#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								14675	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	14675		RNA	SNP	-	NULL		37	NULL		MT																																																																																			-	-	0	0					ENSG00000210194			T			14675	-1	no_errors	ENST00000387459	ensembl	human	novel	54_36p	rna	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			7																																								57375	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	57375		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0					LOC100133120			G			57375	+1	pseudogene	XR_037156	genbank	human	model	54_36p	rna	SNP	1.000	A
C9orf66	157983	genome.wustl.edu	37	9	214631	214631	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:214631G>C	ENST00000382387.2	-	1	1262	c.766C>G	c.(766-768)Cga>Gga	p.R256G	DOCK8_ENST00000432829.2_5'Flank|DOCK8_ENST00000453981.1_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	256	Arg-rich.									central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		CGCAGTGGTCGCCTGTCGTCC	0.731																																																0			9											15.0	16.0	16.0					9																	214631		2199	4297	6496	204631	SO:0001583	missense	157983			AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.766C>G	9.37:g.214631G>C	ENSP00000371824:p.Arg256Gly	Somatic		Capture	Illumina GAIIx	4	204631	Q96NB0	Missense_Mutation	SNP	NULL	p.R256G	ENST00000382387.2	37	c.766	CCDS6439.1	9	.	.	.	.	.	.	.	.	.	.	.	4.059	0.008627	0.07912	.	.	ENSG00000183784	ENST00000382387	T	0.26373	1.74	3.94	-2.24	0.06909	.	.	.	.	.	T	0.22820	0.0551	N	0.08118	0	0.09310	N	1	D	0.89917	1.0	D	0.73380	0.98	T	0.16630	-1.0396	9	0.87932	D	0	.	4.1974	0.10450	0.1879:0.0:0.3706:0.4415	.	256	Q5T8R8	CI066_HUMAN	G	256	ENSP00000371824:R256G	ENSP00000371824:R256G	R	-	1	2	C9orf66	204631	0.016000	0.18221	0.040000	0.18447	0.057000	0.15508	-0.050000	0.11904	-0.603000	0.05767	0.430000	0.28490	CGA	-	NULL		0.731	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf66	protein_coding	OTTHUMT00000055436.1	G	NM_152569		204631	-1	no_errors	NM_152569	genbank	human	validated	54_36p	missense	SNP	0.016	C
BAIAP3	8938	genome.wustl.edu	37	16	1394521	1394521	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr16:1394521G>C	ENST00000324385.5	+	18	1917	c.1759G>C	c.(1759-1761)Gag>Cag	p.E587Q	BAIAP3_ENST00000397488.2_Missense_Mutation_p.E569Q|BAIAP3_ENST00000568887.1_Missense_Mutation_p.E524Q|BAIAP3_ENST00000426824.3_Missense_Mutation_p.E552Q|BAIAP3_ENST00000562208.1_Missense_Mutation_p.E529Q|BAIAP3_ENST00000397489.1_Missense_Mutation_p.E569Q|BAIAP3_ENST00000421665.2_Missense_Mutation_p.E516Q	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	587					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				GAGTCCCCGAGAGCAGGTGCA	0.607																																																0			16											110.0	119.0	116.0					16																	1394521		2199	4300	6499	1334522	SO:0001583	missense	8938			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1759G>C	16.37:g.1394521G>C	ENSP00000324510:p.Glu587Gln	Somatic		Capture	Illumina GAIIx	4	1334522	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,HMMPfam_DUF1041,HMMPfam_Membr_traf_MHD	p.E587Q	ENST00000324385.5	37	c.1759	CCDS10434.1	16	.	.	.	.	.	.	.	.	.	.	G	9.823	1.186208	0.21870	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	T;T;T;T;T	0.72051	-0.61;-0.6;-0.62;-0.6;-0.58	4.17	3.2	0.36748	.	0.627923	0.16942	N	0.193222	T	0.59514	0.2199	L	0.44542	1.39	0.39948	D	0.974504	P;P;P;P	0.40398	0.684;0.498;0.716;0.679	B;B;B;B	0.38106	0.147;0.202;0.265;0.241	T	0.56282	-0.8005	10	0.35671	T	0.21	-17.4552	8.5606	0.33509	0.114:0.0:0.886:0.0	.	516;529;587;569	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	Q	552;569;587;569;516	ENSP00000407242:E552Q;ENSP00000380625:E569Q;ENSP00000324510:E587Q;ENSP00000380626:E569Q;ENSP00000409533:E516Q	ENSP00000324510:E587Q	E	+	1	0	BAIAP3	1334522	0.978000	0.34361	0.995000	0.50966	0.133000	0.20885	2.272000	0.43373	0.837000	0.34925	0.491000	0.48974	GAG	-	HMMPfam_DUF1041		0.607	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	protein_coding	OTTHUMT00000109056.3	G			1334522	+1	no_errors	NM_003933	genbank	human	reviewed	54_36p	missense	SNP	0.955	C
PROKR2	128674	genome.wustl.edu	37	20	5294584	5294584	+	Missense_Mutation	SNP	A	A	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr20:5294584A>T	ENST00000217270.3	-	1	431	c.432T>A	c.(430-432)aaT>aaA	p.N144K	PROKR2_ENST00000546004.1_Missense_Mutation_p.N144K	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	144					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						CCAGCAAGGCATTGGTGGAGA	0.602										HNSCC(71;0.22)																																						0			20											64.0	51.0	55.0					20																	5294584		2203	4300	6503	5242584	SO:0001583	missense	128674			AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.432T>A	20.37:g.5294584A>T	ENSP00000217270:p.Asn144Lys	Somatic		Capture	Illumina GAIIx	4	5242584	A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.N144K	ENST00000217270.3	37	c.432	CCDS13089.1	20	.	.	.	.	.	.	.	.	.	.	A	20.4	3.991622	0.74703	.	.	ENSG00000101292	ENST00000546004;ENST00000217270	T;T	0.37058	1.22;1.22	5.12	-5.17	0.02849	GPCR, rhodopsin-like superfamily (1);	0.048188	0.85682	D	0.000000	T	0.56426	0.1984	M	0.84948	2.725	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	T	0.63283	-0.6672	10	0.41790	T	0.15	.	14.1416	0.65322	0.3992:0.0:0.6008:0.0	.	144	Q8NFJ6	PKR2_HUMAN	K	144	ENSP00000440790:N144K;ENSP00000217270:N144K	ENSP00000217270:N144K	N	-	3	2	PROKR2	5242584	0.996000	0.38824	0.963000	0.40424	0.985000	0.73830	0.595000	0.24029	-0.885000	0.03971	-0.304000	0.09214	AAT	-	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1		0.602	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR2	protein_coding	OTTHUMT00000077854.1	A	NM_144773		5242584	-1	no_errors	NM_144773	genbank	human	reviewed	54_36p	missense	SNP	0.987	T
TP53	7157	genome.wustl.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F|TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000455263.2_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	17											50.0	52.0	51.0					17																	7578461		2202	4300	6502	7519186	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	17.37:g.7578461C>A	ENSP00000269305:p.Val157Phe	Somatic		Capture	Illumina GAIIx	4	7519186	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.V157F	ENST00000269305.4	37	c.469	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519186	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.095	A
SLC2A7	155184	genome.wustl.edu	37	1	9078434	9078434	+	Splice_Site	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:9078434C>T	ENST00000400906.1	-	5	436	c.437G>A	c.(436-438)gGc>gAc	p.G146D		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	146					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GTAGGAGATGCCTGGTTTGGG	0.542																																																0			1											69.0	61.0	63.0					1																	9078434		2203	4300	6503	9001021	SO:0001630	splice_region_variant	155184			AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.437-1G>A	1.37:g.9078434C>T		Somatic		Capture	Illumina GAIIx	4	9001021	A2A333	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_Sugar_tr,PatternScan_SUGAR_TRANSPORT_2,PatternScan_SUGAR_TRANSPORT_1	p.G146D	ENST00000400906.1	37	c.437	CCDS98.2	1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659800	0.88154	.	.	ENSG00000197241	ENST00000400906	D	0.92249	-3.0	4.51	4.51	0.55191	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97645	0.9228	H	0.98005	4.125	0.54753	D	0.999986	D	0.89917	1.0	D	0.97110	1.0	D	0.99267	1.0892	10	0.87932	D	0	.	16.3803	0.83458	0.0:1.0:0.0:0.0	.	146	Q6PXP3	GTR7_HUMAN	D	146	ENSP00000383698:G146D	ENSP00000383698:G146D	G	-	2	0	SLC2A7	9001021	1.000000	0.71417	0.992000	0.48379	0.958000	0.62258	7.037000	0.76531	2.329000	0.79093	0.561000	0.74099	GGC	-	superfamily_MFS_gen_substrate_transporter,HMMPfam_Sugar_tr,PatternScan_SUGAR_TRANSPORT_2		0.542	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A7	protein_coding	OTTHUMT00000127768.3	C	NM_207420	Missense_Mutation	9001021	-1	no_errors	NM_207420	genbank	human	provisional	54_36p	missense	SNP	1.000	T
TYRP1	7306	genome.wustl.edu	37	9	12694160	12694160	+	Missense_Mutation	SNP	G	G	A	rs139670838		TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:12694160G>A	ENST00000388918.5	+	2	293	c.164G>A	c.(163-165)cGc>cAc	p.R55H	TYRP1_ENST00000381136.2_5'Flank|TYRP1_ENST00000381137.2_De_novo_Start_InFrame	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	55					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		GGGACAGACCGCTGTGGCTCA	0.602									Oculocutaneous Albinism																																							0			9						G	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	54.0	47.0	50.0		164	-4.7	0.7	9	dbSNP_134	50	0,8600		0,0,4300	no	missense	TYRP1	NM_000550.2	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	55/538	12694160	2,13004	2203	4300	6503	12684160	SO:0001583	missense	7306	Familial Cancer Database		L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.164G>A	9.37:g.12694160G>A	ENSP00000373570:p.Arg55His	Somatic		Capture	Illumina GAIIx	4	12684160	P78468|P78469|Q13721|Q15679	Missense_Mutation	SNP	superfamily_Di-copper_centre,HMMPfam_Tyrosinase,PatternScan_TYROSINASE_1,PatternScan_TYROSINASE_2	p.R55H	ENST00000388918.5	37	c.164	CCDS34990.1	9	.	.	.	.	.	.	.	.	.	.	G	12.21	1.869555	0.33069	4.54E-4	0.0	ENSG00000107165	ENST00000473763;ENST00000388918	T;D	0.99113	2.34;-5.44	5.39	-4.72	0.03269	.	0.840244	0.10736	N	0.639992	D	0.96034	0.8708	L	0.50333	1.59	0.42059	D	0.991152	P	0.42123	0.771	B	0.34873	0.191	D	0.89133	0.3511	10	0.45353	T	0.12	-6.3906	7.2041	0.25897	0.2341:0.5333:0.1592:0.0735	.	55	P17643	TYRP1_HUMAN	H	55	ENSP00000419006:R55H;ENSP00000373570:R55H	ENSP00000373570:R55H	R	+	2	0	TYRP1	12684160	0.000000	0.05858	0.681000	0.30009	0.424000	0.31475	-0.346000	0.07760	-0.882000	0.03987	-0.253000	0.11424	CGC	-	NULL		0.602	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRP1	protein_coding	OTTHUMT00000055502.3	G	NM_000550		12684160	+1	no_errors	NM_000550	genbank	human	reviewed	54_36p	missense	SNP	0.871	A
PRAMEF4	400735	genome.wustl.edu	37	1	12939692	12939692	+	Missense_Mutation	SNP	G	G	T	rs142785237	byFrequency	TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:12939692G>T	ENST00000235349.5	-	4	1180	c.1110C>A	c.(1108-1110)aaC>aaA	p.N370K		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	370					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCAAGATGGCGTTGACTTGGG	0.512																																																0			1											92.0	97.0	95.0					1																	12939692		1496	2685	4181	12862279	SO:0001583	missense	400735				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.1110C>A	1.37:g.12939692G>T	ENSP00000235349:p.Asn370Lys	Somatic		Capture	Illumina GAIIx	4	12862279	Q5LJB5	Missense_Mutation	SNP	superfamily_SSF52047	p.N370K	ENST00000235349.5	37	c.1110	CCDS30592.1	1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.017508	0.00042	.	.	ENSG00000243073	ENST00000235349	T	0.09445	2.98	1.48	-2.96	0.05547	.	1.784470	0.03110	N	0.162388	T	0.07369	0.0186	L	0.35542	1.07	0.09310	N	1	B	0.32862	0.387	B	0.35240	0.198	T	0.31779	-0.9931	10	0.10377	T	0.69	.	0.319	0.00300	0.3702:0.1396:0.2157:0.2745	.	370	O60810	PRAM4_HUMAN	K	370	ENSP00000235349:N370K	ENSP00000235349:N370K	N	-	3	2	PRAMEF4	12862279	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.255000	0.00265	-3.983000	0.00084	-1.488000	0.00978	AAC	-	superfamily_SSF52047		0.512	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	protein_coding	OTTHUMT00000005518.1	G	NM_001009611		12862279	-1	no_errors	NM_001009611	genbank	human	validated	54_36p	missense	SNP	0.000	T
RAB9A	9367	genome.wustl.edu	37	X	13727391	13727391	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chrX:13727391G>A	ENST00000464506.1	+	3	805	c.526G>A	c.(526-528)Gag>Aag	p.E176K	RAB9A_ENST00000243325.5_3'UTR	NM_001195328.1|NM_004251.4	NP_001182257.1|NP_004242.1	P51151	RAB9A_HUMAN	RAB9A, member RAS oncogene family	176					GTP catabolic process (GO:0006184)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7						TCTTGCTACCGAGGATAGGTC	0.453																																																0			X											88.0	77.0	81.0					X																	13727391		2203	4300	6503	13637312	SO:0001583	missense	9367			U44103	CCDS14156.1	Xp22.2	2010-04-19	2007-01-15	2007-01-15	ENSG00000123595	ENSG00000123595		"""RAB, member RAS oncogene"""	9792	protein-coding gene	gene with protein product		300284	"""RAB9, member RAS oncogene family"""	RAB9		9126495	Standard	NM_004251		Approved		uc010neh.3	P51151	OTTHUMG00000021156	ENST00000464506.1:c.526G>A	X.37:g.13727391G>A	ENSP00000420127:p.Glu176Lys	Somatic		Capture	Illumina GAIIx	4	13637312	A8K390|Q6ICN1	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176	p.E176K	ENST00000464506.1	37	c.526	CCDS14156.1	X	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063681	0.76187	.	.	ENSG00000123595	ENST00000464506	T	0.79247	-1.25	5.36	5.36	0.76844	.	0.105000	0.64402	D	0.000005	T	0.65270	0.2675	N	0.19112	0.55	0.80722	D	1	P	0.34892	0.474	B	0.32211	0.142	T	0.63734	-0.6570	9	.	.	.	-7.8124	18.1669	0.89731	0.0:0.0:1.0:0.0	.	176	P51151	RAB9A_HUMAN	K	176	ENSP00000420127:E176K	.	E	+	1	0	RAB9A	13637312	1.000000	0.71417	0.915000	0.36163	0.987000	0.75469	7.810000	0.86072	2.227000	0.72691	0.594000	0.82650	GAG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00176		0.453	RAB9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB9A	protein_coding	OTTHUMT00000055802.1	G	NM_004251		13637312	+1	no_errors	NM_004251	genbank	human	provisional	54_36p	missense	SNP	0.998	A
AGMO	392636	genome.wustl.edu	37	7	15470653	15470653	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr7:15470653C>G	ENST00000342526.3	-	4	659	c.490G>C	c.(490-492)Gtc>Ctc	p.V164L		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	164					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)			breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						ATCTGGAGGACAGACTGTCTC	0.348																																																0			7											115.0	114.0	114.0					7																	15470653		2203	4299	6502	15437178	SO:0001583	missense	392636				CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.490G>C	7.37:g.15470653C>G	ENSP00000341662:p.Val164Leu	Somatic		Capture	Illumina GAIIx	4	15437178	A4D114|A6NCH5	Missense_Mutation	SNP	HMMPfam_FA_hydroxylase	p.V164L	ENST00000342526.3	37	c.490	CCDS34604.1	7	.	.	.	.	.	.	.	.	.	.	C	10.55	1.381372	0.24944	.	.	ENSG00000187546	ENST00000342526	D	0.83673	-1.75	5.76	3.95	0.45737	Fatty acid hydroxylase (1);	0.815798	0.11131	N	0.596392	T	0.65995	0.2745	N	0.11845	0.185	0.23841	N	0.996694	B	0.10296	0.003	B	0.15052	0.012	T	0.49021	-0.8982	10	0.08381	T	0.77	-31.5004	8.5782	0.33612	0.2704:0.6592:0.0:0.0704	.	164	Q6ZNB7	ALKMO_HUMAN	L	164	ENSP00000341662:V164L	ENSP00000341662:V164L	V	-	1	0	AGMO	15437178	0.278000	0.24230	0.305000	0.25099	0.935000	0.57460	0.802000	0.27069	0.772000	0.33382	0.591000	0.81541	GTC	-	HMMPfam_FA_hydroxylase		0.348	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM195	protein_coding	OTTHUMT00000326049.2	C	NM_001004320		15437178	-1	no_errors	NM_001004320	genbank	human	provisional	54_36p	missense	SNP	0.445	G
ABCC6	368	genome.wustl.edu	37	16	16291943	16291943	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr16:16291943G>C	ENST00000205557.7	-	10	1302	c.1273C>G	c.(1273-1275)Ctc>Gtc	p.L425V	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	425	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	TTGAGGTAGAGGACGCTCTCG	0.612																																																0			16											67.0	48.0	55.0					16																	16291943		2197	4300	6497	16199444	SO:0001583	missense	368			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.1273C>G	16.37:g.16291943G>C	ENSP00000205557:p.Leu425Val	Somatic		Capture	Illumina GAIIx	4	16199444	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.L425V	ENST00000205557.7	37	c.1273	CCDS10568.1	16	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.518218	0.00967	.	.	ENSG00000091262	ENST00000205557;ENST00000456970;ENST00000546056	D;D	0.91577	-2.87;-2.87	4.4	-8.71	0.00848	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	1.787890	0.03711	N	0.250191	T	0.70482	0.3229	N	0.03948	-0.315	0.34019	D	0.652381	B;B	0.12630	0.001;0.006	B;B	0.15052	0.005;0.012	T	0.61372	-0.7076	10	0.07990	T	0.79	.	4.5563	0.12138	0.0802:0.3505:0.1242:0.4451	.	437;425	F5GWQ0;O95255	.;MRP6_HUMAN	V	425;425;437	ENSP00000205557:L425V;ENSP00000405002:L425V	ENSP00000205557:L425V	L	-	1	0	ABCC6	16199444	0.083000	0.21467	0.019000	0.16419	0.130000	0.20726	-0.037000	0.12164	-1.072000	0.03141	-1.083000	0.02208	CTC	-	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane		0.612	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC6	protein_coding	OTTHUMT00000252232.2	G			16199444	-1	no_errors	NM_001171	genbank	human	reviewed	54_36p	missense	SNP	0.523	C
TMEM161A	54929	genome.wustl.edu	37	19	19243235	19243235	+	Nonsense_Mutation	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr19:19243235G>C	ENST00000162044.9	-	5	433	c.369C>G	c.(367-369)taC>taG	p.Y123*	TMEM161A_ENST00000450333.2_Intron|TMEM161A_ENST00000592147.1_5'Flank|TMEM161A_ENST00000587583.2_Nonsense_Mutation_p.Y98*	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	123					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			GCATGTAGTAGTAGGCCTCTG	0.567																																																0			19											165.0	147.0	153.0					19																	19243235		2203	4300	6503	19104235	SO:0001587	stop_gained	54929			BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.369C>G	19.37:g.19243235G>C	ENSP00000162044:p.Tyr123*	Somatic		Capture	Illumina GAIIx	4	19104235	B3KUE0|G5E9M6|Q7L2Y1	Nonsense_Mutation	SNP	HMMPfam_Tmemb_161AB	p.Y123*	ENST00000162044.9	37	c.369	CCDS12393.1	19	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951313	0.53186	.	.	ENSG00000064545	ENST00000162044	.	.	.	3.74	2.7	0.31948	.	0.061993	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.5638	5.1476	0.14993	0.242:0.0:0.758:0.0	.	.	.	.	X	123	.	ENSP00000162044:Y123X	Y	-	3	2	TMEM161A	19104235	1.000000	0.71417	0.998000	0.56505	0.382000	0.30200	1.885000	0.39678	2.099000	0.63709	0.491000	0.48974	TAC	-	HMMPfam_Tmemb_161AB		0.567	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM161A	protein_coding	OTTHUMT00000460089.2	G	NM_017814		19104235	-1	no_errors	NM_017814	genbank	human	provisional	54_36p	nonsense	SNP	1.000	C
UBR4	23352	genome.wustl.edu	37	1	19473417	19473417	+	Silent	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:19473417C>T	ENST00000375254.3	-	52	7734	c.7707G>A	c.(7705-7707)gtG>gtA	p.V2569V	UBR4_ENST00000375217.2_Silent_p.V2569V|UBR4_ENST00000375226.2_Silent_p.V2580V|UBR4_ENST00000375267.2_Silent_p.V2569V	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2569					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GCCTCTGGAACACCTCAGGGT	0.522																																																0			1											259.0	239.0	246.0					1																	19473417		2203	4300	6503	19346004	SO:0001819	synonymous_variant	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.7707G>A	1.37:g.19473417C>T		Somatic		Capture	Illumina GAIIx	4	19346004	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	superfamily_ARM repeat,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-UBR,HMMSmart_SM00396,PatternScan_ASP_GLU_RACEMASE_1	p.V2569	ENST00000375254.3	37	c.7707	CCDS189.1	1																																																																																			-	superfamily_ARM repeat		0.522	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	protein_coding	OTTHUMT00000007085.1	C	NM_020765		19346004	-1	no_errors	NM_020765	genbank	human	validated	54_36p	silent	SNP	1.000	T
