#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CSF2RA	1438	genome.wustl.edu	37	X	1404673	1404673	+	Silent	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chrX:1404673C>T	ENST00000381524.3	+	4	265	c.79C>T	c.(79-81)Ctg>Ttg	p.L27L	CSF2RA_ENST00000417535.2_Silent_p.L27L|CSF2RA_ENST00000361536.3_Silent_p.L27L|CSF2RA_ENST00000381529.3_Silent_p.L27L|CSF2RA_ENST00000381509.3_Silent_p.L27L|CSF2RA_ENST00000432318.2_Silent_p.L27L|CSF2RA_ENST00000355805.2_Silent_p.L27L|CSF2RA_ENST00000501036.2_Intron|CSF2RA_ENST00000355432.3_Silent_p.L27L|CSF2RA_ENST00000494969.2_Silent_p.L27L|CSF2RA_ENST00000381500.1_Silent_p.L27L			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	27					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CCTTGCAGATCTGCGAACAGT	0.423																																					Esophageal Squamous(131;723 1707 25334 40494 41806)											0			X											132.0	134.0	134.0					X																	1404673		2203	4296	6499	1364673	SO:0001819	synonymous_variant	1438			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.79C>T	X.37:g.1404673C>T		Somatic		Capture	Illumina GAIIx	4	1364673	A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Silent	SNP	superfamily_Fibronectin type III,HMMPfam_Haemat_rec_S_F2,PatternScan_HEMATOPO_REC_S_F2	p.L27	ENST00000381524.3	37	c.79	CCDS35191.1	X																																																																																			-	NULL		0.423	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	protein_coding	OTTHUMT00000035013.2	C			1364673	+1	no_errors	NM_006140	genbank	human	reviewed	54_36p	silent	SNP	0.005	T
KCNQ1	3784	genome.wustl.edu	37	11	2683225	2683225	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr11:2683225G>T	ENST00000155840.5	+	11	1536	c.1428G>T	c.(1426-1428)atG>atT	p.M476I	KCNQ1_ENST00000335475.5_Missense_Mutation_p.M349I|KCNQ1OT1_ENST00000597346.1_RNA	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	476					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	AAGTGAGCATGCCCCATTTCA	0.572																																																0			11											163.0	148.0	153.0					11																	2683225		2202	4299	6501	2639801	SO:0001583	missense	3784			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1428G>T	11.37:g.2683225G>T	ENSP00000155840:p.Met476Ile	Somatic		Capture	Illumina GAIIx	4	2639801	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_KCNQ_channel	p.M476I	ENST00000155840.5	37	c.1428	CCDS7736.1	11	.	.	.	.	.	.	.	.	.	.	G	2.185	-0.386559	0.04966	.	.	ENSG00000053918	ENST00000155840;ENST00000335475	D;D	0.99582	-6.22;-6.22	4.28	-8.57	0.00900	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.979822	0.08336	N	0.961573	D	0.95667	0.8591	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.0;0.0;0.001	D	0.93339	0.6708	10	0.29301	T	0.29	-0.7116	2.9677	0.05912	0.4732:0.1908:0.2404:0.0957	.	349;349;476	P51787-2;Q14D14;P51787	.;.;KCNQ1_HUMAN	I	476;349	ENSP00000155840:M476I;ENSP00000334497:M349I	ENSP00000155840:M476I	M	+	3	0	KCNQ1	2639801	0.000000	0.05858	0.000000	0.03702	0.354000	0.29330	-1.665000	0.01965	-2.463000	0.00535	-2.069000	0.00389	ATG	-	HMMPfam_KCNQ_channel		0.572	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ1	protein_coding	OTTHUMT00000027382.2	G	NM_000218		2639801	+1	no_errors	NM_000218	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
PPL	5493	genome.wustl.edu	37	16	4935029	4935029	+	Silent	SNP	G	G	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr16:4935029G>C	ENST00000345988.2	-	22	3716	c.3627C>G	c.(3625-3627)ctC>ctG	p.L1209L	PPL_ENST00000590782.2_Silent_p.L1207L	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1209					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						GGTAGCTCCGGAGCTGCTCCT	0.607																																																0			16											54.0	51.0	52.0					16																	4935029		2197	4300	6497	4875030	SO:0001819	synonymous_variant	5493			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.3627C>G	16.37:g.4935029G>C		Somatic		Capture	Illumina GAIIx	4	4875030	O60314|O60454|Q14C98	Silent	SNP	HMMSmart_SM00150,superfamily_Spectrin repeat,superfamily_Plakin repeat,HMMSmart_SM00250,HMMPfam_Plectin	p.L1209	ENST00000345988.2	37	c.3627	CCDS10526.1	16																																																																																			-	NULL		0.607	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	protein_coding	OTTHUMT00000251715.1	G	NM_002705		4875030	-1	no_errors	NM_002705	genbank	human	reviewed	54_36p	silent	SNP	0.998	C
TPP1	1200	genome.wustl.edu	37	11	6638339	6638339	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr11:6638339C>T	ENST00000299427.6	-	6	614	c.554G>A	c.(553-555)cGt>cAt	p.R185H	TPP1_ENST00000534644.1_5'UTR|TPP1_ENST00000533371.1_5'UTR|RP11-732A19.9_ENST00000545572.1_RNA	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	CGGCTCAGGACGTTGCCTCAG	0.557																																																0			11											79.0	77.0	78.0					11																	6638339		2201	4296	6497	6594915	SO:0001583	missense	1200			AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.554G>A	11.37:g.6638339C>T	ENSP00000299427:p.Arg185His	Somatic		Capture	Illumina GAIIx	4	6594915	Q71V64	Missense_Mutation	SNP	superfamily_Protease propeptides/inhibitors,HMMPfam_Pro-kuma_activ,superfamily_Subtilisin-like	p.R185H	ENST00000299427.6	37	c.554	CCDS7770.1	11	.	.	.	.	.	.	.	.	.	.	C	9.329	1.060017	0.19987	.	.	ENSG00000166340	ENST00000299427	T	0.62788	0.0	4.58	2.72	0.32119	Proteinase inhibitor, propeptide (1);	0.924184	0.09375	N	0.810812	T	0.43964	0.1271	L	0.29908	0.895	0.24581	N	0.993874	B	0.02656	0.0	B	0.01281	0.0	T	0.30357	-0.9981	10	0.13470	T	0.59	-7.7673	4.36	0.11197	0.0:0.5615:0.1659:0.2726	.	185	O14773	TPP1_HUMAN	H	185	ENSP00000299427:R185H	ENSP00000299427:R185H	R	-	2	0	TPP1	6594915	0.038000	0.19896	0.952000	0.39060	0.762000	0.43233	1.994000	0.40757	0.563000	0.29222	-0.378000	0.06908	CGT	-	superfamily_Protease propeptides/inhibitors		0.557	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	protein_coding	OTTHUMT00000257261.2	C			6594915	-1	no_errors	NM_000391	genbank	human	reviewed	54_36p	missense	SNP	0.004	T
TP53	7157	genome.wustl.edu	37	17	7576928	7576928	+	Splice_Site	SNP	T	T	C	rs397516439		TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr17:7576928T>C	ENST00000269305.4	-	9	1109		c.e9-2		TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(28)|p.0?(8)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGGCAGTGCTAGGAAAGAGG	0.493		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(28)|Whole gene deletion(8)|Deletion - Frameshift(2)	lung(11)|upper_aerodigestive_tract(6)|breast(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|liver(2)|large_intestine(1)|stomach(1)|gastrointestinal_tract_(site_indeterminate)(1)|ovary(1)	17											137.0	124.0	129.0					17																	7576928		2203	4300	6503	7517653	SO:0001630	splice_region_variant	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.920-2A>G	17.37:g.7576928T>C		Somatic		Capture	Illumina GAIIx	4	7517653	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e8-2	ENST00000269305.4	37	c.920-2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	8.085	0.773141	0.16051	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.71	3.58	0.41010	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.665	0.28426	0.187:0.0:0.0:0.813	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7517653	0.089000	0.21612	0.933000	0.37362	0.236000	0.25371	0.838000	0.27572	1.993000	0.58246	0.459000	0.35465	.	-	-		0.493	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	Intron	7517653	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	splice_site	SNP	0.950	C
CAMTA1	23261	genome.wustl.edu	37	1	7724294	7724294	+	Missense_Mutation	SNP	A	A	G	rs148901835		TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr1:7724294A>G	ENST00000303635.7	+	9	1894	c.1687A>G	c.(1687-1689)Acc>Gcc	p.T563A	CAMTA1_ENST00000439411.2_Missense_Mutation_p.T563A	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	563					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CCTCACCCTGACCGCCGGCTC	0.652			T	WWTR1	epitheliod hemangioendothelioma																																		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0			1											24.0	29.0	27.0					1																	7724294		2145	4203	6348	7646881	SO:0001583	missense	23261			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.1687A>G	1.37:g.7724294A>G	ENSP00000306522:p.Thr563Ala	Somatic		Capture	Illumina GAIIx	4	7646881	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	HMMPfam_CG-1,superfamily_E set domains,HMMPfam_TIG,superfamily_Ankyrin repeat,HMMPfam_Ank,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_IQ	p.T563A	ENST00000303635.7	37	c.1687	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	a	10.91	1.484430	0.26598	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.22945	1.93;1.94	4.86	0.365	0.16131	.	2.527320	0.01261	N	0.009168	T	0.25568	0.0622	L	0.50333	1.59	0.32738	N	0.508099	B	0.09022	0.002	B	0.09377	0.004	T	0.22730	-1.0208	10	0.38643	T	0.18	-11.9057	6.2967	0.21089	0.5587:0.0:0.0728:0.3685	.	563	Q9Y6Y1	CMTA1_HUMAN	A	563	ENSP00000306522:T563A;ENSP00000402561:T563A	ENSP00000306522:T563A	T	+	1	0	CAMTA1	7646881	0.998000	0.40836	0.616000	0.29078	0.952000	0.60782	3.447000	0.52936	0.184000	0.20083	0.404000	0.27445	ACC	-	NULL		0.652	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	protein_coding	OTTHUMT00000003588.3	A	NM_015215		7646881	+1	no_errors	NM_015215	genbank	human	validated	54_36p	missense	SNP	0.952	G
TUB	7275	genome.wustl.edu	37	11	8120396	8120396	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr11:8120396C>T	ENST00000299506.2	+	9	1239	c.1090C>T	c.(1090-1092)Cgt>Tgt	p.R364C	TUB_ENST00000534099.1_Missense_Mutation_p.R370C|TUB_ENST00000305253.4_Missense_Mutation_p.R419C	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	364					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		TGGAACCTTACGTCAGGAGCT	0.493											OREG0020732	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			11											131.0	122.0	125.0					11																	8120396		2201	4296	6497	8076972	SO:0001583	missense	7275			U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1090C>T	11.37:g.8120396C>T	ENSP00000299506:p.Arg364Cys	Somatic	646	Capture	Illumina GAIIx	4	8076972	D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	superfamily_Tubby_C,HMMPfam_Tub,PatternScan_TUB_1,PatternScan_TUB_2	p.R419C	ENST00000299506.2	37	c.1255	CCDS7787.1	11	.	.	.	.	.	.	.	.	.	.	C	24.4	4.526343	0.85600	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.86297	-2.1;-2.1;-2.1	5.27	4.3	0.51218	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.95494	0.8536	H	0.96048	3.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.96655	0.9484	10	0.87932	D	0	-0.1583	15.7875	0.78319	0.1363:0.8637:0.0:0.0	.	370;364;419	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	C	370;419;364	ENSP00000434400:R370C;ENSP00000305426:R419C;ENSP00000299506:R364C	ENSP00000299506:R364C	R	+	1	0	TUB	8076972	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	6.066000	0.71185	2.610000	0.88304	0.555000	0.69702	CGT	-	superfamily_Tubby_C,HMMPfam_Tub		0.493	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TUB	protein_coding	OTTHUMT00000385823.1	C	NM_003320		8076972	+1	no_errors	NM_003320	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CLEC4D	338339	genome.wustl.edu	37	12	8671627	8671627	+	Silent	SNP	T	T	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr12:8671627T>C	ENST00000299665.2	+	4	448	c.255T>C	c.(253-255)ccT>ccC	p.P85P		NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	85					innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					ACTGTTGTCCTATTGACTGGA	0.443																																																0			12											85.0	76.0	79.0					12																	8671627		2203	4300	6503	8562894	SO:0001819	synonymous_variant	338339			AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		ENST00000299665.2:c.255T>C	12.37:g.8671627T>C		Somatic		Capture	Illumina GAIIx	4	8562894	Q8N5J5	Silent	SNP	PatternScan_C_TYPE_LECTIN_1,HMMSmart_CLECT,superfamily_C-type_lectin_fold,HMMPfam_Lectin_C	p.P85	ENST00000299665.2	37	c.255	CCDS8593.1	12																																																																																			-	HMMSmart_CLECT,superfamily_C-type_lectin_fold		0.443	CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4D	protein_coding	OTTHUMT00000400565.1	T	NM_080387		8562894	+1	no_errors	NM_080387	genbank	human	reviewed	54_36p	silent	SNP	0.271	C
MYH11	4629	genome.wustl.edu	37	16	15808869	15808869	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr16:15808869G>A	ENST00000300036.5	-	40	5792	c.5683C>T	c.(5683-5685)Cgc>Tgc	p.R1895C	NDE1_ENST00000396355.1_Intron|NDE1_ENST00000342673.5_Intron|NDE1_ENST00000396354.1_Intron|MYH11_ENST00000396324.3_Missense_Mutation_p.R1902C|MYH11_ENST00000576790.2_Missense_Mutation_p.R1895C|MYH11_ENST00000452625.2_Missense_Mutation_p.R1902C	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1895					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GCGTTGATGCGCTGGGACTCC	0.632			T	CBFB	AML																																		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0			16											131.0	123.0	126.0					16																	15808869		2197	4300	6497	15716370	SO:0001583	missense	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.5683C>T	16.37:g.15808869G>A	ENSP00000300036:p.Arg1895Cys	Somatic		Capture	Illumina GAIIx	4	15716370	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_SSF52540,HMMSmart_MYSc,HMMPfam_Myosin_head,HMMSmart_IQ,HMMPfam_IQ,HMMPfam_Myosin_tail_1	p.R1902C	ENST00000300036.5	37	c.5704	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513017	0.85389	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	4.76	4.76	0.60689	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.88930	0.6571	M	0.86028	2.79	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	D	0.89781	0.3961	10	0.46703	T	0.11	.	16.7535	0.85493	0.0:0.0:1.0:0.0	.	1902;1895;1902;1895;1902	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	C	1895;1895;1902;1902;1902	ENSP00000300036:R1895C;ENSP00000345136:R1895C;ENSP00000379616:R1902C;ENSP00000407821:R1902C	ENSP00000300036:R1895C	R	-	1	0	MYH11	15716370	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.503000	0.81632	2.177000	0.69029	0.455000	0.32223	CGC	-	HMMPfam_Myosin_tail_1		0.632	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	protein_coding	OTTHUMT00000252192.2	G	NM_001040113		15716370	-1	no_errors	NM_001040114	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PLEKHA7	144100	genome.wustl.edu	37	11	16847922	16847922	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr11:16847922G>T	ENST00000355661.3	-	10	1098	c.1088C>A	c.(1087-1089)tCt>tAt	p.S363Y	PLEKHA7_ENST00000448080.2_Missense_Mutation_p.S363Y|PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Missense_Mutation_p.S363Y			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	363					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						CGAGTACGGAGACCTGGCCTT	0.602																																																0			11											69.0	59.0	63.0					11																	16847922		2200	4294	6494	16804498	SO:0001583	missense	144100			BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.1088C>A	11.37:g.16847922G>T	ENSP00000347883:p.Ser363Tyr	Somatic		Capture	Illumina GAIIx	4	16804498	B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.S363Y	ENST00000355661.3	37	c.1088	CCDS31434.1	11	.	.	.	.	.	.	.	.	.	.	G	13.87	2.367356	0.41902	.	.	ENSG00000166689	ENST00000531066;ENST00000355661;ENST00000448080	T;T;T	0.08370	3.1;3.1;3.1	5.16	5.16	0.70880	.	0.807631	0.12209	N	0.489531	T	0.07234	0.0183	N	0.22421	0.69	0.35246	D	0.778295	P;P;D	0.54964	0.947;0.75;0.969	B;B;B	0.41036	0.254;0.123;0.346	T	0.21008	-1.0258	10	0.87932	D	0	-14.8599	10.7351	0.46120	0.0:0.1316:0.7152:0.1532	.	363;363;363	E9PKC0;Q6IQ23;Q6IQ23-2	.;PKHA7_HUMAN;.	Y	363	ENSP00000435389:S363Y;ENSP00000347883:S363Y;ENSP00000416895:S363Y	ENSP00000347883:S363Y	S	-	2	0	PLEKHA7	16804498	1.000000	0.71417	0.996000	0.52242	0.434000	0.31775	3.692000	0.54727	2.692000	0.91855	0.561000	0.74099	TCT	-	NULL		0.602	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA7	protein_coding	OTTHUMT00000387242.2	G	NM_175058		16804498	-1	no_errors	NM_175058	genbank	human	provisional	54_36p	missense	SNP	0.214	T
