#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PKD1	5310	genome.wustl.edu	37	16	2158972	2158972	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr16:2158972G>C	ENST00000262304.4	-	15	6404	c.6196C>G	c.(6196-6198)Ctg>Gtg	p.L2066V	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Missense_Mutation_p.L2066V	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2066	PKD 17. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCGCTCTGCAGGGCCACATAC	0.687																																																0			16											14.0	15.0	15.0					16																	2158972		2166	4278	6444	2098973	SO:0001583	missense	5310			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.6196C>G	16.37:g.2158972G>C	ENSP00000262304:p.Leu2066Val	Somatic		Capture	Illumina GAIIx	4	2098973	Q15140|Q15141	Missense_Mutation	SNP	HMMPfam_LRRNT,HMMSmart_SM00013,superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,HMMPfam_LRRCT,HMMSmart_SM00321,HMMPfam_WSC,HMMSmart_SM00089,superfamily_PKD domain,HMMPfam_PKD,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,HMMPfam_REJ,HMMPfam_GPS,HMMSmart_SM00303,HMMSmart_SM00308,HMMPfam_PLAT,superfamily_Lipase/lipooxygenase domain (PLAT/LH2 domain),HMMPfam_PKD_channel	p.L2066V	ENST00000262304.4	37	c.6196	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	g	12.27	1.886324	0.33348	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000382481	T;T	0.68331	-0.32;-0.32	5.49	5.49	0.81192	PKD/Chitinase domain (1);Polycystin cation channel (1);PKD domain (1);	0.000000	0.64402	D	0.000001	D	0.84042	0.5385	M	0.83118	2.625	0.41878	D	0.990307	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.85902	0.1435	10	0.66056	D	0.02	.	19.4518	0.94871	0.0:0.0:1.0:0.0	.	2066;2066	P98161-3;P98161	.;PKD1_HUMAN	V	2066;2066;345	ENSP00000262304:L2066V;ENSP00000399501:L2066V	ENSP00000262304:L2066V	L	-	1	2	PKD1	2098973	1.000000	0.71417	0.250000	0.24296	0.033000	0.12548	4.110000	0.57831	2.597000	0.87782	0.544000	0.68410	CTG	-	superfamily_PKD domain,HMMSmart_SM00089,HMMPfam_PKD		0.687	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	protein_coding	OTTHUMT00000341688.1	G			2098973	-1	no_errors	NM_001009944	genbank	human	reviewed	54_36p	missense	SNP	0.833	C
ADCY9	115	genome.wustl.edu	37	16	4016940	4016940	+	Silent	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr16:4016940C>T	ENST00000294016.3	-	11	3436	c.2898G>A	c.(2896-2898)tcG>tcA	p.S966S		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	966					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CACGCGGCACCGAACTATTGC	0.597																																																0			16											41.0	47.0	45.0					16																	4016940		2190	4294	6484	3956941	SO:0001819	synonymous_variant	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2898G>A	16.37:g.4016940C>T		Somatic		Capture	Illumina GAIIx	4	3956941	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.S966	ENST00000294016.3	37	c.2898	CCDS32382.1	16																																																																																			-	NULL		0.597	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	protein_coding	OTTHUMT00000438076.1	C			3956941	-1	no_errors	NM_001116	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
PPL	5493	genome.wustl.edu	37	16	4940815	4940815	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr16:4940815C>G	ENST00000345988.2	-	17	2165	c.2076G>C	c.(2074-2076)gaG>gaC	p.E692D	PPL_ENST00000590782.2_Missense_Mutation_p.E690D	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	692					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CCGGACAGTGCTCCTGGAAGC	0.652																																																0			16											14.0	14.0	14.0					16																	4940815		2187	4293	6480	4880816	SO:0001583	missense	5493			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2076G>C	16.37:g.4940815C>G	ENSP00000340510:p.Glu692Asp	Somatic		Capture	Illumina GAIIx	4	4880816	O60314|O60454|Q14C98	Missense_Mutation	SNP	HMMSmart_SM00150,superfamily_Spectrin repeat,superfamily_Plakin repeat,HMMSmart_SM00250,HMMPfam_Plectin	p.E692D	ENST00000345988.2	37	c.2076	CCDS10526.1	16	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631134	0.67015	.	.	ENSG00000118898	ENST00000345988	T	0.21543	2.0	5.35	4.41	0.53225	.	0.060805	0.64402	D	0.000004	T	0.24275	0.0588	M	0.71581	2.175	0.48975	D	0.999738	P	0.34562	0.457	B	0.27608	0.081	T	0.09952	-1.0651	10	0.72032	D	0.01	.	14.2499	0.66013	0.0:0.9288:0.0:0.0712	.	692	O60437	PEPL_HUMAN	D	692	ENSP00000340510:E692D	ENSP00000340510:E692D	E	-	3	2	PPL	4880816	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	3.910000	0.56371	1.500000	0.48636	-0.151000	0.13558	GAG	-	superfamily_Spectrin repeat		0.652	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	protein_coding	OTTHUMT00000251715.1	C	NM_002705		4880816	-1	no_errors	NM_002705	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
EVC2	132884	genome.wustl.edu	37	4	5699354	5699354	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr4:5699354C>A	ENST00000344408.5	-	2	302	c.249G>T	c.(247-249)tgG>tgT	p.W83C	EVC2_ENST00000310917.2_Missense_Mutation_p.W3C|EVC2_ENST00000344938.1_Missense_Mutation_p.W83C	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	83					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CCACTTTGGGCCAAATCATAC	0.388																																																0			4											116.0	105.0	109.0					4																	5699354		2203	4300	6503	5750255	SO:0001583	missense	132884			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.249G>T	4.37:g.5699354C>A	ENSP00000342144:p.Trp83Cys	Somatic		Capture	Illumina GAIIx	4	5750255	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	NULL	p.W83C	ENST00000344408.5	37	c.249	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	C	9.782	1.175656	0.21704	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.79352	-1.05;-1.26;-1.08	3.94	3.0	0.34707	.	2.608810	0.01394	N	0.013350	T	0.75539	0.3863	L	0.29908	0.895	0.18873	N	0.999988	D	0.63046	0.992	P	0.49561	0.615	T	0.65384	-0.6181	10	0.54805	T	0.06	-4.073	8.2312	0.31599	0.2372:0.7628:0.0:0.0	.	83	Q86UK5	LBN_HUMAN	C	83;3;83	ENSP00000339954:W83C;ENSP00000311683:W3C;ENSP00000342144:W83C	ENSP00000311683:W3C	W	-	3	0	EVC2	5750255	0.014000	0.17966	0.085000	0.20634	0.022000	0.10575	1.067000	0.30616	1.899000	0.54978	0.655000	0.94253	TGG	-	NULL		0.388	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	protein_coding	OTTHUMT00000289822.2	C	NM_147127		5750255	-1	no_errors	NM_147127	genbank	human	validated	54_36p	missense	SNP	0.002	A
EIF4A1	1973	genome.wustl.edu	37	17	7481744	7481744	+	Silent	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr17:7481744T>C	ENST00000293831.8	+	11	1177	c.1161T>C	c.(1159-1161)atT>atC	p.I387I	EIF4A1_ENST00000577269.1_3'UTR|EIF4A1_ENST00000582746.1_3'UTR|CD68_ENST00000250092.6_5'Flank|CD68_ENST00000380498.6_5'Flank|SNORA67_ENST00000384423.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|SNORD10_ENST00000459579.1_RNA	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1	387	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						TTCGAGACATTGAGACCTTCT	0.522																																					Melanoma(120;278 1668 15796 27423 46368)											0			17											111.0	102.0	105.0					17																	7481744		2203	4300	6503	7422468	SO:0001819	synonymous_variant	1973			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.1161T>C	17.37:g.7481744T>C		Somatic		Capture	Illumina GAIIx	4	7422468	B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,PatternScan_DEAD_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C	p.I387	ENST00000293831.8	37	c.1161	CCDS11113.1	17																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.522	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A1	protein_coding	OTTHUMT00000226952.6	T	NM_001416		7422468	+1	no_errors	NM_001416	genbank	human	validated	54_36p	silent	SNP	0.934	C
TP53	7157	genome.wustl.edu	37	17	7577095	7577095	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr17:7577095G>C	ENST00000269305.4	-	8	1032	c.843C>G	c.(841-843)gaC>gaG	p.D281E	TP53_ENST00000420246.2_Missense_Mutation_p.D281E|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.D281E|TP53_ENST00000445888.2_Missense_Mutation_p.D281E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.D281E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	281	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D281E(28)|p.R282W(10)|p.0?(8)|p.D281D(5)|p.?(2)|p.D281fs*63(2)|p.R280_D281delRD(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282fs*24(1)|p.D281R(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGTGCGCCGGTCTCTCCCAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	72	Substitution - Missense(39)|Deletion - In frame(8)|Whole gene deletion(8)|Substitution - coding silent(5)|Deletion - Frameshift(4)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - Frameshift(1)|Insertion - In frame(1)	skin(12)|upper_aerodigestive_tract(8)|ovary(8)|haematopoietic_and_lymphoid_tissue(7)|breast(6)|lung(5)|central_nervous_system(4)|bone(4)|urinary_tract(3)|oesophagus(3)|liver(3)|stomach(2)|endometrium(2)|large_intestine(1)|vulva(1)|genital_tract(1)|pancreas(1)|prostate(1)	17											82.0	70.0	74.0					17																	7577095		2203	4300	6503	7517820	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.843C>G	17.37:g.7577095G>C	ENSP00000269305:p.Asp281Glu	Somatic		Capture	Illumina GAIIx	4	7517820	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.D281E	ENST00000269305.4	37	c.843	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105939	0.77096	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99861	-7.26;-7.26;-7.26;-7.26;-7.26;-7.26	4.99	0.696	0.18075	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99832	0.9924	M	0.92649	3.33	0.53005	D	0.999961	D;D;D;P	0.71674	0.993;0.998;0.995;0.916	D;D;D;D	0.91635	0.965;0.999;0.951;0.943	D	0.98567	1.0644	10	0.87932	D	0	-25.6697	7.6418	0.28298	0.4422:0.0:0.5578:0.0	.	281;281;281;281	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	E	281;281;281;281;281;270;149	ENSP00000352610:D281E;ENSP00000269305:D281E;ENSP00000398846:D281E;ENSP00000391127:D281E;ENSP00000391478:D281E;ENSP00000425104:D149E	ENSP00000269305:D281E	D	-	3	2	TP53	7517820	1.000000	0.71417	0.915000	0.36163	0.964000	0.63967	1.949000	0.40313	0.286000	0.22352	0.462000	0.41574	GAC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517820	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
SLC2A14	144195	genome.wustl.edu	37	12	7984221	7984221	+	Missense_Mutation	SNP	A	A	G	rs113584214		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr12:7984221A>G	ENST00000543909.1	-	9	1079	c.320T>C	c.(319-321)cTc>cCc	p.L107P	SLC2A14_ENST00000542546.1_Intron|SLC2A14_ENST00000431042.2_Missense_Mutation_p.L84P|SLC2A14_ENST00000396589.2_Missense_Mutation_p.L107P|SLC2A14_ENST00000539924.1_Missense_Mutation_p.L122P|SLC2A14_ENST00000340749.5_Missense_Mutation_p.L84P|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000535295.1_Intron			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	107					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		GTTAACAAAGAGTCCGACGGA	0.542											OREG0021654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			12											89.0	83.0	85.0					12																	7984221		2203	4300	6503	7875488	SO:0001583	missense	144195			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.320T>C	12.37:g.7984221A>G	ENSP00000440480:p.Leu107Pro	Somatic	645	Capture	Illumina GAIIx	4	7875488	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr,PatternScan_SUGAR_TRANSPORT_2,PatternScan_SUGAR_TRANSPORT_1	p.L107P	ENST00000543909.1	37	c.320	CCDS8585.1	12	.	.	.	.	.	.	.	.	.	.	A	16.14	3.039599	0.55003	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000539924;ENST00000546234;ENST00000542782;ENST00000535344;ENST00000537557;ENST00000535266;ENST00000542916	T;T;T;T;T;T;T;T;T;T;D	0.84146	-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-0.86;-1.81	3.6	3.6	0.41247	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.445356	0.24242	N	0.040255	T	0.77425	0.4128	L	0.37850	1.14	0.80722	D	1	B;B;B	0.24368	0.102;0.036;0.001	B;B;B	0.27076	0.076;0.031;0.006	T	0.71276	-0.4641	10	0.27082	T	0.32	.	10.4041	0.44246	1.0:0.0:0.0:0.0	.	122;84;107	B7ZAC3;Q8TDB8-2;Q8TDB8	.;.;GTR14_HUMAN	P	84;107;84;107;122;84;84;84;107;107;84	ENSP00000340450:L84P;ENSP00000440480:L107P;ENSP00000407287:L84P;ENSP00000379834:L107P;ENSP00000445929:L122P;ENSP00000440043:L84P;ENSP00000438312:L84P;ENSP00000443217:L84P;ENSP00000440044:L107P;ENSP00000437653:L107P;ENSP00000442402:L84P	ENSP00000340450:L84P	L	-	2	0	SLC2A14	7875488	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	4.168000	0.58216	1.391000	0.46566	0.477000	0.44152	CTC	-	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr		0.542	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	SLC2A14	protein_coding	OTTHUMT00000399836.2	A	NM_153449		7875488	-1	no_errors	NM_153449	genbank	human	provisional	54_36p	missense	SNP	1.000	G
PIK3R5	23533	genome.wustl.edu	37	17	8794203	8794203	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr17:8794203T>C	ENST00000447110.1	-	7	633	c.509A>G	c.(508-510)gAa>gGa	p.E170G	PIK3R5_ENST00000581552.1_Missense_Mutation_p.E170G|PIK3R5_ENST00000584803.1_Missense_Mutation_p.E170G	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	170					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						GGCCTGCACTTCCACTGGGTT	0.657																																					NSCLC(18;589 615 7696 20311 50332)											0			17											122.0	89.0	100.0					17																	8794203		2203	4300	6503	8734928	SO:0001583	missense	23533			AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.509A>G	17.37:g.8794203T>C	ENSP00000392812:p.Glu170Gly	Somatic		Capture	Illumina GAIIx	4	8734928	B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	HMMPfam_PI3K_1B_p101	p.E170G	ENST00000447110.1	37	c.509	CCDS11147.1	17	.	.	.	.	.	.	.	.	.	.	T	12.63	1.994353	0.35226	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T	0.79749	-1.3	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.84147	0.5408	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	D	0.84894	0.0838	10	0.48119	T	0.1	-26.4854	14.786	0.69803	0.0:0.0:0.0:1.0	.	170	Q8WYR1	PI3R5_HUMAN	G	170	ENSP00000392812:E170G	ENSP00000269300:E170G	E	-	2	0	PIK3R5	8734928	1.000000	0.71417	0.996000	0.52242	0.345000	0.29048	5.887000	0.69751	1.969000	0.57287	0.454000	0.30748	GAA	-	HMMPfam_PI3K_1B_p101		0.657	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PIK3R5	protein_coding	OTTHUMT00000227003.2	T	NM_014308		8734928	-1	no_errors	NM_014308	genbank	human	validated	54_36p	missense	SNP	1.000	C
C16orf72	29035	genome.wustl.edu	37	16	9210587	9210587	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr16:9210587G>T	ENST00000327827.7	+	4	1043	c.646G>T	c.(646-648)Gta>Tta	p.V216L		NM_014117.2	NP_054836.2	Q14CZ0	CP072_HUMAN	chromosome 16 open reading frame 72	216										endometrium(4)|large_intestine(2)|lung(2)	8						TCCTACACATGTAAGCAGTGG	0.438																																																0			16											189.0	176.0	181.0					16																	9210587		2197	4300	6497	9118088	SO:0001583	missense	29035			AK123266	CCDS10538.1	16p13.2	2012-11-19			ENSG00000182831	ENSG00000182831			30103	protein-coding gene	gene with protein product						8889548	Standard	NM_014117		Approved	FLJ41272, PRO0149	uc002czm.3	Q14CZ0	OTTHUMG00000178147	ENST00000327827.7:c.646G>T	16.37:g.9210587G>T	ENSP00000331720:p.Val216Leu	Somatic		Capture	Illumina GAIIx	4	9118088		Missense_Mutation	SNP	NULL	p.V216L	ENST00000327827.7	37	c.646	CCDS10538.1	16	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232237	0.39498	.	.	ENSG00000182831	ENST00000327827	T	0.41758	0.99	5.55	5.55	0.83447	.	0.065614	0.64402	D	0.000012	T	0.42086	0.1187	N	0.12182	0.205	0.80722	D	1	D	0.54601	0.967	P	0.55391	0.775	T	0.25257	-1.0137	10	0.27082	T	0.32	-0.0551	19.8696	0.96845	0.0:0.0:1.0:0.0	.	216	Q14CZ0	CP072_HUMAN	L	216	ENSP00000331720:V216L	ENSP00000331720:V216L	V	+	1	0	C16orf72	9118088	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.281000	0.95811	2.773000	0.95371	0.585000	0.79938	GTA	-	NULL		0.438	C16orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf72	protein_coding	OTTHUMT00000440760.2	G	NM_014117		9118088	+1	no_errors	NM_014117	genbank	human	validated	54_36p	missense	SNP	1.000	T
TARDBP	23435	genome.wustl.edu	37	1	11074009	11074009	+	Silent	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:11074009C>G	ENST00000240185.3	+	2	339	c.225C>G	c.(223-225)gtC>gtG	p.V75V	TARDBP_ENST00000439080.2_Nonsense_Mutation_p.S14*|TARDBP_ENST00000315091.3_Silent_p.V75V	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein	75					3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		TGTATGTTGTCAACTATCCAA	0.468																																																0			1											107.0	112.0	110.0					1																	11074009		2203	4300	6503	10996596	SO:0001819	synonymous_variant	23435			U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120	ENST00000240185.3:c.225C>G	1.37:g.11074009C>G		Somatic		Capture	Illumina GAIIx	4	10996596	A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	Silent	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.V75	ENST00000240185.3	37	c.225	CCDS122.1	1	.	.	.	.	.	.	.	.	.	.	C	38	6.701380	0.97772	.	.	ENSG00000120948	ENST00000439080	.	.	.	5.32	2.33	0.28932	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-19.6202	17.9925	0.89172	0.0:0.4461:0.5539:0.0	.	.	.	.	X	14	.	ENSP00000404666:S14X	S	+	2	0	TARDBP	10996596	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	0.865000	0.27940	0.203000	0.20529	-0.172000	0.13284	TCA	-	superfamily_RNA-binding domain RBD		0.468	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARDBP	protein_coding	OTTHUMT00000006063.1	C	NM_007375		10996596	+1	no_errors	NM_007375	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
