ENST00000315872.6	-	13	1898	c.1450C>G	c.(1450-1452)Cta>Gta	p.L484V	ROCK2_ENST00000401753.1_Missense_Mutation_p.L241V	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	484	Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TCCTCTTCTAGCTCCTTTGCT	0.313																																																0			2											93.0	89.0	90.0					2																	11356295		1799	4067	5866	11273746	SO:0001583	missense	9475			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.1450C>G	2.37:g.11356295G>C	ENSP00000317985:p.Leu484Val	Somatic		Capture	Illumina GAIIx	4	11273746	Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_SM00133,HMMPfam_Pkinase_C,HMMPfam_HR1,HMMPfam_Rho_Binding,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Cysteine-rich domain,HMMPfam_C1_1,HMMSmart_SM00109	p.L484V	ENST00000315872.6	37	c.1450	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701617	0.68501	.	.	ENSG00000134318	ENST00000315872;ENST00000401753	D;D	0.84660	-1.88;-1.88	5.67	3.89	0.44902	.	0.000000	0.85682	D	0.000000	D	0.89276	0.6669	M	0.66939	2.045	0.54753	D	0.999984	D	0.60575	0.988	P	0.62184	0.899	D	0.88666	0.3192	10	0.66056	D	0.02	.	10.5627	0.45154	0.2075:0.0:0.7925:0.0	.	484	O75116	ROCK2_HUMAN	V	484;241	ENSP00000317985:L484V;ENSP00000385509:L241V	ENSP00000317985:L484V	L	-	1	2	ROCK2	11273746	1.000000	0.71417	0.998000	0.56505	0.911000	0.54048	3.823000	0.55715	0.764000	0.33197	0.591000	0.81541	CTA	-	HMMPfam_HR1		0.313	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	protein_coding	OTTHUMT00000313886.3	G			11273746	-1	no_errors	NM_004850	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ESF1	51575	genome.wustl.edu	37	20	13698050	13698050	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr20:13698050T>A	ENST00000202816.1	-	13	2334	c.2227A>T	c.(2227-2229)Atg>Ttg	p.M743L		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	743	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						TTCTTTTTCATGAGCTGCTTT	0.393																																																0			20											249.0	216.0	227.0					20																	13698050		2203	4300	6503	13646050	SO:0001583	missense	51575				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.2227A>T	20.37:g.13698050T>A	ENSP00000202816:p.Met743Leu	Somatic		Capture	Illumina GAIIx	4	13646050	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	NULL	p.M743L	ENST00000202816.1	37	c.2227	CCDS13117.1	20	.	.	.	.	.	.	.	.	.	.	T	8.299	0.819580	0.16607	.	.	ENSG00000089048	ENST00000202816	T	0.21361	2.01	5.87	4.75	0.60458	.	0.200752	0.48767	N	0.000166	T	0.17704	0.0425	L	0.39020	1.185	0.32359	N	0.557494	B	0.02656	0.0	B	0.04013	0.001	T	0.08806	-1.0704	10	0.30078	T	0.28	-32.0468	13.1262	0.59356	0.0:0.0:0.1337:0.8663	.	743	Q9H501	ESF1_HUMAN	L	743	ENSP00000202816:M743L	ENSP00000202816:M743L	M	-	1	0	ESF1	13646050	0.997000	0.39634	0.984000	0.44739	0.998000	0.95712	2.565000	0.45939	1.116000	0.41820	0.533000	0.62120	ATG	-	NULL		0.393	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESF1	protein_coding	OTTHUMT00000078049.1	T	NM_016649		13646050	-1	no_errors	NM_016649	genbank	human	provisional	54_36p	missense	SNP	0.980	A
SPECC1	92521	genome.wustl.edu	37	17	20015316	20015316	+	Intron	SNP	T	T	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr17:20015316T>C	ENST00000261503.5	+	3	334				SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395529.3_Intron|SPECC1_ENST00000395527.4_Intron	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1						cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		GGGATGATGATGTTTTGTTTG	0.413																																																0			17																																								19955908	SO:0001627	intron_variant	729404			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.283+1441T>C	17.37:g.20015316T>C		Somatic		Capture	Illumina GAIIx	4	19955908	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	RNA	SNP	-	NULL	ENST00000261503.5	37	NULL	CCDS32590.1	17																																																																																			-	-		0.413	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729404	protein_coding	OTTHUMT00000441206.1	T	NM_152904		19955908	+1	pseudogene	XR_015968	genbank	human	model	54_36p	rna	SNP	1.000	C
LOC81691	81691	genome.wustl.edu	37	16	20824601	20824601	+	Silent	SNP	C	C	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr16:20824601C>G	ENST00000261377.6	+	3	437	c.228C>G	c.(226-228)ggC>ggG	p.G76G	AC004381.6_ENST00000564274.1_Silent_p.G76G|AC004381.6_ENST00000348433.6_Silent_p.G76G|AC004381.6_ENST00000567297.1_3'UTR|ERI2_ENST00000564349.1_Intron	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					CAGTTCTGGGCAAATCCAATG	0.388																																																0			16											67.0	65.0	66.0					16																	20824601		2201	4300	6501	20732102	SO:0001819	synonymous_variant	81691																														ENST00000261377.6:c.228C>G	16.37:g.20824601C>G		Somatic		Capture	Illumina GAIIx	4	20732102		Silent	SNP	superfamily_Ribonuclease H-like,HMMSmart_SM00479,HMMPfam_Exonuc_X-T,HMMSmart_SM00360,HMMPfam_RRM_1,superfamily_RNA-binding domain RBD	p.G76	ENST00000261377.6	37	c.228	CCDS10591.1	16																																																																																			-	NULL		0.388	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC81691	protein_coding	OTTHUMT00000254418.2	C			20732102	+1	no_errors	NM_030941	genbank	human	validated	54_36p	silent	SNP	0.936	G
LDLRAP1	26119	genome.wustl.edu	37	1	25883750	25883750	+	Missense_Mutation	SNP	C	C	T	rs148916767		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr1:25883750C>T	ENST00000374338.4	+	4	570	c.451C>T	c.(451-453)Cgg>Tgg	p.R151W	LDLRAP1_ENST00000488127.1_3'UTR	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1	151	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)	p.R151G(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCACCAAGCGGAAGATGGT	0.637																																																1	Substitution - Missense(1)	endometrium(1)	1						C	TRP/ARG	0,4406		0,0,2203	74.0	57.0	63.0		451	4.8	1.0	1	dbSNP_134	63	2,8598	2.2+/-6.3	0,2,4298	yes	missense	LDLRAP1	NM_015627.2	101	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	151/309	25883750	2,13004	2203	4300	6503	25756337	SO:0001583	missense	26119			BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.451C>T	1.37:g.25883750C>T	ENSP00000363458:p.Arg151Trp	Somatic		Capture	Illumina GAIIx	4	25756337	A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	Missense_Mutation	SNP	superfamily_SSF50729,HMMSmart_PTB,HMMPfam_PID	p.R151W	ENST00000374338.4	37	c.451	CCDS30639.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.957474	0.73902	0.0	2.33E-4	ENSG00000157978	ENST00000374338	T	0.57595	0.39	5.74	4.8	0.61643	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.047109	0.85682	D	0.000000	T	0.72755	0.3500	M	0.80422	2.495	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.76149	-0.3065	10	0.72032	D	0.01	-28.2006	14.4288	0.67236	0.259:0.741:0.0:0.0	.	151	Q5SW96	ARH_HUMAN	W	151	ENSP00000363458:R151W	ENSP00000363458:R151W	R	+	1	2	LDLRAP1	25756337	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	1.689000	0.37700	2.717000	0.92951	0.655000	0.94253	CGG	-	superfamily_SSF50729,HMMSmart_PTB,HMMPfam_PID		0.637	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAP1	protein_coding	OTTHUMT00000019350.3	C	NM_015627		25756337	+1	no_errors	NM_015627	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MAGEB6	158809	genome.wustl.edu	37	X	26212988	26212988	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrX:26212988T>C	ENST00000379034.1	+	2	1174	c.1025T>C	c.(1024-1026)gTg>gCg	p.V342A		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	342	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						GATAAGTACGTGGTTTACCGG	0.493																																																0			X											107.0	105.0	106.0					X																	26212988		2201	4281	6482	26122909	SO:0001583	missense	158809			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.1025T>C	X.37:g.26212988T>C	ENSP00000368320:p.Val342Ala	Somatic		Capture	Illumina GAIIx	4	26122909	Q6GS19|Q9H219	Missense_Mutation	SNP	HMMPfam_MAGE	p.V342A	ENST00000379034.1	37	c.1025	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	T	11.66	1.704653	0.30232	.	.	ENSG00000176746	ENST00000379034	T	0.04970	3.52	3.29	3.29	0.37713	.	0.091506	0.45361	U	0.000371	T	0.07999	0.0200	L	0.49126	1.545	0.09310	N	1	P	0.37207	0.587	B	0.40444	0.329	T	0.15350	-1.0440	10	0.87932	D	0	.	7.3105	0.26471	0.0:0.0:0.0:1.0	.	342	Q8N7X4	MAGB6_HUMAN	A	342	ENSP00000368320:V342A	ENSP00000368320:V342A	V	+	2	0	MAGEB6	26122909	0.571000	0.26659	0.009000	0.14445	0.001000	0.01503	2.924000	0.48876	1.535000	0.49220	0.481000	0.45027	GTG	-	HMMPfam_MAGE		0.493	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	protein_coding	OTTHUMT00000056123.1	T	NM_173523		26122909	+1	no_errors	NM_173523	genbank	human	reviewed	54_36p	missense	SNP	0.006	C
HNF1B	6928	genome.wustl.edu	37	17	36093664	36093664	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr17:36093664C>T	ENST00000225893.4	-	3	1056	c.695G>A	c.(694-696)cGc>cAc	p.R232H	HNF1B_ENST00000560016.1_Missense_Mutation_p.R232H|HNF1B_ENST00000427275.2_Missense_Mutation_p.R206H|HNF1B_ENST00000561193.1_Missense_Mutation_p.R206H	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	232					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			CCGGTTGCGGCGCATCTTCTT	0.567																																					Colon(71;102 1179 9001 27917 43397)											0			17											89.0	84.0	86.0					17																	36093664		2203	4300	6503	33167777	SO:0001583	missense	6928			BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.695G>A	17.37:g.36093664C>T	ENSP00000225893:p.Arg232His	Somatic		Capture	Illumina GAIIx	4	33167777	B4DKM3|E0YMJ9	Missense_Mutation	SNP	superfamily_Dimerization cofactor of HNF-1 alpha,HMMPfam_HNF-1_N,superfamily_lambda repressor-like DNA-binding domains,superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1,HMMPfam_HNF-1B_C	p.R232H	ENST00000225893.4	37	c.695	CCDS11324.1	17	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998256	0.93227	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	D;D	0.97303	-4.33;-4.33	5.18	5.18	0.71444	Homeobox (3);Homeodomain-like (1);	0.147964	0.56097	D	0.000025	D	0.98314	0.9441	M	0.83603	2.65	0.80722	D	1	P;D;D	0.71674	0.536;0.973;0.998	B;P;D	0.63793	0.065;0.476;0.918	D	0.99177	1.0866	10	0.87932	D	0	-4.9051	17.8319	0.88685	0.0:1.0:0.0:0.0	.	206;232;232	E0YMJ6;P35680-3;P35680	.;.;HNF1B_HUMAN	H	232;206;232;120	ENSP00000225893:R232H;ENSP00000412212:R206H	ENSP00000225893:R232H	R	-	2	0	HNF1B	33167777	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.320000	0.79064	2.684000	0.91462	0.591000	0.81541	CGC	-	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox		0.567	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1B	protein_coding	OTTHUMT00000256807.3	C	NM_000458		33167777	-1	no_errors	NM_000458	genbank	human	validated	54_36p	missense	SNP	1.000	T
MROH8	140699	genome.wustl.edu	37	20	35783512	35783512	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr20:35783512C>G	ENST00000400441.3	-	9	1027	c.1028G>C	c.(1027-1029)aGc>aCc	p.S343T	MROH8_ENST00000217333.8_Intron|MROH8_ENST00000441008.2_Missense_Mutation_p.S329T			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	243																	TTGAGCCATGCTGGCCGTGGC	0.507																																																0			20											130.0	126.0	127.0					20																	35783512		1969	4159	6128	35216926	SO:0001583	missense	140699			AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1028G>C	20.37:g.35783512C>G	ENSP00000383291:p.Ser343Thr	Somatic		Capture	Illumina GAIIx	4	35216926	Q5JYQ6	Missense_Mutation	SNP	superfamily_ARM repeat	p.S263T	ENST00000400441.3	37	c.788		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.910|3.910	-0.020275|-0.020275	0.07634|0.07634	.|.	.|.	ENSG00000101353|ENSG00000101353	ENST00000343811;ENST00000400440|ENST00000441008;ENST00000400441	.|T;T	.|0.65549	.|-0.16;1.49	5.57|5.57	2.49|2.49	0.30216|0.30216	.|.	.|0.348630	.|0.31859	.|N	.|0.006957	T|T	0.48077|0.48077	0.1480|0.1480	L|L	0.50919|0.50919	1.6|1.6	0.09310|0.09310	N|N	1|1	.|B;B	.|0.17038	.|0.02;0.003	.|B;B	.|0.17979	.|0.02;0.012	T|T	0.28902|0.28902	-1.0029|-1.0029	5|10	.|0.22706	.|T	.|0.39	-2.644|-2.644	4.1492|4.1492	0.10230|0.10230	0.1687:0.5925:0.152:0.0869|0.1687:0.5925:0.152:0.0869	.|.	.|343;353	.|E7ETR9;Q6PF12	.|.;.	P|T	370;374|329;343	.|ENSP00000392144:S329T;ENSP00000383291:S343T	.|ENSP00000383291:S343T	A|S	-|-	1|2	0|0	C20orf132|C20orf132	35216926|35216926	0.831000|0.831000	0.29352|0.29352	0.032000|0.032000	0.17829|0.17829	0.016000|0.016000	0.09150|0.09150	1.020000|1.020000	0.30027|0.30027	0.353000|0.353000	0.24079|0.24079	0.655000|0.655000	0.94253|0.94253	GCA|AGC	-	superfamily_ARM repeat		0.507	MROH8-202	KNOWN	basic|appris_principal	protein_coding	C20orf132	protein_coding		C	NM_152503		35216926	-1	no_errors	NM_152503	genbank	human	validated	54_36p	missense	SNP	0.334	G
