#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								8010	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	8010		Missense_Mutation	SNP	HMMPfam_COX2_TM,superfamily_Cytochrome c oxidase subunit II-like transmembrane region,superfamily_Cupredoxins,HMMPfam_COX2,PatternScan_COX2	p.V142M		37	c.424		MT																																																																																			-	superfamily_Cupredoxins,HMMPfam_COX2	0	0					MT-CO2			G			8010	+1	no_errors	ENST00000361739	ensembl	human	known	54_36p	missense	SNP	NULL	A
CSF2RA	1438	genome.wustl.edu	37	X	1409297	1409297	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chrX:1409297G>A	ENST00000381524.3	+	7	727	c.541G>A	c.(541-543)Gat>Aat	p.D181N	CSF2RA_ENST00000417535.2_Missense_Mutation_p.D181N|CSF2RA_ENST00000361536.3_Missense_Mutation_p.D181N|CSF2RA_ENST00000381529.3_Missense_Mutation_p.D181N|CSF2RA_ENST00000381509.3_Missense_Mutation_p.D181N|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000355805.2_Missense_Mutation_p.D181N|BX649553.4_ENST00000580687.1_RNA|CSF2RA_ENST00000355432.3_Missense_Mutation_p.D181N|BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000432318.2_Missense_Mutation_p.D181N|CSF2RA_ENST00000501036.2_Missense_Mutation_p.D48N|CSF2RA_ENST00000381500.1_Missense_Mutation_p.D181N			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	181					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ATGTCACCTGGATAACCTGTC	0.438																																					Esophageal Squamous(131;723 1707 25334 40494 41806)											0			X											316.0	305.0	309.0					X																	1409297		2203	4296	6499	1369297	SO:0001583	missense	1438			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.541G>A	X.37:g.1409297G>A	ENSP00000370935:p.Asp181Asn	Somatic		Capture	Illumina GAIIx	4	1369297	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Missense_Mutation	SNP	superfamily_Fibronectin type III,HMMPfam_Haemat_rec_S_F2,PatternScan_HEMATOPO_REC_S_F2	p.D181N	ENST00000381524.3	37	c.541	CCDS35191.1	X	.	.	.	.	.	.	.	.	.	.	.	0.160	-1.082386	0.01888	.	.	ENSG00000198223	ENST00000381529;ENST00000432318;ENST00000361536;ENST00000381507;ENST00000501036;ENST00000381524;ENST00000412290;ENST00000419094;ENST00000381509;ENST00000355805;ENST00000355432;ENST00000417535;ENST00000381500	D;D;D;D;D;D;D;D;D;D;D;D	0.94966	-1.8;-1.8;-1.8;-3.57;-1.8;-1.8;-1.8;-1.8;-1.8;-1.8;-1.8;-1.8	1.57	-3.14	0.05250	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	6.945320	0.01157	U	0.006545	D	0.89715	0.6795	.	.	.	0.09310	N	1	P;B;B;B;B;B	0.34864	0.473;0.339;0.291;0.05;0.244;0.288	B;B;B;B;B;B	0.36504	0.084;0.226;0.061;0.028;0.109;0.174	T	0.81328	-0.0982	9	0.28530	T	0.3	.	4.8229	0.13400	0.1864:0.3109:0.5026:0.0	.	181;181;181;181;181;181	P15509-2;A7J003;P15509-3;P15509-6;P15509-5;P15509	.;.;.;.;.;CSF2R_HUMAN	N	181;181;181;181;48;181;181;181;181;181;181;181;181	ENSP00000370940:D181N;ENSP00000416437:D181N;ENSP00000354836:D181N;ENSP00000440491:D48N;ENSP00000370935:D181N;ENSP00000410667:D181N;ENSP00000397452:D181N;ENSP00000370920:D181N;ENSP00000348058:D181N;ENSP00000347606:D181N;ENSP00000394227:D181N;ENSP00000370911:D181N	ENSP00000347606:D181N	D	+	1	0	CSF2RA	1369297	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.481000	0.02323	-1.709000	0.01399	-0.783000	0.03347	GAT	-	superfamily_Fibronectin type III		0.438	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	protein_coding	OTTHUMT00000035013.2	G			1369297	+1	no_errors	NM_006140	genbank	human	reviewed	54_36p	missense	SNP	0.006	A
ZNF343	79175	genome.wustl.edu	37	20	2464099	2464099	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr20:2464099C>A	ENST00000278772.4	-	6	1995	c.1508G>T	c.(1507-1509)aGc>aTc	p.S503I	RP4-734P14.4_ENST00000461548.1_Intron	NM_001282495.1|NM_001282496.1|NM_024325.4	NP_001269424.1|NP_001269425.1|NP_077301.4	Q6P1L6	ZN343_HUMAN	zinc finger protein 343	503					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|skin(4)|upper_aerodigestive_tract(1)	25						TGACTTCTGGCTAAAACCTCG	0.507																																																0			20											130.0	120.0	123.0					20																	2464099		2203	4300	6503	2412099	SO:0001583	missense	79175			AK096911	CCDS13028.1, CCDS74692.1, CCDS74693.1, CCDS74694.1	20p13	2013-01-08			ENSG00000088876	ENSG00000088876		"""Zinc fingers, C2H2-type"", ""-"""	16017	protein-coding gene	gene with protein product							Standard	NM_001282498		Approved	MGC10715	uc002wge.1	Q6P1L6	OTTHUMG00000031701	ENST00000278772.4:c.1508G>T	20.37:g.2464099C>A	ENSP00000278772:p.Ser503Ile	Somatic		Capture	Illumina GAIIx	4	2412099	Q5JXU8|Q5JXU9|Q8N8F2|Q96EX8|Q96NA5|Q9BQB0	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.S503I	ENST00000278772.4	37	c.1508	CCDS13028.1	20	.	.	.	.	.	.	.	.	.	.	C	12.60	1.988012	0.35036	.	.	ENSG00000088876	ENST00000278772	T	0.56103	0.48	2.42	0.0611	0.14339	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32010	0.0815	L	0.31845	0.965	0.20196	N	0.999921	P	0.37158	0.585	B	0.29716	0.106	T	0.13522	-1.0506	9	0.38643	T	0.18	.	4.1689	0.10320	0.0:0.4385:0.3973:0.1643	.	503	Q6P1L6	ZN343_HUMAN	I	503	ENSP00000278772:S503I	ENSP00000278772:S503I	S	-	2	0	ZNF343	2412099	0.000000	0.05858	0.019000	0.16419	0.430000	0.31655	-0.288000	0.08377	0.350000	0.24002	0.591000	0.81541	AGC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.507	ZNF343-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF343	protein_coding	OTTHUMT00000077617.1	C	NM_024325		2412099	-1	no_errors	NM_024325	genbank	human	validated	54_36p	missense	SNP	0.000	A
ZBED1	9189	genome.wustl.edu	37	X	2407124	2407124	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chrX:2407124T>A	ENST00000381223.4	-	2	1840	c.1637A>T	c.(1636-1638)aAc>aTc	p.N546I	ZBED1_ENST00000381222.2_Missense_Mutation_p.N546I|ZBED1_ENST00000381218.3_Missense_Mutation_p.N546I|ZBED1_ENST00000515319.1_5'Flank|DHRSX_ENST00000334651.5_Intron	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	546					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGCCAGCATGTTGTTGATGAC	0.632																																																0			X											69.0	63.0	65.0					X																	2407124		2203	4296	6499	2417124	SO:0001583	missense	9189			AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.1637A>T	X.37:g.2407124T>A	ENSP00000370621:p.Asn546Ile	Somatic		Capture	Illumina GAIIx	4	2417124	Q96BY4	Missense_Mutation	SNP	HMMSmart_ZnF_BED,HMMPfam_zf-BED,HMMPfam_hATC	p.N546I	ENST00000381223.4	37	c.1637	CCDS14118.1	X	.	.	.	.	.	.	.	.	.	.	T	5.360	0.251786	0.10185	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218	T;T;T	0.23348	1.91;1.91;1.91	3.06	-6.12	0.02124	Ribonuclease H-like (1);	0.438357	0.19813	U	0.105496	T	0.12475	0.0303	.	.	.	0.09310	N	1	B	0.29085	0.232	B	0.20955	0.032	T	0.02417	-1.1162	9	0.40728	T	0.16	.	6.7012	0.23227	0.0:0.4638:0.1439:0.3923	.	546	O96006	ZBED1_HUMAN	I	546	ENSP00000370621:N546I;ENSP00000370620:N546I;ENSP00000370616:N546I	ENSP00000370616:N546I	N	-	2	0	ZBED1	2417124	1.000000	0.71417	0.739000	0.30968	0.850000	0.48378	0.415000	0.21181	-2.305000	0.00654	-0.483000	0.04790	AAC	-	NULL		0.632	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED1	protein_coding	OTTHUMT00000144310.3	T	NM_004729		2417124	-1	no_errors	NM_004729	genbank	human	validated	54_36p	missense	SNP	1.000	A
OR52K3P	390035	genome.wustl.edu	37	11	4496785	4496785	+	IGR	SNP	T	T	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr11:4496785T>G								OR52K2 (25194 upstream) : OR52K1 (13323 downstream)																							AGGTGCCATCTTAGCCTTCTA	0.502																																																0			11																																								4453361	SO:0001628	intergenic_variant	0																															11.37:g.4496785T>G		Somatic		Capture	Illumina GAIIx	4	4453361		Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like	p.L46V		37	c.136		11																																																																																			-	superfamily_Family A G protein-coupled receptor-like	0	0.502					OR52K3P			T			4453361	+1	no_errors	ENST00000380435	ensembl	human	known	54_36p	missense	SNP	0.000	G
NPHP4	261734	genome.wustl.edu	37	1	6021901	6021901	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:6021901G>A	ENST00000378156.4	-	6	891	c.626C>T	c.(625-627)tCt>tTt	p.S209F	NPHP4_ENST00000478423.2_5'UTR	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	209					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCAGACCAGACACCAGAAG	0.557																																																0			1											61.0	63.0	62.0					1																	6021901		2007	4163	6170	5944488	SO:0001583	missense	261734			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.626C>T	1.37:g.6021901G>A	ENSP00000367398:p.Ser209Phe	Somatic		Capture	Illumina GAIIx	4	5944488	Q8IWC0	Missense_Mutation	SNP	NULL	p.S209F	ENST00000378156.4	37	c.626	CCDS44052.1	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368403	0.82463	.	.	ENSG00000131697	ENST00000378156	D	0.88431	-2.38	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.93789	0.8014	M	0.69823	2.125	0.49299	D	0.999775	D	0.76494	0.999	D	0.73380	0.98	D	0.94153	0.7407	10	0.72032	D	0.01	.	16.6005	0.84815	0.0:0.0:1.0:0.0	.	209	O75161	NPHP4_HUMAN	F	209	ENSP00000367398:S209F	ENSP00000367398:S209F	S	-	2	0	NPHP4	5944488	1.000000	0.71417	0.998000	0.56505	0.921000	0.55340	6.142000	0.71750	2.581000	0.87130	0.551000	0.68910	TCT	-	NULL		0.557	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	protein_coding	OTTHUMT00000001715.2	G			5944488	-1	no_errors	NM_015102	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578556	7578556	+	Splice_Site	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:7578556T>C	ENST00000269305.4	-	5	565		c.e5-2		TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(34)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGGGAGTACTGTAGGAAGAG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Unknown(34)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(19)|breast(7)|central_nervous_system(4)|ovary(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|oesophagus(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)	17											41.0	42.0	41.0					17																	7578556		2203	4300	6503	7519281	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.376-2A>G	17.37:g.7578556T>C		Somatic		Capture	Illumina GAIIx	4	7519281	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4-2	ENST00000269305.4	37	c.376-2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.23	3.336894	0.60963	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6026	0.45375	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519281	1.000000	0.71417	0.994000	0.49952	0.902000	0.53008	6.214000	0.72200	2.078000	0.62432	0.533000	0.62120	.	-	-		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	Intron	7519281	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
PER3	8863	genome.wustl.edu	37	1	7890026	7890026	+	Missense_Mutation	SNP	A	A	G	rs199947375|rs57875989		TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:7890026A>G	ENST00000361923.2	+	18	3167	c.2992A>G	c.(2992-2994)Aag>Gag	p.K998E	PER3_ENST00000377532.3_Missense_Mutation_p.K1007E|RP3-467L1.4_ENST00000451646.1_RNA	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	998	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.K998E(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		GCCTCCCATGAAGAATCCATC	0.587																																																1	Substitution - Missense(1)	central_nervous_system(1)	1											84.0	69.0	74.0					1																	7890026		1999	3897	5896	7812613	SO:0001583	missense	8863			BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2992A>G	1.37:g.7890026A>G	ENSP00000355031:p.Lys998Glu	Somatic		Capture	Illumina GAIIx	4	7812613	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	HMMSmart_PAS,superfamily_SSF55785,HMMPfam_PAS_3,HMMSmart_PAC	p.K998E	ENST00000361923.2	37	c.2992	CCDS89.1	1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.434686	0.00182	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.13538	2.58;2.58	.	.	.	Period circadian-like, C-terminal (1);	5.912170	0.01354	N	0.012011	T	0.04724	0.0128	N	0.04508	-0.205	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.26503	-1.0101	8	0.02654	T	1	.	.	.	.	.	998;1007;1007;998	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	E	1007;998	ENSP00000366755:K1007E;ENSP00000355031:K998E	ENSP00000355031:K998E	K	+	1	0	PER3	7812613	0.002000	0.14202	0.013000	0.15412	0.014000	0.08584	-0.844000	0.04345	-0.911000	0.03843	-0.891000	0.02926	AAG	-	NULL		0.587	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	protein_coding	OTTHUMT00000003607.1	A	NM_016831		7812613	+1	no_errors	NM_016831	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
PER1	5187	genome.wustl.edu	37	17	8045172	8045172	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:8045172A>G	ENST00000317276.4	-	22	3788	c.3551T>C	c.(3550-3552)gTg>gCg	p.V1184A	PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Missense_Mutation_p.V1161A	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	1184	CRY binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CCAGGAGTGCACAGCACCCAG	0.592			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																															Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0			17											64.0	74.0	71.0					17																	8045172		2203	4300	6503	7985897	SO:0001583	missense	5187			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.3551T>C	17.37:g.8045172A>G	ENSP00000314420:p.Val1184Ala	Somatic		Capture	Illumina GAIIx	4	7985897	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	HMMSmart_SM00091,superfamily_PYP-like sensor domain (PAS domain),HMMPfam_PAS_3	p.V1184A	ENST00000317276.4	37	c.3551	CCDS11131.1	17	.	.	.	.	.	.	.	.	.	.	A	23.1	4.379325	0.82682	.	.	ENSG00000179094	ENST00000317276	T	0.19394	2.15	5.67	5.67	0.87782	Period circadian-like, C-terminal (1);	0.065827	0.64402	D	0.000014	T	0.39064	0.1064	M	0.64997	1.995	0.80722	D	1	D;D	0.71674	0.998;0.973	D;P	0.66847	0.947;0.744	T	0.27434	-1.0074	10	0.87932	D	0	-15.356	8.416	0.32672	0.9137:0.0:0.0863:0.0	.	1175;1184	A2I2P6;O15534	.;PER1_HUMAN	A	1184	ENSP00000314420:V1184A	ENSP00000314420:V1184A	V	-	2	0	PER1	7985897	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.883000	0.69721	2.178000	0.69098	0.533000	0.62120	GTG	-	NULL		0.592	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	protein_coding	OTTHUMT00000441481.2	A			7985897	-1	no_errors	NM_002616	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
OFCC1	266553	genome.wustl.edu	37	6	9908827	9908827	+	Silent	SNP	G	G	A	rs145100001		TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr6:9908827G>A	ENST00000316020.6	-	5	470	c.471C>T	c.(469-471)taC>taT	p.Y157Y	OFCC1_ENST00000472329.1_5'UTR			Q8IZS5	OFCC1_HUMAN	orofacial cleft 1 candidate 1	89										endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)	11	Ovarian(93;0.0473)|Breast(50;0.201)	all_hematologic(90;0.124)				AATTTCTGCCGTATTCATTTC	0.408																																																0			6						G		1,4405	2.1+/-5.4	0,1,2202	149.0	134.0	139.0		471	4.9	1.0	6	dbSNP_134	139	0,8600		0,0,4300	no	coding-synonymous	OFCC1	XM_003118558.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		157/952	9908827	1,13005	2203	4300	6503	10016813	SO:0001819	synonymous_variant	266553			AF548113		6p24.3	2010-11-23			ENSG00000181355	ENSG00000181355			21017	protein-coding gene	gene with protein product		614287					Standard	XM_003119969		Approved	MRDS1	uc003myh.1	Q8IZS5	OTTHUMG00000159104	ENST00000316020.6:c.471C>T	6.37:g.9908827G>A		Somatic		Capture	Illumina GAIIx	4	10016813	Q7Z2X5|Q8IUL6|Q8IUM1|Q8IZR9|Q8IZS1|Q8IZS3	Silent	SNP	NULL	p.Y89	ENST00000316020.6	37	c.267		6	.	.	.	.	.	.	.	.	.	.	G	7.142	0.581994	0.13749	2.27E-4	0.0	ENSG00000181355	ENST00000492169	.	.	.	5.79	4.93	0.64822	.	.	.	.	.	T	0.59445	0.2194	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61083	-0.7134	4	.	.	.	-0.7021	13.0198	0.58779	0.074:0.0:0.926:0.0	.	.	.	.	W	72	.	.	R	-	1	2	OFCC1	10016813	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.119000	0.41958	1.455000	0.47813	0.655000	0.94253	CGG	-	NULL		0.408	OFCC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	OFCC1	protein_coding		G	NM_153003		10016813	-1	no_errors	NM_153003	genbank	human	provisional	54_36p	silent	SNP	1.000	A
MYH4	4622	genome.wustl.edu	37	17	10356504	10356504	+	Nonsense_Mutation	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:10356504T>A	ENST00000255381.2	-	24	3186	c.3076A>T	c.(3076-3078)Aaa>Taa	p.K1026*	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1026					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GTTTTAGCTTTGGTCAGGGTG	0.468																																																0			17											334.0	299.0	311.0					17																	10356504		2203	4300	6503	10297229	SO:0001587	stop_gained	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3076A>T	17.37:g.10356504T>A	ENSP00000255381:p.Lys1026*	Somatic		Capture	Illumina GAIIx	4	10297229		Nonsense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_Myosin_tail_1	p.K1026*	ENST00000255381.2	37	c.3076	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	T	40	8.361816	0.98777	.	.	ENSG00000141048	ENST00000255381	.	.	.	5.28	5.28	0.74379	.	0.000000	0.39834	U	0.001253	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5054	0.75735	0.0:0.0:0.0:1.0	.	.	.	.	X	1026	.	ENSP00000255381:K1026X	K	-	1	0	MYH4	10297229	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	7.865000	0.87049	2.116000	0.64780	0.533000	0.62120	AAA	-	NULL		0.468	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	T	NM_017533		10297229	-1	no_errors	NM_017533	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
MYH1	4619	genome.wustl.edu	37	17	10398600	10398600	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:10398600T>C	ENST00000226207.5	-	36	5298	c.5204A>G	c.(5203-5205)gAg>gGg	p.E1735G	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1735					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						AATGTCTGTCTCCAGCTTCTT	0.428																																																0			17											202.0	174.0	184.0					17																	10398600		2203	4300	6503	10339325	SO:0001583	missense	4619				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5204A>G	17.37:g.10398600T>C	ENSP00000226207:p.Glu1735Gly	Somatic		Capture	Illumina GAIIx	4	10339325	Q14CA4|Q9Y622	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.E1735G	ENST00000226207.5	37	c.5204	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	T	28.7	4.945876	0.92593	.	.	ENSG00000109061	ENST00000226207	D	0.86030	-2.06	5.28	5.28	0.74379	Myosin tail (1);	0.000000	0.43579	U	0.000545	D	0.95392	0.8504	H	0.98333	4.205	0.58432	D	0.999998	D	0.71674	0.998	D	0.71414	0.973	D	0.97288	0.9922	10	0.87932	D	0	.	15.4996	0.75687	0.0:0.0:0.0:1.0	.	1735	P12882	MYH1_HUMAN	G	1735	ENSP00000226207:E1735G	ENSP00000226207:E1735G	E	-	2	0	MYH1	10339325	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.830000	0.86741	2.115000	0.64714	0.459000	0.35465	GAG	-	HMMPfam_Myosin_tail_1		0.428	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	T	NM_005963		10339325	-1	no_errors	NM_005963	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DGKB	1607	genome.wustl.edu	37	7	14741333	14741333	+	Silent	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:14741333C>T	ENST00000403951.2	-	7	908	c.489G>A	c.(487-489)acG>acA	p.T163T	DGKB_ENST00000444700.2_Silent_p.T156T|DGKB_ENST00000258767.5_Silent_p.T163T|DGKB_ENST00000407950.1_Silent_p.T156T|DGKB_ENST00000402815.1_Silent_p.T163T|DGKB_ENST00000399322.3_Silent_p.T163T|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000406247.3_Silent_p.T163T			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	163	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						CATTCCCATCCGTGTCATAAA	0.308																																																0			7											84.0	82.0	83.0					7																	14741333		1834	4081	5915	14707858	SO:0001819	synonymous_variant	1607			AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.489G>A	7.37:g.14741333C>T		Somatic		Capture	Illumina GAIIx	4	14707858	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Silent	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,HMMPfam_DAGK_cat,HMMSmart_SM00046,HMMPfam_DAGK_acc,HMMSmart_SM00045	p.T163	ENST00000403951.2	37	c.489	CCDS47547.1	7																																																																																			-	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1		0.308	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKB	protein_coding	OTTHUMT00000326356.2	C	NM_004080		14707858	-1	no_errors	NM_004080	genbank	human	reviewed	54_36p	silent	SNP	0.986	T
BFSP1	631	genome.wustl.edu	37	20	17492702	17492702	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr20:17492702T>G	ENST00000377873.3	-	4	585	c.546A>C	c.(544-546)gaA>gaC	p.E182D	BFSP1_ENST00000473415.1_5'UTR|BFSP1_ENST00000377868.2_Missense_Mutation_p.E57D|BFSP1_ENST00000544874.1_Missense_Mutation_p.E43D|BFSP1_ENST00000536626.1_Missense_Mutation_p.E43D	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	182	Coil 1B.|Rod.				cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						AGGTCTGAACTTCCAGAAGAT	0.463																																																0			20											133.0	103.0	113.0					20																	17492702		2203	4300	6503	17440702	SO:0001583	missense	631			Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.546A>C	20.37:g.17492702T>G	ENSP00000367104:p.Glu182Asp	Somatic		Capture	Illumina GAIIx	4	17440702	F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Missense_Mutation	SNP	superfamily_Prefoldin	p.E182D	ENST00000377873.3	37	c.546	CCDS13126.1	20	.	.	.	.	.	.	.	.	.	.	T	20.5	3.995696	0.74703	.	.	ENSG00000125864	ENST00000377873;ENST00000377868;ENST00000536626;ENST00000544874	D;T;T;T	0.90324	-2.65;0.63;0.62;0.62	5.02	2.65	0.31530	Filament (1);	0.000000	0.85682	D	0.000000	D	0.91284	0.7252	L	0.59436	1.845	0.41262	D	0.986787	B;P	0.50272	0.447;0.933	B;P	0.56612	0.179;0.802	D	0.89129	0.3508	10	0.62326	D	0.03	-21.1436	7.9007	0.29734	0.0:0.1836:0.0:0.8164	.	57;182	Q12934-2;Q12934	.;BFSP1_HUMAN	D	182;57;43;43	ENSP00000367104:E182D;ENSP00000367099:E57D;ENSP00000442522:E43D;ENSP00000439870:E43D	ENSP00000367099:E57D	E	-	3	2	BFSP1	17440702	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	1.631000	0.37092	0.308000	0.22923	0.418000	0.28097	GAA	-	NULL		0.463	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFSP1	protein_coding	OTTHUMT00000078119.6	T	NM_001195		17440702	-1	no_errors	NM_001195	genbank	human	reviewed	54_36p	missense	SNP	0.999	G
MRC1	4360	genome.wustl.edu	37	10	18112237	18112237	+	Silent	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr10:18112237T>A	ENST00000239761.3	+	2	358	c.255T>A	c.(253-255)gcT>gcA	p.A85A		NM_002438.2	NP_002429.1	P22897	MRC1_HUMAN	mannose receptor, C type 1	85	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	mannose binding (GO:0005537)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|kidney(1)|lung(2)|prostate(1)|urinary_tract(1)	6						ACTGGGTTGCTATCACTCTCT	0.393																																					GBM(115;1153 1594 28187 28781 35884)											0			10											112.0	112.0	112.0					10																	18112237		1332	2789	4121	18152243	SO:0001819	synonymous_variant	4360			J05550	CCDS7123.1, CCDS7123.2	10p13	2014-04-10			ENSG00000120586	ENSG00000260314		"""CD molecules"", ""C-type lectin domain containing"""	7228	protein-coding gene	gene with protein product		153618	"""mannose receptor, C type 1-like 1"""	MRC1L1		1294118	Standard	NM_002438		Approved	CLEC13D, CD206, bA541I19.1, CLEC13DL	uc031ptj.1	P22897	OTTHUMG00000174646	ENST00000239761.3:c.255T>A	10.37:g.18112237T>A		Somatic		Capture	Illumina GAIIx	4	18152243	A5PKW3|Q5VSJ2|Q5VSK2	Silent	SNP	superfamily_Ricin B-like lectins,HMMSmart_SM00458,HMMPfam_Ricin_B_lectin,superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1	p.A85	ENST00000239761.3	37	c.255	CCDS7123.1	10																																																																																			-	superfamily_Ricin B-like lectins,HMMSmart_SM00458,HMMPfam_Ricin_B_lectin		0.393	MRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC1	protein_coding	OTTHUMT00000047057.1	T	NM_002438		18152243	+1	no_errors	NM_002438	genbank	human	validated	54_36p	silent	SNP	0.001	A