CFAP61	26074	genome.wustl.edu	37	20	20056208	20056208	+	Missense_Mutation	SNP	A	A	G	rs371474647		TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr20:20056208A>G	ENST00000245957.5	+	6	591	c.515A>G	c.(514-516)cAt>cGt	p.H172R	C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000377309.2_5'UTR|C20orf26_ENST00000377306.1_Missense_Mutation_p.H172R|C20orf26_ENST00000451767.2_Missense_Mutation_p.H172R	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		172										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TTTGCAGTGCATATATGTCAC	0.473																																																0			20						A	ARG/HIS,ARG/HIS	1,4405	2.1+/-5.4	0,1,2202	150.0	138.0	142.0		515,515	3.5	0.0	20		142	0,8600		0,0,4300	no	missense,missense	C20orf26	NM_001167816.1,NM_015585.3	29,29	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	172/471,172/1238	20056208	1,13005	2203	4300	6503	20004208	SO:0001583	missense	26074																														ENST00000245957.5:c.515A>G	20.37:g.20056208A>G	ENSP00000245957:p.His172Arg	Somatic		Capture	Illumina GAIIx	4	20004208	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	superfamily_Acyl-CoA N-acyltransferases (Nat),superfamily_FAD/NAD(P)-binding domain	p.H172R	ENST00000245957.5	37	c.515	CCDS33447.1	20	.	.	.	.	.	.	.	.	.	.	A	6.858	0.527686	0.13127	2.27E-4	0.0	ENSG00000089101	ENST00000340348;ENST00000343997;ENST00000389655;ENST00000245957;ENST00000377306;ENST00000377303;ENST00000451767;ENST00000472660	T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6	5.9	3.46	0.39613	Acyl-CoA N-acyltransferase (1);	0.581665	0.18777	N	0.131426	T	0.24812	0.0602	L	0.46157	1.445	0.09310	N	0.99999	P;B;P;B	0.44090	0.744;0.414;0.826;0.078	B;B;B;B	0.40825	0.341;0.15;0.331;0.06	T	0.07986	-1.0744	10	0.25751	T	0.34	.	8.794	0.34868	0.7659:0.0:0.0:0.2341	.	172;172;126;172	Q8NHU2-3;F8W6K4;F8W6E2;Q8NHU2	.;.;.;CT026_HUMAN	R	126;172;172;172;172;172;172;68	ENSP00000345553:H126R;ENSP00000245957:H172R;ENSP00000366521:H172R;ENSP00000366518:H172R;ENSP00000414537:H172R;ENSP00000420498:H68R	ENSP00000245957:H172R	H	+	2	0	C20orf26	20004208	0.027000	0.19231	0.007000	0.13788	0.007000	0.05969	1.288000	0.33296	2.264000	0.75181	0.533000	0.62120	CAT	-	NULL		0.473	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	protein_coding	OTTHUMT00000078228.3	A			20004208	+1	no_errors	NM_015585	genbank	human	predicted	54_36p	missense	SNP	0.002	G
SLC2A11	66035	genome.wustl.edu	37	22	24204383	24204383	+	Silent	SNP	G	G	A	rs185337121		TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr22:24204383G>A	ENST00000345044.6	+	2	382	c.114G>A	c.(112-114)ccG>ccA	p.P38P	SLC2A11_ENST00000467660.1_3'UTR|SLC2A11_ENST00000316185.8_Silent_p.P41P|AP000350.10_ENST00000433835.3_Silent_p.P3P|SLC2A11_ENST00000405847.1_Silent_p.P38P|SLC2A11_ENST00000398356.2_Silent_p.P45P|SLC2A11_ENST00000403208.3_Silent_p.P38P			Q9BYW1	GTR11_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 11	38					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	12						TCAATGCCCCGACCTTGGTAT	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		20825	0.001		0.0	False		,,,				2504	0.0															0			22											188.0	167.0	174.0					22																	24204383		2203	4300	6503	22534383	SO:0001819	synonymous_variant	66035			AJ271290	CCDS13818.1, CCDS33616.1, CCDS46673.1, CCDS74828.1	22q11.23	2013-05-22			ENSG00000133460	ENSG00000133460		"""Solute carriers"""	14239	protein-coding gene	gene with protein product		610367					Standard	NM_001024938		Approved	GLUT11, GLUT10	uc002zyp.4	Q9BYW1	OTTHUMG00000166469	ENST00000345044.6:c.114G>A	22.37:g.24204383G>A		Somatic		Capture	Illumina GAIIx	4	22534383	E9PH55|Q542Y4|Q6ICJ5|Q8WXF9|Q8WYM4	Silent	SNP	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr,PatternScan_SUGAR_TRANSPORT_2	p.P45	ENST00000345044.6	37	c.135	CCDS46673.1	22	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.562	-0.844865	0.02671	.	.	ENSG00000251357	ENST00000421180	.	.	.	3.4	-5.44	0.02624	.	.	.	.	.	T	0.48447	0.1500	.	.	.	0.50813	D	0.999894	.	.	.	.	.	.	T	0.49273	-0.8957	4	.	.	.	.	7.621	0.28185	0.6677:0.1366:0.1957:0.0	.	.	.	.	Q	14	.	.	R	+	2	0	AP000350.10	22534383	0.016000	0.18221	0.201000	0.23476	0.142000	0.21351	-1.928000	0.01560	-0.969000	0.03573	-0.960000	0.02634	CGA	-	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr		0.557	SLC2A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A11	protein_coding	OTTHUMT00000319889.3	G	NM_030807		22534383	+1	no_errors	NM_030807	genbank	human	validated	54_36p	silent	SNP	0.978	A
AP1G2	8906	genome.wustl.edu	37	14	24030606	24030606	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr14:24030606T>C	ENST00000308724.5	-	18	2647	c.1892A>G	c.(1891-1893)gAt>gGt	p.D631G	RP11-66N24.4_ENST00000555446.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA|AP1G2_ENST00000397120.3_Missense_Mutation_p.D631G|RP11-66N24.3_ENST00000555968.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	631					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		AGAAGCCCCATCCAGGAGATC	0.617																																																0			14											53.0	53.0	53.0					14																	24030606		2203	4300	6503	23100446	SO:0001583	missense	8906			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1892A>G	14.37:g.24030606T>C	ENSP00000312442:p.Asp631Gly	Somatic		Capture	Illumina GAIIx	4	23100446	D3DS51|O75504	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_Adaptin_N,superfamily_Clath_adapt,HMMPfam_Alpha_adaptinC2,HMMSmart_Alpha_adaptinC2	p.D631G	ENST00000308724.5	37	c.1892	CCDS9602.1	14	.	.	.	.	.	.	.	.	.	.	T	9.809	1.182540	0.21870	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000545295;ENST00000535852;ENST00000554477	T;T	0.16196	2.36;2.36	5.73	4.55	0.56014	Clathrin adaptor, gamma-adaptin, appendage (1);	0.522587	0.20495	N	0.091217	T	0.08891	0.0220	N	0.19112	0.55	0.31292	N	0.689367	B;B	0.10296	0.003;0.002	B;B	0.09377	0.004;0.002	T	0.29119	-1.0022	10	0.02654	T	1	-6.0601	8.8576	0.35238	0.0:0.0863:0.0:0.9137	.	631;486	O75843;Q86V28	AP1G2_HUMAN;.	G	631;631;400;486;93	ENSP00000312442:D631G;ENSP00000380309:D631G	ENSP00000312442:D631G	D	-	2	0	AP1G2	23100446	0.882000	0.30256	0.993000	0.49108	0.141000	0.21300	1.500000	0.35682	0.956000	0.37904	0.459000	0.35465	GAT	-	NULL		0.617	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G2	protein_coding	OTTHUMT00000071812.4	T	NM_003917		23100446	-1	no_errors	NM_003917	genbank	human	reviewed	54_36p	missense	SNP	0.625	C
PRKCB	5579	genome.wustl.edu	37	16	24202459	24202459	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr16:24202459G>A	ENST00000321728.7	+	16	1946	c.1771G>A	c.(1771-1773)Gaa>Aaa	p.E591K	PRKCB_ENST00000303531.7_Missense_Mutation_p.E591K	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	591	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	ACCTGAAGGCGAACGTGATAT	0.433																																																0			16											106.0	104.0	104.0					16																	24202459		2197	4300	6497	24109960	SO:0001583	missense	5579			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1771G>A	16.37:g.24202459G>A	ENSP00000318315:p.Glu591Lys	Somatic		Capture	Illumina GAIIx	4	24109960	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_SM00133,HMMPfam_Pkinase_C	p.E591K	ENST00000321728.7	37	c.1771	CCDS10618.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.316551	0.95655	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.53206	0.63;0.63	5.79	5.79	0.91817	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60051	0.2239	L	0.42245	1.32	0.80722	D	1	D;D	0.64830	0.957;0.994	P;P	0.61533	0.602;0.89	T	0.55630	-0.8111	10	0.42905	T	0.14	.	18.5987	0.91239	0.0:0.0:1.0:0.0	.	591;591	P05771-2;P05771	.;KPCB_HUMAN	K	591	ENSP00000318315:E591K;ENSP00000305355:E591K	ENSP00000305355:E591K	E	+	1	0	PRKCB	24109960	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	9.357000	0.97099	2.744000	0.94065	0.650000	0.86243	GAA	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Pkinase		0.433	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	protein_coding	OTTHUMT00000254504.2	G	NM_212535		24109960	+1	no_errors	NM_002738	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
BTN3A1	11119	genome.wustl.edu	37	6	26406179	26406179	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr6:26406179T>C	ENST00000289361.6	+	3	496	c.128T>C	c.(127-129)aTg>aCg	p.M43T	BTN3A1_ENST00000414912.2_Missense_Mutation_p.M43T|BTN3A1_ENST00000425234.2_Missense_Mutation_p.M43T|BTN3A1_ENST00000476549.2_Missense_Mutation_p.M43T	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	43	Ig-like V-type 1.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						ATCCTGGCCATGGTGGGTGAA	0.577																																																0			6											64.0	63.0	63.0					6																	26406179		2203	4297	6500	26514158	SO:0001583	missense	11119			U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.128T>C	6.37:g.26406179T>C	ENSP00000289361:p.Met43Thr	Somatic		Capture	Illumina GAIIx	4	26514158	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00406,HMMSmart_SM00589,HMMPfam_SPRY,HMMSmart_SM00449	p.M43T	ENST00000289361.6	37	c.128	CCDS4608.1	6	.	.	.	.	.	.	.	.	.	.	.	15.32	2.798846	0.50208	.	.	ENSG00000026950	ENST00000476549;ENST00000289361;ENST00000450085;ENST00000425234;ENST00000427334;ENST00000506698;ENST00000414912	T;T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;0.15;4.31;-0.09	2.21	-0.319	0.12725	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.41166	0.1147	N	0.20685	0.6	0.09310	N	1	D;D;D;D	0.64830	0.994;0.994;0.994;0.994	D;D;D;D	0.75020	0.985;0.981;0.983;0.985	T	0.20605	-1.0270	9	0.31617	T	0.26	.	4.3659	0.11225	0.0:0.3585:0.0:0.6415	.	43;43;43;43	E9PGB4;O00481-3;O00481-2;O00481	.;.;.;BT3A1_HUMAN	T	43	ENSP00000420010:M43T;ENSP00000289361:M43T;ENSP00000394937:M43T;ENSP00000396684:M43T;ENSP00000399393:M43T;ENSP00000427013:M43T;ENSP00000406667:M43T	ENSP00000289361:M43T	M	+	2	0	BTN3A1	26514158	0.000000	0.05858	0.000000	0.03702	0.913000	0.54294	-0.368000	0.07543	-0.063000	0.13065	0.454000	0.30748	ATG	-	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409		0.577	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN3A1	protein_coding	OTTHUMT00000040112.3	T			26514158	+1	no_errors	NM_007048	genbank	human	validated	54_36p	missense	SNP	0.000	C
IL21R	50615	genome.wustl.edu	37	16	27445751	27445751	+	Missense_Mutation	SNP	A	A	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr16:27445751A>C	ENST00000337929.3	+	3	606	c.133A>C	c.(133-135)Agc>Cgc	p.S45R	IL21R_ENST00000564089.1_Missense_Mutation_p.S45R|IL21R_ENST00000395754.4_Missense_Mutation_p.S45R|IL21R_ENST00000395755.1_Missense_Mutation_p.S45R	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	45	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CCTCCACCCCAGCACGCTCAC	0.622			T	BCL6	NHL																																		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	0			16											105.0	77.0	87.0					16																	27445751		2197	4300	6497	27353252	SO:0001583	missense	50615			AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.133A>C	16.37:g.27445751A>C	ENSP00000338010:p.Ser45Arg	Somatic		Capture	Illumina GAIIx	4	27353252	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	superfamily_Fibronectin type III,PatternScan_HEMATOPO_REC_S_F1	p.S45R	ENST00000337929.3	37	c.133	CCDS10630.1	16	.	.	.	.	.	.	.	.	.	.	a	6.261	0.416255	0.11870	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	D;D;D	0.94793	-3.52;-3.52;-3.52	4.39	-7.06	0.01568	Fibronectin, type III (1);	2.439520	0.01540	N	0.019204	D	0.89434	0.6714	L	0.53249	1.67	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.76022	-0.3111	10	0.22109	T	0.4	-0.233	2.5714	0.04796	0.4681:0.3047:0.1102:0.1171	.	45	Q9HBE5	IL21R_HUMAN	R	45	ENSP00000338010:S45R;ENSP00000379104:S45R;ENSP00000379103:S45R	ENSP00000338010:S45R	S	+	1	0	IL21R	27353252	0.000000	0.05858	0.001000	0.08648	0.397000	0.30659	-1.576000	0.02129	-1.192000	0.02691	0.454000	0.30748	AGC	-	NULL		0.622	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL21R	protein_coding	OTTHUMT00000254578.2	A	NM_181078		27353252	+1	no_errors	NM_021798	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
EIF2B4	8890	genome.wustl.edu	37	2	27587588	27587588	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr2:27587588G>C	ENST00000347454.4	-	12	1540	c.1369C>G	c.(1369-1371)Cta>Gta	p.L457V	EIF2B4_ENST00000493344.2_Missense_Mutation_p.L478V|AC074117.10_ENST00000412749.1_RNA|EIF2B4_ENST00000445933.2_Missense_Mutation_p.L456V|EIF2B4_ENST00000451130.2_Missense_Mutation_p.L477V	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	457					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTTACCTAGCTCATTAGAG	0.483																																																0			2											106.0	102.0	104.0					2																	27587588		2203	4300	6503	27441092	SO:0001583	missense	8890			AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.1369C>G	2.37:g.27587588G>C	ENSP00000233552:p.Leu457Val	Somatic		Capture	Illumina GAIIx	4	27441092	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	superfamily_NagB/RpiA/CoA transferase-like,HMMPfam_IF-2B	p.L477V	ENST00000347454.4	37	c.1429	CCDS33164.1	2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.971261	0.74246	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.96599	0.8890	M	0.83774	2.66	0.80722	D	1	D;D;P;P	0.71674	0.998;0.998;0.859;0.733	D;D;P;P	0.72075	0.976;0.976;0.842;0.525	D	0.95682	0.8733	10	0.35671	T	0.21	.	17.2801	0.87126	0.0:0.0:1.0:0.0	.	454;456;457;477	F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;EI2BD_HUMAN;.	V	457;454;456;477;478	ENSP00000233552:L457V;ENSP00000394397:L456V;ENSP00000394869:L477V;ENSP00000429323:L478V	ENSP00000233552:L457V	L	-	1	2	EIF2B4	27441092	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.471000	0.66762	2.655000	0.90218	0.655000	0.94253	CTA	-	superfamily_NagB/RpiA/CoA transferase-like,HMMPfam_IF-2B		0.483	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF2B4	protein_coding	OTTHUMT00000324448.1	G			27441092	-1	no_errors	NM_172195	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ATXN2L	11273	genome.wustl.edu	37	16	28847795	28847795	+	3'UTR	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr16:28847795G>C	ENST00000336783.4	+	0	3604				ATXN2L_ENST00000340394.8_Intron|ATXN2L_ENST00000382686.4_Intron|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000570200.1_Intron|ATXN2L_ENST00000325215.6_Intron|ATXN2L_ENST00000395547.2_Silent_p.L1096L|ATXN2L_ENST00000564304.1_Intron	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like						regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						ACTGTCTCCTGACTTAGCCGA	0.627																																																0			16											35.0	34.0	34.0					16																	28847795		2197	4300	6497	28755296	SO:0001624	3_prime_UTR_variant	11273				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.*209G>C	16.37:g.28847795G>C		Somatic		Capture	Illumina GAIIx	4	28755296	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Silent	SNP	HMMPfam_LsmAD,HMMPfam_PAM2	p.L1096	ENST00000336783.4	37	c.3288	CCDS10641.1	16																																																																																			-	NULL		0.627	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATXN2L	protein_coding	OTTHUMT00000214139.1	G	NM_007245		28755296	+1	no_errors	NM_148414	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
CD2BP2	10421	genome.wustl.edu	37	16	30365935	30365935	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr16:30365935G>T	ENST00000305596.3	-	2	243	c.68C>A	c.(67-69)cCc>cAc	p.P23H	RP11-347C12.10_ENST00000563252.1_lincRNA|CD2BP2_ENST00000569466.1_Missense_Mutation_p.P23H	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	23					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)			breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CTTCTTCTTGGGGACAATGAT	0.567																																																0			16											250.0	250.0	250.0					16																	30365935		2197	4300	6497	30273436	SO:0001583	missense	10421			AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.68C>A	16.37:g.30365935G>T	ENSP00000304903:p.Pro23His	Somatic		Capture	Illumina GAIIx	4	30273436	B2RDX2|Q9ULP2	Missense_Mutation	SNP	superfamily_GYF domain,HMMPfam_GYF,HMMSmart_SM00444	p.P23H	ENST00000305596.3	37	c.68	CCDS10675.1	16	.	.	.	.	.	.	.	.	.	.	G	29.5	5.009019	0.93346	.	.	ENSG00000169217	ENST00000305596	T	0.30448	1.53	5.34	5.34	0.76211	.	0.166753	0.53938	D	0.000050	T	0.50411	0.1614	L	0.58101	1.795	0.58432	D	0.999999	D	0.89917	1.0	D	0.66196	0.942	T	0.46005	-0.9222	10	0.49607	T	0.09	-0.7209	15.9546	0.79876	0.0:0.0:1.0:0.0	.	23	O95400	CD2B2_HUMAN	H	23	ENSP00000304903:P23H	ENSP00000304903:P23H	P	-	2	0	CD2BP2	30273436	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.914000	0.63348	2.503000	0.84419	0.591000	0.81541	CCC	-	NULL		0.567	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2BP2	protein_coding	OTTHUMT00000255528.1	G	NM_006110		30273436	-1	no_errors	NM_006110	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
KRTAP6-3	337968	genome.wustl.edu	37	21	31965075	31965075	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr21:31965075C>G	ENST00000391624.1	+	1	317	c.290C>G	c.(289-291)tCc>tGc	p.S97C	KRTAP22-2_ENST00000382830.2_5'Flank	NM_181605.3	NP_853636.3	Q3LI67	KRA63_HUMAN	keratin associated protein 6-3	97						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(7)	10						GGCTATGGCTCCAGCTTTGGC	0.537																																																0			21											38.0	45.0	43.0					21																	31965075		2201	4300	6501	30886946	SO:0001583	missense	337968			AP001708		21q22.1	2012-04-19			ENSG00000212938	ENSG00000212938		"""Keratin associated proteins"""	18933	protein-coding gene	gene with protein product						12359730	Standard	NM_181605		Approved	KAP6.3	uc002yom.3	Q3LI67	OTTHUMG00000057791	ENST00000391624.1:c.290C>G	21.37:g.31965075C>G	ENSP00000375482:p.Ser97Cys	Somatic		Capture	Illumina GAIIx	4	30886946	A4IF26	Missense_Mutation	SNP	NULL	p.S104C	ENST00000391624.1	37	c.311		21	.	.	.	.	.	.	.	.	.	.	C	4.375	0.069068	0.08436	.	.	ENSG00000212938	ENST00000391624	T	0.37411	1.2	3.6	2.7	0.31948	.	.	.	.	.	T	0.29190	0.0726	L	0.38175	1.15	0.27360	N	0.956005	B	0.21225	0.053	B	0.21917	0.037	T	0.28138	-1.0053	9	0.87932	D	0	.	9.1772	0.37118	0.0:0.7784:0.2216:0.0	.	97	Q3LI67	KRA63_HUMAN	C	97	ENSP00000375482:S97C	ENSP00000375482:S97C	S	+	2	0	KRTAP6-3	30886946	1.000000	0.71417	0.999000	0.59377	0.077000	0.17291	1.063000	0.30567	1.063000	0.40649	0.557000	0.71058	TCC	-	NULL		0.537	KRTAP6-3-001	KNOWN	basic|appris_principal	protein_coding	KRTAP6-3	protein_coding	OTTHUMT00000128243.2	C	NM_181605		30886946	+1	no_errors	NM_181605	genbank	human	validated	54_36p	missense	SNP	1.000	G