WNT7A	7476	genome.wustl.edu	37	3	13896259	13896259	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:13896259C>A	ENST00000285018.4	-	3	644	c.340G>T	c.(340-342)Ggc>Tgc	p.G114C		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	114					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						TGGGCCACGCCGGCGGCAATG	0.637																																																0			3											82.0	77.0	79.0					3																	13896259		2203	4300	6503	13871260	SO:0001583	missense	7476			D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.340G>T	3.37:g.13896259C>A	ENSP00000285018:p.Gly114Cys	Somatic		Capture	Illumina GAIIx	4	13871260	Q96H90|Q9Y560	Missense_Mutation	SNP	HMMPfam_wnt,HMMSmart_SM00097,PatternScan_WNT1	p.G114C	ENST00000285018.4	37	c.340	CCDS2616.1	3	.	.	.	.	.	.	.	.	.	.	C	19.40	3.819793	0.71028	.	.	ENSG00000154764	ENST00000285018	T	0.81078	-1.45	5.27	4.39	0.52855	.	0.168241	0.52532	D	0.000065	D	0.93344	0.7878	H	0.97491	4.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95625	0.8684	10	0.87932	D	0	.	15.9014	0.79380	0.0:0.8643:0.1357:0.0	.	114	O00755	WNT7A_HUMAN	C	114	ENSP00000285018:G114C	ENSP00000285018:G114C	G	-	1	0	WNT7A	13871260	1.000000	0.71417	0.074000	0.20217	0.644000	0.38419	7.786000	0.85741	1.213000	0.43380	0.561000	0.74099	GGC	-	HMMPfam_wnt,HMMSmart_SM00097		0.637	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT7A	protein_coding	OTTHUMT00000252031.2	C	NM_004625		13871260	-1	no_errors	NM_004625	genbank	human	reviewed	54_36p	missense	SNP	0.994	A
DDI2	84301	genome.wustl.edu	37	1	15957017	15957017	+	Missense_Mutation	SNP	A	A	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:15957017A>T	ENST00000480945.1	+	3	637	c.466A>T	c.(466-468)Aat>Tat	p.N156Y		NM_032341.4	NP_115717.3	Q5TDH0	DDI2_HUMAN	DNA-damage inducible 1 homolog 2 (S. cerevisiae)	156							aspartic-type endopeptidase activity (GO:0004190)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|stomach(1)	17		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		GAAGGAACGCAATCCACCCCT	0.512																																																0			1											94.0	88.0	90.0					1																	15957017		2203	4300	6503	15829604	SO:0001583	missense	84301				CCDS30607.1	1p36.13	2010-05-04	2010-05-04		ENSG00000197312	ENSG00000197312			24578	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae)"""				Standard	NM_032341		Approved	MGC14844	uc001awx.2	Q5TDH0	OTTHUMG00000002381	ENST00000480945.1:c.466A>T	1.37:g.15957017A>T	ENSP00000417748:p.Asn156Tyr	Somatic		Capture	Illumina GAIIx	4	15829604	A8KAE1|Q7RTZ0|Q9BRT1	Missense_Mutation	SNP	superfamily_Ubiquitin-like,HMMPfam_ubiquitin,HMMPfam_Asp_protease,superfamily_Acid proteases	p.N156Y	ENST00000480945.1	37	c.466	CCDS30607.1	1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.640779	0.87859	.	.	ENSG00000197312	ENST00000480945	T	0.29397	1.57	5.67	5.67	0.87782	.	0.000000	0.85682	U	0.000000	T	0.58906	0.2155	M	0.83384	2.64	0.58432	D	0.999999	D	0.89917	1.0	D	0.75020	0.985	T	0.63129	-0.6706	10	0.51188	T	0.08	-44.3756	15.5904	0.76523	1.0:0.0:0.0:0.0	.	156	Q5TDH0	DDI2_HUMAN	Y	156	ENSP00000417748:N156Y	ENSP00000449475:N41Y	N	+	1	0	DDI2	15829604	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.764000	0.91719	2.168000	0.68352	0.528000	0.53228	AAT	-	NULL		0.512	DDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDI2	protein_coding	OTTHUMT00000006826.1	A	NM_032341		15829604	+1	no_errors	NM_032341	genbank	human	provisional	54_36p	missense	SNP	1.000	T
USH1C	10083	genome.wustl.edu	37	11	17531982	17531982	+	Intron	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr11:17531982C>T	ENST00000318024.4	-	15	1393				USH1C_ENST00000527720.1_Intron|USH1C_ENST00000529563.1_Intron|USH1C_ENST00000527020.1_Intron|USH1C_ENST00000005226.7_Silent_p.Q500Q	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)						auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CAGAGGAAATCTGCTCGAGGC	0.517																																																0			11											62.0	55.0	57.0					11																	17531982		2200	4293	6493	17488558	SO:0001627	intron_variant	10083			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1284+6965G>A	11.37:g.17531982C>T		Somatic		Capture	Illumina GAIIx	4	17488558	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Silent	SNP	superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ	p.Q500	ENST00000318024.4	37	c.1500	CCDS31438.1	11																																																																																			-	NULL		0.517	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	protein_coding	OTTHUMT00000389146.1	C	NM_005709		17488558	-1	no_errors	NM_153676	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
PLEKHA5	54477	genome.wustl.edu	37	12	19436473	19436473	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr12:19436473C>A	ENST00000299275.6	+	11	1561	c.1555C>A	c.(1555-1557)Cct>Act	p.P519T	PLEKHA5_ENST00000309364.4_Missense_Mutation_p.P519T|PLEKHA5_ENST00000538714.1_Missense_Mutation_p.P519T|PLEKHA5_ENST00000539256.1_Missense_Mutation_p.P277T|PLEKHA5_ENST00000359180.3_Missense_Mutation_p.P519T|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.P411T|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.P525T|PLEKHA5_ENST00000355397.3_Missense_Mutation_p.P519T|PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.P519T|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.P411T	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	519					reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					GAGCACCCTCCCTCGACACAG	0.498																																					Pancreas(196;329 2193 11246 14234 19524)											0			12											122.0	121.0	121.0					12																	19436473		2203	4300	6503	19327740	SO:0001583	missense	54477			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.1555C>A	12.37:g.19436473C>A	ENSP00000299275:p.Pro519Thr	Somatic		Capture	Illumina GAIIx	4	19327740	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.P519T	ENST00000299275.6	37	c.1555	CCDS8682.1	12	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764529	0.31228	.	.	ENSG00000052126	ENST00000317589;ENST00000355397;ENST00000359180;ENST00000542828;ENST00000309364;ENST00000429027;ENST00000299275;ENST00000539256;ENST00000538714;ENST00000424268;ENST00000543806;ENST00000536974	T;T;T;T;T;T;T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71	3.99	3.99	0.46301	.	0.599803	0.17714	N	0.164494	T	0.07999	0.0200	N	0.11698	0.16	0.28736	N	0.902216	B;B;B;B;B;B;B	0.22146	0.013;0.003;0.007;0.065;0.028;0.002;0.004	B;B;B;B;B;B;B	0.17979	0.02;0.015;0.007;0.01;0.01;0.003;0.007	T	0.14504	-1.0470	10	0.30078	T	0.28	-8.0191	11.7675	0.51939	0.2225:0.7775:0.0:0.0	.	519;411;411;525;525;519;519	Q9HAU0-4;F5H0I0;E7EME8;B4DHK5;E9PHQ3;Q9HAU0;Q9HAU0-2	.;.;.;.;.;PKHA5_HUMAN;.	T	519;519;519;526;519;525;519;277;519;411;411;411	ENSP00000325155:P519T;ENSP00000347560:P519T;ENSP00000352104:P519T;ENSP00000311239:P519T;ENSP00000404296:P525T;ENSP00000299275:P519T;ENSP00000440611:P277T;ENSP00000439673:P519T;ENSP00000400411:P411T;ENSP00000439837:P411T;ENSP00000440371:P411T	ENSP00000299275:P519T	P	+	1	0	PLEKHA5	19327740	0.113000	0.22115	1.000000	0.80357	0.963000	0.63663	1.020000	0.30027	2.214000	0.71695	0.655000	0.94253	CCT	-	NULL		0.498	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA5	protein_coding	OTTHUMT00000397013.1	C	NM_019012		19327740	+1	no_errors	NM_019012	genbank	human	validated	54_36p	missense	SNP	1.000	A
AIFM3	150209	genome.wustl.edu	37	22	21330564	21330564	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr22:21330564T>C	ENST00000399167.2	+	10	1108	c.868T>C	c.(868-870)Tac>Cac	p.Y290H	AIFM3_ENST00000335375.5_Missense_Mutation_p.Y278H|AIFM3_ENST00000465606.1_3'UTR|AIFM3_ENST00000399163.2_Missense_Mutation_p.Y290H|AIFM3_ENST00000405089.1_Missense_Mutation_p.Y296H|AIFM3_ENST00000333607.6_Missense_Mutation_p.Y290H|AIFM3_ENST00000440238.2_Missense_Mutation_p.Y290H	NM_144704.2	NP_653305.1	Q96NN9	AIFM3_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 3	290					cell redox homeostasis (GO:0045454)|execution phase of apoptosis (GO:0097194)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	21	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CAAGCTGGAGTACAGCAAGCT	0.607																																																0			22											104.0	87.0	93.0					22																	21330564		2203	4300	6503	19660564	SO:0001583	missense	150209			AK094844	CCDS13786.1, CCDS33605.1, CCDS54503.1	22q11.21	2007-05-03			ENSG00000183773	ENSG00000183773			26398	protein-coding gene	gene with protein product						15764604	Standard	NM_144704		Approved	AIFL, FLJ30473		Q96NN9	OTTHUMG00000150804	ENST00000399167.2:c.868T>C	22.37:g.21330564T>C	ENSP00000382120:p.Tyr290His	Somatic		Capture	Illumina GAIIx	4	19660564	B7WP37|D3DX37|D3DX38|Q6ZT44|Q8N1V3|Q8N5E0	Missense_Mutation	SNP	HMMPfam_Rieske,superfamily_ISP domain,superfamily_FAD/NAD(P)-binding domain,HMMPfam_Pyr_redox_2,superfamily_FAD/NAD-linked reductases dimerisation (C-terminal) domain	p.Y290H	ENST00000399167.2	37	c.868	CCDS13786.1	22	.	.	.	.	.	.	.	.	.	.	T	21.3	4.121152	0.77436	.	.	ENSG00000183773	ENST00000399167;ENST00000399163;ENST00000405089;ENST00000335375;ENST00000440238;ENST00000333607	T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51	4.15	4.15	0.48705	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.81098	0.4752	H	0.97940	4.11	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;1.0	D	0.86705	0.1932	10	0.87932	D	0	.	11.4545	0.50173	0.0:0.0:0.0:1.0	.	278;278;296;290;290	B7Z9S7;B7Z376;Q96NN9-2;Q96NN9-3;Q96NN9	.;.;.;.;AIFM3_HUMAN	H	290;290;296;278;290;290	ENSP00000382120:Y290H;ENSP00000382116:Y290H;ENSP00000385800:Y296H;ENSP00000335369:Y278H;ENSP00000390798:Y290H;ENSP00000327671:Y290H	ENSP00000327671:Y290H	Y	+	1	0	AIFM3	19660564	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.396000	0.59684	1.879000	0.54435	0.459000	0.35465	TAC	-	superfamily_FAD/NAD(P)-binding domain,HMMPfam_Pyr_redox_2		0.607	AIFM3-002	KNOWN	basic|CCDS	protein_coding	AIFM3	protein_coding	OTTHUMT00000320150.1	T	NM_144704		19660564	+1	no_errors	NM_144704	genbank	human	provisional	54_36p	missense	SNP	1.000	C
CFAP61	26074	genome.wustl.edu	37	20	20177351	20177351	+	Silent	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr20:20177351G>A	ENST00000245957.5	+	16	1804	c.1728G>A	c.(1726-1728)aaG>aaA	p.K576K	C20orf26_ENST00000389656.3_5'UTR|C20orf26_ENST00000377309.2_5'UTR	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		576										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TCTTTCTGAAGGAGATCCTGC	0.473																																																0			20											133.0	121.0	125.0					20																	20177351		2203	4300	6503	20125351	SO:0001819	synonymous_variant	26074																														ENST00000245957.5:c.1728G>A	20.37:g.20177351G>A		Somatic		Capture	Illumina GAIIx	4	20125351	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Silent	SNP	superfamily_Acyl-CoA N-acyltransferases (Nat),superfamily_FAD/NAD(P)-binding domain	p.K576	ENST00000245957.5	37	c.1728	CCDS33447.1	20	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293694	0.23564	.	.	ENSG00000089101	ENST00000431753	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	T	0.64994	0.2649	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62895	-0.6757	4	.	.	.	.	12.7766	0.57453	0.0751:0.0:0.9249:0.0	.	.	.	.	K	116	.	.	R	+	2	0	C20orf26	20125351	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.366000	0.34193	2.595000	0.87683	0.561000	0.74099	AGG	-	NULL		0.473	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	protein_coding	OTTHUMT00000078228.3	G			20125351	+1	no_errors	NM_015585	genbank	human	predicted	54_36p	silent	SNP	1.000	A
NPAP1	23742	genome.wustl.edu	37	15	24922533	24922533	+	Missense_Mutation	SNP	T	T	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr15:24922533T>A	ENST00000329468.2	+	1	1993	c.1519T>A	c.(1519-1521)Ttc>Atc	p.F507I		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	507	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											CACACCCTCCTTCAAGCCTCC	0.542																																																0			15											178.0	191.0	186.0					15																	24922533		2203	4300	6503	22473626	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1519T>A	15.37:g.24922533T>A	ENSP00000333735:p.Phe507Ile	Somatic		Capture	Illumina GAIIx	4	22473626		Missense_Mutation	SNP	NULL	p.F507I	ENST00000329468.2	37	c.1519	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	10.31	1.314514	0.23908	.	.	ENSG00000185823	ENST00000329468	T	0.12465	2.68	1.72	1.72	0.24424	.	1.525930	0.04380	N	0.360618	T	0.10252	0.0251	L	0.39898	1.24	0.09310	N	1	P	0.44659	0.84	B	0.34489	0.184	T	0.29274	-1.0017	10	0.30078	T	0.28	.	5.4775	0.16704	0.0:0.0:0.0:1.0	.	507	Q9NZP6	CO002_HUMAN	I	507	ENSP00000333735:F507I	ENSP00000333735:F507I	F	+	1	0	C15orf2	22473626	0.007000	0.16637	0.016000	0.15963	0.079000	0.17450	0.200000	0.17257	1.047000	0.40274	0.172000	0.16884	TTC	-	NULL		0.542	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf2	protein_coding	OTTHUMT00000251253.1	T	NM_018958		22473626	+1	no_errors	NM_018958	genbank	human	validated	54_36p	missense	SNP	0.009	A
SUSD2	56241	genome.wustl.edu	37	22	24582233	24582233	+	Missense_Mutation	SNP	A	A	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr22:24582233A>C	ENST00000358321.3	+	10	1753	c.1492A>C	c.(1492-1494)Acc>Ccc	p.T498P		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	498	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						AGGCACGGAGACCCGTGGCAC	0.662																																																0			22											56.0	48.0	51.0					22																	24582233		2202	4300	6502	22912233	SO:0001583	missense	56241			AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1492A>C	22.37:g.24582233A>C	ENSP00000351075:p.Thr498Pro	Somatic		Capture	Illumina GAIIx	4	22912233	Q9H5Y6	Missense_Mutation	SNP	HMMSmart_SO,HMMPfam_Somatomedin_B,superfamily_SSF90188,PatternScan_SMB_1,HMMSmart_AMOP,HMMPfam_AMOP,HMMSmart_VWD,HMMPfam_VWD,superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP	p.T498P	ENST00000358321.3	37	c.1492	CCDS13824.1	22	.	.	.	.	.	.	.	.	.	.	A	15.65	2.897594	0.52121	.	.	ENSG00000099994	ENST00000358321	T	0.61510	0.1	5.05	-0.159	0.13379	von Willebrand factor, type D domain (3);	0.419844	0.26485	N	0.024103	T	0.33147	0.0853	N	0.20986	0.625	0.09310	N	1	P	0.39601	0.68	B	0.35859	0.212	T	0.17137	-1.0379	10	0.35671	T	0.21	-8.2895	4.5718	0.12214	0.4734:0.1634:0.3632:0.0	.	498	Q9UGT4	SUSD2_HUMAN	P	498	ENSP00000351075:T498P	ENSP00000351075:T498P	T	+	1	0	SUSD2	22912233	0.011000	0.17503	0.001000	0.08648	0.007000	0.05969	1.344000	0.33941	-0.143000	0.11334	0.454000	0.30748	ACC	-	HMMSmart_VWD,HMMPfam_VWD		0.662	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD2	protein_coding	OTTHUMT00000320088.1	A	NM_019601		22912233	+1	no_errors	NM_019601	genbank	human	validated	54_36p	missense	SNP	0.005	C
SCGN	10590	genome.wustl.edu	37	6	25682188	25682188	+	Missense_Mutation	SNP	T	T	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr6:25682188T>G	ENST00000377961.2	+	7	649	c.481T>G	c.(481-483)Ttt>Gtt	p.F161V	SCGN_ENST00000334979.6_Intron	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	161	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GATGAAGATTTTTGACAGAAA	0.348																																																0			6											109.0	103.0	105.0					6																	25682188		2203	4300	6503	25790167	SO:0001583	missense	10590			BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.481T>G	6.37:g.25682188T>G	ENSP00000367197:p.Phe161Val	Somatic		Capture	Illumina GAIIx	4	25790167	A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1	p.F161V	ENST00000377961.2	37	c.481	CCDS4561.1	6	.	.	.	.	.	.	.	.	.	.	T	21.1	4.100453	0.76983	.	.	ENSG00000079689	ENST00000377961	T	0.71817	-0.6	5.06	5.06	0.68205	EF-hand-like domain (1);	0.044665	0.85682	D	0.000000	T	0.81470	0.4829	M	0.85945	2.785	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	D	0.84694	0.0724	10	0.72032	D	0.01	.	12.7148	0.57109	0.0:0.0:0.0:1.0	.	161	O76038	SEGN_HUMAN	V	161	ENSP00000367197:F161V	ENSP00000367197:F161V	F	+	1	0	SCGN	25790167	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	5.622000	0.67750	2.231000	0.72958	0.533000	0.62120	TTT	-	superfamily_EF-hand,HMMSmart_SM00054		0.348	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGN	protein_coding	OTTHUMT00000040067.1	T			25790167	+1	no_errors	NM_006998	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CDH9	1007	genome.wustl.edu	37	5	26915874	26915874	+	Silent	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr5:26915874C>T	ENST00000231021.4	-	3	559	c.387G>A	c.(385-387)aaG>aaA	p.K129K		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	129	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K129N(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGTCTATAGCCTTGGCACGAA	0.383																																					Melanoma(8;187 585 15745 40864 52829)											1	Substitution - Missense(1)	large_intestine(1)	5											154.0	154.0	154.0					5																	26915874		2203	4299	6502	26951631	SO:0001819	synonymous_variant	1007			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.387G>A	5.37:g.26915874C>T		Somatic		Capture	Illumina GAIIx	4	26951631	Q3B7I5	Silent	SNP	superfamily_Cadherin,HMMSmart_CA,HMMPfam_Cadherin,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.K129	ENST00000231021.4	37	c.387	CCDS3893.1	5																																																																																			-	superfamily_Cadherin,HMMSmart_CA,HMMPfam_Cadherin		0.383	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	protein_coding	OTTHUMT00000207352.1	C	NM_016279		26951631	-1	no_errors	NM_016279	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