CROCC	9696	genome.wustl.edu	37	1	17275337	17275337	+	Missense_Mutation	SNP	C	C	T	rs143866013	byFrequency	TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr1:17275337C>T	ENST00000375541.5	+	19	2821	c.2752C>T	c.(2752-2754)Cgg>Tgg	p.R918W	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.R918W(2)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		TGAGGTGCAACGGCAGCTGGC	0.677																																																2	Substitution - Missense(2)	skin(2)	1											38.0	43.0	41.0					1																	17275337		2203	4298	6501	17147924	SO:0001583	missense	9696			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2752C>T	1.37:g.17275337C>T	ENSP00000364691:p.Arg918Trp	Somatic		Capture	Illumina GAIIx	4	17147924		Missense_Mutation	SNP	superfamily_Prefoldin	p.R918W	ENST00000375541.5	37	c.2752	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.216169	0.58452	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.23552	1.9	4.38	2.36	0.29203	.	.	.	.	.	T	0.39886	0.1095	L	0.50333	1.59	0.34311	D	0.68543	D;D	0.76494	0.999;0.999	D;D	0.63488	0.915;0.915	T	0.53143	-0.8480	9	0.72032	D	0.01	.	10.9364	0.47247	0.41:0.59:0.0:0.0	.	221;918	Q5TZA2-2;Q5TZA2	.;CROCC_HUMAN	W	918;799	ENSP00000364691:R918W	ENSP00000364691:R918W	R	+	1	2	CROCC	17147924	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.205000	0.32308	0.452000	0.26830	0.557000	0.71058	CGG	-	NULL		0.677	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	protein_coding	OTTHUMT00000006249.2	C	NM_014675		17147924	+1	no_errors	NM_014675	genbank	human	validated	54_36p	missense	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	20974609	20974609	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr16:20974609C>T	ENST00000261383.3	-	53	10596	c.10597G>A	c.(10597-10599)Gca>Aca	p.A3533T	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3533	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTCTTACCTGCCATTGGGTCT	0.502																																																0			16											83.0	78.0	80.0					16																	20974609		2201	4300	6501	20882110	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10597G>A	16.37:g.20974609C>T	ENSP00000261383:p.Ala3533Thr	Somatic		Capture	Illumina GAIIx	4	20882110	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,superfamily_Prefoldin,HMMPfam_Dynein_heavy	p.A3533T	ENST00000261383.3	37	c.10597	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.322190	0.95708	.	.	ENSG00000158486	ENST00000261383	T	0.08634	3.07	5.09	5.09	0.68999	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.28566	0.0707	M	0.68728	2.09	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.00800	-1.1561	10	0.45353	T	0.12	.	18.4954	0.90863	0.0:1.0:0.0:0.0	.	3533	Q8TD57	DYH3_HUMAN	T	3533	ENSP00000261383:A3533T	ENSP00000261383:A3533T	A	-	1	0	DNAH3	20882110	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.091000	0.71406	2.379000	0.81126	0.561000	0.74099	GCA	-	HMMPfam_Dynein_heavy		0.502	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	protein_coding	OTTHUMT00000207361.1	C	NM_017539		20882110	-1	no_errors	NM_017539	genbank	human	provisional	54_36p	missense	SNP	1.000	T
IGLV5-45	28781	genome.wustl.edu	37	22	22730762	22730762	+	RNA	SNP	G	G	A	rs372591334	byFrequency	TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr22:22730762G>A	ENST00000390296.2	+	0	285									immunoglobulin lambda variable 5-45																		GTCCCCAGCCGCTTCTCTGGA	0.517													G|||	5	0.000998403	0.003	0.0014	5008	,	,		16853	0.0		0.0	False		,,,				2504	0.0															0			22						G		5,3759		0,5,1877	80.0	81.0	81.0			-0.6	0.2	22		81	1,8231		0,1,4115	no	intergenic				0,6,5992	AA,AG,GG		0.0121,0.1328,0.05			22730762	6,11990	1882	4116	5998	21060762			0			Z73670		22q11.2	2012-02-08			ENSG00000211650	ENSG00000211650		"""Immunoglobulins / IGL locus"""	5924	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151054		22.37:g.22730762G>A		Somatic		Capture	Illumina GAIIx	4	21060762		Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00406	p.R86H	ENST00000390296.2	37	c.257		22																																																																																			-	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00406		0.517	IGLV5-45-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV5-45	IG_V_gene	OTTHUMT00000321114.2	G	NG_000002		21060762	+1	no_stop_codon	ENST00000390296	ensembl	human	known	54_36p	missense	SNP	0.128	A
KIAA0556	23247	genome.wustl.edu	37	16	27642394	27642394	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr16:27642394C>T	ENST00000261588.4	+	5	338	c.319C>T	c.(319-321)Cga>Tga	p.R107*		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	107						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AGATTATGGACGAAGAACTCT	0.512																																																0			16											45.0	34.0	38.0					16																	27642394		2194	4297	6491	27549895	SO:0001587	stop_gained	23247			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.319C>T	16.37:g.27642394C>T	ENSP00000261588:p.Arg107*	Somatic		Capture	Illumina GAIIx	4	27549895	A7E2C2	Nonsense_Mutation	SNP	superfamily_Galactose-binding domain-like,PatternScan_AKH	p.R107*	ENST00000261588.4	37	c.319	CCDS32415.1	16	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405095	0.42613	.	.	ENSG00000047578	ENST00000261588	.	.	.	4.85	3.83	0.44106	.	0.704330	0.12385	N	0.473529	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.9413	8.7452	0.34583	0.2878:0.7121:0.0:0.0	.	.	.	.	X	107	.	ENSP00000261588:R107X	R	+	1	2	KIAA0556	27549895	0.862000	0.29867	0.370000	0.25965	0.083000	0.17756	1.519000	0.35888	2.218000	0.71995	0.555000	0.69702	CGA	-	NULL		0.512	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0556	protein_coding	OTTHUMT00000433724.1	C	NM_015202		27549895	+1	no_errors	NM_015202	genbank	human	validated	54_36p	nonsense	SNP	0.791	T
METTL15	196074	genome.wustl.edu	37	11	28232746	28232746	+	Splice_Site	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr11:28232746G>A	ENST00000407364.3	+	4	759		c.e4+1		METTL15_ENST00000406787.3_Splice_Site|METTL15_ENST00000342303.5_Splice_Site|METTL15_ENST00000303459.6_Splice_Site			A6NJ78	MET15_HUMAN	methyltransferase like 15								methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						AGTTGTATCCGTAAGTAATAC	0.383																																																0			11											109.0	96.0	100.0					11																	28232746		2202	4299	6501	28189322	SO:0001630	splice_region_variant	196074			AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.407+1G>A	11.37:g.28232746G>A		Somatic		Capture	Illumina GAIIx	4	28189322	A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Splice_Site	SNP	-	e2+1	ENST00000407364.3	37	c.407+1	CCDS44559.1	11	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030213	0.75504	.	.	ENSG00000169519	ENST00000406787;ENST00000342303;ENST00000407364;ENST00000303459	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.004	0.89204	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	METTL15	28189322	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	6.309000	0.72825	2.581000	0.87130	0.460000	0.39030	.	-	-		0.383	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	METT5D1	protein_coding	OTTHUMT00000318135.2	G	NM_152636	Intron	28189322	+1	no_errors	NM_152636	genbank	human	validated	54_36p	splice_site	SNP	1.000	A
MTPAP	55149	genome.wustl.edu	37	10	30629203	30629203	+	Silent	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr10:30629203C>T	ENST00000263063.4	-	3	550	c.507G>A	c.(505-507)ttG>ttA	p.L169L	MTPAP_ENST00000358107.4_Silent_p.L299L|MTPAP_ENST00000488290.1_5'UTR	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	169					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TTGAACGTGGCAACTGATTAC	0.383																																																0			10											113.0	104.0	107.0					10																	30629203		2203	4300	6503	30669209	SO:0001819	synonymous_variant	55149			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.507G>A	10.37:g.30629203C>T		Somatic		Capture	Illumina GAIIx	4	30669209	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Silent	SNP	superfamily_Nucleotidyltransferase,superfamily_PAP/OAS1 substrate-binding domain,HMMPfam_PAP_assoc	p.L169	ENST00000263063.4	37	c.507	CCDS7165.1	10																																																																																			-	superfamily_Nucleotidyltransferase		0.383	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	protein_coding	OTTHUMT00000047426.2	C	NM_018109		30669209	-1	no_errors	NM_018109	genbank	human	validated	54_36p	silent	SNP	0.000	T
MAPRE2	10982	genome.wustl.edu	37	18	32677556	32677556	+	Splice_Site	SNP	G	G	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr18:32677556G>T	ENST00000300249.5	+	3	576		c.e3+1		MAPRE2_ENST00000538170.2_Splice_Site|MAPRE2_ENST00000436190.2_Splice_Site|MAPRE2_ENST00000589699.1_Splice_Site|MAPRE2_ENST00000413393.1_Splice_Site|MAPRE2_ENST00000588910.1_Splice_Site	NM_014268.3	NP_055083.1	Q15555	MARE2_HUMAN	microtubule-associated protein, RP/EB family, member 2						cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	9						CGTTGATAAGGTAGGAGACTT	0.318																																																0			18											57.0	57.0	57.0					18																	32677556		2203	4300	6503	30931554	SO:0001630	splice_region_variant	10982			X94232	CCDS11910.1, CCDS45850.1, CCDS45851.1, CCDS58619.1	18q12.1	2013-01-17			ENSG00000166974	ENSG00000166974			6891	protein-coding gene	gene with protein product	"""APC-binding protein EB1"""	605789				9233623, 12475954	Standard	NM_001143826		Approved	RP1, EB1, EB2	uc010xcc.3	Q15555	OTTHUMG00000132551	ENST00000300249.5:c.396+1G>T	18.37:g.32677556G>T		Somatic		Capture	Illumina GAIIx	4	30931554	B2RE21|B3KR39|B4DJV4|B7Z2L3|E9PHR3|F5H1V8|G5E9I6|Q9UQ33	Splice_Site	SNP	-	e3+1	ENST00000300249.5	37	c.396+1	CCDS11910.1	18	.	.	.	.	.	.	.	.	.	.	G	22.7	4.325886	0.81580	.	.	ENSG00000166974	ENST00000413393;ENST00000436190;ENST00000300249;ENST00000538170	.	.	.	5.64	4.76	0.60689	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9824	0.80121	0.0:0.0:0.8641:0.1359	.	.	.	.	.	-1	.	.	.	+	.	.	MAPRE2	30931554	1.000000	0.71417	0.987000	0.45799	0.993000	0.82548	8.022000	0.88759	1.366000	0.46076	0.585000	0.79938	.	-	-		0.318	MAPRE2-001	KNOWN	basic|CCDS	protein_coding	MAPRE2	protein_coding	OTTHUMT00000255753.2	G	NM_014268	Intron	30931554	+1	no_errors	NM_014268	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
SMU1	55234	genome.wustl.edu	37	9	33068870	33068870	+	Silent	SNP	G	G	A	rs113018466		TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr9:33068870G>A	ENST00000397149.3	-	4	503	c.453C>T	c.(451-453)ggC>ggT	p.G151G	SMU1_ENST00000536631.1_5'UTR	NM_018225.2	NP_060695.2	Q2TAY7	SMU1_HUMAN	smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)	151						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|lung(4)|ovary(2)|prostate(1)	9			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)		CACTGACTTCGCCAGCTAAGG	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19589	0.0		0.0	False		,,,				2504	0.0															0			9						G		10,4396	17.9+/-39.9	0,10,2193	191.0	152.0	166.0		453	-0.1	1.0	9	dbSNP_132	166	0,8600		0,0,4300	no	coding-synonymous	SMU1	NM_018225.2		0,10,6493	AA,AG,GG		0.0,0.227,0.0769		151/514	33068870	10,12996	2203	4300	6503	33058870	SO:0001819	synonymous_variant	55234			AK001667	CCDS6534.1	9p12	2013-01-10			ENSG00000122692	ENSG00000122692		"""WD repeat domain containing"""	18247	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 57"""					11438655, 11410362	Standard	NM_018225		Approved	SMU-1, FLJ10805, BWD, fSAP57	uc003zsf.1	Q2TAY7	OTTHUMG00000019757	ENST00000397149.3:c.453C>T	9.37:g.33068870G>A		Somatic		Capture	Illumina GAIIx	4	33058870	B4E3L0|Q9BU59|Q9HA96|Q9NVD1	Silent	SNP	HMMSmart_SM00667,HMMSmart_SM00668,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.G151	ENST00000397149.3	37	c.453	CCDS6534.1	9																																																																																			-	NULL		0.507	SMU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMU1	protein_coding	OTTHUMT00000052022.1	G	NM_018225		33058870	-1	no_errors	NM_018225	genbank	human	validated	54_36p	silent	SNP	0.977	A
KRT10	3858	genome.wustl.edu	37	17	38976385	38976385	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr17:38976385C>G	ENST00000269576.5	-	5	1080	c.1071G>C	c.(1069-1071)caG>caC	p.Q357H	TMEM99_ENST00000496847.1_Intron|TMEM99_ENST00000301665.3_Intron	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	357	Coil 2.|Gly-rich.|Rod.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				AGCTGGATATCTGTTCAATGT	0.363																																																0			17											96.0	94.0	95.0					17																	38976385		2203	4300	6503	36229911	SO:0001583	missense	3858			J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1071G>C	17.37:g.38976385C>G	ENSP00000269576:p.Gln357His	Somatic		Capture	Illumina GAIIx	4	36229911	Q14664|Q8N175	Missense_Mutation	SNP	HMMPfam_Filament,superfamily_Prefoldin,PatternScan_IF	p.Q357H	ENST00000269576.5	37	c.1071	CCDS11377.1	17	.	.	.	.	.	.	.	.	.	.	C	17.24	3.339030	0.60963	.	.	ENSG00000186395	ENST00000269576	T	0.78924	-1.22	5.6	3.41	0.39046	Filament (1);	0.000000	0.34932	N	0.003569	D	0.87261	0.6133	M	0.88031	2.925	0.80722	D	1	D	0.54601	0.967	D	0.72075	0.976	D	0.86546	0.1831	10	0.87932	D	0	.	6.6157	0.22776	0.0:0.2956:0.0:0.7044	.	357	P13645	K1C10_HUMAN	H	357	ENSP00000269576:Q357H	ENSP00000269576:Q357H	Q	-	3	2	KRT10	36229911	0.002000	0.14202	1.000000	0.80357	0.958000	0.62258	0.117000	0.15583	0.977000	0.38444	-0.302000	0.09304	CAG	-	HMMPfam_Filament,superfamily_Prefoldin		0.363	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT10	protein_coding	OTTHUMT00000257875.1	C	NM_000421		36229911	-1	no_errors	NM_000421	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
DYRK1A	1859	genome.wustl.edu	37	21	38878646	38878646	+	Intron	SNP	G	G	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr21:38878646G>C	ENST00000398960.2	+	10	1746				DYRK1A_ENST00000455387.2_Intron|DYRK1A_ENST00000398956.2_Intron|DYRK1A_ENST00000321219.8_Missense_Mutation_p.V541L|DYRK1A_ENST00000338785.3_3'UTR|DYRK1A_ENST00000339659.4_Intron	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A						circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TGACGTTCCTGTCTAAGGAAA	0.443																																					Melanoma(114;464 1602 31203 43785 45765)											0			21											38.0	39.0	39.0					21																	38878646		2202	4299	6501	37800516	SO:0001627	intron_variant	1859			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1671+120G>C	21.37:g.38878646G>C		Somatic		Capture	Illumina GAIIx	4	37800516	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.V541L	ENST00000398960.2	37	c.1621	CCDS42925.1	21	.	.	.	.	.	.	.	.	.	.	G	7.461	0.644779	0.14451	.	.	ENSG00000157540	ENST00000321219	T	0.55413	0.52	3.7	-7.41	0.01392	.	.	.	.	.	T	0.32852	0.0843	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29488	-1.0010	8	0.87932	D	0	.	4.1032	0.10025	0.1104:0.2514:0.475:0.1632	.	540	Q13627-4	.	L	541	ENSP00000319032:V541L	ENSP00000319032:V541L	V	+	1	0	DYRK1A	37800516	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.325000	0.07976	-2.154000	0.00792	-1.036000	0.02392	GTC	-	NULL		0.443	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	protein_coding	OTTHUMT00000194804.1	G	NM_001396		37800516	+1	no_stop_codon	ENST00000321219	ensembl	human	known	54_36p	missense	SNP	0.000	C
DHX57	90957	genome.wustl.edu	37	2	39090539	39090539	+	Missense_Mutation	SNP	C	C	G	rs535416668		TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr2:39090539C>G	ENST00000295373.6	-	3	473	c.347G>C	c.(346-348)cGa>cCa	p.R116P	DHX57_ENST00000479345.2_5'UTR|AC018693.6_ENST00000442829.1_RNA	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	116							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TTGCAGGTCTCGGAGAAGAGC	0.403																																					Melanoma(191;1090 2095 4375 23729 47341)											0			2											148.0	144.0	145.0					2																	39090539		2203	4300	6503	38944043	SO:0001583	missense	90957			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.347G>C	2.37:g.39090539C>G	ENSP00000295373:p.Arg116Pro	Somatic		Capture	Illumina GAIIx	4	38944043	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	HMMPfam_UBA,HMMPfam_RWD,HMMPfam_zf-CCCH,HMMSmart_SM00356,HMMSmart_SM00487,HMMPfam_DEAD,superfamily_P-loop containing nucleoside triphosphate hydrolases,PatternScan_DEAH_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_HA2,HMMPfam_DUF1605	p.R116P	ENST00000295373.6	37	c.347	CCDS1800.1	2	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218868	0.79464	.	.	ENSG00000163214	ENST00000295373;ENST00000355320;ENST00000417233	T	0.04015	3.73	5.68	5.68	0.88126	.	0.000000	0.45606	D	0.000349	T	0.10035	0.0246	N	0.19112	0.55	0.53005	D	0.999964	D;D	0.89917	1.0;0.986	D;P	0.75484	0.986;0.769	T	0.13045	-1.0524	10	0.52906	T	0.07	.	10.5686	0.45188	0.1338:0.7955:0.0:0.0707	.	116;116	Q6P158-2;Q6P158	.;DHX57_HUMAN	P	116;14;14	ENSP00000295373:R116P	ENSP00000295373:R116P	R	-	2	0	DHX57	38944043	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.951000	0.56684	2.669000	0.90835	0.561000	0.74099	CGA	-	NULL		0.403	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX57	protein_coding	OTTHUMT00000219940.2	C	NM_145646		38944043	-1	no_errors	NM_198963	genbank	human	provisional	54_36p	missense	SNP	0.999	G