FGD4	121512	genome.wustl.edu	37	12	32755149	32755149	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr12:32755149G>C	ENST00000427716.2	+	7	1315	c.891G>C	c.(889-891)aaG>aaC	p.K297N	FGD4_ENST00000531134.1_Missense_Mutation_p.K382N|FGD4_ENST00000381025.3_Missense_Mutation_p.K49N|FGD4_ENST00000534526.2_Missense_Mutation_p.K434N|FGD4_ENST00000266482.3_Missense_Mutation_p.K49N|FGD4_ENST00000546442.1_Missense_Mutation_p.K204N|FGD4_ENST00000525053.1_Missense_Mutation_p.K409N	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	297	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					CATTCCTTAAGATGTATGGAG	0.318																																																0			12											129.0	137.0	134.0					12																	32755149		2203	4300	6503	32646416	SO:0001583	missense	121512			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.891G>C	12.37:g.32755149G>C	ENSP00000394487:p.Lys297Asn	Somatic		Capture	Illumina GAIIx	4	32646416	Q6ULS2|Q8TCP6	Missense_Mutation	SNP	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMSmart_SM00064,HMMPfam_FYVE,superfamily_FYVE/PHD zinc finger	p.K297N	ENST00000427716.2	37	c.891	CCDS8727.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059750	0.76074	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000266482;ENST00000546442;ENST00000525053;ENST00000381025	T;T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.02	4.11	0.48088	Dbl homology (DH) domain (5);	0.000000	0.53938	D	0.000045	D	0.82879	0.5133	M	0.86740	2.835	0.58432	D	0.999995	D;D;D;D	0.89917	0.995;0.999;1.0;0.993	D;D;D;D	0.81914	0.983;0.995;0.99;0.923	D	0.86116	0.1565	10	0.87932	D	0	-22.2314	14.3268	0.66526	0.0753:0.0:0.9247:0.0	.	409;382;297;49	E9PJX4;B7Z493;Q96M96;G3XA97	.;.;FGD4_HUMAN;.	N	434;382;297;49;204;409;49	ENSP00000449273:K434N;ENSP00000431323:K382N;ENSP00000394487:K297N;ENSP00000266482:K49N;ENSP00000446695:K204N;ENSP00000433666:K409N;ENSP00000370413:K49N	ENSP00000266482:K49N	K	+	3	2	FGD4	32646416	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.336000	0.43938	2.495000	0.84180	0.655000	0.94253	AAG	-	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325		0.318	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD4	protein_coding	OTTHUMT00000268017.1	G	NM_139241		32646416	+1	no_errors	NM_139241	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
LTBP1	4052	genome.wustl.edu	37	2	33413786	33413786	+	Silent	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr2:33413786C>T	ENST00000404816.2	+	7	1922	c.1569C>T	c.(1567-1569)taC>taT	p.Y523Y	LTBP1_ENST00000404525.1_Silent_p.Y197Y|LTBP1_ENST00000407925.1_Silent_p.Y197Y|LTBP1_ENST00000390003.4_Silent_p.Y197Y|LTBP1_ENST00000354476.3_Silent_p.Y523Y|LTBP1_ENST00000402934.1_Silent_p.Y197Y|LTBP1_ENST00000418533.2_Silent_p.Y197Y			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	523					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAGTCTCGTACCAAGGGCTTC	0.522																																																0			2											132.0	122.0	125.0					2																	33413786		2203	4300	6503	33267290	SO:0001819	synonymous_variant	4052				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1569C>T	2.37:g.33413786C>T		Somatic		Capture	Illumina GAIIx	4	33267290	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,superfamily_TB module/8-cys domain,HMMPfam_TB,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.Y523	ENST00000404816.2	37	c.1569	CCDS33177.2	2																																																																																			-	NULL		0.522	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	protein_coding	OTTHUMT00000326227.2	C	NM_206943		33267290	+1	no_errors	NM_206943	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
NPSR1	387129	genome.wustl.edu	37	7	34888188	34888188	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr7:34888188T>C	ENST00000360581.1	+	8	1066	c.938T>C	c.(937-939)gTg>gCg	p.V313A	NPSR1_ENST00000381539.3_Missense_Mutation_p.V313A|NPSR1_ENST00000381542.1_Missense_Mutation_p.V247A|NPSR1_ENST00000531252.1_Missense_Mutation_p.V302A|NPSR1_ENST00000359791.1_Missense_Mutation_p.V313A	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	313						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	TATGCCTCTGTGATCATTCAG	0.507																																																0			7											228.0	218.0	222.0					7																	34888188		2203	4300	6503	34854713	SO:0001583	missense	387129			AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.938T>C	7.37:g.34888188T>C	ENSP00000353788:p.Val313Ala	Somatic		Capture	Illumina GAIIx	4	34854713	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V313A	ENST00000360581.1	37	c.938	CCDS5444.1	7	.	.	.	.	.	.	.	.	.	.	T	21.6	4.174909	0.78564	.	.	ENSG00000187258	ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539;ENST00000334481	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	5.22	5.22	0.72569	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000057	T	0.45895	0.1365	L	0.42008	1.315	0.47778	D	0.999516	D;D;D;P;D;P	0.63046	0.992;0.971;0.99;0.868;0.971;0.891	P;P;P;P;P;P	0.61533	0.89;0.717;0.824;0.734;0.717;0.783	T	0.21042	-1.0257	10	0.14656	T	0.56	-19.7329	14.4397	0.67306	0.0:0.0:0.0:1.0	.	247;302;247;313;313;313	B7ZMA2;Q6W5P4-5;Q6W5P4-2;Q6W5P4-4;Q6W5P4-3;Q6W5P4	.;.;.;.;.;NPSR1_HUMAN	A	313;247;313;302;313;116	ENSP00000353788:V313A;ENSP00000370953:V247A;ENSP00000352839:V313A;ENSP00000433258:V302A;ENSP00000370950:V313A	ENSP00000334093:V116A	V	+	2	0	NPSR1	34854713	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.429000	0.66495	2.191000	0.70037	0.533000	0.62120	GTG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.507	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPSR1	protein_coding	OTTHUMT00000216837.1	T	NM_207173		34854713	+1	no_errors	NM_207173	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PIGO	84720	genome.wustl.edu	37	9	35091645	35091645	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:35091645C>A	ENST00000378617.3	-	7	2633	c.2239G>T	c.(2239-2241)Gta>Tta	p.V747L	PIGO_ENST00000341666.3_Missense_Mutation_p.V747L|PIGO_ENST00000298004.5_Intron|PIGO_ENST00000361778.2_Intron	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	747					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGCCCTGCTACAGCCCGAGGC	0.672																																																0			9											32.0	37.0	36.0					9																	35091645		2195	4284	6479	35081645	SO:0001583	missense	84720			AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.2239G>T	9.37:g.35091645C>A	ENSP00000367880:p.Val747Leu	Somatic		Capture	Illumina GAIIx	4	35081645	B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Missense_Mutation	SNP	superfamily_Alkaline phosphatase-like,HMMPfam_Phosphodiest	p.V747L	ENST00000378617.3	37	c.2239	CCDS6575.1	9	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630561	0.67015	.	.	ENSG00000165282	ENST00000378617;ENST00000341666	T;T	0.59083	0.29;0.29	5.18	5.18	0.71444	.	0.239659	0.33959	N	0.004386	T	0.58524	0.2128	L	0.29908	0.895	0.80722	D	1	D	0.56968	0.978	P	0.51657	0.676	T	0.58758	-0.7580	10	0.44086	T	0.13	-9.4575	18.8819	0.92358	0.0:1.0:0.0:0.0	.	747	Q8TEQ8	PIGO_HUMAN	L	747	ENSP00000367880:V747L;ENSP00000339382:V747L	ENSP00000339382:V747L	V	-	1	0	PIGO	35081645	1.000000	0.71417	1.000000	0.80357	0.314000	0.28054	3.725000	0.54970	2.688000	0.91661	0.655000	0.94253	GTA	-	NULL		0.672	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGO	protein_coding	OTTHUMT00000052284.1	C	NM_032634		35081645	-1	no_errors	NM_032634	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
STOML2	30968	genome.wustl.edu	37	9	35103081	35103081	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:35103081C>A	ENST00000356493.5	-	1	73	c.11G>T	c.(10-12)cGc>cTc	p.R4L	STOML2_ENST00000452248.2_Missense_Mutation_p.R4L|STOML2_ENST00000487490.1_5'Flank	NM_013442.1	NP_038470.1	Q9UJZ1	STML2_HUMAN	stomatin (EPB72)-like 2	4					CD4-positive, alpha-beta T cell activation (GO:0035710)|cellular calcium ion homeostasis (GO:0006874)|interleukin-2 production (GO:0032623)|lipid localization (GO:0010876)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|mitochondrial calcium ion transport (GO:0006851)|mitochondrial protein processing (GO:0034982)|mitochondrion organization (GO:0007005)|positive regulation of cardiolipin metabolic process (GO:1900210)|positive regulation of mitochondrial DNA replication (GO:0090297)|positive regulation of mitochondrial membrane potential (GO:0010918)|protein oligomerization (GO:0051259)|stress-induced mitochondrial fusion (GO:1990046)|T cell receptor signaling pathway (GO:0050852)	cytoskeleton (GO:0005856)|extrinsic component of plasma membrane (GO:0019897)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	cardiolipin binding (GO:1901612)|receptor binding (GO:0005102)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|prostate(1)	16			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CCGCGCCGCGCGCGCCAGCAT	0.642																																																0			9											29.0	35.0	33.0					9																	35103081		2200	4299	6499	35093081	SO:0001583	missense	30968			AF190167	CCDS6577.1, CCDS69588.1, CCDS75830.1	9p13.1	2008-02-05			ENSG00000165283	ENSG00000165283			14559	protein-coding gene	gene with protein product		608292				10713127, 17121834	Standard	NM_001287031		Approved	SLP-2, HSPC108	uc003zwi.3	Q9UJZ1	OTTHUMG00000019851	ENST00000356493.5:c.11G>T	9.37:g.35103081C>A	ENSP00000348886:p.Arg4Leu	Somatic		Capture	Illumina GAIIx	4	35093081	B4E1K7|D3DRN3|O60376|Q53G29|Q96FY2|Q9P042	Missense_Mutation	SNP	HMMSmart_PHB,HMMPfam_Band_7	p.R4L	ENST00000356493.5	37	c.11	CCDS6577.1	9	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530942	0.85706	.	.	ENSG00000165283	ENST00000356493;ENST00000452248	D;D	0.98135	-3.5;-4.74	5.41	5.41	0.78517	.	0.127109	0.52532	D	0.000076	D	0.96281	0.8787	N	0.08118	0	0.46336	D	0.99899	D;D	0.60160	0.987;0.962	D;D	0.65010	0.931;0.931	D	0.96776	0.9572	10	0.72032	D	0.01	-7.4729	14.5769	0.68255	0.0:1.0:0.0:0.0	.	4;4	B4E1K7;Q9UJZ1	.;STML2_HUMAN	L	4	ENSP00000348886:R4L;ENSP00000395743:R4L	ENSP00000348886:R4L	R	-	2	0	STOML2	35093081	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.704000	0.37857	2.826000	0.97356	0.561000	0.74099	CGC	-	NULL		0.642	STOML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STOML2	protein_coding	OTTHUMT00000052273.1	C	NM_013442		35093081	-1	no_errors	NM_013442	genbank	human	provisional	54_36p	missense	SNP	1.000	A
GJD4	219770	genome.wustl.edu	37	10	35897090	35897090	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr10:35897090G>T	ENST00000321660.1	+	2	807	c.649G>T	c.(649-651)Gtc>Ttc	p.V217F	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	217					cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						CGCCGACCTGGTCTGCAGCCT	0.701																																																0			10											16.0	11.0	12.0					10																	35897090		2103	4148	6251	35937096	SO:0001583	missense	219770			AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.649G>T	10.37:g.35897090G>T	ENSP00000315070:p.Val217Phe	Somatic		Capture	Illumina GAIIx	4	35937096	Q8N2R7	Missense_Mutation	SNP	HMMPfam_Connexin,HMMSmart_CNX,PatternScan_CONNEXINS_1,HMMPfam_Connexin_CCC,PatternScan_CONNEXINS_2	p.V217F	ENST00000321660.1	37	c.649	CCDS7191.1	10	.	.	.	.	.	.	.	.	.	.	G	18.70	3.680251	0.68042	.	.	ENSG00000177291	ENST00000321660	D	0.95137	-3.62	5.56	-7.44	0.01379	Gap junction protein, cysteine-rich domain (1);	1.560890	0.03420	N	0.206101	D	0.89760	0.6808	N	0.17901	0.54	0.09310	N	1	D	0.60575	0.988	P	0.53988	0.739	T	0.79864	-0.1623	10	0.06625	T	0.88	.	8.6688	0.34137	0.3615:0.3938:0.2448:0.0	.	217	Q96KN9	CXD4_HUMAN	F	217	ENSP00000315070:V217F	ENSP00000315070:V217F	V	+	1	0	GJD4	35937096	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.334000	0.02665	-1.355000	0.02186	-0.136000	0.14681	GTC	-	HMMPfam_Connexin_CCC		0.701	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD4	protein_coding	OTTHUMT00000047576.1	G	NM_153368		35937096	+1	no_errors	NM_153368	genbank	human	validated	54_36p	missense	SNP	0.000	T
DNAH8	1769	genome.wustl.edu	37	6	38775494	38775494	+	Splice_Site	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr6:38775494C>G	ENST00000359357.3	+	22	2860		c.e22+2		DNAH8_ENST00000449981.2_Splice_Site|DNAH8_ENST00000441566.1_Splice_Site			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TGTTGCAAGGCAAGTTGAAAA	0.274																																																0			6											89.0	88.0	89.0					6																	38775494		2203	4298	6501	38883472	SO:0001630	splice_region_variant	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.2606+2C>G	6.37:g.38775494C>G		Somatic		Capture	Illumina GAIIx	4	38883472	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Splice_Site	SNP	-	e20+2	ENST00000359357.3	37	c.2606+2		6	.	.	.	.	.	.	.	.	.	.	C	5.787	0.329511	0.10956	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	6.07	-0.734	0.11140	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4273	0.38588	0.0:0.4966:0.0:0.5034	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH8	38883472	1.000000	0.71417	0.964000	0.40570	0.267000	0.26476	0.505000	0.22642	-0.054000	0.13266	-1.735000	0.00691	.	-	-		0.274	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	C	NM_001206927	Intron	38883472	+1	no_errors	NM_001371	genbank	human	validated	54_36p	splice_site	SNP	0.988	G
MAPKBP1	23005	genome.wustl.edu	37	15	42107468	42107468	+	Silent	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr15:42107468G>A	ENST00000456763.2	+	12	1396	c.1200G>A	c.(1198-1200)gaG>gaA	p.E400E	MAPKBP1_ENST00000514566.1_Silent_p.E394E|MAPKBP1_ENST00000457542.2_Silent_p.E394E|MAPKBP1_ENST00000260357.7_Intron|MAPKBP1_ENST00000221214.6_Silent_p.E277E	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	400										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		TCTACCCCGAGGTGAAGGATA	0.572																																																0			15											88.0	78.0	81.0					15																	42107468		2203	4300	6503	39894760	SO:0001819	synonymous_variant	23005			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1200G>A	15.37:g.42107468G>A		Somatic		Capture	Illumina GAIIx	4	39894760	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Silent	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_PTS_HPR_SER	p.E394	ENST00000456763.2	37	c.1182	CCDS45239.1	15																																																																																			-	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40		0.572	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	protein_coding	OTTHUMT00000359745.1	G	NM_014994		39894760	+1	no_errors	NM_014994	genbank	human	validated	54_36p	silent	SNP	1.000	A
SLC8A1	6546	genome.wustl.edu	37	2	40656129	40656129	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr2:40656129C>A	ENST00000403092.1	-	2	1325	c.1292G>T	c.(1291-1293)cGc>cTc	p.R431L	SLC8A1_ENST00000332839.4_Missense_Mutation_p.R431L|SLC8A1_ENST00000406391.2_Missense_Mutation_p.R431L|SLC8A1_ENST00000542756.1_Missense_Mutation_p.R431L|SLC8A1_ENST00000402441.1_Missense_Mutation_p.R431L|SLC8A1_ENST00000542024.1_Missense_Mutation_p.R431L|SLC8A1_ENST00000405269.1_Missense_Mutation_p.R431L|SLC8A1_ENST00000406785.2_Missense_Mutation_p.R431L|SLC8A1_ENST00000408028.2_Missense_Mutation_p.R431L|SLC8A1_ENST00000405901.3_Missense_Mutation_p.R431L			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	431	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.R431H(2)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	ACCACCTCTGCGGATAATGGT	0.433																																																2	Substitution - Missense(2)	large_intestine(2)	2											97.0	84.0	88.0					2																	40656129		2203	4300	6503	40509633	SO:0001583	missense	6546				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1292G>T	2.37:g.40656129C>A	ENSP00000384763:p.Arg431Leu	Somatic		Capture	Illumina GAIIx	4	40509633	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	HMMPfam_Na_Ca_ex,HMMPfam_Calx-beta,HMMSmart_SM00237	p.R431L	ENST00000403092.1	37	c.1292	CCDS1806.1	2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939084	0.73557	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	6.17	6.17	0.99709	Na-Ca exchanger/integrin-beta4 (2);	0.043864	0.85682	D	0.000000	T	0.66436	0.2789	L	0.56124	1.755	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.991;1.0	D;D;D;D;D	0.87578	0.997;0.998;0.997;0.94;0.998	T	0.64525	-0.6387	10	0.62326	D	0.03	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	431;431;431;431;431	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	L	431	ENSP00000383886:R431L;ENSP00000440727:R431L;ENSP00000384763:R431L;ENSP00000385678:R431L;ENSP00000385188:R431L;ENSP00000385535:R431L;ENSP00000332931:R431L;ENSP00000384908:R431L;ENSP00000385811:R431L;ENSP00000443515:R431L	ENSP00000332931:R431L	R	-	2	0	SLC8A1	40509633	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	7.663000	0.83820	2.941000	0.99782	0.655000	0.94253	CGC	-	HMMPfam_Calx-beta,HMMSmart_SM00237		0.433	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	protein_coding	OTTHUMT00000326065.1	C	NM_021097		40509633	-1	no_errors	NM_021097	genbank	human	validated	54_36p	missense	SNP	1.000	A
ZNF607	84775	genome.wustl.edu	37	19	38200708	38200708	+	Missense_Mutation	SNP	C	C	G	rs570323220		TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr19:38200708C>G	ENST00000355202.4	-	3	620	c.25G>C	c.(25-27)Ggg>Cgg	p.G9R	CTD-2528L19.4_ENST00000586606.2_Missense_Mutation_p.G9R|ZNF607_ENST00000395835.3_Missense_Mutation_p.G9R	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	9	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			GCCACATCCCCGAATGTTATT	0.493																																																0			19											106.0	93.0	98.0					19																	38200708		2203	4300	6503	42892548	SO:0001583	missense	84775			AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.25G>C	19.37:g.38200708C>G	ENSP00000347338:p.Gly9Arg	Somatic		Capture	Illumina GAIIx	4	42892548	F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.G9R	ENST00000355202.4	37	c.25	CCDS33006.1	19	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.524441	0.00959	.	.	ENSG00000198182	ENST00000355202;ENST00000395835	T;T	0.01599	4.74;4.74	2.6	-1.75	0.08031	Krueppel-associated box (4);	.	.	.	.	T	0.00666	0.0022	N	0.02213	-0.635	0.09310	N	0.99999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.46400	-0.9194	9	0.05525	T	0.97	.	4.1374	0.10178	0.0:0.2543:0.1806:0.565	.	9;9	Q96SK3;F5H141	ZN607_HUMAN;.	R	9	ENSP00000347338:G9R;ENSP00000438015:G9R	ENSP00000347338:G9R	G	-	1	0	ZNF607	42892548	0.000000	0.05858	0.274000	0.24659	0.062000	0.15995	-0.367000	0.07553	-0.235000	0.09767	-1.423000	0.01107	GGG	-	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349		0.493	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF607	protein_coding	OTTHUMT00000459502.2	C	NM_032689		42892548	-1	no_errors	NM_032689	genbank	human	provisional	54_36p	missense	SNP	0.052	G
SZT2	23334	genome.wustl.edu	37	1	43869271	43869271	+	Splice_Site	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:43869271G>C	ENST00000562955.1	+	3	153		c.e3-1		SZT2_ENST00000372450.4_Intron|SZT2_ENST00000310739.4_Splice_Site	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)						central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CTAATTTTCAGCTTCAGTCTG	0.502																																																0			1											79.0	78.0	79.0					1																	43869271		2203	4300	6503	43641858	SO:0001630	splice_region_variant	149469			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.154-1G>C	1.37:g.43869271G>C		Somatic		Capture	Illumina GAIIx	4	43641858	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Splice_Site	SNP	-	e3-1	ENST00000562955.1	37	c.154-1	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536786	0.85812	.	.	ENSG00000223526	ENST00000310739;ENST00000357658	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.415	0.94690	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AL139289.1	43641858	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.234000	0.95347	2.660000	0.90430	0.655000	0.94253	.	-	-		0.502	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf84	protein_coding	OTTHUMT00000019517.3	G	NM_015284	Intron	43641858	+1	no_errors	ENST00000406439	ensembl	human	known	54_36p	splice_site	SNP	1.000	C