RNF138	51444	genome.wustl.edu	37	18	29709119	29709119	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr18:29709119C>T	ENST00000261593.3	+	8	1165	c.707C>T	c.(706-708)gCt>gTt	p.A236V	RNF138_ENST00000257190.5_Missense_Mutation_p.A142V	NM_001191324.1|NM_016271.4	NP_001178253.2|NP_057355.2	Q8WVD3	RN138_HUMAN	ring finger protein 138, E3 ubiquitin protein ligase	236					protein ubiquitination (GO:0016567)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	ligase activity (GO:0016874)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						TACCAAACTGCTGTTGAAGAA	0.368																																																0			18											149.0	145.0	147.0					18																	29709119		2203	4300	6503	27963117	SO:0001583	missense	51444			AF162680	CCDS11903.1, CCDS11904.1	18q12.1	2013-01-28	2012-02-23		ENSG00000134758	ENSG00000134758		"""RING-type (C3HC4) zinc fingers"""	17765	protein-coding gene	gene with protein product	"""nemo-like kinase associated ring finger protein"""		"""ring finger protein 138"""			22155992, 16714285	Standard	NM_016271		Approved	STRIN, NARF	uc021uip.2	Q8WVD3	OTTHUMG00000132265	ENST00000261593.3:c.707C>T	18.37:g.29709119C>T	ENSP00000261593:p.Ala236Val	Somatic		Capture	Illumina GAIIx	4	27963117	B2RE17|Q9H8K2|Q9UF87|Q9UKI6	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4	p.A236V	ENST00000261593.3	37	c.707	CCDS11903.1	18	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658312	0.67586	.	.	ENSG00000134758	ENST00000261593;ENST00000257190	D	0.89270	-2.49	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.92685	0.7675	L	0.52823	1.66	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.994;0.996	D	0.89280	0.3611	10	0.16896	T	0.51	0.4523	19.4797	0.95005	0.0:1.0:0.0:0.0	.	142;236	Q8WVD3-2;Q8WVD3	.;RN138_HUMAN	V	236;142	ENSP00000261593:A236V	ENSP00000257190:A142V	A	+	2	0	RNF138	27963117	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.841000	0.62824	2.684000	0.91462	0.650000	0.86243	GCT	-	NULL		0.368	RNF138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF138	protein_coding	OTTHUMT00000255352.2	C	NM_016271		27963117	+1	no_errors	NM_016271	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
BAMBI	25805	genome.wustl.edu	37	10	28966845	28966845	+	Missense_Mutation	SNP	T	T	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr10:28966845T>A	ENST00000375533.3	+	1	575	c.19T>A	c.(19-21)Tac>Aac	p.Y7N		NM_012342.2	NP_036474.1	Q13145	BAMBI_HUMAN	BMP and activin membrane-bound inhibitor	7					cell migration (GO:0016477)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell shape (GO:0008360)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|type II transforming growth factor beta receptor binding (GO:0005114)			central_nervous_system(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	17						CCACTCCAGCTACATCTTCAT	0.751																																																0			10											7.0	7.0	7.0					10																	28966845		2119	4145	6264	29006851	SO:0001583	missense	25805			U23070	CCDS7162.1	10p12.3-p11.2	2013-07-23	2013-07-23		ENSG00000095739	ENSG00000095739			30251	protein-coding gene	gene with protein product		604444	"""BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)"""			8621228, 19758997	Standard	NM_012342		Approved	NMA	uc001iuj.1	Q13145	OTTHUMG00000017874	ENST00000375533.3:c.19T>A	10.37:g.28966845T>A	ENSP00000364683:p.Tyr7Asn	Somatic		Capture	Illumina GAIIx	4	29006851		Missense_Mutation	SNP	HMMPfam_BAMBI,superfamily_SSF57302	p.Y7N	ENST00000375533.3	37	c.19	CCDS7162.1	10	.	.	.	.	.	.	.	.	.	.	t	20.3	3.969695	0.74246	.	.	ENSG00000095739	ENST00000375533;ENST00000542444	.	.	.	4.25	4.25	0.50352	.	0.196693	0.44097	D	0.000488	T	0.30008	0.0751	N	0.08118	0	0.36121	D	0.84547	P;P	0.38677	0.642;0.642	B;B	0.42163	0.266;0.378	T	0.42396	-0.9454	9	0.62326	D	0.03	.	8.1814	0.31313	0.0:0.0939:0.0:0.9061	.	7;7	Q13145;Q53G66	BAMBI_HUMAN;.	N	7	.	ENSP00000364683:Y7N	Y	+	1	0	BAMBI	29006851	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.315000	0.43752	1.698000	0.51180	0.398000	0.26397	TAC	-	HMMPfam_BAMBI		0.751	BAMBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAMBI	protein_coding	OTTHUMT00000047374.1	T	NM_012342		29006851	+1	no_errors	NM_012342	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MAP3K7CL	56911	genome.wustl.edu	37	21	30521518	30521518	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr21:30521518C>T	ENST00000399947.2	+	7	656	c.379C>T	c.(379-381)Ccc>Tcc	p.P127S	MAP3K7CL_ENST00000399928.1_Missense_Mutation_p.P27S|MAP3K7CL_ENST00000399935.2_Missense_Mutation_p.P27S|MAP3K7CL_ENST00000339024.4_Missense_Mutation_p.P27S|MAP3K7CL_ENST00000399934.1_Missense_Mutation_p.P27S|MAP3K7CL_ENST00000286791.5_3'UTR|MAP3K7CL_ENST00000399926.1_Missense_Mutation_p.P27S|MAP3K7CL_ENST00000399925.1_Missense_Mutation_p.P27S|MAP3K7CL_ENST00000341618.4_Missense_Mutation_p.P127S|MAP3K7CL_ENST00000545939.1_Missense_Mutation_p.P21S	NM_020152.2	NP_064537.1	P57077	M3KCL_HUMAN	MAP3K7 C-terminal like	127						cytosol (GO:0005829)|nucleus (GO:0005634)											AGATGATACACCCCCTGAAGA	0.408																																																0			21											168.0	158.0	162.0					21																	30521518		2203	4300	6503	29443389	SO:0001583	missense	56911			AF269161	CCDS13584.1, CCDS68182.1, CCDS74775.1	21q22.3	2013-02-22	2013-02-22	2013-02-22	ENSG00000156265	ENSG00000156265			16457	protein-coding gene	gene with protein product		611110	"""chromosome 21 open reading frame 7"""	C21orf7			Standard	NM_020152		Approved	TAKL, TAK1L, TAKL-1, TAKL-2, TAKL-4	uc002ynf.3	P57077	OTTHUMG00000078806	ENST00000399947.2:c.379C>T	21.37:g.30521518C>T	ENSP00000382828:p.Pro127Ser	Somatic		Capture	Illumina GAIIx	4	29443389	D3DSE0|Q8TCL9	Missense_Mutation	SNP	NULL	p.P127S	ENST00000399947.2	37	c.379	CCDS13584.1	21	.	.	.	.	.	.	.	.	.	.	C	6.899	0.535435	0.13188	.	.	ENSG00000156265	ENST00000545939;ENST00000341618;ENST00000399935;ENST00000399934;ENST00000399947;ENST00000339024;ENST00000399928;ENST00000399926;ENST00000399925;ENST00000451489	T;T	0.45276	0.9;0.9	4.49	3.59	0.41128	.	0.280270	0.31589	N	0.007396	T	0.23370	0.0565	N	0.14661	0.345	0.27525	N	0.95128	B;P	0.45715	0.007;0.865	B;B	0.43478	0.007;0.421	T	0.05903	-1.0857	10	0.15952	T	0.53	-10.0206	6.6377	0.22891	0.0:0.554:0.3016:0.1444	.	27;127	B0EVZ8;P57077	.;TAK1L_HUMAN	S	21;127;27;27;127;27;27;27;27;27	ENSP00000343212:P127S;ENSP00000382828:P127S	ENSP00000345777:P27S	P	+	1	0	C21orf7	29443389	0.248000	0.23930	0.974000	0.42286	0.935000	0.57460	0.496000	0.22499	1.459000	0.47892	0.655000	0.94253	CCC	-	NULL		0.408	MAP3K7CL-001	KNOWN	basic|CCDS	protein_coding	C21orf7	protein_coding	OTTHUMT00000171865.2	C	NM_020152		29443389	+1	no_errors	NM_020152	genbank	human	provisional	54_36p	missense	SNP	0.955	T
SLFN5	162394	genome.wustl.edu	37	17	33586531	33586531	+	Missense_Mutation	SNP	A	A	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr17:33586531A>G	ENST00000299977.4	+	2	970	c.822A>G	c.(820-822)atA>atG	p.I274M	SLFN5_ENST00000542451.1_Missense_Mutation_p.I274M|SLFN5_ENST00000592325.1_Missense_Mutation_p.I274M	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	274					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		GGCCTGAGATAAAATATGTCC	0.448																																																0			17											131.0	133.0	132.0					17																	33586531		2203	4300	6503	30610644	SO:0001583	missense	162394			BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.822A>G	17.37:g.33586531A>G	ENSP00000299977:p.Ile274Met	Somatic		Capture	Illumina GAIIx	4	30610644	Q08AF2|Q8WU54|Q96A82	Missense_Mutation	SNP	HMMPfam_AAA_4,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.I274M	ENST00000299977.4	37	c.822	CCDS32619.1	17	.	.	.	.	.	.	.	.	.	.	A	12.98	2.100889	0.37048	.	.	ENSG00000166750	ENST00000299977;ENST00000542451	T;T	0.36878	1.23;1.23	3.68	-5.1	0.02911	.	1.021180	0.07889	N	0.970830	T	0.48768	0.1518	M	0.74467	2.265	0.09310	N	1	P;P;D	0.89917	0.664;0.664;1.0	B;B;D	0.76575	0.283;0.189;0.988	T	0.50180	-0.8858	10	0.87932	D	0	.	1.0854	0.01651	0.243:0.155:0.3729:0.2292	.	274;274;274	B4E128;Q08AF3;Q08AF3-2	.;SLFN5_HUMAN;.	M	274	ENSP00000299977:I274M;ENSP00000440537:I274M	ENSP00000299977:I274M	I	+	3	3	SLFN5	30610644	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.344000	0.00249	-0.711000	0.04995	-0.256000	0.11100	ATA	-	HMMPfam_AAA_4		0.448	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN5	protein_coding	OTTHUMT00000448649.2	A	NM_144975		30610644	+1	no_errors	NM_144975	genbank	human	validated	54_36p	missense	SNP	0.000	G
ADCYAP1R1	117	genome.wustl.edu	37	7	31124406	31124406	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr7:31124406C>G	ENST00000304166.4	+	8	782	c.493C>G	c.(493-495)Ctc>Gtc	p.L165V	ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.L165V|ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.L165V|ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.L144V	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	165					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						CAGCACATCCCTCGTCACCCT	0.567																																					Ovarian(44;225 1186 2158 11092)											0			7											299.0	221.0	248.0					7																	31124406		2203	4300	6503	31090931	SO:0001583	missense	117				CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.493C>G	7.37:g.31124406C>G	ENSP00000306620:p.Leu165Val	Somatic		Capture	Illumina GAIIx	4	31090931	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	superfamily_Hormone receptor domain (HRM Pfam 02793),HMMSmart_SM00008,HMMPfam_HRM,PatternScan_G_PROTEIN_RECEP_F2_1,superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.L165V	ENST00000304166.4	37	c.493	CCDS5433.1	7	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943328	0.73672	.	.	ENSG00000078549	ENST00000304166;ENST00000409363;ENST00000396211;ENST00000409489	T;T;T;T	0.53857	1.08;0.6;0.6;0.6	5.8	4.92	0.64577	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000001	T	0.72120	0.3421	M	0.81497	2.545	0.50467	D	0.999871	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.997;0.999;0.996;0.996	T	0.74538	-0.3632	10	0.49607	T	0.09	.	12.4524	0.55684	0.0:0.9196:0.0:0.0804	.	165;165;165;144;165	B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.;.;.;.;PACR_HUMAN	V	165;144;165;165	ENSP00000306620:L165V;ENSP00000387335:L144V;ENSP00000379514:L165V;ENSP00000386395:L165V	ENSP00000306620:L165V	L	+	1	0	ADCYAP1R1	31090931	1.000000	0.71417	0.962000	0.40283	0.890000	0.51754	3.955000	0.56715	1.455000	0.47813	0.655000	0.94253	CTC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_2		0.567	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADCYAP1R1	protein_coding	OTTHUMT00000215041.3	C	NM_001118		31090931	+1	no_errors	NM_001118	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
AVL9	23080	genome.wustl.edu	37	7	32535410	32535410	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr7:32535410G>A	ENST00000318709.4	+	1	310	c.89G>A	c.(88-90)tGc>tAc	p.C30Y	LSM5_ENST00000409909.3_5'Flank|AVL9_ENST00000404479.1_Missense_Mutation_p.C30Y|AVL9_ENST00000409301.1_Missense_Mutation_p.C30Y|AVL9_ENST00000459629.1_3'UTR|LSM5_ENST00000409952.3_5'Flank	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	30					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AAGAAGGGCTGCCAGGTGAGG	0.721																																																0			7											11.0	15.0	14.0					7																	32535410		1894	3693	5587	32501935	SO:0001583	missense	23080			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.89G>A	7.37:g.32535410G>A	ENSP00000315568:p.Cys30Tyr	Somatic		Capture	Illumina GAIIx	4	32501935	Q92573	Missense_Mutation	SNP	HMMPfam_Avl9	p.C30Y	ENST00000318709.4	37	c.89	CCDS34613.1	7	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893469	0.72639	.	.	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714;ENST00000404479	T;T;T	0.46819	0.86;0.86;0.86	2.84	1.94	0.25998	.	0.000000	0.85682	D	0.000000	T	0.42675	0.1213	L	0.59436	1.845	0.80722	D	1	P;P	0.36392	0.551;0.457	B;B	0.38378	0.272;0.255	T	0.26985	-1.0087	10	0.23302	T	0.38	-19.5098	12.0316	0.53401	0.0:0.1771:0.8229:0.0	.	30;30	Q8N6Z3;Q8NBF6	.;AVL9_HUMAN	Y	30	ENSP00000315568:C30Y;ENSP00000387011:C30Y;ENSP00000385242:C30Y	ENSP00000315568:C30Y	C	+	2	0	AVL9	32501935	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.006000	0.70724	0.745000	0.32763	0.561000	0.74099	TGC	-	HMMPfam_Avl9		0.721	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	AVL9	protein_coding	OTTHUMT00000328643.1	G	NM_015060		32501935	+1	no_errors	NM_015060	genbank	human	provisional	54_36p	missense	SNP	1.000	A
CEP250	11190	genome.wustl.edu	37	20	34090440	34090440	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr20:34090440C>G	ENST00000397527.1	+	30	4963	c.4243C>G	c.(4243-4245)Caa>Gaa	p.Q1415E	CEP250_ENST00000342580.4_Missense_Mutation_p.Q1359E	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1415	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GAAGGTGGCCCAAGGGAAGGC	0.562																																																0			20											40.0	47.0	44.0					20																	34090440		2203	4300	6503	33553854	SO:0001583	missense	11190			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.4243C>G	20.37:g.34090440C>G	ENSP00000380661:p.Gln1415Glu	Somatic		Capture	Illumina GAIIx	4	33553854	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	superfamily_Prefoldin	p.Q1415E	ENST00000397527.1	37	c.4243	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	C	9.528	1.110013	0.20714	.	.	ENSG00000126001	ENST00000397527;ENST00000342580	T;T	0.10382	2.9;2.88	4.33	4.33	0.51752	.	0.360742	0.23889	N	0.043565	T	0.13200	0.0320	M	0.70595	2.14	0.23249	N	0.998047	B	0.18461	0.028	B	0.18561	0.022	T	0.21449	-1.0245	10	0.13853	T	0.58	.	12.5252	0.56083	0.0:1.0:0.0:0.0	.	1415	Q9BV73	CP250_HUMAN	E	1415;1359	ENSP00000380661:Q1415E;ENSP00000341541:Q1359E	ENSP00000341541:Q1359E	Q	+	1	0	CEP250	33553854	0.000000	0.05858	0.963000	0.40424	0.840000	0.47671	0.219000	0.17641	2.420000	0.82092	0.561000	0.74099	CAA	-	NULL		0.562	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	protein_coding	OTTHUMT00000078877.7	C	NM_007186		33553854	+1	no_errors	NM_007186	genbank	human	reviewed	54_36p	missense	SNP	0.838	G
STAR	6770	genome.wustl.edu	37	8	38002755	38002755	+	Silent	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr8:38002755G>C	ENST00000276449.4	-	6	1175	c.729C>G	c.(727-729)ctC>ctG	p.L243L		NM_000349.2	NP_000340.2	P49675	STAR_HUMAN	steroidogenic acute regulatory protein	243	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				bile acid biosynthetic process (GO:0006699)|biphenyl metabolic process (GO:0018879)|brain development (GO:0007420)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth hormone stimulus (GO:0071378)|cellular response to insulin stimulus (GO:0032869)|cellular response to interferon-alpha (GO:0035457)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to luteinizing hormone stimulus (GO:0071373)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cholesterol metabolic process (GO:0008203)|circadian sleep/wake cycle, REM sleep (GO:0042747)|dibenzo-p-dioxin metabolic process (GO:0018894)|diterpenoid metabolic process (GO:0016101)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|glucocorticoid metabolic process (GO:0008211)|insecticide metabolic process (GO:0017143)|intracellular cholesterol transport (GO:0032367)|male gonad development (GO:0008584)|negative regulation of neuron apoptotic process (GO:0043524)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of gene expression (GO:0010628)|positive regulation of neurogenesis (GO:0050769)|progesterone biosynthetic process (GO:0006701)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of steroid biosynthetic process (GO:0050810)|response to activity (GO:0014823)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to hydrogen peroxide (GO:0042542)|response to ionizing radiation (GO:0010212)|response to lead ion (GO:0010288)|response to leptin (GO:0044321)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytosol (GO:0005829)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	cholesterol binding (GO:0015485)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11	Colorectal(12;0.000442)	all_lung(54;0.0151)|Lung NSC(58;0.0295)		READ - Rectum adenocarcinoma(644;0.188)		GGTCGATGCTGAGTAGCCACG	0.557																																																0			8											130.0	106.0	114.0					8																	38002755		2203	4300	6503	38121912	SO:0001819	synonymous_variant	6770			BC010550	CCDS6102.1	8p11.2	2011-09-13	2007-05-15		ENSG00000147465	ENSG00000147465		"""StAR-related lipid transfer (START) domain containing"""	11359	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 1"""	600617	"""steroidogenic acute regulator"""			7761400	Standard	NM_000349		Approved	StAR, STARD1	uc003xkv.1	P49675	OTTHUMG00000164058	ENST00000276449.4:c.729C>G	8.37:g.38002755G>C		Somatic		Capture	Illumina GAIIx	4	38121912	Q16396	Silent	SNP	superfamily_Bet v1-like,HMMPfam_START,HMMSmart_SM00234	p.L243	ENST00000276449.4	37	c.729	CCDS6102.1	8																																																																																			-	superfamily_Bet v1-like,HMMPfam_START,HMMSmart_SM00234		0.557	STAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAR	protein_coding	OTTHUMT00000376990.2	G	NM_000349		38121912	-1	no_errors	NM_000349	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