SCDP1	645313	genome.wustl.edu	37	17	20688970	20688970	+	lincRNA	SNP	A	A	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:20688970A>G	ENST00000578585.1	+	0	0																											TACGACCAGAAGAAAGTCTCC	0.512																																																0			17																																								20629562			645313																															17.37:g.20688970A>G		Somatic		Capture	Illumina GAIIx	4	20629562		RNA	SNP	-	NULL	ENST00000578585.1	37	NULL		17																																																																																			-	-		0.512	RP11-283C24.1-001	KNOWN	basic	lincRNA	LOC645313	lincRNA	OTTHUMT00000431344.1	A			20629562	+1	pseudogene	XR_017585	genbank	human	model	54_36p	rna	SNP	1.000	G
KRT18P40	390904	genome.wustl.edu	37	19	21144295	21144295	+	IGR	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr19:21144295C>T								ZNF85 (10792 upstream) : CTD-2542C24.8 (10772 downstream)																							CCATCAAGGACCTGAGGGCTC	0.498																																																0			19																																								20936135	SO:0001628	intergenic_variant	390904																															19.37:g.21144295C>T		Somatic		Capture	Illumina GAIIx	4	20936135		RNA	SNP	-	NULL		37	NULL		19																																																																																			-	-	0	0.498					KRT18P40			C			20936135	+1	pseudogene	XR_017288	genbank	human	model	54_36p	rna	SNP	1.000	T
XRN2	22803	genome.wustl.edu	37	20	21324813	21324813	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr20:21324813G>A	ENST00000377191.3	+	16	1591	c.1496G>A	c.(1495-1497)aGt>aAt	p.S499N	XRN2_ENST00000430571.2_Missense_Mutation_p.S423N|XRN2_ENST00000539513.1_Missense_Mutation_p.S445N	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	499					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						GCAGAAGACAGTGACAGTGAA	0.423																																																0			20											174.0	156.0	162.0					20																	21324813		2203	4300	6503	21272813	SO:0001583	missense	22803			AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.1496G>A	20.37:g.21324813G>A	ENSP00000366396:p.Ser499Asn	Somatic		Capture	Illumina GAIIx	4	21272813	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	HMMPfam_XRN_N	p.S499N	ENST00000377191.3	37	c.1496	CCDS13144.1	20	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471228	0.63625	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.18657	2.2;2.2;2.2	5.48	5.48	0.80851	.	0.037066	0.85682	D	0.000000	T	0.29190	0.0726	M	0.78801	2.425	0.80722	D	1	B	0.23185	0.081	B	0.17098	0.017	T	0.14254	-1.0479	10	0.17369	T	0.5	-20.6745	19.7111	0.96096	0.0:0.0:1.0:0.0	.	499	Q9H0D6	XRN2_HUMAN	N	499;423;445	ENSP00000366396:S499N;ENSP00000413548:S423N;ENSP00000441113:S445N	ENSP00000366396:S499N	S	+	2	0	XRN2	21272813	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.129000	0.94430	2.703000	0.92315	0.650000	0.86243	AGT	-	NULL		0.423	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRN2	protein_coding	OTTHUMT00000078273.2	G	NM_012255		21272813	+1	no_errors	NM_012255	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
FAM126A	84668	genome.wustl.edu	37	7	23017921	23017921	+	Nonsense_Mutation	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:23017921G>T	ENST00000432176.2	-	4	532	c.300C>A	c.(298-300)tgC>tgA	p.C100*	FAM126A_ENST00000409923.1_Nonsense_Mutation_p.C100*|FAM126A_ENST00000409763.1_Nonsense_Mutation_p.C100*	NM_032581.3	NP_115970.2	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	100					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|urinary_tract(2)	23						GAGCTTCAATGCATCCACTGC	0.388																																																0			7											83.0	77.0	79.0					7																	23017921		2203	4300	6503	22984446	SO:0001587	stop_gained	84668			BC018710	CCDS5377.1	7p15.3	2008-10-02			ENSG00000122591	ENSG00000122591			24587	protein-coding gene	gene with protein product	"""down regulated by Ctnnb1, a"""	610531				10910037, 16951682	Standard	NM_032581		Approved	DRCTNNB1A, HCC, HYCC1, hyccin	uc003svm.4	Q9BYI3	OTTHUMG00000128435	ENST00000432176.2:c.300C>A	7.37:g.23017921G>T	ENSP00000403396:p.Cys100*	Somatic		Capture	Illumina GAIIx	4	22984446	A4D145|Q6N010|Q75MR4|Q7LDZ4|Q96MX1|Q96NQ6	Nonsense_Mutation	SNP	HMMPfam_Hyccin	p.C100*	ENST00000432176.2	37	c.300	CCDS5377.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.459266|4.459266	0.84317|0.84317	.|.	.|.	ENSG00000122591|ENSG00000122591	ENST00000440481|ENST00000432176;ENST00000409923;ENST00000409763	.|.	.|.	.|.	5.86|5.86	4.02|4.02	0.46733|0.46733	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.47451|.	0.1446|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.22626|.	-1.0211|.	4|.	.|0.13470	.|T	.|0.59	-15.3136|-15.3136	9.2527|9.2527	0.37564|0.37564	0.2903:0.0:0.7097:0.0|0.2903:0.0:0.7097:0.0	.|.	.|.	.|.	.|.	E|X	152|100	.|.	.|ENSP00000386624:C100X	A|C	-|-	2|3	0|2	FAM126A|FAM126A	22984446|22984446	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.499000|2.499000	0.45372|0.45372	0.781000|0.781000	0.33589|0.33589	0.585000|0.585000	0.79938|0.79938	GCA|TGC	-	HMMPfam_Hyccin		0.388	FAM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126A	protein_coding	OTTHUMT00000250230.1	G	NM_032581		22984446	-1	no_errors	NM_032581	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
ASAP3	55616	genome.wustl.edu	37	1	23759703	23759703	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:23759703G>C	ENST00000336689.3	-	22	2234	c.2190C>G	c.(2188-2190)aaC>aaG	p.N730K	ASAP3_ENST00000437606.2_Missense_Mutation_p.N721K|ASAP3_ENST00000495646.1_Missense_Mutation_p.N234K	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	730					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CATAGGTCTTGTTGCTGATGT	0.607																																																0			1											73.0	80.0	77.0					1																	23759703		2203	4300	6503	23632290	SO:0001583	missense	55616			AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.2190C>G	1.37:g.23759703G>C	ENSP00000338769:p.Asn730Lys	Somatic		Capture	Illumina GAIIx	4	23632290	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Missense_Mutation	SNP	PatternScan_AIPM_HOMOCIT_SYNTH_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Pyk2-associated protein beta ARF-GAP domain,HMMPfam_ArfGap,HMMSmart_SM00105,superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.N730K	ENST00000336689.3	37	c.2190	CCDS235.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.976771	0.74360	.	.	ENSG00000088280	ENST00000538685;ENST00000495646;ENST00000336689;ENST00000465372;ENST00000437606	T;T;T	0.52057	2.08;0.68;0.68	4.69	2.82	0.32997	.	0.960694	0.08477	U	0.940113	T	0.50480	0.1618	L	0.27053	0.805	0.30115	N	0.806204	D;P;D;D	0.60575	0.988;0.804;0.976;0.979	P;P;P;P	0.60236	0.871;0.546;0.7;0.747	T	0.45116	-0.9283	10	0.33141	T	0.24	.	9.9654	0.41721	0.1683:0.0:0.8317:0.0	.	721;620;253;730	Q8TDY4-3;B4DRP2;Q9NXH7;Q8TDY4	.;.;.;ASAP3_HUMAN	K	253;234;730;57;721	ENSP00000436150:N234K;ENSP00000338769:N730K;ENSP00000408826:N721K	ENSP00000338769:N730K	N	-	3	2	ASAP3	23632290	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	1.491000	0.35583	0.715000	0.32103	0.561000	0.74099	AAC	-	NULL		0.607	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP3	protein_coding	OTTHUMT00000008916.2	G	NM_017707		23632290	-1	no_errors	NM_017707	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
NR1D2	9975	genome.wustl.edu	37	3	24003903	24003903	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr3:24003903T>C	ENST00000312521.4	+	5	1272	c.953T>C	c.(952-954)cTc>cCc	p.L318P	NR1D2_ENST00000492552.1_3'UTR	NM_001145425.1|NM_005126.4	NP_001138897.1|NP_005117	Q14995	NR1D2_HUMAN	nuclear receptor subfamily 1, group D, member 2	318	Ligand-binding.				gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lipid homeostasis (GO:0055088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of inflammatory response (GO:0050727)|regulation of lipid metabolic process (GO:0019216)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	22						CAGCAGCATCTCAATGGACAG	0.408																																																0			3											73.0	63.0	67.0					3																	24003903		2203	4300	6503	23978907	SO:0001583	missense	9975			BC045613	CCDS33718.1	3p24.1	2013-01-16			ENSG00000174738	ENSG00000174738		"""Nuclear hormone receptors"""	7963	protein-coding gene	gene with protein product		602304				7997240, 10198169	Standard	NM_005126		Approved	BD73, RVR, EAR-1r, HZF2, Hs.37288	uc003ccs.2	Q14995	OTTHUMG00000155659	ENST00000312521.4:c.953T>C	3.37:g.24003903T>C	ENSP00000310006:p.Leu318Pro	Somatic		Capture	Illumina GAIIx	4	23978907	B2R8Q3|O00402|Q86XD4	Missense_Mutation	SNP	HMMSmart_ZnF_C4,HMMPfam_zf-C4,superfamily_SSF57716,PatternScan_NUCLEAR_REC_DBD_1,superfamily_Str_ncl_receptor,HMMSmart_HOLI,HMMPfam_Hormone_recep	p.L318P	ENST00000312521.4	37	c.953	CCDS33718.1	3	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372874	0.61624	.	.	ENSG00000174738	ENST00000312521;ENST00000396676	D	0.92348	-3.02	5.84	5.84	0.93424	Nuclear hormone receptor, ligand-binding (1);	0.588021	0.18391	N	0.142642	D	0.89019	0.6596	L	0.44542	1.39	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	D	0.84327	0.0519	10	0.27785	T	0.31	.	16.2047	0.82120	0.0:0.0:0.0:1.0	.	318	Q14995	NR1D2_HUMAN	P	318	ENSP00000310006:L318P	ENSP00000310006:L318P	L	+	2	0	NR1D2	23978907	1.000000	0.71417	0.999000	0.59377	0.929000	0.56500	5.442000	0.66575	2.216000	0.71823	0.533000	0.62120	CTC	-	superfamily_Str_ncl_receptor		0.408	NR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D2	protein_coding	OTTHUMT00000341017.3	T			23978907	+1	no_errors	NM_005126	genbank	human	reviewed	54_36p	missense	SNP	0.981	C
ABHD12	26090	genome.wustl.edu	37	20	25320277	25320277	+	Intron	SNP	A	A	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr20:25320277A>G	ENST00000339157.5	-	2	464				ABHD12_ENST00000376542.3_Intron	NM_001042472.2	NP_001035937.1	Q8N2K0	ABD12_HUMAN	abhydrolase domain containing 12						adult walking behavior (GO:0007628)|phosphatidylserine catabolic process (GO:0006660)|response to auditory stimulus (GO:0010996)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)	acylglycerol lipase activity (GO:0047372)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	12						AGAATACAGCAGAGAAAGCAG	0.498																																																0			20											36.0	33.0	34.0					20																	25320277		876	1991	2867	25268277	SO:0001627	intron_variant	26090			AL117442	CCDS13172.1, CCDS42857.1	20p11.21	2007-04-24	2006-03-10	2006-03-10	ENSG00000100997	ENSG00000100997		"""Abhydrolase domain containing"""	15868	protein-coding gene	gene with protein product		613599	"""chromosome 20 open reading frame 22"""	C20orf22			Standard	NM_015600		Approved	DKFZP434P106, dJ965G21.2, BEM46L2, ABHD12A	uc002wuq.3	Q8N2K0	OTTHUMG00000032121	ENST00000339157.5:c.192-290T>C	20.37:g.25320277A>G		Somatic		Capture	Illumina GAIIx	4	25268277	A6NED4|A6NJ90|A8K450|B4DE71|Q5T710|Q5T711|Q96CR1|Q9BX05|Q9NPX7|Q9UFV6	Missense_Mutation	SNP	superfamily_SSF53474	p.C13R	ENST00000339157.5	37	c.37	CCDS42857.1	20	.	.	.	.	.	.	.	.	.	.	A	12.05	1.821711	0.32237	.	.	ENSG00000100997	ENST00000450393	.	.	.	3.94	3.94	0.45596	.	.	.	.	.	T	0.47783	0.1464	.	.	.	0.29819	N	0.83096	.	.	.	.	.	.	T	0.49051	-0.8979	5	0.46703	T	0.11	.	9.3766	0.38286	1.0:0.0:0.0:0.0	.	.	.	.	R	13	.	ENSP00000413311:C13R	C	-	1	0	ABHD12	25268277	0.026000	0.19158	0.152000	0.22495	0.548000	0.35241	3.350000	0.52224	1.774000	0.52232	0.533000	0.62120	TGC	-	NULL		0.498	ABHD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD12	protein_coding	OTTHUMT00000078423.2	A	NM_015600		25268277	-1	no_stop_codon	ENST00000376517	ensembl	human	known	54_36p	missense	SNP	0.026	G
BTN3A3	10384	genome.wustl.edu	37	6	26452478	26452478	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr6:26452478C>G	ENST00000244519.2	+	11	1837	c.1594C>G	c.(1594-1596)Ctg>Gtg	p.L532V	BTN3A3_ENST00000339789.4_Missense_Mutation_p.L490V|BTN3A3_ENST00000361232.3_Missense_Mutation_p.L483V	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	532					T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						TGATCATTCCCTGGAGACACC	0.537																																																0			6											55.0	54.0	54.0					6																	26452478		2203	4300	6503	26560457	SO:0001583	missense	10384			U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.1594C>G	6.37:g.26452478C>G	ENSP00000244519:p.Leu532Val	Somatic		Capture	Illumina GAIIx	4	26560457	B4DWI7|E9PCP5	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_V-set,HMMSmart_IG,HMMSmart_PRY,HMMPfam_SPRY,HMMSmart_SPRY	p.L532V	ENST00000244519.2	37	c.1594	CCDS4611.1	6	.	.	.	.	.	.	.	.	.	.	C	6.949	0.544865	0.13312	.	.	ENSG00000111801	ENST00000244519;ENST00000339789;ENST00000361232	T;T;T	0.36699	1.32;1.25;1.24	1.91	-0.244	0.13031	.	.	.	.	.	T	0.04770	0.0129	N	0.24115	0.695	0.09310	N	1	P;P	0.51933	0.949;0.949	B;B	0.31245	0.126;0.126	T	0.22521	-1.0214	9	0.30078	T	0.28	.	1.8728	0.03212	0.3299:0.4505:0.0:0.2196	.	483;532	E9PCP5;O00478	.;BT3A3_HUMAN	V	532;490;483	ENSP00000244519:L532V;ENSP00000344968:L490V;ENSP00000355238:L483V	ENSP00000244519:L532V	L	+	1	2	BTN3A3	26560457	0.000000	0.05858	0.002000	0.10522	0.044000	0.14063	-0.591000	0.05753	0.053000	0.16036	0.455000	0.32223	CTG	-	NULL		0.537	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	BTN3A3	protein_coding	OTTHUMT00000040116.2	C	NM_006994		26560457	+1	no_errors	NM_006994	genbank	human	validated	54_36p	missense	SNP	0.013	G
HIST1H2AM	8336	genome.wustl.edu	37	6	27860667	27860667	+	Silent	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr6:27860667G>T	ENST00000359611.2	-	1	296	c.261C>A	c.(259-261)gcC>gcA	p.A87A	HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	87						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						CGTTGCGGATGGCCAGCTGCA	0.597																																																0			6											132.0	132.0	132.0					6																	27860667		2203	4300	6503	27968646	SO:0001819	synonymous_variant	8336			X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.261C>A	6.37:g.27860667G>T		Somatic		Capture	Illumina GAIIx	4	27968646	P02261|Q2M1R2|Q76PA6	Silent	SNP	superfamily_Histone-fold,HMMSmart_SM00414,HMMPfam_Histone,PatternScan_HISTONE_H2A	p.A87	ENST00000359611.2	37	c.261	CCDS4639.1	6																																																																																			-	superfamily_Histone-fold,HMMSmart_SM00414,HMMPfam_Histone		0.597	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AM	protein_coding	OTTHUMT00000040162.1	G	NM_003514		27968646	-1	no_errors	NM_003514	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
THOC5	8563	genome.wustl.edu	37	22	29927908	29927908	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr22:29927908C>G	ENST00000490103.1	-	8	881	c.759G>C	c.(757-759)caG>caC	p.Q253H	THOC5_ENST00000397873.2_Missense_Mutation_p.Q253H|CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397871.1_Missense_Mutation_p.Q253H|THOC5_ENST00000397872.1_Missense_Mutation_p.Q253H	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	253					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCTTGTGAGCCTGGTCGAATG	0.532																																																0			22											108.0	86.0	94.0					22																	29927908		2203	4300	6503	28257908	SO:0001583	missense	8563			AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.759G>C	22.37:g.29927908C>G	ENSP00000420306:p.Gln253His	Somatic		Capture	Illumina GAIIx	4	28257908	O60839|Q9UPZ5	Missense_Mutation	SNP	HMMPfam_FimP	p.Q253H	ENST00000490103.1	37	c.759	CCDS13859.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.35|12.35	1.912487|1.912487	0.33721|0.33721	.|.	.|.	ENSG00000100296|ENSG00000100296	ENST00000443089|ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873	.|T;T;T;T	.|0.23348	.|1.91;1.91;1.91;1.91	6.04|6.04	3.97|3.97	0.46021|0.46021	.|.	.|0.182249	.|0.53938	.|D	.|0.000052	T|T	0.16214|0.16214	0.0390|0.0390	L|L	0.27053|0.27053	0.805|0.805	0.41484|0.41484	D|D	0.988187|0.988187	.|B	.|0.10296	.|0.003	.|B	.|0.12156	.|0.007	T|T	0.06552|0.06552	-1.0820|-1.0820	5|10	.|0.38643	.|T	.|0.18	-31.0597|-31.0597	6.5975|6.5975	0.22683|0.22683	0.0:0.6224:0.1243:0.2533|0.0:0.6224:0.1243:0.2533	.|.	.|253	.|Q13769	.|THOC5_HUMAN	R|H	113|253	.|ENSP00000420306:Q253H;ENSP00000380970:Q253H;ENSP00000380969:Q253H;ENSP00000380971:Q253H	.|ENSP00000380969:Q253H	G|Q	-|-	1|3	0|2	THOC5|THOC5	28257908|28257908	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	0.406000|0.406000	0.21032|0.21032	0.898000|0.898000	0.36418|0.36418	0.563000|0.563000	0.77884|0.77884	GGC|CAG	-	HMMPfam_FimP		0.532	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC5	protein_coding	OTTHUMT00000322097.1	C	NM_003678		28257908	-1	no_errors	NM_001002877	genbank	human	validated	54_36p	missense	SNP	0.994	G
AZI2	64343	genome.wustl.edu	37	3	28368395	28368395	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr3:28368395T>C	ENST00000479665.1	-	7	1225	c.694A>G	c.(694-696)Aat>Gat	p.N232D	AZI2_ENST00000295748.3_5'UTR	NM_022461.3	NP_071906.1	Q9H6S1	AZI2_HUMAN	5-azacytidine induced 2	232	Interaction with TBK1 and IKBKE.				dendritic cell differentiation (GO:0097028)|dendritic cell proliferation (GO:0044565)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-alpha production (GO:0032607)|interferon-gamma production (GO:0032609)|interleukin-6 production (GO:0032635)|mitotic cell cycle (GO:0000278)|T cell activation (GO:0042110)|tumor necrosis factor production (GO:0032640)	cytoplasm (GO:0005737)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15						AGATGTAAATTAGACATTTCT	0.338																																																0			3											194.0	177.0	183.0					3																	28368395		2203	4300	6503	28343399	SO:0001583	missense	64343			AC093142	CCDS2647.1, CCDS46782.1, CCDS46783.1	3p23	2006-03-01			ENSG00000163512	ENSG00000163512			24002	protein-coding gene	gene with protein product		609916				10580148	Standard	NM_001134432		Approved	NAP1, FLJ21939, AZ2	uc003ceb.4	Q9H6S1	OTTHUMG00000130573	ENST00000479665.1:c.694A>G	3.37:g.28368395T>C	ENSP00000419371:p.Asn232Asp	Somatic		Capture	Illumina GAIIx	4	28343399	A8K3M2|C9JB40|H7BXU6|Q86W99|Q9BQF1	Missense_Mutation	SNP	NULL	p.N232D	ENST00000479665.1	37	c.694	CCDS2647.1	3	.	.	.	.	.	.	.	.	.	.	T	17.10	3.301881	0.60195	.	.	ENSG00000163512	ENST00000479665	.	.	.	5.83	5.83	0.93111	Tbk1/Ikki binding domain (1);	0.048549	0.85682	D	0.000000	T	0.66781	0.2824	M	0.68952	2.095	0.80722	D	1	B	0.22746	0.074	B	0.24155	0.051	T	0.63157	-0.6700	9	0.36615	T	0.2	-12.2693	16.2078	0.82141	0.0:0.0:0.0:1.0	.	232	Q9H6S1	AZI2_HUMAN	D	232	.	ENSP00000419371:N232D	N	-	1	0	AZI2	28343399	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.145000	0.71769	2.226000	0.72624	0.528000	0.53228	AAT	-	NULL		0.338	AZI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	protein_coding	OTTHUMT00000252998.2	T	NM_203326		28343399	-1	no_errors	NM_022461	genbank	human	validated	54_36p	missense	SNP	1.000	C
DEPDC5	9681	genome.wustl.edu	37	22	32293484	32293484	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr22:32293484G>C	ENST00000382112.3	+	39	4263	c.4193G>C	c.(4192-4194)cGg>cCg	p.R1398P	DEPDC5_ENST00000535622.1_Missense_Mutation_p.R1307P|DEPDC5_ENST00000266091.3_Missense_Mutation_p.R1385P|DEPDC5_ENST00000400246.1_Missense_Mutation_p.R1407P|DEPDC5_ENST00000539165.1_Missense_Mutation_p.R224P|DEPDC5_ENST00000382111.2_Missense_Mutation_p.R1407P|DEPDC5_ENST00000400248.2_Missense_Mutation_p.R1376P|DEPDC5_ENST00000400249.2_Missense_Mutation_p.R1376P|DEPDC5_ENST00000382105.2_3'UTR	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1407					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GGTTGGCATCGGAAAGCCACC	0.502																																																0			22											112.0	108.0	110.0					22																	32293484		1885	4110	5995	30623484	SO:0001583	missense	9681			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4193G>C	22.37:g.32293484G>C	ENSP00000371546:p.Arg1398Pro	Somatic		Capture	Illumina GAIIx	4	30623484	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMPfam_DEP,HMMSmart_SM00049"	p.R1376P	ENST00000382112.3	37	c.4127	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	g	23.2	4.392498	0.83011	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248;ENST00000539165	T;T;T;T;T;T;T	0.40756	1.02;1.45;1.45;1.35;1.45;1.35;1.45	5.74	4.73	0.59995	.	0.062767	0.64402	D	0.000007	T	0.63129	0.2485	M	0.72353	2.195	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.91635	0.996;0.998;0.999;0.998;0.995;0.995	T	0.67292	-0.5707	10	0.72032	D	0.01	.	13.8147	0.63283	0.0732:0.0:0.9268:0.0	.	1407;1307;793;1385;1398;1376	B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	P	1307;1385;1376;1307;1407;1398;1407;1376;224	ENSP00000440210:R1307P;ENSP00000266091:R1385P;ENSP00000383108:R1376P;ENSP00000383105:R1407P;ENSP00000371546:R1398P;ENSP00000371545:R1407P;ENSP00000383107:R1376P	ENSP00000266091:R1385P	R	+	2	0	DEPDC5	30623484	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	9.454000	0.97621	1.442000	0.47568	0.651000	0.88453	CGG	-	NULL		0.502	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	protein_coding	OTTHUMT00000129087.1	G	NM_014662		30623484	+1	no_errors	NM_014662	genbank	human	validated	54_36p	missense	SNP	1.000	C
HSPA1L	3305	genome.wustl.edu	37	6	31779217	31779217	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr6:31779217G>C	ENST00000375654.4	-	2	722	c.533C>G	c.(532-534)cCc>cGc	p.P178R	HSPA1L_ENST00000417199.3_Missense_Mutation_p.P178R	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	178					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						AGCAGCCGTGGGCTCATTGAT	0.458																																																0			6											99.0	87.0	91.0					6																	31779217		2203	4300	6503	31887196	SO:0001583	missense	3305			D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.533C>G	6.37:g.31779217G>C	ENSP00000364805:p.Pro178Arg	Somatic		Capture	Illumina GAIIx	4	31887196	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	superfamily_SSF53067,HMMPfam_HSP70,PatternScan_HSP70_1,PatternScan_HSP70_2,PatternScan_HSP70_3,superfamily_SSF100920,superfamily_SSF100934	p.P178R	ENST00000375654.4	37	c.533	CCDS34413.1	6	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195234	0.58017	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653;ENST00000424494	T;T	0.08634	3.07;3.07	4.66	4.66	0.58398	.	.	.	.	.	T	0.48259	0.1490	H	0.99975	5.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75351	-0.3348	9	0.87932	D	0	.	15.0885	0.72174	0.0:0.0:1.0:0.0	.	178	P34931	HS71L_HUMAN	R	178;178;123;68	ENSP00000364805:P178R;ENSP00000387691:P178R	ENSP00000364804:P123R	P	-	2	0	HSPA1L	31887196	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	9.626000	0.98410	2.410000	0.81850	0.460000	0.39030	CCC	-	superfamily_SSF53067,HMMPfam_HSP70		0.458	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA1L	protein_coding	OTTHUMT00000076416.2	G			31887196	-1	no_errors	NM_005527	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