GPR34	2857	genome.wustl.edu	37	X	41555341	41555341	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrX:41555341G>A	ENST00000378142.4	+	3	739	c.455G>A	c.(454-456)cGc>cAc	p.R152H	GPR34_ENST00000378138.5_Missense_Mutation_p.R152H|CASK_ENST00000378154.1_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000442742.2_Intron|CASK_ENST00000378163.1_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000421587.2_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	152					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						AGTTTGGATCGCTATATAAAA	0.368																																																0			X											119.0	111.0	113.0					X																	41555341		2203	4300	6503	41440285	SO:0001583	missense	2857			AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.455G>A	X.37:g.41555341G>A	ENSP00000367384:p.Arg152His	Somatic		Capture	Illumina GAIIx	4	41440285	O95853	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R152H	ENST00000378142.4	37	c.455	CCDS14258.1	X	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491581	0.84962	.	.	ENSG00000171659	ENST00000378142;ENST00000378138;ENST00000535368	D;D	0.97161	-4.27;-4.27	5.96	5.96	0.96718	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99107	1.0845	10	0.87932	D	0	-12.7142	19.3529	0.94398	0.0:0.0:1.0:0.0	.	152	Q9UPC5	GPR34_HUMAN	H	152;152;105	ENSP00000367384:R152H;ENSP00000367378:R152H	ENSP00000367378:R152H	R	+	2	0	GPR34	41440285	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.471000	0.97696	2.523000	0.85059	0.594000	0.82650	CGC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1		0.368	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR34	protein_coding	OTTHUMT00000056264.1	G	NM_005300		41440285	+1	no_errors	NM_001097579	genbank	human	validated	54_36p	missense	SNP	1.000	A
ATP5A1	498	genome.wustl.edu	37	18	43669957	43669957	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr18:43669957C>T	ENST00000398752.6	-	4	436	c.315G>A	c.(313-315)atG>atA	p.M105I	ATP5A1_ENST00000590665.1_Missense_Mutation_p.M105I|ATP5A1_ENST00000282050.2_Missense_Mutation_p.M105I|ATP5A1_ENST00000593152.2_Missense_Mutation_p.M55I	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	105					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						AGTTCAAGGACATACCCTGCA	0.443																																																0			18											76.0	64.0	68.0					18																	43669957		2203	4300	6503	41923955	SO:0001583	missense	498			D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.315G>A	18.37:g.43669957C>T	ENSP00000381736:p.Met105Ile	Somatic		Capture	Illumina GAIIx	4	41923955	A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	superfamily_N-terminal domain of alpha and beta subunits of F1 ATP synthase,HMMPfam_ATP-synt_ab_N,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_ATP-synt_ab,PatternScan_ATPASE_ALPHA_BETA,superfamily_C-terminal domain of alpha and beta subunits of F1 ATP synthase,HMMPfam_ATP-synt_ab_C	p.M105I	ENST00000398752.6	37	c.315	CCDS11927.1	18	.	.	.	.	.	.	.	.	.	.	C	19.49	3.837724	0.71373	.	.	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	D;D	0.85773	-2.03;-2.03	5.14	5.14	0.70334	ATPase, F1/A1 complex, alpha subunit, N-terminal (1);ATPase, F1/V1/A1 complex, alpha/beta subunit, N-terminal (1);ATPase, F1/A1 complex, alpha/beta subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82449	0.5039	L	0.42744	1.35	0.80722	D	1	B	0.28026	0.198	B	0.29176	0.099	T	0.80743	-0.1246	10	0.52906	T	0.07	-43.3458	18.6414	0.91397	0.0:1.0:0.0:0.0	.	105	P25705	ATPA_HUMAN	I	105;105;55	ENSP00000282050:M105I;ENSP00000381736:M105I	ENSP00000282050:M105I	M	-	3	0	ATP5A1	41923955	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.399000	0.81585	0.655000	0.94253	ATG	-	superfamily_N-terminal domain of alpha and beta subunits of F1 ATP synthase,HMMPfam_ATP-synt_ab_N		0.443	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5A1	protein_coding	OTTHUMT00000255884.1	C	NM_004046		41923955	-1	no_errors	NM_001001937	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TSPAN18	90139	genome.wustl.edu	37	11	44941491	44941491	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr11:44941491G>A	ENST00000520358.2	+	8	971	c.556G>A	c.(556-558)Ggg>Agg	p.G186R	TSPAN18_ENST00000340160.3_Missense_Mutation_p.G186R			Q96SJ8	TSN18_HUMAN	tetraspanin 18	186						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(6)|lung(3)	10						AAGTCGGGACGGGGTCCTGCT	0.597																																																0			11											79.0	83.0	82.0					11																	44941491		2203	4299	6502	44898067	SO:0001583	missense	90139			AY358087	CCDS7910.1	11p11.2	2013-02-14				ENSG00000157570		"""Tetraspanins"""	20660	protein-coding gene	gene with protein product						11756464	Standard	NM_130783		Approved	TSPAN	uc001mye.4	Q96SJ8		ENST00000520358.2:c.556G>A	11.37:g.44941491G>A	ENSP00000429993:p.Gly186Arg	Somatic		Capture	Illumina GAIIx	4	44898067	Q6UY44|Q8NBI9	Missense_Mutation	SNP	HMMPfam_Tetraspannin,PatternScan_TM4_1,PatternScan_ALBUMIN,superfamily_Tetraspanin	p.G186R	ENST00000520358.2	37	c.556	CCDS7910.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.14|18.14	3.558212|3.558212	0.65538|0.65538	.|.	.|.	ENSG00000157570|ENSG00000157570	ENST00000533080;ENST00000520358;ENST00000340160|ENST00000518429	T;T;T|.	0.78816|.	-1.21;1.53;1.53|.	5.27|5.27	5.27|5.27	0.74061|0.74061	Tetraspanin, EC2 domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.75191|0.75191	0.3816|0.3816	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.994|.	D;P|.	0.69142|.	0.962;0.8|.	T|T	0.74375|0.74375	-0.3686|-0.3686	9|5	0.16420|.	T|.	0.52|.	.|.	18.0206|18.0206	0.89253|0.89253	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	186;186|.	Q8WUV1;Q96SJ8|.	.;TSN18_HUMAN|.	R|Q	121;186;186|189	ENSP00000433362:G121R;ENSP00000429993:G186R;ENSP00000339820:G186R|.	ENSP00000339820:G186R|.	G|R	+|+	1|2	0|0	TSPAN18|TSPAN18	44898067|44898067	0.989000|0.989000	0.36119|0.36119	0.981000|0.981000	0.43875|0.43875	0.976000|0.976000	0.68499|0.68499	2.668000|2.668000	0.46816|0.46816	2.619000|2.619000	0.88677|0.88677	0.561000|0.561000	0.74099|0.74099	GGG|CGG	-	HMMPfam_Tetraspannin,superfamily_Tetraspanin		0.597	TSPAN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN18	protein_coding	OTTHUMT00000376197.3	G	NM_130783		44898067	+1	no_errors	NM_001031730	genbank	human	provisional	54_36p	missense	SNP	0.667	A
ZFAND4	93550	genome.wustl.edu	37	10	46135330	46135330	+	Silent	SNP	A	A	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr10:46135330A>G	ENST00000344646.5	-	6	866	c.651T>C	c.(649-651)aaT>aaC	p.N217N	ZFAND4_ENST00000374371.2_Intron|ZFAND4_ENST00000374366.3_Silent_p.N143N|ZFAND4_ENST00000374370.1_5'UTR	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	217							zinc ion binding (GO:0008270)										TAGTTATTGAATTTTCAATTA	0.373																																																0			10											144.0	138.0	140.0					10																	46135330		2203	4300	6503	45455336	SO:0001819	synonymous_variant	93550			AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.651T>C	10.37:g.46135330A>G		Somatic		Capture	Illumina GAIIx	4	45455336	A8K8V4|B2RAX2|Q5VVY5	Silent	SNP	HMMSmart_SM00213,superfamily_Ubiquitin-like,HMMPfam_ubiquitin,HMMSmart_SM00154,HMMPfam_zf-AN1	p.N217	ENST00000344646.5	37	c.651	CCDS7214.1	10																																																																																			-	NULL		0.373	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANUBL1	protein_coding	OTTHUMT00000047790.1	A	NM_174890		45455336	-1	no_errors	NM_174890	genbank	human	validated	54_36p	silent	SNP	1.000	G
LRRC2	79442	genome.wustl.edu	37	3	46586715	46586715	+	Nonsense_Mutation	SNP	C	C	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr3:46586715C>A	ENST00000395905.3	-	3	546	c.154G>T	c.(154-156)Gaa>Taa	p.E52*	LRRC2_ENST00000296144.3_Nonsense_Mutation_p.E52*|LRRC2_ENST00000496388.1_5'UTR	NM_024512.4	NP_078788.2	Q9BYS8	LRRC2_HUMAN	leucine rich repeat containing 2	52								p.E52K(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	17		Ovarian(412;0.0563)		OV - Ovarian serous cystadenocarcinoma(275;6.37e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00133)|KIRC - Kidney renal clear cell carcinoma(197;0.0214)|Kidney(197;0.0254)		CTCCTGCATTCGGCCACAAAG	0.532																																																1	Substitution - Missense(1)	large_intestine(1)	3											80.0	79.0	80.0					3																	46586715		2203	4300	6503	46561719	SO:0001587	stop_gained	79442			AJ308569	CCDS2741.1	3p21.3	2014-07-30	2003-11-19		ENSG00000163827	ENSG00000163827			14676	protein-coding gene	gene with protein product		607180	"""leucine-rich repeat-containing 2"""			11896456	Standard	NM_024512		Approved		uc010hji.3	Q9BYS8	OTTHUMG00000133479	ENST00000395905.3:c.154G>T	3.37:g.46586715C>A	ENSP00000379241:p.Glu52*	Somatic		Capture	Illumina GAIIx	4	46561719	B2RDQ7|Q96LT5	Nonsense_Mutation	SNP	superfamily_SSF52058,HMMSmart_LRR_TYP,HMMPfam_LRR_1	p.E52*	ENST00000395905.3	37	c.154	CCDS2741.1	3	.	.	.	.	.	.	.	.	.	.	C	31	5.069712	0.93950	.	.	ENSG00000163827	ENST00000395905;ENST00000296144	.	.	.	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.762	0.85514	0.0:1.0:0.0:0.0	.	.	.	.	X	52	.	ENSP00000296144:E52X	E	-	1	0	LRRC2	46561719	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.958000	0.63660	2.635000	0.89317	0.655000	0.94253	GAA	-	superfamily_SSF52058		0.532	LRRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC2	protein_coding	OTTHUMT00000257375.2	C			46561719	-1	no_errors	NM_024512	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
CA10	56934	genome.wustl.edu	37	17	49825008	49825008	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr17:49825008C>G	ENST00000285273.4	-	5	1561	c.450G>C	c.(448-450)caG>caC	p.Q150H	CA10_ENST00000570565.1_Missense_Mutation_p.Q75H|CA10_ENST00000340813.6_Missense_Mutation_p.Q156H|CA10_ENST00000571918.1_5'UTR|CA10_ENST00000451037.2_Missense_Mutation_p.Q150H|CA10_ENST00000442502.2_Missense_Mutation_p.Q150H	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	150					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	CAGAGAAGGCCTGTCCATTGA	0.498																																																0			17											179.0	166.0	170.0					17																	49825008		2203	4300	6503	47180007	SO:0001583	missense	56934			AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.450G>C	17.37:g.49825008C>G	ENSP00000285273:p.Gln150His	Somatic		Capture	Illumina GAIIx	4	47180007	B2R7J0|B4DGL6	Missense_Mutation	SNP	superfamily_Carbonic anhydrase,HMMPfam_Carb_anhydrase	p.Q150H	ENST00000285273.4	37	c.450	CCDS32684.1	17	.	.	.	.	.	.	.	.	.	.	c	15.50	2.852691	0.51270	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.72	2.61	0.31194	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	T	0.74733	0.3755	L	0.45698	1.435	0.58432	D	0.999993	D;D;B	0.76494	0.999;0.999;0.13	D;D;B	0.74023	0.982;0.982;0.149	T	0.70008	-0.4990	9	.	.	.	.	7.701	0.28623	0.0:0.6674:0.0:0.3326	.	150;156;75	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	H	150;150;150;156	ENSP00000390666:Q150H;ENSP00000285273:Q150H;ENSP00000405388:Q150H;ENSP00000340363:Q156H	.	Q	-	3	2	CA10	47180007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.486000	0.35530	0.370000	0.24538	0.655000	0.94253	CAG	-	superfamily_Carbonic anhydrase,HMMPfam_Carb_anhydrase		0.498	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CA10	protein_coding	OTTHUMT00000437480.1	C	NM_020178		47180007	-1	no_errors	NM_001082533	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SCAP	22937	genome.wustl.edu	37	3	47455532	47455532	+	Missense_Mutation	SNP	C	C	T	rs201494816		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr3:47455532C>T	ENST00000265565.5	-	23	4064	c.3652G>A	c.(3652-3654)Ggc>Agc	p.G1218S	SCAP_ENST00000441517.2_Missense_Mutation_p.G962S|SCAP_ENST00000545718.1_Missense_Mutation_p.G825S	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	1218	Interaction with SREBF2. {ECO:0000250}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CAGCCCTGGCCGCCAGTCACC	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		18678	0.0		0.001	False		,,,				2504	0.0				Pancreas(149;978 1908 29304 37806 46700)											0			3						C	SER/GLY	0,4406		0,0,2203	62.0	69.0	67.0		3652	5.2	1.0	3		67	1,8599	1.2+/-3.3	0,1,4299	no	missense	SCAP	NM_012235.2	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1218/1280	47455532	1,13005	2203	4300	6503	47430536	SO:0001583	missense	22937			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.3652G>A	3.37:g.47455532C>T	ENSP00000265565:p.Gly1218Ser	Somatic		Capture	Illumina GAIIx	4	47430536	Q8N2E0|Q8WUA1	Missense_Mutation	SNP	superfamily_Multidrug efflux transporter AcrB transmembrane domain,HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.G1218S	ENST00000265565.5	37	c.3652	CCDS2755.2	3	2	9.157509157509158E-4	0	0.0	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	C	33	5.238790	0.95240	0.0	1.16E-4	ENSG00000114650	ENST00000339815;ENST00000360832;ENST00000265565;ENST00000441517;ENST00000545718	T;T;T	0.34275	1.66;2.33;1.37	5.2	5.2	0.72013	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.54367	0.1854	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;0.987	D;P	0.97110	1.0;0.659	T	0.44832	-0.9302	10	0.35671	T	0.21	-35.0093	18.531	0.90992	0.0:1.0:0.0:0.0	.	962;1218	F8W921;Q12770	.;SCAP_HUMAN	S	710;844;1218;962;825	ENSP00000265565:G1218S;ENSP00000416847:G962S;ENSP00000438956:G825S	ENSP00000265565:G1218S	G	-	1	0	SCAP	47430536	1.000000	0.71417	0.981000	0.43875	0.926000	0.56050	7.296000	0.78790	2.706000	0.92434	0.655000	0.94253	GGC	-	superfamily_WD40 repeat-like,HMMSmart_SM00320		0.587	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAP	protein_coding	OTTHUMT00000246872.2	C	NM_012235		47430536	-1	no_errors	NM_012235	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