EGFLAM	133584	genome.wustl.edu	37	5	38427278	38427278	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr5:38427278G>C	ENST00000354891.3	+	14	2324	c.1978G>C	c.(1978-1980)Gac>Cac	p.D660H	EGFLAM_ENST00000322350.5_Missense_Mutation_p.D660H|EGFLAM_ENST00000336740.6_Missense_Mutation_p.D426H|EGFLAM_ENST00000397202.2_Missense_Mutation_p.D26H|EGFLAM-AS1_ENST00000508986.1_RNA	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	660	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGGCAGCAAAGACTTCCTGTC	0.547																																					Colon(62;485 1295 3347 17454)											0			5											154.0	153.0	153.0					5																	38427278		2203	4300	6503	38463035	SO:0001583	missense	133584			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.1978G>C	5.37:g.38427278G>C	ENSP00000346964:p.Asp660His	Somatic		Capture	Illumina GAIIx	4	38463035	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3,HMMSmart_EGF,superfamily_ConA_like_lec_gl,PatternScan_EGF_1,HMMSmart_LamG,HMMPfam_Laminin_G_1,HMMPfam_EGF,PatternScan_EGF_2,HMMPfam_Laminin_G_2	p.D660H	ENST00000354891.3	37	c.1978	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	G	23.0	4.357277	0.82243	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000397202;ENST00000339580	T;T;T;D	0.82167	-0.82;-0.82;-0.82;-1.58	5.76	4.87	0.63330	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.095776	0.64402	D	0.000001	D	0.94056	0.8095	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95951	0.8954	10	0.87932	D	0	-29.6224	16.607	0.84832	0.0:0.1303:0.8697:0.0	.	426;660;660	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	H	660;660;426;26;426	ENSP00000346964:D660H;ENSP00000313084:D660H;ENSP00000337607:D426H;ENSP00000380385:D26H	ENSP00000313084:D660H	D	+	1	0	EGFLAM	38463035	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.395000	0.97266	1.399000	0.46721	0.655000	0.94253	GAC	-	superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2		0.547	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	protein_coding	OTTHUMT00000367323.1	G	NM_152403		38463035	+1	no_errors	NM_152403	genbank	human	validated	54_36p	missense	SNP	1.000	C
SEC23A	10484	genome.wustl.edu	37	14	39561751	39561751	+	Silent	SNP	T	T	C	rs376431559		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr14:39561751T>C	ENST00000307712.6	-	4	877	c.360A>G	c.(358-360)gtA>gtG	p.V120V	SEC23A_ENST00000536508.1_5'UTR|SEC23A_ENST00000545328.2_Intron	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	120					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		TTACCAGAACTACATATTCAA	0.289																																																0			14											26.0	26.0	26.0					14																	39561751		2202	4285	6487	38631502	SO:0001819	synonymous_variant	10484			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.360A>G	14.37:g.39561751T>C		Somatic		Capture	Illumina GAIIx	4	38631502	B2R5P4|B3KXI2|Q8NE16	Silent	SNP	superfamily_SSF81995,superfamily_Znf_Sec23_Sec24,HMMPfam_zf-Sec23_Sec24,HMMPfam_Sec23_trunk,superfamily_SSF53300,HMMPfam_Sec23_BS,superfamily_Sec23_helical,HMMPfam_Sec23_helical,superfamily_SSF82754,HMMPfam_Gelsolin	p.V120	ENST00000307712.6	37	c.360	CCDS9668.1	14																																																																																			-	superfamily_SSF81995,superfamily_Znf_Sec23_Sec24		0.289	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23A	protein_coding	OTTHUMT00000276728.2	T			38631502	-1	no_errors	NM_006364	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
DNAH8	1769	genome.wustl.edu	37	6	38862480	38862480	+	Nonsense_Mutation	SNP	A	A	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr6:38862480A>T	ENST00000359357.3	+	57	8190	c.7936A>T	c.(7936-7938)Aag>Tag	p.K2646*	DNAH8_ENST00000441566.1_Nonsense_Mutation_p.K2610*|DNAH8_ENST00000449981.2_Nonsense_Mutation_p.K2863*			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2646	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TCTCTAGGTGAAGATGCTGCC	0.343																																																0			6											78.0	76.0	77.0					6																	38862480		2203	4300	6503	38970458	SO:0001587	stop_gained	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7936A>T	6.37:g.38862480A>T	ENSP00000352312:p.Lys2646*	Somatic		Capture	Illumina GAIIx	4	38970458	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Nonsense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,PatternScan_THIOL_PROTEASE_HIS,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.K2646*	ENST00000359357.3	37	c.7936		6	.	.	.	.	.	.	.	.	.	.	A	51	17.817845	0.99894	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.2987	0.73931	1.0:0.0:0.0:0.0	.	.	.	.	X	2851;2851;2646;2610	.	ENSP00000333363:K2851X	K	+	1	0	DNAH8	38970458	1.000000	0.71417	0.987000	0.45799	0.965000	0.64279	6.891000	0.75639	1.999000	0.58509	0.455000	0.32223	AAG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.343	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	A	NM_001206927		38970458	+1	no_errors	NM_001371	genbank	human	validated	54_36p	nonsense	SNP	0.999	T
BRWD1	54014	genome.wustl.edu	37	21	40584593	40584593	+	Splice_Site	SNP	C	C	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr21:40584593C>A	ENST00000333229.2	-	34	4226	c.3899G>T	c.(3898-3900)aGa>aTa	p.R1300I	BRWD1_ENST00000342449.3_Splice_Site_p.R1300I|BRWD1_ENST00000380800.3_Splice_Site_p.R1300I	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1300					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GTAACTTACTCTCCTCCTTCC	0.299																																					Melanoma(170;988 1986 4794 16843 39731)											0			21											75.0	80.0	78.0					21																	40584593		2203	4295	6498	39506463	SO:0001630	splice_region_variant	54014			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3900+1G>T	21.37:g.40584593C>A		Somatic		Capture	Illumina GAIIx	4	39506463	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40,PatternScan_WD_REPEATS_1,HMMSmart_SM00297,superfamily_Bromodomain,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.R1300I	ENST00000333229.2	37	c.3899	CCDS13662.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.42|15.42	2.829583|2.829583	0.50845|0.50845	.|.	.|.	ENSG00000185658|ENSG00000185658	ENST00000424441|ENST00000333229;ENST00000342449;ENST00000380800;ENST00000380783	.|T;T;T	.|0.57107	.|0.42;0.44;0.51	5.47|5.47	3.61|3.61	0.41365|0.41365	.|Bromodomain (1);	.|0.158163	.|0.43416	.|D	.|0.000576	T|T	0.42404|0.42404	0.1201|0.1201	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.44578	.|0.534;0.666;0.838	.|B;B;B	.|0.35813	.|0.211;0.168;0.205	T|T	0.43426|0.43426	-0.9392|-0.9392	5|10	.|0.51188	.|T	.|0.08	-3.3032|-3.3032	8.1615|8.1615	0.31201|0.31201	0.0:0.8168:0.0:0.1832|0.0:0.8168:0.0:0.1832	.|.	.|1300;1300;1300	.|Q9NSI6-3;Q9NSI6-2;Q9NSI6	.|.;.;BRWD1_HUMAN	D|I	285|1300;1300;1300;304	.|ENSP00000330753:R1300I;ENSP00000344333:R1300I;ENSP00000370178:R1300I	.|ENSP00000330753:R1300I	E|R	-|-	3|2	2|0	BRWD1|BRWD1	39506463|39506463	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	0.927000|0.927000	0.28818|0.28818	1.414000|1.414000	0.47017|0.47017	0.655000|0.655000	0.94253|0.94253	GAG|AGA	-	superfamily_WD40 repeat-like,superfamily_Bromodomain		0.299	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	protein_coding	OTTHUMT00000141398.3	C	NM_033656	Missense_Mutation	39506463	-1	no_errors	NM_018963	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
UBTF	7343	genome.wustl.edu	37	17	42287494	42287494	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr17:42287494C>T	ENST00000302904.4	-	15	2116	c.1624G>A	c.(1624-1626)Gag>Aag	p.E542K	UBTF_ENST00000533177.1_Missense_Mutation_p.E505K|UBTF_ENST00000436088.1_Missense_Mutation_p.E542K|UBTF_ENST00000343638.5_Missense_Mutation_p.E505K|UBTF_ENST00000393606.3_Missense_Mutation_p.E505K|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000529383.1_Missense_Mutation_p.E542K|UBTF_ENST00000526094.1_Missense_Mutation_p.E505K|UBTF_ENST00000527034.1_Missense_Mutation_p.E505K			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	542					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		ATTCCTACCTCATATCGCTTT	0.512											OREG0024456	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			17											151.0	158.0	156.0					17																	42287494		2203	4300	6503	39643020	SO:0001583	missense	7343			BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.1624G>A	17.37:g.42287494C>T	ENSP00000302640:p.Glu542Lys	Somatic	907	Capture	Illumina GAIIx	4	39643020	A8K6R8	Missense_Mutation	SNP	superfamily_HMG-box,HMMSmart_SM00398,HMMPfam_HMG_box	p.E542K	ENST00000302904.4	37	c.1624	CCDS11480.1	17	.	.	.	.	.	.	.	.	.	.	C	18.45	3.626297	0.66901	.	.	ENSG00000108312	ENST00000343638;ENST00000302904;ENST00000527034;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383;ENST00000529373	D;D;D;D;D;D;D;D;T	0.98437	-4.91;-4.13;-4.93;-4.91;-4.13;-4.91;-4.91;-4.13;1.68	5.3	4.32	0.51571	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (3);	0.000000	0.85682	D	0.000000	D	0.96858	0.8974	L	0.32530	0.975	0.80722	D	1	D;P;P	0.53745	0.962;0.873;0.944	P;B;P	0.52514	0.534;0.385;0.701	D	0.95359	0.8454	10	0.22706	T	0.39	-31.6668	14.8218	0.70080	0.0:0.8546:0.1454:0.0	.	505;505;542	E9PKP7;P17480-2;P17480	.;.;UBF1_HUMAN	K	505;542;505;505;542;505;505;542;129	ENSP00000345297:E505K;ENSP00000302640:E542K;ENSP00000431539:E505K;ENSP00000437180:E505K;ENSP00000390669:E542K;ENSP00000377231:E505K;ENSP00000432925:E505K;ENSP00000435708:E542K;ENSP00000431295:E129K	ENSP00000302640:E542K	E	-	1	0	UBTF	39643020	1.000000	0.71417	0.917000	0.36280	0.023000	0.10783	7.733000	0.84916	1.212000	0.43366	-0.499000	0.04595	GAG	-	superfamily_HMG-box,HMMSmart_SM00398		0.512	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTF	protein_coding	OTTHUMT00000395205.1	C	NM_014233		39643020	-1	no_errors	NM_014233	genbank	human	validated	54_36p	missense	SNP	1.000	T
CCDC13	152206	genome.wustl.edu	37	3	42788802	42788802	+	Missense_Mutation	SNP	C	C	A	rs560123615		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:42788802C>A	ENST00000310232.6	-	6	750	c.667G>T	c.(667-669)Gac>Tac	p.D223Y	CCDC13-AS1_ENST00000418161.1_RNA|CCDC13-AS1_ENST00000446950.1_RNA|CCDC13_ENST00000435327.2_5'Flank	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	223										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TTTCGGAGGTCACTCATCTTC	0.567																																																0			3											80.0	71.0	74.0					3																	42788802		2203	4300	6503	42763806	SO:0001583	missense	152206			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.667G>T	3.37:g.42788802C>A	ENSP00000309836:p.Asp223Tyr	Somatic		Capture	Illumina GAIIx	4	42763806		Missense_Mutation	SNP	NULL	p.D223Y	ENST00000310232.6	37	c.667	CCDS2705.1	3	.	.	.	.	.	.	.	.	.	.	C	21.8	4.198029	0.79015	.	.	ENSG00000244607	ENST00000310232	T	0.25250	1.81	5.1	4.2	0.49525	.	0.196320	0.52532	N	0.000072	T	0.47948	0.1473	M	0.66939	2.045	0.39767	D	0.972101	B;D	0.89917	0.379;1.0	B;D	0.72338	0.111;0.977	T	0.53704	-0.8401	10	0.87932	D	0	.	13.5044	0.61476	0.1578:0.8422:0.0:0.0	.	223;223	Q96LI1;Q8IYE1	.;CCD13_HUMAN	Y	223	ENSP00000309836:D223Y	ENSP00000309836:D223Y	D	-	1	0	CCDC13	42763806	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	6.760000	0.74939	1.082000	0.41137	0.655000	0.94253	GAC	-	NULL		0.567	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	protein_coding	OTTHUMT00000256652.1	C	NM_144719		42763806	-1	no_errors	NM_144719	genbank	human	validated	54_36p	missense	SNP	0.996	A
ZNF318	24149	genome.wustl.edu	37	6	43307012	43307012	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr6:43307012C>T	ENST00000361428.2	-	10	4801	c.4724G>A	c.(4723-4725)aGt>aAt	p.S1575N	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1575					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTTTCCACCACTACTATAGAA	0.468																																																0			6											52.0	56.0	55.0					6																	43307012		2203	4299	6502	43414990	SO:0001583	missense	24149			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4724G>A	6.37:g.43307012C>T	ENSP00000354964:p.Ser1575Asn	Somatic		Capture	Illumina GAIIx	4	43414990	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	HMMSmart_SM00451,superfamily_C2H2 and C2HC zinc fingers,PatternScan_ZINC_FINGER_C2H2_1	p.S1575N	ENST00000361428.2	37	c.4724	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	C	16.98	3.272507	0.59649	.	.	ENSG00000171467	ENST00000361428	T	0.21031	2.03	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000001	T	0.24509	0.0594	N	0.19112	0.55	0.80722	D	1	D	0.67145	0.996	D	0.75484	0.986	T	0.07849	-1.0751	10	0.87932	D	0	-11.219	17.3046	0.87191	0.0:1.0:0.0:0.0	.	1575	Q5VUA4	ZN318_HUMAN	N	1575	ENSP00000354964:S1575N	ENSP00000354964:S1575N	S	-	2	0	ZNF318	43414990	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.821000	0.55700	2.756000	0.94617	0.563000	0.77884	AGT	-	NULL		0.468	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	protein_coding	OTTHUMT00000040601.2	C	NM_014345		43414990	-1	no_errors	NM_014345	genbank	human	validated	54_36p	missense	SNP	1.000	T
ZNF318	24149	genome.wustl.edu	37	6	43323046	43323046	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr6:43323046G>T	ENST00000361428.2	-	4	2103	c.2026C>A	c.(2026-2028)Cta>Ata	p.L676I	ZNF318_ENST00000318149.3_Missense_Mutation_p.L676I	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	676					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			CTGCTCTCTAGTCTGTGGGGA	0.537																																																0			6											158.0	119.0	132.0					6																	43323046		2203	4300	6503	43431024	SO:0001583	missense	24149			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2026C>A	6.37:g.43323046G>T	ENSP00000354964:p.Leu676Ile	Somatic		Capture	Illumina GAIIx	4	43431024	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	HMMSmart_SM00451,PatternScan_ZINC_FINGER_C2H2_1,superfamily_C2H2 and C2HC zinc fingers	p.L676I	ENST00000361428.2	37	c.2026	CCDS4895.2	6	.	.	.	.	.	.	.	.	.	.	G	12.98	2.100587	0.37048	.	.	ENSG00000171467	ENST00000318149;ENST00000361428	T;T	0.34275	1.37;2.64	6.17	0.367	0.16140	.	0.353710	0.27535	N	0.018924	T	0.16342	0.0393	N	0.19112	0.55	0.21553	N	0.999648	D	0.59767	0.986	P	0.57776	0.827	T	0.12604	-1.0541	10	0.44086	T	0.13	-0.3436	6.3155	0.21188	0.3364:0.1176:0.546:0.0	.	676	Q5VUA4	ZN318_HUMAN	I	676	ENSP00000323032:L676I;ENSP00000354964:L676I	ENSP00000323032:L676I	L	-	1	2	ZNF318	43431024	0.924000	0.31332	0.482000	0.27366	0.724000	0.41520	0.834000	0.27518	-0.217000	0.10033	-0.175000	0.13238	CTA	-	NULL		0.537	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	protein_coding	OTTHUMT00000040601.2	G	NM_014345		43431024	-1	no_errors	NM_014345	genbank	human	validated	54_36p	missense	SNP	0.994	T
POFUT2	23275	genome.wustl.edu	37	21	46707753	46707753	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr21:46707753C>G	ENST00000349485.5	-	1	60	c.34G>C	c.(34-36)Ggg>Cgg	p.G12R	POFUT2_ENST00000331343.7_Missense_Mutation_p.G12R|BX322557.10_ENST00000454115.2_RNA	NM_133635.4	NP_598368.2	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2	12					fucose metabolic process (GO:0006004)|mesoderm formation (GO:0001707)|protein O-linked fucosylation (GO:0036066)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of gene expression (GO:0010468)|regulation of secretion (GO:0051046)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	20				Colorectal(79;0.243)		GACACTGCCCCCAGCAGCAGG	0.726																																																0			21											6.0	7.0	7.0					21																	46707753		2056	4052	6108	45532181	SO:0001583	missense	23275			AJ203079	CCDS13719.1, CCDS13721.1	21q22.3	2013-03-06	2004-06-07	2004-06-09	ENSG00000186866	ENSG00000186866	2.4.1.221	"""Fucosyltransferases"""	14683	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 2"""	610249	"""chromosome 21 open reading frame 80"""	C21orf80			Standard	NM_133635		Approved	KIAA0958, FUT13	uc002zhc.3	Q9Y2G5	OTTHUMG00000084874	ENST00000349485.5:c.34G>C	21.37:g.46707753C>G	ENSP00000339613:p.Gly12Arg	Somatic		Capture	Illumina GAIIx	4	45532181	Q6PJV1|Q7Z4N0|Q8WWU6|Q9BQS4|Q9BQS5|Q9UFY3	Missense_Mutation	SNP	HMMPfam_O-FucT	p.G12R	ENST00000349485.5	37	c.34	CCDS13719.1	21	.	.	.	.	.	.	.	.	.	.	C	5.225	0.227095	0.09916	.	.	ENSG00000186866	ENST00000331343;ENST00000349485	.	.	.	2.98	-3.54	0.04653	.	2.785850	0.01630	N	0.023502	T	0.12902	0.0313	N	0.08118	0	0.09310	N	1	P;B;B	0.40476	0.718;0.263;0.01	B;B;B	0.31245	0.126;0.048;0.018	T	0.12604	-1.0541	9	0.23891	T	0.37	-0.9406	7.4461	0.27211	0.6333:0.2227:0.144:0.0	.	12;12;12	B4DH78;Q9Y2G5-1;Q9Y2G5	.;.;OFUT2_HUMAN	R	12	.	ENSP00000329682:G12R	G	-	1	0	POFUT2	45532181	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.511000	0.02260	-0.811000	0.04369	-0.271000	0.10264	GGG	-	NULL		0.726	POFUT2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	POFUT2	protein_coding	OTTHUMT00000192573.2	C	NM_015227		45532181	-1	no_errors	NM_133635	genbank	human	validated	54_36p	missense	SNP	0.012	G