EHMT2	10919	genome.wustl.edu	37	6	31864480	31864480	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr6:31864480C>A	ENST00000375537.4	-	3	237	c.231G>T	c.(229-231)gaG>gaT	p.E77D	C2_ENST00000469372.1_5'Flank|EHMT2_ENST00000375530.4_Missense_Mutation_p.E77D|EHMT2_ENST00000395728.3_Missense_Mutation_p.E134D|EHMT2_ENST00000480912.1_5'Flank|EHMT2_ENST00000375528.4_Missense_Mutation_p.E134D	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	77					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						TGTCAGCCCCCTCATCACCAA	0.622																																																0			6											64.0	79.0	73.0					6																	31864480		1511	2709	4220	31972459	SO:0001583	missense	10919			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.231G>T	6.37:g.31864480C>A	ENSP00000364687:p.Glu77Asp	Somatic		Capture	Illumina GAIIx	4	31972459	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,superfamily_SET domain,HMMSmart_SM00468,HMMPfam_Pre-SET,HMMPfam_SET,HMMSmart_SM00317	p.E77D	ENST00000375537.4	37	c.231	CCDS4725.1	6	.	.	.	.	.	.	.	.	.	.	c	12.07	1.828263	0.32329	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	2.98	2.1	0.27182	.	0.814520	0.10148	N	0.710032	T	0.04952	0.0133	N	0.08118	0	0.23636	N	0.997235	B;P;B;B	0.37500	0.013;0.597;0.023;0.013	B;B;B;B	0.33960	0.01;0.173;0.005;0.002	T	0.20907	-1.0261	10	0.17832	T	0.49	.	4.4327	0.11535	0.0:0.6341:0.233:0.1329	.	134;77;77;77	A2ABF8;Q96KQ7-3;Q96KQ7-2;Q96KQ7	.;.;.;EHMT2_HUMAN	D	134;134;77;77	ENSP00000379078:E134D;ENSP00000364678:E134D;ENSP00000364680:E77D;ENSP00000364687:E77D	ENSP00000364678:E134D	E	-	3	2	EHMT2	31972459	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	2.073000	0.41519	0.822000	0.34565	0.556000	0.70494	GAG	-	NULL		0.622	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	protein_coding	OTTHUMT00000076355.5	C	NM_006709		31972459	-1	no_errors	NM_006709	genbank	human	reviewed	54_36p	missense	SNP	0.997	A
NPSR1	387129	genome.wustl.edu	37	7	34698124	34698124	+	Nonsense_Mutation	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:34698124G>T	ENST00000360581.1	+	1	228	c.100G>T	c.(100-102)Gaa>Taa	p.E34*	NPSR1-AS1_ENST00000419766.1_RNA|NPSR1_ENST00000359791.1_Nonsense_Mutation_p.E34*|NPSR1_ENST00000381542.1_Nonsense_Mutation_p.E34*|AC005493.1_ENST00000399077.1_Intron|NPSR1_ENST00000381539.3_Nonsense_Mutation_p.E34*|NPSR1_ENST00000381553.3_Nonsense_Mutation_p.E34*|NPSR1_ENST00000465305.1_Nonsense_Mutation_p.E34*|NPSR1_ENST00000531252.1_Nonsense_Mutation_p.E34*	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	34						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	GACTTTTACTGAAGTGGTGGA	0.498																																																0			7											120.0	115.0	117.0					7																	34698124		2203	4300	6503	34664649	SO:0001587	stop_gained	387129			AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.100G>T	7.37:g.34698124G>T	ENSP00000353788:p.Glu34*	Somatic		Capture	Illumina GAIIx	4	34664649	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Nonsense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.E34*	ENST00000360581.1	37	c.100	CCDS5444.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.945785	0.97134	.	.	ENSG00000187258	ENST00000381553;ENST00000465305;ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539	.	.	.	4.39	2.55	0.30701	.	0.228718	0.29995	N	0.010674	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-10.3714	6.0852	0.19962	0.1041:0.1915:0.7044:0.0	.	.	.	.	X	34	.	ENSP00000352839:E34X	E	+	1	0	NPSR1	34664649	0.995000	0.38212	0.236000	0.24074	0.989000	0.77384	2.021000	0.41020	0.568000	0.29311	0.561000	0.74099	GAA	-	NULL		0.498	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPSR1	protein_coding	OTTHUMT00000216837.1	G	NM_207173		34664649	+1	no_errors	NM_207173	genbank	human	reviewed	54_36p	nonsense	SNP	0.829	T
LINC00669	647946	genome.wustl.edu	37	18	36915002	36915002	+	lincRNA	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr18:36915002T>C	ENST00000591629.1	-	0	440					NR_024391.1				long intergenic non-protein coding RNA 669																		CAAAGTGCCTTTGTCTTCCGA	0.532																																																0			18																																								35169000			0			AK090603, BG220862, DB038664		18q12.2-q12.3	2012-10-12				ENSG00000267374		"""Long non-coding RNAs"""	44332	non-coding RNA	RNA, long non-coding							Standard	NR_024391		Approved		uc002lak.1				18.37:g.36915002T>C		Somatic		Capture	Illumina GAIIx	4	35169000		Missense_Mutation	SNP	NULL	p.F65S	ENST00000591629.1	37	c.194		18																																																																																			-	NULL		0.532	LINC00669-001	KNOWN	basic	lincRNA	LOC100132910	lincRNA	OTTHUMT00000441462.1	T	NR_024391		35169000	+1	no_errors	XM_001720527	genbank	human	model	54_36p	missense	SNP	0.995	C
THRA	7067	genome.wustl.edu	37	17	38244743	38244743	+	Silent	SNP	A	A	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:38244743A>G	ENST00000264637.4	+	8	1552	c.972A>G	c.(970-972)ctA>ctG	p.L324L	THRA_ENST00000584985.1_Silent_p.L324L|THRA_ENST00000450525.2_Silent_p.L324L|THRA_ENST00000546243.1_Silent_p.L324L|THRA_ENST00000394121.4_Silent_p.L324L	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	324	Ligand-binding.				cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CTGTGCTGCTAATGTCAACAG	0.577																																																0			17											107.0	97.0	100.0					17																	38244743		2203	4300	6503	35498269	SO:0001819	synonymous_variant	7067			J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.972A>G	17.37:g.38244743A>G		Somatic		Capture	Illumina GAIIx	4	35498269	A8K3B5|P21205|Q8N6A1|Q96H73	Silent	SNP	HMMSmart_SM00399,superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMPfam_zf-C4,PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.L324	ENST00000264637.4	37	c.972	CCDS11360.1	17																																																																																			-	superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep		0.577	THRA-001	KNOWN	basic|CCDS	protein_coding	THRA	protein_coding	OTTHUMT00000257160.2	A			35498269	+1	no_errors	NM_003250	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
ZNF536	9745	genome.wustl.edu	37	19	30934607	30934607	+	Silent	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr19:30934607C>A	ENST00000355537.3	+	2	285	c.138C>A	c.(136-138)gcC>gcA	p.A46A		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	46					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TCAGCCATGCCTTCCCCGAGC	0.677																																																0			19											76.0	76.0	76.0					19																	30934607		2203	4300	6503	35626447	SO:0001819	synonymous_variant	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.138C>A	19.37:g.30934607C>A		Somatic		Capture	Illumina GAIIx	4	35626447	A2RU18	Silent	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.A46	ENST00000355537.3	37	c.138	CCDS32984.1	19																																																																																			-	NULL		0.677	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	protein_coding	OTTHUMT00000459667.2	C	NM_014717		35626447	+1	no_errors	NM_014717	genbank	human	provisional	54_36p	silent	SNP	1.000	A
TRIM44	54765	genome.wustl.edu	37	11	35685175	35685175	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr11:35685175G>C	ENST00000299413.5	+	1	823	c.516G>C	c.(514-516)gaG>gaC	p.E172D	RP1-276E15.1_ENST00000525573.2_lincRNA	NM_017583.4	NP_060053.2	Q96DX7	TRI44_HUMAN	tripartite motif containing 44	172	Glu-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				TGGAAGCAGAGAGAGTGGCCA	0.517																																																0			11											128.0	120.0	123.0					11																	35685175		2202	4298	6500	35641751	SO:0001583	missense	54765			BC024031	CCDS31461.1	11p13	2011-04-20	2011-01-25		ENSG00000166326	ENSG00000166326		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19016	protein-coding gene	gene with protein product		612298	"""tripartite motif-containing 44"""				Standard	NM_017583		Approved	DIPB, MC7	uc001mwi.2	Q96DX7	OTTHUMG00000166312	ENST00000299413.5:c.516G>C	11.37:g.35685175G>C	ENSP00000299413:p.Glu172Asp	Somatic		Capture	Illumina GAIIx	4	35641751	D3DR14|Q96QY2|Q9UGK0	Missense_Mutation	SNP	HMMPfam_zf-B_box,HMMSmart_BBOX,superfamily_SSF57845	p.E172D	ENST00000299413.5	37	c.516	CCDS31461.1	11	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959694	0.34565	.	.	ENSG00000166326	ENST00000299413	T	0.35605	1.3	4.31	4.31	0.51392	.	0.000000	0.38326	N	0.001721	T	0.26738	0.0654	N	0.08118	0	0.24466	N	0.994417	D	0.67145	0.996	P	0.51701	0.677	T	0.09707	-1.0662	10	0.25106	T	0.35	-13.9191	12.4543	0.55695	0.0:0.0:1.0:0.0	.	172	Q96DX7	TRI44_HUMAN	D	172	ENSP00000299413:E172D	ENSP00000299413:E172D	E	+	3	2	TRIM44	35641751	1.000000	0.71417	0.999000	0.59377	0.044000	0.14063	0.779000	0.26746	2.375000	0.81037	0.655000	0.94253	GAG	-	NULL		0.517	TRIM44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM44	protein_coding	OTTHUMT00000389081.1	G	NM_017583		35641751	+1	no_errors	NM_017583	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ELMO1	9844	genome.wustl.edu	37	7	37459352	37459352	+	Intron	SNP	T	T	C	rs138097845	byFrequency	TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:37459352T>C	ENST00000310758.4	-	1	575				ELMO1_ENST00000448602.1_Intron|SNORA51_ENST00000363243.1_RNA	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1						actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						TGGTCTGTATTGTAAATGCAG	0.428													T|||	35	0.00698882	0.0	0.0	5008	,	,		18305	0.0347		0.0	False		,,,				2504	0.0															0			7																																								37425877	SO:0001627	intron_variant	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.72+28925A>G	7.37:g.37459352T>C		Somatic		Capture	Illumina GAIIx	4	37425877	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	RNA	SNP	-	NULL	ENST00000310758.4	37	NULL	CCDS5449.1	7																																																																																			-	-		0.428	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000200113	protein_coding	OTTHUMT00000219830.4	T	NM_130442		37425877	+1	no_errors	ENST00000363243	ensembl	human	novel	54_36p	rna	SNP	0.073	C
GNL2	29889	genome.wustl.edu	37	1	38034882	38034882	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:38034882C>T	ENST00000373062.3	-	13	1536	c.1438G>A	c.(1438-1440)Gaa>Aaa	p.E480K	GNL2_ENST00000462812.1_5'UTR	NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	480					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				GGGACAACTTCCAAAGATGAG	0.418																																																0			1											56.0	53.0	54.0					1																	38034882		2203	4300	6503	37807469	SO:0001583	missense	29889			L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.1438G>A	1.37:g.38034882C>T	ENSP00000362153:p.Glu480Lys	Somatic		Capture	Illumina GAIIx	4	37807469	Q9BWN7	Missense_Mutation	SNP	HMMPfam_NGP1NT,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_MMR_HSR1	p.E480K	ENST00000373062.3	37	c.1438	CCDS421.1	1	.	.	.	.	.	.	.	.	.	.	C	13.64	2.296134	0.40594	.	.	ENSG00000134697	ENST00000373062	T	0.22539	1.95	5.6	4.68	0.58851	.	0.146549	0.64402	D	0.000012	T	0.19604	0.0471	L	0.42245	1.32	0.48975	D	0.999735	B	0.18863	0.031	B	0.21360	0.034	T	0.03728	-1.1009	10	0.18276	T	0.48	-18.2748	15.2181	0.73285	0.0:0.8599:0.1401:0.0	.	480	Q13823	NOG2_HUMAN	K	480	ENSP00000362153:E480K	ENSP00000362153:E480K	E	-	1	0	GNL2	37807469	0.903000	0.30736	0.625000	0.29200	0.118000	0.20060	1.711000	0.37930	1.485000	0.48380	0.650000	0.86243	GAA	-	NULL		0.418	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL2	protein_coding	OTTHUMT00000012478.1	C	NM_013285		37807469	-1	no_errors	NM_013285	genbank	human	validated	54_36p	missense	SNP	0.872	T
LSM12	124801	genome.wustl.edu	37	17	42141262	42141262	+	Silent	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:42141262G>T	ENST00000591247.1	-	3	487	c.165C>A	c.(163-165)atC>atA	p.I55I	LSM12_ENST00000293406.3_Silent_p.I55I|LSM12_ENST00000585388.1_Silent_p.I55I	NM_152344.3	NP_689557.1	Q3MHD2	LSM12_HUMAN	LSM12 homolog (S. cerevisiae)	55										NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	6		Breast(137;0.0313)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.115)		TTATGAGCAAGATGTCTGCAT	0.418																																																0			17											95.0	85.0	88.0					17																	42141262		2203	4299	6502	39496788	SO:0001819	synonymous_variant	124801			BC044587	CCDS11475.1	17q21.31	2007-08-21				ENSG00000161654			26407	protein-coding gene	gene with protein product		611793				15225602	Standard	NM_152344		Approved	FLJ30656	uc002iev.3	Q3MHD2		ENST00000591247.1:c.165C>A	17.37:g.42141262G>T		Somatic		Capture	Illumina GAIIx	4	39496788	Q86YB1|Q96NL5	Silent	SNP	HMMPfam_AD	p.I55	ENST00000591247.1	37	c.165	CCDS11475.1	17																																																																																			-	NULL		0.418	LSM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM12	protein_coding	OTTHUMT00000457672.1	G	NM_152344		39496788	-1	no_errors	NM_152344	genbank	human	validated	54_36p	silent	SNP	1.000	T
ADAM11	4185	genome.wustl.edu	37	17	42849004	42849004	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:42849004C>T	ENST00000200557.6	+	5	603	c.434C>T	c.(433-435)tCc>tTc	p.S145F	ADAM11_ENST00000535346.1_5'UTR	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	145					integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				AACCCGCACTCCTTCGCCGCC	0.692																																																0			17											47.0	52.0	50.0					17																	42849004		2203	4299	6502	40204530	SO:0001583	missense	4185			D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.434C>T	17.37:g.42849004C>T	ENSP00000200557:p.Ser145Phe	Somatic		Capture	Illumina GAIIx	4	40204530	Q14808|Q14809|Q14810	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMPfam_Disintegrin,HMMSmart_SM00050,superfamily_Blood coagulation inhibitor (disintegrin),PatternScan_DISINTEGRIN_1,HMMSmart_SM00608,HMMPfam_ADAM_CR,HMMPfam_EGF_2,superfamily_EGF/Laminin,PatternScan_EGF_1"	p.S145F	ENST00000200557.6	37	c.434	CCDS11486.1	17	.	.	.	.	.	.	.	.	.	.	C	12.40	1.928022	0.34002	.	.	ENSG00000073670	ENST00000200557;ENST00000355638	T	0.13307	2.6	4.83	4.83	0.62350	Peptidase M12B, propeptide (1);	0.000000	0.64402	D	0.000001	T	0.46190	0.1380	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58375	-0.7647	10	0.87932	D	0	.	13.4297	0.61049	0.0:1.0:0.0:0.0	.	145	O75078	ADA11_HUMAN	F	145;45	ENSP00000200557:S145F	ENSP00000200557:S145F	S	+	2	0	ADAM11	40204530	1.000000	0.71417	0.975000	0.42487	0.589000	0.36550	6.377000	0.73145	2.236000	0.73375	0.561000	0.74099	TCC	-	HMMPfam_Pep_M12B_propep		0.692	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM11	protein_coding	OTTHUMT00000444531.1	C	NM_002390		40204530	+1	no_errors	NM_002390	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SREBF2	6721	genome.wustl.edu	37	22	42271369	42271369	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr22:42271369C>G	ENST00000361204.4	+	6	1284	c.1118C>G	c.(1117-1119)gCc>gGc	p.A373G		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	373	Interaction with LMNA. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CTGAGGAAGGCCATTGATTAC	0.478																																																0			22											86.0	74.0	78.0					22																	42271369		2203	4300	6503	40601315	SO:0001583	missense	6721			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1118C>G	22.37:g.42271369C>G	ENSP00000354476:p.Ala373Gly	Somatic		Capture	Illumina GAIIx	4	40601315	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH	p.A373G	ENST00000361204.4	37	c.1118	CCDS14023.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.569979	0.96540	.	.	ENSG00000198911	ENST00000361204;ENST00000444813;ENST00000457567	D	0.99519	-6.07	6.07	6.07	0.98685	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99715	0.9890	H	0.94183	3.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97820	1.0256	10	0.87932	D	0	-28.0295	20.6439	0.99570	0.0:1.0:0.0:0.0	.	373	Q12772	SRBP2_HUMAN	G	373	ENSP00000354476:A373G	ENSP00000354476:A373G	A	+	2	0	SREBF2	40601315	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	GCC	-	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH		0.478	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	protein_coding	OTTHUMT00000321956.1	C	NM_004599		40601315	+1	no_errors	NM_004599	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SETBP1	26040	genome.wustl.edu	37	18	42533293	42533293	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr18:42533293T>A	ENST00000282030.5	+	4	4284	c.3988T>A	c.(3988-3990)Tcc>Acc	p.S1330T		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1330						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TTATGACTCCTCCATGTCTCC	0.448									Schinzel-Giedion syndrome																																							0			18											82.0	78.0	79.0					18																	42533293		2203	4300	6503	40787291	SO:0001583	missense	26040	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3988T>A	18.37:g.42533293T>A	ENSP00000282030:p.Ser1330Thr	Somatic		Capture	Illumina GAIIx	4	40787291	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	HMMPfam_AT_hook,HMMSmart_AT_hook	p.S1276T	ENST00000282030.5	37	c.3826	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	T	13.60	2.284676	0.40394	.	.	ENSG00000152217	ENST00000282030	T	0.71698	-0.59	6.17	5.0	0.66597	.	0.267034	0.39341	N	0.001388	T	0.55705	0.1937	L	0.27053	0.805	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.50684	-0.8799	10	0.42905	T	0.14	.	8.8185	0.35011	0.1268:0.0:0.1331:0.7401	.	1330	Q9Y6X0	SETBP_HUMAN	T	1330	ENSP00000282030:S1330T	ENSP00000282030:S1330T	S	+	1	0	SETBP1	40787291	0.999000	0.42202	0.998000	0.56505	0.979000	0.70002	1.933000	0.40153	1.129000	0.42072	-0.336000	0.08194	TCC	-	NULL		0.448	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	protein_coding	OTTHUMT00000255854.4	T	NM_001130110		40787291	+1	no_errors	NM_015559	genbank	human	validated	54_36p	missense	SNP	0.905	A
GTSF1L	149699	genome.wustl.edu	37	20	42355121	42355121	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr20:42355121C>T	ENST00000373003.1	-	1	517	c.214G>A	c.(214-216)Gag>Aag	p.E72K	GTSF1L_ENST00000373005.2_Missense_Mutation_p.E72K	NM_001008901.1|NM_176791.3	NP_001008901.1|NP_789761.1	Q9H1H1	GTSFL_HUMAN	gametocyte specific factor 1-like	72							metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TCGGTGTCCTCTTCTTCCACA	0.537																																																0			20											141.0	120.0	127.0					20																	42355121		2203	4300	6503	41788535	SO:0001583	missense	149699			AK058060	CCDS13323.1, CCDS33471.1	20q13.12	2007-11-27	2007-11-27	2007-11-27	ENSG00000124196	ENSG00000124196			16198	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 65"", ""family with sequence similarity 112, member A"""	C20orf65, FAM112A			Standard	NM_176791		Approved	dJ1028D15.4	uc002xld.3	Q9H1H1	OTTHUMG00000032510	ENST00000373003.1:c.214G>A	20.37:g.42355121C>T	ENSP00000362094:p.Glu72Lys	Somatic		Capture	Illumina GAIIx	4	41788535	Q5JWH5	Missense_Mutation	SNP	HMMPfam_UPF0224	p.E72K	ENST00000373003.1	37	c.214	CCDS13323.1	20	.	.	.	.	.	.	.	.	.	.	C	11.26	1.584810	0.28268	.	.	ENSG00000124196	ENST00000373003;ENST00000373005	T;T	0.47177	0.85;0.9	3.63	2.48	0.30137	.	0.692173	0.12916	N	0.428541	T	0.34919	0.0914	L	0.58810	1.83	0.32076	N	0.593814	P;P	0.46395	0.877;0.734	B;B	0.38106	0.265;0.196	T	0.37820	-0.9689	10	0.12103	T	0.63	-14.0304	5.3876	0.16226	0.0:0.7969:0.0:0.2031	.	72;72	Q9H1H1;Q5JWH5	GTSFL_HUMAN;.	K	72	ENSP00000362094:E72K;ENSP00000362096:E72K	ENSP00000362094:E72K	E	-	1	0	GTSF1L	41788535	0.361000	0.24972	0.783000	0.31826	0.365000	0.29674	1.427000	0.34881	0.869000	0.35703	0.430000	0.28490	GAG	-	HMMPfam_UPF0224		0.537	GTSF1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTSF1L	protein_coding	OTTHUMT00000079313.1	C	NM_176791		41788535	-1	no_errors	NM_176791	genbank	human	validated	54_36p	missense	SNP	0.158	T
HIVEP3	59269	genome.wustl.edu	37	1	42048372	42048372	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:42048372C>A	ENST00000372583.1	-	4	2982	c.2097G>T	c.(2095-2097)atG>atT	p.M699I	HIVEP3_ENST00000372584.1_Missense_Mutation_p.M699I|HIVEP3_ENST00000247584.5_Missense_Mutation_p.M699I|HIVEP3_ENST00000429157.2_Missense_Mutation_p.M699I|HIVEP3_ENST00000460604.1_5'Flank	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	699	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GTTTGTAATGCATCATTTGGG	0.532																																																0			1											138.0	126.0	130.0					1																	42048372		2203	4300	6503	41820959	SO:0001583	missense	59269			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2097G>T	1.37:g.42048372C>A	ENSP00000361664:p.Met699Ile	Somatic		Capture	Illumina GAIIx	4	41820959	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	PatternScan_AIPM_HOMOCIT_SYNTH_1,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_C2H2 and C2HC zinc fingers	p.M699I	ENST00000372583.1	37	c.2097	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	C	15.21	2.766620	0.49574	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.14893	2.47;2.47;2.47;2.47	4.47	4.47	0.54385	.	0.000000	0.64402	D	0.000004	T	0.21801	0.0525	L	0.46157	1.445	0.39437	D	0.967178	P;P	0.37548	0.599;0.464	B;B	0.44108	0.441;0.256	T	0.02942	-1.1091	10	0.49607	T	0.09	-15.9357	12.773	0.57432	0.0:0.8349:0.1651:0.0	.	699;699	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	I	699	ENSP00000361665:M699I;ENSP00000361664:M699I;ENSP00000247584:M699I;ENSP00000410828:M699I	ENSP00000247584:M699I	M	-	3	0	HIVEP3	41820959	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.691000	0.61738	2.326000	0.78906	0.555000	0.69702	ATG	-	NULL		0.532	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	protein_coding	OTTHUMT00000016978.1	C	NM_024503		41820959	-1	no_errors	NM_024503	genbank	human	validated	54_36p	missense	SNP	1.000	A
USP49	25862	genome.wustl.edu	37	6	41766497	41766497	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr6:41766497C>T	ENST00000394253.3	-	6	2170	c.1841G>A	c.(1840-1842)gGa>gAa	p.G614E	USP49_ENST00000297229.2_Missense_Mutation_p.G614E|USP49_ENST00000373006.1_Missense_Mutation_p.G614E|USP49_ENST00000373009.3_Missense_Mutation_p.G614E|USP49_ENST00000373010.1_Intron			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	614	USP.				histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGTGTAGTGTCCTGAGCCAAA	0.522																																																0			6											197.0	162.0	173.0					6																	41766497		2203	4300	6503	41874475	SO:0001583	missense	25862			AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.1841G>A	6.37:g.41766497C>T	ENSP00000377797:p.Gly614Glu	Somatic		Capture	Illumina GAIIx	4	41874475	Q5T3D9|Q5T3E0|Q96CK4	Missense_Mutation	SNP	HMMSmart_SM00290,HMMPfam_zf-UBP,superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.G614E	ENST00000394253.3	37	c.1841		6	.	.	.	.	.	.	.	.	.	.	C	34	5.398735	0.96030	.	.	ENSG00000164663	ENST00000394253;ENST00000373009;ENST00000373006;ENST00000297229	T;T;D;D	0.97505	0.42;0.42;-4.41;-4.41	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.99369	0.9778	H	0.99143	4.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98503	1.0615	10	0.87932	D	0	-10.0321	20.4745	0.99168	0.0:1.0:0.0:0.0	.	614	Q70CQ1-2	.	E	614	ENSP00000377797:G614E;ENSP00000362100:G614E;ENSP00000362097:G614E;ENSP00000297229:G614E	ENSP00000297229:G614E	G	-	2	0	USP49	41874475	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGA	-	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_2		0.522	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	USP49	protein_coding	OTTHUMT00000316513.3	C	NM_018561		41874475	-1	no_errors	NM_018561	genbank	human	provisional	54_36p	missense	SNP	1.000	T
CDC27	996	genome.wustl.edu	37	17	45206793	45206793	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:45206793C>G	ENST00000066544.3	-	16	2219	c.2126G>C	c.(2125-2127)aGa>aCa	p.R709T	CDC27_ENST00000446365.2_Missense_Mutation_p.R648T|CDC27_ENST00000527547.1_Missense_Mutation_p.R708T|CDC27_ENST00000531206.1_Missense_Mutation_p.R715T	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	709					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AACTGAGGCTCTGTGAAATTT	0.348																																																0			17											94.0	98.0	96.0					17																	45206793		2203	4299	6502	42561792	SO:0001583	missense	996			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.2126G>C	17.37:g.45206793C>G	ENSP00000066544:p.Arg709Thr	Somatic		Capture	Illumina GAIIx	4	42561792	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR	p.R709T	ENST00000066544.3	37	c.2126	CCDS11509.1	17	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828772	0.90955	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.68	5.68	0.88126	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.80929	0.4718	M	0.89968	3.075	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.993	D;D;D;D	0.79784	0.993;0.971;0.971;0.917	D	0.84535	0.0635	10	0.87932	D	0	-12.6948	17.2896	0.87152	0.0:1.0:0.0:0.0	.	648;708;715;709	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	T	709;715;648;708	ENSP00000066544:R709T;ENSP00000434614:R715T;ENSP00000392802:R648T;ENSP00000437339:R708T	ENSP00000066544:R709T	R	-	2	0	CDC27	42561792	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.041000	0.70988	2.669000	0.90835	0.563000	0.77884	AGA	-	superfamily_SSF48452,HMMSmart_TPR		0.348	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	protein_coding	OTTHUMT00000389742.2	C			42561792	-1	no_errors	NM_001256	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