CLCN5	1184	genome.wustl.edu	37	X	49854820	49854820	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrX:49854820C>A	ENST00000307367.2	+	10	1873	c.1582C>A	c.(1582-1584)Ctg>Atg	p.L528M	CLCN5_ENST00000376088.3_Missense_Mutation_p.L598M|CLCN5_ENST00000376108.3_Missense_Mutation_p.L528M|CLCN5_ENST00000376091.3_Missense_Mutation_p.L598M			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	528					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					AATGTTTGAACTGACTGGTGG	0.488																																																0			X											191.0	175.0	180.0					X																	49854820		2203	4300	6503	49741560	SO:0001583	missense	1184			X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1582C>A	X.37:g.49854820C>A	ENSP00000304257:p.Leu528Met	Somatic		Capture	Illumina GAIIx	4	49741560	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	superfamily_Clc chloride channel,HMMPfam_Voltage_CLC,superfamily_CBS-domain,HMMSmart_SM00116,HMMPfam_CBS	p.L528M	ENST00000307367.2	37	c.1582	CCDS14328.1	X	.	.	.	.	.	.	.	.	.	.	C	17.95	3.512821	0.64522	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.95069	-3.6;-3.6;-3.6;-3.6	5.79	4.04	0.47022	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.96352	0.8810	M	0.71920	2.185	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.85130	0.989;0.997	D	0.95526	0.8599	10	0.72032	D	0.01	-5.972	10.6713	0.45760	0.0:0.8397:0.0:0.1603	.	528;598	P51795;P51795-2	CLCN5_HUMAN;.	M	598;430;598;528;528	ENSP00000365256:L598M;ENSP00000365259:L598M;ENSP00000365276:L528M;ENSP00000304257:L528M	ENSP00000304257:L528M	L	+	1	2	CLCN5	49741560	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	4.004000	0.57068	0.612000	0.30071	0.600000	0.82982	CTG	-	superfamily_Clc chloride channel,HMMPfam_Voltage_CLC		0.488	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN5	protein_coding	OTTHUMT00000056544.1	C			49741560	+1	no_errors	NM_000084	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CSRNP2	81566	genome.wustl.edu	37	12	51470244	51470244	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr12:51470244C>G	ENST00000228515.1	-	2	398	c.101G>C	c.(100-102)aGt>aCt	p.S34T	CSRNP2_ENST00000550461.1_5'Flank	NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	34					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						GCTGTCAGCACTATCACTGCT	0.532																																																0			12											183.0	148.0	160.0					12																	51470244		2203	4300	6503	49756511	SO:0001583	missense	81566			AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.101G>C	12.37:g.51470244C>G	ENSP00000228515:p.Ser34Thr	Somatic		Capture	Illumina GAIIx	4	49756511		Missense_Mutation	SNP	NULL	p.S34T	ENST00000228515.1	37	c.101	CCDS8807.1	12	.	.	.	.	.	.	.	.	.	.	C	22.6	4.316973	0.81469	.	.	ENSG00000110925	ENST00000228515;ENST00000548981;ENST00000552899;ENST00000546935	T;T	0.16196	2.36;2.36	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.37812	0.1017	L	0.50993	1.605	0.58432	D	0.999999	D	0.67145	0.996	D	0.76071	0.987	T	0.01053	-1.1467	10	0.41790	T	0.15	-12.1291	18.5492	0.91057	0.0:1.0:0.0:0.0	.	34	Q9H175	CSRN2_HUMAN	T	34	ENSP00000228515:S34T;ENSP00000447657:S34T	ENSP00000228515:S34T	S	-	2	0	CSRNP2	49756511	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.449000	0.80643	2.760000	0.94817	0.478000	0.44815	AGT	-	NULL		0.532	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP2	protein_coding	OTTHUMT00000404893.1	C			49756511	-1	no_errors	NM_030809	genbank	human	provisional	54_36p	missense	SNP	1.000	G
KRT73	319101	genome.wustl.edu	37	12	53012144	53012144	+	Silent	SNP	C	C	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr12:53012144C>G	ENST00000305748.3	-	1	199	c.165G>C	c.(163-165)cgG>cgC	p.R55R		NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	55	Gly-rich.|Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		AAGAGATGCTCCGGGCACCCC	0.637																																																0			12											63.0	74.0	70.0					12																	53012144		2203	4300	6503	51298411	SO:0001819	synonymous_variant	319101			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.165G>C	12.37:g.53012144C>G		Somatic		Capture	Illumina GAIIx	4	51298411	Q32MB2	Silent	SNP	HMMPfam_Filament,PatternScan_IF	p.R55	ENST00000305748.3	37	c.165	CCDS8834.1	12																																																																																			-	NULL		0.637	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	protein_coding	OTTHUMT00000405700.1	C	NM_175068		51298411	-1	no_errors	NM_175068	genbank	human	provisional	54_36p	silent	SNP	0.931	G
ASAH2	56624	genome.wustl.edu	37	10	52002997	52002997	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr10:52002997C>T	ENST00000395526.4	-	3	474	c.475G>A	c.(475-477)Gac>Aac	p.D159N	ASAH2_ENST00000443575.1_5'Flank|ASAH2_ENST00000447815.1_Missense_Mutation_p.D159N|ASAH2_ENST00000329428.6_Missense_Mutation_p.D140N	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	159					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)			large_intestine(1)|lung(9)|urinary_tract(1)	11						ATGCCTATGTCGATGCTGACA	0.468																																																0			10											260.0	222.0	235.0					10																	52002997		2203	4300	6503	51673003	SO:0001583	missense	56624			AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.475G>A	10.37:g.52002997C>T	ENSP00000378897:p.Asp159Asn	Somatic		Capture	Illumina GAIIx	4	51673003	Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	HMMPfam_Ceramidase_alk	p.D140N	ENST00000395526.4	37	c.418	CCDS7239.2	10	.	.	.	.	.	.	.	.	.	.	C	35	5.456592	0.96223	.	.	ENSG00000188611	ENST00000395526;ENST00000447815;ENST00000329428	T;T;T	0.61627	0.09;0.09;0.09	5.82	5.82	0.92795	.	0.131088	0.64402	D	0.000018	T	0.79793	0.4507	H	0.95712	3.71	0.80722	D	1	P;P	0.47191	0.833;0.891	B;P	0.53006	0.33;0.715	D	0.85208	0.1019	10	0.72032	D	0.01	.	17.5905	0.87994	0.0:1.0:0.0:0.0	.	159;159	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	N	159;159;140	ENSP00000378897:D159N;ENSP00000388206:D159N;ENSP00000329886:D140N	ENSP00000329886:D140N	D	-	1	0	ASAH2	51673003	1.000000	0.71417	0.916000	0.36221	0.797000	0.45037	7.167000	0.77562	2.753000	0.94483	0.557000	0.71058	GAC	-	HMMPfam_Ceramidase_alk		0.468	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAH2	protein_coding	OTTHUMT00000048061.3	C	NM_019893		51673003	-1	no_errors	NM_019893	genbank	human	validated	54_36p	missense	SNP	0.999	T
CPT2	1376	genome.wustl.edu	37	1	53679044	53679044	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr1:53679044A>G	ENST00000371486.3	+	5	2269	c.1754A>G	c.(1753-1755)aAt>aGt	p.N585S	RP5-1024G6.2_ENST00000452466.1_RNA|C1orf123_ENST00000470385.1_5'Flank	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	585					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	ATAAACCACAATGTCCTGTCC	0.552																																																0			1											150.0	136.0	141.0					1																	53679044		2203	4300	6503	53451632	SO:0001583	missense	1376			BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.1754A>G	1.37:g.53679044A>G	ENSP00000360541:p.Asn585Ser	Somatic		Capture	Illumina GAIIx	4	53451632	B2R6S0|Q5SW68|Q9BQ26	Missense_Mutation	SNP	superfamily_CoA-dependent acyltransferases,HMMPfam_Carn_acyltransf,PatternScan_ACYLTRANSF_C_1,PatternScan_ACYLTRANSF_C_2	p.N585S	ENST00000371486.3	37	c.1754	CCDS575.1	1	.	.	.	.	.	.	.	.	.	.	A	15.99	2.994531	0.54041	.	.	ENSG00000157184	ENST00000371486	D	0.96491	-4.03	5.9	4.75	0.60458	.	0.000000	0.85682	D	0.000000	D	0.96411	0.8829	L	0.59436	1.845	0.58432	D	0.999998	P	0.51537	0.946	P	0.58013	0.831	D	0.94408	0.7629	10	0.22109	T	0.4	-17.3929	12.3613	0.55205	0.8735:0.0:0.0:0.1265	.	585	P23786	CPT2_HUMAN	S	585	ENSP00000360541:N585S	ENSP00000360541:N585S	N	+	2	0	CPT2	53451632	1.000000	0.71417	1.000000	0.80357	0.522000	0.34438	7.394000	0.79862	1.020000	0.39573	0.528000	0.53228	AAT	-	HMMPfam_Carn_acyltransf,superfamily_CoA-dependent acyltransferases		0.552	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT2	protein_coding	OTTHUMT00000024757.1	A	NM_000098		53451632	+1	no_errors	NM_000098	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PPP1R15A	23645	genome.wustl.edu	37	19	49377589	49377589	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr19:49377589G>C	ENST00000200453.5	+	2	1368	c.1099G>C	c.(1099-1101)Gat>Cat	p.D367H		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	367	4 X 34 AA approximate repeats.|Glu-rich.|Interaction with SMAD7.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		CTCTGGATCAGATGAGGAAGA	0.542																																																0			19											86.0	89.0	88.0					19																	49377589		2203	4300	6503	54069401	SO:0001583	missense	23645			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1099G>C	19.37:g.49377589G>C	ENSP00000200453:p.Asp367His	Somatic		Capture	Illumina GAIIx	4	54069401	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	HMMPfam_PP1c_bdg	p.D367H	ENST00000200453.5	37	c.1099	CCDS12738.1	19	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813821	0.32053	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.05786	3.39	4.77	0.181	0.15073	.	1.163930	0.06327	N	0.705531	T	0.05547	0.0146	L	0.36672	1.1	0.21355	N	0.999715	P	0.45078	0.85	B	0.37780	0.258	T	0.39187	-0.9626	10	0.52906	T	0.07	-1.0324	5.2294	0.15414	0.2627:0.1527:0.5846:0.0	.	367	O75807	PR15A_HUMAN	H	367;207;325	ENSP00000200453:D367H	ENSP00000200453:D367H	D	+	1	0	PPP1R15A	54069401	0.000000	0.05858	0.884000	0.34674	0.429000	0.31625	0.134000	0.15932	0.176000	0.19873	0.650000	0.86243	GAT	-	NULL		0.542	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15A	protein_coding	OTTHUMT00000466226.1	G	NM_014330		54069401	+1	no_errors	NM_014330	genbank	human	validated	54_36p	missense	SNP	0.022	C
PPP1R15A	23645	genome.wustl.edu	37	19	49377706	49377706	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr19:49377706G>T	ENST00000200453.5	+	2	1485	c.1216G>T	c.(1216-1218)Gat>Tat	p.D406Y		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	406	4 X 34 AA approximate repeats.|Glu-rich.|Interaction with SMAD7.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		TGAGGACAGTGATACAGGATC	0.542																																																0			19											139.0	132.0	134.0					19																	49377706		2203	4300	6503	54069518	SO:0001583	missense	23645			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1216G>T	19.37:g.49377706G>T	ENSP00000200453:p.Asp406Tyr	Somatic		Capture	Illumina GAIIx	4	54069518	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	HMMPfam_PP1c_bdg	p.D406Y	ENST00000200453.5	37	c.1216	CCDS12738.1	19	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879342	0.51801	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.08896	3.04	4.58	4.58	0.56647	.	0.471077	0.18679	N	0.134207	T	0.27967	0.0689	M	0.66297	2.02	0.53688	D	0.999977	D	0.89917	1.0	D	0.87578	0.998	T	0.00893	-1.1524	10	0.72032	D	0.01	-12.4488	15.7089	0.77609	0.0:0.0:1.0:0.0	.	406	O75807	PR15A_HUMAN	Y	406;246;364	ENSP00000200453:D406Y	ENSP00000200453:D406Y	D	+	1	0	PPP1R15A	54069518	0.467000	0.25831	0.125000	0.21846	0.270000	0.26580	2.422000	0.44696	2.480000	0.83734	0.650000	0.86243	GAT	-	NULL		0.542	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15A	protein_coding	OTTHUMT00000466226.1	G	NM_014330		54069518	+1	no_errors	NM_014330	genbank	human	validated	54_36p	missense	SNP	0.011	T
PPP1R15A	23645	genome.wustl.edu	37	19	49377957	49377957	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr19:49377957G>C	ENST00000200453.5	+	2	1736	c.1467G>C	c.(1465-1467)gaG>gaC	p.E489D		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	489	4 X 34 AA approximate repeats.|Glu-rich.|Interaction with KMT2A/MLL1.|Interaction with SMAD7.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		CTGGAAAAGAGACAGAGGAAG	0.607																																																0			19											80.0	76.0	78.0					19																	49377957		2203	4300	6503	54069769	SO:0001583	missense	23645			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1467G>C	19.37:g.49377957G>C	ENSP00000200453:p.Glu489Asp	Somatic		Capture	Illumina GAIIx	4	54069769	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	HMMPfam_PP1c_bdg	p.E489D	ENST00000200453.5	37	c.1467	CCDS12738.1	19	.	.	.	.	.	.	.	.	.	.	G	6.661	0.490547	0.12702	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.04970	3.52	4.13	-7.12	0.01537	.	0.692857	0.12343	N	0.477333	T	0.01800	0.0057	N	0.04880	-0.145	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.42068	-0.9473	10	0.11794	T	0.64	-0.9918	2.7003	0.05146	0.2672:0.4424:0.1526:0.1377	.	489	O75807	PR15A_HUMAN	D	489;329;447	ENSP00000200453:E489D	ENSP00000200453:E489D	E	+	3	2	PPP1R15A	54069769	0.000000	0.05858	0.002000	0.10522	0.046000	0.14306	-0.291000	0.08343	-1.389000	0.02090	-0.142000	0.14014	GAG	-	NULL		0.607	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15A	protein_coding	OTTHUMT00000466226.1	G	NM_014330		54069769	+1	no_errors	NM_014330	genbank	human	validated	54_36p	missense	SNP	0.000	C
PPP1R15A	23645	genome.wustl.edu	37	19	49378027	49378027	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr19:49378027G>C	ENST00000200453.5	+	2	1806	c.1537G>C	c.(1537-1539)Gta>Cta	p.V513L		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	513	Interaction with KMT2A/MLL1.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		GGCCATCTATGTACCTGGAGA	0.617																																																0			19											52.0	50.0	51.0					19																	49378027		2203	4300	6503	54069839	SO:0001583	missense	23645			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1537G>C	19.37:g.49378027G>C	ENSP00000200453:p.Val513Leu	Somatic		Capture	Illumina GAIIx	4	54069839	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	HMMPfam_PP1c_bdg	p.V513L	ENST00000200453.5	37	c.1537	CCDS12738.1	19	.	.	.	.	.	.	.	.	.	.	G	2.214	-0.379969	0.05000	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.03301	3.98	4.43	-8.8	0.00817	.	0.922975	0.08976	N	0.866568	T	0.01124	0.0037	N	0.01729	-0.75	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.44436	-0.9328	10	0.02654	T	1	-0.1277	10.5565	0.45121	0.0:0.5077:0.3453:0.147	.	513	O75807	PR15A_HUMAN	L	513;353;471	ENSP00000200453:V513L	ENSP00000200453:V513L	V	+	1	0	PPP1R15A	54069839	0.005000	0.15991	0.365000	0.25901	0.920000	0.55202	-1.602000	0.02079	-2.072000	0.00879	-1.036000	0.02392	GTA	-	NULL		0.617	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15A	protein_coding	OTTHUMT00000466226.1	G	NM_014330		54069839	+1	no_errors	NM_014330	genbank	human	validated	54_36p	missense	SNP	0.000	C