ATP10D	57205	genome.wustl.edu	37	4	47593177	47593177	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr4:47593177G>A	ENST00000273859.3	+	23	4329	c.4060G>A	c.(4060-4062)Gga>Aga	p.G1354R		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1354					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GAGAGGGGCTGGAAAGATGAA	0.473																																																0			4											109.0	109.0	109.0					4																	47593177		2203	4300	6503	47287934	SO:0001583	missense	57205			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.4060G>A	4.37:g.47593177G>A	ENSP00000273859:p.Gly1354Arg	Somatic		Capture	Illumina GAIIx	4	47287934	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Hydrolase_3	p.G1354R	ENST00000273859.3	37	c.4060	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	9.547	1.115010	0.20795	.	.	ENSG00000145246	ENST00000273859	T	0.37584	1.19	4.62	1.53	0.23141	.	0.880696	0.09877	N	0.744156	T	0.21631	0.0521	L	0.33485	1.01	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29549	-1.0008	10	0.15499	T	0.54	-1.3522	2.9134	0.05744	0.3551:0.0:0.3325:0.3124	.	1354	Q9P241	AT10D_HUMAN	R	1354	ENSP00000273859:G1354R	ENSP00000273859:G1354R	G	+	1	0	ATP10D	47287934	0.001000	0.12720	0.006000	0.13384	0.282000	0.26991	0.837000	0.27558	0.487000	0.27698	0.460000	0.39030	GGA	-	NULL		0.473	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	protein_coding	OTTHUMT00000216900.1	G	NM_020453		47287934	+1	no_errors	NM_020453	genbank	human	validated	54_36p	missense	SNP	0.000	A
ADCY7	113	genome.wustl.edu	37	16	50349009	50349009	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr16:50349009C>T	ENST00000394697.2	+	25	3396	c.3056C>T	c.(3055-3057)gCc>gTc	p.A1019V	ADCY7_ENST00000254235.3_Missense_Mutation_p.A1019V			P51828	ADCY7_HUMAN	adenylate cyclase 7	1019	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		GTCAATGTGGCCAGCCGAATG	0.493																																																0			16											109.0	111.0	110.0					16																	50349009		2198	4300	6498	48906510	SO:0001583	missense	113			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.3056C>T	16.37:g.50349009C>T	ENSP00000378187:p.Ala1019Val	Somatic		Capture	Illumina GAIIx	4	48906510	A0AVA6	Missense_Mutation	SNP	HMMSmart_CYCc,superfamily_A/G_cyclase,HMMPfam_Guanylate_cyc,HMMPfam_DUF1053,PatternScan_GUANYLATE_CYCLASE_1	p.A1019V	ENST00000394697.2	37	c.3056	CCDS10741.1	16	.	.	.	.	.	.	.	.	.	.	C	31	5.064497	0.93898	.	.	ENSG00000121281	ENST00000394697;ENST00000254235	T;T	0.66638	-0.22;-0.22	5.33	4.35	0.52113	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.44097	U	0.000489	D	0.90130	0.6916	H	0.99609	4.655	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94728	0.7907	10	0.87932	D	0	.	15.9081	0.79447	0.0:0.8646:0.1354:0.0	.	1019	P51828	ADCY7_HUMAN	V	1019	ENSP00000378187:A1019V;ENSP00000254235:A1019V	ENSP00000254235:A1019V	A	+	2	0	ADCY7	48906510	1.000000	0.71417	0.998000	0.56505	0.944000	0.59088	7.651000	0.83577	1.420000	0.47138	0.561000	0.74099	GCC	-	HMMSmart_CYCc,HMMPfam_Guanylate_cyc,superfamily_A/G_cyclase,PatternScan_GUANYLATE_CYCLASE_1		0.493	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	protein_coding	OTTHUMT00000256877.3	C			48906510	+1	no_errors	NM_001114	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
EBPL	84650	genome.wustl.edu	37	13	50235197	50235197	+	Nonsense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr13:50235197C>T	ENST00000242827.6	-	4	578	c.528G>A	c.(526-528)tgG>tgA	p.W176*	EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000378270.5_3'UTR|EBPL_ENST00000378284.2_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	176					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)			endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		GGATCAGAACCCACACACCGT	0.473																																					NSCLC(39;857 1083 36109 42364 51411)											0			13											66.0	63.0	64.0					13																	50235197		2203	4300	6503	49133198	SO:0001587	stop_gained	84650			AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.528G>A	13.37:g.50235197C>T	ENSP00000242827:p.Trp176*	Somatic		Capture	Illumina GAIIx	4	49133198	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Nonsense_Mutation	SNP	HMMPfam_EBP	p.W176*	ENST00000242827.6	37	c.528	CCDS9420.1	13	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415027	0.83449	.	.	ENSG00000123179	ENST00000242827	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.1318	18.7789	0.91924	0.0:1.0:0.0:0.0	.	.	.	.	X	176	.	ENSP00000242827:W176X	W	-	3	0	EBPL	49133198	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	6.448000	0.73469	2.814000	0.96858	0.650000	0.86243	TGG	-	HMMPfam_EBP		0.473	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EBPL	protein_coding	OTTHUMT00000044932.2	C	NM_032565		49133198	-1	no_errors	NM_032565	genbank	human	provisional	54_36p	nonsense	SNP	1.000	T
LAMB2	3913	genome.wustl.edu	37	3	49160307	49160307	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:49160307G>A	ENST00000418109.1	-	28	4567	c.4403C>T	c.(4402-4404)gCa>gTa	p.A1468V	USP19_ENST00000434032.2_5'Flank|USP19_ENST00000417901.1_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.A1468V|USP19_ENST00000398888.2_5'Flank|USP19_ENST00000398892.3_5'Flank|LAMB2_ENST00000464891.1_5'Flank|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000453664.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1468	Domain I.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACCACCTTCTGCCAGTGCCCG	0.677																																																0			3											55.0	55.0	55.0					3																	49160307		2203	4300	6503	49135311	SO:0001583	missense	3913				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.4403C>T	3.37:g.49160307G>A	ENSP00000388325:p.Ala1468Val	Somatic		Capture	Illumina GAIIx	4	49135311	Q16321	Missense_Mutation	SNP	HMMSmart_LamNT,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_SSF57196,PatternScan_EGF_1,PatternScan_EGF_LAM_1,PatternScan_EGF_2	p.A1468V	ENST00000418109.1	37	c.4403	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	G	11.28	1.591654	0.28357	.	.	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000395387	T;T	0.35421	1.31;1.31	5.6	1.01	0.19927	.	0.246709	0.39341	N	0.001383	T	0.14227	0.0344	N	0.11255	0.115	0.24415	N	0.994646	B	0.02656	0.0	B	0.04013	0.001	T	0.10177	-1.0641	10	0.30078	T	0.28	.	1.7915	0.03053	0.3919:0.2945:0.2027:0.1109	.	1468	P55268	LAMB2_HUMAN	V	1468;1468;235	ENSP00000388325:A1468V;ENSP00000307156:A1468V	ENSP00000307156:A1468V	A	-	2	0	LAMB2	49135311	0.039000	0.19947	0.994000	0.49952	0.991000	0.79684	-0.126000	0.10563	0.135000	0.18707	-0.137000	0.14449	GCA	-	NULL		0.677	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	protein_coding	OTTHUMT00000345939.1	G	NM_002292		49135311	-1	no_errors	NM_002292	genbank	human	reviewed	54_36p	missense	SNP	0.824	A
NOD2	64127	genome.wustl.edu	37	16	50759443	50759443	+	Missense_Mutation	SNP	G	G	A	rs148561632		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr16:50759443G>A	ENST00000300589.2	+	10	3031	c.2926G>A	c.(2926-2928)Gca>Aca	p.A976T		NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	976					activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				ATGTTCTCTCGCAGAAGGACT	0.423																																																0			16						G	THR/ALA	0,4396		0,0,2198	94.0	93.0	93.0		2926	4.9	0.2	16	dbSNP_134	93	3,8597	3.0+/-9.4	0,3,4297	no	missense	NOD2	NM_022162.1	58	0,3,6495	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging	976/1041	50759443	3,12993	2198	4300	6498	49316944	SO:0001583	missense	64127			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.2926G>A	16.37:g.50759443G>A	ENSP00000300589:p.Ala976Thr	Somatic		Capture	Illumina GAIIx	4	49316944	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	HMMPfam_CARD,superfamily_DEATH domain,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_NACHT,superfamily_RNI-like,HMMSmart_SM00368,HMMPfam_LRR_1	p.A976T	ENST00000300589.2	37	c.2926	CCDS10746.1	16	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638430	0.47153	0.0	3.49E-4	ENSG00000167207	ENST00000526417;ENST00000300589;ENST00000431240	T	0.56776	0.44	5.82	4.87	0.63330	.	0.202787	0.34802	N	0.003672	T	0.54679	0.1873	M	0.85630	2.765	0.09310	N	1	B	0.34226	0.443	B	0.30029	0.11	T	0.58126	-0.7691	10	0.66056	D	0.02	.	10.7534	0.46221	0.0874:0.0:0.9126:0.0	.	976	Q9HC29	NOD2_HUMAN	T	949;976;116	ENSP00000300589:A976T	ENSP00000300589:A976T	A	+	1	0	NOD2	49316944	0.211000	0.23529	0.208000	0.23602	0.790000	0.44656	2.072000	0.41510	1.458000	0.47871	0.655000	0.94253	GCA	-	superfamily_RNI-like,HMMSmart_SM00368		0.423	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD2	protein_coding	OTTHUMT00000256876.2	G	NM_022162		49316944	+1	no_errors	NM_022162	genbank	human	reviewed	54_36p	missense	SNP	0.855	A
BCAM	4059	genome.wustl.edu	37	19	45317433	45317433	+	Nonsense_Mutation	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr19:45317433G>A	ENST00000270233.6	+	7	831	c.809G>A	c.(808-810)tGg>tAg	p.W270*	BCAM_ENST00000589651.1_Nonsense_Mutation_p.W270*	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	270					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				GTGCAGTTCTGGGTGGGCAGC	0.652																																																0			19											85.0	77.0	80.0					19																	45317433		2202	4300	6502	50009273	SO:0001587	stop_gained	4059			X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.809G>A	19.37:g.45317433G>A	ENSP00000270233:p.Trp270*	Somatic		Capture	Illumina GAIIx	4	50009273	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Nonsense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG,HMMPfam_C2-set_2,HMMSmart_IGc2,HMMPfam_ig	p.W270*	ENST00000270233.6	37	c.809	CCDS12644.1	19	.	.	.	.	.	.	.	.	.	.	.	20.3	3.959890	0.74016	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	.	.	.	3.98	3.98	0.46160	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-18.0398	12.2859	0.54791	0.0:0.0:1.0:0.0	.	.	.	.	X	270	.	ENSP00000270233:W270X	W	+	2	0	BCAM	50009273	1.000000	0.71417	0.993000	0.49108	0.294000	0.27393	1.460000	0.35244	2.159000	0.67721	0.462000	0.41574	TGG	-	superfamily_SSF48726		0.652	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAM	protein_coding	OTTHUMT00000453220.1	G	NM_005581		50009273	+1	no_errors	NM_005581	genbank	human	reviewed	54_36p	nonsense	SNP	0.998	A
TLR9	54106	genome.wustl.edu	37	3	52257120	52257120	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:52257120G>T	ENST00000360658.2	-	2	1845	c.1212C>A	c.(1210-1212)aaC>aaA	p.N404K	TLR9_ENST00000494383.1_Missense_Mutation_p.P558T|TLR9_ENST00000597542.1_Missense_Mutation_p.N428K	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	404					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	GCTGGGCCTGGTTGATGAAGT	0.632																																																0			3											66.0	69.0	68.0					3																	52257120		2203	4300	6503	52232160	SO:0001583	missense	54106			AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.1212C>A	3.37:g.52257120G>T	ENSP00000353874:p.Asn404Lys	Somatic		Capture	Illumina GAIIx	4	52232160	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMSmart_SM00365,HMMPfam_LRR_1,HMMSmart_SM00364,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.N404K	ENST00000360658.2	37	c.1212	CCDS2848.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.23|12.23	1.875841|1.875841	0.33162|0.33162	.|.	.|.	ENSG00000239732|ENSG00000173366	ENST00000360658|ENST00000494383	T|.	0.34859|.	1.34|.	4.98|4.98	3.14|3.14	0.36123|0.36123	.|.	0.334909|.	0.21658|.	N|.	0.071071|.	T|T	0.26810|0.26810	0.0656|0.0656	L|L	0.31476|0.31476	0.935|0.935	0.09310|0.09310	N|N	1|1	B;P|.	0.36616|.	0.002;0.561|.	B;B|.	0.30495|.	0.002;0.116|.	T|T	0.19582|0.19582	-1.0301|-1.0301	10|5	0.10902|.	T|.	0.67|.	.|.	6.0712|6.0712	0.19891|0.19891	0.0895:0.0:0.5783:0.3321|0.0895:0.0:0.5783:0.3321	.|.	501;404|.	B4E0A1;Q9NR96|.	.;TLR9_HUMAN|.	K|T	404|558	ENSP00000353874:N404K|.	ENSP00000353874:N404K|.	N|P	-|-	3|1	2|0	TLR9|RP11-330H6.5	52232160|52232160	0.000000|0.000000	0.05858|0.05858	0.996000|0.996000	0.52242|0.52242	0.510000|0.510000	0.34073|0.34073	0.154000|0.154000	0.16343|0.16343	0.579000|0.579000	0.29504|0.29504	0.655000|0.655000	0.94253|0.94253	AAC|CCA	-	superfamily_L domain-like,HMMSmart_SM00369		0.632	TLR9-001	KNOWN	basic|CCDS	protein_coding	TLR9	protein_coding	OTTHUMT00000350203.1	G			52232160	-1	no_errors	NM_017442	genbank	human	reviewed	54_36p	missense	SNP	0.616	T
FTO	79068	genome.wustl.edu	37	16	53859939	53859939	+	Missense_Mutation	SNP	G	G	T	rs139577103		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr16:53859939G>T	ENST00000471389.1	+	3	509	c.287G>T	c.(286-288)cGc>cTc	p.R96L	FTO_ENST00000394647.3_Intron	NM_001080432.2	NP_001073901.1	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	96	Fe2OG dioxygenase domain.				adipose tissue development (GO:0060612)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|oxidative demethylation (GO:0070989)|oxidative single-stranded DNA demethylation (GO:0035552)|oxidative single-stranded RNA demethylation (GO:0035553)|regulation of lipid storage (GO:0010883)|regulation of multicellular organism growth (GO:0040014)|regulation of respiratory system process (GO:0044065)|regulation of white fat cell proliferation (GO:0070350)|RNA repair (GO:0042245)|temperature homeostasis (GO:0001659)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|oxidative DNA demethylase activity (GO:0035516)|oxidative RNA demethylase activity (GO:0035515)			endometrium(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						CCGGTATCTCGCATCCTCATT	0.498																																																0			16											97.0	86.0	90.0					16																	53859939		2198	4300	6498	52417440	SO:0001583	missense	79068			BC003583	CCDS32448.1	16q12.2	2013-11-15			ENSG00000140718	ENSG00000140718		"""Alkylation repair homologs"""	24678	protein-coding gene	gene with protein product	"""AlkB homolog 9"", ""alpha-ketoglutarate-dependent dioxygenase"""	610966				17434869, 17991826, 22002720	Standard	NM_001080432		Approved	KIAA1752, MGC5149, ALKBH9	uc002ehr.3	Q9C0B1	OTTHUMG00000158780	ENST00000471389.1:c.287G>T	16.37:g.53859939G>T	ENSP00000418823:p.Arg96Leu	Somatic		Capture	Illumina GAIIx	4	52417440	A2RUH1|B2RNS0|Q0P676|Q7Z785	Missense_Mutation	SNP	NULL	p.R96L	ENST00000471389.1	37	c.287	CCDS32448.1	16	.	.	.	.	.	.	.	.	.	.	G	34	5.333505	0.95758	.	.	ENSG00000140718	ENST00000471389	D	0.85861	-2.04	5.46	5.46	0.80206	Alpha-ketoglutarate-dependent dioxygenase FTO, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92718	0.7685	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93263	0.6645	10	0.87932	D	0	-12.4496	19.3039	0.94153	0.0:0.0:1.0:0.0	.	96	Q9C0B1	FTO_HUMAN	L	96	ENSP00000418823:R96L	ENSP00000418823:R96L	R	+	2	0	FTO	52417440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.782000	0.91809	2.562000	0.86427	0.650000	0.86243	CGC	-	NULL		0.498	FTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTO	protein_coding	OTTHUMT00000352196.1	G	NM_001080432		52417440	+1	no_errors	NM_001080432	genbank	human	provisional	54_36p	missense	SNP	1.000	T
PODN	127435	genome.wustl.edu	37	1	53544495	53544495	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:53544495C>T	ENST00000312553.5	+	8	1464	c.1457C>T	c.(1456-1458)tCg>tTg	p.S486L	RP11-334A14.5_ENST00000447867.1_RNA|PODN_ENST00000371500.3_Missense_Mutation_p.S467L|PODN_ENST00000395871.2_Missense_Mutation_p.S344L	NM_001199081.1|NM_153703.4	NP_001186010.1|NP_714914.2	Q7Z5L7	PODN_HUMAN	podocan	438					negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						CTGGACCTGTCGGGCAACCGG	0.657																																																0			1											64.0	52.0	56.0					1																	53544495		2203	4298	6501	53317083	SO:0001583	missense	127435			AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000312553.5:c.1457C>T	1.37:g.53544495C>T	ENSP00000308315:p.Ser486Leu	Somatic		Capture	Illumina GAIIx	4	53317083	B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRRNT,HMMSmart_LRRNT,HMMSmart_LRR_TYP,HMMPfam_LRR_1,superfamily_SSF52047	p.S486L	ENST00000312553.5	37	c.1457	CCDS573.1	1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.035432	0.93630	.	.	ENSG00000174348	ENST00000371500;ENST00000395871;ENST00000312553	T;T;T	0.62364	0.03;0.03;0.03	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.81264	0.4786	M	0.82517	2.595	0.58432	D	0.999997	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.85130	0.981;0.997;0.951	D	0.84509	0.0621	10	0.87932	D	0	.	18.0614	0.89378	0.0:1.0:0.0:0.0	.	344;467;486	Q7Z5L7-4;Q7Z5L7-2;Q7Z5L7-3	.;.;.	L	467;344;486	ENSP00000360555:S467L;ENSP00000379212:S344L;ENSP00000308315:S486L	ENSP00000308315:S486L	S	+	2	0	PODN	53317083	1.000000	0.71417	0.978000	0.43139	0.972000	0.66771	5.756000	0.68757	2.492000	0.84095	0.555000	0.69702	TCG	-	superfamily_SSF52047,HMMSmart_LRR_TYP,HMMPfam_LRR_1		0.657	PODN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PODN	protein_coding	OTTHUMT00000024735.1	C	NM_153703		53317083	+1	no_errors	NM_153703	genbank	human	validated	54_36p	missense	SNP	0.999	T