NPHS1	4868	genome.wustl.edu	37	19	36321761	36321761	+	Silent	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr19:36321761G>A	ENST00000378910.5	-	28	3578	c.3579C>T	c.(3577-3579)taC>taT	p.Y1193Y	NPHS1_ENST00000353632.6_Silent_p.Y1153Y	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	1193	Binds to NPHS2.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCACTTCATCGTAGAGGGGTC	0.527																																																0			19											102.0	103.0	103.0					19																	36321761		2203	4300	6503	41013601	SO:0001819	synonymous_variant	4868				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.3579C>T	19.37:g.36321761G>A		Somatic		Capture	Illumina GAIIx	4	41013601	A6NDH2|C3RX61	Silent	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_C2-set_2,HMMPfam_I-set,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.Y1193	ENST00000378910.5	37	c.3579	CCDS32996.1	19																																																																																			-	NULL		0.527	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	protein_coding	OTTHUMT00000452553.1	G			41013601	-1	no_errors	NM_004646	genbank	human	validated	54_36p	silent	SNP	0.960	A
EPG5	57724	genome.wustl.edu	37	18	43534628	43534628	+	Missense_Mutation	SNP	G	G	A	rs140494095	byFrequency	TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr18:43534628G>A	ENST00000282041.5	-	2	774	c.740C>T	c.(739-741)cCg>cTg	p.P247L		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	247					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CAGTTGAGACGGGAGTTCTGG	0.453													G|||	42	0.00838658	0.0	0.0288	5008	,	,		18471	0.0159		0.0	False		,,,				2504	0.0061															0			18						G	LEU/PRO	3,4251		0,3,2124	80.0	81.0	81.0		740	5.6	1.0	18	dbSNP_134	81	0,8530		0,0,4265	yes	missense	EPG5	NM_020964.2	98	0,3,6389	AA,AG,GG		0.0,0.0705,0.0235	probably-damaging	247/2580	43534628	3,12781	2127	4265	6392	41788626	SO:0001583	missense	57724			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.740C>T	18.37:g.43534628G>A	ENSP00000282041:p.Pro247Leu	Somatic		Capture	Illumina GAIIx	4	41788626	A2BDF3|Q9H8C8	Missense_Mutation	SNP	NULL	p.P247L	ENST00000282041.5	37	c.740	CCDS11926.2	18	16	0.007326007326007326	0	0.0	8	0.022099447513812154	8	0.013986013986013986	0	0.0	G	16.45	3.126044	0.56721	7.05E-4	0.0	ENSG00000152223	ENST00000282041	T	0.11930	2.73	5.61	5.61	0.85477	.	0.054958	0.85682	D	0.000000	T	0.20414	0.0491	L	0.56769	1.78	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.66497	0.944;0.766	T	0.00546	-1.1678	10	0.72032	D	0.01	-10.225	19.6471	0.95779	0.0:0.0:1.0:0.0	.	247;247	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	L	247	ENSP00000282041:P247L	ENSP00000282041:P247L	P	-	2	0	EPG5	41788626	1.000000	0.71417	0.989000	0.46669	0.004000	0.04260	5.781000	0.68964	2.629000	0.89072	0.655000	0.94253	CCG	-	NULL		0.453	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1632	protein_coding	OTTHUMT00000445081.1	G	NM_020964		41788626	-1	no_errors	NM_020964	genbank	human	validated	54_36p	missense	SNP	0.993	A
CCNYL2	414194	genome.wustl.edu	37	10	42949779	42949779	+	RNA	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr10:42949779G>A	ENST00000483242.3	-	0	623					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					breast(2)|endometrium(1)|lung(3)|ovary(1)	7						CCCTGGTGCTGGTGCAACCCA	0.582																																																0			10																																								42269785			414194			BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42949779G>A		Somatic		Capture	Illumina GAIIx	4	42269785		Nonsense_Mutation	SNP	HMMSmart_SM00385,superfamily_Cyclin-like,HMMPfam_Cyclin_N	p.Q197*	ENST00000483242.3	37	c.589		10	.	.	.	.	.	.	.	.	.	.	.	10.86	1.468789	0.26335	.	.	ENSG00000182632	ENST00000426433	.	.	.	1.64	0.603	0.17541	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	5.6443	0.17580	0.0:0.3474:0.6526:0.0	.	.	.	.	X	19	.	ENSP00000395902:Q19X	Q	-	1	0	CCNYL2	42269785	0.989000	0.36119	0.361000	0.25849	0.024000	0.10985	0.734000	0.26101	0.224000	0.20940	0.298000	0.19748	CAG	-	NULL		0.582	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	pseudogene	OTTHUMT00000047670.5	G	XM_936368		42269785	-1	no_errors	XM_374787	genbank	human	model	54_36p	nonsense	SNP	0.061	A
ZNF335	63925	genome.wustl.edu	37	20	44579114	44579114	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr20:44579114C>G	ENST00000322927.2	-	21	3410	c.3310G>C	c.(3310-3312)Gca>Cca	p.A1104P	ZNF335_ENST00000426788.1_Missense_Mutation_p.A949P	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1104					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				AGGTGGCATGCAAAAGGCTTC	0.587																																																0			20											134.0	131.0	132.0					20																	44579114		2203	4300	6503	44012521	SO:0001583	missense	63925			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3310G>C	20.37:g.44579114C>G	ENSP00000325326:p.Ala1104Pro	Somatic		Capture	Illumina GAIIx	4	44012521	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.A1104P	ENST00000322927.2	37	c.3310	CCDS13389.1	20	.	.	.	.	.	.	.	.	.	.	C	10.73	1.433878	0.25813	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.16457	2.34;2.34	4.82	1.4	0.22301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.743986	0.13003	N	0.421535	T	0.18002	0.0432	L	0.41079	1.255	0.09310	N	1	P;P	0.38335	0.573;0.627	B;B	0.42112	0.259;0.376	T	0.15492	-1.0435	10	0.33141	T	0.24	-5.0528	13.4051	0.60908	0.6336:0.3663:0.0:0.0	.	949;1104	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	P	1104;881;949	ENSP00000325326:A1104P;ENSP00000397098:A949P	ENSP00000243961:A881P	A	-	1	0	ZNF335	44012521	0.004000	0.15560	0.256000	0.24389	0.858000	0.48976	0.138000	0.16016	0.610000	0.30035	0.563000	0.77884	GCA	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355		0.587	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	protein_coding	OTTHUMT00000079553.1	C	NM_022095		44012521	-1	no_errors	NM_022095	genbank	human	reviewed	54_36p	missense	SNP	0.320	G
RUVBL2	10856	genome.wustl.edu	37	19	49517781	49517781	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr19:49517781A>G	ENST00000595090.1	+	12	1506	c.1042A>G	c.(1042-1044)Ata>Gta	p.I348V	RUVBL2_ENST00000601968.1_Missense_Mutation_p.I303V|RUVBL2_ENST00000413176.2_Missense_Mutation_p.I303V	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	348					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		CGGCATCCCCATAGACCTGCT	0.617																																																0			19											57.0	64.0	61.0					19																	49517781		1996	4167	6163	54209593	SO:0001583	missense	10856			AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.1042A>G	19.37:g.49517781A>G	ENSP00000473172:p.Ile348Val	Somatic		Capture	Illumina GAIIx	4	54209593	B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA,HMMPfam_TIP49	p.I348V	ENST00000595090.1	37	c.1042	CCDS42588.1	19	.	.	.	.	.	.	.	.	.	.	A	12.58	1.979475	0.34942	.	.	ENSG00000183207	ENST00000221413;ENST00000413176	T	0.40476	1.03	5.19	4.15	0.48705	TIP49, C-terminal (1);ATPase, AAA+ type, core (1);	0.049234	0.85682	D	0.000000	T	0.28566	0.0707	L	0.31845	0.965	0.58432	D	0.999997	B;B	0.10296	0.003;0.001	B;B	0.16289	0.015;0.006	T	0.05937	-1.0855	10	0.12766	T	0.61	-26.5183	9.7694	0.40580	0.8454:0.0:0.0:0.1546	.	348;314	Q9Y230;B3KNL2	RUVB2_HUMAN;.	V	348;303	ENSP00000413890:I303V	ENSP00000221413:I348V	I	+	1	0	RUVBL2	54209593	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	3.495000	0.53280	0.885000	0.36088	0.459000	0.35465	ATA	-	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_TIP49		0.617	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUVBL2	protein_coding	OTTHUMT00000466235.1	A			54209593	+1	no_errors	NM_006666	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MED25	81857	genome.wustl.edu	37	19	50331742	50331742	+	Silent	SNP	C	C	T	rs367931150		TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr19:50331742C>T	ENST00000312865.6	+	4	395	c.342C>T	c.(340-342)atC>atT	p.I114I	MED25_ENST00000538643.1_Intron	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	114	Interaction with the Mediator complex.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		GCAGCCTCATCGCGGAAGGAC	0.627																																					GBM(51;894 1657 37868)											0			19						C		1,4405	2.1+/-5.4	0,1,2202	96.0	97.0	97.0		342	0.2	1.0	19		97	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MED25	NM_030973.3		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		114/748	50331742	2,13004	2203	4300	6503	55023554	SO:0001819	synonymous_variant	81857			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.342C>T	19.37:g.50331742C>T		Somatic		Capture	Illumina GAIIx	4	55023554	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Silent	SNP	NULL	p.I114	ENST00000312865.6	37	c.342	CCDS33075.1	19																																																																																			-	NULL		0.627	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	protein_coding	OTTHUMT00000465316.1	C	NM_030973		55023554	+1	no_errors	NM_030973	genbank	human	validated	54_36p	silent	SNP	0.996	T
DDX4	54514	genome.wustl.edu	37	5	55088496	55088496	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr5:55088496G>A	ENST00000505374.1	+	17	1422	c.1330G>A	c.(1330-1332)Gtt>Att	p.V444I	DDX4_ENST00000511853.1_Missense_Mutation_p.V295I|DDX4_ENST00000354991.5_Missense_Mutation_p.V410I|DDX4_ENST00000514278.2_Missense_Mutation_p.V424I|DDX4_ENST00000353507.5_Missense_Mutation_p.V410I	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	444	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				CAAATACTTAGTTTTGGATGA	0.343																																																0			5											64.0	63.0	63.0					5																	55088496		2203	4300	6503	55124253	SO:0001583	missense	54514			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.1330G>A	5.37:g.55088496G>A	ENSP00000424838:p.Val444Ile	Somatic		Capture	Illumina GAIIx	4	55124253	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,PatternScan_DEAD_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C	p.V444I	ENST00000505374.1	37	c.1330	CCDS3969.1	5	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444040	0.63067	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000354991;ENST00000511853	T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83	5.39	5.39	0.77823	RNA helicase, ATP-dependent, DEAD-box, conserved site (1);DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.130467	0.49305	D	0.000145	T	0.41949	0.1181	L	0.33753	1.03	0.58432	D	0.999999	P;P;P;D	0.69078	0.682;0.688;0.682;0.997	B;B;B;D	0.77557	0.365;0.262;0.365;0.99	T	0.07083	-1.0791	10	0.33940	T	0.23	-16.9927	19.5193	0.95179	0.0:0.0:1.0:0.0	.	424;295;410;444	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	I	410;424;444;424;410;295	ENSP00000334167:V410I;ENSP00000425359:V424I;ENSP00000424838:V444I;ENSP00000427167:V424I;ENSP00000347087:V410I;ENSP00000423123:V295I	ENSP00000334167:V410I	V	+	1	0	DDX4	55124253	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.405000	0.97313	2.687000	0.91594	0.561000	0.74099	GTT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,PatternScan_DEAD_ATP_HELICASE		0.343	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX4	protein_coding	OTTHUMT00000214147.2	G	NM_024415		55124253	+1	no_errors	NM_024415	genbank	human	validated	54_36p	missense	SNP	1.000	A
LANCL2	55915	genome.wustl.edu	37	7	55459485	55459485	+	Splice_Site	SNP	G	G	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr7:55459485G>C	ENST00000254770.2	+	2	782		c.e2-1			NM_018697.3	NP_061167.1	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2 (bacterial)						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of abscisic acid-activated signaling pathway (GO:0009789)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|GTP binding (GO:0005525)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	25	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			TTGGATCTCAGATCATTCATA	0.368																																																0			7											57.0	57.0	57.0					7																	55459485		2203	4300	6503	55426979	SO:0001630	splice_region_variant	55915			AJ278245	CCDS5517.1	7q31.1-q31.33	2008-07-18	2001-12-04		ENSG00000132434	ENSG00000132434			6509	protein-coding gene	gene with protein product	"""testis-specific adriamycin sensitivity protein"", ""G protein-coupled receptor 69B"""	612919	"""LanC (bacterial lantibiotic synthetase component C)-like 2"""	GPR69B		11762191	Standard	NM_018697		Approved	TASP	uc003tqp.3	Q9NS86	OTTHUMG00000023779	ENST00000254770.2:c.205-1G>C	7.37:g.55459485G>C		Somatic		Capture	Illumina GAIIx	4	55426979	B2R8D4|Q6NSL4|Q8TCQ3|Q9BSR1	Splice_Site	SNP	-	e2-1	ENST00000254770.2	37	c.205-1	CCDS5517.1	7	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348668	0.82132	.	.	ENSG00000132434	ENST00000254770	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5771	0.91159	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LANCL2	55426979	1.000000	0.71417	0.994000	0.49952	0.947000	0.59692	6.903000	0.75703	2.727000	0.93392	0.655000	0.94253	.	-	-		0.368	LANCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LANCL2	protein_coding	OTTHUMT00000251459.1	G	NM_018697	Intron	55426979	+1	no_errors	NM_018697	genbank	human	validated	54_36p	splice_site	SNP	1.000	C
LRP1	4035	genome.wustl.edu	37	12	57584600	57584600	+	Nonsense_Mutation	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr12:57584600G>A	ENST00000243077.3	+	43	7510	c.7044G>A	c.(7042-7044)tgG>tgA	p.W2348*		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2348					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCATGTTCTGGACCAACTGGA	0.602																																																0			12											70.0	59.0	63.0					12																	57584600		2203	4300	6503	55870867	SO:0001587	stop_gained	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.7044G>A	12.37:g.57584600G>A	ENSP00000243077:p.Trp2348*	Somatic		Capture	Illumina GAIIx	4	55870867	Q2PP12|Q86SW0|Q8IVG8	Nonsense_Mutation	SNP	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b,PatternScan_EGF_1	p.W2348*	ENST00000243077.3	37	c.7044	CCDS8932.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	50|50	17.120043|17.120043	0.99879|0.99879	.|.	.|.	ENSG00000123384|ENSG00000123384	ENST00000554118|ENST00000243077	.|.	.|.	.|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	.|0.084626	.|0.51477	.|D	.|0.000090	T|.	0.43875|.	0.1267|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.32241|.	-0.9914|.	4|.	.|0.02654	.|T	.|1	.|.	16.9063|16.9063	0.86128|0.86128	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	34|2348	.|.	.|ENSP00000243077:W2348X	G|W	+|+	2|3	0|0	LRP1|LRP1	55870867|55870867	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.739000|0.739000	0.42172|0.42172	9.639000|9.639000	0.98448|0.98448	2.506000|2.506000	0.84524|0.84524	0.542000|0.542000	0.68232|0.68232	GGA|TGG	-	superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b		0.602	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	G	NM_002332		55870867	+1	no_errors	NM_002332	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
SERPINB2	5055	genome.wustl.edu	37	18	61564441	61564441	+	Silent	SNP	G	G	C	rs140108044	byFrequency	TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr18:61564441G>C	ENST00000299502.4	+	4	485	c.405G>C	c.(403-405)gcG>gcC	p.A135A	SERPINB2_ENST00000482254.1_3'UTR|SERPINB2_ENST00000457692.1_Silent_p.A135A	NM_002575.2	NP_002566.1	P05120	PAI2_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 2	135					blood coagulation (GO:0007596)|fibrinolysis (GO:0042730)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|liver(1)|lung(12)|prostate(2)|skin(2)|stomach(1)	32		Esophageal squamous(42;0.131)			Tenecteplase(DB00031)|Urokinase(DB00013)	AGAAGTCTGCGAGCTTCCGGG	0.413																																																0			18											107.0	108.0	108.0					18																	61564441		2203	4300	6503	59715421	SO:0001819	synonymous_variant	5055			Y00630	CCDS11989.1	18q21.3	2014-02-18	2005-08-18		ENSG00000197632	ENSG00000197632		"""Serine (or cysteine) peptidase inhibitors"""	8584	protein-coding gene	gene with protein product		173390	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2"""	PLANH2, PAI2		24172014	Standard	NM_002575		Approved	HsT1201	uc002ljo.3	P05120	OTTHUMG00000060592	ENST00000299502.4:c.405G>C	18.37:g.61564441G>C		Somatic		Capture	Illumina GAIIx	4	59715421	Q96E96	Silent	SNP	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN,PatternScan_SERPIN	p.A135	ENST00000299502.4	37	c.405	CCDS11989.1	18	.	.	.	.	.	.	.	.	.	.	G	9.062	0.994713	0.19043	.	.	ENSG00000242550	ENST00000397996;ENST00000418725	.	.	.	5.93	-10.4	0.00318	.	.	.	.	.	T	0.21801	0.0525	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	T	0.16541	-1.0399	4	.	.	.	.	6.6103	0.22747	0.1647:0.2401:0.5096:0.0857	.	.	.	.	Q	12	.	.	E	+	1	0	SERPINB10	59715421	0.000000	0.05858	0.000000	0.03702	0.974000	0.67602	-4.049000	0.00305	-1.747000	0.01333	-0.290000	0.09829	GAG	-	HMMPfam_Serpin,superfamily_Prot_inh_serpin,HMMSmart_SERPIN		0.413	SERPINB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB2	protein_coding	OTTHUMT00000134009.1	G	NM_002575		59715421	+1	no_errors	NM_002575	genbank	human	validated	54_36p	silent	SNP	0.000	C