PPP1R15A	23645	genome.wustl.edu	37	19	49378910	49378910	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr19:49378910G>C	ENST00000200453.5	+	3	1974	c.1705G>C	c.(1705-1707)Gtc>Ctc	p.V569L		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	569	Interaction with SMARCB1.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		TTTCCTGGCTGTCTGGGCAGG	0.692																																																0			19											33.0	38.0	36.0					19																	49378910		2202	4295	6497	54070722	SO:0001583	missense	23645			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1705G>C	19.37:g.49378910G>C	ENSP00000200453:p.Val569Leu	Somatic		Capture	Illumina GAIIx	4	54070722	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	HMMPfam_PP1c_bdg	p.V569L	ENST00000200453.5	37	c.1705	CCDS12738.1	19	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782478	0.90282	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.23552	1.9	4.87	4.87	0.63330	Protein phosphatase 1, regulatory subunit 15A/B, C-terminal (1);	0.000000	0.56097	D	0.000024	T	0.51805	0.1696	M	0.79258	2.445	0.48830	D	0.999714	D	0.89917	1.0	D	0.85130	0.997	T	0.55496	-0.8132	10	0.87932	D	0	-28.0661	14.2284	0.65875	0.0:0.0:1.0:0.0	.	569	O75807	PR15A_HUMAN	L	569;409;527	ENSP00000200453:V569L	ENSP00000200453:V569L	V	+	1	0	PPP1R15A	54070722	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	4.723000	0.61965	2.629000	0.89072	0.591000	0.81541	GTC	-	HMMPfam_PP1c_bdg		0.692	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15A	protein_coding	OTTHUMT00000466226.1	G	NM_014330		54070722	+1	no_errors	NM_014330	genbank	human	validated	54_36p	missense	SNP	0.992	C
TRO	7216	genome.wustl.edu	37	X	54952108	54952108	+	Silent	SNP	A	A	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrX:54952108A>C	ENST00000173898.7	+	7	1681	c.1569A>C	c.(1567-1569)atA>atC	p.I523I	TRO_ENST00000319167.8_Silent_p.I523I|TRO_ENST00000375041.2_Silent_p.I126I|TRO_ENST00000399736.1_Silent_p.I126I|TRO_ENST00000375022.4_Silent_p.I523I|TRO_ENST00000420798.2_Silent_p.I54I|SNORA11_ENST00000408823.1_RNA	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	523	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CTGCAGGCATACTGGGAACGT	0.448																																																0			X											53.0	50.0	51.0					X																	54952108		2163	4255	6418	54968833	SO:0001819	synonymous_variant	7216			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1569A>C	X.37:g.54952108A>C		Somatic		Capture	Illumina GAIIx	4	54968833	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	HMMPfam_MAGE	p.I523	ENST00000173898.7	37	c.1569	CCDS43959.1	X																																																																																			-	HMMPfam_MAGE		0.448	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	protein_coding	OTTHUMT00000056837.3	A	NM_016157		54968833	+1	no_errors	NM_001039705	genbank	human	reviewed	54_36p	silent	SNP	0.999	C
MYO1A	4640	genome.wustl.edu	37	12	57436900	57436900	+	Missense_Mutation	SNP	G	G	A	rs145245907		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr12:57436900G>A	ENST00000442789.2	-	13	1341	c.1054C>T	c.(1054-1056)Cgc>Tgc	p.R352C	MYO1A_ENST00000300119.3_Missense_Mutation_p.R352C|MYO1A_ENST00000544473.1_Missense_Mutation_p.R190C	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	352	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						TCAAAGAGGCGGCTGTAGATG	0.557																																																0			12						G	CYS/ARG	0,4406		0,0,2203	105.0	94.0	98.0		1054	5.2	1.0	12	dbSNP_134	98	1,8599	1.2+/-3.3	0,1,4299	no	missense	MYO1A	NM_005379.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	352/1044	57436900	1,13005	2203	4300	6503	55723167	SO:0001583	missense	4640			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.1054C>T	12.37:g.57436900G>A	ENSP00000393392:p.Arg352Cys	Somatic		Capture	Illumina GAIIx	4	55723167	Q9UQD7	Missense_Mutation	SNP	HMMSmart_MYSc,superfamily_SSF52540,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_TH1	p.R352C	ENST00000442789.2	37	c.1054	CCDS8929.1	12	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111582	0.77210	0.0	1.16E-4	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473;ENST00000492945	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	5.17	5.17	0.71159	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.95063	0.8401	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95369	0.8462	10	0.87932	D	0	.	16.5838	0.84722	0.0:0.0:1.0:0.0	.	352	Q9UBC5	MYO1A_HUMAN	C	352;352;190;48	ENSP00000300119:R352C;ENSP00000393392:R352C;ENSP00000440514:R190C;ENSP00000452229:R48C	ENSP00000300119:R352C	R	-	1	0	MYO1A	55723167	1.000000	0.71417	1.000000	0.80357	0.325000	0.28411	6.458000	0.73509	2.861000	0.98227	0.655000	0.94253	CGC	-	HMMSmart_MYSc,superfamily_SSF52540,HMMPfam_Myosin_head		0.557	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1A	protein_coding	OTTHUMT00000313833.2	G	NM_005379		55723167	-1	no_errors	NM_005379	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CTDSP2	10106	genome.wustl.edu	37	12	58220830	58220830	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr12:58220830C>A	ENST00000398073.2	-	4	606	c.303G>T	c.(301-303)agG>agT	p.R101S	CTDSP2_ENST00000547701.1_5'UTR|CTDSP2_ENST00000548823.1_Intron|MIR26A2_ENST00000385054.1_RNA	NM_005730.3	NP_005721.3	O14595	CTDS2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2	101	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein dephosphorylation (GO:0006470)	nucleoplasm (GO:0005654)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_neural(12;0.00559)|Glioma(12;0.0143)|Melanoma(17;0.122)					CCACACAGATCCTTCCTTGAT	0.493																																																0			12											118.0	115.0	116.0					12																	58220830		1965	4151	6116	56507097	SO:0001583	missense	10106			AF000152	CCDS41801.1	12q14.1	2012-06-14			ENSG00000175215	ENSG00000175215		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	17077	protein-coding gene	gene with protein product	"""conserved gene amplified in osteosarcoma"", ""nuclear LIM interactor-interacting factor 2"", ""NLI-interacting factor 2"", ""small CTD phosphatase 2"""	608711				9315096, 12721286	Standard	XM_005268556		Approved	OS4, SCP2, PSR2	uc001sqm.3	O14595	OTTHUMG00000170483	ENST00000398073.2:c.303G>T	12.37:g.58220830C>A	ENSP00000381148:p.Arg101Ser	Somatic		Capture	Illumina GAIIx	4	56507097	A8K5H4|Q53ZR2|Q6NZY3|Q9UEX1	Missense_Mutation	SNP	superfamily_HAD-like,HMMPfam_NIF,HMMSmart_SM00577	p.R101S	ENST00000398073.2	37	c.303	CCDS41801.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.02|18.02	3.529179|3.529179	0.64860|0.64860	.|.	.|.	ENSG00000175215|ENSG00000175215	ENST00000550144|ENST00000398073	.|T	.|0.18016	.|2.24	4.92|4.92	4.02|4.02	0.46733|0.46733	.|NLI interacting factor (2);HAD-like domain (2);	.|0.046883	.|0.85682	.|D	.|0.000000	T|T	0.24431|0.24431	0.0592|0.0592	M|M	0.83223|0.83223	2.63|2.63	0.80722|0.80722	D|D	1|1	.|P	.|0.39601	.|0.68	.|B	.|0.39876	.|0.312	T|T	0.05566|0.05566	-1.0877|-1.0877	5|10	.|0.87932	.|D	.|0	-27.6026|-27.6026	8.4677|8.4677	0.32966|0.32966	0.0:0.8129:0.0:0.1871|0.0:0.8129:0.0:0.1871	.|.	.|101	.|O14595	.|CTDS2_HUMAN	Y|S	71|101	.|ENSP00000381148:R101S	.|ENSP00000381148:R101S	D|R	-|-	1|3	0|2	CTDSP2|CTDSP2	56507097|56507097	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.969000|1.969000	0.40510|0.40510	1.395000|1.395000	0.46643|0.46643	0.563000|0.563000	0.77884|0.77884	GAT|AGG	-	superfamily_HAD-like,HMMPfam_NIF,HMMSmart_SM00577		0.493	CTDSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSP2	protein_coding	OTTHUMT00000409353.1	C	NM_005730		56507097	-1	no_errors	NM_005730	genbank	human	validated	54_36p	missense	SNP	1.000	A
ACTBL2	345651	genome.wustl.edu	37	5	56777754	56777754	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr5:56777754C>G	ENST00000423391.1	-	1	882	c.781G>C	c.(781-783)Gcc>Ccc	p.A261P	CTD-2023N9.1_ENST00000506106.1_RNA|AC025470.1_ENST00000584598.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	261						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		TGGAAAATGGCTTCAGGGCAT	0.522																																																0			5											91.0	85.0	87.0					5																	56777754		2203	4300	6503	56813511	SO:0001583	missense	345651				CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.781G>C	5.37:g.56777754C>G	ENSP00000416706:p.Ala261Pro	Somatic		Capture	Illumina GAIIx	4	56813511	B2RPJ1|Q562R2|Q562S9|Q562X8	Missense_Mutation	SNP	superfamily_Actin-like ATPase domain,HMMPfam_Actin,HMMSmart_SM00268,PatternScan_ACTINS_1,PatternScan_ACTINS_ACT_LIKE,PatternScan_ACTINS_2	p.A261P	ENST00000423391.1	37	c.781	CCDS34163.1	5	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205992	0.39003	.	.	ENSG00000169067	ENST00000423391	D	0.94828	-3.53	4.91	3.0	0.34707	.	0.081933	0.46758	D	0.000266	D	0.95924	0.8673	M	0.69185	2.1	0.40357	D	0.979205	P	0.46578	0.88	P	0.62560	0.904	D	0.96151	0.9108	10	0.87932	D	0	.	11.7883	0.52055	0.333:0.667:0.0:0.0	.	261	Q562R1	ACTBL_HUMAN	P	261	ENSP00000416706:A261P	ENSP00000416706:A261P	A	-	1	0	ACTBL2	56813511	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.937000	0.28951	1.244000	0.43870	0.655000	0.94253	GCC	-	HMMPfam_Actin,HMMSmart_SM00268,superfamily_Actin-like ATPase domain		0.522	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTBL2	protein_coding	OTTHUMT00000368579.1	C	NM_001017992		56813511	-1	no_errors	NM_001017992	genbank	human	validated	54_36p	missense	SNP	1.000	G
SPIN3	169981	genome.wustl.edu	37	X	57020872	57020872	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrX:57020872G>A	ENST00000374919.3	-	2	831	c.509C>T	c.(508-510)cCt>cTt	p.P170L		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	170					gamete generation (GO:0007276)					central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						ATATAATACAGGATCTTTCTC	0.433																																																0			X											94.0	93.0	93.0					X																	57020872		2159	4247	6406	57037597	SO:0001583	missense	169981			AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.509C>T	X.37:g.57020872G>A	ENSP00000364054:p.Pro170Leu	Somatic		Capture	Illumina GAIIx	4	57037597	B2RUW3|B7Z8W2|Q8N5D9	Missense_Mutation	SNP	HMMPfam_Spin-Ssty	p.P170L	ENST00000374919.3	37	c.509	CCDS43963.1	X	.	.	.	.	.	.	.	.	.	.	G	16.38	3.105686	0.56291	.	.	ENSG00000204271	ENST00000374919	T	0.45276	0.9	2.72	1.38	0.22167	.	0.000000	0.64402	U	0.000013	T	0.58032	0.2094	M	0.77313	2.365	0.49483	D	0.999797	D	0.89917	1.0	D	0.77004	0.989	T	0.55655	-0.8107	10	0.59425	D	0.04	-4.5042	6.3869	0.21566	0.224:0.0:0.776:0.0	.	170	Q5JUX0	SPIN3_HUMAN	L	170	ENSP00000364054:P170L	ENSP00000364054:P170L	P	-	2	0	SPIN3	57037597	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	4.870000	0.63035	0.315000	0.23110	0.600000	0.82982	CCT	-	HMMPfam_Spin-Ssty		0.433	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN3	protein_coding	OTTHUMT00000056908.1	G	XM_093024		57037597	-1	no_errors	NM_001010862	genbank	human	validated	54_36p	missense	SNP	1.000	A
BRIP1	83990	genome.wustl.edu	37	17	59876618	59876618	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr17:59876618C>T	ENST00000259008.2	-	9	1450	c.1183G>A	c.(1183-1185)Gct>Act	p.A395T	BRIP1_ENST00000577598.1_Missense_Mutation_p.A395T	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	395	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						ATGTTATGAGCTTCATCTAAA	0.358			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																														yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	0			17											96.0	89.0	91.0					17																	59876618		2203	4300	6503	57231400	SO:0001583	missense	83990			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.1183G>A	17.37:g.59876618C>T	ENSP00000259008:p.Ala395Thr	Somatic		Capture	Illumina GAIIx	4	57231400	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00488,HMMSmart_SM00487,HMMPfam_DEAD_2,HMMSmart_SM00491	p.A395T	ENST00000259008.2	37	c.1183	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.402189	0.96030	.	.	ENSG00000136492	ENST00000259008	D	0.83250	-1.7	5.61	5.61	0.85477	DEAD-like helicase (1);DEAD2 (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.000000	0.85682	D	0.000000	D	0.94935	0.8362	H	0.98238	4.18	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96561	0.9415	9	.	.	.	-17.7862	18.6272	0.91344	0.0:1.0:0.0:0.0	.	395	Q9BX63	FANCJ_HUMAN	T	395	ENSP00000259008:A395T	.	A	-	1	0	BRIP1	57231400	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.010000	0.76353	2.652000	0.90054	0.460000	0.39030	GCT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00488,HMMSmart_SM00487,HMMPfam_DEAD_2		0.358	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	protein_coding	OTTHUMT00000445362.1	C	NM_032043		57231400	-1	no_errors	NM_032043	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TMPRSS11A	339967	genome.wustl.edu	37	4	68797727	68797727	+	Missense_Mutation	SNP	G	G	T	rs370242991		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr4:68797727G>T	ENST00000334830.7	-	4	1059	c.313C>A	c.(313-315)Caa>Aaa	p.Q105K	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000508048.1_Missense_Mutation_p.Q101K|TMPRSS11A_ENST00000396188.2_Missense_Mutation_p.Q102K			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	105	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						CTGACTACTTGGTTCTTGATA	0.358																																					NSCLC(26;2 894 10941 14480 22546)											0			4											148.0	144.0	145.0					4																	68797727		2203	4300	6503	68480322	SO:0001583	missense	339967			AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.313C>A	4.37:g.68797727G>T	ENSP00000334611:p.Gln105Lys	Somatic		Capture	Illumina GAIIx	4	68480322	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Missense_Mutation	SNP	superfamily_SEA domain,HMMPfam_SEA,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.Q105K	ENST00000334830.7	37	c.313	CCDS3519.1	4	.	.	.	.	.	.	.	.	.	.	G	9.333	1.061027	0.19987	.	.	ENSG00000187054	ENST00000508048;ENST00000334830;ENST00000396188;ENST00000513536	T;T;T;T	0.38887	1.11;1.11;1.11;1.11	6.08	5.24	0.73138	SEA (1);	1.193730	0.05995	N	0.646698	T	0.47600	0.1454	M	0.65975	2.015	0.22873	N	0.998626	B;B	0.30146	0.27;0.27	B;B	0.28232	0.087;0.087	T	0.44757	-0.9307	10	0.49607	T	0.09	.	12.8253	0.57716	0.0:0.0:0.8368:0.1632	.	102;105	B5MDI9;Q6ZMR5	.;TM11A_HUMAN	K	101;105;102;82	ENSP00000426911:Q101K;ENSP00000334611:Q105K;ENSP00000379491:Q102K;ENSP00000427621:Q82K	ENSP00000334611:Q105K	Q	-	1	0	TMPRSS11A	68480322	0.991000	0.36638	0.681000	0.30009	0.164000	0.22412	1.595000	0.36708	1.565000	0.49641	0.655000	0.94253	CAA	-	superfamily_SEA domain,HMMPfam_SEA		0.358	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS11A	protein_coding	OTTHUMT00000251433.3	G	NM_182606		68480322	-1	no_errors	NM_182606	genbank	human	validated	54_36p	missense	SNP	0.540	T