RASSF4	83937	genome.wustl.edu	37	10	45480393	45480393	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr10:45480393T>C	ENST00000340258.5	+	6	619	c.506T>C	c.(505-507)aTc>aCc	p.I169T	RASSF4_ENST00000472561.1_3'UTR|RASSF4_ENST00000374417.2_3'UTR|RASSF4_ENST00000334940.6_Missense_Mutation_p.I178T	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	0	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CGGTTCTCTATCAACGGCCAC	0.647																																																0			10											63.0	75.0	71.0					10																	45480393		2203	4300	6503	44800399	SO:0001583	missense	83937			BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.506T>C	10.37:g.45480393T>C	ENSP00000339692:p.Ile169Thr	Somatic		Capture	Illumina GAIIx	4	44800399	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	HMMSmart_SM00314,HMMPfam_RA	p.I169T	ENST00000340258.5	37	c.506	CCDS7208.1	10	.	.	.	.	.	.	.	.	.	.	T	24.5	4.534689	0.85812	.	.	ENSG00000107551	ENST00000334940;ENST00000340258;ENST00000374411	T;T	0.51817	0.69;0.69	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.68384	0.2995	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	T	0.71533	-0.4564	10	0.62326	D	0.03	-36.3478	14.1438	0.65336	0.0:0.0:0.0:1.0	.	178;260;169	Q9H2L5-2;Q59FL4;Q9H2L5	.;.;RASF4_HUMAN	T	178;169;260	ENSP00000334543:I178T;ENSP00000339692:I169T	ENSP00000334543:I178T	I	+	2	0	RASSF4	44800399	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	7.530000	0.81962	2.216000	0.71823	0.533000	0.62120	ATC	-	NULL		0.647	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF4	protein_coding	OTTHUMT00000047745.2	T	NM_032023		44800399	+1	no_errors	NM_032023	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
SPTBN4	57731	genome.wustl.edu	37	19	41007827	41007827	+	Splice_Site	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr19:41007827G>C	ENST00000352632.3	+	8	870		c.e8-1		SPTBN4_ENST00000598249.1_Splice_Site|SPTBN4_ENST00000344104.3_Splice_Site|SPTBN4_ENST00000338932.3_Splice_Site|SPTBN4_ENST00000595535.1_Splice_Site			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4						actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTTGCTTCCAGATGTGAACAT	0.507																																																0			19											151.0	149.0	150.0					19																	41007827		2203	4300	6503	45699667	SO:0001630	splice_region_variant	57731			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.785-1G>C	19.37:g.41007827G>C		Somatic		Capture	Illumina GAIIx	4	45699667	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Splice_Site	SNP	-	e7-1	ENST00000352632.3	37	c.785-1	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393734	0.62066	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	.	.	.	3.94	3.94	0.45596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2763	0.73745	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SPTBN4	45699667	1.000000	0.71417	0.998000	0.56505	0.810000	0.45777	9.616000	0.98359	2.215000	0.71742	0.467000	0.42956	.	-	-		0.507	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	protein_coding	OTTHUMT00000462559.2	G		Intron	45699667	+1	no_errors	NM_020971	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
PCED1B	91523	genome.wustl.edu	37	12	47629392	47629392	+	Silent	SNP	G	G	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr12:47629392G>T	ENST00000546455.1	+	4	1277	c.546G>T	c.(544-546)cgG>cgT	p.R182R	PCED1B_ENST00000432328.1_Silent_p.R182R|RP11-493L12.3_ENST00000547748.1_RNA			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	182							hydrolase activity (GO:0016787)										CCAAGCTCCGGCGGCAGAAGG	0.592																																																0			12											30.0	28.0	29.0					12																	47629392		2203	4297	6500	45915659	SO:0001819	synonymous_variant	91523			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.546G>T	12.37:g.47629392G>T		Somatic		Capture	Illumina GAIIx	4	45915659	Q96B20	Silent	SNP	superfamily_SGNH hydrolase	p.R182	ENST00000546455.1	37	c.546	CCDS8752.1	12																																																																																			-	superfamily_SGNH hydrolase		0.592	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM113B	protein_coding	OTTHUMT00000405079.1	G	NM_138371		45915659	+1	no_errors	NM_138371	genbank	human	predicted	54_36p	silent	SNP	0.089	T
VDR	7421	genome.wustl.edu	37	12	48238764	48238764	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr12:48238764G>A	ENST00000395324.2	-	10	1317	c.1049C>T	c.(1048-1050)gCg>gTg	p.A350V	VDR_ENST00000535672.1_Missense_Mutation_p.A318V|VDR_ENST00000229022.3_Missense_Mutation_p.A350V|VDR_ENST00000550325.1_Missense_Mutation_p.A400V|VDR_ENST00000549336.1_Missense_Mutation_p.A350V			P11473	VDR_HUMAN	vitamin D (1,25- dihydroxyvitamin D3) receptor	350	Ligand-binding.				bile acid signaling pathway (GO:0038183)|calcium ion transport (GO:0006816)|cell morphogenesis (GO:0000902)|cellular calcium ion homeostasis (GO:0006874)|decidualization (GO:0046697)|gene expression (GO:0010467)|intestinal absorption (GO:0050892)|lactation (GO:0007595)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of calcidiol 1-monooxygenase activity (GO:0060558)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin D receptor signaling pathway (GO:0070561)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcitriol binding (GO:1902098)|calcitriol receptor activity (GO:0008434)|DNA binding (GO:0003677)|lithocholic acid binding (GO:1902121)|lithocholic acid receptor activity (GO:0038186)|retinoid X receptor binding (GO:0046965)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(3)|skin(2)	22		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Alfacalcidol(DB01436)|Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Cholecalciferol(DB00169)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	CTCAATCAGCGCGGCGTCCTG	0.657																																																0			12											97.0	103.0	101.0					12																	48238764		2203	4300	6503	46525031	SO:0001583	missense	7421			J03258	CCDS8757.1, CCDS55820.1	12q12-q14	2014-06-13				ENSG00000111424		"""Nuclear hormone receptors"""	12679	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 163"""	601769				1662663	Standard	NM_001017536		Approved	NR1I1, PPP1R163	uc001rql.3	P11473		ENST00000395324.2:c.1049C>T	12.37:g.48238764G>A	ENSP00000378734:p.Ala350Val	Somatic		Capture	Illumina GAIIx	4	46525031	B2R5Q1|G3V1V9|Q5PSV3	Missense_Mutation	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.A350V	ENST00000395324.2	37	c.1049	CCDS8757.1	12	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436594	0.25813	.	.	ENSG00000111424	ENST00000395324;ENST00000229022;ENST00000549336;ENST00000550325;ENST00000535672	D;D;D;D;D	0.96716	-4.1;-4.1;-4.1;-4.1;-4.1	4.05	3.07	0.35406	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.696409	0.12877	N	0.431746	D	0.93507	0.7928	L	0.51422	1.61	0.09310	N	1	B;B;B	0.23316	0.028;0.004;0.083	B;B;B	0.18871	0.023;0.023;0.011	D	0.85972	0.1477	10	0.34782	T	0.22	.	10.745	0.46175	0.0:0.0:0.7243:0.2757	.	318;350;400	B4DRV7;P11473;G3V1V9	.;VDR_HUMAN;.	V	350;350;350;400;318	ENSP00000378734:A350V;ENSP00000229022:A350V;ENSP00000449573:A350V;ENSP00000447173:A400V;ENSP00000442145:A318V	ENSP00000229022:A350V	A	-	2	0	VDR	46525031	0.044000	0.20184	0.001000	0.08648	0.027000	0.11550	2.277000	0.43417	0.852000	0.35287	0.462000	0.41574	GCG	-	superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep		0.657	VDR-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	VDR	protein_coding	OTTHUMT00000406433.1	G			46525031	-1	no_errors	NM_000376	genbank	human	reviewed	54_36p	missense	SNP	0.165	A
IP6K2	51447	genome.wustl.edu	37	3	48726977	48726977	+	Silent	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr3:48726977G>A	ENST00000328631.5	-	5	997	c.774C>T	c.(772-774)ggC>ggT	p.G258G		NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	258					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						TCACCTGCATGCCACACACAC	0.547																																																0			3											113.0	91.0	98.0					3																	48726977		2203	4300	6503	48701981	SO:0001819	synonymous_variant	51447			AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.774C>T	3.37:g.48726977G>A		Somatic		Capture	Illumina GAIIx	4	48701981	A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Silent	SNP	superfamily_SAICAR synthase-like,HMMPfam_IPK	p.G258	ENST00000328631.5	37	c.774	CCDS2777.1	3																																																																																			-	superfamily_SAICAR synthase-like,HMMPfam_IPK		0.547	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IP6K2	protein_coding	OTTHUMT00000257521.2	G	NM_016291		48701981	-1	no_errors	NM_001005909	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
WDR6	11180	genome.wustl.edu	37	3	49050042	49050042	+	Missense_Mutation	SNP	T	T	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr3:49050042T>A	ENST00000608424.1	+	2	1114	c.1075T>A	c.(1075-1077)Tct>Act	p.S359T	WDR6_ENST00000489684.1_3'UTR|WDR6_ENST00000395474.3_Missense_Mutation_p.S389T|WDR6_ENST00000448293.1_Missense_Mutation_p.S308T|WDR6_ENST00000415265.2_Intron			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	359					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		TCTGGCTGGCTCTTGGCGACT	0.577																																																0			3											47.0	50.0	49.0					3																	49050042		2203	4300	6503	49025046	SO:0001583	missense	11180			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.1075T>A	3.37:g.49050042T>A	ENSP00000477389:p.Ser359Thr	Somatic		Capture	Illumina GAIIx	4	49025046	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.S359T	ENST00000608424.1	37	c.1075		3	.	.	.	.	.	.	.	.	.	.	T	4.959	0.178163	0.09443	.	.	ENSG00000178252	ENST00000395474;ENST00000448293	T;T	0.61274	0.12;2.28	5.28	1.88	0.25563	WD40 repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);	0.126702	0.49916	D	0.000130	T	0.27169	0.0666	N	0.05383	-0.06	0.09310	N	1	B;B;B	0.22683	0.073;0.03;0.073	B;B;B	0.19946	0.027;0.012;0.018	T	0.03068	-1.1076	10	0.29301	T	0.29	-14.7077	1.1779	0.01839	0.3289:0.0937:0.1406:0.4368	.	230;359;308	B4DK45;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	T	389;308	ENSP00000378857:S389T;ENSP00000413432:S308T	ENSP00000378857:S389T	S	+	1	0	WDR6	49025046	0.013000	0.17824	0.989000	0.46669	0.982000	0.71751	0.454000	0.21827	2.005000	0.58758	0.459000	0.35465	TCT	-	superfamily_WD40_like		0.577	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	protein_coding	OTTHUMT00000471652.1	T			49025046	+1	no_errors	NM_018031	genbank	human	reviewed	54_36p	missense	SNP	0.022	A
PGBD3	267004	genome.wustl.edu	37	10	50724735	50724735	+	Silent	SNP	G	G	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr10:50724735G>T	ENST00000374127.3	-	2	627	c.426C>A	c.(424-426)ccC>ccA	p.P142P	ERCC6_ENST00000355832.5_Intron|PGBD3_ENST00000603152.1_Silent_p.P610P|ERCC6-PGBD3_ENST00000447839.2_Silent_p.P610P|ERCC6-PGBD3_ENST00000515869.1_Silent_p.P610P|PGBD3_ENST00000508005.2_Silent_p.P142P	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	142										breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						GAATTTCTGTGGGAGTTCTCA	0.403																																																0			10											142.0	136.0	138.0					10																	50724735		2203	4300	6503	50394741	SO:0001819	synonymous_variant	267004			AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.426C>A	10.37:g.50724735G>T		Somatic		Capture	Illumina GAIIx	4	50394741	B3KQC4|Q5W0M0|Q6PIH0	Silent	SNP	NULL	p.P142	ENST00000374127.3	37	c.426	CCDS7230.1	10																																																																																			-	NULL		0.403	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PGBD3	protein_coding	OTTHUMT00000047988.1	G			50394741	-1	no_errors	NM_170753	genbank	human	validated	54_36p	silent	SNP	0.827	T
KRT80	144501	genome.wustl.edu	37	12	52574466	52574466	+	Intron	SNP	G	G	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr12:52574466G>T	ENST00000394815.2	-	4	668				KRT80_ENST00000313234.5_Intron	NM_182507.2	NP_872313.2	Q6KB66	K2C80_HUMAN	keratin 80							cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(2)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.108)		CTGGGGGGCTGCCTCCTGGGT	0.617																																					GBM(178;2309 2916 15678 35873)											0			12											51.0	52.0	52.0					12																	52574466		692	1591	2283	50860733	SO:0001627	intron_variant	144501			BX537567	CCDS8821.2, CCDS41784.1	12q13.13	2013-01-16			ENSG00000167767	ENSG00000167767		"""-"", ""Intermediate filaments type II, keratins (basic)"""	27056	protein-coding gene	gene with protein product		611161				16831889	Standard	NM_001081492		Approved	KB20	uc001rzx.3	Q6KB66	OTTHUMG00000150193	ENST00000394815.2:c.571-74C>A	12.37:g.52574466G>T		Somatic		Capture	Illumina GAIIx	4	50860733	Q6P1A5|Q7Z3Q0	Missense_Mutation	SNP	HMMPfam_Filament	p.A201E	ENST00000394815.2	37	c.602	CCDS8821.2	12																																																																																			-	NULL		0.617	KRT80-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRT80	protein_coding	OTTHUMT00000316757.1	G	NM_182507		50860733	-1	no_errors	ENST00000301446	ensembl	human	known	54_36p	missense	SNP	0.000	T
STAB1	23166	genome.wustl.edu	37	3	52555462	52555462	+	Silent	SNP	T	T	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr3:52555462T>C	ENST00000321725.6	+	56	6070	c.5994T>C	c.(5992-5994)cgT>cgC	p.R1998R		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1998	Laminin EGF-like 2. {ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GTCTGTGCCGTTCAGGTTTTG	0.642																																																0			3											213.0	190.0	198.0					3																	52555462		2203	4300	6503	52530502	SO:0001819	synonymous_variant	23166			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5994T>C	3.37:g.52555462T>C		Somatic		Capture	Illumina GAIIx	4	52530502	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF_2,HMMSmart_SM00180,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_FAS1 domain,HMMSmart_SM00554,HMMPfam_Fasciclin,PatternScan_CYTOCHROME_P450,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_EGF_LAM_1,HMMPfam_Laminin_EGF,superfamily_Growth factor receptor domain,HMMSmart_SM00445,HMMPfam_Xlink,superfamily_C-type lectin-like,PatternScan_LINK_1	p.R1998	ENST00000321725.6	37	c.5994	CCDS33768.1	3																																																																																			-	superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMSmart_SM00180,HMMPfam_Laminin_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_LAM_1		0.642	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	protein_coding	OTTHUMT00000351380.2	T	NM_015136		52530502	+1	no_errors	NM_015136	genbank	human	reviewed	54_36p	silent	SNP	0.012	C
RFT1	91869	genome.wustl.edu	37	3	53126420	53126420	+	Missense_Mutation	SNP	A	A	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr3:53126420A>C	ENST00000296292.3	-	12	1484	c.1423T>G	c.(1423-1425)Ttt>Gtt	p.F475V	RFT1_ENST00000394738.3_Missense_Mutation_p.F436V|RP11-894J14.5_ENST00000607203.1_Intron	NM_052859.3	NP_443091.1	Q96AA3	RFT1_HUMAN	RFT1 homolog (S. cerevisiae)	475					carbohydrate transport (GO:0008643)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)	lipid transporter activity (GO:0005319)			NS(1)|breast(1)|kidney(1)|lung(5)|skin(2)|urinary_tract(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		CTGAGGGCAAATGTCCCGAGC	0.622																																																0			3											44.0	40.0	41.0					3																	53126420		2203	4300	6503	53101460	SO:0001583	missense	91869			AJ318099	CCDS2869.1	3p21.1	2014-02-06	2005-01-26		ENSG00000163933	ENSG00000163933			30220	protein-coding gene	gene with protein product	"""congenital disorder of glycosylation 1N"""	611908	"""RFT1, requiring fifty three 1 homolog (S. cerevisiae)"""			12477932	Standard	NM_052859		Approved	CDG1N	uc003dgj.3	Q96AA3	OTTHUMG00000074035	ENST00000296292.3:c.1423T>G	3.37:g.53126420A>C	ENSP00000296292:p.Phe475Val	Somatic		Capture	Illumina GAIIx	4	53101460	Q96J03	Missense_Mutation	SNP	HMMPfam_Rft-1	p.F475V	ENST00000296292.3	37	c.1423	CCDS2869.1	3	.	.	.	.	.	.	.	.	.	.	A	9.950	1.219844	0.22373	.	.	ENSG00000163933	ENST00000296292;ENST00000394738	D;D	0.84730	-1.89;-1.89	5.46	5.46	0.80206	.	0.231716	0.46758	D	0.000279	T	0.76586	0.4008	L	0.34521	1.04	0.09310	N	0.999999	B;B	0.24651	0.108;0.108	B;B	0.24269	0.052;0.052	T	0.65307	-0.6200	10	0.36615	T	0.2	.	9.1063	0.36701	0.9167:0.0:0.0833:0.0	.	436;475	B5MDE0;Q96AA3	.;RFT1_HUMAN	V	475;436	ENSP00000296292:F475V;ENSP00000378223:F436V	ENSP00000296292:F475V	F	-	1	0	RFT1	53101460	1.000000	0.71417	0.044000	0.18714	0.048000	0.14542	4.984000	0.63838	2.081000	0.62600	0.459000	0.35465	TTT	-	HMMPfam_Rft-1		0.622	RFT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFT1	protein_coding	OTTHUMT00000157136.2	A	NM_052859		53101460	-1	no_errors	NM_052859	genbank	human	reviewed	54_36p	missense	SNP	0.087	C
CCNO	10309	genome.wustl.edu	37	5	54529143	54529143	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr5:54529143C>A	ENST00000282572.4	-	1	365	c.209G>T	c.(208-210)gGc>gTc	p.G70V	RP11-506H20.1_ENST00000506435.1_RNA	NM_021147.3	NP_066970.3	P22674	CCNO_HUMAN	cyclin O	70					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cell cycle (GO:0007049)|cell division (GO:0051301)|cilium assembly (GO:0042384)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)|embryo development (GO:0009790)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	uracil DNA N-glycosylase activity (GO:0004844)			endometrium(1)|lung(3)|skin(1)	5		Lung NSC(810;4.08e-05)|Breast(144;0.0735)|Prostate(74;0.183)	LUSC - Lung squamous cell carcinoma(15;0.142)|Lung(15;0.161)			GCTCTCTGCGCCGTCTGAGCC	0.716																																																0			5											9.0	10.0	10.0					5																	54529143		2177	4268	6445	54564900	SO:0001583	missense	10309			M87499	CCDS34157.1	5q11.2	2010-11-15	2007-07-26	2007-07-26	ENSG00000152669	ENSG00000152669			18576	protein-coding gene	gene with protein product		607752	"""cyclin U"""	CCNU			Standard	NR_125346		Approved	UDG2, FLJ22422, UNG2	uc003jpw.3	P22674	OTTHUMG00000162598	ENST00000282572.4:c.209G>T	5.37:g.54529143C>A	ENSP00000282572:p.Gly70Val	Somatic		Capture	Illumina GAIIx	4	54564900	A8K1W5|Q0P6J2|Q9H6B0|Q9UMD5	Missense_Mutation	SNP	superfamily_Cyclin-like,HMMPfam_Cyclin_N,HMMSmart_SM00385,HMMPfam_Cyclin_C	p.G70V	ENST00000282572.4	37	c.209	CCDS34157.1	5	.	.	.	.	.	.	.	.	.	.	C	4.382	0.070552	0.08436	.	.	ENSG00000152669	ENST00000282572	T	0.18657	2.2	5.37	0.182	0.15077	.	1.208020	0.05981	N	0.644196	T	0.11922	0.0290	N	0.19112	0.55	0.18873	N	0.999986	B	0.15930	0.015	B	0.12837	0.008	T	0.33777	-0.9855	10	0.27785	T	0.31	.	2.7552	0.05291	0.261:0.2428:0.3829:0.1134	.	70	P22674	CCNO_HUMAN	V	70	ENSP00000282572:G70V	ENSP00000282572:G70V	G	-	2	0	CCNO	54564900	0.003000	0.15002	0.013000	0.15412	0.012000	0.07955	0.768000	0.26590	0.236000	0.21180	-1.083000	0.02208	GGC	-	NULL		0.716	CCNO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNO	protein_coding	OTTHUMT00000369707.1	C	NM_021147		54564900	-1	no_errors	NM_021147	genbank	human	validated	54_36p	missense	SNP	0.209	A
SYCP2	10388	genome.wustl.edu	37	20	58448961	58448961	+	Missense_Mutation	SNP	A	A	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr20:58448961A>T	ENST00000357552.3	-	35	3730	c.3505T>A	c.(3505-3507)Ttc>Atc	p.F1169I	SYCP2_ENST00000371001.2_Missense_Mutation_p.F1169I			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1169					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			GCACACAGGAAGTTTTTCTCA	0.338																																																0			20											169.0	145.0	153.0					20																	58448961		2203	4300	6503	57882356	SO:0001583	missense	10388			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3505T>A	20.37:g.58448961A>T	ENSP00000350162:p.Phe1169Ile	Somatic		Capture	Illumina GAIIx	4	57882356	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.F1169I	ENST00000357552.3	37	c.3505	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	A	10.06	1.247158	0.22796	.	.	ENSG00000196074	ENST00000371001;ENST00000357552	T;T	0.13196	2.61;2.61	4.92	-2.1	0.07210	.	2.285240	0.01657	N	0.024870	T	0.07593	0.0191	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24835	-1.0149	10	0.23302	T	0.38	0.0503	3.551	0.07845	0.3672:0.4242:0.079:0.1296	.	1169	Q9BX26	SYCP2_HUMAN	I	1169	ENSP00000360040:F1169I;ENSP00000350162:F1169I	ENSP00000350162:F1169I	F	-	1	0	SYCP2	57882356	0.000000	0.05858	0.000000	0.03702	0.365000	0.29674	-0.036000	0.12185	-0.480000	0.06803	-0.371000	0.07208	TTC	-	NULL		0.338	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	protein_coding	OTTHUMT00000079930.3	A	NM_014258		57882356	-1	no_errors	NM_014258	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