RARRES3	5920	genome.wustl.edu	37	11	63312250	63312250	+	Silent	SNP	C	C	T	rs548285155		TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr11:63312250C>T	ENST00000255688.3	+	3	324	c.276C>T	c.(274-276)atC>atT	p.I92I	RARRES3_ENST00000537871.1_3'UTR|RARRES3_ENST00000354445.2_Silent_p.I92I|RARRES3_ENST00000439013.2_Silent_p.I92I	NM_004585.3	NP_004576.2	Q9UL19	HRSL4_HUMAN	retinoic acid receptor responder (tazarotene induced) 3	92					lipid catabolic process (GO:0016042)|negative regulation of cell proliferation (GO:0008285)|phospholipid metabolic process (GO:0006644)	integral component of membrane (GO:0016021)	phospholipase A2 activity (GO:0004623)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	6						TGGAGGTGATCATCAGTTCTG	0.532																																																0			11											117.0	123.0	121.0					11																	63312250		2032	4194	6226	63068826	SO:0001819	synonymous_variant	5920				CCDS41662.1	11q23	2008-05-02			ENSG00000133321	ENSG00000133321			9869	protein-coding gene	gene with protein product		605092				9270552	Standard	NM_004585		Approved	TIG3, HRASLS4	uc001nxf.4	Q9UL19	OTTHUMG00000167850	ENST00000255688.3:c.276C>T	11.37:g.63312250C>T		Somatic		Capture	Illumina GAIIx	4	63068826	B2R599|B4DDW2|E7ENZ7|O95200	Silent	SNP	HMMPfam_NC	p.I92	ENST00000255688.3	37	c.276	CCDS41662.1	11																																																																																			-	HMMPfam_NC		0.532	RARRES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RARRES3	protein_coding	OTTHUMT00000396629.1	C			63068826	+1	no_errors	NM_004585	genbank	human	validated	54_36p	silent	SNP	0.970	T
PLA2G15	23659	genome.wustl.edu	37	16	68279354	68279354	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr16:68279354C>G	ENST00000219345.5	+	1	108	c.25C>G	c.(25-27)Cgt>Ggt	p.R9G	PLA2G15_ENST00000413021.2_Missense_Mutation_p.R9G|PLA2G15_ENST00000566188.1_Missense_Mutation_p.R9G|PLA2G15_ENST00000444212.2_Missense_Mutation_p.R9G	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	9					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)			kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						CCGCCCCTACCGTGTGGGGCT	0.701																																																0			16											44.0	38.0	40.0					16																	68279354		2197	4300	6497	66836855	SO:0001583	missense	23659			AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.25C>G	16.37:g.68279354C>G	ENSP00000219345:p.Arg9Gly	Somatic		Capture	Illumina GAIIx	4	66836855	B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Missense_Mutation	SNP	superfamily_alpha/beta-Hydrolases,HMMPfam_LACT	p.R9G	ENST00000219345.5	37	c.25	CCDS10864.1	16	.	.	.	.	.	.	.	.	.	.	C	9.987	1.229821	0.22542	.	.	ENSG00000103066	ENST00000413021;ENST00000219345;ENST00000444212	D;D;D	0.99252	-5.06;-4.02;-5.63	4.24	1.16	0.20824	.	1.105560	0.06664	N	0.765037	D	0.97754	0.9263	L	0.61218	1.895	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.06405	0.001;0.002;0.002;0.001	D	0.93563	0.6897	10	0.38643	T	0.18	-6.1121	4.3556	0.11176	0.0:0.6053:0.1879:0.2069	.	9;9;9;9	B4DPU0;B4DUD1;B4DJW4;Q8NCC3	.;.;.;PAG15_HUMAN	G	9	ENSP00000394197:R9G;ENSP00000219345:R9G;ENSP00000393610:R9G	ENSP00000219345:R9G	R	+	1	0	PLA2G15	66836855	0.003000	0.15002	0.002000	0.10522	0.006000	0.05464	0.693000	0.25497	0.312000	0.23038	0.511000	0.50034	CGT	-	NULL		0.701	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G15	protein_coding	OTTHUMT00000268888.2	C	NM_012320		66836855	+1	no_errors	NM_012320	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
CABP4	57010	genome.wustl.edu	37	11	67225914	67225914	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr11:67225914C>T	ENST00000325656.5	+	5	801	c.724C>T	c.(724-726)Ccg>Tcg	p.P242S	CABP4_ENST00000438189.2_Missense_Mutation_p.P137S|CTC-1337H24.1_ENST00000602912.1_lincRNA	NM_145200.3	NP_660201.1	P57796	CABP4_HUMAN	calcium binding protein 4	242					photoreceptor cell morphogenesis (GO:0008594)|phototransduction (GO:0007602)|retinal bipolar neuron differentiation (GO:0060040)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytosol (GO:0005829)|extracellular region (GO:0005576)|synapse (GO:0045202)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)			central_nervous_system(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)	11			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			GCTCGGGGAGCCGCTGGCGGG	0.627																																																0			11											54.0	61.0	59.0					11																	67225914		2200	4295	6495	66982490	SO:0001583	missense	57010			AC005849	CCDS8166.1, CCDS73333.1	11q13.2	2013-09-20			ENSG00000175544	ENSG00000175544		"""EF-hand domain containing"""	1386	protein-coding gene	gene with protein product		608965				10625670, 16960802	Standard	NM_145200		Approved	CSNB2B	uc001olo.3	P57796	OTTHUMG00000168033	ENST00000325656.5:c.724C>T	11.37:g.67225914C>T	ENSP00000324960:p.Pro242Ser	Somatic		Capture	Illumina GAIIx	4	66982490	Q8N4Z2|Q8WWY5	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1	p.P242S	ENST00000325656.5	37	c.724	CCDS8166.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168188	0.78339	.	.	ENSG00000175544	ENST00000438189;ENST00000325656	T;T	0.70399	-0.48;-0.48	4.99	4.08	0.47627	EF-hand-like domain (1);	0.130692	0.52532	D	0.000070	T	0.56529	0.1991	N	0.10972	0.075	0.43698	D	0.996157	P;B	0.34934	0.476;0.264	B;B	0.40329	0.326;0.033	T	0.63681	-0.6582	10	0.72032	D	0.01	-19.8115	12.6752	0.56891	0.0:0.9187:0.0:0.0813	.	242;137	P57796;P57796-2	CABP4_HUMAN;.	S	137;242	ENSP00000401555:P137S;ENSP00000324960:P242S	ENSP00000324960:P242S	P	+	1	0	CABP4	66982490	1.000000	0.71417	0.964000	0.40570	0.623000	0.37688	2.594000	0.46189	1.480000	0.48289	0.655000	0.94253	CCG	-	superfamily_EF-hand		0.627	CABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABP4	protein_coding	OTTHUMT00000397624.2	C			66982490	+1	no_errors	NM_145200	genbank	human	validated	54_36p	missense	SNP	0.996	T
RPLP1	6176	genome.wustl.edu	37	15	69747810	69747810	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr15:69747810G>C	ENST00000260379.6	+	4	474	c.309G>C	c.(307-309)gaG>gaC	p.E103D	RPLP1_ENST00000560274.1_Missense_Mutation_p.S39T|U3_ENST00000384391.1_RNA|RPLP1_ENST00000357790.5_Missense_Mutation_p.E78D	NM_001003.2	NP_000994.1	P05386	RLA1_HUMAN	ribosomal protein, large, P1	103					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			ovary(1)	1						AATCCGAGGAGTCTGATGATG	0.358																																																0			15											54.0	51.0	52.0					15																	69747810		2199	4298	6497	67534864	SO:0001583	missense	6176				CCDS10233.1, CCDS10234.1	15q22	2011-07-29			ENSG00000137818	ENSG00000137818		"""L ribosomal proteins"""	10372	protein-coding gene	gene with protein product		180520					Standard	NM_001003		Approved	LP1	uc002asd.1	P05386	OTTHUMG00000133359	ENST00000260379.6:c.309G>C	15.37:g.69747810G>C	ENSP00000346037:p.Glu103Asp	Somatic		Capture	Illumina GAIIx	4	67534864	A6NIB2	Missense_Mutation	SNP	HMMPfam_Ribosomal_60s	p.E103D	ENST00000260379.6	37	c.309	CCDS10233.1	15	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281161	0.23392	.	.	ENSG00000137818	ENST00000260379;ENST00000357790	.	.	.	5.24	-2.31	0.06765	.	0.000000	0.85682	D	0.000000	T	0.48677	0.1513	M	0.80422	2.495	0.19575	N	0.999967	B;B	0.33000	0.004;0.393	B;B	0.37731	0.037;0.257	T	0.53222	-0.8469	9	0.52906	T	0.07	.	11.4527	0.50162	0.4896:0.0:0.5104:0.0	.	78;103	A6NIB2;P05386	.;RLA1_HUMAN	D	103;78	.	ENSP00000346037:E103D	E	+	3	2	RPLP1	67534864	0.998000	0.40836	0.985000	0.45067	0.876000	0.50452	0.423000	0.21313	-0.304000	0.08843	-1.523000	0.00931	GAG	-	HMMPfam_Ribosomal_60s		0.358	RPLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPLP1	protein_coding	OTTHUMT00000257195.2	G	NM_001003		67534864	+1	no_errors	NM_001003	genbank	human	reviewed	54_36p	missense	SNP	0.994	C
BAI3	577	genome.wustl.edu	37	6	70034877	70034877	+	Silent	SNP	A	A	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr6:70034877A>G	ENST00000370598.1	+	21	3749	c.2928A>G	c.(2926-2928)acA>acG	p.T976T	BAI3_ENST00000238918.8_Silent_p.T182T	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	976					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				AAATTAGGACACGGCTTATAA	0.408																																																0			6											203.0	193.0	196.0					6																	70034877		2203	4300	6503	70091598	SO:0001819	synonymous_variant	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2928A>G	6.37:g.70034877A>G		Somatic		Capture	Illumina GAIIx	4	70091598	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00008,HMMPfam_HRM,HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.T976	ENST00000370598.1	37	c.2928	CCDS4968.1	6																																																																																			-	HMMPfam_7tm_2		0.408	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	protein_coding	OTTHUMT00000041120.1	A			70091598	+1	no_errors	NM_001704	genbank	human	reviewed	54_36p	silent	SNP	0.915	G
ZNF516	9658	genome.wustl.edu	37	18	74154469	74154469	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr18:74154469C>T	ENST00000443185.2	-	3	859	c.542G>A	c.(541-543)aGc>aAc	p.S181N	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTCGAACTGGCTCTTGCAGAA	0.667																																																0			18											20.0	23.0	22.0					18																	74154469		2120	4215	6335	72283457	SO:0001583	missense	9658			D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.542G>A	18.37:g.74154469C>T	ENSP00000394757:p.Ser181Asn	Somatic		Capture	Illumina GAIIx	4	72283457		Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.S181N	ENST00000443185.2	37	c.542		18	.	.	.	.	.	.	.	.	.	.	C	13.42	2.231688	0.39399	.	.	ENSG00000101493	ENST00000443185	T	0.01613	4.73	4.53	2.55	0.30701	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.181464	0.47852	D	0.000206	T	0.01489	0.0048	.	.	.	0.27662	N	0.947055	B	0.21071	0.051	B	0.19946	0.027	T	0.43686	-0.9376	9	0.31617	T	0.26	-22.9273	8.4327	0.32769	0.0:0.6117:0.2698:0.1185	.	181	Q92618	ZN516_HUMAN	N	181	ENSP00000394757:S181N	ENSP00000394757:S181N	S	-	2	0	ZNF516	72283457	1.000000	0.71417	0.983000	0.44433	0.984000	0.73092	1.745000	0.38278	1.231000	0.43661	0.655000	0.94253	AGC	-	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.667	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ZNF516	protein_coding		C	NM_014643		72283457	-1	no_errors	ENST00000217537	ensembl	human	known	54_36p	missense	SNP	0.904	T
LOC101929408	101929408	genome.wustl.edu	37	15	76039702	76039702	+	IGR	SNP	T	T	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr15:76039702T>G								AC019294.1 (8134 upstream) : RP11-24M17.4 (11204 downstream)																							AGAATCTTTGTGCTCTCGCTG	0.403																																																0			15																																								73826757	SO:0001628	intergenic_variant	391532																															15.37:g.76039702T>G		Somatic		Capture	Illumina GAIIx	4	73826757		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.403					LOC391532			T			73826757	+1	pseudogene	XR_017653	genbank	human	model	54_36p	rna	SNP	0.978	G
SIRT7	51547	genome.wustl.edu	37	17	79872212	79872212	+	Silent	SNP	G	G	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr17:79872212G>T	ENST00000328666.6	-	7	836	c.774C>A	c.(772-774)gcC>gcA	p.A258A	PCYT2_ENST00000538721.2_5'Flank|PCYT2_ENST00000570388.1_5'Flank|PCYT2_ENST00000538936.2_5'Flank|PCYT2_ENST00000571105.1_5'Flank	NM_016538.2	NP_057622.1	Q9NRC8	SIR7_HUMAN	sirtuin 7	258	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription on exit from mitosis (GO:0007072)|rRNA transcription (GO:0009303)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleolus organizer region (GO:0005731)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CTGCTCTGCTGGCAGCCTCGG	0.632																																																0			17											56.0	48.0	50.0					17																	79872212		2203	4300	6503	77465504	SO:0001819	synonymous_variant	51547			AF233395	CCDS11792.1	17q25.3	2010-06-25	2010-06-25			ENSG00000187531			14935	protein-coding gene	gene with protein product		606212	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 7"", ""sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)"""			10873683, 16618798	Standard	NM_016538		Approved		uc002kcj.2	Q9NRC8		ENST00000328666.6:c.774C>A	17.37:g.79872212G>T		Somatic		Capture	Illumina GAIIx	4	77465504	A8K2K0|B3KSU8|Q3MIK4|Q9NSZ6|Q9NUS6	Silent	SNP	superfamily_DHS-like NAD/FAD-binding domain,HMMPfam_SIR2	p.A258	ENST00000328666.6	37	c.774	CCDS11792.1	17																																																																																			-	superfamily_DHS-like NAD/FAD-binding domain,HMMPfam_SIR2		0.632	SIRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT7	protein_coding	OTTHUMT00000439961.1	G	NM_016538		77465504	-1	no_errors	NM_016538	genbank	human	reviewed	54_36p	silent	SNP	0.572	T
Unknown	0	genome.wustl.edu	37	6	80779065	80779065	+	IGR	SNP	C	C	G	rs375695926		TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr6:80779065C>G								TTK (26821 upstream) : BCKDHB (37298 downstream)																							AGTCCTTACACTTTCATTGCA	0.413																																																0			6																																								80835784	SO:0001628	intergenic_variant	643562																															6.37:g.80779065C>G		Somatic		Capture	Illumina GAIIx	4	80835784		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.413					LOC643562			C			80835784	-1	pseudogene	XR_016539	genbank	human	model	54_36p	rna	SNP	0.956	G
Unknown	0	genome.wustl.edu	37	15	89533425	89533425	+	IGR	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr15:89533425G>A								AC067805.1 (17742 upstream) : RP11-326A19.4 (51028 downstream)																							CATTTTTACAGGAGTAAACTG	0.433																																																0			15																																								87334429	SO:0001628	intergenic_variant	0																															15.37:g.89533425G>A		Somatic		Capture	Illumina GAIIx	4	87334429		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.433					LOC100129942			G			87334429	-1	pseudogene	XR_038237	genbank	human	model	54_36p	rna	SNP	1.000	A
C15orf32	145858	genome.wustl.edu	37	15	93015689	93015689	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr15:93015689C>T	ENST00000333334.2	+	1	806	c.311C>T	c.(310-312)cCa>cTa	p.P104L	C15orf32_ENST00000556865.1_Missense_Mutation_p.P104L|RP11-763K15.1_ENST00000554440.1_lincRNA	NM_153040.2	NP_694585.1	Q32M92	CO032_HUMAN	chromosome 15 open reading frame 32	104										endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	12	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)			TTGTTAACACCATCTCAGCTC	0.423																																																0			15											77.0	83.0	81.0					15																	93015689		2198	4298	6496	90816693	SO:0001583	missense	145858				CCDS10373.1, CCDS73784.1	15q26.1	2014-09-10			ENSG00000183643	ENSG00000183643			26549	protein-coding gene	gene with protein product							Standard	NM_153040		Approved	FLJ32831	uc002brc.1	Q32M92	OTTHUMG00000149844	ENST00000333334.2:c.311C>T	15.37:g.93015689C>T	ENSP00000330267:p.Pro104Leu	Somatic		Capture	Illumina GAIIx	4	90816693	C5HTZ8|Q96M45	Missense_Mutation	SNP	NULL	p.P104L	ENST00000333334.2	37	c.311	CCDS10373.1	15	.	.	.	.	.	.	.	.	.	.	C	7.437	0.639967	0.14386	.	.	ENSG00000183643	ENST00000333334	T	0.57107	0.42	2.42	-0.733	0.11144	.	.	.	.	.	T	0.30417	0.0764	N	0.14661	0.345	0.09310	N	1	P	0.35908	0.527	B	0.34873	0.191	T	0.18967	-1.0320	9	0.87932	D	0	.	4.9889	0.14203	0.4239:0.3687:0.2074:0.0	.	104	Q32M92	CO032_HUMAN	L	104	ENSP00000330267:P104L	ENSP00000330267:P104L	P	+	2	0	C15orf32	90816693	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.886000	0.04157	-0.166000	0.10890	-0.842000	0.03052	CCA	-	NULL		0.423	C15orf32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C15orf32	protein_coding	OTTHUMT00000313527.2	C	NM_153040		90816693	+1	no_errors	NM_153040	genbank	human	predicted	54_36p	missense	SNP	0.013	T