ZSWIM8	23053	genome.wustl.edu	37	10	75557657	75557657	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr10:75557657A>T	ENST00000605216.1	+	19	3983	c.3766A>T	c.(3766-3768)Agc>Tgc	p.S1256C	ZSWIM8_ENST00000398706.2_Missense_Mutation_p.S1261C|ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.S1223C|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.S1256C|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.S1261C	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1256							zinc ion binding (GO:0008270)										AGGGGGCAACAGCAGCACTTC	0.567																																																0			10											112.0	123.0	119.0					10																	75557657		2115	4221	6336	75227663	SO:0001583	missense	23053			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.3766A>T	10.37:g.75557657A>T	ENSP00000474748:p.Ser1256Cys	Somatic		Capture	Illumina GAIIx	4	75227663	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	HMMPfam_SWIM	p.S1261C	ENST00000605216.1	37	c.3781		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.40|18.40	3.616059|3.616059	0.66672|0.66672	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000433366|ENST00000398706	.|T	.|0.53857	.|0.6	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.305311	.|0.30890	.|U	.|0.008666	T|T	0.73505|0.73505	0.3595|0.3595	M|M	0.79123|0.79123	2.44|2.44	0.49130|0.49130	D|D	0.999758|0.999758	.|D;D;D;D	.|0.76494	.|0.999;0.999;0.999;0.999	.|D;D;D;D	.|0.81914	.|0.993;0.995;0.995;0.993	T|T	0.77330|0.77330	-0.2628|-0.2628	5|10	.|0.87932	.|D	.|0	-6.3461|-6.3461	16.0343|16.0343	0.80612|0.80612	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1256;1268;1256;1261	.|A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4	.|K0913_HUMAN;.;.;.	L|C	971|1261	.|ENSP00000381693:S1261C	.|ENSP00000381693:S1261C	Q|S	+|+	2|1	0|0	KIAA0913|KIAA0913	75227663|75227663	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.671000|6.671000	0.74472|0.74472	2.198000|2.198000	0.70561|0.70561	0.533000|0.533000	0.62120|0.62120	CAG|AGC	-	NULL		0.567	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	protein_coding	OTTHUMT00000468545.1	A	NM_001242487		75227663	+1	no_errors	NM_015037	genbank	human	validated	54_36p	missense	SNP	1.000	T
ACSBG1	23205	genome.wustl.edu	37	15	78471002	78471002	+	Silent	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr15:78471002G>A	ENST00000258873.4	-	11	1861	c.1656C>T	c.(1654-1656)ggC>ggT	p.G552G	ACSBG1_ENST00000560817.1_Silent_p.G310G|ACSBG1_ENST00000541759.1_Silent_p.G310G	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	552					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CGTCCAGGCGGCCAGCATCAC	0.617																																																0			15											89.0	60.0	70.0					15																	78471002		2196	4293	6489	76258057	SO:0001819	synonymous_variant	23205			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.1656C>T	15.37:g.78471002G>A		Somatic		Capture	Illumina GAIIx	4	76258057	B2RB61|O75126|Q76N27|Q9HC26	Silent	SNP	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding,PatternScan_AMP_BINDING	p.G552	ENST00000258873.4	37	c.1656	CCDS10298.1	15																																																																																			-	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding		0.617	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	protein_coding	OTTHUMT00000289802.2	G	NM_015162		76258057	-1	no_errors	NM_015162	genbank	human	reviewed	54_36p	silent	SNP	0.995	A
VASH1	22846	genome.wustl.edu	37	14	77237567	77237567	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr14:77237567A>G	ENST00000167106.4	+	3	1066	c.433A>G	c.(433-435)Aag>Gag	p.K145E	VASH1_ENST00000554237.1_Missense_Mutation_p.K145E|VASH1_ENST00000556038.1_3'UTR	NM_014909.4	NP_055724.1	Q7L8A9	VASH1_HUMAN	vasohibin 1	145					angiogenesis (GO:0001525)|cell cycle arrest (GO:0007050)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of lymphangiogenesis (GO:1901491)|regulation of cellular senescence (GO:2000772)|response to wounding (GO:0009611)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|urinary_tract(3)	10			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)		CTTTGAAATTAAGAAGAGCAG	0.537																																																0			14											111.0	99.0	103.0					14																	77237567		2203	4300	6503	76307320	SO:0001583	missense	22846			AB028959	CCDS9851.1	14q24.3	2006-09-25	2005-08-16	2005-08-16		ENSG00000071246			19964	protein-coding gene	gene with protein product		609011	"""KIAA1036"""	KIAA1036			Standard	NM_014909		Approved		uc001xst.2	Q7L8A9		ENST00000167106.4:c.433A>G	14.37:g.77237567A>G	ENSP00000167106:p.Lys145Glu	Somatic		Capture	Illumina GAIIx	4	76307320	Q96H02|Q9UBF4|Q9Y629	Missense_Mutation	SNP	NULL	p.K145E	ENST00000167106.4	37	c.433	CCDS9851.1	14	.	.	.	.	.	.	.	.	.	.	A	27.4	4.827277	0.90955	.	.	ENSG00000071246	ENST00000167106;ENST00000554237	.	.	.	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.67552	0.2905	L	0.48362	1.52	0.80722	D	1	D;D	0.69078	0.965;0.997	P;D	0.64042	0.78;0.921	T	0.71174	-0.4670	9	0.72032	D	0.01	-11.4317	14.1988	0.65688	1.0:0.0:0.0:0.0	.	145;145	Q7L8A9;Q7L8A9-2	VASH1_HUMAN;.	E	145	.	ENSP00000167106:K145E	K	+	1	0	VASH1	76307320	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	1.765000	0.52091	0.459000	0.35465	AAG	-	NULL		0.537	VASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH1	protein_coding	OTTHUMT00000413706.1	A	NM_014909		76307320	+1	no_errors	NM_014909	genbank	human	validated	54_36p	missense	SNP	1.000	G
LPAR4	2846	genome.wustl.edu	37	X	78010926	78010926	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrX:78010926C>A	ENST00000435339.3	+	2	946	c.560C>A	c.(559-561)aCc>aAc	p.T187N		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	187					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						GCAACCACCACCTGCTTTGAA	0.408																																																0			X											94.0	79.0	84.0					X																	78010926		2203	4298	6501	77897582	SO:0001583	missense	2846			U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.560C>A	X.37:g.78010926C>A	ENSP00000408205:p.Thr187Asn	Somatic		Capture	Illumina GAIIx	4	77897582	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T187N	ENST00000435339.3	37	c.560	CCDS14441.1	X	.	.	.	.	.	.	.	.	.	.	C	10.49	1.365383	0.24684	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.37915	1.17;1.17	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.059443	0.64402	D	0.000004	T	0.40815	0.1132	M	0.71036	2.16	0.53688	D	0.999971	B	0.29232	0.238	B	0.31495	0.131	T	0.46133	-0.9213	10	0.56958	D	0.05	.	14.3788	0.66897	0.0:1.0:0.0:0.0	.	187	Q99677	LPAR4_HUMAN	N	187	ENSP00000408205:T187N;ENSP00000362398:T187N	ENSP00000362398:T187N	T	+	2	0	LPAR4	77897582	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	4.296000	0.59055	1.938000	0.56188	0.415000	0.27848	ACC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.408	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR4	protein_coding	OTTHUMT00000057322.2	C	NM_005296		77897582	+1	no_errors	NM_005296	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ROBO1	6091	genome.wustl.edu	37	3	78676638	78676638	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr3:78676638T>G	ENST00000464233.1	-	26	3821	c.3708A>C	c.(3706-3708)gaA>gaC	p.E1236D	ROBO1_ENST00000467549.1_Missense_Mutation_p.E1136D|ROBO1_ENST00000495273.1_Missense_Mutation_p.E1191D|ROBO1_ENST00000436010.2_Missense_Mutation_p.E1197D	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1236					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.E1236E(1)|p.E1213E(1)|p.E1191E(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TGGGGCCTCGTTCATCTTCCT	0.512																																																3	Substitution - coding silent(3)	large_intestine(3)	3											77.0	93.0	87.0					3																	78676638		2075	4210	6285	78759328	SO:0001583	missense	6091			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3708A>C	3.37:g.78676638T>G	ENSP00000420321:p.Glu1236Asp	Somatic		Capture	Illumina GAIIx	4	78759328	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.E1236D	ENST00000464233.1	37	c.3708	CCDS54611.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.47|16.47	3.132918|3.132918	0.56828|0.56828	.|.	.|.	ENSG00000169855|ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414|ENST00000472273	T;T;T;T|.	0.64085|.	0.02;-0.0;0.01;-0.08|.	5.29|5.29	1.57|1.57	0.23409|0.23409	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51618|0.51618	0.1685|0.1685	L|L	0.39245|0.39245	1.2|1.2	0.42882|0.42882	D|D	0.994171|0.994171	D;B;D;D;D|.	0.71674|.	0.99;0.11;0.998;0.988;0.97|.	D;B;D;P;P|.	0.74674|.	0.98;0.068;0.984;0.621;0.839|.	T|T	0.35724|0.35724	-0.9777|-0.9777	9|5	.|.	.|.	.|.	.|.	9.2082|9.2082	0.37302|0.37302	0.0:0.308:0.0:0.692|0.0:0.308:0.0:0.692	.|.	1200;1236;1191;1136;1197|.	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4|.	.;ROBO1_HUMAN;.;.;.|.	D|T	1197;1191;1236;1191;1136;1240|163	ENSP00000406043:E1197D;ENSP00000420321:E1236D;ENSP00000420637:E1191D;ENSP00000417992:E1136D|.	.|.	E|N	-|-	3|2	2|0	ROBO1|ROBO1	78759328|78759328	0.996000|0.996000	0.38824|0.38824	0.997000|0.997000	0.53966|0.53966	0.924000|0.924000	0.55760|0.55760	0.833000|0.833000	0.27504|0.27504	0.091000|0.091000	0.17302|0.17302	0.459000|0.459000	0.35465|0.35465	GAA|AAC	-	NULL		0.512	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	protein_coding	OTTHUMT00000352610.1	T	NM_002941		78759328	-1	no_errors	NM_002941	genbank	human	reviewed	54_36p	missense	SNP	0.908	G
BTBD1	53339	genome.wustl.edu	37	15	83718867	83718867	+	Missense_Mutation	SNP	T	T	C	rs115033616	byFrequency	TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr15:83718867T>C	ENST00000261721.4	-	3	824	c.622A>G	c.(622-624)Atg>Gtg	p.M208V	RP11-382A20.5_ENST00000566841.1_RNA|RP11-382A20.6_ENST00000568441.1_RNA|BTBD1_ENST00000379403.2_Missense_Mutation_p.M208V|RP11-382A20.7_ENST00000570202.1_RNA	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	208					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		ATTGCATCCATTGTGCTTTTG	0.323													T|||	5	0.000998403	0.0	0.0014	5008	,	,		17585	0.0		0.004	False		,,,				2504	0.0															0			15						T	VAL/MET,VAL/MET	1,4405	2.1+/-5.4	0,1,2202	124.0	116.0	119.0		622,622	-0.9	0.3	15	dbSNP_132	119	21,8579	14.6+/-50.1	0,21,4279	yes	missense,missense	BTBD1	NM_001011885.1,NM_025238.3	21,21	0,22,6481	CC,CT,TT		0.2442,0.0227,0.1692	benign,benign	208/386,208/483	83718867	22,12984	2203	4300	6503	81509871	SO:0001583	missense	53339			AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.622A>G	15.37:g.83718867T>C	ENSP00000261721:p.Met208Val	Somatic		Capture	Illumina GAIIx	4	81509871	A6NMI8|Q9BX71|Q9NWN4	Missense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB,HMMPfam_BACK,HMMPfam_PHR	p.M208V	ENST00000261721.4	37	c.622	CCDS10322.1	15	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	T	11.82	1.751756	0.31046	2.27E-4	0.002442	ENSG00000064726	ENST00000261721;ENST00000379403	T;T	0.67865	-0.29;-0.29	5.51	-0.916	0.10489	BTB/Kelch-associated (2);	0.321368	0.40554	N	0.001065	T	0.36468	0.0968	N	0.02802	-0.49	0.25196	N	0.990096	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.22347	-1.0219	10	0.33141	T	0.24	-7.6133	10.4737	0.44652	0.0:0.4494:0.0:0.5506	.	208;208	A6NMI8;Q9H0C5	.;BTBD1_HUMAN	V	208	ENSP00000261721:M208V;ENSP00000368713:M208V	ENSP00000261721:M208V	M	-	1	0	BTBD1	81509871	0.264000	0.24093	0.269000	0.24586	0.998000	0.95712	0.712000	0.25779	-0.333000	0.08476	0.533000	0.62120	ATG	-	HMMPfam_BACK		0.323	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD1	protein_coding	OTTHUMT00000304008.1	T			81509871	-1	no_errors	NM_025238	genbank	human	reviewed	54_36p	missense	SNP	0.952	C
ABCA4	24	genome.wustl.edu	37	1	94487457	94487457	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr1:94487457C>T	ENST00000370225.3	-	33	4804	c.4718G>A	c.(4717-4719)gGg>gAg	p.G1573E		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1573					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AAGTGCTTCCCCCGTGATGGG	0.498																																																0			1											69.0	71.0	70.0					1																	94487457		2203	4300	6503	94260045	SO:0001583	missense	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.4718G>A	1.37:g.94487457C>T	ENSP00000359245:p.Gly1573Glu	Somatic		Capture	Illumina GAIIx	4	94260045	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.G1573E	ENST00000370225.3	37	c.4718	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	C	9.406	1.079315	0.20227	.	.	ENSG00000198691	ENST00000546054;ENST00000370225	D	0.90133	-2.62	6.16	4.23	0.50019	.	0.239347	0.43260	D	0.000588	D	0.84561	0.5499	M	0.63843	1.955	0.80722	D	1	B	0.15930	0.015	B	0.12837	0.008	T	0.80006	-0.1563	10	0.46703	T	0.11	.	16.8057	0.85626	0.0:0.7569:0.2431:0.0	.	1573	P78363	ABCA4_HUMAN	E	365;1573	ENSP00000359245:G1573E	ENSP00000359245:G1573E	G	-	2	0	ABCA4	94260045	0.007000	0.16637	0.677000	0.29947	0.017000	0.09413	0.435000	0.21510	0.861000	0.35504	0.650000	0.86243	GGG	-	NULL		0.498	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	C	NM_000350		94260045	-1	no_errors	NM_000350	genbank	human	reviewed	54_36p	missense	SNP	0.112	T