BMP4	652	genome.wustl.edu	37	14	54416767	54416767	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr14:54416767C>G	ENST00000245451.4	-	4	1603	c.1210G>C	c.(1210-1212)Gga>Cga	p.G404R	BMP4_ENST00000559087.1_Missense_Mutation_p.G404R|BMP4_ENST00000558984.1_Missense_Mutation_p.G404R|BMP4_ENST00000417573.1_Missense_Mutation_p.G404R|MIR5580_ENST00000580850.1_RNA	NM_001202.3	NP_001193.2	P12644	BMP4_HUMAN	bone morphogenetic protein 4	404					activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification (GO:0009948)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|BMP signaling pathway involved in nephric duct formation (GO:0071893)|BMP signaling pathway involved in renal system segmentation (GO:0061151)|BMP signaling pathway involved in ureter morphogenesis (GO:0061149)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|branching morphogenesis of an epithelial tube (GO:0048754)|bronchus development (GO:0060433)|bud dilation involved in lung branching (GO:0060503)|bud elongation involved in lung branching (GO:0060449)|cardiac septum development (GO:0003279)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte differentiation (GO:0002062)|cloacal septation (GO:0060197)|common-partner SMAD protein phosphorylation (GO:0007182)|cranial suture morphogenesis (GO:0060363)|deltoid tuberosity development (GO:0035993)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint morphogenesis (GO:0060272)|endocardial cushion development (GO:0003197)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in lung morphogenesis (GO:0060502)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal cell signaling (GO:0060684)|erythrocyte differentiation (GO:0030218)|extracellular matrix organization (GO:0030198)|germ cell development (GO:0007281)|glomerular capillary formation (GO:0072104)|glomerular visceral epithelial cell development (GO:0072015)|hematopoietic progenitor cell differentiation (GO:0002244)|inner ear receptor cell differentiation (GO:0060113)|intermediate mesodermal cell differentiation (GO:0048392)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|mammary gland formation (GO:0060592)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal cell proliferation involved in ureter development (GO:0072198)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate determination (GO:0007500)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway (GO:0072097)|negative regulation of branching involved in ureteric bud morphogenesis (GO:0090191)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in heart morphogenesis (GO:2000137)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of glomerulus development (GO:0090194)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell proliferation involved in ureter development (GO:0072200)|negative regulation of metanephric comma-shaped body morphogenesis (GO:2000007)|negative regulation of metanephric S-shaped body morphogenesis (GO:2000005)|negative regulation of mitosis (GO:0045839)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of cardiac muscle fiber development (GO:0055020)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell death (GO:0010942)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of kidney development (GO:0090184)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|pulmonary artery endothelial tube morphogenesis (GO:0061155)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|renal system process (GO:0003014)|secondary heart field specification (GO:0003139)|SMAD protein signal transduction (GO:0060395)|smooth muscle tissue development (GO:0048745)|smoothened signaling pathway (GO:0007224)|specification of organ position (GO:0010159)|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway (GO:0072101)|steroid hormone mediated signaling pathway (GO:0043401)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|tendon cell differentiation (GO:0035990)|trachea development (GO:0060438)|trachea formation (GO:0060440)|type B pancreatic cell development (GO:0003323)|ureter epithelial cell differentiation (GO:0072192)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	BMP receptor binding (GO:0070700)|chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|heparin binding (GO:0008201)			breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(3)|urinary_tract(1)	19						CACCCACATCCCTCTACTACC	0.493																																																0			14											123.0	102.0	109.0					14																	54416767		2203	4300	6503	53486517	SO:0001583	missense	652			AF035427	CCDS9715.1	14q22-q23	2014-01-30			ENSG00000125378	ENSG00000125378		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1071	protein-coding gene	gene with protein product		112262		BMP2B		7558046, 7579580	Standard	NM_001202		Approved		uc010aoh.3	P12644	OTTHUMG00000140303	ENST00000245451.4:c.1210G>C	14.37:g.54416767C>G	ENSP00000245451:p.Gly404Arg	Somatic		Capture	Illumina GAIIx	4	53486517	Q9UM80	Missense_Mutation	SNP	HMMPfam_TGFb_propeptide,superfamily_Cystine-knot cytokines,HMMPfam_TGF_beta,HMMSmart_SM00204,PatternScan_TGF_BETA_1	p.G404R	ENST00000245451.4	37	c.1210	CCDS9715.1	14	.	.	.	.	.	.	.	.	.	.	C	19.26	3.792725	0.70452	.	.	ENSG00000125378	ENST00000245451;ENST00000417573	T;T	0.63096	-0.02;-0.02	5.4	5.4	0.78164	Transforming growth factor-beta, C-terminal (3);	0.098661	0.64402	D	0.000001	T	0.76140	0.3946	L	0.60067	1.865	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.77482	-0.2571	10	0.87932	D	0	.	16.7038	0.85366	0.0:1.0:0.0:0.0	.	404	P12644	BMP4_HUMAN	R	404	ENSP00000245451:G404R;ENSP00000394165:G404R	ENSP00000245451:G404R	G	-	1	0	BMP4	53486517	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.644000	0.83416	2.813000	0.96785	0.561000	0.74099	GGA	-	superfamily_Cystine-knot cytokines,HMMPfam_TGF_beta,HMMSmart_SM00204		0.493	BMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP4	protein_coding	OTTHUMT00000276894.2	C	NM_001202		53486517	-1	no_errors	NM_001202	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SYNGR4	23546	genome.wustl.edu	37	19	48878980	48878980	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr19:48878980G>T	ENST00000344846.2	+	4	692	c.442G>T	c.(442-444)Gcc>Tcc	p.A148S	SYNGR4_ENST00000601610.1_Missense_Mutation_p.A99S|SYNGR4_ENST00000595322.1_Intron	NM_012451.3	NP_036583.2	O95473	SNG4_HUMAN	synaptogyrin 4	148	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		GGCAGCCATCGCCTTCACCTT	0.602																																																0			19											95.0	84.0	88.0					19																	48878980		2203	4300	6503	53570792	SO:0001583	missense	23546			AJ011733	CCDS12717.1	19q13.3	2008-07-04				ENSG00000105467			11502	protein-coding gene	gene with protein product		608373					Standard	NM_012451		Approved		uc002piz.3	O95473		ENST00000344846.2:c.442G>T	19.37:g.48878980G>T	ENSP00000344041:p.Ala148Ser	Somatic		Capture	Illumina GAIIx	4	53570792	Q3KP58	Missense_Mutation	SNP	HMMPfam_MARVEL	p.A148S	ENST00000344846.2	37	c.442	CCDS12717.1	19	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121047	0.37436	.	.	ENSG00000105467	ENST00000344846	T	0.33216	1.42	4.53	-9.06	0.00727	Marvel (1);MARVEL-like domain (1);	0.649699	0.16953	N	0.192798	T	0.25121	0.0610	L	0.45470	1.425	0.25903	N	0.983336	B	0.28880	0.226	B	0.34489	0.184	T	0.11567	-1.0582	10	0.62326	D	0.03	-7.7214	15.543	0.76070	0.1267:0.0:0.7771:0.0962	.	148	O95473	SNG4_HUMAN	S	148	ENSP00000344041:A148S	ENSP00000344041:A148S	A	+	1	0	SYNGR4	53570792	0.002000	0.14202	0.369000	0.25952	0.702000	0.40608	-1.137000	0.03219	-2.078000	0.00872	-0.263000	0.10527	GCC	-	HMMPfam_MARVEL		0.602	SYNGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGR4	protein_coding	OTTHUMT00000465704.1	G			53570792	+1	no_errors	NM_012451	genbank	human	reviewed	54_36p	missense	SNP	0.978	T
KDR	3791	genome.wustl.edu	37	4	55968612	55968612	+	Missense_Mutation	SNP	A	A	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr4:55968612A>T	ENST00000263923.4	-	14	2346	c.2051T>A	c.(2050-2052)aTc>aAc	p.I684N		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	684	Ig-like C2-type 7.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGAGACTTCGATGCTTTCCCC	0.448			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																													Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	0			4											196.0	165.0	176.0					4																	55968612		2203	4300	6503	55663369	SO:0001583	missense	3791			AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2051T>A	4.37:g.55968612A>T	ENSP00000263923:p.Ile684Asn	Somatic		Capture	Illumina GAIIx	4	55663369	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,HMMPfam_V-set,HMMPfam_I-set,HMMSmart_IGc2,HMMPfam_ig,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_RECEPTOR_TYR_KIN_III,PatternScan_PROTEIN_KINASE_TYR	p.I684N	ENST00000263923.4	37	c.2051	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	A	17.31	3.357325	0.61293	.	.	ENSG00000128052	ENST00000263923	D	0.82619	-1.63	6.02	6.02	0.97574	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.109051	0.64402	D	0.000012	D	0.91610	0.7349	M	0.89414	3.03	0.54753	D	0.999985	D	0.56746	0.977	P	0.61003	0.882	D	0.93007	0.6428	10	0.87932	D	0	.	16.1843	0.81939	1.0:0.0:0.0:0.0	.	684	P35968	VGFR2_HUMAN	N	684	ENSP00000263923:I684N	ENSP00000263923:I684N	I	-	2	0	KDR	55663369	1.000000	0.71417	0.988000	0.46212	0.084000	0.17831	7.906000	0.87423	2.302000	0.77476	0.533000	0.62120	ATC	-	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2		0.448	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	protein_coding	OTTHUMT00000250645.1	A			55663369	-1	no_errors	NM_002253	genbank	human	validated	54_36p	missense	SNP	0.998	T
GNAS	2778	genome.wustl.edu	37	20	57415359	57415359	+	Silent	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr20:57415359C>T	ENST00000313949.7	+	1	587	c.198C>T	c.(196-198)aaC>aaT	p.N66N	GNAS-AS1_ENST00000598163.1_RNA|GNAS-AS1_ENST00000443966.1_RNA|GNAS_ENST00000371098.2_Silent_p.N66N|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371075.3_Silent_p.N66N			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCTTCCTTAACGCCCACCACC	0.682			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0			20											35.0	42.0	39.0					20																	57415359		2203	4299	6502	56848754	SO:0001819	synonymous_variant	2778			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000313949.7:c.198C>T	20.37:g.57415359C>T		Somatic		Capture	Illumina GAIIx	4	56848754	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Silent	SNP	HMMPfam_NESP55	p.N66	ENST00000313949.7	37	c.198	CCDS13471.1	20																																																																																			-	HMMPfam_NESP55		0.682	GNAS-002	KNOWN	NMD_exception|basic|CCDS	protein_coding	GNAS	protein_coding	OTTHUMT00000080418.7	C	NM_000516		56848754	+1	no_errors	NM_016592	genbank	human	reviewed	54_36p	silent	SNP	0.998	T
FPR1	2357	genome.wustl.edu	37	19	52250020	52250020	+	Silent	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr19:52250020G>A	ENST00000595042.1	-	3	369	c.228C>T	c.(226-228)tcC>tcT	p.S76S	FPR1_ENST00000304748.4_Silent_p.S76S	NM_001193306.1	NP_001180235.1	P21462	FPR1_HUMAN	formyl peptide receptor 1	76					activation of MAPK activity (GO:0000187)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|nitric oxide mediated signal transduction (GO:0007263)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)|receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(3)	20		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Nedocromil(DB00716)	ATGGCAAAGTGGAGGTGAAAC	0.522																																																0			19											142.0	110.0	121.0					19																	52250020		2203	4300	6503	56941832	SO:0001819	synonymous_variant	2357			M60627	CCDS12839.1	19q13.41	2014-09-17				ENSG00000171051		"""GPCR / Class A : Formyl peptide receptors"""	3826	protein-coding gene	gene with protein product		136537				2161213, 12595898	Standard	NM_001193306		Approved	FPR, FMLP	uc002pxq.3	P21462		ENST00000595042.1:c.228C>T	19.37:g.52250020G>A		Somatic		Capture	Illumina GAIIx	4	56941832	Q14939|Q7Z6A4|Q86U52|Q9NS48	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S76	ENST00000595042.1	37	c.228	CCDS12839.1	19																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.522	FPR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FPR1	protein_coding	OTTHUMT00000466905.1	G	NM_002029		56941832	-1	no_errors	NM_002029	genbank	human	validated	54_36p	silent	SNP	0.030	A
SYCP2	10388	genome.wustl.edu	37	20	58452580	58452580	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr20:58452580C>A	ENST00000357552.3	-	33	3235	c.3010G>T	c.(3010-3012)Gac>Tac	p.D1004Y	SYCP2_ENST00000371001.2_Missense_Mutation_p.D1004Y			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1004					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			ATTGTCTTGTCCATCTTTTTT	0.318																																																0			20											73.0	74.0	74.0					20																	58452580		2201	4295	6496	57885975	SO:0001583	missense	10388			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.3010G>T	20.37:g.58452580C>A	ENSP00000350162:p.Asp1004Tyr	Somatic		Capture	Illumina GAIIx	4	57885975	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.D1004Y	ENST00000357552.3	37	c.3010	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	C	2.224	-0.377781	0.05000	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.22539	2.24;2.24;1.95	5.8	0.232	0.15381	.	0.657537	0.15135	N	0.278587	T	0.08758	0.0217	N	0.11201	0.11	0.09310	N	1	B	0.20261	0.043	B	0.23018	0.043	T	0.25882	-1.0119	10	0.38643	T	0.18	-0.8937	2.1816	0.03876	0.1508:0.4129:0.2747:0.1616	.	1004	Q9BX26	SYCP2_HUMAN	Y	1004	ENSP00000360040:D1004Y;ENSP00000350162:D1004Y;ENSP00000402456:D1004Y	ENSP00000350162:D1004Y	D	-	1	0	SYCP2	57885975	0.004000	0.15560	0.000000	0.03702	0.032000	0.12392	0.184000	0.16939	-0.161000	0.10983	0.491000	0.48974	GAC	-	NULL		0.318	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	protein_coding	OTTHUMT00000079930.3	C	NM_014258		57885975	-1	no_errors	NM_014258	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
OR5A1	219982	genome.wustl.edu	37	11	59211212	59211212	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr11:59211212T>C	ENST00000302030.2	+	1	596	c.571T>C	c.(571-573)Tct>Cct	p.S191P		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						CCTGGCTCTGTCTTGCTCTGA	0.517																																																0			11											224.0	220.0	221.0					11																	59211212		2201	4295	6496	58967788	SO:0001583	missense	219982			AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.571T>C	11.37:g.59211212T>C	ENSP00000303096:p.Ser191Pro	Somatic		Capture	Illumina GAIIx	4	58967788	B9EH58|Q6IFF2|Q96RB1	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S191P	ENST00000302030.2	37	c.571	CCDS31561.1	11	.	.	.	.	.	.	.	.	.	.	T	16.28	3.078841	0.55753	.	.	ENSG00000172320	ENST00000302030	T	0.00301	8.21	5.98	2.24	0.28232	GPCR, rhodopsin-like superfamily (1);	0.254138	0.28230	N	0.016111	T	0.00967	0.0032	H	0.97682	4.055	0.26714	N	0.970919	D	0.76494	0.999	D	0.72982	0.979	T	0.28870	-1.0030	10	0.72032	D	0.01	-16.3378	7.8549	0.29476	0.0:0.0682:0.2589:0.6729	.	191	Q8NGJ0	OR5A1_HUMAN	P	191	ENSP00000303096:S191P	ENSP00000303096:S191P	S	+	1	0	OR5A1	58967788	0.000000	0.05858	0.328000	0.25416	0.929000	0.56500	-0.715000	0.04997	0.119000	0.18210	-0.323000	0.08544	TCT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.517	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5A1	protein_coding	OTTHUMT00000394233.1	T	NM_001004728		58967788	+1	no_errors	NM_001004728	genbank	human	provisional	54_36p	missense	SNP	0.955	C
OR4D9	390199	genome.wustl.edu	37	11	59282611	59282611	+	Missense_Mutation	SNP	A	A	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr11:59282611A>G	ENST00000329328.3	+	1	226	c.226A>G	c.(226-228)Atc>Gtc	p.I76V		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						CTTTTCCTCCATCACAGCTCC	0.468																																																0			11											168.0	160.0	163.0					11																	59282611		2201	4295	6496	59039187	SO:0001583	missense	390199			AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.226A>G	11.37:g.59282611A>G	ENSP00000328563:p.Ile76Val	Somatic		Capture	Illumina GAIIx	4	59039187	Q6IFF3	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.I76V	ENST00000329328.3	37	c.226	CCDS31564.1	11	.	.	.	.	.	.	.	.	.	.	A	0.110	-1.139395	0.01728	.	.	ENSG00000172742	ENST00000329328	T	0.00375	7.71	4.02	1.54	0.23209	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40728	U	0.001032	T	0.00073	0.0002	N	0.00514	-1.41	0.19300	N	0.999977	B	0.09022	0.002	B	0.10450	0.005	T	0.41787	-0.9489	10	0.02654	T	1	.	2.1034	0.03685	0.5837:0.1639:0.0942:0.1582	.	76	Q8NGE8	OR4D9_HUMAN	V	76	ENSP00000328563:I76V	ENSP00000328563:I76V	I	+	1	0	OR4D9	59039187	0.000000	0.05858	0.976000	0.42696	0.876000	0.50452	0.462000	0.21956	0.066000	0.16515	0.379000	0.24179	ATC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.468	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D9	protein_coding	OTTHUMT00000394237.1	A	NM_001004711		59039187	+1	no_errors	NM_001004711	genbank	human	provisional	54_36p	missense	SNP	0.001	G