CLLU1OS	574016	genome.wustl.edu	37	12	92814938	92814938	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr12:92814938T>A	ENST00000378487.2	-	3	155	c.154A>T	c.(154-156)Aca>Tca	p.T52S	RP11-693J15.4_ENST00000508671.1_RNA|CLLU1_ENST00000378485.1_5'Flank|CLLU1OS_ENST00000538965.1_Missense_Mutation_p.T52S	NM_001025232.1	NP_001020403.1	Q5K130	CLU1O_HUMAN	chronic lymphocytic leukemia up-regulated 1 opposite strand	52										large_intestine(1)|lung(7)	8						GGTAAACTTGTTAGCAAGGCC	0.413																																																0			12											121.0	113.0	116.0					12																	92814938		2203	4300	6503	91339069	SO:0001583	missense	574016			AJ845168	CCDS31871.1	12q22	2006-03-30	2006-03-30		ENSG00000205057	ENSG00000205057			24070	protein-coding gene	gene with protein product			"""chronic lymphocytic leukemia up-regulated 1 overlapping strand"""				Standard	NM_001025232		Approved		uc001tcb.1	Q5K130	OTTHUMG00000161990	ENST00000378487.2:c.154A>T	12.37:g.92814938T>A	ENSP00000367748:p.Thr52Ser	Somatic		Capture	Illumina GAIIx	4	91339069		Missense_Mutation	SNP	NULL	p.T52S	ENST00000378487.2	37	c.154	CCDS31871.1	12	.	.	.	.	.	.	.	.	.	.	T	11.72	1.721973	0.30503	.	.	ENSG00000205057	ENST00000378487;ENST00000538965	.	.	.	3.32	2.13	0.27403	.	.	.	.	.	T	0.17109	0.0411	N	0.08118	0	0.09310	N	1	B	0.33103	0.397	B	0.28638	0.092	T	0.14035	-1.0487	8	0.87932	D	0	.	6.5659	0.22511	0.0:0.0:0.2474:0.7526	.	52	Q5K130	CLU1O_HUMAN	S	52	.	ENSP00000367748:T52S	T	-	1	0	CLLU1OS	91339069	0.001000	0.12720	0.003000	0.11579	0.425000	0.31504	0.113000	0.15499	0.634000	0.30469	0.448000	0.29417	ACA	-	NULL		0.413	CLLU1OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLLU1OS	protein_coding	OTTHUMT00000366646.1	T			91339069	-1	no_errors	NM_001025232	genbank	human	provisional	54_36p	missense	SNP	0.035	A
RHOBTB3	22836	genome.wustl.edu	37	5	95088016	95088016	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr5:95088016C>G	ENST00000379982.3	+	5	1152	c.644C>G	c.(643-645)tCc>tGc	p.S215C	GLRX_ENST00000508780.1_Intron	NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	215					ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		ATGAGCAACTCCTTTCATGGA	0.328																																																0			5											110.0	116.0	114.0					5																	95088016		2203	4300	6503	95113772	SO:0001583	missense	22836			AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.644C>G	5.37:g.95088016C>G	ENSP00000369318:p.Ser215Cys	Somatic		Capture	Illumina GAIIx	4	95113772	A0PJA4|A8K1W9|Q8IW06	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_BTB,superfamily_BTB/POZ_fold,HMMPfam_BTB	p.S215C	ENST00000379982.3	37	c.644	CCDS4077.1	5	.	.	.	.	.	.	.	.	.	.	C	15.11	2.736155	0.49045	.	.	ENSG00000164292	ENST00000379982	T	0.65364	-0.15	5.4	4.41	0.53225	.	0.160540	0.53938	D	0.000049	T	0.38081	0.1027	N	0.08118	0	0.80722	D	1	P	0.45078	0.85	B	0.37780	0.258	T	0.42565	-0.9444	10	0.56958	D	0.05	-13.8266	10.067	0.42311	0.2476:0.7524:0.0:0.0	.	215	O94955	RHBT3_HUMAN	C	215	ENSP00000369318:S215C	ENSP00000369318:S215C	S	+	2	0	RHOBTB3	95113772	0.836000	0.29430	0.958000	0.39756	0.902000	0.53008	2.114000	0.41911	2.684000	0.91462	0.585000	0.79938	TCC	-	NULL		0.328	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB3	protein_coding	OTTHUMT00000241658.1	C	NM_014899		95113772	+1	no_errors	NM_014899	genbank	human	validated	54_36p	missense	SNP	0.003	G
ANKRD36C	400986	genome.wustl.edu	37	2	96521129	96521129	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr2:96521129G>A	ENST00000456556.1	-	63	4964	c.4880C>T	c.(4879-4881)gCt>gTt	p.A1627V	ANKRD36C_ENST00000419039.2_Missense_Mutation_p.A654V|ANKRD36C_ENST00000420871.2_Missense_Mutation_p.A878V			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1627							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						TCTGCACTCAGCTTGAAGGTT	0.363																																																0			2																																								95884856	SO:0001583	missense	400986			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.4880C>T	2.37:g.96521129G>A	ENSP00000403302:p.Ala1627Val	Somatic		Capture	Illumina GAIIx	4	95884856	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.A1627V	ENST00000456556.1	37	c.4880		2	.	.	.	.	.	.	.	.	.	.	g	14.43	2.534349	0.45073	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039	T;T;T	0.15834	2.39;2.39;2.39	2.11	-2.82	0.05787	.	.	.	.	.	T	0.15435	0.0372	L	0.53617	1.68	0.09310	N	1	.	.	.	.	.	.	T	0.31081	-0.9956	7	0.45353	T	0.12	.	1.178	0.01839	0.242:0.1678:0.4199:0.1703	.	.	.	.	V	878;1627;654	ENSP00000415231:A878V;ENSP00000403302:A1627V;ENSP00000407838:A654V	ENSP00000407838:A654V	A	-	2	0	AC073995.2	95884856	0.903000	0.30736	0.003000	0.11579	0.038000	0.13279	0.330000	0.19715	-0.781000	0.04548	-0.666000	0.03841	GCT	-	NULL		0.363	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	LOC400986	protein_coding	OTTHUMT00000338799.2	G	NM_001010914		95884856	-1	no_errors	XM_001717763	genbank	human	model	54_36p	missense	SNP	0.915	A
HSD17B3	3293	genome.wustl.edu	37	9	99003178	99003178	+	Silent	SNP	T	T	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr9:99003178T>C	ENST00000375263.3	-	10	731	c.684A>G	c.(682-684)ccA>ccG	p.P228P	HSD17B3_ENST00000464104.1_5'UTR|HSD17B3_ENST00000375262.2_Intron	NM_000197.1	NP_000188.1	P37058	DHB3_HUMAN	hydroxysteroid (17-beta) dehydrogenase 3	228					androgen biosynthetic process (GO:0006702)|male genitalia development (GO:0030539)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			breast(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)				AGACAGCATATGGGGTCAGCA	0.433																																																0			9											123.0	114.0	117.0					9																	99003178		2203	4300	6503	98042999	SO:0001819	synonymous_variant	3293				CCDS6716.1	9q22	2011-09-20			ENSG00000130948	ENSG00000130948	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5212	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 2"""	605573				8075637, 19027726	Standard	NM_000197		Approved	SDR12C2	uc004awa.1	P37058	OTTHUMG00000020292	ENST00000375263.3:c.684A>G	9.37:g.99003178T>C		Somatic		Capture	Illumina GAIIx	4	98042999	Q5U0Q6	Silent	SNP	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_adh_short,PatternScan_ADH_SHORT,PatternScan_ALDEHYDE_DEHYDR_CYS	p.P228	ENST00000375263.3	37	c.684	CCDS6716.1	9																																																																																			-	superfamily_NAD(P)-binding Rossmann-fold domains		0.433	HSD17B3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B3	protein_coding	OTTHUMT00000053259.1	T	NM_000197		98042999	-1	no_errors	NM_000197	genbank	human	reviewed	54_36p	silent	SNP	0.956	C
WDR20	91833	genome.wustl.edu	37	14	102674944	102674944	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr14:102674944T>A	ENST00000342702.3	+	3	468	c.437T>A	c.(436-438)cTa>cAa	p.L146Q	WDR20_ENST00000545563.1_5'UTR|WDR20_ENST00000499851.2_Intron|WDR20_ENST00000322340.5_Intron|WDR20_ENST00000454394.2_Missense_Mutation_p.L177Q|WDR20_ENST00000335263.5_Missense_Mutation_p.L146Q|WDR20_ENST00000556807.1_Missense_Mutation_p.L85Q|WDR20_ENST00000556511.2_Missense_Mutation_p.L85Q|WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000424963.2_Missense_Mutation_p.L22Q	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	146										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						TCACAGAGACTAATAGACAAG	0.453																																																0			14											54.0	53.0	53.0					14																	102674944		2203	4300	6503	101744697	SO:0001583	missense	91833			BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.437T>A	14.37:g.102674944T>A	ENSP00000341037:p.Leu146Gln	Somatic		Capture	Illumina GAIIx	4	101744697	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40	p.L146Q	ENST00000342702.3	37	c.437	CCDS9969.1	14	.	.	.	.	.	.	.	.	.	.	T	17.49	3.401751	0.62288	.	.	ENSG00000140153	ENST00000335263;ENST00000299135;ENST00000424963;ENST00000342702;ENST00000556807;ENST00000454394;ENST00000401892	T;T;T;T;T	0.63580	0.68;-0.05;0.68;1.96;0.68	5.31	5.31	0.75309	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.74627	0.3741	L	0.56280	1.765	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;0.998;1.0;0.998;0.999;0.998;0.996	D;D;D;D;D;D;D	0.78314	0.966;0.969;0.984;0.966;0.99;0.991;0.957	T	0.74509	-0.3642	10	0.42905	T	0.14	.	15.5565	0.76200	0.0:0.0:0.0:1.0	.	177;158;85;146;85;22;146	E7EUY8;Q5JPH5;G3V2F8;Q8TBZ3-2;F8W9S4;B3KR43;Q8TBZ3	.;.;.;.;.;.;WDR20_HUMAN	Q	146;85;22;146;85;177;76	ENSP00000335434:L146Q;ENSP00000395793:L22Q;ENSP00000341037:L146Q;ENSP00000450636:L85Q;ENSP00000406084:L177Q	ENSP00000299135:L85Q	L	+	2	0	WDR20	101744697	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.655000	0.83696	2.143000	0.66587	0.533000	0.62120	CTA	-	superfamily_WD40_like,HMMSmart_WD40		0.453	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR20	protein_coding	OTTHUMT00000414963.1	T	NM_181291		101744697	+1	no_errors	NM_181291	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SVEP1	79987	genome.wustl.edu	37	9	113252037	113252037	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr9:113252037G>C	ENST00000401783.2	-	9	2159	c.1823C>G	c.(1822-1824)gCt>gGt	p.A608G	SVEP1_ENST00000374469.1_Missense_Mutation_p.A585G|SVEP1_ENST00000374461.1_Missense_Mutation_p.A585G|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000302728.8_Missense_Mutation_p.A608G	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	608	HYR 1. {ECO:0000255|PROSITE- ProRule:PRU00113}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TGGGGTGAAAGCTGGATGAAC	0.393																																																0			9											162.0	155.0	157.0					9																	113252037		1934	4143	6077	112291858	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1823C>G	9.37:g.113252037G>C	ENSP00000384917:p.Ala608Gly	Somatic		Capture	Illumina GAIIx	4	112291858	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,superfamily_Growth factor receptor domain,PatternScan_EGF_2,HMMPfam_GCC2_GCC3,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,HMMPfam_HYR,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,HMMSmart_SM00159,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Pentaxin,HMMPfam_EGF_CA,HMMPfam_EGF_2	p.A608G	ENST00000401783.2	37	c.1823	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860117	0.71834	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.21191	2.02;2.02;2.02;2.02	4.85	4.85	0.62838	Hyalin (2);	0.116034	0.64402	D	0.000020	T	0.31040	0.0784	N	0.20401	0.57	0.32336	N	0.560412	D;D;P	0.76494	0.978;0.999;0.952	P;D;P	0.70227	0.829;0.968;0.6	T	0.25293	-1.0136	10	0.28530	T	0.3	.	17.9412	0.89027	0.0:0.0:1.0:0.0	.	608;608;608	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	G	608;585;608;585	ENSP00000384917:A608G;ENSP00000363593:A585G;ENSP00000304118:A608G;ENSP00000363585:A585G	ENSP00000304118:A608G	A	-	2	0	SVEP1	112291858	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	6.915000	0.75770	2.247000	0.74100	0.563000	0.77884	GCT	-	HMMPfam_HYR		0.393	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	protein_coding		G			112291858	-1	no_errors	NM_153366	genbank	human	validated	54_36p	missense	SNP	1.000	C
PLBD2	196463	genome.wustl.edu	37	12	113824765	113824765	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr12:113824765C>T	ENST00000280800.3	+	10	1341	c.1310C>T	c.(1309-1311)gCc>gTc	p.A437V	PLBD2_ENST00000545182.2_Missense_Mutation_p.A405V	NM_173542.3	NP_775813.2	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2	437					lipid catabolic process (GO:0016042)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						GTGTTCAATGCCAGTGGGCTG	0.632																																																0			12											62.0	56.0	58.0					12																	113824765		2203	4300	6503	112309148	SO:0001583	missense	196463			BC030618	CCDS9168.1, CCDS53834.1	12q24.13	2013-10-11				ENSG00000151176			27283	protein-coding gene	gene with protein product	"""PLB homolog 2 (Dictyostelium)"", ""mannose-6-phosphate protein associated protein p76"""					17105447, 15193148, 19019078	Standard	NM_001159727		Approved	p76	uc001tve.2	Q8NHP8	OTTHUMG00000169567	ENST00000280800.3:c.1310C>T	12.37:g.113824765C>T	ENSP00000280800:p.Ala437Val	Somatic		Capture	Illumina GAIIx	4	112309148	F5H5E2	Missense_Mutation	SNP	HMMPfam_Phospholip_B	p.A437V	ENST00000280800.3	37	c.1310	CCDS9168.1	12	.	.	.	.	.	.	.	.	.	.	C	13.23	2.175247	0.38413	.	.	ENSG00000151176	ENST00000545182;ENST00000280800	T;T	0.15952	2.38;2.38	5.33	4.44	0.53790	.	0.049483	0.85682	D	0.000000	T	0.16257	0.0391	L	0.58925	1.835	0.39373	D	0.966124	B;B	0.17038	0.02;0.009	B;B	0.20184	0.028;0.007	T	0.08310	-1.0728	10	0.02654	T	1	-21.3707	13.6194	0.62128	0.0:0.9257:0.0:0.0743	.	405;437	F5H5E2;Q8NHP8	.;PLBL2_HUMAN	V	405;437	ENSP00000443463:A405V;ENSP00000280800:A437V	ENSP00000280800:A437V	A	+	2	0	PLBD2	112309148	0.989000	0.36119	0.956000	0.39512	0.956000	0.61745	1.976000	0.40579	1.244000	0.43870	0.561000	0.74099	GCC	-	HMMPfam_Phospholip_B		0.632	PLBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD2	protein_coding	OTTHUMT00000404835.1	C	NM_173542		112309148	+1	no_errors	NM_173542	genbank	human	provisional	54_36p	missense	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	114290914	114290914	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr8:114290914G>A	ENST00000297405.5	-	3	665	c.421C>T	c.(421-423)Cca>Tca	p.P141S	CSMD3_ENST00000352409.3_Missense_Mutation_p.P141S|CSMD3_ENST00000343508.3_Missense_Mutation_p.P101S|CSMD3_ENST00000455883.2_Missense_Mutation_p.P141S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	141	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACTGGAGGTGGCAGATGGAAT	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						0			8											108.0	98.0	101.0					8																	114290914		2203	4299	6502	114360090	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.421C>T	8.37:g.114290914G>A	ENSP00000297405:p.Pro141Ser	Somatic		Capture	Illumina GAIIx	4	114360090	Q96PZ3	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,PatternScan_GLYCOSYL_HYDROL_F10	p.P141S	ENST00000297405.5	37	c.421	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493620	0.64186	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	T;T;T;T	0.35421	1.31;1.31;1.31;1.31	5.18	5.18	0.71444	CUB (5);	0.000000	0.64402	D	0.000011	T	0.58177	0.2104	M	0.67700	2.07	0.42109	D	0.991373	D;D;D;D	0.89917	0.996;1.0;0.999;0.977	D;D;D;P	0.83275	0.986;0.996;0.996;0.857	T	0.54997	-0.8209	10	0.34782	T	0.22	.	16.5442	0.84410	0.0:0.0:1.0:0.0	.	141;141;141;101	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	S	101;141;141;141	ENSP00000345799:P101S;ENSP00000297405:P141S;ENSP00000412263:P141S;ENSP00000343124:P141S	ENSP00000297405:P141S	P	-	1	0	CSMD3	114360090	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.162000	0.94745	2.561000	0.86390	0.543000	0.68304	CCA	-	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042		0.333	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	G	NM_052900		114360090	-1	no_errors	NM_198123	genbank	human	validated	54_36p	missense	SNP	1.000	A
GCN1L1	10985	genome.wustl.edu	37	12	120575510	120575510	+	Silent	SNP	T	T	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr12:120575510T>G	ENST00000300648.6	-	49	6514	c.6502A>C	c.(6502-6504)Agg>Cgg	p.R2168R		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2168					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCAGCTTGCCTCATGCCCACC	0.592																																																0			12											42.0	51.0	48.0					12																	120575510		2132	4246	6378	119059893	SO:0001819	synonymous_variant	10985			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.6502A>C	12.37:g.120575510T>G		Somatic		Capture	Illumina GAIIx	4	119059893	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Silent	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.R2168	ENST00000300648.6	37	c.6502	CCDS41847.1	12																																																																																			-	superfamily_ARM repeat		0.592	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	protein_coding	OTTHUMT00000403592.1	T			119059893	-1	no_errors	NM_006836	genbank	human	validated	54_36p	silent	SNP	1.000	G