ZNF611	81856	genome.wustl.edu	37	19	53207775	53207775	+	3'UTR	SNP	A	A	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr19:53207775A>T	ENST00000319783.1	-	0	2849				ZNF611_ENST00000453741.2_3'UTR|ZNF611_ENST00000602162.1_3'UTR|ZNF611_ENST00000543227.1_3'UTR|ZNF611_ENST00000540744.1_3'UTR	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TGACATTTGTAAGGTTTCTCT	0.383																																																0			19																																								57899587	SO:0001624	3_prime_UTR_variant	0			AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.*415T>A	19.37:g.53207775A>T		Somatic		Capture	Illumina GAIIx	4	57899587	B3KRD5|Q69YG9	Silent	SNP	NULL	p.L45	ENST00000319783.1	37	c.135	CCDS12855.1	19																																																																																			-	NULL		0.383	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000175885	protein_coding	OTTHUMT00000337612.1	A	NM_030972		57899587	-1	no_errors	ENST00000354515	ensembl	human	known	54_36p	silent	SNP	0.142	T
Unknown	0	genome.wustl.edu	37	19	53819305	53819305	+	IGR	SNP	C	C	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr19:53819305C>A								FAM90A28P (7408 upstream) : ZNF845 (17696 downstream)																							GACAAGATCCCCTAAACTGAT	0.378																																																0			19																																								58511117	SO:0001628	intergenic_variant	0																															19.37:g.53819305C>A		Somatic		Capture	Illumina GAIIx	4	58511117		RNA	SNP	-	NULL		37	NULL		19																																																																																			-	-	0	0.378					LOC653753			C			58511117	+1	pseudogene	XR_039415	genbank	human	model	54_36p	rna	SNP	0.001	A
OGFR	11054	genome.wustl.edu	37	20	61444447	61444447	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr20:61444447G>A	ENST00000290291.6	+	7	1505	c.1480G>A	c.(1480-1482)Gga>Aga	p.G494R	OGFR_ENST00000370461.1_Missense_Mutation_p.G442R	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	494					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCCCAAGGCTGGACACAGTGA	0.682																																																0			20											21.0	24.0	23.0					20																	61444447		2162	4260	6422	60914892	SO:0001583	missense	11054			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1480G>A	20.37:g.61444447G>A	ENSP00000290291:p.Gly494Arg	Somatic		Capture	Illumina GAIIx	4	60914892	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	HMMPfam_OGFr_N,HMMPfam_OGFr_III	p.G494R	ENST00000290291.6	37	c.1480	CCDS13504.1	20	.	.	.	.	.	.	.	.	.	.	G	13.74	2.327027	0.41197	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.32753	1.9;1.44	4.17	-5.29	0.02747	.	4.527330	0.00789	N	0.001337	T	0.18551	0.0445	N	0.22421	0.69	0.09310	N	1	B;B;B	0.17852	0.012;0.024;0.024	B;B;B	0.14023	0.006;0.01;0.01	T	0.13098	-1.0522	10	0.20519	T	0.43	2.3131	7.1398	0.25550	0.3483:0.2063:0.4455:0.0	.	494;477;494	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	R	494;494;349;442	ENSP00000290291:G494R;ENSP00000359491:G442R	ENSP00000290291:G494R	G	+	1	0	OGFR	60914892	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.190000	0.09615	-0.984000	0.03507	-1.080000	0.02220	GGA	-	NULL		0.682	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	protein_coding	OTTHUMT00000080067.1	G			60914892	+1	no_errors	NM_007346	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
EHBP1	23301	genome.wustl.edu	37	2	63223825	63223825	+	Silent	SNP	A	A	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr2:63223825A>T	ENST00000263991.5	+	21	3722	c.3240A>T	c.(3238-3240)gcA>gcT	p.A1080A	EHBP1_ENST00000431489.1_Silent_p.A1009A|EHBP1_ENST00000496857.1_3'UTR|EHBP1_ENST00000405289.1_Silent_p.A1045A|EHBP1_ENST00000354487.3_Silent_p.A1045A|EHBP1_ENST00000405015.3_Silent_p.A1009A	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	1080						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AATTGGCAGCACTAGAGAATG	0.443																																																0			2											122.0	117.0	119.0					2																	63223825		2203	4300	6503	63077329	SO:0001819	synonymous_variant	23301			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.3240A>T	2.37:g.63223825A>T		Somatic		Capture	Illumina GAIIx	4	63077329	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Silent	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033	p.A1080	ENST00000263991.5	37	c.3240	CCDS1872.1	2																																																																																			-	NULL		0.443	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	protein_coding	OTTHUMT00000251616.1	A	NM_015252		63077329	+1	no_errors	NM_015252	genbank	human	validated	54_36p	silent	SNP	1.000	T
SPTB	6710	genome.wustl.edu	37	14	65235790	65235790	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr14:65235790T>C	ENST00000389721.5	-	28	6016	c.5984A>G	c.(5983-5985)aAt>aGt	p.N1995S	SPTB_ENST00000389722.3_Missense_Mutation_p.N1995S|SPTB_ENST00000556626.1_Missense_Mutation_p.N1995S|SPTB_ENST00000542895.1_Missense_Mutation_p.N1995S|SPTB_ENST00000389720.3_Missense_Mutation_p.N1995S	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1995					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CCACTTCTCATTCATCTCTTT	0.597																																																0			14											145.0	144.0	144.0					14																	65235790		2203	4300	6503	64305543	SO:0001583	missense	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5984A>G	14.37:g.65235790T>C	ENSP00000374371:p.Asn1995Ser	Somatic		Capture	Illumina GAIIx	4	64305543	Q15510|Q15519	Missense_Mutation	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,superfamily_Spectrin,HMMPfam_Spectrin,HMMSmart_SPEC,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.N1995S	ENST00000389721.5	37	c.5984	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	T	8.160	0.789403	0.16258	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84	5.51	1.51	0.23008	.	0.387965	0.30930	N	0.008587	T	0.30103	0.0754	N	0.22421	0.69	0.29810	N	0.831727	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.10450	0.005;0.002;0.0	T	0.17992	-1.0351	10	0.29301	T	0.29	.	10.0784	0.42375	0.662:0.0:0.0:0.3379	.	779;1995;1999	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	S	1999;1995;779;660;1995;1995;1995;1995	ENSP00000374372:N1995S;ENSP00000451324:N660S;ENSP00000451752:N1995S;ENSP00000374371:N1995S;ENSP00000443882:N1995S;ENSP00000374370:N1995S	ENSP00000334218:N779S	N	-	2	0	SPTB	64305543	0.996000	0.38824	0.530000	0.27963	0.970000	0.65996	3.976000	0.56867	0.363000	0.24346	0.454000	0.30748	AAT	-	HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC		0.597	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	protein_coding	OTTHUMT00000414080.1	T			64305543	-1	no_errors	NM_001024858	genbank	human	validated	54_36p	missense	SNP	0.990	C
CTSF	8722	genome.wustl.edu	37	11	66332382	66332382	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr11:66332382C>T	ENST00000310325.5	-	9	1250	c.1141G>A	c.(1141-1143)Gtg>Atg	p.V381M	ACTN3_ENST00000502692.1_RNA|ACTN3_ENST00000513398.1_RNA|CTSF_ENST00000533168.1_5'Flank	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F	381					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						CTCAGCTCCACGGAGTCATTG	0.607																																																0			11											147.0	137.0	140.0					11																	66332382		2200	4295	6495	66088958	SO:0001583	missense	8722			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090	ENST00000310325.5:c.1141G>A	11.37:g.66332382C>T	ENSP00000310832:p.Val381Met	Somatic		Capture	Illumina GAIIx	4	66088958	B2R964|O95240|Q9NSU4|Q9UKQ5	Missense_Mutation	SNP	PatternScan_THIOL_PROTEASE_ASN,HMMPfam_Inhibitor_I29,superfamily_SSF54001,HMMPfam_Peptidase_C1,HMMSmart_Pept_C1,PatternScan_THIOL_PROTEASE_CYS,PatternScan_THIOL_PROTEASE_HIS	p.V381M	ENST00000310325.5	37	c.1141	CCDS8144.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.979084|3.979084	0.74360|0.74360	.|.	.|.	ENSG00000174080|ENSG00000174080	ENST00000524994|ENST00000310325	.|T	.|0.24538	.|1.85	4.56|4.56	2.68|2.68	0.31781|0.31781	.|Peptidase C1A, papain C-terminal (2);	.|0.124411	.|0.53938	.|N	.|0.000056	T|T	0.35828|0.35828	0.0945|0.0945	M|M	0.75150|0.75150	2.29|2.29	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.65815	.|0.995	.|P	.|0.51135	.|0.66	T|T	0.14699|0.14699	-1.0463|-1.0463	5|10	.|0.52906	.|T	.|0.07	.|.	8.8176|8.8176	0.35004|0.35004	0.0:0.8135:0.0:0.1865|0.0:0.8135:0.0:0.1865	.|.	.|381	.|Q9UBX1	.|CATF_HUMAN	H|M	228|381	.|ENSP00000310832:V381M	.|ENSP00000310832:V381M	R|V	-|-	2|1	0|0	CTSF|CTSF	66088958|66088958	0.975000|0.975000	0.34042|0.34042	0.889000|0.889000	0.34880|0.34880	0.943000|0.943000	0.58893|0.58893	2.423000|2.423000	0.44705|0.44705	0.658000|0.658000	0.30925|0.30925	0.462000|0.462000	0.41574|0.41574	CGT|GTG	-	superfamily_SSF54001,HMMPfam_Peptidase_C1,HMMSmart_Pept_C1		0.607	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSF	protein_coding	OTTHUMT00000393047.1	C	NM_003793		66088958	-1	no_errors	NM_003793	genbank	human	reviewed	54_36p	missense	SNP	0.921	T
PDE7A	5150	genome.wustl.edu	37	8	66639197	66639197	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr8:66639197G>A	ENST00000401827.3	-	9	1276	c.833C>T	c.(832-834)aCc>aTc	p.T278I	PDE7A_ENST00000518667.1_5'UTR|PDE7A_ENST00000396642.3_Missense_Mutation_p.T278I|PDE7A_ENST00000379419.4_Missense_Mutation_p.T252I	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A	278	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	CAGTACTGAGGTATTCTACAA	0.373																																																0			8											118.0	118.0	118.0					8																	66639197		2203	4300	6503	66801751	SO:0001583	missense	5150			L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.833C>T	8.37:g.66639197G>A	ENSP00000385632:p.Thr278Ile	Somatic		Capture	Illumina GAIIx	4	66801751	A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Missense_Mutation	SNP	superfamily_SSF109604,HMMSmart_HDc,HMMPfam_PDEase_I,PatternScan_PDEASE_I	p.T252I	ENST00000401827.3	37	c.755	CCDS56538.1	8	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034543	0.54896	.	.	ENSG00000205268	ENST00000401827;ENST00000379419;ENST00000396642	T;T;T	0.81330	-1.48;-1.48;-1.48	5.53	4.65	0.58169	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.096899	0.64402	D	0.000001	T	0.74794	0.3763	N	0.20401	0.57	0.80722	D	1	B;B;P	0.43662	0.209;0.001;0.814	B;B;P	0.47626	0.209;0.017;0.552	T	0.76570	-0.2911	10	0.49607	T	0.09	.	13.8932	0.63753	0.0728:0.0:0.9272:0.0	.	278;278;252	Q13946-3;Q13946;Q13946-2	.;PDE7A_HUMAN;.	I	278;252;278	ENSP00000385632:T278I;ENSP00000368730:T252I;ENSP00000379881:T278I	ENSP00000368730:T252I	T	-	2	0	PDE7A	66801751	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.658000	0.74407	1.338000	0.45544	0.491000	0.48974	ACC	-	superfamily_SSF109604,HMMSmart_HDc,HMMPfam_PDEase_I		0.373	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7A	protein_coding	OTTHUMT00000378905.1	G			66801751	-1	no_errors	NM_002603	genbank	human	validated	54_36p	missense	SNP	1.000	A
MAP3K9	4293	genome.wustl.edu	37	14	71275547	71275547	+	Silent	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr14:71275547G>A	ENST00000554752.2	-	1	341	c.342C>T	c.(340-342)cgC>cgT	p.R114R	RP6-65G23.3_ENST00000557691.1_lincRNA|MAP3K9_ENST00000381250.4_Silent_p.R114R|MAP3K9_ENST00000555993.2_Silent_p.R114R	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	114	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		AGAAGGCGCTGCGCGGGGTCA	0.701																																					GBM(114;411 1587 13539 28235 50070)											0			14											12.0	13.0	13.0					14																	71275547		2131	4238	6369	70345300	SO:0001819	synonymous_variant	4293			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.342C>T	14.37:g.71275547G>A		Somatic		Capture	Illumina GAIIx	4	70345300	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Silent	SNP	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_Kinase_like,HMMSmart_TyrKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.R114	ENST00000554752.2	37	c.342		14																																																																																			-	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_Kinase_like		0.701	MAP3K9-001	KNOWN	basic	protein_coding	MAP3K9	protein_coding	OTTHUMT00000412550.2	G			70345300	-1	no_errors	NM_033141	genbank	human	validated	54_36p	silent	SNP	0.824	A
TRPM3	80036	genome.wustl.edu	37	9	73461470	73461470	+	Missense_Mutation	SNP	A	A	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:73461470A>G	ENST00000377111.2	-	4	743	c.500T>C	c.(499-501)cTc>cCc	p.L167P	TRPM3_ENST00000396283.1_Missense_Mutation_p.L14P|TRPM3_ENST00000377106.1_Missense_Mutation_p.L14P|TRPM3_ENST00000377110.3_Missense_Mutation_p.L167P|TRPM3_ENST00000357533.2_Missense_Mutation_p.L169P|TRPM3_ENST00000396285.1_Missense_Mutation_p.L14P|TRPM3_ENST00000423814.3_Missense_Mutation_p.L169P|TRPM3_ENST00000360823.2_Missense_Mutation_p.L14P|TRPM3_ENST00000358082.3_Missense_Mutation_p.L14P|TRPM3_ENST00000396292.4_Missense_Mutation_p.L14P|TRPM3_ENST00000396280.5_Missense_Mutation_p.L14P|TRPM3_ENST00000377105.1_Missense_Mutation_p.L14P|TRPM3_ENST00000377101.1_Missense_Mutation_p.L14P|TRPM3_ENST00000361823.5_Missense_Mutation_p.L14P|TRPM3_ENST00000408909.2_Missense_Mutation_p.L14P|TRPM3_ENST00000377097.3_Missense_Mutation_p.L14P	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	167					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CAGGTGTAAGAGGAGATCAGG	0.473																																																0			9											96.0	92.0	93.0					9																	73461470		2203	4300	6503	72651290	SO:0001583	missense	80036			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.500T>C	9.37:g.73461470A>G	ENSP00000366315:p.Leu167Pro	Somatic		Capture	Illumina GAIIx	4	72651290	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	HMMPfam_Ion_trans	p.L167P	ENST00000377111.2	37	c.500		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.4|24.4	4.530593|4.530593	0.85706|0.85706	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101;ENST00000396283;ENST00000361823;ENST00000455451|ENST00000377097	T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.06528|.	3.29;3.29;3.29;3.29;3.29;3.29;3.29;3.29;3.29;3.29;3.29;3.29;3.29;3.29|.	6.01|6.01	6.01|6.01	0.97437|0.97437	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84288|0.84288	0.5439|0.5439	M|M	0.89840|0.89840	3.065|3.065	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D;D;D|.	0.76494|.	0.987;0.999;0.996;0.984;0.989;0.999;0.986;0.992;0.999|.	P;D;D;D;D;D;P;D;D|.	0.87578|.	0.836;0.983;0.959;0.921;0.919;0.998;0.836;0.928;0.998|.	D|D	0.87191|0.87191	0.2234|0.2234	10|5	0.87932|.	D|.	0|.	-6.6854|-6.6854	16.5285|16.5285	0.84344|0.84344	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	167;169;14;167;167;167;169;14;14|.	Q9HCF6;Q4VXD2;Q504Y1;Q9HCF6-2;Q9HCF6-10;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1|.	TRPM3_HUMAN;.;.;.;.;.;.;.;.|.	P|P	167;167;14;14;14;169;14;14;14;14;169;14;14;14;14|57	ENSP00000366315:L167P;ENSP00000366314:L167P;ENSP00000366310:L14P;ENSP00000354066:L14P;ENSP00000366309:L14P;ENSP00000350140:L169P;ENSP00000386127:L14P;ENSP00000379581:L14P;ENSP00000379587:L14P;ENSP00000350791:L14P;ENSP00000389542:L169P;ENSP00000366305:L14P;ENSP00000379579:L14P;ENSP00000355395:L14P|.	ENSP00000350140:L169P|.	L|S	-|-	2|1	0|0	TRPM3|TRPM3	72651290|72651290	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.243000|9.243000	0.95416|0.95416	2.307000|2.307000	0.77673|0.77673	0.528000|0.528000	0.53228|0.53228	CTC|TCT	-	NULL		0.473	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	protein_coding	OTTHUMT00000214157.5	A	NM_206945		72651290	-1	no_errors	NM_001007471	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
C2CD3	26005	genome.wustl.edu	37	11	73796734	73796734	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr11:73796734G>C	ENST00000334126.7	-	21	4065	c.3839C>G	c.(3838-3840)gCc>gGc	p.A1280G	C2CD3_ENST00000313663.7_Missense_Mutation_p.A1280G			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1280	C2 1.				brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TAGGAAACAGGCCTCTCCACT	0.473																																																0			11											77.0	72.0	74.0					11																	73796734		2200	4293	6493	73474382	SO:0001583	missense	26005			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.3839C>G	11.37:g.73796734G>C	ENSP00000334379:p.Ala1280Gly	Somatic		Capture	Illumina GAIIx	4	73474382	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	HMMSmart_SM00239,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_C2	p.A1280G	ENST00000334126.7	37	c.3839		11	.	.	.	.	.	.	.	.	.	.	G	31	5.074333	0.94000	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	T;T;T	0.15718	2.79;2.81;2.4	5.95	5.95	0.96441	.	0.163088	0.53938	D	0.000042	T	0.25791	0.0628	L	0.43152	1.355	0.38405	D	0.945774	P	0.48503	0.911	P	0.47941	0.562	T	0.00458	-1.1727	10	0.49607	T	0.09	-8.5082	19.9647	0.97261	0.0:0.0:1.0:0.0	.	1280	Q4AC94-1	.	G	1280;1280;1280;88	ENSP00000334379:A1280G;ENSP00000323339:A1280G;ENSP00000388750:A88G	ENSP00000323339:A1280G	A	-	2	0	C2CD3	73474382	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.271000	0.78506	2.811000	0.96726	0.655000	0.94253	GCC	-	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239		0.473	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	protein_coding		G	NM_015531		73474382	-1	no_errors	NM_015531	genbank	human	validated	54_36p	missense	SNP	1.000	C
RNF213	57674	genome.wustl.edu	37	17	78237543	78237543	+	Silent	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr17:78237543C>T	ENST00000582970.1	+	2	206	c.63C>T	c.(61-63)tgC>tgT	p.C21C	RNF213_ENST00000456466.1_Silent_p.C21C|RNF213_ENST00000508628.2_Silent_p.C21C|RNF213_ENST00000319921.4_Silent_p.C21C	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	21					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCAGCCAGTGCGGAGAGAGGC	0.637																																																0			17											58.0	58.0	58.0					17																	78237543		2203	4300	6503	75852138	SO:0001819	synonymous_variant	57714			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.63C>T	17.37:g.78237543C>T		Somatic		Capture	Illumina GAIIx	4	75852138	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	NULL	p.C21	ENST00000582970.1	37	c.63	CCDS58606.1	17																																																																																			-	NULL		0.637	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1618	protein_coding	OTTHUMT00000443298.1	C	NM_020914		75852138	+1	no_errors	NM_020954	genbank	human	validated	54_36p	silent	SNP	0.027	T