RPL30	6156	genome.wustl.edu	37	8	99057245	99057245	+	Nonsense_Mutation	SNP	G	G	C			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr8:99057245G>C	ENST00000521291.1	-	2	239	c.93C>G	c.(91-93)taC>taG	p.Y31*	RPL30_ENST00000518164.1_5'UTR|SNORA72_ENST00000384339.1_RNA|RPL30_ENST00000287038.3_Nonsense_Mutation_p.Y31*|RPL30_ENST00000396070.2_Nonsense_Mutation_p.Y31*|KB-1208A12.3_ENST00000501016.2_RNA|RPL30_ENST00000523172.1_Intron			P62888	RL30_HUMAN	ribosomal protein L30	31					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(2)|lung(4)|skin(1)	7	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.192)			GAGTCTGCTTGTACCCCAGGA	0.458																																																0			8											171.0	156.0	161.0					8																	99057245		2203	4300	6503	99126421	SO:0001587	stop_gained	6156				CCDS34928.1	8q22	2013-05-09			ENSG00000156482	ENSG00000156482		"""L ribosomal proteins"""	10333	protein-coding gene	gene with protein product		180467				1577483	Standard	NM_000989		Approved	L30	uc003yif.3	P62888	OTTHUMG00000164796	ENST00000521291.1:c.93C>G	8.37:g.99057245G>C	ENSP00000428085:p.Tyr31*	Somatic		Capture	Illumina GAIIx	4	99126421	B2R591|P04645|Q502Z6	Nonsense_Mutation	SNP	superfamily_L30e-like,HMMPfam_Ribosomal_L7Ae,PatternScan_RIBOSOMAL_L30E_1,PatternScan_RIBOSOMAL_L30E_2	p.Y31*	ENST00000521291.1	37	c.93	CCDS34928.1	8	.	.	.	.	.	.	.	.	.	.	G	37	6.296308	0.97453	.	.	ENSG00000156482	ENST00000521291;ENST00000396070;ENST00000287038;ENST00000521726	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.4214	16.9749	0.86310	0.0:0.0:1.0:0.0	.	.	.	.	X	31	.	ENSP00000287038:Y31X	Y	-	3	2	RPL30	99126421	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.420000	0.73349	2.440000	0.82611	0.655000	0.94253	TAC	-	superfamily_L30e-like,HMMPfam_Ribosomal_L7Ae,PatternScan_RIBOSOMAL_L30E_1		0.458	RPL30-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL30	protein_coding	OTTHUMT00000380450.1	G			99126421	-1	no_errors	NM_000989	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	C
DYNC1H1	1778	genome.wustl.edu	37	14	102493590	102493590	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr14:102493590G>A	ENST00000360184.4	+	45	9015	c.8851G>A	c.(8851-8853)Gcc>Acc	p.A2951T		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2951	AAA 4. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TCGTTTCGTCGCCTGGATGAA	0.488																																																0			14											296.0	252.0	267.0					14																	102493590		2203	4300	6503	101563343	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8851G>A	14.37:g.102493590G>A	ENSP00000348965:p.Ala2951Thr	Somatic		Capture	Illumina GAIIx	4	101563343	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.A2951T	ENST00000360184.4	37	c.8851	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.956091	0.97145	.	.	ENSG00000197102	ENST00000360184	T	0.60548	0.18	5.81	5.81	0.92471	Dynein heavy chain, P-loop containing D4 domain (1);ATPase, AAA+ type, core (1);	0.051204	0.85682	D	0.000000	T	0.78084	0.4228	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.67382	0.951	T	0.78785	-0.2068	10	0.56958	D	0.05	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	2951	Q14204	DYHC1_HUMAN	T	2951	ENSP00000348965:A2951T	ENSP00000348965:A2951T	A	+	1	0	DYNC1H1	101563343	1.000000	0.71417	0.986000	0.45419	0.936000	0.57629	9.531000	0.98054	2.736000	0.93811	0.655000	0.94253	GCC	-	superfamily_SSF52540,HMMSmart_AAA		0.488	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	G	NM_001376		101563343	+1	no_errors	NM_001376	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
POLR3B	55703	genome.wustl.edu	37	12	106895134	106895134	+	Silent	SNP	C	C	T	rs373346251		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr12:106895134C>T	ENST00000228347.4	+	26	3240	c.3018C>T	c.(3016-3018)ccC>ccT	p.P1006P	POLR3B_ENST00000539066.1_Silent_p.P948P|RP11-144F15.1_ENST00000551505.1_Intron	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	1006					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						ATTTTGGCCCCGTGTACTATC	0.463																																																0			12						C	,	0,4406		0,0,2203	72.0	75.0	74.0		2844,3018	-10.5	0.4	12		74	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	POLR3B	NM_001160708.1,NM_018082.5	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	948/1076,1006/1134	106895134	1,13005	2203	4300	6503	105419264	SO:0001819	synonymous_variant	55703			AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.3018C>T	12.37:g.106895134C>T		Somatic		Capture	Illumina GAIIx	4	105419264	A8K6H0|B3KV73|F5H1E6|Q9NW59	Silent	SNP	superfamily_beta and beta-prime subunits of DNA dependent RNA-polymerase,HMMPfam_RNA_pol_Rpb2_1,HMMPfam_RNA_pol_Rpb2_2,HMMPfam_RNA_pol_Rpb2_3,HMMPfam_RNA_pol_Rpb2_4,HMMPfam_RNA_pol_Rpb2_5,HMMPfam_RNA_pol_Rpb2_6,PatternScan_RNA_POL_BETA,HMMPfam_RNA_pol_Rpb2_7	p.P1006	ENST00000228347.4	37	c.3018	CCDS9105.1	12																																																																																			-	superfamily_beta and beta-prime subunits of DNA dependent RNA-polymerase,HMMPfam_RNA_pol_Rpb2_6		0.463	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3B	protein_coding	OTTHUMT00000407166.1	C	NM_018082		105419264	+1	no_errors	NM_018082	genbank	human	provisional	54_36p	silent	SNP	0.156	T
PKHD1L1	93035	genome.wustl.edu	37	8	110476896	110476896	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr8:110476896T>A	ENST00000378402.5	+	49	7939	c.7835T>A	c.(7834-7836)tTt>tAt	p.F2612Y		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2612					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GGCGAATTTTTTAACAATACT	0.443										HNSCC(38;0.096)																																						0			8											107.0	107.0	107.0					8																	110476896		1860	4103	5963	110546072	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.7835T>A	8.37:g.110476896T>A	ENSP00000367655:p.Phe2612Tyr	Somatic		Capture	Illumina GAIIx	4	110546072	Q567P2|Q9UF27	Missense_Mutation	SNP	superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG,HMMSmart_SM00758,superfamily_Anthrax protective antigen,HMMSmart_SM00710,superfamily_Cupredoxins,HMMPfam_G8,superfamily_Pectin lyase-like	p.F2612Y	ENST00000378402.5	37	c.7835	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	T	7.072	0.568498	0.13560	.	.	ENSG00000205038	ENST00000378402	T	0.80214	-1.35	5.79	3.23	0.37069	Pectin lyase fold/virulence factor (1);	0.272597	0.35772	N	0.003000	T	0.46502	0.1396	N	0.00894	-1.105	0.24812	N	0.992634	B	0.02656	0.0	B	0.04013	0.001	T	0.44544	-0.9321	10	0.02654	T	1	.	8.6196	0.33853	0.4247:0.0:0.0:0.5753	.	2612	Q86WI1	PKHL1_HUMAN	Y	2612	ENSP00000367655:F2612Y	ENSP00000367655:F2612Y	F	+	2	0	PKHD1L1	110546072	0.997000	0.39634	1.000000	0.80357	0.975000	0.68041	0.231000	0.17872	0.976000	0.38417	0.533000	0.62120	TTT	-	NULL		0.443	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	protein_coding	OTTHUMT00000381017.1	T	NM_177531		110546072	+1	no_errors	NM_177531	genbank	human	validated	54_36p	missense	SNP	0.998	A
KCND3	3752	genome.wustl.edu	37	1	112525240	112525240	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr1:112525240G>A	ENST00000315987.2	-	2	588	c.109C>T	c.(109-111)Cgg>Tgg	p.R37W	KCND3_ENST00000302127.4_Missense_Mutation_p.R37W|KCND3_ENST00000369697.1_Missense_Mutation_p.R37W	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	37					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TCATCCTGCCGCTTGTTCTTG	0.682																																																0			1											45.0	45.0	45.0					1																	112525240		2203	4300	6503	112326763	SO:0001583	missense	3752			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.109C>T	1.37:g.112525240G>A	ENSP00000319591:p.Arg37Trp	Somatic		Capture	Illumina GAIIx	4	112326763	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_K_tetra,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.R37W	ENST00000315987.2	37	c.109	CCDS843.1	1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.813787	0.50527	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.97066	-4.23;-4.23;-4.23	5.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	D	0.95909	0.8668	M	0.66939	2.045	0.58432	D	0.999995	P;D	0.55172	0.939;0.97	P;P	0.47528	0.549;0.549	D	0.96149	0.9106	10	0.72032	D	0.01	.	14.9326	0.70929	0.0:0.0:0.786:0.214	.	37;37	Q14D71;Q9UK17	.;KCND3_HUMAN	W	37	ENSP00000358711:R37W;ENSP00000319591:R37W;ENSP00000306923:R37W	ENSP00000306923:R37W	R	-	1	2	KCND3	112326763	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.597000	0.36729	2.542000	0.85734	0.561000	0.74099	CGG	-	NULL		0.682	KCND3-001	KNOWN	basic|CCDS	protein_coding	KCND3	protein_coding	OTTHUMT00000033144.1	G	NM_172198		112326763	-1	no_errors	NM_004980	genbank	human	reviewed	54_36p	missense	SNP	0.995	A
ATRNL1	26033	genome.wustl.edu	37	10	117026367	117026367	+	Silent	SNP	A	A	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr10:117026367A>G	ENST00000355044.3	+	12	1992	c.1866A>G	c.(1864-1866)gaA>gaG	p.E622E		NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	622	PSI 1.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GAGATGAAGAACTTTGTAAAA	0.343																																																0			10											97.0	108.0	104.0					10																	117026367		2203	4300	6503	117016357	SO:0001819	synonymous_variant	26033			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.1866A>G	10.37:g.117026367A>G		Somatic		Capture	Illumina GAIIx	4	117016357	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,HMMPfam_EGF_2,superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMPfam_Kelch_2,superfamily_Plexin repeat,HMMSmart_SM00423,HMMPfam_PSI,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,HMMPfam_Laminin_EGF,HMMSmart_SM00180,PatternScan_EGF_LAM_1	p.E622	ENST00000355044.3	37	c.1866	CCDS7592.1	10																																																																																			-	superfamily_Plexin repeat,HMMSmart_SM00423		0.343	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	protein_coding	OTTHUMT00000050507.3	A	XM_049349		117016357	+1	no_errors	NM_207303	genbank	human	validated	54_36p	silent	SNP	0.282	G
DOCK11	139818	genome.wustl.edu	37	X	117702117	117702117	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrX:117702117G>A	ENST00000276202.7	+	10	1090	c.1027G>A	c.(1027-1029)Gaa>Aaa	p.E343K	DOCK11_ENST00000276204.6_Missense_Mutation_p.E343K|Y_RNA_ENST00000384135.1_RNA	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	343					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TTTTGATTCAGAAGTTCAGGT	0.284																																																0			X											70.0	69.0	69.0					X																	117702117		2200	4290	6490	117586145	SO:0001583	missense	139818			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.1027G>A	X.37:g.117702117G>A	ENSP00000276202:p.Glu343Lys	Somatic		Capture	Illumina GAIIx	4	117586145	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMPfam_Ded_cyto	p.E343K	ENST00000276202.7	37	c.1027	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	17.28	3.350237	0.61183	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.03358	3.96;3.96	5.23	5.23	0.72850	.	0.113273	0.64402	D	0.000017	T	0.05273	0.0140	L	0.43923	1.385	0.54753	D	0.999982	B;B	0.29936	0.262;0.262	B;B	0.28991	0.097;0.097	T	0.36744	-0.9735	10	0.52906	T	0.07	-9.1428	14.5464	0.68032	0.0:0.0:1.0:0.0	.	343;343	A6NIW2;Q5JSL3	.;DOC11_HUMAN	K	343	ENSP00000276204:E343K;ENSP00000276202:E343K	ENSP00000276202:E343K	E	+	1	0	DOCK11	117586145	1.000000	0.71417	0.924000	0.36721	0.955000	0.61496	7.694000	0.84235	2.178000	0.69098	0.544000	0.68410	GAA	-	NULL		0.284	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	protein_coding	OTTHUMT00000356002.1	G	NM_144658		117586145	+1	no_errors	NM_144658	genbank	human	validated	54_36p	missense	SNP	0.989	A
RNF148	378925	genome.wustl.edu	37	7	122342021	122342021	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr7:122342021A>T	ENST00000434824.1	-	1	1000	c.784T>A	c.(784-786)Ttt>Att	p.F262I	CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000313070.7_Intron|RNF148_ENST00000447240.1_3'UTR|CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000412584.2_Intron|RNF133_ENST00000340112.2_5'Flank	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	262						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						TATGTGTCAAAGCAAACAACA	0.408																																																0			7											135.0	126.0	128.0					7																	122342021		1906	4131	6037	122129257	SO:0001583	missense	378925			BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.784T>A	7.37:g.122342021A>T	ENSP00000388207:p.Phe262Ile	Somatic		Capture	Illumina GAIIx	4	122129257	A4D0X4|Q8N308	Missense_Mutation	SNP	superfamily_SSF52025,HMMPfam_PA,superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4	p.F262I	ENST00000434824.1	37	c.784	CCDS47692.1	7	.	.	.	.	.	.	.	.	.	.	A	3.420	-0.118432	0.06838	.	.	ENSG00000235631	ENST00000434824	T	0.42131	0.98	5.51	5.51	0.81932	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	.	.	.	.	T	0.27098	0.0664	N	0.13098	0.295	0.80722	D	1	B	0.16166	0.016	B	0.31101	0.124	T	0.12426	-1.0548	9	0.12766	T	0.61	.	10.7781	0.46361	0.924:0.0:0.076:0.0	.	262	Q8N7C7	RN148_HUMAN	I	262	ENSP00000388207:F262I	ENSP00000388207:F262I	F	-	1	0	RNF148	122129257	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.109000	0.41863	2.086000	0.62901	0.533000	0.62120	TTT	-	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4		0.408	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF148	protein_coding	OTTHUMT00000347424.1	A	NM_198085		122129257	-1	no_errors	NM_198085	genbank	human	validated	54_36p	missense	SNP	1.000	T