RYR1	6261	genome.wustl.edu	37	19	38937395	38937395	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr19:38937395C>A	ENST00000359596.3	+	9	787	c.787C>A	c.(787-789)Cca>Aca	p.P263T	RYR1_ENST00000355481.4_Missense_Mutation_p.P263T|RYR1_ENST00000360985.3_Missense_Mutation_p.P263T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	263	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GAGGCTGGAGCCACTGAGAAT	0.592																																																0			19											37.0	37.0	37.0					19																	38937395		2203	4300	6503	43629235	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.787C>A	19.37:g.38937395C>A	ENSP00000352608:p.Pro263Thr	Somatic		Capture	Illumina GAIIx	4	43629235	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_RYDR_ITPR,HMMPfam_SPRY,HMMSmart_SM00449,HMMPfam_RyR,HMMPfam_RIH_assoc,superfamily_EF-hand,HMMPfam_RR_TM4-6,HMMPfam_Ion_trans	p.P263T	ENST00000359596.3	37	c.787	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255873	0.59321	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.86769	-2.17;-2.17;-2.17	4.31	4.31	0.51392	MIR motif (2);MIR (2);	0.000000	0.64402	U	0.000004	D	0.90998	0.7169	L	0.54908	1.71	0.52501	D	0.99995	D;P	0.89917	1.0;0.846	D;P	0.91635	0.999;0.842	D	0.90218	0.4269	10	0.39692	T	0.17	.	14.3051	0.66380	0.0:1.0:0.0:0.0	.	263;263	P21817-2;P21817	.;RYR1_HUMAN	T	263	ENSP00000352608:P263T;ENSP00000347667:P263T;ENSP00000354254:P263T	ENSP00000347667:P263T	P	+	1	0	RYR1	43629235	1.000000	0.71417	0.993000	0.49108	0.904000	0.53231	2.217000	0.42880	2.242000	0.73789	0.563000	0.77884	CCA	-	HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815)		0.592	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	C			43629235	+1	no_errors	NM_000540	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MMP9	4318	genome.wustl.edu	37	20	44639843	44639843	+	Silent	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr20:44639843G>A	ENST00000372330.3	+	5	730	c.711G>A	c.(709-711)gaG>gaA	p.E237E	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	237	Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	TCATCTTCGAGGGCCGCTCCT	0.652																																																0			20											89.0	96.0	94.0					20																	44639843		2203	4300	6503	44073250	SO:0001819	synonymous_variant	4318				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.711G>A	20.37:g.44639843G>A		Somatic		Capture	Illumina GAIIx	4	44073250	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Silent	SNP	"superfamily_PGBD-like,HMMPfam_PG_binding_1,PatternScan_CYSTEINE_SWITCH,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMSmart_SM00235,HMMPfam_Peptidase_M10,superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1,HMMPfam_PT,superfamily_Hemopexin-like domain,HMMPfam_Hemopexin,HMMSmart_SM00120,PatternScan_HEMOPEXIN"	p.E237	ENST00000372330.3	37	c.711	CCDS13390.1	20																																																																																			-	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMSmart_SM00235,HMMPfam_Peptidase_M10,superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1"		0.652	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP9	protein_coding	OTTHUMT00000080337.1	G			44073250	+1	no_errors	NM_004994	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
TCTE1	202500	genome.wustl.edu	37	6	44255366	44255366	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr6:44255366G>A	ENST00000371505.4	-	2	319	c.197C>T	c.(196-198)gCt>gTt	p.A66V	TCTE1_ENST00000371504.1_5'Flank|TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371503.3_5'UTR|RP11-444E17.6_ENST00000505802.1_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1	66										breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGGATCCTCAGCAATGATCCG	0.547																																																0			6											129.0	113.0	119.0					6																	44255366		2203	4300	6503	44363344	SO:0001583	missense	202500			BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763	ENST00000371505.4:c.197C>T	6.37:g.44255366G>A	ENSP00000360560:p.Ala66Val	Somatic		Capture	Illumina GAIIx	4	44363344	B4DX59|Q8IYS6	Missense_Mutation	SNP	superfamily_SSF52047	p.A66V	ENST00000371505.4	37	c.197	CCDS4910.1	6	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389474	0.61956	.	.	ENSG00000146221	ENST00000371505	T	0.34072	1.38	5.49	5.49	0.81192	.	0.234157	0.41938	D	0.000784	T	0.25306	0.0615	M	0.61703	1.905	0.80722	D	1	P	0.48294	0.908	B	0.40285	0.325	T	0.04976	-1.0914	10	0.38643	T	0.18	-13.5639	14.6353	0.68686	0.0722:0.0:0.9278:0.0	.	66	Q5JU00	TCTE1_HUMAN	V	66	ENSP00000360560:A66V	ENSP00000360560:A66V	A	-	2	0	TCTE1	44363344	0.998000	0.40836	0.909000	0.35828	0.870000	0.49936	5.776000	0.68924	2.585000	0.87301	0.404000	0.27445	GCT	-	NULL		0.547	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTE1	protein_coding	OTTHUMT00000040736.1	G	NM_182539		44363344	-1	no_errors	NM_182539	genbank	human	provisional	54_36p	missense	SNP	0.995	A
CTGLF12P	414224	genome.wustl.edu	37	10	49219500	49219500	+	IGR	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr10:49219500G>T								FAM25C (11682 upstream) : RNA5SP315 (28975 downstream)																							ATGTAAACAGGTTGGACCAGC	0.577																																																0			10																																								48889506	SO:0001628	intergenic_variant	0																															10.37:g.49219500G>T		Somatic		Capture	Illumina GAIIx	4	48889506		Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH	p.N217K		37	c.651		10																																																																																			-	NULL	0	0.577					uc001jgd.1			G			48889506	-1	no_start_codon:no_stop_codon	ENST00000339771	ensembl	human	known	54_36p	missense	SNP	1.000	T
AP4E1	23431	genome.wustl.edu	37	15	51204293	51204293	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr15:51204293C>T	ENST00000261842.5	+	2	275	c.169C>T	c.(169-171)Cag>Tag	p.Q57*	AP4E1_ENST00000560508.1_5'UTR	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	57					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		AAAATTAATCCAGCAGGAACT	0.333																																																0			15											56.0	58.0	58.0					15																	51204293		2196	4294	6490	48991585	SO:0001587	stop_gained	23431			AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.169C>T	15.37:g.51204293C>T	ENSP00000261842:p.Gln57*	Somatic		Capture	Illumina GAIIx	4	48991585	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Nonsense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_Adaptin_N,HMMPfam_Coatamer_beta_C	p.Q57*	ENST00000261842.5	37	c.169	CCDS32240.1	15	.	.	.	.	.	.	.	.	.	.	C	37	6.108544	0.97291	.	.	ENSG00000081014	ENST00000261842	.	.	.	5.19	5.19	0.71726	.	0.061015	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-8.4966	17.2697	0.87097	0.0:1.0:0.0:0.0	.	.	.	.	X	57	.	ENSP00000261842:Q57X	Q	+	1	0	AP4E1	48991585	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.082000	0.57635	2.409000	0.81822	0.591000	0.81541	CAG	-	superfamily_ARM-type_fold,HMMPfam_Adaptin_N		0.333	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	AP4E1	protein_coding	OTTHUMT00000418656.1	C			48991585	+1	no_errors	NM_007347	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
GLDN	342035	genome.wustl.edu	37	15	51696934	51696934	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr15:51696934A>G	ENST00000335449.6	+	10	1695	c.1639A>G	c.(1639-1641)Act>Gct	p.T547A	GLDN_ENST00000396399.2_Missense_Mutation_p.T423A	NM_181789.2	NP_861454.2	Q6ZMI3	GLDN_HUMAN	gliomedin	547					clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|microvillus organization (GO:0032528)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		GTTTTTGTCAACTACCTTAAA	0.418																																																0			15											101.0	110.0	107.0					15																	51696934		2196	4292	6488	49484226	SO:0001583	missense	342035			AY358144	CCDS10140.2	15q15.3	2008-02-05	2005-10-06	2005-10-06	ENSG00000186417	ENSG00000186417			29514	protein-coding gene	gene with protein product		608603	"""collomin"""	COLM		16039564, 12642876	Standard	XM_005254338		Approved	CRG-L2, CLOM, colmedin, UNC-112	uc002aba.3	Q6ZMI3	OTTHUMG00000131746	ENST00000335449.6:c.1639A>G	15.37:g.51696934A>G	ENSP00000335196:p.Thr547Ala	Somatic		Capture	Illumina GAIIx	4	49484226	Q6UXZ7|Q7Z359	Missense_Mutation	SNP	HMMPfam_Collagen,HMMPfam_OLF,HMMSmart_SM00284	p.T547A	ENST00000335449.6	37	c.1639	CCDS10140.2	15	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.996789	0.00435	.	.	ENSG00000186417	ENST00000335449;ENST00000396399;ENST00000537339	D;D	0.91351	-2.83;-2.66	5.93	-0.395	0.12431	.	1.526740	0.04865	N	0.444907	T	0.68769	0.3037	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.63756	-0.6565	10	0.07813	T	0.8	.	2.505	0.04643	0.2682:0.1433:0.4748:0.1136	.	547	Q6ZMI3	GLDN_HUMAN	A	547;423;423	ENSP00000335196:T547A;ENSP00000379681:T423A	ENSP00000335196:T547A	T	+	1	0	GLDN	49484226	.	.	0.007000	0.13788	0.005000	0.04900	.	.	-0.352000	0.08237	-0.250000	0.11733	ACT	-	NULL		0.418	GLDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDN	protein_coding	OTTHUMT00000254667.2	A	NM_181789		49484226	+1	no_errors	NM_181789	genbank	human	validated	54_36p	missense	SNP	0.001	G
CHD9	80205	genome.wustl.edu	37	16	53190438	53190438	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr16:53190438A>T	ENST00000398510.3	+	1	524	c.437A>T	c.(436-438)cAt>cTt	p.H146L	CHD9_ENST00000447540.1_Missense_Mutation_p.H146L|CHD9_ENST00000564845.1_Missense_Mutation_p.H146L|CHD9_ENST00000566029.1_Missense_Mutation_p.H146L			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	146					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				CAACAAGGACATTCACACTCT	0.418																																																0			16											111.0	108.0	109.0					16																	53190438		1918	4149	6067	51747939	SO:0001583	missense	80205			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.437A>T	16.37:g.53190438A>T	ENSP00000381522:p.His146Leu	Somatic		Capture	Illumina GAIIx	4	51747939	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	superfamily_Chromodomain-like,HMMSmart_CHROMO,HMMPfam_Chromo,superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_SNF2_N,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_BRK,HMMSmart_BRK	p.H146L	ENST00000398510.3	37	c.437		16	.	.	.	.	.	.	.	.	.	.	A	16.86	3.239138	0.58995	.	.	ENSG00000177200	ENST00000447540;ENST00000398510	D;D	0.88046	-2.26;-2.33	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000008	D	0.92080	0.7490	L	0.60455	1.87	0.44547	D	0.997504	B;B;D;B	0.76494	0.005;0.003;0.999;0.005	B;B;D;B	0.80764	0.011;0.005;0.994;0.011	D	0.92859	0.6304	10	0.87932	D	0	-17.9626	16.0085	0.80380	1.0:0.0:0.0:0.0	.	146;146;146;146	Q3L8U1-3;Q3L8U1;Q8NAR9;Q3L8U1-2	.;CHD9_HUMAN;.;.	L	146	ENSP00000396345:H146L;ENSP00000381522:H146L	ENSP00000381522:H146L	H	+	2	0	CHD9	51747939	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.783000	0.75078	2.172000	0.68678	0.528000	0.53228	CAT	-	NULL		0.418	CHD9-020	KNOWN	basic	protein_coding	CHD9	protein_coding	OTTHUMT00000422345.1	A	NM_025134		51747939	+1	no_errors	NM_025134	genbank	human	validated	54_36p	missense	SNP	1.000	T
OLFM4	10562	genome.wustl.edu	37	13	53624717	53624717	+	Silent	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr13:53624717C>A	ENST00000219022.2	+	5	1422	c.1344C>A	c.(1342-1344)acC>acA	p.T448T		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	448	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		CTATGAACACCAGAACAGAAG	0.408																																																0			13											132.0	122.0	126.0					13																	53624717		2203	4300	6503	52522718	SO:0001819	synonymous_variant	10562			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1344C>A	13.37:g.53624717C>A		Somatic		Capture	Illumina GAIIx	4	52522718	O95362|Q5VWG0|Q86T22	Silent	SNP	HMMPfam_OLF,HMMSmart_OLF	p.T448	ENST00000219022.2	37	c.1344	CCDS9440.1	13																																																																																			-	HMMPfam_OLF,HMMSmart_OLF		0.408	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	protein_coding	OTTHUMT00000045112.2	C	NM_006418		52522718	+1	no_errors	NM_006418	genbank	human	reviewed	54_36p	silent	SNP	0.979	A
ERBB3	2065	genome.wustl.edu	37	12	56487326	56487326	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr12:56487326G>C	ENST00000267101.3	+	12	1912	c.1472G>C	c.(1471-1473)aGa>aCa	p.R491T	ERBB3_ENST00000415288.2_Missense_Mutation_p.R432T|ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000553131.1_5'Flank	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	491					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CGGCCGCGCAGAGACTGCGGT	0.567																																																0			12											54.0	53.0	54.0					12																	56487326		2203	4300	6503	54773593	SO:0001583	missense	2065			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1472G>C	12.37:g.56487326G>C	ENSP00000267101:p.Arg491Thr	Somatic		Capture	Illumina GAIIx	4	54773593	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	superfamily_L domain-like,HMMPfam_Recep_L_domain,HMMSmart_SM00261,HMMPfam_Furin-like,superfamily_Growth factor receptor domain,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220	p.R491T	ENST00000267101.3	37	c.1472	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	5.574	0.290778	0.10567	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	T;T	0.76316	-1.01;-1.01	5.06	4.09	0.47781	.	0.278421	0.30620	N	0.009223	T	0.51719	0.1691	N	0.05124	-0.11	0.25821	N	0.984287	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.23655	-1.0182	10	0.26408	T	0.33	.	5.0403	0.14456	0.2558:0.0:0.7442:0.0	.	491;491	B4DGQ7;P21860	.;ERBB3_HUMAN	T	491;432	ENSP00000267101:R491T;ENSP00000408340:R432T	ENSP00000267101:R491T	R	+	2	0	ERBB3	54773593	0.001000	0.12720	0.731000	0.30826	0.025000	0.11179	0.724000	0.25954	2.619000	0.88677	0.655000	0.94253	AGA	-	superfamily_L domain-like,HMMSmart_SM00261		0.567	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	protein_coding	OTTHUMT00000407619.3	G			54773593	+1	no_errors	NM_001982	genbank	human	reviewed	54_36p	missense	SNP	0.013	C
FAM83B	222584	genome.wustl.edu	37	6	54805146	54805146	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr6:54805146G>T	ENST00000306858.7	+	5	1493	c.1377G>T	c.(1375-1377)agG>agT	p.R459S	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	459										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TTGCAGACAGGAATTCAAATG	0.458																																																0			6											61.0	64.0	63.0					6																	54805146		2203	4300	6503	54913105	SO:0001583	missense	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1377G>T	6.37:g.54805146G>T	ENSP00000304078:p.Arg459Ser	Somatic		Capture	Illumina GAIIx	4	54913105	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	HMMPfam_DUF1669,superfamily_SSF56024	p.R459S	ENST00000306858.7	37	c.1377	CCDS34479.1	6	.	.	.	.	.	.	.	.	.	.	G	14.80	2.642242	0.47153	.	.	ENSG00000168143	ENST00000306858	T	0.17691	2.26	5.56	-0.235	0.13071	.	0.120151	0.64402	D	0.000018	T	0.22126	0.0533	M	0.74881	2.28	0.48288	D	0.999627	D	0.89917	1.0	D	0.83275	0.996	T	0.05305	-1.0893	10	0.29301	T	0.29	-25.1974	9.5521	0.39317	0.5378:0.0:0.4622:0.0	.	459	Q5T0W9	FA83B_HUMAN	S	459	ENSP00000304078:R459S	ENSP00000304078:R459S	R	+	3	2	FAM83B	54913105	1.000000	0.71417	0.998000	0.56505	0.672000	0.39443	1.303000	0.33470	0.038000	0.15604	-0.137000	0.14449	AGG	-	NULL		0.458	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	protein_coding	OTTHUMT00000040994.1	G	XM_294139		54913105	+1	no_errors	NM_001010872	genbank	human	validated	54_36p	missense	SNP	1.000	T
AMFR	267	genome.wustl.edu	37	16	56435670	56435670	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr16:56435670G>C	ENST00000290649.5	-	8	1270	c.1060C>G	c.(1060-1062)Ctg>Gtg	p.L354V		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	354					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						CCACAGGGCAGTTTCCGCGCA	0.542																																					Pancreas(2;144 323 39528)											0			16											133.0	126.0	128.0					16																	56435670		2198	4300	6498	54993171	SO:0001583	missense	267			L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.1060C>G	16.37:g.56435670G>C	ENSP00000290649:p.Leu354Val	Somatic		Capture	Illumina GAIIx	4	54993171	P26442|Q8IZ70	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,HMMPfam_CUE,HMMSmart_SM00546	p.L354V	ENST00000290649.5	37	c.1060	CCDS10758.1	16	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790796	0.90367	.	.	ENSG00000159461	ENST00000290649	T	0.57907	0.37	5.63	5.63	0.86233	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.069122	0.64402	D	0.000013	T	0.75982	0.3924	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78540	-0.2165	10	0.87932	D	0	-17.294	19.6949	0.96021	0.0:0.0:1.0:0.0	.	354	Q9UKV5	AMFR2_HUMAN	V	354	ENSP00000290649:L354V	ENSP00000290649:L354V	L	-	1	2	AMFR	54993171	1.000000	0.71417	0.960000	0.40013	0.964000	0.63967	7.806000	0.86020	2.649000	0.89929	0.650000	0.86243	CTG	-	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4		0.542	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMFR	protein_coding	OTTHUMT00000256978.2	G			54993171	-1	no_errors	NM_001144	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DHCR24	1718	genome.wustl.edu	37	1	55319767	55319767	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:55319767C>T	ENST00000371269.3	-	7	1259	c.1161G>A	c.(1159-1161)atG>atA	p.M387I	DHCR24_ENST00000537443.1_Missense_Mutation_p.M171I|DHCR24_ENST00000535035.1_Missense_Mutation_p.M346I	NM_014762.3	NP_055577.1	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase	387					amyloid precursor protein catabolic process (GO:0042987)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cholesterol biosynthetic process (GO:0006695)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|oxidation-reduction process (GO:0055114)|plasminogen activation (GO:0031639)|protein localization (GO:0008104)|Ras protein signal transduction (GO:0007265)|regulation of neuron death (GO:1901214)|response to hormone (GO:0009725)|response to oxidative stress (GO:0006979)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|tissue development (GO:0009888)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	delta24(24-1) sterol reductase activity (GO:0000246)|delta24-sterol reductase activity (GO:0050614)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|peptide antigen binding (GO:0042605)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			large_intestine(2)|liver(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7						TGGGCACCAGCATGTCCTGCA	0.622																																					Pancreas(39;516 1021 24601 30715 32780)											0			1											71.0	62.0	65.0					1																	55319767		2203	4300	6503	55092355	SO:0001583	missense	1718			AF261758	CCDS600.1	1p32.3	2008-02-05			ENSG00000116133	ENSG00000116133			2859	protein-coding gene	gene with protein product		606418				11519011	Standard	NM_014762		Approved	KIAA0018, seladin-1	uc001cyc.1	Q15392	OTTHUMG00000009989	ENST00000371269.3:c.1161G>A	1.37:g.55319767C>T	ENSP00000360316:p.Met387Ile	Somatic		Capture	Illumina GAIIx	4	55092355	B7Z817|D3DQ51|Q9HBA8	Missense_Mutation	SNP	superfamily_FAD-binding_2,HMMPfam_FAD_binding_4	p.M387I	ENST00000371269.3	37	c.1161	CCDS600.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.319780|5.319780	0.95682|0.95682	.|.	.|.	ENSG00000116133|ENSG00000116133	ENST00000436604|ENST00000371269;ENST00000537443;ENST00000535035	.|T;T;T	.|0.67523	.|-0.27;-0.27;-0.27	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73450|0.73450	0.3588|0.3588	L|L	0.53249|0.53249	1.67|1.67	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.58620	.|0.97;0.97;0.983	.|P;P;P	.|0.55615	.|0.629;0.576;0.78	T|T	0.68914|0.68914	-0.5283|-0.5283	5|10	.|0.22109	.|T	.|0.4	-45.0429|-45.0429	18.8078|18.8078	0.92045|0.92045	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|346;346;387	.|B7Z817;B7ZAV4;Q15392	.|.;.;DHC24_HUMAN	T|I	25|387;171;346	.|ENSP00000360316:M387I;ENSP00000439852:M171I;ENSP00000440191:M346I	.|ENSP00000360316:M387I	A|M	-|-	1|3	0|0	DHCR24|DHCR24	55092355|55092355	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.741000|7.741000	0.84997|0.84997	2.534000|2.534000	0.85438|0.85438	0.561000|0.561000	0.74099|0.74099	GCT|ATG	-	NULL		0.622	DHCR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHCR24	protein_coding	OTTHUMT00000027680.1	C	NM_014762		55092355	-1	no_errors	NM_014762	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
RP1	6101	genome.wustl.edu	37	8	55533657	55533657	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr8:55533657G>A	ENST00000220676.1	+	2	279	c.131G>A	c.(130-132)gGa>gAa	p.G44E		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	44	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TACAAGAGCGGAGACCCCCAA	0.542																																					Colon(91;1014 1389 7634 14542 40420)											0			8											106.0	96.0	99.0					8																	55533657		2203	4300	6503	55696210	SO:0001583	missense	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.131G>A	8.37:g.55533657G>A	ENSP00000220676:p.Gly44Glu	Somatic		Capture	Illumina GAIIx	4	55696210		Missense_Mutation	SNP	superfamily_SSF89837,HMMSmart_DCX,HMMPfam_DCX	p.G44E	ENST00000220676.1	37	c.131	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026910	0.93518	.	.	ENSG00000104237	ENST00000220676	D	0.95272	-3.66	5.34	5.34	0.76211	Doublecortin domain (4);	0.000000	0.56097	D	0.000023	D	0.98166	0.9394	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99246	1.0886	10	0.87932	D	0	-18.28	19.0468	0.93022	0.0:0.0:1.0:0.0	.	44	P56715	RP1_HUMAN	E	44	ENSP00000220676:G44E	ENSP00000220676:G44E	G	+	2	0	RP1	55696210	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	9.790000	0.99075	2.498000	0.84270	0.650000	0.86243	GGA	-	superfamily_SSF89837,HMMSmart_DCX		0.542	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	protein_coding	OTTHUMT00000378532.2	G	NM_006269		55696210	+1	no_errors	ENST00000220676	ensembl	human	known	54_36p	missense	SNP	1.000	A
SCN4A	6329	genome.wustl.edu	37	17	62021137	62021137	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:62021137T>A	ENST00000435607.1	-	22	4062	c.3986A>T	c.(3985-3987)aAg>aTg	p.K1329M	SCN4A_ENST00000578147.1_Missense_Mutation_p.K1329M	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1329					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGAGGCTTCTTGGAGCCAAG	0.542																																																0			17											75.0	78.0	77.0					17																	62021137		2140	4288	6428	59374869	SO:0001583	missense	6329			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3986A>T	17.37:g.62021137T>A	ENSP00000396320:p.Lys1329Met	Somatic		Capture	Illumina GAIIx	4	59374869	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,HMMPfam_IQ	p.K1329M	ENST00000435607.1	37	c.3986	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	T	20.7	4.029655	0.75504	.	.	ENSG00000007314	ENST00000435607	D	0.96802	-4.13	3.38	3.38	0.38709	.	0.116742	0.56097	D	0.000022	D	0.98729	0.9573	H	0.98276	4.19	0.54753	D	0.999983	D	0.89917	1.0	D	0.80764	0.994	D	0.98628	1.0670	10	0.87932	D	0	.	11.4387	0.50083	0.0:0.0:0.0:1.0	.	1329	P35499	SCN4A_HUMAN	M	1329	ENSP00000396320:K1329M	ENSP00000396320:K1329M	K	-	2	0	SCN4A	59374869	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.817000	0.86213	1.552000	0.49463	0.368000	0.22195	AAG	-	NULL		0.542	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	protein_coding		T	NM_000334		59374869	-1	no_errors	NM_000334	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