ESRRB	2103	genome.wustl.edu	37	14	76905769	76905769	+	Missense_Mutation	SNP	T	T	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr14:76905769T>A	ENST00000509242.1	+	3	171	c.73T>A	c.(73-75)Tcg>Acg	p.S25T	ESRRB_ENST00000507951.1_3'UTR|ESRRB_ENST00000261532.7_Missense_Mutation_p.S25T|ESRRB_ENST00000556177.1_Missense_Mutation_p.S25T|ESRRB_ENST00000380887.2_Missense_Mutation_p.S25T	NM_004452.3	NP_004443.3	O95718	ERR2_HUMAN	estrogen-related receptor beta	25					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|trophectodermal cell proliferation (GO:0001834)|trophectodermal cellular morphogenesis (GO:0001831)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(234;0.0213)		CAGCCCGTCCTCGGGCATCGA	0.667																																																0			14											32.0	34.0	33.0					14																	76905769		2188	4285	6473	75975522	SO:0001583	missense	2103			X51417	CCDS9850.1, CCDS9850.2	14q24.3	2013-01-16				ENSG00000119715		"""Nuclear hormone receptors"""	3473	protein-coding gene	gene with protein product		602167	"""deafness, autosomal recessive 35"""	ESRL2, DFNB35		3267207, 9344655, 18179891	Standard	NM_004452		Approved	ERR2, ERRbeta, NR3B2, ERRb	uc001xsr.3	O95718		ENST00000509242.1:c.73T>A	14.37:g.76905769T>A	ENSP00000422488:p.Ser25Thr	Somatic		Capture	Illumina GAIIx	4	75975522	A2VDJ2|B6ZGU4|Q5F0P7|Q5F0P8|Q9HCB4	Missense_Mutation	SNP	superfamily_SSF57716,HMMSmart_ZnF_C4,HMMPfam_zf-C4,PatternScan_NUCLEAR_REC_DBD_1,superfamily_Str_ncl_receptor,HMMSmart_HOLI,HMMPfam_Hormone_recep	p.S25T	ENST00000509242.1	37	c.73	CCDS9850.2	14	.	.	.	.	.	.	.	.	.	.	T	27.3	4.817821	0.90790	.	.	ENSG00000119715	ENST00000512784;ENST00000509242;ENST00000556177;ENST00000380887;ENST00000261532	D;D;D;D;D	0.93133	-3.17;-3.17;-3.14;-3.17;-3.14	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	D	0.93976	0.8071	M	0.64997	1.995	0.80722	D	1	P;P	0.47910	0.902;0.902	P;P	0.50791	0.55;0.65	D	0.94263	0.7504	10	0.59425	D	0.04	.	14.5256	0.67887	0.0:0.0:0.0:1.0	.	25;30	Q5F0P7;E7EWD9	.;.	T	30;25;25;25;25	ENSP00000424992:S30T;ENSP00000422488:S25T;ENSP00000451658:S25T;ENSP00000370270:S25T;ENSP00000261532:S25T	ENSP00000261532:S25T	S	+	1	0	ESRRB	75975522	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.956000	0.87863	1.844000	0.53588	0.533000	0.62120	TCG	-	NULL		0.667	ESRRB-003	KNOWN	basic|CCDS	protein_coding	ESRRB	protein_coding	OTTHUMT00000360663.1	T			75975522	+1	no_errors	NM_004452	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ATMIN	23300	genome.wustl.edu	37	16	81077192	81077192	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr16:81077192G>T	ENST00000299575.4	+	4	1113	c.1089G>T	c.(1087-1089)aaG>aaT	p.K363N	ATMIN_ENST00000566488.1_Missense_Mutation_p.K207N|ATMIN_ENST00000564241.1_Missense_Mutation_p.K207N|ATMIN_ENST00000539819.1_3'UTR	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	363	Required for formation of RAD51 foci.				cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						GCTCTCTTAAGGAGAGCCTAC	0.463																																																0			16											47.0	47.0	47.0					16																	81077192		2202	4300	6502	79634693	SO:0001583	missense	23300			BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.1089G>T	16.37:g.81077192G>T	ENSP00000299575:p.Lys363Asn	Somatic		Capture	Illumina GAIIx	4	79634693	A8K4H8|Q68DC9	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.K363N	ENST00000299575.4	37	c.1089	CCDS32494.1	16	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359266	0.41801	.	.	ENSG00000166454	ENST00000299575;ENST00000539819	T	0.03094	4.05	6.17	1.79	0.24919	.	0.153579	0.56097	D	0.000022	T	0.04497	0.0123	M	0.77616	2.38	0.39751	D	0.971888	B	0.31680	0.335	B	0.26614	0.071	T	0.34700	-0.9818	10	0.87932	D	0	-17.5946	0.8615	0.01194	0.338:0.1543:0.3497:0.1581	.	363	O43313	ATMIN_HUMAN	N	363;134	ENSP00000299575:K363N	ENSP00000299575:K363N	K	+	3	2	ATMIN	79634693	1.000000	0.71417	0.995000	0.50966	0.236000	0.25371	1.302000	0.33459	0.875000	0.35847	0.655000	0.94253	AAG	-	NULL		0.463	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATMIN	protein_coding	OTTHUMT00000432140.1	G	NM_015251		79634693	+1	no_errors	NM_015251	genbank	human	validated	54_36p	missense	SNP	0.441	T
RPS6KA6	27330	genome.wustl.edu	37	X	83351223	83351223	+	Silent	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chrX:83351223G>A	ENST00000262752.2	-	20	1957	c.1950C>T	c.(1948-1950)gaC>gaT	p.D650D	RPS6KA6_ENST00000543399.1_Silent_p.D650D|RPS6KA6_ENST00000495332.1_5'UTR	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	650	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						CTGAAATATTGTCCCAGTTTC	0.373																																																0			X											79.0	65.0	70.0					X																	83351223		2203	4300	6503	83237879	SO:0001819	synonymous_variant	27330			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1950C>T	X.37:g.83351223G>A		Somatic		Capture	Illumina GAIIx	4	83237879	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_SERPIN,PatternScan_PROTEIN_KINASE_ST,HMMSmart_SM00133,HMMPfam_Pkinase_C	p.D650	ENST00000262752.2	37	c.1950	CCDS14451.1	X																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.373	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA6	protein_coding	OTTHUMT00000057372.1	G	NM_014496		83237879	-1	no_errors	NM_014496	genbank	human	provisional	54_36p	silent	SNP	0.990	A
GPRIN3	285513	genome.wustl.edu	37	4	90169018	90169018	+	Silent	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr4:90169018C>T	ENST00000609438.1	-	2	2762	c.2244G>A	c.(2242-2244)agG>agA	p.R748R	GPRIN3_ENST00000333209.4_Silent_p.R748R	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	748										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CACTGTGCTGCCTTCCTCTGA	0.463																																																0			4											111.0	113.0	112.0					4																	90169018		2203	4300	6503	90388041	SO:0001819	synonymous_variant	285513			AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.2244G>A	4.37:g.90169018C>T		Somatic		Capture	Illumina GAIIx	4	90388041	Q8IVE4	Silent	SNP	NULL	p.R748	ENST00000609438.1	37	c.2244	CCDS34030.1	4																																																																																			-	NULL		0.463	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN3	protein_coding	OTTHUMT00000363540.2	C	NM_198281		90388041	-1	no_errors	NM_198281	genbank	human	validated	54_36p	silent	SNP	1.000	T
CCDC132	55610	genome.wustl.edu	37	7	92905560	92905560	+	Silent	SNP	A	A	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr7:92905560A>G	ENST00000305866.5	+	12	1013	c.885A>G	c.(883-885)ctA>ctG	p.L295L	CCDC132_ENST00000251739.5_Silent_p.L295L|CCDC132_ENST00000544910.1_Silent_p.L265L|CCDC132_ENST00000541136.1_Silent_p.L106L|CCDC132_ENST00000317751.6_Silent_p.L26L|CCDC132_ENST00000535481.1_Intron	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	295						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			ATGTGGAACTATGTGCAGGAA	0.368																																																0			7											185.0	166.0	172.0					7																	92905560		2203	4300	6503	92743496	SO:0001819	synonymous_variant	55610			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.885A>G	7.37:g.92905560A>G		Somatic		Capture	Illumina GAIIx	4	92743496	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Silent	SNP	HMMPfam_DUF2450,HMMPfam_DUF2451	p.L295	ENST00000305866.5	37	c.885	CCDS43617.1	7	.	.	.	.	.	.	.	.	.	.	A	10.09	1.254067	0.22965	.	.	ENSG00000004766	ENST00000458707	.	.	.	5.59	-3.09	0.05331	.	.	.	.	.	T	0.40522	0.1120	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33752	-0.9856	4	.	.	.	-11.9007	3.4272	0.07414	0.1468:0.1412:0.4661:0.2459	.	.	.	.	C	82	.	.	Y	+	2	0	CCDC132	92743496	0.932000	0.31603	0.971000	0.41717	0.985000	0.73830	0.020000	0.13466	-0.342000	0.08363	-0.256000	0.11100	TAT	-	HMMPfam_DUF2450		0.368	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	protein_coding	OTTHUMT00000341687.1	A	NM_017667		92743496	+1	no_errors	NM_017667	genbank	human	validated	54_36p	silent	SNP	0.989	G
ABCA4	24	genome.wustl.edu	37	1	94564537	94564537	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:94564537C>A	ENST00000370225.3	-	6	667	c.581G>T	c.(580-582)gGa>gTa	p.G194V	ABCA4_ENST00000535735.1_Missense_Mutation_p.G194V	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	194					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GTCCGGGACTCCATGAGCGAA	0.582																																																0			1											29.0	28.0	29.0					1																	94564537		2203	4300	6503	94337125	SO:0001583	missense	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.581G>T	1.37:g.94564537C>A	ENSP00000359245:p.Gly194Val	Somatic		Capture	Illumina GAIIx	4	94337125	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.G194V	ENST00000370225.3	37	c.581	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	C	19.81	3.897469	0.72639	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.91407	-2.69;-2.84	5.83	5.83	0.93111	.	0.118903	0.56097	D	0.000022	D	0.88157	0.6361	M	0.64260	1.97	0.80722	D	1	P;D	0.54772	0.869;0.968	P;P	0.47981	0.563;0.495	D	0.85672	0.1295	10	0.17369	T	0.5	.	17.9044	0.88914	0.0:1.0:0.0:0.0	.	194;194	F5H6E5;P78363	.;ABCA4_HUMAN	V	194	ENSP00000359245:G194V;ENSP00000437682:G194V	ENSP00000359245:G194V	G	-	2	0	ABCA4	94337125	1.000000	0.71417	1.000000	0.80357	0.484000	0.33280	7.449000	0.80643	2.757000	0.94681	0.563000	0.77884	GGA	-	NULL		0.582	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	C	NM_000350		94337125	-1	no_errors	NM_000350	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	6	99228359	99228359	+	IGR	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr6:99228359C>T								RP3-453D15.1 (221912 upstream) : POU3F2 (54220 downstream)																							TTGAAGTAATCATCAGTAAGA	0.398																																																0			6																																								99335080	SO:0001628	intergenic_variant	0																															6.37:g.99228359C>T		Somatic		Capture	Illumina GAIIx	4	99335080		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.398					LOC100129158			C			99335080	-1	pseudogene	XR_038602	genbank	human	model	54_36p	rna	SNP	0.888	T
VPS13B	157680	genome.wustl.edu	37	8	100548922	100548922	+	Intron	SNP	G	G	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr8:100548922G>C	ENST00000358544.2	+	30	4931				VPS13B_ENST00000357162.2_Intron|MIR875_ENST00000401250.1_RNA|VPS13B_ENST00000395996.1_Intron|MIR599_ENST00000385069.1_RNA	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)						protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CCTGTCCCATGTCAGCTTATC	0.398																																					Colon(161;2205 2542 7338 31318)											0			8											110.0	96.0	101.0					8																	100548922		1568	3582	5150	100618098	SO:0001627	intron_variant	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4820+15684G>C	8.37:g.100548922G>C		Somatic		Capture	Illumina GAIIx	4	100618098	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	RNA	SNP	-	NULL	ENST00000358544.2	37	NULL	CCDS6280.1	8																																																																																			-	-		0.398	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MIRN599	protein_coding	OTTHUMT00000277138.1	G	NM_184042		100618098	-1	no_errors	ENST00000385069	ensembl	human	known	54_36p	rna	SNP	1.000	C
MTA1	9112	genome.wustl.edu	37	14	105929881	105929881	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr14:105929881C>G	ENST00000331320.7	+	12	1283	c.1069C>G	c.(1069-1071)Ccc>Gcc	p.P357A	MTA1_ENST00000435036.2_5'UTR|MTA1_ENST00000405646.1_Missense_Mutation_p.P340A|MTA1_ENST00000406191.1_Missense_Mutation_p.P357A	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	357					circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		AGTTTATATTCCCAACTAGTA	0.567																																																0			14											61.0	64.0	63.0					14																	105929881		2203	4300	6503	105000926	SO:0001583	missense	9112			U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.1069C>G	14.37:g.105929881C>G	ENSP00000333633:p.Pro357Ala	Somatic		Capture	Illumina GAIIx	4	105000926	A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Missense_Mutation	SNP	HMMPfam_BAH,HMMSmart_SM00439,HMMPfam_ELM2,HMMSmart_SM00717,HMMPfam_Myb_DNA-binding,superfamily_Homeodomain-like,HMMSmart_SM00401,superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMPfam_GATA	p.P357A	ENST00000331320.7	37	c.1069	CCDS32169.1	14	.	.	.	.	.	.	.	.	.	.	C	25.5	4.639951	0.87760	.	.	ENSG00000182979	ENST00000414153;ENST00000331320;ENST00000406191;ENST00000405646;ENST00000434050	T;T;T;T	0.36878	1.25;1.23;1.23;1.24	4.11	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.59115	0.2170	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.87578	0.998;0.945	T	0.65471	-0.6160	10	0.87932	D	0	-25.2015	15.2768	0.73748	0.0:1.0:0.0:0.0	.	149;357	Q59FW1;Q13330	.;MTA1_HUMAN	A	266;357;357;340;149	ENSP00000333633:P357A;ENSP00000385702:P357A;ENSP00000384180:P340A;ENSP00000394106:P149A	ENSP00000333633:P357A	P	+	1	0	MTA1	105000926	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.689000	0.84165	2.005000	0.58758	0.563000	0.77884	CCC	-	NULL		0.567	MTA1-001	KNOWN	basic|CCDS	protein_coding	MTA1	protein_coding	OTTHUMT00000317849.15	C			105000926	+1	no_errors	NM_004689	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CALHM2	51063	genome.wustl.edu	37	10	105209181	105209181	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr10:105209181C>T	ENST00000260743.5	-	3	1041	c.518G>A	c.(517-519)cGg>cAg	p.R173Q	CALHM2_ENST00000494180.1_5'Flank|RP11-225H22.7_ENST00000608063.1_RNA|CALHM2_ENST00000369788.3_Missense_Mutation_p.R173Q|CALHM2_ENST00000393235.1_Missense_Mutation_p.R173Q	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	173					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						GACCTCCTCCCGGAAGTCTGA	0.602																																																0			10											63.0	65.0	64.0					10																	105209181		2202	4298	6500	105199171	SO:0001583	missense	51063			BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.518G>A	10.37:g.105209181C>T	ENSP00000260743:p.Arg173Gln	Somatic		Capture	Illumina GAIIx	4	105199171	D3DR94|O95893|Q6ZUV9	Missense_Mutation	SNP	NULL	p.R173Q	ENST00000260743.5	37	c.518	CCDS7549.1	10	.	.	.	.	.	.	.	.	.	.	C	14.69	2.610934	0.46631	.	.	ENSG00000138172	ENST00000369788;ENST00000260743;ENST00000393235	T;T;T	0.18657	2.2;2.2;2.2	5.45	2.22	0.28083	.	0.419984	0.23239	N	0.050361	T	0.13927	0.0337	L	0.35542	1.07	0.27414	N	0.954472	B;B;B	0.28605	0.043;0.014;0.217	B;B;B	0.24848	0.008;0.002;0.056	T	0.13308	-1.0514	10	0.45353	T	0.12	-35.5257	7.6922	0.28575	0.0:0.5628:0.0:0.4372	.	173;173;173	Q9HA72-2;Q9HA72-3;Q9HA72	.;.;CAHM2_HUMAN	Q	173	ENSP00000358803:R173Q;ENSP00000260743:R173Q;ENSP00000376927:R173Q	ENSP00000260743:R173Q	R	-	2	0	CALHM2	105199171	0.974000	0.33945	1.000000	0.80357	0.887000	0.51463	0.723000	0.25939	0.689000	0.31550	-0.215000	0.12644	CGG	-	NULL		0.602	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM2	protein_coding	OTTHUMT00000050159.1	C	NM_015916		105199171	-1	no_errors	NM_015916	genbank	human	validated	54_36p	missense	SNP	0.912	T
COL4A6	1288	genome.wustl.edu	37	X	107403874	107403874	+	Silent	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chrX:107403874C>T	ENST00000372216.4	-	43	4447	c.4347G>A	c.(4345-4347)ggG>ggA	p.G1449G	COL4A6_ENST00000334504.7_Silent_p.G1448G|COL4A6_ENST00000538570.1_Silent_p.G1391G|COL4A6_ENST00000394872.2_Silent_p.G1449G|COL4A6_ENST00000418180.1_5'Flank|COL4A6_ENST00000545689.1_Silent_p.G1424G	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1449	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GGCCTTGCTGCCCTGGAGCTC	0.547									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											0			X											64.0	58.0	60.0					X																	107403874		2203	4300	6503	107290530	SO:0001819	synonymous_variant	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.4347G>A	X.37:g.107403874C>T		Somatic		Capture	Illumina GAIIx	4	107290530	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	HMMPfam_Collagen,HMMPfam_C4,HMMSmart_SM00111,superfamily_C-type lectin-like	p.G1449	ENST00000372216.4	37	c.4347	CCDS14541.1	X																																																																																			-	NULL		0.547	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	protein_coding	OTTHUMT00000057875.2	C			107290530	-1	no_errors	NM_001847	genbank	human	reviewed	54_36p	silent	SNP	0.549	T
FRRS1L	23732	genome.wustl.edu	37	9	111899877	111899877	+	Missense_Mutation	SNP	G	G	A	rs199731037		TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:111899877G>A	ENST00000561981.2	-	5	892	c.893C>T	c.(892-894)cCg>cTg	p.P298L		NM_014334.2	NP_055149.2	Q9P0K9	FRS1L_HUMAN	ferric-chelate reductase 1-like	298						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)											TGAAGCCGGCGGTGAGTCTAT	0.388																																																0			9						G	LEU/PRO	0,4406		0,0,2203	117.0	122.0	120.0		893	5.7	1.0	9		120	3,8597	3.0+/-9.4	0,3,4297	no	missense	C9orf4	NM_014334.2	98	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging	298/345	111899877	3,13003	2203	4300	6503	110939698	SO:0001583	missense	23732			AF155065	CCDS35098.1	9q31.3	2014-07-16	2012-03-06	2012-03-06	ENSG00000260230	ENSG00000260230			1362	protein-coding gene	gene with protein product		604574	"""chromosome 9 open reading frame 4"""	C9orf4		10603000	Standard	NM_014334		Approved	CG-6	uc004bdw.1	Q9P0K9	OTTHUMG00000020468	ENST00000561981.2:c.893C>T	9.37:g.111899877G>A	ENSP00000477141:p.Pro298Leu	Somatic		Capture	Illumina GAIIx	4	110939698	Q5T4G4	Missense_Mutation	SNP	HMMSmart_DoH,HMMPfam_DOMON	p.P298L	ENST00000561981.2	37	c.893	CCDS35098.1	9	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550107	0.86127	0.0	3.49E-4	ENSG00000136805	ENST00000374581	.	.	.	5.65	5.65	0.86999	DOMON domain (1);	0.000000	0.85682	D	0.000000	T	0.58793	0.2147	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.58482	-0.7629	9	0.18276	T	0.48	-4.0204	19.7357	0.96202	0.0:0.0:1.0:0.0	.	298	Q9P0K9	CI004_HUMAN	L	298	.	ENSP00000363709:P298L	P	-	2	0	C9orf4	110939698	1.000000	0.71417	0.977000	0.42913	0.913000	0.54294	9.476000	0.97823	2.662000	0.90505	0.563000	0.77884	CCG	-	HMMSmart_DoH		0.388	FRRS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf4	protein_coding	OTTHUMT00000053586.2	G	NM_014334		110939698	-1	no_errors	NM_014334	genbank	human	validated	54_36p	missense	SNP	1.000	A
QTRTD1	79691	genome.wustl.edu	37	3	113789576	113789576	+	Missense_Mutation	SNP	A	A	G	rs556393060	byFrequency	TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr3:113789576A>G	ENST00000493014.1	+	2	187	c.119A>G	c.(118-120)gAt>gGt	p.D40G	QTRTD1_ENST00000485050.1_Missense_Mutation_p.D158G|QTRTD1_ENST00000281273.4_Missense_Mutation_p.D146G|QTRTD1_ENST00000466050.1_3'UTR|QTRTD1_ENST00000479882.1_Missense_Mutation_p.D23G	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						TGCCTCTCCGATGGAGAAGTA	0.478													A|||	2	0.000399361	0.0	0.0	5008	,	,		16340	0.0		0.0	False		,,,				2504	0.002															0			3											106.0	96.0	100.0					3																	113789576		2203	4300	6503	115272266	SO:0001583	missense	79691			AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.119A>G	3.37:g.113789576A>G	ENSP00000419169:p.Asp40Gly	Somatic		Capture	Illumina GAIIx	4	115272266		Missense_Mutation	SNP	superfamily_tRNA_ribo_trans,HMMPfam_TGT	p.D146G	ENST00000493014.1	37	c.437	CCDS58845.1	3	.	.	.	.	.	.	.	.	.	.	A	21.5	4.157518	0.78114	.	.	ENSG00000151576	ENST00000472599;ENST00000485050;ENST00000281273;ENST00000479882;ENST00000493014	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	D	0.86138	0.5861	M	0.92459	3.31	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.89457	0.3734	9	0.87932	D	0	-15.2072	16.2987	0.82793	1.0:0.0:0.0:0.0	.	40;23;160;146	B7Z472;B7Z5R2;C9JJ71;Q9H974	.;.;.;QTRD1_HUMAN	G	160;158;146;23;40	.	ENSP00000281273:D146G	D	+	2	0	QTRTD1	115272266	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	8.962000	0.93254	2.257000	0.74773	0.459000	0.35465	GAT	-	superfamily_tRNA_ribo_trans,HMMPfam_TGT		0.478	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	QTRTD1	protein_coding	OTTHUMT00000354711.1	A	NM_024638		115272266	+1	no_errors	NM_024638	genbank	human	provisional	54_36p	missense	SNP	1.000	G