GAPDHP32	644213	genome.wustl.edu	37	1	120076956	120076956	+	IGR	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr1:120076956C>T								HSD3B1 (19275 upstream) : LINC00622 (63368 downstream)																							AGGTTGTTGTCATACTTCTCA	0.522																																																0			1																																								119878479	SO:0001628	intergenic_variant	644213																															1.37:g.120076956C>T		Somatic		Capture	Illumina GAIIx	4	119878479		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.522					LOC644213			C			119878479	-1	pseudogene	XR_016570	genbank	human	model	54_36p	rna	SNP	1.000	T
C5	727	genome.wustl.edu	37	9	123769251	123769251	+	Missense_Mutation	SNP	G	G	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr9:123769251G>C	ENST00000223642.1	-	19	2382	c.2353C>G	c.(2353-2355)Cag>Gag	p.Q785E	C5_ENST00000466280.1_5'Flank	NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	785					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	AACTGCAACTGTTTTCTGGAA	0.353																																																0			9											97.0	93.0	94.0					9																	123769251		2203	4300	6503	122809072	SO:0001583	missense	727			M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.2353C>G	9.37:g.123769251G>C	ENSP00000223642:p.Gln785Glu	Somatic		Capture	Illumina GAIIx	4	122809072	Q14CJ0|Q27I61	Missense_Mutation	SNP	PatternScan_ALPHA_2_MACROGLOBULIN,HMMPfam_A2M_N,HMMPfam_A2M_N_2,superfamily_Anaphylatoxin,HMMPfam_ANATO,HMMSmart_ANATO,PatternScan_ANAPHYLATOXIN_1,HMMPfam_A2M,superfamily_Terp_cyc_toroid,HMMPfam_A2M_comp,superfamily_AM_receptor_bind,HMMPfam_A2M_recep,HMMSmart_C345C,HMMPfam_NTR	p.Q785E	ENST00000223642.1	37	c.2353	CCDS6826.1	9	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.458902	0.00173	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.24350	1.86	5.8	2.59	0.31030	Alpha-2-macroglobulin (1);	0.477765	0.21649	N	0.071215	T	0.13500	0.0327	N	0.21545	0.675	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.31668	-0.9935	10	0.09590	T	0.72	.	8.2688	0.31831	0.0:0.1183:0.3721:0.5096	.	785	P01031	CO5_HUMAN	E	785;856	ENSP00000223642:Q785E	ENSP00000223642:Q785E	Q	-	1	0	C5	122809072	0.005000	0.15991	0.008000	0.14137	0.010000	0.07245	0.722000	0.25925	0.738000	0.32606	0.563000	0.77884	CAG	-	HMMPfam_A2M		0.353	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5	protein_coding	OTTHUMT00000053844.1	G	NM_001735		122809072	-1	no_errors	NM_001735	genbank	human	reviewed	54_36p	missense	SNP	0.002	C
TEX43	389320	genome.wustl.edu	37	5	125971795	125971795	+	Silent	SNP	T	T	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr5:125971795T>C	ENST00000357147.3	+	3	280	c.267T>C	c.(265-267)ctT>ctC	p.L89L		NM_207408.1	NP_997291.1	Q6ZNM6	TEX43_HUMAN		89										large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	7						GTGAAAGGCTTTGCCATGGGG	0.423																																																0			5											138.0	144.0	142.0					5																	125971795		2203	4300	6503	125999694	SO:0001819	synonymous_variant	389320																														ENST00000357147.3:c.267T>C	5.37:g.125971795T>C		Somatic		Capture	Illumina GAIIx	4	125999694		Silent	SNP	NULL	p.L89	ENST00000357147.3	37	c.267	CCDS4139.1	5																																																																																			-	NULL		0.423	C5orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf48	protein_coding	OTTHUMT00000250923.1	T			125999694	+1	no_errors	NM_207408	genbank	human	predicted	54_36p	silent	SNP	1.000	C
PIWIL1	9271	genome.wustl.edu	37	12	130840123	130840123	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr12:130840123C>G	ENST00000245255.3	+	12	1587	c.1315C>G	c.(1315-1317)Cga>Gga	p.R439G		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	439					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		AAGGGAGCTTCGAGACTGGGG	0.393																																																0			12											204.0	212.0	210.0					12																	130840123		2203	4300	6503	129406076	SO:0001583	missense	9271			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1315C>G	12.37:g.130840123C>G	ENSP00000245255:p.Arg439Gly	Somatic		Capture	Illumina GAIIx	4	129406076	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	superfamily_PAZ domain,HMMPfam_PAZ,superfamily_Ribonuclease H-like,HMMPfam_Piwi	p.R439G	ENST00000245255.3	37	c.1315	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	C	14.22	2.470113	0.43839	.	.	ENSG00000125207	ENST00000245255	T	0.05382	3.45	5.48	5.48	0.80851	Ribonuclease H-like (1);	0.462111	0.24573	N	0.037365	T	0.07188	0.0182	L	0.28115	0.83	0.31829	N	0.624942	B;B	0.17667	0.023;0.002	B;B	0.13407	0.008;0.009	T	0.05435	-1.0885	10	0.48119	T	0.1	-10.8483	18.4016	0.90518	0.0:1.0:0.0:0.0	.	439;439	Q96J94;Q96J94-2	PIWL1_HUMAN;.	G	439	ENSP00000245255:R439G	ENSP00000245255:R439G	R	+	1	2	PIWIL1	129406076	0.996000	0.38824	0.997000	0.53966	0.995000	0.86356	2.214000	0.42853	2.577000	0.86979	0.650000	0.86243	CGA	-	NULL		0.393	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	protein_coding	OTTHUMT00000399510.1	C			129406076	+1	no_errors	NM_004764	genbank	human	reviewed	54_36p	missense	SNP	0.879	G
DOLPP1	57171	genome.wustl.edu	37	9	131847014	131847014	+	Silent	SNP	G	G	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr9:131847014G>C	ENST00000372546.4	+	2	176	c.144G>C	c.(142-144)gtG>gtC	p.V48V	DOLPP1_ENST00000406974.3_Silent_p.V48V|DOLPP1_ENST00000540102.1_5'UTR	NM_020438.4	NP_065171.2	Q86YN1	DOPP1_HUMAN	dolichyldiphosphatase 1	48					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|lipid biosynthetic process (GO:0008610)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichyldiphosphatase activity (GO:0047874)			endometrium(3)|kidney(2)|lung(7)|skin(1)	13						TCGGTTTCGTGACCCTCATCA	0.587																																																0			9											368.0	333.0	345.0					9																	131847014		2203	4300	6503	130886835	SO:0001819	synonymous_variant	57171			BC009493	CCDS6918.1, CCDS48039.1	9q34.1	2013-05-21	2013-05-21		ENSG00000167130	ENSG00000167130	3.6.1.43		29565	protein-coding gene	gene with protein product	"""linked to Surfeit genes in Fugu rubripes 2"""	614516	"""dolichyl pyrophosphate phosphatase 1"""			10369878, 12198133	Standard	NM_020438		Approved	LSFR2	uc004bxc.3	Q86YN1	OTTHUMG00000020771	ENST00000372546.4:c.144G>C	9.37:g.131847014G>C		Somatic		Capture	Illumina GAIIx	4	130886835	A8K3U8|B0QZG4|Q96GF8|Q9Y3G1	Silent	SNP	superfamily_AcPase_VanPerase,HMMPfam_PAP2,HMMSmart_acidPPc	p.V48	ENST00000372546.4	37	c.144	CCDS6918.1	9																																																																																			-	superfamily_AcPase_VanPerase		0.587	DOLPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOLPP1	protein_coding	OTTHUMT00000054548.4	G	NM_020438		130886835	+1	no_errors	NM_020438	genbank	human	validated	54_36p	silent	SNP	1.000	C
CEP63	80254	genome.wustl.edu	37	3	134278230	134278230	+	Missense_Mutation	SNP	A	A	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr3:134278230A>G	ENST00000337090.3	+	14	2085	c.1912A>G	c.(1912-1914)Atg>Gtg	p.M638V	CEP63_ENST00000332047.5_Intron|CEP63_ENST00000383229.3_Intron|CEP63_ENST00000513612.2_Missense_Mutation_p.M638V|CEP63_ENST00000354446.3_Intron|CEP63_ENST00000606977.1_Missense_Mutation_p.M638V			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	638					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TTCTGACACTATGTCTGAGAG	0.358																																																0			3											75.0	72.0	73.0					3																	134278230		2203	4300	6503	135760920	SO:0001583	missense	80254			AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.1912A>G	3.37:g.134278230A>G	ENSP00000336524:p.Met638Val	Somatic		Capture	Illumina GAIIx	4	135760920	D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Missense_Mutation	SNP	NULL	p.M638V	ENST00000337090.3	37	c.1912	CCDS3086.1	3	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.700053	0.00725	.	.	ENSG00000182923	ENST00000337090;ENST00000513612	T;T	0.16457	2.34;2.34	4.8	-3.31	0.04988	.	0.956991	0.08589	N	0.923323	T	0.05135	0.0137	N	0.02142	-0.665	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40534	-0.9558	10	0.27082	T	0.32	0.2622	5.492	0.16781	0.482:0.2896:0.2284:0.0	.	638	Q96MT8	CEP63_HUMAN	V	638	ENSP00000336524:M638V;ENSP00000426129:M638V	ENSP00000336524:M638V	M	+	1	0	CEP63	135760920	0.000000	0.05858	0.723000	0.30687	0.130000	0.20726	-1.640000	0.02009	-0.280000	0.09154	-0.137000	0.14449	ATG	-	NULL		0.358	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP63	protein_coding	OTTHUMT00000470139.1	A	NM_025180		135760920	+1	no_errors	NM_025180	genbank	human	reviewed	54_36p	missense	SNP	0.218	G
PSD2	84249	genome.wustl.edu	37	5	139189190	139189190	+	Silent	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr5:139189190G>A	ENST00000274710.3	+	2	370	c.165G>A	c.(163-165)gcG>gcA	p.A55A		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	55					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACCCCAGCGGACACTGAGG	0.642																																																0			5											61.0	65.0	63.0					5																	139189190		2203	4300	6503	139169374	SO:0001819	synonymous_variant	84249			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.165G>A	5.37:g.139189190G>A		Somatic		Capture	Illumina GAIIx	4	139169374	D3DQD3|Q8N3J8	Silent	SNP	HMMSmart_SM00222,HMMPfam_Sec7,superfamily_Sec7 domain,HMMPfam_PH,HMMSmart_SM00233,superfamily_PH domain-like	p.A55	ENST00000274710.3	37	c.165	CCDS4216.1	5																																																																																			-	NULL		0.642	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	protein_coding	OTTHUMT00000251339.1	G	NM_032289		139169374	+1	no_errors	NM_032289	genbank	human	provisional	54_36p	silent	SNP	0.000	A
ANKRD35	148741	genome.wustl.edu	37	1	145562273	145562273	+	Missense_Mutation	SNP	G	G	A	rs587604541		TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr1:145562273G>A	ENST00000355594.4	+	10	2048	c.1961G>A	c.(1960-1962)cGg>cAg	p.R654Q		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	654										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CGGCTGCAGCGGGAGTTTGTG	0.607																																					Melanoma(9;127 754 22988 51047)											0			1											41.0	45.0	43.0					1																	145562273		2203	4298	6501	144273630	SO:0001583	missense	148741			AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1961G>A	1.37:g.145562273G>A	ENSP00000347802:p.Arg654Gln	Somatic		Capture	Illumina GAIIx	4	144273630	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.R654Q	ENST00000355594.4	37	c.1961	CCDS919.1	1	.	.	.	.	.	.	.	.	.	.	G	8.984	0.976145	0.18736	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.66280	-0.2	4.82	2.87	0.33458	.	0.153130	0.30374	N	0.009778	T	0.25644	0.0624	L	0.38838	1.175	0.46725	D	0.999173	B	0.19583	0.037	B	0.11329	0.006	T	0.07947	-1.0746	10	0.16896	T	0.51	-7.0326	6.4261	0.21770	0.2358:0.0:0.7642:0.0	.	654	Q8N283	ANR35_HUMAN	Q	563;654	ENSP00000347802:R654Q	ENSP00000347802:R654Q	R	+	2	0	ANKRD35	144273630	0.186000	0.23225	0.177000	0.23020	0.358000	0.29455	0.776000	0.26704	0.576000	0.29452	0.563000	0.77884	CGG	-	NULL		0.607	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	protein_coding	OTTHUMT00000038515.1	G	NM_144698		144273630	+1	no_errors	NM_144698	genbank	human	validated	54_36p	missense	SNP	0.722	A
FOXH1	8928	genome.wustl.edu	37	8	145701125	145701125	+	Silent	SNP	G	G	A	rs374587860	byFrequency	TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr8:145701125G>A	ENST00000377317.4	-	1	593	c.15C>T	c.(13-15)agC>agT	p.S5S	FOXH1_ENST00000525197.1_5'UTR	NM_003923.2	NP_003914.1	O75593	FOXH1_HUMAN	forkhead box H1	5					aorta morphogenesis (GO:0035909)|axial mesoderm development (GO:0048318)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|heart looping (GO:0001947)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|secondary heart field specification (GO:0003139)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular trabecula myocardium morphogenesis (GO:0003222)	activin responsive factor complex (GO:0032444)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|co-SMAD binding (GO:0070410)|enhancer binding (GO:0035326)|protein domain specific binding (GO:0019904)|R-SMAD binding (GO:0070412)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.76e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GGCGGGAGCCGCTGCAGGGCC	0.701													G|||	2	0.000399361	0.0	0.0014	5008	,	,		9101	0.0		0.001	False		,,,				2504	0.0															0			8						G		0,4108		0,0,2054	5.0	5.0	5.0		15	2.0	0.3	8		5	2,8130		0,2,4064	no	coding-synonymous	FOXH1	NM_003923.2		0,2,6118	AA,AG,GG		0.0246,0.0,0.0163		5/366	145701125	2,12238	2054	4066	6120	145671933	SO:0001819	synonymous_variant	8928			AF076292	CCDS6428.1	8q24.3	2014-08-12			ENSG00000160973			"""Forkhead boxes"""	3814	protein-coding gene	gene with protein product		603621				9702198	Standard	NM_003923		Approved	FAST1	uc003zdc.3	O75593	OTTHUMG00000165172	ENST00000377317.4:c.15C>T	8.37:g.145701125G>A		Somatic		Capture	Illumina GAIIx	4	145671933	D3DWM4	Silent	SNP	PatternScan_FORK_HEAD_1,HMMSmart_FH,superfamily_SSF46785,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2	p.S5	ENST00000377317.4	37	c.15	CCDS6428.1	8																																																																																			-	NULL		0.701	FOXH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXH1	protein_coding	OTTHUMT00000382451.1	G			145671933	-1	no_errors	NM_003923	genbank	human	reviewed	54_36p	silent	SNP	0.057	A
PPP2R2B	5521	genome.wustl.edu	37	5	146085934	146085934	+	Intron	SNP	C	C	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr5:146085934C>A	ENST00000394413.3	-	2	641				PPP2R2B_ENST00000530902.1_Intron|PPP2R2B_ENST00000394410.2_Intron|PPP2R2B_ENST00000504198.1_Intron|PPP2R2B_ENST00000394414.1_Intron|PPP2R2B_ENST00000453001.1_Intron|PPP2R2B_ENST00000394409.3_Intron|PPP2R2B_ENST00000508545.2_Intron|PPP2R2B_ENST00000356826.3_Intron|PPP2R2B_ENST00000394411.4_Intron|PPP2R2B_ENST00000336640.6_Intron			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta						apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTGAGGCCCCCATAGGCCAAG	0.607																																																0			5																																								146066127	SO:0001627	intron_variant	0			M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.71-5229G>T	5.37:g.146085934C>A		Somatic		Capture	Illumina GAIIx	4	146066127	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	RNA	SNP	-	NULL	ENST00000394413.3	37	NULL	CCDS4284.1	5																																																																																			-	-		0.607	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128116	protein_coding	OTTHUMT00000251893.2	C	NM_181678		146066127	-1	pseudogene	XR_039194	genbank	human	model	54_36p	rna	SNP	0.067	A
GATAD2B	57459	genome.wustl.edu	37	1	153785810	153785810	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr1:153785810C>T	ENST00000368655.4	-	8	1578	c.1335G>A	c.(1333-1335)atG>atA	p.M445I		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	445	CR2; histone tail-binding.				ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGTTGGAGGTCATACACTGCT	0.463																																																0			1											210.0	180.0	190.0					1																	153785810		2203	4300	6503	152052434	SO:0001583	missense	57459			AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.1335G>A	1.37:g.153785810C>T	ENSP00000357644:p.Met445Ile	Somatic		Capture	Illumina GAIIx	4	152052434	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	PatternScan_GATA_ZN_FINGER_1,superfamily_SSF57716,HMMPfam_GATA	p.M445I	ENST00000368655.4	37	c.1335	CCDS1054.1	1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559885	0.86335	.	.	ENSG00000143614	ENST00000368655	D	0.99458	-5.93	5.19	5.19	0.71726	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (1);	0.000000	0.85682	D	0.000000	D	0.97436	0.9161	L	0.55481	1.735	0.80722	D	1	B	0.33694	0.421	B	0.28139	0.086	D	0.99948	1.1502	10	0.18276	T	0.48	7.4664	17.6428	0.88141	0.0:1.0:0.0:0.0	.	445	Q8WXI9	P66B_HUMAN	I	445	ENSP00000357644:M445I	ENSP00000357644:M445I	M	-	3	0	GATAD2B	152052434	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.821000	0.69257	2.709000	0.92574	0.655000	0.94253	ATG	-	HMMPfam_GATA		0.463	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATAD2B	protein_coding	OTTHUMT00000090305.1	C	NM_020699		152052434	-1	no_errors	NM_020699	genbank	human	validated	54_36p	missense	SNP	1.000	T