RP11-51O6.1	0	genome.wustl.edu	37	16	61089642	61089642	+	RNA	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr16:61089642G>A	ENST00000591758.1	-	0	226																											TTTGAATATTGTAGTCAGACA	0.438																																																0			16																																								59647143			643358																															16.37:g.61089642G>A		Somatic		Capture	Illumina GAIIx	4	59647143		RNA	SNP	-	NULL	ENST00000591758.1	37	NULL		16																																																																																			-	-		0.438	RP11-51O6.1-002	KNOWN	basic	processed_transcript	LOC643358	pseudogene	OTTHUMT00000460612.1	G			59647143	-1	pseudogene	XR_017145	genbank	human	model	54_36p	rna	SNP	1.000	A
LILRA1	11024	genome.wustl.edu	37	19	55106416	55106416	+	Splice_Site	SNP	A	A	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr19:55106416A>T	ENST00000251372.3	+	4	539	c.357A>T	c.(355-357)acA>acT	p.T119T	LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000453777.1_Splice_Site_p.T119T	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	119	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		TGGTGGTGACAGGTGAGCTGA	0.627																																																0			19											63.0	63.0	63.0					19																	55106416		2203	4300	6503	59798228	SO:0001630	splice_region_variant	11024			AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.358+1A>T	19.37:g.55106416A>T		Somatic		Capture	Illumina GAIIx	4	59798228	O75018|Q3MJA6	Silent	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig	p.T119	ENST00000251372.3	37	c.357	CCDS12901.1	19																																																																																			-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.627	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	protein_coding	OTTHUMT00000140807.2	A	NM_006863	Silent	59798228	+1	no_errors	NM_006863	genbank	human	provisional	54_36p	silent	SNP	1.000	T
ISCA1P1	389293	genome.wustl.edu	37	5	62072856	62072856	+	IGR	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr5:62072856G>A								IPO11 (148447 upstream) : None (None downstream)																							ACTCCATCTTGAATAACTTCT	0.373																																																0			5											93.0	104.0	100.0					5																	62072856		2200	4298	6498	62108612	SO:0001628	intergenic_variant	389293																															5.37:g.62072856G>A		Somatic		Capture	Illumina GAIIx	4	62108612		Nonsense_Mutation	SNP	superfamily_HesB_yadR_yfhF-like,HMMPfam_Fe-S_biosyn	p.Q79*		37	c.235		5																																																																																			-	superfamily_HesB_yadR_yfhF-like,HMMPfam_Fe-S_biosyn	0	0.373					ISCA1L			G			62108612	-1	no_errors	NM_001080540	genbank	human	provisional	54_36p	nonsense	SNP	1.000	A
GANAB	23193	genome.wustl.edu	37	11	62397423	62397423	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr11:62397423C>G	ENST00000356638.3	-	14	1616	c.1600G>C	c.(1600-1602)Gct>Cct	p.A534P	GANAB_ENST00000346178.4_Missense_Mutation_p.A556P|GANAB_ENST00000540933.1_Missense_Mutation_p.A437P|GANAB_ENST00000534779.1_Missense_Mutation_p.A442P	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	534					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	AGGTTGGGAGCTGAGCCCTGG	0.512																																					Melanoma(23;1005 1074 15747 18937)											0			11											82.0	73.0	76.0					11																	62397423		2202	4299	6501	62153999	SO:0001583	missense	23193			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1600G>C	11.37:g.62397423C>G	ENSP00000349053:p.Ala534Pro	Somatic		Capture	Illumina GAIIx	4	62153999	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_31,PatternScan_GLYCOSYL_HYDROL_F31_1,PatternScan_GLYCOSYL_HYDROL_F31_2	p.A556P	ENST00000356638.3	37	c.1666	CCDS8026.1	11	.	.	.	.	.	.	.	.	.	.	C	13.40	2.226523	0.39300	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933	D;D;D;D	0.93133	-3.17;-3.17;-3.17;-3.17	4.99	0.343	0.16001	Glycoside hydrolase, superfamily (1);	0.488396	0.23129	N	0.051620	D	0.89546	0.6746	L	0.42008	1.315	0.29758	N	0.835778	B;B;B;B	0.29552	0.14;0.248;0.064;0.123	B;B;B;B	0.40101	0.319;0.319;0.063;0.037	D	0.83601	0.0128	10	0.72032	D	0.01	-2.3366	3.7565	0.08588	0.4686:0.3213:0.0:0.2101	.	420;442;534;556	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	P	556;534;442;437	ENSP00000340466:A556P;ENSP00000349053:A534P;ENSP00000435306:A442P;ENSP00000442962:A437P	ENSP00000340466:A556P	A	-	1	0	GANAB	62153999	0.979000	0.34478	0.957000	0.39632	0.998000	0.95712	1.450000	0.35134	-0.087000	0.12528	0.655000	0.94253	GCT	-	HMMPfam_Glyco_hydro_31		0.512	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	protein_coding	OTTHUMT00000395689.1	C	NM_198334		62153999	-1	no_errors	NM_198335	genbank	human	validated	54_36p	missense	SNP	0.987	G
SNX1	6642	genome.wustl.edu	37	15	64423921	64423921	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr15:64423921C>G	ENST00000559844.1	+	11	1065	c.1051C>G	c.(1051-1053)Cta>Gta	p.L351V	SNX1_ENST00000353874.4_Missense_Mutation_p.L351V|SNX1_ENST00000561026.1_Missense_Mutation_p.L286V|SNX1_ENST00000261889.5_Missense_Mutation_p.L351V|SNX1_ENST00000560829.1_Missense_Mutation_p.L133V			Q13596	SNX1_HUMAN	sorting nexin 1	351	BAR.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(1)|endometrium(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						TGCAAAGAGTCTAGCCATGCT	0.527																																																0			15											80.0	78.0	79.0					15																	64423921		2203	4300	6503	62210974	SO:0001583	missense	6642			BC000357	CCDS32266.1, CCDS32268.1, CCDS58371.1	15q22.31	2011-05-03			ENSG00000028528	ENSG00000028528		"""Sorting nexins"""	11172	protein-coding gene	gene with protein product		601272				8638121	Standard	NM_003099		Approved	SNX1A, MGC8664, HsT17379, Vps5	uc010uio.2	Q13596		ENST00000559844.1:c.1051C>G	15.37:g.64423921C>G	ENSP00000453785:p.Leu351Val	Somatic		Capture	Illumina GAIIx	4	62210974	A6NM19|A8K6T7|H0Y2M5|O60750|O60751|Q6ZRJ8	Missense_Mutation	SNP	HMMPfam_Sorting_nexin,superfamily_PX domain,HMMPfam_PX,HMMSmart_SM00312,HMMPfam_Vps5	p.L351V	ENST00000559844.1	37	c.1051	CCDS32266.1	15	.	.	.	.	.	.	.	.	.	.	C	3.149	-0.174670	0.06421	.	.	ENSG00000028528	ENST00000380285;ENST00000353874;ENST00000261889	T	0.55413	0.52	5.2	5.2	0.72013	Vps5 C-terminal (1);	0.174951	0.50627	D	0.000104	T	0.44603	0.1301	L	0.28694	0.88	0.43846	D	0.99643	B;B;B;B;B;B;B	0.27951	0.044;0.016;0.016;0.016;0.036;0.195;0.016	B;B;B;B;B;B;B	0.29663	0.058;0.034;0.034;0.034;0.034;0.105;0.034	T	0.32640	-0.9899	10	0.37606	T	0.19	-18.9045	17.8936	0.88879	0.0:1.0:0.0:0.0	.	351;261;351;351;286;351;351	Q6ZRJ8;Q59GU6;Q53HL9;Q53GY8;Q13596-2;A6NKH4;Q13596	.;.;.;.;.;.;SNX1_HUMAN	V	351;351;286	ENSP00000326668:L351V	ENSP00000261889:L286V	L	+	1	2	SNX1	62210974	0.847000	0.29606	1.000000	0.80357	0.998000	0.95712	0.534000	0.23098	2.693000	0.91896	0.561000	0.74099	CTA	-	HMMPfam_Vps5		0.527	SNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX1	protein_coding	OTTHUMT00000418559.1	C	NM_003099		62210974	+1	no_errors	NM_003099	genbank	human	reviewed	54_36p	missense	SNP	0.923	G
LCTL	197021	genome.wustl.edu	37	15	66855949	66855949	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr15:66855949T>G	ENST00000341509.5	-	4	516	c.385A>C	c.(385-387)Aag>Cag	p.K129Q	LCTL_ENST00000563438.1_5'UTR|LCTL_ENST00000537670.1_5'UTR	NM_207338.2	NP_997221.2	Q6UWM7	LCTL_HUMAN	lactase-like	129					carbohydrate metabolic process (GO:0005975)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ATTCCCTTCTTGTTCACCTGC	0.532																																																0			15											125.0	104.0	111.0					15																	66855949		2201	4299	6500	64643003	SO:0001583	missense	197021			AY358729	CCDS10220.1, CCDS61678.1	15q21.3	2008-02-05			ENSG00000188501	ENSG00000188501			15583	protein-coding gene	gene with protein product	"""klotho gamma"", ""KL lactase phlorizin hydrolase"""					12084582	Standard	NM_207338		Approved	KLPH, FLJ33279, KLG	uc002aqc.3	Q6UWM7	OTTHUMG00000133207	ENST00000341509.5:c.385A>C	15.37:g.66855949T>G	ENSP00000343490:p.Lys129Gln	Somatic		Capture	Illumina GAIIx	4	64643003	B3KQY0	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_1,superfamily_Glyco_hydro_cat,PatternScan_GLYCOSYL_HYDROL_F1_2,PatternScan_GLYCOSYL_HYDROL_F1_1	p.K129Q	ENST00000341509.5	37	c.385	CCDS10220.1	15	.	.	.	.	.	.	.	.	.	.	T	0.307	-0.970324	0.02232	.	.	ENSG00000188501	ENST00000341509	T	0.31247	1.5	5.67	-4.72	0.03269	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.686699	0.15423	N	0.263104	T	0.10809	0.0264	N	0.05050	-0.12	0.21719	N	0.999573	B	0.20164	0.042	B	0.25506	0.061	T	0.38023	-0.9680	10	0.07175	T	0.84	-6.7746	9.9814	0.41815	0.0:0.367:0.0918:0.5413	.	129	Q6UWM7	LCTL_HUMAN	Q	129	ENSP00000343490:K129Q	ENSP00000343490:K129Q	K	-	1	0	LCTL	64643003	0.152000	0.22762	0.033000	0.17914	0.281000	0.26958	0.404000	0.20999	-0.704000	0.05042	0.379000	0.24179	AAG	-	HMMPfam_Glyco_hydro_1,superfamily_Glyco_hydro_cat		0.532	LCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCTL	protein_coding	OTTHUMT00000256921.2	T	NM_207338		64643003	-1	no_errors	NM_207338	genbank	human	validated	54_36p	missense	SNP	0.757	G
Unknown	0	genome.wustl.edu	37	9	68455295	68455295	+	IGR	SNP	C	C	A	rs147998434		TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr9:68455295C>A								MIR4477B (39907 upstream) : CR786580.2 (57050 downstream)																							CGGGGAGGAACAGAAGTGTAG	0.557													.|||	1	0.000199681	0.0	0.0014	5008	,	,		13372	0.0		0.0	False		,,,				2504	0.0															0			9																																								67945115	SO:0001628	intergenic_variant	642236																															9.37:g.68455295C>A		Somatic		Capture	Illumina GAIIx	4	67945115		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.557					LOC642236			C			67945115	-1	no_errors	XR_041085	genbank	human	model	54_36p	rna	SNP	0.003	A
WBP2	23558	genome.wustl.edu	37	17	73845688	73845688	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:73845688C>G	ENST00000591399.1	-	4	725	c.301G>C	c.(301-303)Gga>Cga	p.G101R	WBP2_ENST00000254806.3_Missense_Mutation_p.G101R|WBP2_ENST00000344296.4_Missense_Mutation_p.G79R|WBP2_ENST00000590450.1_5'UTR|WBP2_ENST00000590221.1_Missense_Mutation_p.G101R|WBP2_ENST00000433525.2_Missense_Mutation_p.G101R|WBP2_ENST00000585462.1_Missense_Mutation_p.G79R			Q969T9	WBP2_HUMAN	WW domain binding protein 2	101					cellular response to estrogen stimulus (GO:0071391)|establishment of protein localization (GO:0045184)|positive regulation of gene expression, epigenetic (GO:0045815)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nuclear chromatin (GO:0000790)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7			all cancers(21;2.61e-06)|Epithelial(20;2.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CACCTACCTCCCGCTTCCGCC	0.562																																																0			17											163.0	129.0	141.0					17																	73845688		2203	4300	6503	71357283	SO:0001583	missense	23558			U79458	CCDS11731.1	17q25	2008-02-01				ENSG00000132471			12738	protein-coding gene	gene with protein product		606962				7644498	Standard	NM_012478		Approved	WBP-2	uc002jps.3	Q969T9		ENST00000591399.1:c.301G>C	17.37:g.73845688C>G	ENSP00000467579:p.Gly101Arg	Somatic		Capture	Illumina GAIIx	4	71357283	O95638	Missense_Mutation	SNP	HMMPfam_GRAM,HMMPfam_WWbp	p.G101R	ENST00000591399.1	37	c.301	CCDS11731.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.241197	0.95272	.	.	ENSG00000132471	ENST00000254806;ENST00000344296;ENST00000433525;ENST00000431190;ENST00000416574	T;T;T	0.38722	1.12;1.12;1.12	4.77	4.77	0.60923	WW-domain-binding protein (1);	0.000000	0.85682	D	0.000000	T	0.54967	0.1891	L	0.46670	1.46	0.80722	D	1	D;P;P;P	0.57899	0.981;0.927;0.909;0.909	P;P;P;P	0.59171	0.853;0.615;0.534;0.534	T	0.58267	-0.7666	10	0.59425	D	0.04	.	17.8009	0.88586	0.0:1.0:0.0:0.0	.	101;101;101;101	B4DV07;B4DFG2;Q7Z511;Q969T9	.;.;.;WBP2_HUMAN	R	101;79;101;101;101	ENSP00000254806:G101R;ENSP00000341570:G79R;ENSP00000415251:G101R	ENSP00000254806:G101R	G	-	1	0	WBP2	71357283	1.000000	0.71417	0.999000	0.59377	0.909000	0.53808	7.773000	0.85462	2.201000	0.70794	0.561000	0.74099	GGA	-	HMMPfam_WWbp		0.562	WBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP2	protein_coding	OTTHUMT00000448862.1	C	NM_012478		71357283	-1	no_errors	NM_012478	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FOLR1	2348	genome.wustl.edu	37	11	71906336	71906336	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr11:71906336G>A	ENST00000393679.1	+	3	626	c.190G>A	c.(190-192)Gcc>Acc	p.A64T	FOLR1_ENST00000312293.4_Missense_Mutation_p.A64T|FOLR1_ENST00000393676.3_Missense_Mutation_p.A64T|RP11-807H22.7_ENST00000378140.3_RNA|FOLR1_ENST00000393681.2_Missense_Mutation_p.A64T			P15328	FOLR1_HUMAN	folate receptor 1 (adult)	64					cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)			cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	GAGGAAGAATGCCTGCTGTTC	0.532																																																0			11											103.0	95.0	98.0					11																	71906336		2200	4293	6493	71583984	SO:0001583	missense	2348			J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.190G>A	11.37:g.71906336G>A	ENSP00000377284:p.Ala64Thr	Somatic		Capture	Illumina GAIIx	4	71583984	Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Missense_Mutation	SNP	HMMPfam_Folate_rec	p.A64T	ENST00000393679.1	37	c.190	CCDS8211.1	11	.	.	.	.	.	.	.	.	.	.	g	19.49	3.837583	0.71373	.	.	ENSG00000110195	ENST00000312293;ENST00000393681;ENST00000393679;ENST00000393676	T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1	4.66	-8.93	0.00771	Folate receptor-like (1);	0.413171	0.26224	N	0.025607	D	0.85379	0.5683	M	0.85710	2.77	0.24577	N	0.993898	D	0.63046	0.992	D	0.65773	0.938	D	0.83842	0.0258	10	0.62326	D	0.03	-12.9984	19.0893	0.93219	0.0:0.0:0.2489:0.7511	.	64	P15328	FOLR1_HUMAN	T	64	ENSP00000308137:A64T;ENSP00000377286:A64T;ENSP00000377284:A64T;ENSP00000377281:A64T	ENSP00000308137:A64T	A	+	1	0	FOLR1	71583984	0.778000	0.28640	0.004000	0.12327	0.812000	0.45895	0.988000	0.29616	-1.640000	0.01525	0.563000	0.77884	GCC	-	HMMPfam_Folate_rec		0.532	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FOLR1	protein_coding	OTTHUMT00000396773.1	G	NM_016725		71583984	+1	no_errors	NM_000802	genbank	human	reviewed	54_36p	missense	SNP	0.566	A
PALD1	27143	genome.wustl.edu	37	10	72307186	72307186	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr10:72307186T>A	ENST00000263563.6	+	18	2514	c.2246T>A	c.(2245-2247)aTc>aAc	p.I749N		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	749						cytosol (GO:0005829)											GAGATCATCATCTGCACCTAC	0.647																																																0			10											96.0	75.0	82.0					10																	72307186		2203	4300	6503	71977192	SO:0001583	missense	27143			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.2246T>A	10.37:g.72307186T>A	ENSP00000263563:p.Ile749Asn	Somatic		Capture	Illumina GAIIx	4	71977192	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	superfamily_SSF52799	p.I749N	ENST00000263563.6	37	c.2246	CCDS31215.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.77|19.77	3.888595|3.888595	0.72524|0.72524	.|.	.|.	ENSG00000107719|ENSG00000107719	ENST00000426268|ENST00000263563;ENST00000373214	.|T	.|0.36157	.|1.27	4.03|4.03	4.03|4.03	0.46877|0.46877	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.40297|0.40297	0.1111|0.1111	M|M	0.78801|0.78801	2.425|2.425	0.80722|0.80722	D|D	1|1	.|P	.|0.44734	.|0.842	.|B	.|0.39419	.|0.299	T|T	0.52495|0.52495	-0.8568|-0.8568	5|10	.|0.87932	.|D	.|0	-27.9723|-27.9723	12.7978|12.7978	0.57567|0.57567	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|749	.|Q9ULE6	.|PALD_HUMAN	Q|N	129|749;725	.|ENSP00000263563:I749N	.|ENSP00000263563:I749N	H|I	+|+	3|2	2|0	KIAA1274|KIAA1274	71977192|71977192	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.731000|7.731000	0.84895|0.84895	1.707000|1.707000	0.51288|0.51288	0.450000|0.450000	0.29827|0.29827	CAT|ATC	-	NULL		0.647	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1274	protein_coding	OTTHUMT00000048515.2	T	NM_014431		71977192	+1	no_errors	NM_014431	genbank	human	validated	54_36p	missense	SNP	1.000	A
MOB1B	92597	genome.wustl.edu	37	4	71840950	71840950	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr4:71840950T>C	ENST00000309395.2	+	4	557	c.356T>C	c.(355-357)aTg>aCg	p.M119T	MOB1B_ENST00000511449.1_Intron|MOB1B_ENST00000396051.2_Missense_Mutation_p.M124T	NM_001244766.1|NM_173468.3	NP_001231695.1|NP_775739.1	Q7L9L4	MOB1B_HUMAN	MOB kinase activator 1B	119					hippo signaling (GO:0035329)|positive regulation of phosphorylation (GO:0042327)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	kinase activator activity (GO:0019209)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)										GATTACTTGATGACTTGGGTT	0.343																																																0			4											109.0	110.0	110.0					4																	71840950		2203	4300	6503	72059814	SO:0001583	missense	92597			BC038112	CCDS34002.1, CCDS58903.1	4q13.3	2011-09-28	2011-09-28	2011-09-27	ENSG00000173542	ENSG00000173542		"""MOB kinase activators"""	29801	protein-coding gene	gene with protein product	"""Mob4A protein"""	609282	"""MOB1, Mps One Binder kinase activator-like 1A (yeast)"", ""MOB1 Mps One Binder homolog B (yeast)"""	MOBKL1A		15067004	Standard	NM_173468		Approved	MOB4A	uc003hfw.3	Q7L9L4	OTTHUMG00000160844	ENST00000309395.2:c.356T>C	4.37:g.71840950T>C	ENSP00000310189:p.Met119Thr	Somatic		Capture	Illumina GAIIx	4	72059814	B2R8U6|B4DRY3|Q8IY23	Missense_Mutation	SNP	HMMPfam_Mob1_phocein,superfamily_Mob1/phocein	p.M119T	ENST00000309395.2	37	c.356	CCDS34002.1	4	.	.	.	.	.	.	.	.	.	.	T	25.1	4.608245	0.87258	.	.	ENSG00000173542	ENST00000502869;ENST00000309395;ENST00000396051	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.87095	0.6092	H	0.94964	3.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.997;1.0	D	0.90527	0.4493	9	0.87932	D	0	-15.107	16.5763	0.84648	0.0:0.0:0.0:1.0	.	124;119;119	B4DRY3;Q7L9L4;B3KSH6	.;MOB1B_HUMAN;.	T	124;119;124	.	ENSP00000310189:M119T	M	+	2	0	MOBKL1A	72059814	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.887000	0.87295	2.317000	0.78254	0.459000	0.35465	ATG	-	HMMPfam_Mob1_phocein,superfamily_Mob1/phocein		0.343	MOB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOBKL1A	protein_coding	OTTHUMT00000362634.1	T	NM_173468		72059814	+1	no_errors	NM_173468	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DNAH17	8632	genome.wustl.edu	37	17	76446789	76446789	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr17:76446789T>G	ENST00000585328.1	-	67	10983	c.10859A>C	c.(10858-10860)cAc>cCc	p.H3620P	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.H3611P	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3611					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GCTGGCTGTGTGCTTGGTGGT	0.647																																																0			17											77.0	62.0	67.0					17																	76446789		2203	4300	6503	73958384	SO:0001583	missense	8632			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.10859A>C	17.37:g.76446789T>G	ENSP00000465516:p.His3620Pro	Somatic		Capture	Illumina GAIIx	4	73958384	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	HMMPfam_DHC_N1,superfamily_Spectrin repeat,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,PatternScan_THIOL_PROTEASE_HIS,HMMPfam_AAA_5,PatternScan_WD_REPEATS_1,HMMPfam_Dynein_heavy	p.H3620P	ENST00000585328.1	37	c.10859		17	.	.	.	.	.	.	.	.	.	.	T	14.47	2.543677	0.45280	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.52526	0.66	5.37	4.25	0.50352	.	0.091829	0.47455	D	0.000238	T	0.36386	0.0965	L	0.38175	1.15	0.36219	D	0.851893	B	0.26902	0.163	B	0.36808	0.233	T	0.49418	-0.8942	10	0.52906	T	0.07	.	1.546	0.02565	0.3032:0.199:0.0:0.4978	.	3620	E7EUM8	.	P	3620;3611	ENSP00000374490:H3611P	ENSP00000300671:H3620P	H	-	2	0	DNAH17	73958384	0.921000	0.31238	0.972000	0.41901	0.804000	0.45430	0.888000	0.28268	2.018000	0.59344	0.528000	0.53228	CAC	-	NULL		0.647	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	protein_coding	OTTHUMT00000318962.2	T	NM_173628		73958384	-1	no_errors	ENST00000300671	ensembl	human	known	54_36p	missense	SNP	1.000	G
ACADM	34	genome.wustl.edu	37	1	76198414	76198414	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:76198414T>A	ENST00000370841.4	+	3	641	c.204T>A	c.(202-204)gaT>gaA	p.D68E	ACADM_ENST00000543667.1_5'UTR|ACADM_ENST00000541113.1_Missense_Mutation_p.D32E|ACADM_ENST00000420607.2_Missense_Mutation_p.D72E|ACADM_ENST00000370834.5_Missense_Mutation_p.D68E	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	68					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	CAGAATATGATAAAACTGGTG	0.318																																																0			1											78.0	87.0	84.0					1																	76198414		2203	4300	6503	75971002	SO:0001583	missense	34			M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.204T>A	1.37:g.76198414T>A	ENSP00000359878:p.Asp68Glu	Somatic		Capture	Illumina GAIIx	4	75971002	Q5T4U4|Q9NYF1	Missense_Mutation	SNP	superfamily_Acyl-CoA dehydrogenase NM domain-like,HMMPfam_Acyl-CoA_dh_N,HMMPfam_Acyl-CoA_dh_M,PatternScan_ACYL_COA_DH_1,HMMPfam_Acyl-CoA_dh_1,superfamily_Acyl-CoA dehydrogenase C-terminal domain-like,PatternScan_ACYL_COA_DH_2	p.D68E	ENST00000370841.4	37	c.204	CCDS668.1	1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.242277	0.79912	.	.	ENSG00000117054	ENST00000370841;ENST00000370834;ENST00000541113;ENST00000420607	D;D;D;D	0.99716	-6.51;-6.51;-6.51;-6.51	5.57	1.43	0.22495	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99375	0.9780	M	0.73372	2.23	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.99636	1.0987	10	0.66056	D	0.02	.	8.6367	0.33953	0.0:0.3432:0.0:0.6568	.	32;68;68;72;68	B7Z9I1;E9PJM9;Q5T4U5;P11310-2;P11310	.;.;.;.;ACADM_HUMAN	E	68;68;32;72	ENSP00000359878:D68E;ENSP00000359871:D68E;ENSP00000442324:D32E;ENSP00000409612:D72E	ENSP00000359871:D68E	D	+	3	2	ACADM	75971002	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.785000	0.26830	0.371000	0.24564	0.528000	0.53228	GAT	-	superfamily_Acyl-CoA dehydrogenase NM domain-like,HMMPfam_Acyl-CoA_dh_N		0.318	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ACADM	protein_coding	OTTHUMT00000026967.1	T			75971002	+1	no_errors	NM_000016	genbank	human	reviewed	54_36p	missense	SNP	0.975	A
NOXRED1	122945	genome.wustl.edu	37	14	77860981	77860981	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr14:77860981G>T	ENST00000380835.2	-	6	1239	c.1073C>A	c.(1072-1074)tCc>tAc	p.S358Y		NM_001113475.2	NP_001106946.1	Q6NXP6	NXRD1_HUMAN	NADP-dependent oxidoreductase domain containing 1	358					proline biosynthetic process (GO:0006561)		pyrroline-5-carboxylate reductase activity (GO:0004735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9						CTCTTATTGGGATGGAAAGCC	0.438																																																0			14											151.0	134.0	139.0					14																	77860981		1568	3582	5150	76930734	SO:0001583	missense	122945			AK057371	CCDS45142.1	14q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000165555	ENSG00000165555			20487	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 148"""	C14orf148			Standard	NM_001113475		Approved	FLJ32809	uc001xtr.3	Q6NXP6	OTTHUMG00000171554	ENST00000380835.2:c.1073C>A	14.37:g.77860981G>T	ENSP00000370215:p.Ser358Tyr	Somatic		Capture	Illumina GAIIx	4	76930734	B3KQ47|O95435	Missense_Mutation	SNP	PatternScan_P5CR,superfamily_NAD(P)-bd,HMMPfam_F420_oxidored	p.S358Y	ENST00000380835.2	37	c.1073	CCDS45142.1	14	.	.	.	.	.	.	.	.	.	.	G	15.27	2.782998	0.49891	.	.	ENSG00000165555	ENST00000380835	T	0.57907	0.37	4.6	3.7	0.42460	.	0.714947	0.12519	N	0.461807	T	0.48077	0.1480	L	0.54323	1.7	0.19775	N	0.999951	P	0.36616	0.561	B	0.36719	0.231	T	0.44590	-0.9318	10	0.87932	D	0	-0.4318	8.9499	0.35783	0.1059:0.0:0.8941:0.0	.	358	Q6NXP6	NXRD1_HUMAN	Y	358	ENSP00000370215:S358Y	ENSP00000370215:S358Y	S	-	2	0	C14orf148	76930734	0.223000	0.23663	0.002000	0.10522	0.022000	0.10575	1.772000	0.38552	1.051000	0.40369	0.563000	0.77884	TCC	-	NULL		0.438	NOXRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf148	protein_coding	OTTHUMT00000414103.1	G	NM_138791		76930734	-1	no_errors	ENST00000380835	ensembl	human	known	54_36p	missense	SNP	0.015	T