GSN	2934	genome.wustl.edu	37	9	124073039	124073039	+	Silent	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr9:124073039G>A	ENST00000373818.4	+	4	651	c.582G>A	c.(580-582)ggG>ggA	p.G194G	GSN_ENST00000449733.1_Silent_p.G143G|GSN_ENST00000485767.1_3'UTR|GSN_ENST00000373823.3_Silent_p.G143G|GSN_ENST00000436847.1_Silent_p.G154G|GSN_ENST00000545652.1_Silent_p.G151G|GSN_ENST00000394353.2_Silent_p.G154G|GSN_ENST00000412819.1_Silent_p.G143G|GSN_ENST00000373807.1_5'Flank|GSN_ENST00000341272.2_Silent_p.G143G|GSN_ENST00000373808.2_Silent_p.G143G	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	194	Polyphosphoinositide binding. {ECO:0000250}.				actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						AGGTCAAAGGGCGGCGTGTGG	0.582																																																0			9											208.0	147.0	167.0					9																	124073039		2203	4300	6503	123112860	SO:0001819	synonymous_variant	2934			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.582G>A	9.37:g.124073039G>A		Somatic		Capture	Illumina GAIIx	4	123112860	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Silent	SNP	superfamily_Actin depolymerizing proteins,HMMSmart_SM00262,HMMPfam_Gelsolin	p.G194	ENST00000373818.4	37	c.582	CCDS6828.1	9																																																																																			-	superfamily_Actin depolymerizing proteins,HMMSmart_SM00262		0.582	GSN-001	KNOWN	basic|CCDS	protein_coding	GSN	protein_coding	OTTHUMT00000053861.1	G	NM_000177		123112860	+1	no_errors	NM_000177	genbank	human	reviewed	54_36p	silent	SNP	0.998	A
GRM8	2918	genome.wustl.edu	37	7	126746621	126746621	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr7:126746621G>A	ENST00000339582.2	-	3	1464	c.656C>T	c.(655-657)tCg>tTg	p.S219L	GRM8_ENST00000405249.1_Missense_Mutation_p.S219L|GRM8_ENST00000444921.2_Missense_Mutation_p.S219L|GRM8_ENST00000358373.3_Missense_Mutation_p.S219L|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	219					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.S219L(2)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				AGCCAGTGTCGAAACATAATT	0.493										HNSCC(24;0.065)																																						2	Substitution - Missense(2)	endometrium(2)	7											141.0	122.0	129.0					7																	126746621		2203	4300	6503	126533857	SO:0001583	missense	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.656C>T	7.37:g.126746621G>A	ENSP00000344173:p.Ser219Leu	Somatic		Capture	Illumina GAIIx	4	126533857	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3	p.S219L	ENST00000339582.2	37	c.656	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384331	0.82792	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249;ENST00000457830;ENST00000465844	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.11	5.11	0.69529	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000001	D	0.93861	0.8036	H	0.95079	3.62	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.75484	0.986;0.956	D	0.95641	0.8698	10	0.87932	D	0	.	17.5651	0.87917	0.0:0.0:1.0:0.0	.	219;219	O00222-2;O00222	.;GRM8_HUMAN	L	219;219;219;219;219;29	ENSP00000344173:S219L;ENSP00000409790:S219L;ENSP00000351142:S219L;ENSP00000385731:S219L;ENSP00000415522:S219L;ENSP00000418255:S29L	ENSP00000344173:S219L	S	-	2	0	GRM8	126533857	1.000000	0.71417	0.946000	0.38457	0.542000	0.35054	8.018000	0.88722	2.386000	0.81285	0.563000	0.77884	TCG	-	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor		0.493	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	protein_coding	OTTHUMT00000059209.4	G			126533857	-1	no_errors	NM_000845	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
FLNC	2318	genome.wustl.edu	37	7	128477557	128477557	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr7:128477557C>T	ENST00000325888.8	+	4	1066	c.805C>T	c.(805-807)Cga>Tga	p.R269*	FLNC_ENST00000346177.6_Nonsense_Mutation_p.R269*	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	269					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TGCCCCTGTTCGATCCAAGCA	0.597																																																0			7											126.0	137.0	133.0					7																	128477557		2166	4295	6461	128264793	SO:0001587	stop_gained	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.805C>T	7.37:g.128477557C>T	ENSP00000327145:p.Arg269*	Somatic		Capture	Illumina GAIIx	4	128264793	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Nonsense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_E set domains,HMMPfam_Filamin,HMMSmart_SM00557	p.R269*	ENST00000325888.8	37	c.805	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	C	39	7.720959	0.98453	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.3587	0.60644	0.1679:0.8321:0.0:0.0	.	.	.	.	X	269	.	ENSP00000327145:R269X	R	+	1	2	FLNC	128264793	0.008000	0.16893	1.000000	0.80357	0.944000	0.59088	0.757000	0.26433	2.431000	0.82371	0.655000	0.94253	CGA	-	NULL		0.597	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	protein_coding	OTTHUMT00000059948.3	C			128264793	+1	no_errors	NM_001458	genbank	human	reviewed	54_36p	nonsense	SNP	0.867	T
OR13H1	347468	genome.wustl.edu	37	X	130678870	130678870	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrX:130678870G>A	ENST00000338616.3	+	1	921	c.823G>A	c.(823-825)Gtg>Atg	p.V275M		NM_001004486.1	NP_001004486.1	Q8NG92	O13H1_HUMAN	olfactory receptor, family 13, subfamily H, member 1	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15	Acute lymphoblastic leukemia(192;0.000636)					GTTTATCTCAGTGTTTTATGG	0.428																																																0			X											111.0	104.0	106.0					X																	130678870		2203	4299	6502	130506551	SO:0001583	missense	347468				CCDS35396.1	Xq26.2	2012-08-23			ENSG00000171054	ENSG00000171054		"""GPCR / Class A : Olfactory receptors"""	14755	protein-coding gene	gene with protein product							Standard	NM_001004486		Approved		uc011muw.2	Q8NG92	OTTHUMG00000022411	ENST00000338616.3:c.823G>A	X.37:g.130678870G>A	ENSP00000340748:p.Val275Met	Somatic		Capture	Illumina GAIIx	4	130506551	B2RNQ3|Q6IET8|Q96R12	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.V275M	ENST00000338616.3	37	c.823	CCDS35396.1	X	.	.	.	.	.	.	.	.	.	.	G	7.509	0.654196	0.14580	.	.	ENSG00000171054	ENST00000338616	T	0.00274	8.35	4.87	-0.295	0.12828	GPCR, rhodopsin-like superfamily (1);	0.427134	0.17017	U	0.190249	T	0.00178	0.0005	L	0.39633	1.23	0.09310	N	1	B	0.27823	0.19	B	0.23574	0.047	T	0.34775	-0.9815	10	0.56958	D	0.05	.	5.8773	0.18836	0.0851:0.505:0.2788:0.1312	.	275	Q8NG92	O13H1_HUMAN	M	275	ENSP00000340748:V275M	ENSP00000340748:V275M	V	+	1	0	OR13H1	130506551	0.000000	0.05858	0.046000	0.18839	0.959000	0.62525	-0.324000	0.07986	-0.121000	0.11787	0.594000	0.82650	GTG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.428	OR13H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13H1	protein_coding	OTTHUMT00000058297.1	G			130506551	+1	no_errors	NM_001004486	genbank	human	provisional	54_36p	missense	SNP	0.010	A
GRM1	2911	genome.wustl.edu	37	6	146625901	146625901	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr6:146625901C>G	ENST00000282753.1	+	3	1340	c.1105C>G	c.(1105-1107)Cct>Gct	p.P369A	GRM1_ENST00000392299.2_Missense_Mutation_p.P369A|GRM1_ENST00000361719.2_Missense_Mutation_p.P369A|GRM1_ENST00000507907.1_Missense_Mutation_p.P369A|GRM1_ENST00000355289.4_Missense_Mutation_p.P369A|GRM1_ENST00000492807.2_Missense_Mutation_p.P369A			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	369					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		TCCCTGGTTCCCTGAGTTCTG	0.483																																																0			6											129.0	112.0	118.0					6																	146625901		2203	4300	6503	146667594	SO:0001583	missense	2911			U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.1105C>G	6.37:g.146625901C>G	ENSP00000282753:p.Pro369Ala	Somatic		Capture	Illumina GAIIx	4	146667594	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	superfamily_SSF53822,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3,HMMPfam_GluR_Homer-bdg	p.P369A	ENST00000282753.1	37	c.1105	CCDS5209.1	6	.	.	.	.	.	.	.	.	.	.	C	4.498	0.092288	0.08632	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	6.06	6.06	0.98353	Extracellular ligand-binding receptor (1);	0.055231	0.64402	D	0.000001	T	0.49133	0.1539	N	0.01446	-0.86	0.54753	D	0.999982	B;B;B	0.09022	0.0;0.002;0.001	B;B;B	0.14578	0.002;0.011;0.005	T	0.55598	-0.8116	10	0.10636	T	0.68	.	15.3675	0.74535	0.1394:0.8606:0.0:0.0	.	369;369;369	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	A	369	ENSP00000354896:P369A;ENSP00000376119:P369A;ENSP00000424095:P369A;ENSP00000282753:P369A;ENSP00000347437:P369A;ENSP00000425599:P369A	ENSP00000282753:P369A	P	+	1	0	GRM1	146667594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.642000	0.54367	2.880000	0.98712	0.650000	0.86243	CCT	-	superfamily_SSF53822,HMMPfam_ANF_receptor		0.483	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM1	protein_coding	OTTHUMT00000042574.1	C	NM_000838		146667594	+1	no_errors	NM_000838	genbank	human	reviewed	54_36p	missense	SNP	0.999	G
RP11-404O13.5	0	genome.wustl.edu	37	1	158165367	158165367	+	lincRNA	SNP	T	T	A	rs71579607|rs75037519	byFrequency	TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr1:158165367T>A	ENST00000415019.1	-	0	3998																											tttttttttttaatttttttt	0.333													T|||	2365	0.472244	0.3185	0.3213	5008	,	,		16693	0.6071		0.4443	False		,,,				2504	0.6769															0			1																																								156431991			729780																															1.37:g.158165367T>A		Somatic		Capture	Illumina GAIIx	4	156431991		RNA	SNP	-	NULL	ENST00000415019.1	37	NULL		1																																																																																			-	-		0.333	RP11-404O13.5-001	KNOWN	basic	lincRNA	LOC729780	lincRNA	OTTHUMT00000058352.1	T			156431991	-1	pseudogene	XR_015653	genbank	human	model	54_36p	rna	SNP	0.301	A
RAPGEF2	9693	genome.wustl.edu	37	4	160264453	160264453	+	Missense_Mutation	SNP	G	G	A	rs377126972		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr4:160264453G>A	ENST00000264431.4	+	16	3087	c.2668G>A	c.(2668-2670)Ggg>Agg	p.G890R		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	890	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		AAAAGTAGACGGGCTGGTCAA	0.448																																																0			4						G	ARG/GLY	1,3739		0,1,1869	105.0	102.0	103.0		2668	5.0	0.9	4		103	0,8200		0,0,4100	no	missense	RAPGEF2	NM_014247.2	125	0,1,5969	AA,AG,GG		0.0,0.0267,0.0084	probably-damaging	890/1500	160264453	1,11939	1870	4100	5970	160483903	SO:0001583	missense	9693			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.2668G>A	4.37:g.160264453G>A	ENSP00000264431:p.Gly890Arg	Somatic		Capture	Illumina GAIIx	4	160483903	D3DP27	Missense_Mutation	SNP	superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding,superfamily_Ras_GEF,HMMSmart_RasGEFN,HMMPfam_RasGEF_N,superfamily_PDZ,HMMSmart_PDZ,HMMPfam_PDZ,HMMPfam_RA,HMMSmart_RA,HMMSmart_RasGEF,HMMPfam_RasGEF	p.G890R	ENST00000264431.4	37	c.2668	CCDS43277.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.758197|4.758197	0.89843|0.89843	2.67E-4|2.67E-4	0.0|0.0	ENSG00000109756|ENSG00000109756	ENST00000264431|ENST00000502485	T|.	0.37584|.	1.19|.	5.82|5.82	4.98|4.98	0.66077|0.66077	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79088|0.79088	0.4387|0.4387	M|M	0.86573|0.86573	2.825|2.825	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|T	0.82153|0.82153	-0.0598|-0.0598	10|5	0.87932|.	D|.	0|.	.|.	14.8636|14.8636	0.70399|0.70399	0.0687:0.0:0.9313:0.0|0.0687:0.0:0.9313:0.0	.|.	890|.	Q9Y4G8|.	RPGF2_HUMAN|.	R|Q	890|3	ENSP00000264431:G890R|.	ENSP00000264431:G890R|.	G|R	+|+	1|2	0|0	RAPGEF2|RAPGEF2	160483903|160483903	1.000000|1.000000	0.71417|0.71417	0.928000|0.928000	0.36995|0.36995	0.980000|0.980000	0.70556|0.70556	9.864000|9.864000	0.99589|0.99589	1.466000|1.466000	0.48025|0.48025	0.561000|0.561000	0.74099|0.74099	GGG|CGG	-	superfamily_Ras_GEF,HMMSmart_RasGEF,HMMPfam_RasGEF		0.448	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	protein_coding	OTTHUMT00000364980.2	G	NM_014247		160483903	+1	no_errors	NM_014247	genbank	human	validated	54_36p	missense	SNP	1.000	A
RPS6KA2	6196	genome.wustl.edu	37	6	166833417	166833417	+	Silent	SNP	C	C	T	rs55690286		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr6:166833417C>T	ENST00000265678.4	-	18	1996	c.1773G>A	c.(1771-1773)gcG>gcA	p.A591A	RPS6KA2_ENST00000405189.3_Silent_p.A502A|RPS6KA2_ENST00000503859.1_Silent_p.A599A|RPS6KA2_ENST00000481261.2_Silent_p.A502A|RPS6KA2_ENST00000509742.1_5'UTR|RPS6KA2_ENST00000510118.1_Silent_p.A616A	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2	591	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		AGATGTCACACGCCGCATCAT	0.557																																																0			6						C	,	0,4406		0,0,2203	189.0	126.0	147.0		1797,1773	-6.5	0.5	6	dbSNP_129	147	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	RPS6KA2	NM_001006932.1,NM_021135.4	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	599/742,591/734	166833417	1,13005	2203	4300	6503	166753407	SO:0001819	synonymous_variant	6196			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.1773G>A	6.37:g.166833417C>T		Somatic		Capture	Illumina GAIIx	4	166753407	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	Silent	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_S_TK_X,HMMPfam_Pkinase_C	p.A599	ENST00000265678.4	37	c.1797	CCDS5294.1	6																																																																																			-	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase		0.557	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA2	protein_coding	OTTHUMT00000043075.3	C	NM_021135		166753407	-1	no_errors	NM_001006932	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