TFPT	29844	genome.wustl.edu	37	19	54617895	54617895	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr19:54617895C>T	ENST00000391759.1	-	2	614	c.209G>A	c.(208-210)cGg>cAg	p.R70Q	TFPT_ENST00000391757.1_Missense_Mutation_p.R70Q|PRPF31_ENST00000321030.4_5'Flank|TFPT_ENST00000391758.1_Missense_Mutation_p.R61Q|PRPF31_ENST00000419967.1_5'Flank	NM_013342.3	NP_037474.1	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner (in childhood Leukemia)	70					apoptotic signaling pathway (GO:0097190)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(2)	4	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					GCGCCGCCGCCGACCCCGGGC	0.642			T	TCF3	pre-B ALL																																		Dom	yes		19	19q13	29844	TCF3 (E2A) fusion partner (in childhood Leukemia)		L	0			19											57.0	68.0	64.0					19																	54617895		2203	4299	6502	59309707	SO:0001583	missense	29844			AF052052	CCDS12878.1	19q13	2011-07-06			ENSG00000105619	ENSG00000105619		"""INO80 complex subunits"""	13630	protein-coding gene	gene with protein product	"""amida, partner of the E2A"", ""INO80 complex subunit F"""	609519				10644725, 16230350	Standard	NM_013342		Approved	FB1, amida, INO80F	uc010yej.1	P0C1Z6	OTTHUMG00000065906	ENST00000391759.1:c.209G>A	19.37:g.54617895C>T	ENSP00000375639:p.Arg70Gln	Somatic		Capture	Illumina GAIIx	4	59309707		Missense_Mutation	SNP	NULL	p.R70Q	ENST00000391759.1	37	c.209	CCDS12878.1	19	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431033	0.43122	.	.	ENSG00000105619	ENST00000391759;ENST00000391758;ENST00000391757	.	.	.	4.95	2.78	0.32641	.	0.362010	0.22816	N	0.055294	T	0.23014	0.0556	N	0.22421	0.69	0.23445	N	0.997664	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.23302	T	0.38	-6.7852	4.363	0.11211	0.176:0.6244:0.0:0.1996	.	70	P0C1Z6	TFPT_HUMAN	Q	70;61;70	.	ENSP00000375637:R70Q	R	-	2	0	TFPT	59309707	0.836000	0.29430	0.868000	0.34077	0.990000	0.78478	0.665000	0.25083	0.564000	0.29238	0.563000	0.77884	CGG	-	NULL		0.642	TFPT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPT	protein_coding	OTTHUMT00000141215.4	C	NM_013342		59309707	-1	no_errors	NM_013342	genbank	human	validated	54_36p	missense	SNP	0.856	T
CNOT3	4849	genome.wustl.edu	37	19	54655965	54655965	+	Silent	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr19:54655965C>T	ENST00000406403.1	+	13	3211	c.1608C>T	c.(1606-1608)gcC>gcT	p.A536A	CNOT3_ENST00000221232.5_Silent_p.A536A|CNOT3_ENST00000358389.3_Silent_p.A355A|CNOT3_ENST00000496327.1_3'UTR			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	536	Pro-rich.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTCCCCAGGCCCCTGAGCCTC	0.637																																																0			19											40.0	41.0	41.0					19																	54655965		2203	4300	6503	59347777	SO:0001819	synonymous_variant	4849			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.1608C>T	19.37:g.54655965C>T		Somatic		Capture	Illumina GAIIx	4	59347777	Q9NZN7|Q9UF76	Silent	SNP	HMMPfam_Not3,HMMPfam_NOT2_3_5	p.A536	ENST00000406403.1	37	c.1608	CCDS12880.1	19	.	.	.	.	.	.	.	.	.	.	C	12.45	1.941538	0.34283	.	.	ENSG00000088038	ENST00000457463	.	.	.	4.49	3.42	0.39159	.	.	.	.	.	T	0.48259	0.1490	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43442	-0.9391	4	.	.	.	-25.188	4.769	0.13146	0.1855:0.6324:0.0:0.1821	.	.	.	.	S	68	.	.	P	+	1	0	CNOT3	59347777	0.011000	0.17503	0.999000	0.59377	0.967000	0.64934	-1.329000	0.02677	2.199000	0.70637	0.655000	0.94253	CCC	-	NULL		0.637	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT3	protein_coding	OTTHUMT00000142130.3	C	NM_014516		59347777	+1	no_errors	NM_014516	genbank	human	validated	54_36p	silent	SNP	0.998	T
LAMA5	3911	genome.wustl.edu	37	20	60913525	60913525	+	Splice_Site	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr20:60913525C>G	ENST00000252999.3	-	12	1683	c.1617G>C	c.(1615-1617)caG>caC	p.Q539H		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	539	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGGACTCACGCTGGCAGCCGG	0.652																																																0			20											38.0	38.0	38.0					20																	60913525		2200	4296	6496	60346920	SO:0001630	splice_region_variant	3911			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.1618+1G>C	20.37:g.60913525C>G		Somatic		Capture	Illumina GAIIx	4	60346920	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	HMMSmart_SM00136,HMMPfam_Laminin_N,superfamily_Galactose-binding domain-like,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_LAM_1,HMMSmart_SM00181,PatternScan_EGF_2,HMMSmart_SM00281,HMMPfam_Laminin_B,PatternScan_TNFR_NGFR_1,HMMPfam_Laminin_I,HMMPfam_Laminin_II,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2	p.Q539H	ENST00000252999.3	37	c.1617	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808130	0.31961	.	.	ENSG00000130702	ENST00000252999	T	0.20598	2.06	5.59	2.51	0.30379	EGF-like, laminin (2);	0.267324	0.37715	N	0.001976	T	0.18002	0.0432	L	0.42744	1.35	0.80722	D	1	B	0.21688	0.059	B	0.23419	0.046	T	0.04413	-1.0953	10	0.37606	T	0.19	.	10.539	0.45022	0.0:0.6705:0.2604:0.0691	.	539	O15230	LAMA5_HUMAN	H	539	ENSP00000252999:Q539H	ENSP00000252999:Q539H	Q	-	3	2	LAMA5	60346920	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	1.329000	0.33770	0.267000	0.21916	0.561000	0.74099	CAG	-	HMMSmart_SM00181,PatternScan_EGF_LAM_1		0.652	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	protein_coding	OTTHUMT00000080014.2	C	NM_005560	Missense_Mutation	60346920	-1	no_errors	NM_005560	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
LOC101927016	101927016	genome.wustl.edu	37	13	64321072	64321072	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr13:64321072G>A	ENST00000453638.2	+	1	139	c.139G>A	c.(139-141)Ggc>Agc	p.G47S	RP11-473M10.3_ENST00000418943.1_lincRNA																endometrium(2)|lung(1)|urinary_tract(1)	4						ctatggctgtggctatggctc	0.557																																																0			13																																								63219073	SO:0001583	missense	647262																														ENST00000453638.2:c.139G>A	13.37:g.64321072G>A	ENSP00000443634:p.Gly47Ser	Somatic		Capture	Illumina GAIIx	4	63219073		Missense_Mutation	SNP	NULL	p.G47S	ENST00000453638.2	37	c.139		13	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554873	0.27739	.	.	ENSG00000226974	ENST00000453638	D	0.92545	-3.06	1.71	1.71	0.24356	.	.	.	.	.	D	0.88735	0.6517	.	.	.	.	.	.	.	.	.	.	.	.	D	0.86536	0.1825	5	0.29301	T	0.29	.	7.0477	0.25055	0.0:0.0:1.0:0.0	.	.	.	.	S	47	ENSP00000443634:G47S	ENSP00000443634:G47S	G	+	1	0	AL445989.1	63219073	0.008000	0.16893	0.777000	0.31699	0.023000	0.10783	0.132000	0.15891	1.305000	0.44909	0.447000	0.29281	GGC	-	NULL		0.557	AL445989.1-201	KNOWN	basic|appris_principal	protein_coding	LOC647262	protein_coding		G			63219073	+1	no_errors	XM_934622	genbank	human	model	54_36p	missense	SNP	0.094	A
IL26	55801	genome.wustl.edu	37	12	68619501	68619501	+	Silent	SNP	C	C	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr12:68619501C>A	ENST00000229134.4	-	1	100	c.36G>T	c.(34-36)ctG>ctT	p.L12L	IFNG-AS1_ENST00000536914.1_RNA	NM_018402.1	NP_060872.1	Q9NPH9	IL26_HUMAN	interleukin 26	12					cell-cell signaling (GO:0007267)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		GAGTGACTAACAGCAACCCAC	0.483																																																0			12											275.0	237.0	250.0					12																	68619501		2203	4300	6503	66905768	SO:0001819	synonymous_variant	55801			AJ251549	CCDS8981.1	12q15	2008-08-04			ENSG00000111536	ENSG00000111536		"""Interleukins and interleukin receptors"""	17119	protein-coding gene	gene with protein product		605679				10729163, 11528524	Standard	NM_018402		Approved	AK155, IL-26	uc001stx.1	Q9NPH9	OTTHUMG00000169114	ENST00000229134.4:c.36G>T	12.37:g.68619501C>A		Somatic		Capture	Illumina GAIIx	4	66905768		Silent	SNP	superfamily_4_helix_cytokine,HMMSmart_IL10,PatternScan_INTERLEUKIN_10,HMMPfam_IL10	p.L12	ENST00000229134.4	37	c.36	CCDS8981.1	12																																																																																			-	NULL		0.483	IL26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL26	protein_coding	OTTHUMT00000402302.1	C	NM_018402		66905768	-1	no_errors	NM_018402	genbank	human	reviewed	54_36p	silent	SNP	0.018	A
COG4	25839	genome.wustl.edu	37	16	70530318	70530318	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr16:70530318T>C	ENST00000323786.5	-	12	1519	c.1498A>G	c.(1498-1500)Aag>Gag	p.K500E		NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	496					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				ATCCGCAGCTTATTACACAGA	0.562																																																0			16											83.0	69.0	74.0					16																	70530318		2198	4300	6498	69087819	SO:0001583	missense	25839			AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.1498A>G	16.37:g.70530318T>C	ENSP00000315775:p.Lys500Glu	Somatic		Capture	Illumina GAIIx	4	69087819	B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	HMMPfam_COG4,HMMSmart_SM00762	p.K500E	ENST00000323786.5	37	c.1498	CCDS10892.2	16	.	.	.	.	.	.	.	.	.	.	T	26.3	4.726601	0.89298	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000539961	T	0.53640	0.61	6.04	6.04	0.98038	Conserved oligomeric Golgi complex, subunit 4 (2);	0.000000	0.85682	D	0.000000	T	0.62768	0.2455	M	0.83223	2.63	0.80722	D	1	P;P;P	0.51791	0.948;0.623;0.9	P;B;P	0.49887	0.625;0.372;0.472	T	0.68157	-0.5483	10	0.54805	T	0.06	-25.8571	16.5763	0.84648	0.0:0.0:0.0:1.0	.	406;495;496	Q8N8L9;Q6PIW8;Q9H9E3	.;.;COG4_HUMAN	E	500;496;158	ENSP00000315775:K500E	ENSP00000315775:K500E	K	-	1	0	COG4	69087819	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.846000	0.86887	2.317000	0.78254	0.459000	0.35465	AAG	-	HMMPfam_COG4,HMMSmart_SM00762		0.562	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	protein_coding	OTTHUMT00000250326.3	T			69087819	-1	no_errors	NM_015386	genbank	human	validated	54_36p	missense	SNP	1.000	C
BAI3	577	genome.wustl.edu	37	6	69348999	69348999	+	Silent	SNP	A	A	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr6:69348999A>G	ENST00000370598.1	+	3	1253	c.432A>G	c.(430-432)aaA>aaG	p.K144K		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	144	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TACAGAAAAAAGGGGAAGAAG	0.353																																																0			6											50.0	52.0	51.0					6																	69348999		2203	4300	6503	69405720	SO:0001819	synonymous_variant	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.432A>G	6.37:g.69348999A>G		Somatic		Capture	Illumina GAIIx	4	69405720	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00008,HMMPfam_HRM,HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.K144	ENST00000370598.1	37	c.432	CCDS4968.1	6																																																																																			-	NULL		0.353	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	protein_coding	OTTHUMT00000041120.1	A			69405720	+1	no_errors	NM_001704	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
DLG3	1741	genome.wustl.edu	37	X	69670154	69670154	+	Splice_Site	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chrX:69670154C>T	ENST00000374360.3	+	5	1072	c.839C>T	c.(838-840)gCg>gTg	p.A280V	DLG3-AS1_ENST00000431103.1_RNA|DLG3_ENST00000194900.4_Splice_Site_p.A298V|DLG3-AS1_ENST00000424211.1_RNA|DLG3_ENST00000374355.3_5'Flank|RNU4-81P_ENST00000363561.1_RNA	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	280	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)			endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					CGGCTGCTGGCGGTGAGACAG	0.567																																																0			X											25.0	21.0	22.0					X																	69670154		2197	4267	6464	69586879	SO:0001630	splice_region_variant	1741			U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.840+1C>T	X.37:g.69670154C>T		Somatic		Capture	Illumina GAIIx	4	69586879	B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Missense_Mutation	SNP	HMMPfam_MAGUK_N_PEST,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,HMMPfam_PDZ_assoc,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00072,PatternScan_GUANYLATE_KINASE_1,HMMPfam_Guanylate_kin,HMMPfam_Gua_kin_assoc_C	p.A280V	ENST00000374360.3	37	c.839	CCDS14403.1	X	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951971	0.73787	.	.	ENSG00000082458	ENST00000194900;ENST00000374360	T;T	0.30182	1.54;1.54	4.48	4.48	0.54585	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.42494	0.1205	M	0.91561	3.22	0.80722	D	1	P	0.45594	0.862	B	0.37601	0.254	T	0.60767	-0.7198	9	.	.	.	.	15.3401	0.74290	0.0:1.0:0.0:0.0	.	280	Q92796	DLG3_HUMAN	V	298;280	ENSP00000194900:A298V;ENSP00000363480:A280V	.	A	+	2	0	DLG3	69586879	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.228000	0.78079	2.067000	0.61834	0.436000	0.28706	GCG	-	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228		0.567	DLG3-001	KNOWN	basic|CCDS	protein_coding	DLG3	protein_coding	OTTHUMT00000057074.2	C	NM_021120	Missense_Mutation	69586879	+1	no_errors	NM_021120	genbank	human	validated	54_36p	missense	SNP	1.000	T
UGT2A3	79799	genome.wustl.edu	37	4	69817045	69817045	+	Missense_Mutation	SNP	A	A	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr4:69817045A>G	ENST00000251566.4	-	1	464	c.434T>C	c.(433-435)gTa>gCa	p.V145A	UGT2A3_ENST00000420231.2_5'UTR	NM_024743.3	NP_079019.3	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A3	145					cellular glucuronidation (GO:0052695)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TATAAGCATTACATCGTAGTT	0.398																																																0			4											75.0	75.0	75.0					4																	69817045		2203	4300	6503	69851634	SO:0001583	missense	79799				CCDS3525.1	4q13.2	2010-12-14			ENSG00000135220	ENSG00000135220		"""UDP glucuronosyltransferases"""	28528	protein-coding gene	gene with protein product							Standard	NM_024743		Approved	FLJ21934	uc003hef.2	Q6UWM9	OTTHUMG00000129408	ENST00000251566.4:c.434T>C	4.37:g.69817045A>G	ENSP00000251566:p.Val145Ala	Somatic		Capture	Illumina GAIIx	4	69851634	Q9H6S4	Missense_Mutation	SNP	PatternScan_HMA_1,superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_UDPGT,PatternScan_UDPGT	p.V145A	ENST00000251566.4	37	c.434	CCDS3525.1	4	.	.	.	.	.	.	.	.	.	.	A	15.17	2.755406	0.49362	.	.	ENSG00000135220	ENST00000251566	T	0.61742	0.08	4.74	3.57	0.40892	.	0.079729	0.51477	D	0.000093	T	0.65428	0.2690	L	0.58583	1.82	0.52099	D	0.999948	D	0.64830	0.994	D	0.68483	0.958	T	0.60915	-0.7168	10	0.20519	T	0.43	.	8.0985	0.30844	0.9044:0.0:0.0956:0.0	.	145	Q6UWM9	UD2A3_HUMAN	A	145	ENSP00000251566:V145A	ENSP00000251566:V145A	V	-	2	0	UGT2A3	69851634	0.063000	0.20901	0.005000	0.12908	0.251000	0.25915	3.632000	0.54287	0.868000	0.35678	0.482000	0.46254	GTA	-	superfamily_UDP-Glycosyltransferase/glycogen phosphorylase,HMMPfam_UDPGT		0.398	UGT2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A3	protein_coding	OTTHUMT00000251564.1	A	NM_024743		69851634	-1	no_errors	NM_024743	genbank	human	validated	54_36p	missense	SNP	0.362	G
POM121	9883	genome.wustl.edu	37	7	72413915	72413915	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr7:72413915G>C	ENST00000434423.2	+	11	3383	c.3383G>C	c.(3382-3384)aGc>aCc	p.S1128T	POM121_ENST00000358357.3_Missense_Mutation_p.S863T|POM121_ENST00000257622.4_Missense_Mutation_p.S863T|POM121_ENST00000446813.1_Missense_Mutation_p.S863T|POM121_ENST00000395270.1_Missense_Mutation_p.S863T			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1128	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				GGAGCTTTCAGCTTTGGAGCA	0.647																																																0			7											24.0	24.0	24.0					7																	72413915		2201	4299	6500	72051851	SO:0001583	missense	9883			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.3383G>C	7.37:g.72413915G>C	ENSP00000405562:p.Ser1128Thr	Somatic		Capture	Illumina GAIIx	4	72051851	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NULL	p.S863T	ENST00000434423.2	37	c.2588		7	.	.	.	.	.	.	.	.	.	.	G	5.492	0.275827	0.10403	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.07327	3.2;3.23;3.2;3.23;3.4	3.01	1.02	0.19986	.	0.295611	0.24285	N	0.039873	T	0.09202	0.0227	M	0.73217	2.22	0.21020	N	0.999806	P;P	0.40731	0.728;0.728	B;B	0.38616	0.277;0.277	T	0.16571	-1.0398	10	0.40728	T	0.16	.	5.1481	0.14996	0.1236:0.2133:0.6631:0.0	.	863;1128	A8MXF9;Q96HA1	.;P121A_HUMAN	T	863;863;863;863;1128	ENSP00000393020:S863T;ENSP00000257622:S863T;ENSP00000378687:S863T;ENSP00000351124:S863T;ENSP00000405562:S1128T	ENSP00000257622:S863T	S	+	2	0	POM121	72051851	0.991000	0.36638	0.006000	0.13384	0.006000	0.05464	0.068000	0.14531	0.106000	0.17784	0.391000	0.25812	AGC	-	NULL		0.647	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	protein_coding	OTTHUMT00000347344.1	G			72051851	+1	no_errors	NM_172020	genbank	human	reviewed	54_36p	missense	SNP	0.158	C
PAAF1	80227	genome.wustl.edu	37	11	73632769	73632769	+	Intron	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr11:73632769C>G	ENST00000310571.3	+	10	1071				PAAF1_ENST00000541951.1_Intron|PAAF1_ENST00000536003.1_Intron|PAAF1_ENST00000544909.1_Intron|PAAF1_ENST00000376384.5_Intron|PAAF1_ENST00000535604.1_Intron|PAAF1_ENST00000544552.1_Intron	NM_025155.2	NP_079431.1	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1						viral process (GO:0016032)	proteasome complex (GO:0000502)				breast(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(11;7.42e-05)					CCACTTGCAGCGTTTATCATT	0.473																																																0			11																																								73310417	SO:0001627	intron_variant	729841			BC006142	CCDS8226.1, CCDS58157.1, CCDS58158.1	11q13.4	2013-05-21	2007-08-16	2007-08-16	ENSG00000175575	ENSG00000175575		"""WD repeat domain containing"""	25687	protein-coding gene	gene with protein product			"""WD repeat domain 71"""	WDR71		15831487, 17317272, 17289585	Standard	NM_001267803		Approved	FLJ11848, Rpn14	uc001ouk.2	Q9BRP4	OTTHUMG00000168062	ENST00000310571.3:c.1018+2692C>G	11.37:g.73632769C>G		Somatic		Capture	Illumina GAIIx	4	73310417	A6NDR5|B4DPB0|B7ZAS9|Q4G165|Q53HS9|Q7Z500|Q8TBU6|Q9HAB6	RNA	SNP	-	NULL	ENST00000310571.3	37	NULL	CCDS8226.1	11																																																																																			-	-		0.473	PAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729841	protein_coding	OTTHUMT00000397885.1	C	NM_025155		73310417	-1	pseudogene	XR_016017	genbank	human	model	54_36p	rna	SNP	1.000	G