DPP10	57628	genome.wustl.edu	37	2	116593799	116593799	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr2:116593799G>A	ENST00000410059.1	+	22	2497	c.2017G>A	c.(2017-2019)Gtg>Atg	p.V673M	DPP10_ENST00000310323.8_Missense_Mutation_p.V666M|DPP10_ENST00000409163.1_Missense_Mutation_p.V623M|DPP10_ENST00000393147.2_Missense_Mutation_p.V677M	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	673						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						ATGTGGATCCGTGGTTGCACC	0.333																																																0			2											85.0	83.0	84.0					2																	116593799		2203	4300	6503	116310269	SO:0001583	missense	57628			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.2017G>A	2.37:g.116593799G>A	ENSP00000386565:p.Val673Met	Somatic		Capture	Illumina GAIIx	4	116310269	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	superfamily_Dipeptidyl peptidase IV/CD26 N-terminal domain,HMMPfam_DPPIV_N,superfamily_alpha/beta-Hydrolases,HMMPfam_Peptidase_S9	p.V673M	ENST00000410059.1	37	c.2017	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759010	0.69763	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.67	4.79	0.61399	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.217359	0.39985	N	0.001209	T	0.31358	0.0794	N	0.16368	0.405	0.33747	D	0.620108	D;D;D;D	0.63046	0.978;0.988;0.992;0.983	P;P;P;P	0.58660	0.757;0.742;0.843;0.843	T	0.48614	-0.9020	10	0.87932	D	0	-20.6983	8.5213	0.33277	0.0764:0.0:0.7713:0.1522	.	666;677;669;673	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	M	673;623;677;666	ENSP00000386565:V673M;ENSP00000387038:V623M;ENSP00000376855:V677M;ENSP00000309066:V666M	ENSP00000309066:V666M	V	+	1	0	DPP10	116310269	0.997000	0.39634	0.994000	0.49952	0.958000	0.62258	3.045000	0.49838	1.381000	0.46364	0.655000	0.94253	GTG	-	superfamily_alpha/beta-Hydrolases,HMMPfam_Peptidase_S9		0.333	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	protein_coding	OTTHUMT00000330580.4	G	NM_020868		116310269	+1	no_errors	NM_020868	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PAPPA	5069	genome.wustl.edu	37	9	118973935	118973935	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:118973935C>G	ENST00000328252.3	+	4	2011	c.1642C>G	c.(1642-1644)Cca>Gca	p.P548A	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	548	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TGTCTTGAACCCATCTTTCTA	0.502																																																0			9											125.0	111.0	115.0					9																	118973935		2203	4300	6503	118013756	SO:0001583	missense	5069				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1642C>G	9.37:g.118973935C>G	ENSP00000330658:p.Pro548Ala	Somatic		Capture	Illumina GAIIx	4	118013756	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	superfamily_ConA_like_lec_gl,HMMSmart_LamGL,superfamily_SSF55486,HMMPfam_Notch,HMMSmart_NL,PatternScan_ZINC_PROTEASE,HMMPfam_Peptidase_M43,superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP	p.P548A	ENST00000328252.3	37	c.1642	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932062	0.73442	.	.	ENSG00000182752	ENST00000328252	T	0.01981	4.52	5.64	5.64	0.86602	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.09247	0.0228	L	0.38953	1.18	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04825	-1.0924	10	0.87932	D	0	-9.2841	20.0666	0.97706	0.0:1.0:0.0:0.0	.	548	Q13219	PAPP1_HUMAN	A	548	ENSP00000330658:P548A	ENSP00000330658:P548A	P	+	1	0	PAPPA	118013756	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.744000	0.85034	2.826000	0.97356	0.561000	0.74099	CCA	-	superfamily_SSF55486		0.502	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	protein_coding	OTTHUMT00000055546.1	C	NM_002581		118013756	+1	no_errors	NM_002581	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
P2RX7	5027	genome.wustl.edu	37	12	121622368	121622368	+	Silent	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr12:121622368C>G	ENST00000546057.1	+	13	1694	c.1551C>G	c.(1549-1551)gtC>gtG	p.V517V	RP11-340F14.5_ENST00000569999.1_RNA|P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000541446.1_Silent_p.V228V|P2RX7_ENST00000535250.1_Silent_p.V427V|P2RX7_ENST00000328963.5_Silent_p.V347V	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	517					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGAAGCTGGTCCTGTCCAGAC	0.617																																																0			12											37.0	34.0	35.0					12																	121622368		2203	4300	6503	120106751	SO:0001819	synonymous_variant	5027			Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.1551C>G	12.37:g.121622368C>G		Somatic		Capture	Illumina GAIIx	4	120106751	A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Silent	SNP	HMMPfam_P2X_receptor,PatternScan_P2X_RECEPTOR	p.V517	ENST00000546057.1	37	c.1551	CCDS9213.1	12																																																																																			-	NULL		0.617	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX7	protein_coding	OTTHUMT00000402532.1	C	NM_002562		120106751	+1	no_errors	NM_002562	genbank	human	reviewed	54_36p	silent	SNP	0.950	G
INPP5F	22876	genome.wustl.edu	37	10	121567542	121567542	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr10:121567542C>G	ENST00000361976.2	+	13	1705	c.1539C>G	c.(1537-1539)agC>agG	p.S513R		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	5-phosphatase.		Y -> C (in OCRL; dbSNP:rs137853847). {ECO:0000269|PubMed:9682219}.		cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		ACTCCATTAGCAGACAGTATG	0.443																																																0			10											110.0	97.0	101.0					10																	121567542		2203	4300	6503	121557532	SO:0001583	missense	22876			AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1539C>G	10.37:g.121567542C>G	ENSP00000354519:p.Ser513Arg	Somatic		Capture	Illumina GAIIx	4	121557532	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	HMMPfam_Syja_N	p.S513R	ENST00000361976.2	37	c.1539	CCDS7616.1	10	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855323	0.71719	.	.	ENSG00000198825	ENST00000361976	T	0.24908	1.83	5.56	1.52	0.23074	Synaptojanin, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64011	0.2560	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.71151	-0.4676	10	0.87932	D	0	-19.0375	9.5361	0.39224	0.0:0.7126:0.0:0.2874	.	513	Q9Y2H2	SAC2_HUMAN	R	513	ENSP00000354519:S513R	ENSP00000354519:S513R	S	+	3	2	INPP5F	121557532	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.675000	0.37555	0.362000	0.24319	0.591000	0.81541	AGC	-	NULL		0.443	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5F	protein_coding	OTTHUMT00000050679.1	C	NM_014937		121557532	+1	no_errors	NM_014937	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
GSN	2934	genome.wustl.edu	37	9	124079409	124079409	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:124079409G>A	ENST00000373818.4	+	7	1021	c.952G>A	c.(952-954)Gag>Aag	p.E318K	GSN_ENST00000341272.2_Missense_Mutation_p.E267K|GSN_ENST00000485767.1_3'UTR|GSN_ENST00000394353.2_Missense_Mutation_p.E278K|GSN_ENST00000373823.3_Missense_Mutation_p.E267K|GSN_ENST00000545652.1_Missense_Mutation_p.E275K|GSN_ENST00000436847.1_Missense_Mutation_p.E278K|GSN_ENST00000373807.1_Missense_Mutation_p.E49K|GSN_ENST00000373808.2_Missense_Mutation_p.E267K|GSN_ENST00000449733.1_Missense_Mutation_p.E267K|GSN_ENST00000412819.1_Missense_Mutation_p.E267K	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	318					actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						CGTGGCTGATGAGAACCCCTT	0.587																																																0			9											143.0	132.0	136.0					9																	124079409		2203	4300	6503	123119230	SO:0001583	missense	2934			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.952G>A	9.37:g.124079409G>A	ENSP00000362924:p.Glu318Lys	Somatic		Capture	Illumina GAIIx	4	123119230	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Missense_Mutation	SNP	superfamily_Actin depolymerizing proteins,HMMSmart_SM00262,HMMPfam_Gelsolin	p.E318K	ENST00000373818.4	37	c.952	CCDS6828.1	9	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039958	0.55003	.	.	ENSG00000148180	ENST00000373823;ENST00000436847;ENST00000394353;ENST00000449733;ENST00000412819;ENST00000341272;ENST00000373808;ENST00000394352;ENST00000456109;ENST00000545652;ENST00000373818;ENST00000373807	T;T;T;T;T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51;0.51	5.42	4.53	0.55603	Gelsolin domain (1);	0.097462	0.64402	D	0.000001	T	0.40119	0.1104	N	0.22421	0.69	0.53005	D	0.999962	B;B;B;B;P	0.34826	0.053;0.043;0.031;0.065;0.471	B;B;B;B;B	0.40134	0.034;0.02;0.041;0.102;0.32	T	0.21759	-1.0236	10	0.29301	T	0.29	-34.5812	9.1798	0.37134	0.0771:0.1454:0.7775:0.0	.	291;275;278;49;318	B7Z9A0;F5H1A8;B7Z373;Q5T0H9;P06396	.;.;.;.;GELS_HUMAN	K	267;278;278;267;267;267;267;251;241;275;318;49	ENSP00000362929:E267K;ENSP00000411293:E278K;ENSP00000377882:E278K;ENSP00000409358:E267K;ENSP00000416586:E267K;ENSP00000340888:E267K;ENSP00000362914:E267K;ENSP00000445823:E275K;ENSP00000362924:E318K;ENSP00000362913:E49K	ENSP00000340888:E267K	E	+	1	0	GSN	123119230	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.346000	0.79347	1.294000	0.44707	0.561000	0.74099	GAG	-	superfamily_Actin depolymerizing proteins,HMMSmart_SM00262,HMMPfam_Gelsolin		0.587	GSN-001	KNOWN	basic|CCDS	protein_coding	GSN	protein_coding	OTTHUMT00000053861.1	G	NM_000177		123119230	+1	no_errors	NM_000177	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
C10orf90	118611	genome.wustl.edu	37	10	128147616	128147616	+	Silent	SNP	A	A	C			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr10:128147616A>C	ENST00000284694.7	-	6	2010	c.1890T>G	c.(1888-1890)ccT>ccG	p.P630P	C10orf90_ENST00000454341.1_Silent_p.P533P|C10orf90_ENST00000480379.1_Silent_p.P34P|C10orf90_ENST00000544758.1_Silent_p.P727P|C10orf90_ENST00000356858.3_Silent_p.P583P	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	630	ALMS motif. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		TACCACTCAGAGGATGGGGAA	0.587																																																0			10											122.0	94.0	104.0					10																	128147616		2203	4300	6503	128137606	SO:0001819	synonymous_variant	118611			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1890T>G	10.37:g.128147616A>C		Somatic		Capture	Illumina GAIIx	4	128137606	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Silent	SNP	NULL	p.P630	ENST00000284694.7	37	c.1890	CCDS31310.1	10	.	.	.	.	.	.	.	.	.	.	A	0.742	-0.775857	0.02951	.	.	ENSG00000154493	ENST00000424927	.	.	.	5.01	-10.0	0.00425	.	.	.	.	.	T	0.31231	0.0790	.	.	.	0.48762	D	0.999706	.	.	.	.	.	.	T	0.38735	-0.9647	4	.	.	.	-19.3055	0.9718	0.01417	0.1579:0.2788:0.1968:0.3665	.	.	.	.	R	173	.	.	L	-	2	0	C10orf90	128137606	0.232000	0.23762	0.018000	0.16275	0.166000	0.22503	-0.683000	0.05179	-2.114000	0.00832	-0.301000	0.09380	CTC	-	NULL		0.587	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf90	protein_coding		A	NM_001004298		128137606	-1	no_errors	NM_001004298	genbank	human	validated	54_36p	silent	SNP	0.998	C
STXBP1	6812	genome.wustl.edu	37	9	130423445	130423445	+	Silent	SNP	G	G	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:130423445G>T	ENST00000373299.1	+	6	505	c.390G>T	c.(388-390)ctG>ctT	p.L130L	STXBP1_ENST00000373302.3_Silent_p.L130L	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	130					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						TCAAAACTCTGACGGAAATCA	0.468																																																0			9											119.0	112.0	114.0					9																	130423445		2203	4300	6503	129463266	SO:0001819	synonymous_variant	6812			AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.390G>T	9.37:g.130423445G>T		Somatic		Capture	Illumina GAIIx	4	129463266	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Silent	SNP	superfamily_Sec1/munc18-like (SM) proteins,HMMPfam_Sec1	p.L130	ENST00000373299.1	37	c.390	CCDS35146.1	9																																																																																			-	superfamily_Sec1/munc18-like (SM) proteins,HMMPfam_Sec1		0.468	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP1	protein_coding	OTTHUMT00000054229.1	G	NM_003165		129463266	+1	no_errors	NM_003165	genbank	human	provisional	54_36p	silent	SNP	1.000	T
NUP205	23165	genome.wustl.edu	37	7	135287641	135287641	+	Silent	SNP	A	A	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr7:135287641A>G	ENST00000285968.6	+	18	2627	c.2601A>G	c.(2599-2601)ctA>ctG	p.L867L		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	867					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TGGACCTTCTAAGAGAGAGTC	0.398																																																0			7											87.0	92.0	90.0					7																	135287641		2203	4300	6503	134938181	SO:0001819	synonymous_variant	23165			D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.2601A>G	7.37:g.135287641A>G		Somatic		Capture	Illumina GAIIx	4	134938181	A6H8X3|Q86YC1	Silent	SNP	NULL	p.L867	ENST00000285968.6	37	c.2601	CCDS34759.1	7																																																																																			-	NULL		0.398	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP205	protein_coding	OTTHUMT00000340358.1	A			134938181	+1	no_errors	NM_015135	genbank	human	validated	54_36p	silent	SNP	0.994	G
MAP3K5	4217	genome.wustl.edu	37	6	136934308	136934308	+	Nonsense_Mutation	SNP	C	C	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr6:136934308C>A	ENST00000359015.4	-	17	2725	c.2365G>T	c.(2365-2367)Gaa>Taa	p.E789*	MAP3K5_ENST00000355845.4_Nonsense_Mutation_p.E36*	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	789	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TTTAATCCTTCCAGTATTTGC	0.388																																																0			6											152.0	141.0	145.0					6																	136934308		2203	4300	6503	136976001	SO:0001587	stop_gained	4217			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.2365G>T	6.37:g.136934308C>A	ENSP00000351908:p.Glu789*	Somatic		Capture	Illumina GAIIx	4	136976001	A6NIA0|B4DGB2|Q5THN3|Q99461	Nonsense_Mutation	SNP	HMMSmart_S_TKc,HMMPfam_Pkinase,superfamily_Kinase_like,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,superfamily_SAM_homology	p.E789*	ENST00000359015.4	37	c.2365	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	C	43	10.166850	0.99351	.	.	ENSG00000197442	ENST00000359015;ENST00000355845;ENST00000367768	.	.	.	5.67	5.67	0.87782	.	0.141019	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	19.7547	0.96285	0.0:1.0:0.0:0.0	.	.	.	.	X	789;36;869	.	ENSP00000348104:E36X	E	-	1	0	MAP3K5	136976001	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.487000	0.81328	2.667000	0.90743	0.655000	0.94253	GAA	-	HMMSmart_S_TKc,HMMPfam_Pkinase,superfamily_Kinase_like		0.388	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	protein_coding	OTTHUMT00000042383.1	C			136976001	-1	no_errors	NM_005923	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
OLFM1	10439	genome.wustl.edu	37	9	137987847	137987847	+	Silent	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr9:137987847C>T	ENST00000371793.3	+	3	689	c.438C>T	c.(436-438)caC>caT	p.H146H	OLFM1_ENST00000371796.3_Silent_p.H119H|OLFM1_ENST00000252854.4_Silent_p.H128H|OLFM1_ENST00000277415.11_Silent_p.H128H|OLFM1_ENST00000392991.4_Silent_p.H146H	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	146					negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		ATAAGCAACACCTGGCCAGGC	0.552																																																0			9											270.0	193.0	219.0					9																	137987847		2202	4300	6502	137127668	SO:0001819	synonymous_variant	10439			AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.438C>T	9.37:g.137987847C>T		Somatic		Capture	Illumina GAIIx	4	137127668	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Silent	SNP	NULL	p.H128	ENST00000371793.3	37	c.384		9	.	.	.	.	.	.	.	.	.	.	c	8.126	0.782033	0.16189	.	.	ENSG00000130558	ENST00000545657	.	.	.	4.8	2.51	0.30379	.	.	.	.	.	T	0.59649	0.2209	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56300	-0.8002	4	.	.	.	.	10.3449	0.43901	0.0:0.7434:0.0:0.2566	.	.	.	.	S	6	.	.	P	+	1	0	OLFM1	137127668	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.583000	0.36579	1.016000	0.39470	0.627000	0.83407	CCT	-	NULL		0.552	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	OLFM1	protein_coding	OTTHUMT00000054974.1	C	NM_014279		137127668	+1	no_errors	NM_006334	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
PCDHB8	56128	genome.wustl.edu	37	5	140558832	140558832	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr5:140558832C>G	ENST00000239444.2	+	1	1462	c.1217C>G	c.(1216-1218)aCa>aGa	p.T406R	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	406	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCCTACTAACAGAGACACCA	0.468																																																0			5											115.0	150.0	138.0					5																	140558832		2203	4300	6503	140539016	SO:0001583	missense	56128			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1217C>G	5.37:g.140558832C>G	ENSP00000239444:p.Thr406Arg	Somatic		Capture	Illumina GAIIx	4	140539016	B9EGV1	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.T406R	ENST00000239444.2	37	c.1217	CCDS4250.1	5	.	.	.	.	.	.	.	.	.	.	C	9.542	1.113645	0.20795	.	.	ENSG00000120322	ENST00000239444	T	0.01787	4.64	4.25	4.25	0.50352	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.16896	0.0406	H	0.97962	4.115	0.09310	N	0.999995	D	0.59767	0.986	D	0.64877	0.93	T	0.23797	-1.0178	9	0.87932	D	0	.	11.0168	0.47693	0.0:0.9069:0.0:0.0931	.	406	Q9UN66	PCDB8_HUMAN	R	406	ENSP00000239444:T406R	ENSP00000239444:T406R	T	+	2	0	PCDHB8	140539016	0.017000	0.18338	0.002000	0.10522	0.001000	0.01503	1.643000	0.37217	1.911000	0.55334	0.585000	0.79938	ACA	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.468	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	protein_coding	OTTHUMT00000251816.2	C	NM_019120		140539016	+1	no_errors	NM_019120	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
RORC	6097	genome.wustl.edu	37	1	151789281	151789281	+	Splice_Site	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:151789281C>T	ENST00000318247.6	-	4	264	c.157G>A	c.(157-159)Ggc>Agc	p.G53S	RORC_ENST00000392697.3_Splice_Site_p.G107S|RORC_ENST00000480719.1_5'Flank|RORC_ENST00000356728.6_Splice_Site_p.G32S	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	53					adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CGGAAGAAGCCCTGGGGAAAG	0.622																																																0			1											28.0	23.0	25.0					1																	151789281		2200	4300	6500	150055905	SO:0001630	splice_region_variant	6097			U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.157-1G>A	1.37:g.151789281C>T		Somatic		Capture	Illumina GAIIx	4	150055905	Q5SZR9|Q8N5V7|Q8NCY8	Missense_Mutation	SNP	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.G53S	ENST00000318247.6	37	c.157	CCDS1004.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.500106	0.96355	.	.	ENSG00000143365	ENST00000356728;ENST00000392697;ENST00000318247	D;D;D	0.97529	-4.42;-4.42;-4.42	5.24	5.24	0.73138	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.64402	U	0.000004	D	0.98175	0.9397	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.99429	1.0935	10	0.87932	D	0	.	16.3321	0.83039	0.0:1.0:0.0:0.0	.	53;107;53;32	B6ZGS6;B4DPR1;P51449;F1D8P6	.;.;RORG_HUMAN;.	S	32;107;53	ENSP00000349164:G32S;ENSP00000376461:G107S;ENSP00000327025:G53S	ENSP00000327025:G53S	G	-	1	0	RORC	150055905	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.813000	0.86123	2.436000	0.82500	0.563000	0.77884	GGC	-	HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1		0.622	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RORC	protein_coding	OTTHUMT00000036626.1	C		Missense_Mutation	150055905	-1	no_errors	NM_005060	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