MED12L	116931	genome.wustl.edu	37	3	151107798	151107798	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr3:151107798C>A	ENST00000474524.1	+	36	5416	c.5378C>A	c.(5377-5379)cCt>cAt	p.P1793H	MED12L_ENST00000273432.4_Missense_Mutation_p.P1653H	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1793						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TACCGAGTGCCTCCTAATTAC	0.448																																																0			3											165.0	156.0	159.0					3																	151107798		2203	4300	6503	152590488	SO:0001583	missense	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5378C>A	3.37:g.151107798C>A	ENSP00000417235:p.Pro1793His	Somatic		Capture	Illumina GAIIx	4	152590488	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	HMMPfam_Med12	p.P1793H	ENST00000474524.1	37	c.5378	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229121	0.58777	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.61274	0.33;0.12	5.73	5.73	0.89815	.	0.286088	0.35235	N	0.003344	T	0.66436	0.2789	L	0.27053	0.805	0.44985	D	0.998003	P;D	0.76494	0.924;0.999	B;D	0.77557	0.443;0.99	T	0.68838	-0.5303	10	0.66056	D	0.02	-8.0723	17.6747	0.88227	0.0:1.0:0.0:0.0	.	1653;1793	F8WAE6;Q86YW9	.;MD12L_HUMAN	H	1793;1653	ENSP00000417235:P1793H;ENSP00000273432:P1653H	ENSP00000273432:P1653H	P	+	2	0	MED12L	152590488	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.204000	0.65180	2.707000	0.92482	0.561000	0.74099	CCT	-	NULL		0.448	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	protein_coding	OTTHUMT00000357707.2	C	NM_053002		152590488	+1	no_errors	NM_053002	genbank	human	validated	54_36p	missense	SNP	1.000	A
INSRR	3645	genome.wustl.edu	37	1	156815544	156815544	+	Missense_Mutation	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr1:156815544C>T	ENST00000368195.3	-	10	2437	c.2041G>A	c.(2041-2043)Gcc>Acc	p.A681T	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	681	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCCATCTCGGCCTCAGGATCC	0.647																																																0			1											42.0	38.0	39.0					1																	156815544		2203	4300	6503	155082168	SO:0001583	missense	3645			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2041G>A	1.37:g.156815544C>T	ENSP00000357178:p.Ala681Thr	Somatic		Capture	Illumina GAIIx	4	155082168	O60724|Q5VZS3	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_Recep_L_domain,HMMPfam_Furin-like,superfamily_Grow_fac_recept,HMMSmart_FU,HMMSmart_FN3,superfamily_FN_III-like,HMMPfam_fn3,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,PatternScan_RECEPTOR_TYR_KIN_II	p.A681T	ENST00000368195.3	37	c.2041	CCDS1160.1	1	.	.	.	.	.	.	.	.	.	.	C	0.314	-0.966201	0.02232	.	.	ENSG00000027644	ENST00000368195	T	0.56275	0.47	4.58	2.71	0.32032	Fibronectin, type III (3);	0.138047	0.33290	N	0.005077	T	0.10252	0.0251	.	.	.	0.32496	N	0.539497	B	0.02656	0.0	B	0.01281	0.0	T	0.18493	-1.0335	9	0.09338	T	0.73	.	4.7146	0.12889	0.0:0.6235:0.1803:0.1963	.	681	P14616	INSRR_HUMAN	T	681	ENSP00000357178:A681T	ENSP00000357178:A681T	A	-	1	0	INSRR	155082168	0.001000	0.12720	0.110000	0.21437	0.063000	0.16089	0.381000	0.20619	0.666000	0.31087	0.561000	0.74099	GCC	-	superfamily_FN_III-like,HMMSmart_FN3		0.647	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	protein_coding	OTTHUMT00000098929.1	C	NM_014215		155082168	-1	no_errors	NM_014215	genbank	human	validated	54_36p	missense	SNP	0.033	T
KCNJ3	3760	genome.wustl.edu	37	2	155555788	155555788	+	Silent	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr2:155555788C>T	ENST00000295101.2	+	1	978	c.501C>T	c.(499-501)atC>atT	p.I167I	AC061961.2_ENST00000443901.1_RNA|KCNJ3_ENST00000544049.1_Silent_p.I167I	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	167					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	TCCAGTCCATCCTGGGCTCCA	0.587																																																0			2											99.0	81.0	87.0					2																	155555788		2203	4300	6503	155264034	SO:0001819	synonymous_variant	3760			U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.501C>T	2.37:g.155555788C>T		Somatic		Capture	Illumina GAIIx	4	155264034	B4DEW7|Q8TBI0	Silent	SNP	HMMPfam_IRK,superfamily_SSF81324,superfamily_Ig_E-set	p.I167	ENST00000295101.2	37	c.501	CCDS2200.1	2																																																																																			-	HMMPfam_IRK,superfamily_SSF81324		0.587	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ3	protein_coding	OTTHUMT00000254890.2	C	NM_002239		155264034	+1	no_errors	NM_002239	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
SGCD	6444	genome.wustl.edu	37	5	155771527	155771527	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr5:155771527G>A	ENST00000435422.3	+	2	516	c.29G>A	c.(28-30)cGg>cAg	p.R10Q	SGCD_ENST00000447401.1_Missense_Mutation_p.R11Q|SGCD_ENST00000517913.1_Missense_Mutation_p.R11Q|SGCD_ENST00000337851.4_Missense_Mutation_p.R11Q	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	10					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACTCACCACCGGAGCACCATG	0.478																																																0			5											111.0	112.0	112.0					5																	155771527		1951	4165	6116	155704105	SO:0001583	missense	6444			BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.29G>A	5.37:g.155771527G>A	ENSP00000403003:p.Arg10Gln	Somatic		Capture	Illumina GAIIx	4	155704105	A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	HMMPfam_Sarcoglycan_1	p.R11Q	ENST00000435422.3	37	c.32	CCDS47327.1	5	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099751	0.56183	.	.	ENSG00000170624	ENST00000517913;ENST00000435422;ENST00000337851;ENST00000447401	T;D;D;T	0.85773	1.52;-2.01;-2.03;1.52	5.59	5.59	0.84812	.	0.051785	0.64402	D	0.000001	D	0.88112	0.6349	L	0.35487	1.065	0.80722	D	1	D;D;D	0.89917	0.997;0.998;1.0	D;D;D	0.83275	0.968;0.986;0.996	D	0.83447	0.0046	10	0.13108	T	0.6	0.2039	19.6056	0.95580	0.0:0.0:1.0:0.0	.	10;11;11	Q92629;Q92629-2;Q92629-3	SGCD_HUMAN;.;.	Q	11;10;11;11	ENSP00000429378:R11Q;ENSP00000403003:R10Q;ENSP00000338343:R11Q;ENSP00000408324:R11Q	ENSP00000338343:R11Q	R	+	2	0	SGCD	155704105	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.731000	0.98807	2.625000	0.88918	0.655000	0.94253	CGG	-	NULL		0.478	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGCD	protein_coding	OTTHUMT00000373469.3	G			155704105	+1	no_errors	NM_000337	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
FGA	2243	genome.wustl.edu	37	4	155505510	155505510	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr4:155505510G>T	ENST00000302053.3	-	6	2445	c.2367C>A	c.(2365-2367)gaC>gaA	p.D789E		NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	789	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CTGCATCCCTGTCAAAGGTGC	0.517																																					NSCLC(143;340 1922 20892 22370 48145)											0			4											136.0	126.0	129.0					4																	155505510		2203	4300	6503	155724960	SO:0001583	missense	2243				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.2367C>A	4.37:g.155505510G>T	ENSP00000306361:p.Asp789Glu	Somatic		Capture	Illumina GAIIx	4	155724960	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	HMMPfam_Fib_alpha,superfamily_Fibrinogen C-terminal domain-like,HMMSmart_SM00186,HMMPfam_Fibrinogen_C,PatternScan_FIBRIN_AG_C_DOMAIN	p.D789E	ENST00000302053.3	37	c.2367	CCDS3787.1	4	.	.	.	.	.	.	.	.	.	.	G	18.32	3.599162	0.66332	.	.	ENSG00000171560	ENST00000302053	D	0.85773	-2.03	5.7	4.68	0.58851	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.93223	0.7841	M	0.93763	3.455	0.80722	D	1	D	0.64830	0.994	D	0.73708	0.981	D	0.93594	0.6924	10	0.66056	D	0.02	.	10.3011	0.43653	0.2019:0.0:0.798:0.0	.	789	P02671	FIBA_HUMAN	E	789	ENSP00000306361:D789E	ENSP00000306361:D789E	D	-	3	2	FGA	155724960	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.939000	0.48995	2.690000	0.91761	0.650000	0.86243	GAC	-	superfamily_Fibrinogen C-terminal domain-like,HMMSmart_SM00186,HMMPfam_Fibrinogen_C		0.517	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	protein_coding	OTTHUMT00000317593.1	G	NM_000508		155724960	-1	no_errors	NM_000508	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PLCH1	23007	genome.wustl.edu	37	3	155198866	155198866	+	Missense_Mutation	SNP	G	G	A	rs144969124	byFrequency	TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr3:155198866G>A	ENST00000340059.7	-	23	4972	c.4973C>T	c.(4972-4974)aCg>aTg	p.T1658M	PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000414191.1_Missense_Mutation_p.T1620M|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.T1620M|PLCH1_ENST00000460012.1_Missense_Mutation_p.T1620M	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1658					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GTGAAGAGCCGTGCATGCCCC	0.512													G|||	4	0.000798722	0.0	0.0	5008	,	,		17585	0.004		0.0	False		,,,				2504	0.0															0			3						G	MET/THR,,MET/THR	1,4405	2.1+/-5.4	0,1,2202	48.0	52.0	51.0		4973,,4859	3.3	0.1	3	dbSNP_134	51	0,8600		0,0,4300	yes	missense,utr-3,missense	PLCH1	NM_001130960.1,NM_001130961.1,NM_014996.2	81,,81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,,possibly-damaging	1658/1694,,1620/1656	155198866	1,13005	2203	4300	6503	156681560	SO:0001583	missense	23007			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4973C>T	3.37:g.155198866G>A	ENSP00000345988:p.Thr1658Met	Somatic		Capture	Illumina GAIIx	4	156681560	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1,superfamily_SSF47473,HMMPfam_efhand_like,HMMSmart_PLCXc,HMMPfam_PI-PLC-X,superfamily_PLC-like_Pdiesterase_TIM-brl,HMMPfam_PI-PLC-Y,HMMSmart_PLCYc,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.T1620M	ENST00000340059.7	37	c.4859	CCDS46939.1	3	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	9.692	1.152078	0.21371	2.27E-4	0.0	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.29917	1.55;1.56;1.55;1.55	5.26	3.35	0.38373	.	1.305670	0.05147	N	0.495437	T	0.22085	0.0532	L	0.40543	1.245	0.37273	D	0.907509	B;B	0.23735	0.063;0.09	B;B	0.18263	0.021;0.009	T	0.13335	-1.0513	10	0.87932	D	0	.	9.5869	0.39521	0.0752:0.0:0.7845:0.1403	.	1620;1658	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	M	1620;1658;1620;1620	ENSP00000417502:T1620M;ENSP00000345988:T1658M;ENSP00000335469:T1620M;ENSP00000412977:T1620M	ENSP00000335469:T1620M	T	-	2	0	PLCH1	156681560	0.937000	0.31787	0.070000	0.20053	0.268000	0.26511	5.114000	0.64648	1.205000	0.43262	0.655000	0.94253	ACG	-	NULL		0.512	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	protein_coding	OTTHUMT00000351125.1	G	NM_014996		156681560	-1	no_errors	NM_014996	genbank	human	validated	54_36p	missense	SNP	0.989	A
ATP10B	23120	genome.wustl.edu	37	5	160034016	160034016	+	Silent	SNP	C	C	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr5:160034016C>T	ENST00000327245.5	-	19	3762	c.2916G>A	c.(2914-2916)aaG>aaA	p.K972K		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	972					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCCAAAGAGCTTGCGGTCTG	0.448																																																0			5											113.0	107.0	109.0					5																	160034016		1950	4130	6080	159966594	SO:0001819	synonymous_variant	23120			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2916G>A	5.37:g.160034016C>T		Somatic		Capture	Illumina GAIIx	4	159966594	Q9H725	Silent	SNP	HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Hydrolase_3	p.K972	ENST00000327245.5	37	c.2916	CCDS43394.1	5																																																																																			-	superfamily_HAD-like		0.448	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	protein_coding	OTTHUMT00000374127.1	C	NM_025153		159966594	-1	no_errors	NM_025153	genbank	human	validated	54_36p	silent	SNP	0.004	T
TTN	7273	genome.wustl.edu	37	2	179398318	179398318	+	Missense_Mutation	SNP	C	C	G			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr2:179398318C>G	ENST00000591111.1	-	308	98325	c.98101G>C	c.(98101-98103)Gac>Cac	p.D32701H	TTN_ENST00000342175.6_Missense_Mutation_p.D25469H|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D25402H|TTN_ENST00000460472.2_Missense_Mutation_p.D25277H|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D34342H|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D31774H|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000604571.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32701	Ig-like 144.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTACAGCTGTCTTCACCATAT	0.418																																																0			2											146.0	130.0	135.0					2																	179398318		1991	4182	6173	179106564	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.98101G>C	2.37:g.179398318C>G	ENSP00000465570:p.Asp32701His	Somatic		Capture	Illumina GAIIx	4	179106564	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,HMMPfam_Titin_Z,HMMSmart_SM00406,PatternScan_IG_MHC,HMMPfam_PPAK,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_TYR	p.D30323H	ENST00000591111.1	37	c.90967		2	.	.	.	.	.	.	.	.	.	.	C	18.31	3.595920	0.66332	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.74	5.74	0.90152	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.83871	0.5348	M	0.83118	2.625	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.69824	0.966;0.966;0.966;0.966	D	0.85460	0.1166	9	0.87932	D	0	.	19.9077	0.97014	0.0:1.0:0.0:0.0	.	25277;25402;25469;32701	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	31774;25277;25469;25402;25274	ENSP00000343764:D31774H;ENSP00000434586:D25277H;ENSP00000340554:D25469H;ENSP00000352154:D25402H	ENSP00000340554:D25469H	D	-	1	0	TTN	179106564	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.794000	0.85869	2.712000	0.92718	0.561000	0.74099	GAC	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179106564	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	1.000	G
SLC40A1	30061	genome.wustl.edu	37	2	190428442	190428442	+	Missense_Mutation	SNP	G	G	T			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr2:190428442G>T	ENST00000261024.2	-	7	1696	c.1270C>A	c.(1270-1272)Cct>Act	p.P424T		NM_014585.5	NP_055400.1	Q9NP59	S40A1_HUMAN	solute carrier family 40 (iron-regulated transporter), member 1	424					anatomical structure morphogenesis (GO:0009653)|cellular iron ion homeostasis (GO:0006879)|endothelium development (GO:0003158)|iron ion transmembrane transport (GO:0034755)|lymphocyte homeostasis (GO:0002260)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of apoptotic process (GO:0043066)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|spleen trabecula formation (GO:0060345)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	iron ion transmembrane transporter activity (GO:0005381)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(117;0.000917)|Epithelial(96;0.014)|all cancers(119;0.0491)			GTAATTTCAGGTATCTTGGTA	0.418																																																0			2											99.0	102.0	101.0					2																	190428442		2203	4300	6503	190136687	SO:0001583	missense	30061			AF215636	CCDS2299.1	2q32	2014-09-17	2003-06-04	2003-06-05	ENSG00000138449	ENSG00000138449		"""Solute carriers"""	10909	protein-coding gene	gene with protein product	"""ferroportin 1"""	604653	"""solute carrier family 11 (proton-coupled divalent metal ion transporters), member 3"""	SLC11A3		10828623	Standard	NM_014585		Approved	MTP1, IREG1, FPN1, HFE4	uc002uqp.4	Q9NP59	OTTHUMG00000132662	ENST00000261024.2:c.1270C>A	2.37:g.190428442G>T	ENSP00000261024:p.Pro424Thr	Somatic		Capture	Illumina GAIIx	4	190136687	Q6FI62|Q7Z4F8|Q8IVB2|Q9NRL0	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_FPN1	p.P424T	ENST00000261024.2	37	c.1270	CCDS2299.1	2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.086567	0.76642	.	.	ENSG00000138449	ENST00000261024;ENST00000544056	D	0.92595	-3.07	5.87	3.1	0.35709	Major facilitator superfamily domain, general substrate transporter (1);	0.294792	0.38381	N	0.001710	D	0.93766	0.8007	M	0.78049	2.395	0.50171	D	0.999856	D	0.61697	0.99	D	0.63877	0.919	D	0.90590	0.4536	10	0.11485	T	0.65	-12.5544	9.4417	0.38673	0.129:0.1187:0.7523:0.0	.	424	Q9NP59	S40A1_HUMAN	T	424;159	ENSP00000261024:P424T	ENSP00000261024:P424T	P	-	1	0	SLC40A1	190136687	0.079000	0.21365	0.899000	0.35326	0.374000	0.29953	0.206000	0.17375	0.381000	0.24851	0.650000	0.86243	CCT	-	superfamily_MFS general substrate transporter		0.418	SLC40A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC40A1	protein_coding	OTTHUMT00000255916.2	G			190136687	-1	no_errors	NM_014585	genbank	human	reviewed	54_36p	missense	SNP	0.831	T