FAM73A	374986	genome.wustl.edu	37	1	78276566	78276566	+	Intron	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:78276566G>A	ENST00000370791.3	+	6	669				FAM73A_ENST00000443751.2_Intron	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A							integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		TGCAAAGTTTGATGTAGATGA	0.368																																																0			1																																								78049154	SO:0001627	intron_variant	653631				CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.638-2853G>A	1.37:g.78276566G>A		Somatic		Capture	Illumina GAIIx	4	78049154	Q6MZG0	Nonsense_Mutation	SNP	superfamily_Domain from hypothetical 2610208m17rik protein,HMMPfam_DUF1855	p.Q301*	ENST00000370791.3	37	c.901	CCDS681.1	1																																																																																			-	HMMPfam_DUF1855		0.368	FAM73A-001	KNOWN	basic|CCDS	protein_coding	LOC653631	protein_coding	OTTHUMT00000026931.1	G	NM_198549		78049154	-1	no_errors	XM_930476	genbank	human	model	54_36p	nonsense	SNP	1.000	A
POLR1A	25885	genome.wustl.edu	37	2	86254644	86254644	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr2:86254644A>T	ENST00000263857.6	-	34	5443	c.5065T>A	c.(5065-5067)Tcc>Acc	p.S1689T	POLR1A_ENST00000409681.1_Missense_Mutation_p.S1628T			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1689					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						TCATCGTGGGATCCTGACAGA	0.547																																																0			2											65.0	68.0	67.0					2																	86254644		2077	4219	6296	86108155	SO:0001583	missense	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.5065T>A	2.37:g.86254644A>T	ENSP00000263857:p.Ser1689Thr	Somatic		Capture	Illumina GAIIx	4	86108155	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	superfamily_beta and beta-prime subunits of DNA dependent RNA-polymerase,HMMPfam_RNA_pol_Rpb1_1,HMMSmart_SM00663,HMMPfam_RNA_pol_Rpb1_2,HMMPfam_RNA_pol_Rpb1_3,HMMPfam_RNA_pol_Rpb1_4,HMMPfam_RNA_pol_Rpb1_5	p.S1689T	ENST00000263857.6	37	c.5065	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	A	14.32	2.499291	0.44455	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.67523	-0.27;-0.27	5.37	2.79	0.32731	.	0.125534	0.56097	D	0.000039	T	0.42899	0.1223	N	0.19112	0.55	0.48975	D	0.999733	P	0.43094	0.799	B	0.31869	0.137	T	0.42498	-0.9448	10	0.28530	T	0.3	-23.0648	11.302	0.49311	0.6731:0.3269:0.0:0.0	.	1689	O95602	RPA1_HUMAN	T	1689;1628	ENSP00000263857:S1689T;ENSP00000386300:S1628T	ENSP00000263857:S1689T	S	-	1	0	POLR1A	86108155	0.981000	0.34729	1.000000	0.80357	0.983000	0.72400	1.751000	0.38339	2.028000	0.59812	0.533000	0.62120	TCC	-	superfamily_beta and beta-prime subunits of DNA dependent RNA-polymerase		0.547	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	protein_coding	OTTHUMT00000329830.2	A	NM_015425		86108155	-1	no_errors	NM_015425	genbank	human	validated	54_36p	missense	SNP	0.998	T
E2F5	1875	genome.wustl.edu	37	8	86124416	86124416	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr8:86124416T>C	ENST00000416274.2	+	7	942	c.908T>C	c.(907-909)aTt>aCt	p.I303T	E2F5_ENST00000418930.2_Missense_Mutation_p.I302T|E2F5_ENST00000519128.1_3'UTR|E2F5_ENST00000517476.1_Missense_Mutation_p.I142T|E2F5_ENST00000521429.1_Missense_Mutation_p.I130T|E2F5_ENST00000256117.5_Missense_Mutation_p.I304T	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	303	Transactivation. {ECO:0000255}.				gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						GGAGATATCATTGATGAGTTA	0.289																																																0			8											97.0	94.0	95.0					8																	86124416		1829	4084	5913	86311668	SO:0001583	missense	1875			X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.908T>C	8.37:g.86124416T>C	ENSP00000398124:p.Ile303Thr	Somatic		Capture	Illumina GAIIx	4	86311668	E9PBN9|Q16601|Q92756	Missense_Mutation	SNP	superfamily_SSF46785,HMMPfam_E2F_TDP	p.I303T	ENST00000416274.2	37	c.908	CCDS47885.1	8	.	.	.	.	.	.	.	.	.	.	T	16.29	3.081852	0.55861	.	.	ENSG00000133740	ENST00000418930;ENST00000256117;ENST00000416274;ENST00000517476;ENST00000521429;ENST00000518234	D;D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39;-2.39	5.28	5.28	0.74379	.	0.049591	0.85682	D	0.000000	D	0.91570	0.7337	M	0.62723	1.935	0.58432	D	0.999999	D;P;P	0.67145	0.996;0.804;0.828	P;B;B	0.61477	0.889;0.184;0.219	D	0.89223	0.3572	10	0.13470	T	0.59	-16.6814	15.1973	0.73104	0.0:0.0:0.0:1.0	.	130;302;303	E5RHD4;Q15329-2;Q15329	.;.;E2F5_HUMAN	T	302;304;303;142;130;139	ENSP00000414312:I302T;ENSP00000256117:I304T;ENSP00000398124:I303T;ENSP00000429120:I142T;ENSP00000428606:I130T;ENSP00000429669:I139T	ENSP00000256117:I304T	I	+	2	0	E2F5	86311668	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.084000	0.76866	1.979000	0.57680	0.482000	0.46254	ATT	-	NULL		0.289	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	E2F5	protein_coding	OTTHUMT00000380274.1	T	NM_001951		86311668	+1	no_errors	NM_001951	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
VGLL3	389136	genome.wustl.edu	37	3	87017809	87017809	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr3:87017809C>G	ENST00000398399.2	-	3	1231	c.868G>C	c.(868-870)Gct>Cct	p.A290P	VGLL3_ENST00000383698.3_Missense_Mutation_p.A290P	NM_016206.2	NP_057290.2			vestigial-like family member 3											NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		GCTGAGGTAGCAGAGGTGACT	0.517																																																0			3											84.0	85.0	85.0					3																	87017809		2080	4203	6283	87100499	SO:0001583	missense	389136			AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.868G>C	3.37:g.87017809C>G	ENSP00000381436:p.Ala290Pro	Somatic		Capture	Illumina GAIIx	4	87100499		Missense_Mutation	SNP	HMMPfam_Vg_Tdu,HMMSmart_SM00711	p.A290P	ENST00000398399.2	37	c.868	CCDS43110.1	3	.	.	.	.	.	.	.	.	.	.	C	16.89	3.246877	0.59103	.	.	ENSG00000206538	ENST00000398399;ENST00000383698	T;T	0.52983	0.64;0.69	5.77	5.77	0.91146	.	0.069900	0.56097	D	0.000023	T	0.48314	0.1493	L	0.54323	1.7	0.44711	D	0.997702	B	0.19073	0.033	B	0.18561	0.022	T	0.34378	-0.9831	10	0.41790	T	0.15	-9.2068	19.5912	0.95511	0.0:1.0:0.0:0.0	.	290	A8MV65	VGLL3_HUMAN	P	290	ENSP00000381436:A290P;ENSP00000373199:A290P	ENSP00000373199:A290P	A	-	1	0	VGLL3	87100499	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.738000	0.55067	2.744000	0.94065	0.561000	0.74099	GCT	-	NULL		0.517	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VGLL3	protein_coding	OTTHUMT00000352805.1	C	NM_016206		87100499	-1	no_errors	NM_016206	genbank	human	validated	54_36p	missense	SNP	1.000	G
SPATA7	55812	genome.wustl.edu	37	14	88904580	88904580	+	Silent	SNP	G	G	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr14:88904580G>C	ENST00000393545.4	+	12	1903	c.1614G>C	c.(1612-1614)gtG>gtC	p.V538V	SPATA7_ENST00000045347.7_Intron|SPATA7_ENST00000556553.1_Silent_p.V506V|SPATA7_ENST00000356583.5_Silent_p.V506V	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	538					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						AAACTTCTGTGAATGTCATTG	0.373																																																0			14											95.0	85.0	89.0					14																	88904580		2203	4300	6503	87974333	SO:0001819	synonymous_variant	55812			AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.1614G>C	14.37:g.88904580G>C		Somatic		Capture	Illumina GAIIx	4	87974333	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Silent	SNP	NULL	p.V538	ENST00000393545.4	37	c.1614	CCDS9883.1	14																																																																																			-	NULL		0.373	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA7	protein_coding	OTTHUMT00000410172.1	G			87974333	+1	no_errors	NM_018418	genbank	human	validated	54_36p	silent	SNP	0.111	C
KLHL8	57563	genome.wustl.edu	37	4	88091765	88091765	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr4:88091765C>A	ENST00000273963.5	-	7	1552	c.1211G>T	c.(1210-1212)cGa>cTa	p.R404L	KLHL8_ENST00000545252.1_Missense_Mutation_p.R53L|KLHL8_ENST00000498875.2_Missense_Mutation_p.R328L|KLHL8_ENST00000425278.2_Missense_Mutation_p.R221L|KLHL8_ENST00000512111.1_Missense_Mutation_p.R404L	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	404					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)		p.R404Q(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		GGCAATTCCTCGCCTGCAAAG	0.348																																																1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	4											75.0	65.0	68.0					4																	88091765		2203	4300	6503	88310789	SO:0001583	missense	57563			AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1211G>T	4.37:g.88091765C>A	ENSP00000273963:p.Arg404Leu	Somatic		Capture	Illumina GAIIx	4	88310789	Q53XA3|Q6N018	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMPfam_Kelch_1,HMMSmart_SM00612	p.R404L	ENST00000273963.5	37	c.1211	CCDS3617.1	4	.	.	.	.	.	.	.	.	.	.	C	32	5.138998	0.94560	.	.	ENSG00000145332	ENST00000273963;ENST00000498875;ENST00000425278;ENST00000545252;ENST00000512111	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	5.54	5.54	0.83059	Galactose oxidase, beta-propeller (1);	0.052408	0.85682	D	0.000000	D	0.85323	0.5670	L	0.47016	1.485	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.85130	0.981;0.996;0.997	D	0.84169	0.0433	10	0.42905	T	0.14	.	19.4987	0.95085	0.0:1.0:0.0:0.0	.	221;328;404	Q68DU9;Q6N018;Q9P2G9	.;.;KLHL8_HUMAN	L	404;328;221;53;404	ENSP00000273963:R404L;ENSP00000426451:R328L;ENSP00000408854:R221L;ENSP00000439514:R53L;ENSP00000424131:R404L	ENSP00000273963:R404L	R	-	2	0	KLHL8	88310789	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.437000	0.80417	2.609000	0.88269	0.460000	0.39030	CGA	-	superfamily_Galactose oxidase central domain,HMMSmart_SM00612,HMMPfam_Kelch_1		0.348	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL8	protein_coding	OTTHUMT00000253040.1	C			88310789	-1	no_errors	NM_020803	genbank	human	validated	54_36p	missense	SNP	1.000	A
AKAP9	10142	genome.wustl.edu	37	7	91731967	91731967	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:91731967G>C	ENST00000359028.2	+	46	11394	c.11169G>C	c.(11167-11169)aaG>aaC	p.K3723N	AKAP9_ENST00000358100.2_Missense_Mutation_p.K3669N|AKAP9_ENST00000356239.3_Missense_Mutation_p.K3719N			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3723					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTTACCAGAAGAAATACCTGC	0.453			T	BRAF	papillary thyroid																																		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0			7											87.0	91.0	89.0					7																	91731967		2203	4300	6503	91569903	SO:0001583	missense	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.11169G>C	7.37:g.91731967G>C	ENSP00000351922:p.Lys3723Asn	Somatic		Capture	Illumina GAIIx	4	91569903	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	PatternScan_CPSASE_2,HMMPfam_PACT_coil_coil	p.K3719N	ENST00000359028.2	37	c.11157		7	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702994	0.48412	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.24723	1.98;2.01;2.07;1.84	5.32	2.54	0.30619	Pericentrin/AKAP-450 centrosomal targeting domain (1);	0.000000	0.39407	N	0.001365	T	0.52175	0.1718	M	0.87456	2.885	0.50632	D	0.999889	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.999	T	0.54715	-0.8252	10	0.87932	D	0	.	9.9004	0.41344	0.2873:0.0:0.7127:0.0	.	994;3723;3723;3719;3711	B3KQF9;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	N	3719;3723;3669;3723;1565	ENSP00000348573:K3719N;ENSP00000351922:K3723N;ENSP00000350813:K3669N;ENSP00000378042:K1565N	ENSP00000348573:K3719N	K	+	3	2	AKAP9	91569903	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.452000	0.60054	0.383000	0.24910	-0.237000	0.12165	AAG	-	HMMPfam_PACT_coil_coil		0.453	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	protein_coding		G	NM_005751		91569903	+1	no_errors	NM_005751	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MCTP2	55784	genome.wustl.edu	37	15	94927339	94927339	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr15:94927339C>A	ENST00000357742.4	+	12	1671	c.1671C>A	c.(1669-1671)aaC>aaA	p.N557K	MCTP2_ENST00000451018.3_Missense_Mutation_p.N557K|MCTP2_ENST00000557742.1_Missense_Mutation_p.N145K|MCTP2_ENST00000331706.4_Missense_Mutation_p.N145K	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	557	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CTGAATGGAACAAAGTTTTTA	0.418																																																0			15											106.0	90.0	95.0					15																	94927339		2197	4298	6495	92728343	SO:0001583	missense	55784			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1671C>A	15.37:g.94927339C>A	ENSP00000350377:p.Asn557Lys	Somatic		Capture	Illumina GAIIx	4	92728343	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.N557K	ENST00000357742.4	37	c.1671	CCDS32338.1	15	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013413	0.75161	.	.	ENSG00000140563	ENST00000451018;ENST00000331706;ENST00000357742	T;T;T	0.72051	-0.62;-0.62;-0.62	5.95	5.03	0.67393	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.123535	0.85682	D	0.000000	T	0.82001	0.4942	M	0.80508	2.5	0.80722	D	1	P;P;P	0.45957	0.859;0.652;0.869	P;P;P	0.56788	0.724;0.449;0.806	D	0.83803	0.0237	10	0.72032	D	0.01	.	14.5827	0.68302	0.0:0.9307:0.0:0.0693	.	557;145;557	Q6DN12-2;Q6DN12-4;Q6DN12	.;.;MCTP2_HUMAN	K	557;145;557	ENSP00000395109:N557K;ENSP00000329646:N145K;ENSP00000350377:N557K	ENSP00000329646:N145K	N	+	3	2	MCTP2	92728343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.890000	0.39728	2.824000	0.97209	0.655000	0.94253	AAC	-	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2		0.418	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	protein_coding	OTTHUMT00000415060.3	C	NM_018349		92728343	+1	no_errors	NM_018349	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ATP5J2	9551	genome.wustl.edu	37	7	99056849	99056849	+	Silent	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:99056849C>T	ENST00000292475.3	-	3	366	c.177G>A	c.(175-177)aaG>aaA	p.K59K	ATP5J2_ENST00000359832.4_Intron|PTCD1_ENST00000555673.1_Intron|ATP5J2-PTCD1_ENST00000413834.1_Intron|ATP5J2_ENST00000394186.3_Silent_p.K53K|ATP5J2_ENST00000488775.1_Intron|ATP5J2-PTCD1_ENST00000437572.1_Intron|ATP5J2_ENST00000544611.1_Silent_p.K53K|ATP5J2_ENST00000466753.1_Intron|ATP5J2_ENST00000449683.1_Silent_p.K63K	NM_004889.3	NP_004880.1	P56134	ATPK_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2	59					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|nucleus (GO:0005634)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	transmembrane transporter activity (GO:0022857)			large_intestine(1)|ovary(1)	2	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TGCTCCCCTTCTTCACATTGA	0.517											OREG0018190	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			7											159.0	115.0	130.0					7																	99056849		2203	4300	6503	98894785	SO:0001819	synonymous_variant	9551			AF047436	CCDS5665.1, CCDS34692.1, CCDS47653.1, CCDS47654.1	7q22.1	2012-10-12	2010-06-11		ENSG00000241468	ENSG00000241468		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	848	protein-coding gene	gene with protein product	"""F1Fo-ATPase synthase f subunit"", ""ATP synthase f chain, mitochondrial"", ""F1Fo-ATP synthase complex Fo membrane domain f subunit"""		"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit f, isoform 2"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2"""			9653160	Standard	NM_004889		Approved	F1Fo-ATPase, ATP5JL		P56134	OTTHUMG00000154609	ENST00000292475.3:c.177G>A	7.37:g.99056849C>T		Somatic	1340	Capture	Illumina GAIIx	4	98894785	C9J8H9|F8W7V3|O76079|Q6IBB3|Q96L83|Q9BTI8	Silent	SNP	HMMPfam_WRW	p.K59	ENST00000292475.3	37	c.177	CCDS5665.1	7																																																																																			-	HMMPfam_WRW		0.517	ATP5J2-001	KNOWN	basic|CCDS	protein_coding	ATP5J2	protein_coding	OTTHUMT00000336263.1	C	NM_004889		98894785	-1	no_errors	NM_004889	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
NR1H4	9971	genome.wustl.edu	37	12	100897200	100897200	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr12:100897200T>A	ENST00000551379.1	+	1	63	c.35T>A	c.(34-36)aTt>aAt	p.I12N	NR1H4_ENST00000392986.3_Intron|NR1H4_ENST00000188403.7_Missense_Mutation_p.I12N|NR1H4_ENST00000548884.1_Intron|NR1H4_ENST00000549996.1_Intron|NR1H4_ENST00000546380.1_Intron			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	12					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	GAAAATCCAATTCAAATTAGT	0.443																																																0			12											42.0	40.0	41.0					12																	100897200		876	1991	2867	99421331	SO:0001583	missense	9971			U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.35T>A	12.37:g.100897200T>A	ENSP00000447149:p.Ile12Asn	Somatic		Capture	Illumina GAIIx	4	99421331	A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Missense_Mutation	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.I12N	ENST00000551379.1	37	c.35	CCDS55876.1	12	.	.	.	.	.	.	.	.	.	.	T	14.25	2.479231	0.44044	.	.	ENSG00000012504	ENST00000551379;ENST00000188403	D;D	0.93488	-3.23;-3.18	5.75	-4.21	0.03812	.	1.315740	0.04802	N	0.433598	D	0.84534	0.5493	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.69895	-0.5021	10	0.87932	D	0	.	1.4608	0.02395	0.2198:0.3233:0.1129:0.344	.	12;12	Q96RI1;Q96RI1-4	NR1H4_HUMAN;.	N	12	ENSP00000447149:I12N;ENSP00000188403:I12N	ENSP00000188403:I12N	I	+	2	0	NR1H4	99421331	0.000000	0.05858	0.000000	0.03702	0.492000	0.33523	-0.684000	0.05173	-0.958000	0.03622	0.528000	0.53228	ATT	-	NULL		0.443	NR1H4-006	KNOWN	basic|CCDS	protein_coding	NR1H4	protein_coding	OTTHUMT00000409140.1	T	NM_005123		99421331	+1	no_errors	ENST00000188403	ensembl	human	known	54_36p	missense	SNP	0.000	A
PCDH19	57526	genome.wustl.edu	37	X	99661900	99661900	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chrX:99661900G>A	ENST00000373034.4	-	1	3371	c.1696C>T	c.(1696-1698)Cca>Tca	p.P566S	PCDH19_ENST00000420881.2_Missense_Mutation_p.P566S|PCDH19_ENST00000255531.7_Missense_Mutation_p.P566S	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	566					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						ATCAGAGGTGGGGCTGTGATG	0.592																																																0			X											113.0	110.0	111.0					X																	99661900		2143	4217	6360	99548556	SO:0001583	missense	57526			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1696C>T	X.37:g.99661900G>A	ENSP00000362125:p.Pro566Ser	Somatic		Capture	Illumina GAIIx	4	99548556	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.P566S	ENST00000373034.4	37	c.1696	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	G	17.77	3.471586	0.63737	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.60040	0.22;0.22;0.22	5.84	5.84	0.93424	Cadherin (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.73225	0.3560	L	0.49126	1.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	T	0.74899	-0.3507	10	0.87932	D	0	.	19.0738	0.93151	0.0:0.0:1.0:0.0	.	566;566;566	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	S	566	ENSP00000400327:P566S;ENSP00000362125:P566S;ENSP00000255531:P566S	ENSP00000255531:P566S	P	-	1	0	PCDH19	99548556	1.000000	0.71417	0.976000	0.42696	0.735000	0.41995	9.869000	0.99810	2.454000	0.82982	0.513000	0.50165	CCA	-	superfamily_Cadherin		0.592	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	protein_coding	OTTHUMT00000057479.2	G	NM_020766		99548556	-1	no_errors	NM_001105243	genbank	human	validated	54_36p	missense	SNP	1.000	A
DCBLD2	131566	genome.wustl.edu	37	3	98541108	98541108	+	Missense_Mutation	SNP	T	T	C	rs200547215		TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr3:98541108T>C	ENST00000326840.6	-	6	1156	c.794A>G	c.(793-795)tAt>tGt	p.Y265C	DCBLD2_ENST00000469648.1_5'Flank|DCBLD2_ENST00000326857.9_Missense_Mutation_p.Y265C	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	265	LCCL. {ECO:0000255|PROSITE- ProRule:PRU00123}.				cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						AGAACTTTCATAATAGGGGAT	0.403																																																0			3						T	CYS/TYR	1,3781		0,1,1890	66.0	59.0	61.0		794	5.8	1.0	3		61	0,8240		0,0,4120	no	missense	DCBLD2	NM_080927.3	194	0,1,6010	CC,CT,TT		0.0,0.0264,0.0083	probably-damaging	265/776	98541108	1,12021	1891	4120	6011	100023798	SO:0001583	missense	131566				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.794A>G	3.37:g.98541108T>C	ENSP00000321573:p.Tyr265Cys	Somatic		Capture	Illumina GAIIx	4	100023798	B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_LCCL domain,HMMSmart_SM00603,HMMPfam_LCCL,HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1	p.Y265C	ENST00000326840.6	37	c.794	CCDS46878.1	3	.	.	.	.	.	.	.	.	.	.	T	24.5	4.534346	0.85812	2.64E-4	0.0	ENSG00000057019	ENST00000326840;ENST00000404023;ENST00000326857	D;D	0.93953	-3.32;-3.32	5.83	5.83	0.93111	LCCL (5);	0.000000	0.85682	D	0.000000	D	0.97517	0.9187	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98025	1.0373	10	0.51188	T	0.08	-16.2429	14.1414	0.65322	0.0:0.0:0.0:1.0	.	265;265	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	C	265;219;265	ENSP00000321573:Y265C;ENSP00000321646:Y265C	ENSP00000321573:Y265C	Y	-	2	0	DCBLD2	100023798	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	7.449000	0.80643	2.222000	0.72286	0.477000	0.44152	TAT	-	superfamily_LCCL domain,HMMSmart_SM00603,HMMPfam_LCCL		0.403	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCBLD2	protein_coding	OTTHUMT00000324675.2	T	NM_080927		100023798	-1	no_errors	NM_080927	genbank	human	validated	54_36p	missense	SNP	1.000	C
IL1RAPL2	26280	genome.wustl.edu	37	X	105011403	105011403	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chrX:105011403C>T	ENST00000372582.1	+	11	2566	c.1810C>T	c.(1810-1812)Cct>Tct	p.P604S	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.P604S	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	604					central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GGCTGATCTCCCTGAATTCCA	0.488																																																0			X											105.0	91.0	96.0					X																	105011403		2203	4300	6503	104898059	SO:0001583	missense	26280			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1810C>T	X.37:g.105011403C>T	ENSP00000361663:p.Pro604Ser	Somatic		Capture	Illumina GAIIx	4	104898059	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.P604S	ENST00000372582.1	37	c.1810	CCDS14517.1	X	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.528075	0.00959	.	.	ENSG00000189108	ENST00000372582;ENST00000344799;ENST00000538500	T;T;T	0.04015	4.02;4.02;3.73	5.89	3.96	0.45880	.	0.504809	0.20026	N	0.100814	T	0.01592	0.0051	N	0.04297	-0.235	0.23473	N	0.997608	B	0.10296	0.003	B	0.08055	0.003	T	0.51702	-0.8672	10	0.02654	T	1	.	1.1536	0.01791	0.2792:0.401:0.1399:0.1799	.	604	Q9NP60	IRPL2_HUMAN	S	604;604;209	ENSP00000361663:P604S;ENSP00000344976:P604S;ENSP00000445576:P209S	ENSP00000344976:P604S	P	+	1	0	IL1RAPL2	104898059	0.984000	0.35163	0.999000	0.59377	0.471000	0.32888	0.938000	0.28965	2.492000	0.84095	0.597000	0.82753	CCT	-	NULL		0.488	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL2	protein_coding	OTTHUMT00000057785.1	C	NM_017416		104898059	+1	no_errors	NM_017416	genbank	human	reviewed	54_36p	missense	SNP	0.965	T