KPRP	448834	genome.wustl.edu	37	1	152733748	152733748	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:152733748G>T	ENST00000606109.1	+	1	1712	c.1684G>T	c.(1684-1686)Gac>Tac	p.D562Y	KPRP_ENST00000368773.1_Missense_Mutation_p.D562Y			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	562						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGCCATGGAGACCAAGGCAA	0.522																																																0			1											72.0	68.0	69.0					1																	152733748		2203	4300	6503	151000372	SO:0001583	missense	448834			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1684G>T	1.37:g.152733748G>T	ENSP00000475216:p.Asp562Tyr	Somatic		Capture	Illumina GAIIx	4	151000372		Missense_Mutation	SNP	NULL	p.D562Y	ENST00000606109.1	37	c.1684	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.200131	0.58126	.	.	ENSG00000203786	ENST00000368773	T	0.17054	2.3	4.48	2.57	0.30868	.	0.457268	0.18647	N	0.135104	T	0.05731	0.0150	L	0.52573	1.65	0.30206	N	0.798149	B	0.32031	0.352	B	0.29176	0.099	T	0.17349	-1.0372	10	0.87932	D	0	-2.0985	4.9972	0.14245	0.1069:0.0:0.6834:0.2097	.	562	Q5T749	KPRP_HUMAN	Y	562	ENSP00000357762:D562Y	ENSP00000357762:D562Y	D	+	1	0	KPRP	151000372	0.798000	0.28890	0.970000	0.41538	0.241000	0.25554	0.500000	0.22562	1.226000	0.43582	0.313000	0.20887	GAC	-	NULL		0.522	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	protein_coding	OTTHUMT00000034522.2	G	NM_001025231		151000372	+1	no_errors	NM_001025231	genbank	human	provisional	54_36p	missense	SNP	0.967	T
NMUR2	56923	genome.wustl.edu	37	5	151784620	151784620	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr5:151784620C>G	ENST00000255262.3	-	1	220	c.55G>C	c.(55-57)Gaa>Caa	p.E19Q	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	19					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)			breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AATGGATCTTCTAGTTTCTGC	0.522																																																0			5											96.0	103.0	101.0					5																	151784620		2203	4300	6503	151764813	SO:0001583	missense	56923			AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.55G>C	5.37:g.151784620C>G	ENSP00000255262:p.Glu19Gln	Somatic		Capture	Illumina GAIIx	4	151764813	Q7LC54|Q96AM5|Q9NRA6	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.E19Q	ENST00000255262.3	37	c.55	CCDS4321.1	5	.	.	.	.	.	.	.	.	.	.	C	3.370	-0.128719	0.06753	.	.	ENSG00000132911	ENST00000255262	T	0.70516	-0.49	5.04	3.27	0.37495	.	0.746589	0.12562	N	0.458068	T	0.55097	0.1899	L	0.34521	1.04	0.21064	N	0.999799	B	0.18741	0.03	B	0.15870	0.014	T	0.37502	-0.9703	10	0.16896	T	0.51	-0.5975	7.3984	0.26950	0.0:0.692:0.1476:0.1604	.	19	Q9GZQ4	NMUR2_HUMAN	Q	19	ENSP00000255262:E19Q	ENSP00000255262:E19Q	E	-	1	0	NMUR2	151764813	0.007000	0.16637	0.368000	0.25939	0.018000	0.09664	1.459000	0.35234	0.547000	0.28938	-0.123000	0.14984	GAA	-	superfamily_Family A G protein-coupled receptor-like		0.522	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR2	protein_coding	OTTHUMT00000252439.1	C	NM_020167		151764813	-1	no_errors	NM_020167	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
OR10J5	127385	genome.wustl.edu	37	1	159505234	159505234	+	Silent	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:159505234G>A	ENST00000334857.2	-	1	608	c.564C>T	c.(562-564)tgC>tgT	p.C188C		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					TGGTATCAATGCAAGAAAGTT	0.393																																																0			1											79.0	73.0	75.0					1																	159505234		2203	4300	6503	157771858	SO:0001819	synonymous_variant	127385				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.564C>T	1.37:g.159505234G>A		Somatic		Capture	Illumina GAIIx	4	157771858	B9EH35|Q6IFH2	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.C188	ENST00000334857.2	37	c.564	CCDS30910.1	1																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.393	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	protein_coding	OTTHUMT00000059021.1	G	NM_001004469		157771858	-1	no_errors	NM_001004469	genbank	human	provisional	54_36p	silent	SNP	0.219	A
Unknown	0	genome.wustl.edu	37	2	159719130	159719130	+	IGR	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr2:159719130C>G								DAPL1 (8836 upstream) : RNU2-21P (73179 downstream)																							AGAGTCATCTCCTATGCAGGC	0.517																																																0			2																																								159427376	SO:0001628	intergenic_variant	0																															2.37:g.159719130C>G		Somatic		Capture	Illumina GAIIx	4	159427376		Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.S60C		37	c.179		2																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	0	0.517					ENSG00000188668			C			159427376	+1	no_errors	ENST00000343761	ensembl	human	known	54_36p	missense	SNP	0.701	G
PPIG	9360	genome.wustl.edu	37	2	170493379	170493379	+	Silent	SNP	A	A	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr2:170493379A>G	ENST00000260970.3	+	14	1831	c.1611A>G	c.(1609-1611)gaA>gaG	p.E537E	PPIG_ENST00000409714.3_Silent_p.E522E|PPIG_ENST00000448752.2_Silent_p.E537E	NM_004792.2	NP_004783.2	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G (cyclophilin G)	537					protein folding (GO:0006457)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(17)|ovary(2)|stomach(1)|urinary_tract(1)	43					L-Proline(DB00172)	AAAGTAAGGAAAAGGATAGAC	0.368																																																0			2											67.0	65.0	66.0					2																	170493379		2203	4300	6503	170201625	SO:0001819	synonymous_variant	9360			X99717	CCDS2235.1	2q31.1	2010-07-23	2006-01-12		ENSG00000138398	ENSG00000138398	6.1.1.16		14650	protein-coding gene	gene with protein product	"""SR-related CTD-associated factor 10"""	606093	"""peptidyl-prolyl isomerase G (cyclophilin G)"""			8973360, 9153302	Standard	NM_004792		Approved	CARS-Cyp, SRCyp, SCAF10	uc002uez.3	Q13427	OTTHUMG00000132206	ENST00000260970.3:c.1611A>G	2.37:g.170493379A>G		Somatic		Capture	Illumina GAIIx	4	170201625	D3DPC5|D3DPC6|O00706|Q53R40|Q53SN4|Q96DG9	Silent	SNP	superfamily_Cyclophilin-like,HMMPfam_Pro_isomerase,PatternScan_CSA_PPIASE_1	p.E537	ENST00000260970.3	37	c.1611	CCDS2235.1	2																																																																																			-	NULL		0.368	PPIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIG	protein_coding	OTTHUMT00000255264.2	A			170201625	+1	no_errors	NM_004792	genbank	human	validated	54_36p	silent	SNP	0.923	G
NSD1	64324	genome.wustl.edu	37	5	176665275	176665275	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr5:176665275G>A	ENST00000439151.2	+	7	4004	c.3959G>A	c.(3958-3960)cGa>cAa	p.R1320Q	NSD1_ENST00000361032.4_Missense_Mutation_p.R1217Q|NSD1_ENST00000347982.4_Missense_Mutation_p.R1051Q|NSD1_ENST00000354179.4_Missense_Mutation_p.R1051Q	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1320					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CTTCTAGCCCGAGGTCGATCT	0.423			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																													Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0			5											93.0	101.0	99.0					5																	176665275		2203	4300	6503	176597881	SO:0001583	missense	64324	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.3959G>A	5.37:g.176665275G>A	ENSP00000395929:p.Arg1320Gln	Somatic		Capture	Illumina GAIIx	4	176597881	Q96PD8|Q96RN7	Missense_Mutation	SNP	superfamily_Tudor/PWWP/MBT,HMMPfam_PWWP,HMMSmart_SM00293,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_SET domain,HMMSmart_SM00570,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00508	p.R1320Q	ENST00000439151.2	37	c.3959	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828279	0.50845	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93247	-3.08;-3.1;-3.08;-3.19	5.19	3.26	0.37387	.	0.545556	0.16912	N	0.194472	T	0.79587	0.4471	N	0.04880	-0.145	0.26215	N	0.979241	B;P;B	0.34864	0.093;0.473;0.026	B;B;B	0.19148	0.021;0.024;0.001	T	0.71702	-0.4513	10	0.32370	T	0.25	.	6.2374	0.20770	0.2235:0.0:0.7765:0.0	.	1051;1217;1320	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	Q	1051;1320;1051;1217	ENSP00000346111:R1051Q;ENSP00000395929:R1320Q;ENSP00000343209:R1051Q;ENSP00000354310:R1217Q	ENSP00000343209:R1051Q	R	+	2	0	NSD1	176597881	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	0.871000	0.28023	1.420000	0.47138	0.655000	0.94253	CGA	-	NULL		0.423	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	protein_coding	OTTHUMT00000253412.2	G	NM_172349		176597881	+1	no_errors	NM_022455	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
TBC1D9B	23061	genome.wustl.edu	37	5	179334815	179334815	+	Silent	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr5:179334815G>A	ENST00000356834.3	-	1	44	c.7C>T	c.(7-9)Ctg>Ttg	p.L3L	TBC1D9B_ENST00000355235.3_Silent_p.L3L	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	3						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCGGGCTCAGCCACATCGCG	0.771																																																0			5											7.0	6.0	6.0					5																	179334815		1429	2622	4051	179267421	SO:0001819	synonymous_variant	23061			AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.7C>T	5.37:g.179334815G>A		Somatic		Capture	Illumina GAIIx	4	179267421	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Silent	SNP	HMMPfam_GRAM,HMMSmart_SM00568,superfamily_Ypt/Rab-GAP domain of gyp1p,HMMPfam_TBC,HMMSmart_SM00164,superfamily_EF-hand,HMMPfam_efhand	p.L3	ENST00000356834.3	37	c.7	CCDS43408.1	5																																																																																			-	NULL		0.771	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D9B	protein_coding	OTTHUMT00000253501.3	G	NM_015043		179267421	-1	no_errors	NM_198868	genbank	human	validated	54_36p	silent	SNP	1.000	A
FXR1	8087	genome.wustl.edu	37	3	180685969	180685969	+	Silent	SNP	A	A	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr3:180685969A>T	ENST00000357559.4	+	14	1713	c.1329A>T	c.(1327-1329)ggA>ggT	p.G443G	FXR1_ENST00000468861.1_Silent_p.G358G|FXR1_ENST00000445140.2_Silent_p.G443G|FXR1_ENST00000491062.1_Silent_p.G394G|FXR1_ENST00000480918.1_Silent_p.G430G|FXR1_ENST00000305586.7_Silent_p.G358G	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	443	RNA-binding RGG-box.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			GACGCCCAGGAGGAAGAGGCA	0.527																																																0			3											124.0	108.0	113.0					3																	180685969		2203	4300	6503	182168663	SO:0001819	synonymous_variant	8087			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1329A>T	3.37:g.180685969A>T		Somatic		Capture	Illumina GAIIx	4	182168663	A8K9B8|Q7Z450|Q8N6R8	Silent	SNP	HMMPfam_Agenet,superfamily_Eukaryotic type KH-domain (KH-domain type I),HMMSmart_SM00322,HMMPfam_KH_1	p.G443	ENST00000357559.4	37	c.1329	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	A	11.57	1.677807	0.29783	.	.	ENSG00000114416	ENST00000482125	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	T	0.59609	0.2206	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59322	-0.7476	4	.	.	.	-5.5711	8.0806	0.30741	0.8073:0.0:0.1927:0.0	.	.	.	.	V	44	.	.	E	+	2	0	FXR1	182168663	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.816000	0.27267	2.217000	0.71921	0.482000	0.46254	GAG	-	NULL		0.527	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	protein_coding	OTTHUMT00000350265.5	A			182168663	+1	no_errors	NM_005087	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
EXO1	9156	genome.wustl.edu	37	1	242015649	242015649	+	Missense_Mutation	SNP	C	C	A	rs199625132		TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:242015649C>A	ENST00000366548.3	+	5	810	c.217C>A	c.(217-219)Cct>Act	p.P73T	EXO1_ENST00000493702.1_Intron|EXO1_ENST00000518483.1_Missense_Mutation_p.P73T|EXO1_ENST00000348581.5_Missense_Mutation_p.P73T	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	73	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TGGGATCAAGCCTATTCTCGT	0.318								Editing and processing nucleases																																								0			1											157.0	167.0	164.0					1																	242015649		2203	4300	6503	240082272	SO:0001583	missense	9156			AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.217C>A	1.37:g.242015649C>A	ENSP00000355506:p.Pro73Thr	Somatic		Capture	Illumina GAIIx	4	240082272	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	HMMPfam_XPG_N,HMMSmart_SM00485,superfamily_PIN domain-like,PatternScan_XPG_1,HMMSmart_SM00484,HMMPfam_XPG_I,PatternScan_XPG_2,superfamily_5' to 3' exonuclease C-terminal subdomain,HMMSmart_SM00279	p.P73T	ENST00000366548.3	37	c.217	CCDS1620.1	1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394615	0.83011	.	.	ENSG00000174371	ENST00000366548;ENST00000348581;ENST00000518483;ENST00000450748	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	5.0	5.0	0.66597	XPG conserved site (1);XPG N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96439	0.8838	H	0.97186	3.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97852	1.0275	10	0.87932	D	0	-0.0322	16.0799	0.81000	0.0:1.0:0.0:0.0	.	73;73;73	A8K5H6;Q9UQ84-4;Q9UQ84	.;.;EXO1_HUMAN	T	73	ENSP00000355506:P73T;ENSP00000311873:P73T;ENSP00000430251:P73T;ENSP00000406652:P73T	ENSP00000311873:P73T	P	+	1	0	EXO1	240082272	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.762000	0.85270	2.336000	0.79503	0.591000	0.81541	CCT	-	HMMPfam_XPG_N,HMMSmart_SM00485,superfamily_PIN domain-like,PatternScan_XPG_1		0.318	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	protein_coding	OTTHUMT00000096405.1	C	NM_006027		240082272	+1	no_errors	NM_006027	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
STK25	10494	genome.wustl.edu	37	2	242438556	242438556	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr2:242438556C>T	ENST00000316586.4	-	7	968	c.619G>A	c.(619-621)Gag>Aag	p.E207K	STK25_ENST00000535007.1_Missense_Mutation_p.E113K|STK25_ENST00000401869.1_Missense_Mutation_p.E207K|STK25_ENST00000403346.3_Missense_Mutation_p.E207K|STK25_ENST00000543554.1_Missense_Mutation_p.E113K|STK25_ENST00000405883.3_Missense_Mutation_p.E130K|STK25_ENST00000478403.1_5'UTR|STK25_ENST00000405585.1_Missense_Mutation_p.E130K	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25	207	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		TTGGCCAGCTCGATGGCTGTG	0.637																																					NSCLC(99;1100 1566 7679 28647 48345)											0			2											70.0	77.0	74.0					2																	242438556		2203	4300	6503	242087229	SO:0001583	missense	10494			D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.619G>A	2.37:g.242438556C>T	ENSP00000325748:p.Glu207Lys	Somatic		Capture	Illumina GAIIx	4	242087229	A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP	p.E207K	ENST00000316586.4	37	c.619	CCDS2549.1	2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270193	0.80469	.	.	ENSG00000115694	ENST00000316586;ENST00000403346;ENST00000401869;ENST00000405883;ENST00000545437;ENST00000405585;ENST00000543554;ENST00000535007;ENST00000450497;ENST00000424537;ENST00000442307;ENST00000413760	T;T;T;T;T;T;T;T;T;T;T	0.69806	1.23;1.23;1.23;1.23;1.23;1.23;1.23;-0.43;-0.43;-0.43;-0.43	5.18	5.18	0.71444	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87406	0.6169	H	0.94542	3.55	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.90800	0.4693	10	0.87932	D	0	.	19.0624	0.93099	0.0:1.0:0.0:0.0	.	133;130;207;113	B4DVS7;A8K6Z3;O00506;B4E185	.;.;STK25_HUMAN;.	K	207;207;207;130;113;130;113;113;113;111;113;113	ENSP00000325748:E207K;ENSP00000384162:E207K;ENSP00000385687:E207K;ENSP00000384444:E130K;ENSP00000385541:E130K;ENSP00000444886:E113K;ENSP00000446008:E113K;ENSP00000399212:E113K;ENSP00000417020:E111K;ENSP00000403607:E113K;ENSP00000395104:E113K	ENSP00000325748:E207K	E	-	1	0	STK25	242087229	1.000000	0.71417	0.953000	0.39169	0.163000	0.22366	7.583000	0.82559	2.578000	0.87016	0.655000	0.94253	GAG	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.637	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK25	protein_coding	OTTHUMT00000257265.4	C	NM_006374		242087229	-1	no_errors	NM_006374	genbank	human	provisional	54_36p	missense	SNP	1.000	T
C1orf101	257044	genome.wustl.edu	37	1	244756716	244756716	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:244756716C>G	ENST00000366534.4	+	16	2263	c.2209C>G	c.(2209-2211)Cca>Gca	p.P737A	C1orf101_ENST00000366533.4_Missense_Mutation_p.P737A|C1orf101_ENST00000366531.3_Missense_Mutation_p.P586A|C1orf101_ENST00000473875.1_3'UTR	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	737						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			GAGGCATCAGCCATCGAAAAA	0.313																																																0			1											94.0	99.0	97.0					1																	244756716		2203	4300	6503	242823339	SO:0001583	missense	257044			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.2209C>G	1.37:g.244756716C>G	ENSP00000355492:p.Pro737Ala	Somatic		Capture	Illumina GAIIx	4	242823339	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	NULL	p.P737A	ENST00000366534.4	37	c.2209	CCDS44340.1	1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.604275	0.00849	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042;ENST00000366531	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	4.03	1.92	0.25849	.	0.433620	0.19358	N	0.116232	T	0.10078	0.0247	N	0.21194	0.64	0.09310	N	1	P;B;B;B	0.36909	0.573;0.063;0.373;0.419	B;B;B;B	0.35413	0.164;0.033;0.117;0.202	T	0.20840	-1.0263	10	0.08837	T	0.75	.	6.2625	0.20907	0.2147:0.5772:0.2082:0.0	.	657;737;737;586	B1AQM6;Q5SY80;Q5SY80-2;B4DZR4	.;CA101_HUMAN;.;.	A	737;737;737;657;586	ENSP00000355492:P737A;ENSP00000355491:P737A;ENSP00000395796:P657A;ENSP00000355489:P586A	ENSP00000355489:P586A	P	+	1	0	C1orf101	242823339	0.001000	0.12720	0.029000	0.17559	0.015000	0.08874	0.476000	0.22180	1.007000	0.39238	0.462000	0.41574	CCA	-	NULL		0.313	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	protein_coding	OTTHUMT00000096701.1	C	NM_173807		242823339	+1	no_errors	NM_173807	genbank	human	validated	54_36p	missense	SNP	0.005	G
OR2M2	391194	genome.wustl.edu	37	1	248343796	248343796	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2432-01A-01D-1526-09	TCGA-29-2432-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	fe930e94-15b5-426d-b383-0c76fdee9532	b5233d4e-e526-4f15-8470-a1d8271359cf	g.chr1:248343796G>A	ENST00000359682.2	+	1	509	c.509G>A	c.(508-510)gGg>gAg	p.G170E		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G170V(2)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TCCTTTTGTGGGTCTCGGGAA	0.423																																																2	Substitution - Missense(2)	lung(2)	1											227.0	223.0	224.0					1																	248343796		2203	4300	6503	246410419	SO:0001583	missense	391194			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.509G>A	1.37:g.248343796G>A	ENSP00000352710:p.Gly170Glu	Somatic		Capture	Illumina GAIIx	4	246410419	A3KFT4	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G170E	ENST00000359682.2	37	c.509	CCDS31106.1	1	.	.	.	.	.	.	.	.	.	.	g	12.23	1.875788	0.33162	.	.	ENSG00000198601	ENST00000359682	T	0.38887	1.11	1.88	0.9	0.19278	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31257	U	0.007963	T	0.57169	0.2035	M	0.88310	2.945	0.09310	N	1	D	0.53462	0.96	P	0.59703	0.862	T	0.45352	-0.9267	10	0.59425	D	0.04	.	3.8019	0.08761	0.2484:0.2348:0.5167:0.0	.	170	Q96R28	OR2M2_HUMAN	E	170	ENSP00000352710:G170E	ENSP00000352710:G170E	G	+	2	0	OR2M2	246410419	0.006000	0.16342	0.039000	0.18376	0.006000	0.05464	0.021000	0.13489	1.056000	0.40484	0.454000	0.30748	GGG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.423	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M2	protein_coding	OTTHUMT00000097356.2	G	NM_001004688		246410419	+1	no_errors	NM_001004688	genbank	human	provisional	54_36p	missense	SNP	0.018	A