DNAH7	56171	genome.wustl.edu	37	2	196759815	196759815	+	Missense_Mutation	SNP	T	T	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr2:196759815T>A	ENST00000312428.6	-	30	4881	c.4781A>T	c.(4780-4782)cAa>cTa	p.Q1594L		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1594	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTCATATACTTGAAGAATCTT	0.373																																																0			2											96.0	88.0	90.0					2																	196759815		1842	4096	5938	196468060	SO:0001583	missense	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.4781A>T	2.37:g.196759815T>A	ENSP00000311273:p.Gln1594Leu	Somatic		Capture	Illumina GAIIx	4	196468060	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,PatternScan_EF_HAND_1,HMMPfam_Dynein_heavy,PatternScan_ADH_SHORT	p.Q1594L	ENST00000312428.6	37	c.4781	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	T	24.7	4.556418	0.86231	.	.	ENSG00000118997	ENST00000312428	T	0.38240	1.15	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.74928	0.3781	H	0.98646	4.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85323	0.1085	10	0.87932	D	0	.	15.0066	0.71516	0.0:0.0:0.0:1.0	.	1594	Q8WXX0	DYH7_HUMAN	L	1594	ENSP00000311273:Q1594L	ENSP00000311273:Q1594L	Q	-	2	0	DNAH7	196468060	1.000000	0.71417	0.995000	0.50966	0.795000	0.44927	7.868000	0.87116	2.218000	0.71995	0.533000	0.62120	CAA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.373	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	T	NM_018897		196468060	-1	no_errors	NM_018897	genbank	human	validated	54_36p	missense	SNP	1.000	A
ABCB10	23456	genome.wustl.edu	37	1	229661839	229661839	+	Missense_Mutation	SNP	T	T	C			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr1:229661839T>C	ENST00000344517.4	-	10	1792	c.1750A>G	c.(1750-1752)Att>Gtt	p.I584V		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	584	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TTCTCAGCAATAGAGCAAGAA	0.413																																																0			1											74.0	74.0	74.0					1																	229661839		2203	4300	6503	227728462	SO:0001583	missense	23456			U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1750A>G	1.37:g.229661839T>C	ENSP00000355637:p.Ile584Val	Somatic		Capture	Illumina GAIIx	4	227728462	Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	superfamily_ABC_TM_1,HMMPfam_ABC_membrane,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.I584V	ENST00000344517.4	37	c.1750	CCDS1580.1	1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.996534	0.35226	.	.	ENSG00000135776	ENST00000344517	D	0.84873	-1.91	4.85	3.72	0.42706	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.047337	0.85682	N	0.000000	T	0.72684	0.3491	N	0.12443	0.215	0.53005	D	0.999961	B	0.20368	0.044	B	0.27500	0.08	T	0.65627	-0.6122	10	0.42905	T	0.14	-16.1289	9.84	0.40993	0.0:0.0834:0.0:0.9165	.	584	Q9NRK6	ABCBA_HUMAN	V	584	ENSP00000355637:I584V	ENSP00000355637:I584V	I	-	1	0	ABCB10	227728462	1.000000	0.71417	0.697000	0.30258	0.475000	0.33008	6.274000	0.72587	0.809000	0.34255	0.482000	0.46254	ATT	-	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran		0.413	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB10	protein_coding	OTTHUMT00000095240.1	T	NM_012089		227728462	-1	no_errors	NM_012089	genbank	human	reviewed	54_36p	missense	SNP	0.984	C
SPHKAP	80309	genome.wustl.edu	37	2	228881944	228881944	+	Missense_Mutation	SNP	C	C	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr2:228881944C>A	ENST00000392056.3	-	7	3672	c.3626G>T	c.(3625-3627)aGt>aTt	p.S1209I	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S1209I	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1209						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGAGGAGGCACTTTCTCTGCT	0.577																																																0			2											95.0	94.0	94.0					2																	228881944		2203	4300	6503	228590188	SO:0001583	missense	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.3626G>T	2.37:g.228881944C>A	ENSP00000375909:p.Ser1209Ile	Somatic		Capture	Illumina GAIIx	4	228590188	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	HMMPfam_AKAP_110	p.S1209I	ENST00000392056.3	37	c.3626	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	2.781	-0.253603	0.05829	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.44083	0.93;0.93	5.87	3.13	0.36017	.	0.802103	0.12142	N	0.495739	T	0.40546	0.1121	L	0.47716	1.5	0.09310	N	1	P;P;D	0.54397	0.898;0.855;0.966	B;B;P	0.50708	0.352;0.36;0.648	T	0.16070	-1.0415	10	0.28530	T	0.3	.	4.4631	0.11676	0.1572:0.5947:0.0:0.2481	.	240;1209;1209	B3KR30;Q2M3C7;Q2M3C7-2	.;SPKAP_HUMAN;.	I	1209	ENSP00000375909:S1209I;ENSP00000339886:S1209I	ENSP00000339886:S1209I	S	-	2	0	SPHKAP	228590188	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.088000	0.14979	0.410000	0.25675	-0.122000	0.15005	AGT	-	NULL		0.577	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	C	NM_030623		228590188	-1	no_errors	NM_030623	genbank	human	validated	54_36p	missense	SNP	0.000	A
WDR64	128025	genome.wustl.edu	37	1	241929595	241929595	+	Missense_Mutation	SNP	G	G	A			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr1:241929595G>A	ENST00000366552.2	+	15	2200	c.1993G>A	c.(1993-1995)Gga>Aga	p.G665R	WDR64_ENST00000437684.2_Missense_Mutation_p.G665R	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	665										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			GATAGCAGCTGGAACCTTAAA	0.348																																																0			1											143.0	142.0	142.0					1																	241929595		2203	4300	6503	239996218	SO:0001583	missense	128025			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1993G>A	1.37:g.241929595G>A	ENSP00000355510:p.Gly665Arg	Somatic		Capture	Illumina GAIIx	4	239996218	B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.G385R	ENST00000366552.2	37	c.1153		1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.640661	0.47153	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.53857	1.82;0.6;4.5	4.91	4.91	0.64330	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.599273	0.15809	N	0.243587	T	0.69378	0.3104	M	0.62723	1.935	0.35778	D	0.821415	D;D	0.89917	1.0;0.982	D;P	0.71414	0.973;0.785	T	0.76179	-0.3054	10	0.59425	D	0.04	-16.4774	15.0212	0.71632	0.0:0.0:1.0:0.0	.	665;385	B1ANS9;D1MPS4	WDR64_HUMAN;.	R	665;665;436	ENSP00000355510:G665R;ENSP00000402446:G665R;ENSP00000406656:G436R	ENSP00000355510:G665R	G	+	1	0	WDR64	239996218	1.000000	0.71417	0.782000	0.31804	0.092000	0.18411	5.343000	0.65976	2.276000	0.75962	0.650000	0.86243	GGA	-	superfamily_WD40 repeat-like		0.348	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	protein_coding		G	NM_144625		239996218	+1	no_errors	NM_144625	genbank	human	validated	54_36p	missense	SNP	0.269	A
KIAA1551	55196	genome.wustl.edu	37	12	32133963	32133985	+	Frame_Shift_Del	DEL	ACCAGTCTTTAATAAACCAAATT	ACCAGTCTTTAATAAACCAAATT	-			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	ACCAGTCTTTAATAAACCAAATT	ACCAGTCTTTAATAAACCAAATT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr12:32133963_32133985delACCAGTCTTTAATAAACCAAATT	ENST00000312561.4	+	4	488_510	c.74_96delACCAGTCTTTAATAAACCAAATT	c.(73-96)caccagtctttaataaaccaaattfs	p.HQSLINQI25fs	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	25																	CCTTTTTTGCACCAGTCTTTAATAAACCAAATTACCACAACAT	0.39																																																0			12																																								32025252	SO:0001589	frameshift_variant	55196			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.74_96delACCAGTCTTTAATAAACCAAATT	12.37:g.32133963_32133985delACCAGTCTTTAATAAACCAAATT	ENSP00000310338:p.His25fs	Somatic		Capture	Illumina GAIIx	4	32025230	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Frame_Shift_Del	DEL	NULL	p.Q26fs	ENST00000312561.4	37	c.74_96	CCDS8725.2	12																																																																																			(deletion:cds_exon[32025157,32030158])	NULL		0.390	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf35	protein_coding	OTTHUMT00000250307.2	ACCAGTCTTTAATAAACCAAATT	NM_018169		32025252	+1	no_errors	NM_018169	genbank	human	validated	54_36p	frame_shift_del	DEL	0.000:0.001:0.047:0.059:0.014:0.014:0.013:0.010:0.035:0.034:0.004:0.002:0.002:0.003:0.006:0.001:0.000:0.001:0.001:0.000:0.000:0.001:0.003	-
CYP21A2	1589	genome.wustl.edu	37	6	32006215	32006217	+	In_Frame_Del	DEL	CTG	CTG	-	rs61338903|rs138498156	byFrequency	TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	CTG	CTG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr6:32006215_32006217delCTG	ENST00000418967.2	+	1	174_176	c.16_18delCTG	c.(16-18)ctgdel	p.L10del	C4B-AS1_ENST00000415626.1_RNA|CYP21A2_ENST00000435122.2_In_Frame_Del_p.L10del	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	0					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	gctcctgggcctgctgctgctgc	0.67														1086	0.216853	0.0356	0.3703	5008	,	,		14879	0.2123		0.336	False		,,,				2504	0.2352				Melanoma(174;1669 1998 3915 34700 46447)											0			6							,	328,3316		88,152,1582					,	1.1	0.8		dbSNP_134	4	2077,4999		596,885,2057	no	coding,coding	CYP21A2	NM_001128590.3,NM_000500.7	,	684,1037,3639	A1A1,A1R,RR		29.3527,9.0011,22.4347	,	,		2405,8315				32114196	SO:0001651	inframe_deletion	1589			X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.16_18delCTG	6.37:g.32006224_32006226delCTG	ENSP00000408860:p.Leu10del	Somatic		Capture	Illumina GAIIx	4	32114194	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	In_Frame_Del	DEL	superfamily_Cytochrome_P450,HMMPfam_p450,PatternScan_CYTOCHROME_P450	p.L9in_frame_del	ENST00000418967.2	37	c.16_18	CCDS4735.1	6																																																																																			(deletion:cds_exon[32114179,32114380])	NULL		0.670	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP21A2	protein_coding	OTTHUMT00000268768.2	CTG	NM_000500		32114196	+1	no_errors	NM_000500	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.796:0.973:0.975	-
ZNF485	220992	genome.wustl.edu	37	10	44112356	44112356	+	Frame_Shift_Del	DEL	C	C	-			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr10:44112356delC	ENST00000361807.3	+	5	1059	c.865delC	c.(865-867)cagfs	p.Q289fs	ZNF485_ENST00000374437.2_Frame_Shift_Del_p.Q198fs|ZNF485_ENST00000374435.3_Frame_Shift_Del_p.Q289fs	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	289					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						GTTGGAACATCAGAAAATCCA	0.393																																																0			10											75.0	81.0	79.0					10																	44112356		2203	4300	6503	43432362	SO:0001589	frameshift_variant	220992			AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.865delC	10.37:g.44112356delC	ENSP00000354694:p.Gln289fs	Somatic		Capture	Illumina GAIIx	4	43432362	B4DSE6|Q96CL0	Frame_Shift_Del	DEL	HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.Q250fs	ENST00000361807.3	37	c.748	CCDS7205.2	10																																																																																			(deletion:cds_exon[43431745,43432823])	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.393	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF485	protein_coding	OTTHUMT00000047719.2	C	NM_145312		43432362	+1	no_errors	NM_145312	genbank	human	validated	54_36p	frame_shift_del	DEL	0.881	-
CCDC142	84865	genome.wustl.edu	37	2	74701899	74701899	+	Frame_Shift_Del	DEL	A	A	-			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr2:74701899delA	ENST00000393965.3	-	9	2423	c.2027delT	c.(2026-2028)ttgfs	p.L676fs	MRPL53_ENST00000258105.7_5'Flank|CCDC142_ENST00000290418.4_Frame_Shift_Del_p.L669fs|MRPL53_ENST00000409710.1_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	676										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						GCTGCTGGGCAATTTCGTGGT	0.562																																																0			2											38.0	41.0	40.0					2																	74701899		2203	4300	6503	74555407	SO:0001589	frameshift_variant	84865			AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.2027delT	2.37:g.74701899delA	ENSP00000377537:p.Leu676fs	Somatic		Capture	Illumina GAIIx	4	74555407	B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Frame_Shift_Del	DEL	NULL	p.L669fs	ENST00000393965.3	37	c.2006		2																																																																																			(deletion:cds_exon[74555181,74555437])	NULL		0.562	CCDC142-003	KNOWN	basic	protein_coding	CCDC142	protein_coding	OTTHUMT00000328391.1	A	NM_032779		74555407	-1	no_errors	NM_032779	genbank	human	validated	54_36p	frame_shift_del	DEL	0.820	-
KIAA1033	23325	genome.wustl.edu	37	12	105543491	105543492	+	In_Frame_Ins	INS	-	-	TTT	rs370839435		TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr12:105543491_105543492insTTT	ENST00000332180.5	+	25	2700_2701	c.2613_2614insTTT	c.(2614-2616)ttt>TTTttt	p.872_872F>FF		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						AAGATATTCGATTTTTCAGGGA	0.297																																																0			12																																								104067622	SO:0001652	inframe_insertion	23325			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.2614_2616dupTTT	12.37:g.105543492_105543494dupTTT	ENSP00000328062:p.Phe873dup	Somatic		Capture	Illumina GAIIx	4	104067621		In_Frame_Ins	INS	NULL	p.873in_frame_insF	ENST00000332180.5	37	c.2613_2614	CCDS41826.1	12																																																																																			-	NULL		0.297	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1033	protein_coding	OTTHUMT00000406138.4	-	NM_015275		104067622	+1	no_errors	NM_015275	genbank	human	validated	54_36p	in_frame_ins	INS	0.959:1.000	TTT
FAM166A	401565	genome.wustl.edu	37	9	140138736	140138737	+	Frame_Shift_Del	DEL	AG	AG	-	rs570890546|rs113461609	byFrequency	TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	AG	AG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr9:140138736_140138737delAG	ENST00000344774.4	-	6	805_806	c.751_752delCT	c.(751-753)ctgfs	p.L251fs		NM_001001710.1	NP_001001710.1	Q6J272	F166A_HUMAN	family with sequence similarity 166, member A	251						nucleus (GO:0005634)				kidney(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(2)	15						GTTTCTAAACAGGAACTGGGGA	0.604														10	0.00199681	0.0008	0.0014	5008	,	,		19070	0.0		0.008	False		,,,				2504	0.0															0			9								9,4253		0,9,2122						-2.1	0.0			80	51,8203		0,51,4076	no	frameshift	FAM166A	NM_001001710.1		0,60,6198	A1A1,A1R,RR		0.6179,0.2112,0.4794				60,12456				139258558	SO:0001589	frameshift_variant	401565			BC132916	CCDS35186.1	9q34.3	2008-08-08			ENSG00000188163	ENSG00000188163			33818	protein-coding gene	gene with protein product							Standard	XR_245332		Approved		uc004cmi.1	Q6J272	OTTHUMG00000159545	ENST00000344774.4:c.751_752delCT	9.37:g.140138736_140138737delAG	ENSP00000344729:p.Leu251fs	Somatic		Capture	Illumina GAIIx	4	139258557	A6NND9|Q8N830	Frame_Shift_Del	DEL	HMMPfam_DUF2475	p.L251fs	ENST00000344774.4	37	c.752_751	CCDS35186.1	9																																																																																			(deletion:cds_exon[139258444,139258561])	NULL		0.604	FAM166A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM166A	protein_coding	OTTHUMT00000356125.1	AG	NM_001001710		139258558	-1	no_errors	NM_001001710	genbank	human	predicted	54_36p	frame_shift_del	DEL	0.001:0.002	-
SLC25A4	291	genome.wustl.edu	37	4	186066219	186066241	+	Frame_Shift_Del	DEL	GGACCAGGTTGGCTGCTGATGTG	GGACCAGGTTGGCTGCTGATGTG	-			TCGA-29-1785-01A-01W-0633-09	TCGA-29-1785-10A-01W-0634-09	GGACCAGGTTGGCTGCTGATGTG	GGACCAGGTTGGCTGCTGATGTG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	d4ad0ff7-92fa-4c79-9e83-4408f8da83da	a7dc1312-038d-49bb-b3e4-d52e0d09e4d8	g.chr4:186066219_186066241delGGACCAGGTTGGCTGCTGATGTG	ENST00000281456.6	+	2	545_567	c.413_435delGGACCAGGTTGGCTGCTGATGTG	c.(412-435)aggaccaggttggctgctgatgtgfs	p.RTRLAADV138fs		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	138					adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	GACTTTGCTAGGACCAGGTTGGCTGCTGATGTGGGCAAGGGCG	0.601																																																0			4																																								186303235	SO:0001589	frameshift_variant	291			BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.413_435delGGACCAGGTTGGCTGCTGATGTG	4.37:g.186066219_186066241delGGACCAGGTTGGCTGCTGATGTG	ENSP00000281456:p.Arg138fs	Somatic		Capture	Illumina GAIIx	4	186303213	D3DP59	Frame_Shift_Del	DEL	superfamily_Mitoch_carrier,HMMPfam_Mito_carr	p.T139fs	ENST00000281456.6	37	c.413_435	CCDS34114.1	4																																																																																			(deletion:cds_exon[186302912,186303398])	superfamily_Mitoch_carrier,HMMPfam_Mito_carr		0.601	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A4	protein_coding	OTTHUMT00000259170.3	GGACCAGGTTGGCTGCTGATGTG	NM_001151		186303235	+1	no_errors	NM_001151	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.989:1.000:1.000:0.918:1.000:1.000:0.987:1.000:1.000:1.000	-