NEURL1	9148	genome.wustl.edu	37	10	105330869	105330869	+	Splice_Site	SNP	A	A	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr10:105330869A>T	ENST00000369780.4	+	2	735	c.326A>T	c.(325-327)aAg>aTg	p.K109M	NEURL_ENST00000369777.2_Splice_Site_p.K92M	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		109	NHR 1. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GTCAGGCTGAAGGTGGGCCTG	0.667																																																0			10											32.0	30.0	31.0					10																	105330869		2202	4298	6500	105320859	SO:0001630	splice_region_variant	9148																														ENST00000369780.4:c.327+1A>T	10.37:g.105330869A>T		Somatic		Capture	Illumina GAIIx	4	105320859	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	HMMSmart_SM00588,HMMPfam_Neuralized,superfamily_RING/U-box	p.K109M	ENST00000369780.4	37	c.326	CCDS7551.1	10	.	.	.	.	.	.	.	.	.	.	A	22.9	4.344280	0.82022	.	.	ENSG00000107954	ENST00000369780;ENST00000437579;ENST00000369777;ENST00000455386	.	.	.	5.23	5.23	0.72850	NEUZ (3);	0.000000	0.85682	D	0.000000	T	0.76004	0.3927	L	0.58669	1.825	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78853	-0.2040	9	0.87932	D	0	-0.1418	15.1114	0.72359	1.0:0.0:0.0:0.0	.	109	O76050	NEU1A_HUMAN	M	109;92;92;34	.	ENSP00000358792:K92M	K	+	2	0	NEURL	105320859	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.824000	0.92023	1.957000	0.56846	0.459000	0.35465	AAG	-	HMMSmart_SM00588,HMMPfam_Neuralized		0.667	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEURL	protein_coding	OTTHUMT00000050170.1	A		Missense_Mutation	105320859	+1	no_errors	NM_004210	genbank	human	validated	54_36p	missense	SNP	1.000	T
GUCY1A2	2977	genome.wustl.edu	37	11	106698267	106698267	+	Intron	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr11:106698267T>C	ENST00000526355.2	-	5	1675				GUCY1A2_ENST00000347596.2_Intron|GUCY1A2_ENST00000282249.2_Intron	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	ATATCAACTTTGGTTTAGCTC	0.378																																																0			11																																								106203477	SO:0001627	intron_variant	642732			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1207-17063A>G	11.37:g.106698267T>C		Somatic		Capture	Illumina GAIIx	4	106203477	A1L4C4|B7ZLT5	RNA	SNP	-	NULL	ENST00000526355.2	37	NULL	CCDS8335.1	11																																																																																			-	-		0.378	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	LOC642732	protein_coding	OTTHUMT00000389003.2	T			106203477	-1	pseudogene	XR_016381	genbank	human	model	54_36p	rna	SNP	0.960	C
COL4A6	1288	genome.wustl.edu	37	X	107402842	107402842	+	Silent	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chrX:107402842G>A	ENST00000372216.4	-	44	4765	c.4665C>T	c.(4663-4665)ccC>ccT	p.P1555P	COL4A6_ENST00000545689.1_Silent_p.P1530P|COL4A6_ENST00000418180.1_Silent_p.P89P|COL4A6_ENST00000394872.2_Silent_p.P1555P|COL4A6_ENST00000538570.1_Silent_p.P1497P|COL4A6_ENST00000334504.7_Silent_p.P1554P	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1555	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						TCTGGCTGACGGGCATCATGG	0.572									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											0			X											128.0	107.0	114.0					X																	107402842		2203	4300	6503	107289498	SO:0001819	synonymous_variant	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.4665C>T	X.37:g.107402842G>A		Somatic		Capture	Illumina GAIIx	4	107289498	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	HMMPfam_Collagen,HMMPfam_C4,HMMSmart_SM00111,superfamily_C-type lectin-like	p.P1555	ENST00000372216.4	37	c.4665	CCDS14541.1	X																																																																																			-	HMMPfam_C4,HMMSmart_SM00111,superfamily_C-type lectin-like		0.572	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	protein_coding	OTTHUMT00000057875.2	G			107289498	-1	no_errors	NM_001847	genbank	human	reviewed	54_36p	silent	SNP	0.898	A
KCNV1	27012	genome.wustl.edu	37	8	110984496	110984496	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr8:110984496G>A	ENST00000524391.1	-	3	2014	c.982C>T	c.(982-984)Cat>Tat	p.H328Y	KCNV1_ENST00000297404.1_Missense_Mutation_p.H328Y|RP11-696P8.2_ENST00000530667.1_RNA			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	328					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CCTGTGGAATGTCTGCCCAGC	0.502																																																0			8											63.0	61.0	62.0					8																	110984496		2203	4300	6503	111053672	SO:0001583	missense	27012			AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.982C>T	8.37:g.110984496G>A	ENSP00000435954:p.His328Tyr	Somatic		Capture	Illumina GAIIx	4	111053672	Q9UHJ4	Missense_Mutation	SNP	superfamily_POZ domain,HMMSmart_SM00225,HMMPfam_K_tetra,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.H328Y	ENST00000524391.1	37	c.982	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685402	0.88639	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	D;D	0.98437	-4.93;-4.93	5.95	5.95	0.96441	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98055	0.9359	N	0.25992	0.78	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.99857	1.1078	10	0.87932	D	0	.	19.3629	0.94448	0.0:0.0:1.0:0.0	.	328	Q6PIU1	KCNV1_HUMAN	Y	328;328;204	ENSP00000435954:H328Y;ENSP00000297404:H328Y	ENSP00000297404:H328Y	H	-	1	0	KCNV1	111053672	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.869000	0.99810	2.817000	0.96982	0.563000	0.77884	CAT	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.502	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	protein_coding	OTTHUMT00000385525.1	G	NM_014379		111053672	-1	no_errors	NM_014379	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DOCK4	9732	genome.wustl.edu	37	7	111487070	111487070	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:111487070G>C	ENST00000437633.1	-	24	2842	c.2586C>G	c.(2584-2586)atC>atG	p.I862M	DOCK4_ENST00000428084.1_Missense_Mutation_p.I862M	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	862					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				TATTTTTCTTGATAAGACAAA	0.388																																																0			7											119.0	117.0	117.0					7																	111487070		1883	4108	5991	111274306	SO:0001583	missense	9732				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.2586C>G	7.37:g.111487070G>C	ENSP00000404179:p.Ile862Met	Somatic		Capture	Illumina GAIIx	4	111274306	O14584|O94824|Q8NB45	Missense_Mutation	SNP	superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2	p.I862M	ENST00000437633.1	37	c.2586	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.38|14.38	2.519496|2.519496	0.44866|0.44866	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250|ENST00000423057;ENST00000445943	T;T|.	0.66815|.	-0.23;-0.23|.	6.03|6.03	5.14|5.14	0.70334|0.70334	.|.	0.147481|.	0.64402|.	D|.	0.000011|.	T|.	0.69424|.	0.3109|.	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	B;B;B|.	0.24258|.	0.061;0.061;0.1|.	B;B;B|.	0.28991|.	0.045;0.045;0.097|.	T|.	0.68191|.	-0.5474|.	10|.	0.62326|.	D|.	0.03|.	.|.	14.978|14.978	0.71289|0.71289	0.0:0.0:0.7401:0.2599|0.0:0.0:0.7401:0.2599	.|.	862;862;862|.	Q149N5;Q8N1I0;Q8N1I0-2|.	.;DOCK4_HUMAN;.|.	M|X	850;862;862;850;861|314;850	ENSP00000410746:I862M;ENSP00000404179:I862M|.	ENSP00000345432:I850M|.	I|S	-|-	3|2	3|0	DOCK4|DOCK4	111274306|111274306	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.288000|4.288000	0.59007|0.59007	1.534000|1.534000	0.49203|0.49203	0.655000|0.655000	0.94253|0.94253	ATC|TCA	-	NULL		0.388	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	protein_coding	OTTHUMT00000338369.4	G	NM_014705		111274306	-1	no_errors	NM_014705	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PPP1R3A	5506	genome.wustl.edu	37	7	113520112	113520112	+	Silent	SNP	A	A	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:113520112A>G	ENST00000284601.3	-	4	1103	c.1035T>C	c.(1033-1035)gaT>gaC	p.D345D		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	345					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						AATTGACTGGATCTGTTGAAA	0.348																																																0			7											151.0	150.0	150.0					7																	113520112		2203	4299	6502	113307348	SO:0001819	synonymous_variant	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1035T>C	7.37:g.113520112A>G		Somatic		Capture	Illumina GAIIx	4	113307348	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	HMMPfam_CBM_21	p.D345	ENST00000284601.3	37	c.1035	CCDS5759.1	7																																																																																			-	NULL		0.348	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	protein_coding	OTTHUMT00000346724.1	A	NM_002711		113307348	-1	no_errors	NM_002711	genbank	human	reviewed	54_36p	silent	SNP	0.768	G
CSMD3	114788	genome.wustl.edu	37	8	113249508	113249508	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr8:113249508G>T	ENST00000297405.5	-	67	10782	c.10538C>A	c.(10537-10539)cCc>cAc	p.P3513H	CSMD3_ENST00000343508.3_Missense_Mutation_p.P3473H|CSMD3_ENST00000352409.3_Missense_Mutation_p.P3443H|CSMD3_ENST00000455883.2_Missense_Mutation_p.P3344H	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3513						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TAAGGTCATGGGTTGTTTCCT	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						0			8											200.0	181.0	188.0					8																	113249508		2203	4300	6503	113318684	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10538C>A	8.37:g.113249508G>T	ENSP00000297405:p.Pro3513His	Somatic		Capture	Illumina GAIIx	4	113318684	Q96PZ3	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,PatternScan_GLYCOSYL_HYDROL_F10	p.P3513H	ENST00000297405.5	37	c.10538	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	23.8	4.454706	0.84209	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.32023	1.82;1.82;1.86;1.47;1.84	4.87	4.87	0.63330	.	0.000000	0.64402	D	0.000002	T	0.56426	0.1984	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.994	D;D;D	0.91635	0.999;0.999;0.916	T	0.58194	-0.7679	10	0.52906	T	0.07	.	18.1948	0.89818	0.0:0.0:1.0:0.0	.	3344;3513;3473	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	H	3473;3513;2783;3344;3443	ENSP00000345799:P3473H;ENSP00000297405:P3513H;ENSP00000341558:P2783H;ENSP00000412263:P3344H;ENSP00000343124:P3443H	ENSP00000297405:P3513H	P	-	2	0	CSMD3	113318684	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.630000	0.83225	2.514000	0.84764	0.467000	0.42956	CCC	-	NULL		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	G	NM_052900		113318684	-1	no_errors	NM_198123	genbank	human	validated	54_36p	missense	SNP	1.000	T
SUSD1	64420	genome.wustl.edu	37	9	114840825	114840825	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr9:114840825C>G	ENST00000374270.3	-	12	1918	c.1746G>C	c.(1744-1746)caG>caC	p.Q582H	SUSD1_ENST00000374263.3_Missense_Mutation_p.Q582H|SUSD1_ENST00000374264.2_Missense_Mutation_p.Q582H	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	582						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						TACCTGTTATCTGGGTTGTCA	0.443																																																0			9											107.0	102.0	104.0					9																	114840825		2203	4300	6503	113880646	SO:0001583	missense	64420			AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.1746G>C	9.37:g.114840825C>G	ENSP00000363388:p.Gln582His	Somatic		Capture	Illumina GAIIx	4	113880646	A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.Q582H	ENST00000374270.3	37	c.1746	CCDS6783.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	17.50|17.50	3.404957|3.404957	0.62288|0.62288	.|.	.|.	ENSG00000106868|ENSG00000106868	ENST00000355396|ENST00000374270;ENST00000374263;ENST00000374264	.|T;T;T	.|0.32515	.|1.45;1.45;1.45	4.87|4.87	2.92|2.92	0.33932|0.33932	.|.	.|0.158258	.|0.29980	.|N	.|0.010712	T|T	0.38665|0.38665	0.1049|0.1049	L|L	0.59436|0.59436	1.845|1.845	0.29584|0.29584	N|N	0.848931|0.848931	.|P;D;P	.|0.53885	.|0.874;0.963;0.895	.|P;P;P	.|0.55999	.|0.667;0.789;0.498	T|T	0.23332|0.23332	-1.0191|-1.0191	5|9	.|.	.|.	.|.	-3.937|-3.937	5.9674|5.9674	0.19332|0.19332	0.0:0.6991:0.197:0.1039|0.0:0.6991:0.197:0.1039	.|.	.|582;582;582	.|F8WAQ1;Q6UWL2-2;Q6UWL2	.|.;.;SUSD1_HUMAN	H|H	566|582	.|ENSP00000363388:Q582H;ENSP00000363381:Q582H;ENSP00000363382:Q582H	.|.	D|Q	-|-	1|3	0|2	SUSD1|SUSD1	113880646|113880646	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	0.670000|0.670000	0.25157|0.25157	1.130000|1.130000	0.42092|0.42092	0.580000|0.580000	0.79431|0.79431	GAT|CAG	-	NULL		0.443	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD1	protein_coding	OTTHUMT00000053668.3	C	NM_022486		113880646	-1	no_errors	NM_022486	genbank	human	validated	54_36p	missense	SNP	0.999	G
ANAPC5	51433	genome.wustl.edu	37	12	121773425	121773425	+	Silent	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr12:121773425T>C	ENST00000261819.3	-	7	982	c.861A>G	c.(859-861)gaA>gaG	p.E287E	ANAPC5_ENST00000441917.2_Silent_p.E188E|ANAPC5_ENST00000541887.1_Silent_p.E287E|ANAPC5_ENST00000536366.1_Silent_p.E166E|ANAPC5_ENST00000544314.1_5'UTR|ANAPC5_ENST00000344395.4_Silent_p.E188E	NM_016237.4	NP_057321.2	Q9UJX4	APC5_HUMAN	anaphase promoting complex subunit 5	287					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(6)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(3)	31	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TACTTTTGCTTTCGGCTCCGG	0.473																																																0			12											127.0	123.0	124.0					12																	121773425		2203	4300	6503	120257808	SO:0001819	synonymous_variant	51433			AF191339	CCDS9220.1, CCDS45000.1	12q24.31	2014-08-12			ENSG00000089053	ENSG00000089053		"""Anaphase promoting complex subunits"""	15713	protein-coding gene	gene with protein product		606948				9469815	Standard	NM_016237		Approved	APC5	uc001uag.3	Q9UJX4	OTTHUMG00000169157	ENST00000261819.3:c.861A>G	12.37:g.121773425T>C		Somatic		Capture	Illumina GAIIx	4	120257808	E9PFB2|Q8N4H7|Q9BQD4	Silent	SNP	superfamily_TPR-like,HMMSmart_SM00028	p.E287	ENST00000261819.3	37	c.861	CCDS9220.1	12																																																																																			-	superfamily_TPR-like		0.473	ANAPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC5	protein_coding	OTTHUMT00000402582.1	T			120257808	-1	no_errors	NM_016237	genbank	human	reviewed	54_36p	silent	SNP	0.985	C
COL14A1	7373	genome.wustl.edu	37	8	121259903	121259903	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr8:121259903G>A	ENST00000297848.3	+	21	2801	c.2531G>A	c.(2530-2532)cGg>cAg	p.R844Q	COL14A1_ENST00000247781.3_Missense_Mutation_p.R749Q|COL14A1_ENST00000309791.4_Missense_Mutation_p.R844Q|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TGGTATAACCGGTTGCGCATT	0.458																																																0			8											103.0	90.0	94.0					8																	121259903		2203	4300	6503	121329084	SO:0001583	missense	7373				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2531G>A	8.37:g.121259903G>A	ENSP00000297848:p.Arg844Gln	Somatic		Capture	Illumina GAIIx	4	121329084		Missense_Mutation	SNP	HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Collagen	p.R844Q	ENST00000297848.3	37	c.2531	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.270788	0.95429	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.07	5.07	0.68467	Fibronectin, type III (4);	0.056293	0.64402	D	0.000002	T	0.72534	0.3472	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;0.989	D;P	0.64042	0.921;0.736	T	0.73997	-0.3806	10	0.51188	T	0.08	.	19.3312	0.94288	0.0:0.0:1.0:0.0	.	844;844	Q05707-2;Q05707	.;COEA1_HUMAN	Q	844;844;749;657	ENSP00000311809:R844Q;ENSP00000297848:R844Q;ENSP00000247781:R749Q;ENSP00000409461:R657Q	ENSP00000247781:R749Q	R	+	2	0	COL14A1	121329084	1.000000	0.71417	0.967000	0.41034	0.921000	0.55340	9.139000	0.94554	2.745000	0.94114	0.462000	0.41574	CGG	-	HMMPfam_fn3,superfamily_Fibronectin type III,HMMSmart_SM00060		0.458	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	protein_coding	OTTHUMT00000313657.2	G	NM_021110		121329084	+1	no_errors	NM_021110	genbank	human	validated	54_36p	missense	SNP	1.000	A
PDIA5	10954	genome.wustl.edu	37	3	122829811	122829811	+	Silent	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr3:122829811G>A	ENST00000316218.7	+	7	596	c.501G>A	c.(499-501)aaG>aaA	p.K167K		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	167	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		GGCTCCTGAAGAAGGAAGAGA	0.537																																																0			3											134.0	137.0	136.0					3																	122829811		2203	4300	6503	124312501	SO:0001819	synonymous_variant	10954			AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.501G>A	3.37:g.122829811G>A		Somatic		Capture	Illumina GAIIx	4	124312501	D3DN95|Q9BV43	Silent	SNP	superfamily_Thiordxn-like_fd,HMMPfam_Thioredoxin,PatternScan_THIOREDOXIN_1,PatternScan_ER_TARGET	p.K167	ENST00000316218.7	37	c.501	CCDS3020.1	3																																																																																			-	superfamily_Thiordxn-like_fd,HMMPfam_Thioredoxin		0.537	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA5	protein_coding	OTTHUMT00000356192.1	G	NM_006810		124312501	+1	no_errors	NM_006810	genbank	human	provisional	54_36p	silent	SNP	1.000	A
ACTRT1	139741	genome.wustl.edu	37	X	127185083	127185083	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chrX:127185083G>T	ENST00000371124.3	-	1	1299	c.1103C>A	c.(1102-1104)aCa>aAa	p.T368K		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	368						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						AACCACAGATGTCCCATACTC	0.463																																																0			X											173.0	160.0	165.0					X																	127185083		2203	4300	6503	127012764	SO:0001583	missense	139741			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.1103C>A	X.37:g.127185083G>T	ENSP00000360165:p.Thr368Lys	Somatic		Capture	Illumina GAIIx	4	127012764	Q6X7C1|Q96L10	Missense_Mutation	SNP	HMMPfam_Actin,superfamily_SSF53067,HMMSmart_ACTIN	p.T368K	ENST00000371124.3	37	c.1103	CCDS14611.1	X	.	.	.	.	.	.	.	.	.	.	G	6.170	0.399627	0.11696	.	.	ENSG00000123165	ENST00000371124	T	0.29142	1.58	4.23	-3.17	0.05202	.	1.205560	0.06029	N	0.652703	T	0.17152	0.0412	N	0.17082	0.46	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.30001	-0.9993	10	0.87932	D	0	.	4.2155	0.10531	0.0812:0.1188:0.3232:0.4768	.	368	Q8TDG2	ACTT1_HUMAN	K	368	ENSP00000360165:T368K	ENSP00000360165:T368K	T	-	2	0	ACTRT1	127012764	0.947000	0.32204	0.000000	0.03702	0.005000	0.04900	4.903000	0.63272	-1.098000	0.03038	-0.222000	0.12452	ACA	-	HMMPfam_Actin,HMMSmart_ACTIN,superfamily_SSF53067		0.463	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT1	protein_coding	OTTHUMT00000058192.1	G	NM_138289		127012764	-1	no_errors	NM_138289	genbank	human	provisional	54_36p	missense	SNP	0.927	T
MAP3K19	80122	genome.wustl.edu	37	2	135744365	135744365	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr2:135744365A>T	ENST00000375845.3	-	7	2107	c.2077T>A	c.(2077-2079)Tca>Aca	p.S693T	MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000392915.1_Missense_Mutation_p.S710T|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000358371.4_Missense_Mutation_p.S580T|MAP3K19_ENST00000315513.3_5'UTR	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	693							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										CGTCTGCCTGATGGAGCCGAA	0.418																																																0			2											190.0	176.0	180.0					2																	135744365		2203	4300	6503	135460835	SO:0001583	missense	80122			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.2077T>A	2.37:g.135744365A>T	ENSP00000365005:p.Ser693Thr	Somatic		Capture	Illumina GAIIx	4	135460835	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.S693T	ENST00000375845.3	37	c.2077	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	A	7.954	0.745471	0.15710	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000392915;ENST00000437365	T;T;T;T	0.73047	-0.62;-0.6;1.73;-0.71	5.67	1.73	0.24493	.	0.328049	0.22378	N	0.060849	T	0.59115	0.2170	L	0.46157	1.445	0.31825	N	0.625441	P;P;P	0.46395	0.553;0.877;0.672	B;B;B	0.43478	0.151;0.421;0.12	T	0.64076	-0.6492	10	0.72032	D	0.01	.	2.5494	0.04745	0.5401:0.1239:0.2268:0.1092	.	580;710;693	Q56UN5-3;A8MWG7;Q56UN5	.;.;YSK4_HUMAN	T	693;580;710;83	ENSP00000365005:S693T;ENSP00000351140:S580T;ENSP00000376647:S710T;ENSP00000392827:S83T	ENSP00000351140:S580T	S	-	1	0	YSK4	135460835	0.000000	0.05858	0.864000	0.33941	0.048000	0.14542	-0.568000	0.05909	0.435000	0.26365	0.459000	0.35465	TCA	-	NULL		0.418	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	protein_coding	OTTHUMT00000158244.1	A	NM_025052		135460835	-1	no_errors	NM_025052	genbank	human	validated	54_36p	missense	SNP	0.377	T
PPP2R3A	5523	genome.wustl.edu	37	3	135825100	135825100	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr3:135825100T>A	ENST00000264977.3	+	13	3882	c.3265T>A	c.(3265-3267)Ttt>Att	p.F1089I	PPP2R3A_ENST00000490467.1_Missense_Mutation_p.F353I|PPP2R3A_ENST00000334546.2_Missense_Mutation_p.F468I|PPP2R3A_ENST00000469270.1_3'UTR	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	1089					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTGGGACCGGTTTGCCGCTGA	0.448																																																0			3											75.0	77.0	76.0					3																	135825100		2203	4300	6503	137307790	SO:0001583	missense	5523			L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.3265T>A	3.37:g.135825100T>A	ENSP00000264977:p.Phe1089Ile	Somatic		Capture	Illumina GAIIx	4	137307790	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	superfamily_EF-hand,PatternScan_EF_HAND_1	p.F1089I	ENST00000264977.3	37	c.3265	CCDS3087.1	3	.	.	.	.	.	.	.	.	.	.	T	25.1	4.607425	0.87157	.	.	ENSG00000073711	ENST00000264977;ENST00000490467;ENST00000334546	T;T;T	0.42131	0.98;0.98;0.98	6.02	6.02	0.97574	.	0.058812	0.64402	D	0.000001	T	0.57489	0.2057	M	0.64404	1.975	0.80722	D	1	D;P	0.56287	0.975;0.749	P;B	0.56700	0.804;0.339	T	0.60707	-0.7210	10	0.87932	D	0	.	15.7305	0.77800	0.0:0.0:0.0:1.0	.	468;1089	Q06190-2;Q06190	.;P2R3A_HUMAN	I	1089;353;468	ENSP00000264977:F1089I;ENSP00000419344:F353I;ENSP00000334748:F468I	ENSP00000264977:F1089I	F	+	1	0	PPP2R3A	137307790	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.499000	0.81566	2.299000	0.77371	0.528000	0.53228	TTT	-	NULL		0.448	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3A	protein_coding	OTTHUMT00000357232.1	T	NM_002718		137307790	+1	no_errors	NM_002718	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MCF2	4168	genome.wustl.edu	37	X	138698502	138698502	+	Missense_Mutation	SNP	A	A	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chrX:138698502A>T	ENST00000370576.4	-	9	1339	c.1130T>A	c.(1129-1131)aTa>aAa	p.I377K	MCF2_ENST00000370578.4_Missense_Mutation_p.I522K|MCF2_ENST00000520602.1_Missense_Mutation_p.I437K|MCF2_ENST00000483690.1_5'Flank|MCF2_ENST00000414978.1_Missense_Mutation_p.I437K|MCF2_ENST00000536274.1_Missense_Mutation_p.I338K|MCF2_ENST00000519895.1_Missense_Mutation_p.I437K|MCF2_ENST00000338585.6_Missense_Mutation_p.I377K|MCF2_ENST00000370573.4_Missense_Mutation_p.I377K	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	377					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TTCATAATTTATAAAGGGTAG	0.303																																																0			X											37.0	35.0	36.0					X																	138698502		2203	4289	6492	138526168	SO:0001583	missense	4168				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.1130T>A	X.37:g.138698502A>T	ENSP00000359608:p.Ile377Lys	Somatic		Capture	Illumina GAIIx	4	138526168	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	HMMSmart_SEC14,superfamily_Spectrin,HMMSmart_SPEC,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,PatternScan_DH_1,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.I437K	ENST00000370576.4	37	c.1310	CCDS14667.1	X	.	.	.	.	.	.	.	.	.	.	A	8.622	0.891552	0.17613	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T	0.36520	1.44;1.33;1.25;1.41;1.44;1.5;1.34;1.39	5.84	4.66	0.58398	.	0.177879	0.51477	D	0.000081	T	0.30230	0.0758	N	0.21194	0.64	0.27463	N	0.953106	B;P;B;B;B;B;P;B	0.42375	0.003;0.67;0.002;0.003;0.002;0.003;0.778;0.003	B;P;B;B;B;B;P;B	0.51833	0.008;0.482;0.01;0.008;0.01;0.008;0.681;0.008	T	0.12837	-1.0532	10	0.14252	T	0.57	.	5.496	0.16804	0.7635:0.0:0.0805:0.156	.	437;522;338;377;377;522;377;377	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	K	437;377;338;522;437;437;377;377	ENSP00000427745:I437K;ENSP00000359608:I377K;ENSP00000438155:I338K;ENSP00000359610:I522K;ENSP00000397055:I437K;ENSP00000430276:I437K;ENSP00000359605:I377K;ENSP00000342204:I377K	ENSP00000342204:I377K	I	-	2	0	MCF2	138526168	1.000000	0.71417	0.867000	0.34043	0.991000	0.79684	6.705000	0.74644	0.797000	0.33971	0.441000	0.28932	ATA	-	NULL		0.303	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MCF2	protein_coding	OTTHUMT00000058560.1	A	NM_005369		138526168	-1	no_errors	NM_001099855	genbank	human	validated	54_36p	missense	SNP	0.831	T