RFTN2	130132	genome.wustl.edu	37	2	198540075	198540075	+	Silent	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr2:198540075G>A	ENST00000295049.4	-	1	644	c.108C>T	c.(106-108)taC>taT	p.Y36Y		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	36					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						ATACATATTCGTAAGCAAATT	0.368																																																0			2											139.0	145.0	143.0					2																	198540075		2203	4300	6503	198248320	SO:0001819	synonymous_variant	130132			AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.108C>T	2.37:g.198540075G>A		Somatic		Capture	Illumina GAIIx	4	198248320	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Silent	SNP	NULL	p.Y36	ENST00000295049.4	37	c.108	CCDS2323.1	2																																																																																			-	NULL		0.368	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFTN2	protein_coding	OTTHUMT00000256106.2	G	NM_144629		198248320	-1	no_errors	NM_144629	genbank	human	validated	54_36p	silent	SNP	1.000	A
GIGYF2	26058	genome.wustl.edu	37	2	233684567	233684567	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr2:233684567G>A	ENST00000409547.1	+	23	2712	c.2401G>A	c.(2401-2403)Gaa>Aaa	p.E801K	GIGYF2_ENST00000373563.4_Missense_Mutation_p.E801K|GIGYF2_ENST00000373566.3_Missense_Mutation_p.E823K|GIGYF2_ENST00000409480.1_Missense_Mutation_p.E823K|GIGYF2_ENST00000409451.3_Missense_Mutation_p.E822K|GIGYF2_ENST00000409196.3_Missense_Mutation_p.E795K|GIGYF2_ENST00000452341.2_Missense_Mutation_p.E632K	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	801	Gln-rich.|Glu-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GCGGGAGCAAGAAATTGCATT	0.493																																																0			2											58.0	62.0	61.0					2																	233684567		2203	4300	6503	233392811	SO:0001583	missense	26058			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2401G>A	2.37:g.233684567G>A	ENSP00000386537:p.Glu801Lys	Somatic		Capture	Illumina GAIIx	4	233392811	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	superfamily_GYF,HMMPfam_GYF,HMMSmart_GYF	p.E822K	ENST00000409547.1	37	c.2464	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	G	18.55	3.649112	0.67358	.	.	ENSG00000204120	ENST00000373566;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;T;T;T;T	0.76060	-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.99	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.79540	0.4463	L	0.41824	1.3	0.58432	D	0.999994	D;D;D;D	0.67145	0.996;0.993;0.993;0.993	D;D;D;D	0.76071	0.987;0.971;0.971;0.971	T	0.74121	-0.3767	10	0.13853	T	0.58	-15.4232	16.5658	0.84599	0.0:0.0:1.0:0.0	.	632;822;801;795	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	K	823;801;823;801;795;822;795;632	ENSP00000362667:E823K;ENSP00000362664:E801K;ENSP00000386765:E823K;ENSP00000386537:E801K;ENSP00000387070:E795K;ENSP00000387170:E822K;ENSP00000410297:E795K;ENSP00000411505:E632K	ENSP00000362664:E801K	E	+	1	0	GIGYF2	233392811	1.000000	0.71417	0.996000	0.52242	0.964000	0.63967	7.817000	0.86213	2.333000	0.79357	0.462000	0.41574	GAA	-	NULL		0.493	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	protein_coding	OTTHUMT00000330316.2	G	NM_001103146		233392811	+1	no_errors	NM_001103147	genbank	human	validated	54_36p	missense	SNP	1.000	A
PRR21	643905	genome.wustl.edu	37	2	240982243	240982243	+	Missense_Mutation	SNP	G	G	A	rs80033040	byFrequency	TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr2:240982243G>A	ENST00000408934.1	-	1	156	c.157C>T	c.(157-159)Cgg>Tgg	p.R53W		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	53	Pro-rich.							p.R53W(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGCCGTGGATGAAGG	0.582																																																2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	2											121.0	107.0	112.0					2																	240982243		2203	4300	6503	240630916	SO:0001583	missense	643905			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.157C>T	2.37:g.240982243G>A	ENSP00000386166:p.Arg53Trp	Somatic		Capture	Illumina GAIIx	4	240630916		Missense_Mutation	SNP	NULL	p.R53W	ENST00000408934.1	37	c.157	CCDS33417.1	2	.	.	.	.	.	.	.	.	.	.	N	7.137	0.581093	0.13686	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13657	2.57;2.57	1.19	-1.7	0.08159	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35101	-0.9802	9	0.56958	D	0.05	.	2.7336	0.05234	0.2267:0.299:0.4742:0.0	.	53	Q8WXC7	PRR21_HUMAN	W	53	ENSP00000386166:R53W;ENSP00000418240:R53W	ENSP00000386166:R53W	R	-	1	2	PRR21	240630916	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.394000	0.07296	-0.428000	0.07339	-0.481000	0.04817	CGG	-	NULL		0.582	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643905	protein_coding		G	NM_001080835		240630916	-1	no_errors	NM_001080835	genbank	human	predicted	54_36p	missense	SNP	0.003	A
ZNF263	10127	genome.wustl.edu	37	16	3340127	3340128	+	Frame_Shift_Del	DEL	GA	GA	-	rs186225306		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	GA	GA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr16:3340127_3340128delGA	ENST00000219069.5	+	6	2497_2498	c.1621_1622delGA	c.(1621-1623)gagfs	p.E541fs	ZNF263_ENST00000538765.1_Frame_Shift_Del_p.E189fs	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	541					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						AAGAACTCATGAGAGAGAGAGA	0.5																																																0			16																																								3280129	SO:0001589	frameshift_variant	10127			AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.1621_1622delGA	16.37:g.3340137_3340138delGA	ENSP00000219069:p.Glu541fs	Somatic		Capture	Illumina GAIIx	4	3280128	B2R634|O43387|Q96H95	Frame_Shift_Del	DEL	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMSmart_SM00349,HMMPfam_KRAB,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.R544fs	ENST00000219069.5	37	c.1621_1622	CCDS10499.1	16																																																																																			(deletion:cds_exon[3279394,3280559])	NULL		0.500	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF263	protein_coding	OTTHUMT00000251463.2	GA			3280129	+1	no_errors	NM_005741	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000	-
TP53	7157	genome.wustl.edu	37	17	7579319	7579320	+	Frame_Shift_Ins	INS	-	-	TC	rs587780067		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr17:7579319_7579320insTC	ENST00000269305.4	-	4	556_557	c.367_368insGA	c.(367-369)actfs	p.T123fs	TP53_ENST00000359597.4_Frame_Shift_Ins_p.T123fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.T123fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.T123fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Ins_p.T123fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.T123fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	123	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> I (in a sporadic cancer; somatic mutation).|T -> N (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G59fs*23(3)|p.T123I(1)|p.V73fs*9(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.V122fs*46(1)|p.Y107fs*44(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GACCGTGCAAGTCACAGACTTG	0.545		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	19	Deletion - Frameshift(9)|Whole gene deletion(8)|Substitution - Missense(1)|Deletion - In frame(1)	upper_aerodigestive_tract(4)|bone(4)|central_nervous_system(3)|breast(3)|lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)	17																																								7520045	SO:0001589	frameshift_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.366_367dupGA	17.37:g.7579320_7579321dupTC	ENSP00000269305:p.Thr123fs	Somatic		Capture	Illumina GAIIx	4	7520044	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.T123fs	ENST00000269305.4	37	c.368_367	CCDS11118.1	17																																																																																			-	HMMPfam_P53,superfamily_p53-like transcription factors		0.545	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546		7520045	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	frame_shift_ins	INS	0.995:0.986	TC
PRSS16	10279	genome.wustl.edu	37	6	27223065	27223079	+	In_Frame_Del	DEL	AAGGAGAGCCAGATT	AAGGAGAGCCAGATT	-	rs199705677|rs201493618|rs144604424|rs140280737|rs371606222|rs147170589|rs143492910|rs200987021|rs141138864|rs142712601	byFrequency	TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	AAGGAGAGCCAGATT	AAGGAGAGCCAGATT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr6:27223065_27223079delAAGGAGAGCCAGATT	ENST00000230582.3	+	12	1531_1545	c.1516_1530delAAGGAGAGCCAGATT	c.(1516-1530)aaggagagccagattdel	p.KESQI506del	PRSS16_ENST00000377456.2_3'UTR|PRSS16_ENST00000421826.2_In_Frame_Del_p.KESQI249del	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	506					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)	p.K506_I510delKESQI(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CAAGCTGGCAAAGGAGAGCCAGATTAAGGGTGAAG	0.479														511	0.102037	0.1135	0.1124	5008	,	,		20927	0.0139		0.174	False		,,,				2504	0.0961				NSCLC(178;1118 2105 17078 23587 44429)											1	Deletion - In frame(1)	ovary(1)	6								514,3748		27,460,1644						-5.7	0.0		dbSNP_113	73	1519,6735		166,1187,2774	no	coding	PRSS16	NM_005865.3		193,1647,4418	A1A1,A1R,RR		18.4032,12.0601,16.2432				2033,10483				27331058	SO:0001651	inframe_deletion	10279			AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.1516_1530delAAGGAGAGCCAGATT	6.37:g.27223065_27223079delAAGGAGAGCCAGATT	ENSP00000230582:p.Lys506_Ile510del	Somatic		Capture	Illumina GAIIx	4	27331044	O75416	In_Frame_Del	DEL	HMMPfam_Peptidase_S28,superfamily_SSF53474	p.ESQIK507in_frame_del	ENST00000230582.3	37	c.1516_1530	CCDS4623.1	6																																																																																			(deletion:cds_exon[27331005,27331073])	NULL		0.479	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS16	protein_coding	OTTHUMT00000043418.2	AAGGAGAGCCAGATT			27331058	+1	no_errors	NM_005865	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.008:0.021:0.022:0.020:0.048:0.068:0.213:0.244:0.303:0.312:0.297:0.218:0.073:0.000:0.000	-
DGKK	139189	genome.wustl.edu	37	X	50119110	50119111	+	RNA	INS	-	-	ACAG			TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chrX:50119110_50119111insACAG	ENST00000376025.2	-	0	3384_3385							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					CGCTGGCATTCACAGAACCCAT	0.446																																																0			X																																								50135851			139189			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50119111_50119114dupACAG		Somatic		Capture	Illumina GAIIx	4	50135850	B2RP91	Frame_Shift_Ins	INS	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,HMMPfam_DAGK_cat,HMMSmart_SM00046,HMMPfam_DAGK_acc,HMMSmart_SM00045	p.N1109fs	ENST00000376025.2	37	c.3324_3323		X																																																																																			-	NULL		0.446	DGKK-001	KNOWN	basic	processed_transcript	DGKK	processed_transcript	OTTHUMT00000368187.1	-	NM_001013742		50135851	-1	no_errors	ENST00000376025	ensembl	human	known	54_36p	frame_shift_ins	INS	0.997:1.000	ACAG
TBL1XR1	79718	genome.wustl.edu	37	3	176767863	176767881	+	Frame_Shift_Del	DEL	CTGTGTAGAGCCACTGGTG	CTGTGTAGAGCCACTGGTG	-	rs561869177		TCGA-29-1783-01A-01W-0633-09	TCGA-29-1783-10A-01W-0634-09	CTGTGTAGAGCCACTGGTG	CTGTGTAGAGCCACTGGTG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	44ea2f32-53d4-4310-a339-7b2de9adcc08	dfba5f76-d9ea-4e47-b9a7-76b427ad3a04	g.chr3:176767863_176767881delCTGTGTAGAGCCACTGGTG	ENST00000430069.1	-	7	865_883	c.606_624delCACCAGTGGCTCTACACAG	c.(604-624)agcaccagtggctctacacagfs	p.STSGSTQ202fs	TBL1XR1_ENST00000457928.2_Frame_Shift_Del_p.STSGSTQ202fs|TBL1XR1-AS1_ENST00000454723.2_RNA			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	202					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			TAAGTACTAACTGTGTAGAGCCACTGGTGCTGTTCTCAC	0.393																																																0			3																																								178250575	SO:0001589	frameshift_variant	79718			AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.606_624delCACCAGTGGCTCTACACAG	3.37:g.176767863_176767881delCTGTGTAGAGCCACTGGTG	ENSP00000405574:p.Ser202fs	Somatic		Capture	Illumina GAIIx	4	178250557	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Frame_Shift_Del	DEL	HMMSmart_LisH,HMMPfam_LisH,HMMSmart_WD40,superfamily_WD40_like,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.T203fs	ENST00000430069.1	37	c.624_606	CCDS46961.1	3																																																																																			(deletion:cds_exon[178250479,178250620])	NULL		0.393	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL1XR1	protein_coding	OTTHUMT00000347587.3	CTGTGTAGAGCCACTGGTG	NM_024665		178250575	-1	no_errors	NM_024665	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:0.917:1.000:1.000:0.994:1.000:1.000:0.998:1.000:1.000:1.000:1.000:0.968:0.169:0.956:0.999:0.999	-