OR2F2	135948	genome.wustl.edu	37	7	143632560	143632560	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:143632560C>T	ENST00000408955.2	+	1	302	c.235C>T	c.(235-237)Ccc>Tcc	p.P79S		NM_001004685.1	NP_001004685.1	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F, member 2	79						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(19)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	32	Melanoma(164;0.0903)					AAGCGTAGTCCCCCAGCTGCT	0.512																																																0			7											225.0	218.0	220.0					7																	143632560		2203	4300	6503	143263493	SO:0001583	missense	135948				CCDS43666.1	7q33-q35	2012-08-09			ENSG00000221910	ENSG00000221910		"""GPCR / Class A : Olfactory receptors"""	8247	protein-coding gene	gene with protein product							Standard	NM_001004685		Approved	OR7-1	uc011ktv.2	O95006	OTTHUMG00000157768	ENST00000408955.2:c.235C>T	7.37:g.143632560C>T	ENSP00000386222:p.Pro79Ser	Somatic		Capture	Illumina GAIIx	4	143263493	A4D2G0|Q6IFP8	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.P79S	ENST00000408955.2	37	c.235	CCDS43666.1	7	.	.	.	.	.	.	.	.	.	.	C	14.20	2.464725	0.43736	.	.	ENSG00000221910	ENST00000408955	T	0.20332	2.08	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000091	T	0.59742	0.2216	H	0.97758	4.07	0.49130	D	0.999757	D	0.89917	1.0	D	0.87578	0.998	T	0.74881	-0.3513	10	0.87932	D	0	-29.3816	12.8566	0.57888	0.0:1.0:0.0:0.0	.	79	O95006	OR2F2_HUMAN	S	79	ENSP00000386222:P79S	ENSP00000386222:P79S	P	+	1	0	OR2F2	143263493	1.000000	0.71417	0.941000	0.38009	0.052000	0.14988	7.545000	0.82128	1.937000	0.56155	0.491000	0.48974	CCC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.512	OR2F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F2	protein_coding	OTTHUMT00000349570.1	C			143263493	+1	no_errors	NM_001004685	genbank	human	provisional	54_36p	missense	SNP	0.880	T
PRKAG2	51422	genome.wustl.edu	37	7	151269791	151269791	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr7:151269791T>A	ENST00000287878.4	-	9	1514	c.1010A>T	c.(1009-1011)cAg>cTg	p.Q337L	PRKAG2_ENST00000433631.2_Missense_Mutation_p.Q212L|PRKAG2_ENST00000392801.2_Missense_Mutation_p.Q293L|PRKAG2_ENST00000418337.2_Missense_Mutation_p.Q96L|PRKAG2_ENST00000492843.1_Missense_Mutation_p.Q213L	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	337					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	TTCATAAATCTGTACCTGCaa	0.259																																																0			7											63.0	62.0	62.0					7																	151269791		2201	4293	6494	150900724	SO:0001583	missense	51422			AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.1010A>T	7.37:g.151269791T>A	ENSP00000287878:p.Gln337Leu	Somatic		Capture	Illumina GAIIx	4	150900724	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Missense_Mutation	SNP	superfamily_CBS-domain,HMMPfam_CBS,HMMSmart_SM00116	p.Q337L	ENST00000287878.4	37	c.1010	CCDS5928.1	7	.	.	.	.	.	.	.	.	.	.	T	18.28	3.588162	0.66105	.	.	ENSG00000106617	ENST00000418337;ENST00000287878;ENST00000492843;ENST00000433631;ENST00000392801;ENST00000476632	D;D;D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74;-2.74;-2.74	5.15	5.15	0.70609	Aldolase-type TIM barrel (1);	0.106954	0.64402	D	0.000003	D	0.89136	0.6629	M	0.79805	2.47	0.80722	D	1	B;P	0.36990	0.246;0.577	B;B	0.25987	0.045;0.065	D	0.89683	0.3892	10	0.56958	D	0.05	.	14.2372	0.65934	0.0:0.0:0.0:1.0	.	212;337	B7Z6X8;Q9UGJ0	.;AAKG2_HUMAN	L	96;337;213;212;293;96	ENSP00000387386:Q96L;ENSP00000287878:Q337L;ENSP00000419577:Q213L;ENSP00000406544:Q212L;ENSP00000376549:Q293L;ENSP00000419493:Q96L	ENSP00000287878:Q337L	Q	-	2	0	PRKAG2	150900724	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.727000	0.84838	1.944000	0.56390	0.529000	0.55759	CAG	-	HMMPfam_CBS		0.259	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAG2	protein_coding	OTTHUMT00000348440.2	T	NM_016203		150900724	-1	no_errors	NM_016203	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ARHGEF11	9826	genome.wustl.edu	37	1	156910168	156910168	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:156910168C>A	ENST00000361409.2	-	35	4186	c.3444G>T	c.(3442-3444)gaG>gaT	p.E1148D	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.E1188D|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.E564D|ARHGEF11_ENST00000487682.1_5'UTR	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1148					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCTCAGGGTCCTCTAGCAGGA	0.587																																																0			1											86.0	73.0	77.0					1																	156910168		2203	4300	6503	155176792	SO:0001583	missense	9826			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3444G>T	1.37:g.156910168C>A	ENSP00000354644:p.Glu1148Asp	Somatic		Capture	Illumina GAIIx	4	155176792	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,HMMPfam_RGS-like,superfamily_Regulat_G_prot_signal_superfam,HMMSmart_RGS,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,superfamily_SSF50729,HMMSmart_PH	p.E1188D	ENST00000361409.2	37	c.3564	CCDS1162.1	1	.	.	.	.	.	.	.	.	.	.	C	9.287	1.049542	0.19827	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.71461	-0.57;-0.56;-0.53	4.16	0.988	0.19796	.	0.626077	0.14053	N	0.344577	T	0.32376	0.0827	L	0.27053	0.805	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.001	B;B;B	0.13407	0.009;0.002;0.004	T	0.28004	-1.0057	10	0.23891	T	0.37	-0.565	9.1904	0.37195	0.0:0.7013:0.0:0.2987	.	564;1148;1188	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	D	1188;1148;564	ENSP00000357177:E1188D;ENSP00000354644:E1148D;ENSP00000313470:E564D	ENSP00000313470:E564D	E	-	3	2	ARHGEF11	155176792	0.437000	0.25593	0.002000	0.10522	0.614000	0.37383	0.930000	0.28858	0.402000	0.25451	0.561000	0.74099	GAG	-	NULL		0.587	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	protein_coding	OTTHUMT00000098931.1	C	NM_198236		155176792	-1	no_errors	NM_198236	genbank	human	reviewed	54_36p	missense	SNP	0.049	A
TENM2	57451	genome.wustl.edu	37	5	167673868	167673868	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr5:167673868C>A	ENST00000518659.1	+	27	5963	c.5924C>A	c.(5923-5925)tCc>tAc	p.S1975Y	TENM2_ENST00000519204.1_Missense_Mutation_p.S1854Y|TENM2_ENST00000403607.2_Missense_Mutation_p.S1799Y|TENM2_ENST00000520394.1_Missense_Mutation_p.S1736Y|TENM2_ENST00000545108.1_Missense_Mutation_p.S1974Y	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1975					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CACAGCATGTCCACACACACC	0.537																																																0			5											139.0	146.0	144.0					5																	167673868		2119	4243	6362	167606446	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5924C>A	5.37:g.167673868C>A	ENSP00000429430:p.Ser1975Tyr	Somatic		Capture	Illumina GAIIx	4	167606446	Q9ULU2	Missense_Mutation	SNP	HMMPfam_Ten_N,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Carboxypeptidase regulatory domain,superfamily_NHL repeat,HMMPfam_NHL,HMMPfam_RHS_repeat	p.S1974Y	ENST00000518659.1	37	c.5921		5	.	.	.	.	.	.	.	.	.	.	C	10.03	1.239171	0.22711	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90732	-2.25;-2.23;-2.35;-2.72;-2.71	5.35	4.48	0.54585	.	0.422638	0.28803	N	0.014098	T	0.81312	0.4796	N	0.08118	0	0.42909	D	0.994255	B;B;B	0.13145	0.007;0.001;0.002	B;B;B	0.12156	0.007;0.003;0.001	T	0.76658	-0.2878	10	0.52906	T	0.07	.	13.5451	0.61697	0.0:0.9251:0.0:0.0749	.	1974;1975;1736	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	Y	1975;1974;1854;1736;1799	ENSP00000429430:S1975Y;ENSP00000438635:S1974Y;ENSP00000428964:S1854Y;ENSP00000427874:S1736Y;ENSP00000384905:S1799Y	ENSP00000384905:S1799Y	S	+	2	0	ODZ2	167606446	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.105000	0.50314	1.261000	0.44149	0.491000	0.48974	TCC	-	superfamily_Concanavalin A-like lectins/glucanases		0.537	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	protein_coding	OTTHUMT00000376096.1	C	NM_001122679		167606446	+1	no_errors	ENST00000388903	ensembl	human	known	54_36p	missense	SNP	1.000	A
HAT1	8520	genome.wustl.edu	37	2	172822423	172822423	+	Missense_Mutation	SNP	T	T	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr2:172822423T>G	ENST00000264108.4	+	6	641	c.605T>G	c.(604-606)tTt>tGt	p.F202C	HAT1_ENST00000392584.1_Missense_Mutation_p.F117C|SLC25A12_ENST00000472748.1_Intron	NM_003642.3	NP_003633.1	O14929	HAT1_HUMAN	histone acetyltransferase 1	202					chromatin organization (GO:0006325)|chromatin silencing at telomere (GO:0006348)|DNA packaging (GO:0006323)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4 acetylation (GO:0043967)|internal protein amino acid acetylation (GO:0006475)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	H4 histone acetyltransferase activity (GO:0010485)|histone acetyltransferase activity (GO:0004402)			breast(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|prostate(1)	19			OV - Ovarian serous cystadenocarcinoma(117;0.216)			TGGCACTACTTTCTAGTGTAA	0.383																																																0			2											137.0	127.0	131.0					2																	172822423		2203	4300	6503	172530669	SO:0001583	missense	8520			AF030424	CCDS2245.1	2q31.2-q33.1	2011-07-01			ENSG00000128708	ENSG00000128708	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"""	4821	protein-coding gene	gene with protein product		603053				9427644	Standard	NM_003642		Approved	KAT1	uc002uhi.3	O14929	OTTHUMG00000132282	ENST00000264108.4:c.605T>G	2.37:g.172822423T>G	ENSP00000264108:p.Phe202Cys	Somatic		Capture	Illumina GAIIx	4	172530669	Q49A44|Q53QF0|Q53SU4|Q6P594|Q8WWB9	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase,HMMPfam_Hat1_N	p.F202C	ENST00000264108.4	37	c.605	CCDS2245.1	2	.	.	.	.	.	.	.	.	.	.	T	16.77	3.214304	0.58452	.	.	ENSG00000128708	ENST00000392584;ENST00000264108	.	.	.	5.93	5.93	0.95920	Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.83885	0.5351	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	D	0.86487	0.1795	9	0.87932	D	0	-21.7509	16.3736	0.83374	0.0:0.0:0.0:1.0	.	117;202	O14929-2;O14929	.;HAT1_HUMAN	C	117;202	.	ENSP00000264108:F202C	F	+	2	0	HAT1	172530669	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.273000	0.75805	0.482000	0.46254	TTT	-	superfamily_Acyl_CoA_acyltransferase		0.383	HAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAT1	protein_coding	OTTHUMT00000255377.1	T	NM_003642		172530669	+1	no_errors	NM_003642	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PAPPA2	60676	genome.wustl.edu	37	1	176526225	176526225	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:176526225C>G	ENST00000367662.3	+	2	1931	c.767C>G	c.(766-768)tCc>tGc	p.S256C	PAPPA2_ENST00000367661.3_Missense_Mutation_p.S256C	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	256					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						ACCTTTAACTCCCAAGTAGGA	0.557																																																0			1											72.0	70.0	71.0					1																	176526225		1916	4145	6061	174792848	SO:0001583	missense	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.767C>G	1.37:g.176526225C>G	ENSP00000356634:p.Ser256Cys	Somatic		Capture	Illumina GAIIx	4	174792848	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	"superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00560,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMSmart_SM00004,HMMPfam_Notch,PatternScan_ZINC_PROTEASE,HMMPfam_Peptidase_M43,PatternScan_N6_MTASE,superfamily_Complement control module/SCR domain,HMMSmart_SM00032,HMMPfam_Sushi,superfamily_Notch domain"	p.S256C	ENST00000367662.3	37	c.767	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.419871	0.42918	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.35605	4.57;1.3	4.43	4.43	0.53597	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	1.193730	0.06157	U	0.675246	T	0.38983	0.1061	L	0.43152	1.355	0.30595	N	0.761135	D;D	0.55172	0.97;0.97	B;B	0.43916	0.436;0.339	T	0.40346	-0.9568	10	0.72032	D	0.01	-1.0988	12.5498	0.56220	0.0:1.0:0.0:0.0	.	256;256	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	C	256	ENSP00000356634:S256C;ENSP00000356633:S256C	ENSP00000356633:S256C	S	+	2	0	PAPPA2	174792848	0.029000	0.19370	0.394000	0.26270	0.959000	0.62525	1.470000	0.35354	2.024000	0.59613	0.313000	0.20887	TCC	-	superfamily_Concanavalin A-like lectins/glucanases		0.557	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	protein_coding	OTTHUMT00000084763.1	C			174792848	+1	no_errors	NM_020318	genbank	human	validated	54_36p	missense	SNP	0.183	G
PAPPA2	60676	genome.wustl.edu	37	1	176661371	176661371	+	Silent	SNP	C	C	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:176661371C>T	ENST00000367662.3	+	6	3705	c.2541C>T	c.(2539-2541)ccC>ccT	p.P847P		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	847					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCCCCATCCCCATTCCACCTA	0.517																																																0			1											164.0	171.0	169.0					1																	176661371		2069	4208	6277	174927994	SO:0001819	synonymous_variant	60676			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2541C>T	1.37:g.176661371C>T		Somatic		Capture	Illumina GAIIx	4	174927994	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	"HMMPfam_Sushi,HMMSmart_SM00032,HMMPfam_Notch,HMMSmart_SM00004,superfamily_Notch domain,PatternScan_N6_MTASE,PatternScan_ZINC_PROTEASE,HMMSmart_SM00560,HMMPfam_Peptidase_M43,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Complement control module/SCR domain,superfamily_Metalloproteases (""zincins"") catalytic domain"	p.P847	ENST00000367662.3	37	c.2541	CCDS41438.1	1																																																																																			-	HMMPfam_Peptidase_M43		0.517	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	protein_coding	OTTHUMT00000084763.1	C			174927994	+1	no_errors	NM_020318	genbank	human	validated	54_36p	silent	SNP	0.998	T
HTR3D	200909	genome.wustl.edu	37	3	183754282	183754282	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr3:183754282C>A	ENST00000382489.3	+	4	500	c.500C>A	c.(499-501)tCc>tAc	p.S167Y	HTR3D_ENST00000428798.2_Missense_Mutation_p.S106Y|HTR3D_ENST00000453435.1_Intron|HTR3D_ENST00000334128.2_Missense_Mutation_p.S32Y	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	167					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)	p.S167F(1)|p.S32F(1)		large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	ATTTCCCCTTCCATGGACAGA	0.488																																																2	Substitution - Missense(2)	lung(2)	3											147.0	116.0	127.0					3																	183754282		2203	4300	6503	185236976	SO:0001583	missense	200909			AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.500C>A	3.37:g.183754282C>A	ENSP00000371929:p.Ser167Tyr	Somatic		Capture	Illumina GAIIx	4	185236976	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Missense_Mutation	SNP	superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_memb	p.S32Y	ENST00000382489.3	37	c.95	CCDS54685.1	3	.	.	.	.	.	.	.	.	.	.	c	4.071	0.011030	0.07912	.	.	ENSG00000186090	ENST00000334128;ENST00000428798;ENST00000382489	T;T;T	0.78481	-0.88;-1.1;-1.18	4.98	1.39	0.22231	Neurotransmitter-gated ion-channel ligand-binding (1);	2.354890	0.01771	U	0.031160	T	0.64972	0.2647	N	0.08118	0	0.80722	D	1	D;D;D	0.59767	0.98;0.969;0.986	P;P;P	0.51135	0.629;0.656;0.66	T	0.67389	-0.5683	10	0.02654	T	1	-2.3888	7.3104	0.26471	0.0:0.2773:0.0:0.7227	.	167;32;32	Q70Z44;Q70Z44-2;F6WC43	5HT3D_HUMAN;.;.	Y	32;106;167	ENSP00000334315:S32Y;ENSP00000405409:S106Y;ENSP00000371929:S167Y	ENSP00000334315:S32Y	S	+	2	0	HTR3D	185236976	0.991000	0.36638	0.976000	0.42696	0.578000	0.36192	0.128000	0.15810	0.149000	0.19098	-0.310000	0.09108	TCC	-	NULL		0.488	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HTR3D	protein_coding	OTTHUMT00000346289.1	C	NM_182537		185236976	+1	no_errors	NM_182537	genbank	human	reviewed	54_36p	missense	SNP	0.959	A
SORBS2	8470	genome.wustl.edu	37	4	186573818	186573818	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr4:186573818G>A	ENST00000284776.7	-	7	841	c.332C>T	c.(331-333)cCg>cTg	p.P111L	SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000437304.2_Missense_Mutation_p.P290L|SORBS2_ENST00000393528.3_Missense_Mutation_p.P157L|SORBS2_ENST00000449407.2_Missense_Mutation_p.P197L|SORBS2_ENST00000448662.2_Missense_Mutation_p.P180L|SORBS2_ENST00000355634.5_Missense_Mutation_p.P211L|SORBS2_ENST00000431808.1_Missense_Mutation_p.P111L|SORBS2_ENST00000319471.9_Missense_Mutation_p.P197L|SORBS2_ENST00000418609.1_Missense_Mutation_p.P30L	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	111	SoHo. {ECO:0000255|PROSITE- ProRule:PRU00195}.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		AGACATACCCGGCTTGTGCAC	0.483																																					Esophageal Squamous(153;41 2433 9491 36028)											0			4											248.0	196.0	213.0					4																	186573818		2203	4300	6503	186810812	SO:0001583	missense	8470				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.332C>T	4.37:g.186573818G>A	ENSP00000284776:p.Pro111Leu	Somatic		Capture	Illumina GAIIx	4	186810812	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	HMMPfam_Sorb,HMMSmart_SM00459,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326	p.P111L	ENST00000284776.7	37	c.332	CCDS3845.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.33|19.33	3.807156|3.807156	0.70797|0.70797	.|.	.|.	ENSG00000154556|ENSG00000154556	ENST00000284776;ENST00000448662;ENST00000431808;ENST00000418609;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454|ENST00000445625	T;T;T;T;T;T;T;T;T;T|.	0.36878|.	1.33;1.52;1.33;1.65;1.23;1.29;1.65;1.32;1.65;1.47|.	5.16|5.16	4.31|4.31	0.51392|0.51392	Sorbin-like (3);|.	0.201057|.	0.53938|.	D|.	0.000051|.	T|T	0.56514|0.56514	0.1990|0.1990	L|L	0.34521|0.34521	1.04|1.04	0.37872|0.37872	D|D	0.930094|0.930094	P;P;P;P;P;P;D;P;P;P;B;B;P;P;P;P|.	0.63046|.	0.711;0.786;0.5;0.939;0.818;0.786;0.992;0.782;0.939;0.939;0.404;0.415;0.489;0.919;0.786;0.786|.	P;B;B;P;B;B;P;B;P;P;B;B;B;P;B;B|.	0.60236|.	0.487;0.408;0.064;0.804;0.35;0.355;0.871;0.343;0.804;0.804;0.3;0.181;0.212;0.522;0.247;0.355|.	T|T	0.58651|0.58651	-0.7599|-0.7599	10|5	0.87932|.	D|.	0|.	-26.7084|-26.7084	16.1565|16.1565	0.81673|0.81673	0.0:0.1336:0.8664:0.0|0.0:0.1336:0.8664:0.0	.|.	174;157;180;30;30;30;30;157;211;111;197;290;180;157;111;157|.	B7Z3D7;G3XAI0;C9JKV9;B7Z3X6;B7Z997;O94875-6;B3KPU4;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2|.	.;.;.;.;.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.|.	L|W	111;180;111;30;290;197;197;211;157;157|9	ENSP00000284776:P111L;ENSP00000409158:P180L;ENSP00000411764:P111L;ENSP00000397482:P30L;ENSP00000396008:P290L;ENSP00000322182:P197L;ENSP00000397262:P197L;ENSP00000347852:P211L;ENSP00000377162:P157L;ENSP00000321983:P157L|.	ENSP00000284776:P111L|.	P|R	-|-	2|1	0|2	SORBS2|SORBS2	186810812|186810812	1.000000|1.000000	0.71417|0.71417	0.898000|0.898000	0.35279|0.35279	0.309000|0.309000	0.27889|0.27889	7.371000|7.371000	0.79600|0.79600	1.521000|1.521000	0.48983|0.48983	-0.176000|-0.176000	0.13171|0.13171	CCG|CGG	-	HMMPfam_Sorb,HMMSmart_SM00459		0.483	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	protein_coding	OTTHUMT00000347944.3	G	NM_003603		186810812	-1	no_errors	NM_021069	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
KCNH1	3756	genome.wustl.edu	37	1	210856996	210856996	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:210856996G>T	ENST00000271751.4	-	11	2624	c.2597C>A	c.(2596-2598)aCa>aAa	p.T866K	KCNH1_ENST00000367007.4_Missense_Mutation_p.T839K			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	866					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TGACGCTTTTGTCCTCTCGGG	0.572																																																0			1											98.0	94.0	95.0					1																	210856996		2203	4300	6503	208923619	SO:0001583	missense	3756			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2597C>A	1.37:g.210856996G>T	ENSP00000271751:p.Thr866Lys	Somatic		Capture	Illumina GAIIx	4	208923619	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	superfamily_PYP-like sensor domain (PAS domain),HMMSmart_SM00086,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding	p.T866K	ENST00000271751.4	37	c.2597	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083845	0.55861	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98862	-5.13;-5.19	4.93	4.93	0.64822	.	0.046720	0.85682	D	0.000000	D	0.96898	0.8987	L	0.56769	1.78	0.80722	D	1	B;B	0.22983	0.078;0.005	B;B	0.21546	0.035;0.003	D	0.95953	0.8956	10	0.06236	T	0.91	.	17.7569	0.88451	0.0:0.0:1.0:0.0	.	839;866	Q14CL3;O95259	.;KCNH1_HUMAN	K	866;839	ENSP00000271751:T866K;ENSP00000355974:T839K	ENSP00000271751:T866K	T	-	2	0	KCNH1	208923619	1.000000	0.71417	0.986000	0.45419	0.808000	0.45660	7.600000	0.82769	2.290000	0.77057	0.561000	0.74099	ACA	-	NULL		0.572	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	protein_coding	OTTHUMT00000088332.1	G	NM_002238		208923619	-1	no_errors	NM_172362	genbank	human	reviewed	54_36p	missense	SNP	0.997	T
FN1	2335	genome.wustl.edu	37	2	216259411	216259411	+	Silent	SNP	A	A	G			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr2:216259411A>G	ENST00000359671.1	-	24	3901	c.3636T>C	c.(3634-3636)ccT>ccC	p.P1212P	FN1_ENST00000346544.3_Silent_p.P1212P|FN1_ENST00000357009.2_Silent_p.P1212P|FN1_ENST00000421182.1_Silent_p.P1212P|FN1_ENST00000345488.5_Silent_p.P1212P|FN1_ENST00000357867.4_Silent_p.P1212P|FN1_ENST00000446046.1_Silent_p.P1212P|FN1_ENST00000443816.1_Silent_p.P1212P|FN1_ENST00000354785.4_Silent_p.P1212P|FN1_ENST00000323926.6_Silent_p.P1212P|FN1_ENST00000432072.2_Silent_p.P1212P|FN1_ENST00000356005.4_Silent_p.P1212P|FN1_ENST00000336916.4_Silent_p.P1212P			P02751	FINC_HUMAN	fibronectin 1	1212	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GGCCGTTTGTAGGGGTTGTGG	0.448																																																0			2											105.0	113.0	110.0					2																	216259411		2203	4300	6503	215967656	SO:0001819	synonymous_variant	2335				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3636T>C	2.37:g.216259411A>G		Somatic		Capture	Illumina GAIIx	4	215967656	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	superfamily_Fibronectin type I module,HMMPfam_fn1,PatternScan_FN1_1,HMMSmart_SM00058,PatternScan_EGF_1,superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,PatternScan_ALDEHYDE_DEHYDR_GLU	p.P1212	ENST00000359671.1	37	c.3636		2																																																																																			-	superfamily_Fibronectin type III,HMMPfam_fn3,HMMSmart_SM00060		0.448	FN1-204	KNOWN	basic	protein_coding	FN1	protein_coding		A	NM_212476		215967656	-1	no_errors	NM_212482	genbank	human	reviewed	54_36p	silent	SNP	0.871	G
OR2W5	441932	genome.wustl.edu	37	1	247654898	247654898	+	RNA	SNP	T	T	C			TCGA-29-1784-01A-02W-0633-09	TCGA-29-1784-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	214738d1-a084-4024-a0e5-7f4683233a06	47f4fbdc-08e4-445d-a5cd-be801f5fa9ee	g.chr1:247654898T>C	ENST00000522351.1	+	0	529							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CCTAAACTCCTTCATCATGTG	0.582																																																0			1											115.0	86.0	96.0					1																	247654898		2203	4300	6503	245721521			441932					1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247654898T>C		Somatic		Capture	Illumina GAIIx	4	245721521	B9EH85	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.F157L	ENST00000522351.1	37	c.469		1																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.582	OR2W5-002	KNOWN	basic	processed_transcript	OR2W5	pseudogene	OTTHUMT00000375789.1	T	NM_001004698		245721521	+1	no_errors	NM_001004698	genbank	human	provisional	54_36p	missense	SNP	0.000	C