TMC1	117531	genome.wustl.edu	37	9	75435908	75435908	+	Silent	SNP	C	C	T	rs370910801		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr9:75435908C>T	ENST00000297784.5	+	20	2454	c.1914C>T	c.(1912-1914)ggC>ggT	p.G638G	TMC1_ENST00000486417.1_3'UTR|TMC1_ENST00000396237.3_Silent_p.G638G|TMC1_ENST00000340019.3_Silent_p.G638G	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	638					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						TCTACCTGGGCATGCTACTGC	0.488																																					Pancreas(75;173 1345 14232 34245 43413)											0			9											254.0	214.0	228.0					9																	75435908		2203	4300	6503	74625728	SO:0001819	synonymous_variant	117531			AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1914C>T	9.37:g.75435908C>T		Somatic		Capture	Illumina GAIIx	4	74625728	A8MVZ2|B1AM91	Silent	SNP	HMMPfam_TMC	p.G638	ENST00000297784.5	37	c.1914	CCDS6643.1	9																																																																																			-	NULL		0.488	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC1	protein_coding	OTTHUMT00000052655.1	C			74625728	+1	no_errors	NM_138691	genbank	human	reviewed	54_36p	silent	SNP	0.995	T
FLVCR2	55640	genome.wustl.edu	37	14	76108239	76108239	+	Missense_Mutation	SNP	A	A	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr14:76108239A>T	ENST00000238667.4	+	9	1863	c.1507A>T	c.(1507-1509)Aac>Tac	p.N503Y	FLVCR2_ENST00000556241.1_Intron|FLVCR2_ENST00000555027.1_Missense_Mutation_p.N218Y|FLVCR2_ENST00000556856.1_Intron|FLVCR2_ENST00000539311.1_Missense_Mutation_p.N298Y|FLVCR2_ENST00000553587.1_Intron	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	503					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		AACTCTTGAGAACGTGAGTAT	0.463																																																0			14											126.0	120.0	122.0					14																	76108239		2203	4300	6503	75177992	SO:0001583	missense	55640			AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.1507A>T	14.37:g.76108239A>T	ENSP00000238667:p.Asn503Tyr	Somatic		Capture	Illumina GAIIx	4	75177992	B7Z485|Q53ZT9|Q96JY3|Q9NX90	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.N503Y	ENST00000238667.4	37	c.1507	CCDS9844.1	14	.	.	.	.	.	.	.	.	.	.	A	12.24	1.877417	0.33162	.	.	ENSG00000119686	ENST00000238667;ENST00000539311;ENST00000554580;ENST00000555027	D;D;D;D	0.88818	-1.95;-2.02;-2.43;-2.38	5.55	5.55	0.83447	Major facilitator superfamily domain, general substrate transporter (1);	0.250060	0.36815	N	0.002383	D	0.83013	0.5162	L	0.29908	0.895	0.58432	D	0.999999	B;B	0.33448	0.412;0.412	B;B	0.31614	0.133;0.133	D	0.83435	0.0040	10	0.56958	D	0.05	-16.5197	14.2135	0.65779	1.0:0.0:0.0:0.0	.	298;503	B7Z485;Q9UPI3	.;FLVC2_HUMAN	Y	503;298;203;218	ENSP00000238667:N503Y;ENSP00000443439:N298Y;ENSP00000451781:N203Y;ENSP00000452453:N218Y	ENSP00000238667:N503Y	N	+	1	0	AC007182.1	75177992	0.986000	0.35501	0.683000	0.30040	0.391000	0.30476	2.993000	0.49425	2.233000	0.73108	0.533000	0.62120	AAC	-	superfamily_MFS_gen_substrate_transporter		0.463	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLVCR2	protein_coding	OTTHUMT00000413672.1	A	NM_017791		75177992	+1	no_errors	NM_017791	genbank	human	validated	54_36p	missense	SNP	0.580	T
Unknown	0	genome.wustl.edu	37	12	77151439	77151439	+	IGR	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr12:77151439G>C								RP11-20E24.1 (142228 upstream) : ZDHHC17 (5928 downstream)																							GGAAGGCCAAGTTTGATGAAG	0.313																																																0			12																																								75675570	SO:0001628	intergenic_variant	727789																															12.37:g.77151439G>C		Somatic		Capture	Illumina GAIIx	4	75675570		RNA	SNP	-	NULL		37	NULL		12																																																																																			-	-	0	0.313					LOC727789			G			75675570	+1	pseudogene	XR_015128	genbank	human	model	54_36p	rna	SNP	0.962	C
NRXN3	9369	genome.wustl.edu	37	14	79270070	79270070	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr14:79270070G>A	ENST00000554719.1	+	6	1524	c.1033G>A	c.(1033-1035)Gct>Act	p.A345T	NRXN3_ENST00000335750.5_Missense_Mutation_p.A345T	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	122					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GTCCCAGCGAGCTTATGGGCT	0.547																																																0			14											183.0	134.0	150.0					14																	79270070		2203	4300	6503	78339823	SO:0001583	missense	9369			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1033G>A	14.37:g.79270070G>A	ENSP00000451648:p.Ala345Thr	Somatic		Capture	Illumina GAIIx	4	78339823	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	superfamily_ConA_like_lec_gl,HMMPfam_Laminin_G_2,HMMSmart_LamG,HMMSmart_EGF,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,HMMSmart_4.1m	p.A345T	ENST00000554719.1	37	c.1033	CCDS9870.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.618143	0.96649	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750	T;T	0.78364	-1.17;-1.17	6.17	6.17	0.99709	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.89076	0.6612	.	.	.	0.80722	D	1	D;P	0.89917	1.0;0.804	D;B	0.91635	0.999;0.418	D	0.87318	0.2316	8	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	718;345	Q9Y4C0;Q9Y4C0-3	NRX3A_HUMAN;.	T	718;716;345;345	ENSP00000451648:A345T;ENSP00000338349:A345T	.	A	+	1	0	NRXN3	78339823	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GCT	-	superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2		0.547	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRXN3	protein_coding	OTTHUMT00000413787.1	G	NM_001105250		78339823	+1	no_errors	NM_004796	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
VPS13A	23230	genome.wustl.edu	37	9	79981666	79981666	+	Silent	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr9:79981666T>C	ENST00000360280.3	+	61	8609	c.8349T>C	c.(8347-8349)agT>agC	p.S2783S	VPS13A_ENST00000376636.3_Silent_p.S2744S|VPS13A_ENST00000376634.4_Silent_p.S2783S|VPS13A_ENST00000357409.5_Silent_p.S2783S	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2783					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TTTCACTGAGTTCCGGCAGAG	0.299																																																0			9											47.0	48.0	48.0					9																	79981666		2203	4298	6501	79171486	SO:0001819	synonymous_variant	23230			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.8349T>C	9.37:g.79981666T>C		Somatic		Capture	Illumina GAIIx	4	79171486	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	HMMPfam_DUF1162	p.S2783	ENST00000360280.3	37	c.8349	CCDS6655.1	9																																																																																			-	NULL		0.299	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	protein_coding	OTTHUMT00000052753.2	T	NM_015186		79171486	+1	no_errors	NM_033305	genbank	human	reviewed	54_36p	silent	SNP	0.954	C
RASGRF2	5924	genome.wustl.edu	37	5	80422919	80422919	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr5:80422919T>C	ENST00000265080.4	+	17	2690	c.2623T>C	c.(2623-2625)Tct>Cct	p.S875P		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	875					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TGCCCACTGCTCTGTTTCACC	0.458																																																0			5											65.0	65.0	65.0					5																	80422919		2203	4300	6503	80458675	SO:0001583	missense	5924			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2623T>C	5.37:g.80422919T>C	ENSP00000265080:p.Ser875Pro	Somatic		Capture	Illumina GAIIx	4	80458675	B9EG89|Q9UK56	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMPfam_IQ,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_Ras GEF,HMMSmart_SM00229,HMMPfam_RasGEF_N,HMMSmart_SM00147,HMMPfam_RasGEF,PatternScan_RASGEF	p.S875P	ENST00000265080.4	37	c.2623	CCDS4052.1	5	.	.	.	.	.	.	.	.	.	.	T	12.81	2.048201	0.36181	.	.	ENSG00000113319	ENST00000265080	T	0.75260	-0.92	5.92	4.74	0.60224	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.249746	0.48767	N	0.000170	T	0.59676	0.2211	N	0.22421	0.69	0.38153	D	0.938817	B	0.06786	0.001	B	0.04013	0.001	T	0.55289	-0.8164	10	0.27785	T	0.31	.	11.533	0.50620	0.0:0.0:0.2822:0.7178	.	875	O14827	RGRF2_HUMAN	P	875	ENSP00000265080:S875P	ENSP00000265080:S875P	S	+	1	0	RASGRF2	80458675	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	2.045000	0.41250	1.026000	0.39733	0.528000	0.53228	TCT	-	superfamily_Ras GEF,HMMPfam_RasGEF_N,HMMSmart_SM00229		0.458	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRF2	protein_coding	OTTHUMT00000239215.2	T	NM_006909		80458675	+1	no_errors	NM_006909	genbank	human	validated	54_36p	missense	SNP	0.991	C
KRT18P24	340460	genome.wustl.edu	37	9	81652257	81652257	+	IGR	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr9:81652257T>C								PSAT1 (707248 upstream) : RP11-165H23.1 (98079 downstream)																							ATCTAGGGTCTCTTCTTCTCC	0.527																																																0			9																																								80842077	SO:0001628	intergenic_variant	340460																															9.37:g.81652257T>C		Somatic		Capture	Illumina GAIIx	4	80842077		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.527					KRT18P24			T			80842077	-1	pseudogene	XR_016865	genbank	human	model	54_36p	rna	SNP	0.997	C
TERF1P4	648283	genome.wustl.edu	37	X	83004871	83004871	+	IGR	SNP	C	C	T	rs191233980		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chrX:83004871C>T								RP3-326L13.3 (237736 upstream) : CYLC1 (111282 downstream)																							GCGGCCATCGCGGAAAGCTCA	0.592													C|||	18	0.00476821	0.0023	0.0072	3775	,	,		11384	0.0		0.004	False		,,,				2504	0.0061															0			X																																								82891527	SO:0001628	intergenic_variant	0																															X.37:g.83004871C>T		Somatic		Capture	Illumina GAIIx	4	82891527		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.592					LOC648283			C			82891527	-1	pseudogene	XR_038857	genbank	human	model	54_36p	rna	SNP	0.068	T
ME1	4199	genome.wustl.edu	37	6	84061798	84061798	+	Silent	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr6:84061798T>C	ENST00000369705.3	-	4	539	c.423A>G	c.(421-423)ccA>ccG	p.P141P	ME1_ENST00000543031.1_Silent_p.P66P|ME1_ENST00000541327.1_5'UTR	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	141					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)			NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		TGACATCTTCTGGCCATGCAT	0.318																																																0			6											63.0	55.0	58.0					6																	84061798		2203	4300	6503	84118517	SO:0001819	synonymous_variant	4199			X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.423A>G	6.37:g.84061798T>C		Somatic		Capture	Illumina GAIIx	4	84118517	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Silent	SNP	superfamily_SSF53223,HMMPfam_malic,PatternScan_MALIC_ENZYMES,HMMPfam_Malic_M,superfamily_NAD(P)-bd	p.P141	ENST00000369705.3	37	c.423	CCDS34492.1	6																																																																																			-	superfamily_SSF53223,HMMPfam_malic		0.318	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME1	protein_coding	OTTHUMT00000041350.1	T			84118517	-1	no_errors	NM_002395	genbank	human	reviewed	54_36p	silent	SNP	0.995	C
STIP1P3	441505	genome.wustl.edu	37	X	85340614	85340614	+	IGR	SNP	A	A	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chrX:85340614A>G								CHM (38048 upstream) : DACH2 (62847 downstream)																							GTAATGCTTCAAGGCTGTCAG	0.458																																																0			X																																								85227270	SO:0001628	intergenic_variant	441505																															X.37:g.85340614A>G		Somatic		Capture	Illumina GAIIx	4	85227270		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.458					LOC441505			A			85227270	-1	pseudogene	XR_016229	genbank	human	model	54_36p	rna	SNP	1.000	G
GRM3	2913	genome.wustl.edu	37	7	86416244	86416244	+	Missense_Mutation	SNP	T	T	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr7:86416244T>G	ENST00000361669.2	+	3	2235	c.1136T>G	c.(1135-1137)aTc>aGc	p.I379S	AC005009.2_ENST00000452471.1_RNA|GRM3_ENST00000536043.1_Missense_Mutation_p.I251S|AC005009.2_ENST00000418031.1_RNA|GRM3_ENST00000394720.2_Missense_Mutation_p.I377S|GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Missense_Mutation_p.I379S	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	379					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					CACCTGGCCATCGACAGCAGC	0.567																																					GBM(52;969 1098 3139 52280)											0			7											125.0	104.0	111.0					7																	86416244		2203	4300	6503	86254180	SO:0001583	missense	2913				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1136T>G	7.37:g.86416244T>G	ENSP00000355316:p.Ile379Ser	Somatic		Capture	Illumina GAIIx	4	86254180	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3	p.I379S	ENST00000361669.2	37	c.1136	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	T	23.0	4.358309	0.82243	.	.	ENSG00000198822	ENST00000361669;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	5.93	5.93	0.95920	Extracellular ligand-binding receptor (1);	0.233996	0.48286	D	0.000194	D	0.90981	0.7164	L	0.51853	1.615	0.58432	D	0.999999	B;P;B	0.44816	0.396;0.844;0.243	P;P;P	0.61132	0.798;0.884;0.87	D	0.91173	0.4970	10	0.56958	D	0.05	.	15.5577	0.76213	0.0:0.0:0.0:1.0	.	251;379;379	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	S	379;251;379;377	ENSP00000355316:I379S;ENSP00000441407:I251S;ENSP00000398767:I379S;ENSP00000378209:I377S	ENSP00000355316:I379S	I	+	2	0	GRM3	86254180	0.999000	0.42202	0.979000	0.43373	0.995000	0.86356	6.142000	0.71750	2.263000	0.75096	0.533000	0.62120	ATC	-	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor		0.567	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	protein_coding	OTTHUMT00000253362.2	T			86254180	+1	no_errors	NM_000840	genbank	human	reviewed	54_36p	missense	SNP	0.813	G
ABCB1	5243	genome.wustl.edu	37	7	87144616	87144616	+	Missense_Mutation	SNP	G	G	T	rs202201068		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr7:87144616G>T	ENST00000265724.3	-	26	3630	c.3213C>A	c.(3211-3213)agC>agA	p.S1071R	ABCB1_ENST00000543898.1_Missense_Mutation_p.S1007R|ABCB1_ENST00000488737.2_5'UTR	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	1071	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CACAGCCACTGCTGCCCACCA	0.572																																																0			7											66.0	61.0	63.0					7																	87144616		2203	4300	6503	86982552	SO:0001583	missense	5243			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.3213C>A	7.37:g.87144616G>T	ENSP00000265724:p.Ser1071Arg	Somatic		Capture	Illumina GAIIx	4	86982552	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.S1071R	ENST00000265724.3	37	c.3213	CCDS5608.1	7	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919938	0.73098	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.93488	-3.23;-3.23	6.06	5.18	0.71444	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.311492	0.44483	D	0.000446	D	0.89354	0.6691	N	0.10645	0.015	0.80722	D	1	P;D	0.54047	0.895;0.964	B;P	0.50617	0.173;0.646	D	0.91538	0.5247	10	0.72032	D	0.01	-4.2895	14.4176	0.67160	0.0701:0.0:0.9299:0.0	.	1007;1071	B5AK60;P08183	.;MDR1_HUMAN	R	852;1071;1007	ENSP00000265724:S1071R;ENSP00000444095:S1007R	ENSP00000265724:S1071R	S	-	3	2	ABCB1	86982552	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.775000	0.75018	1.584000	0.49913	0.655000	0.94253	AGC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran		0.572	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	protein_coding	OTTHUMT00000335444.2	G	NM_000927		86982552	-1	no_errors	NM_000927	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
GBP4	115361	genome.wustl.edu	37	1	89654347	89654347	+	Missense_Mutation	SNP	A	A	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:89654347A>G	ENST00000355754.6	-	8	1425	c.1328T>C	c.(1327-1329)gTt>gCt	p.V443A		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	443						cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		TCCTCCAGGAACAGAGAAAAT	0.453																																																0			1											239.0	259.0	252.0					1																	89654347		2203	4300	6503	89426935	SO:0001583	missense	115361			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.1328T>C	1.37:g.89654347A>G	ENSP00000359490:p.Val443Ala	Somatic		Capture	Illumina GAIIx	4	89426935	B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	superfamily_SSF52540,HMMPfam_GBP,HMMPfam_GBP_C,superfamily_GBP	p.V443A	ENST00000355754.6	37	c.1328	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	A	6.786	0.514087	0.12944	.	.	ENSG00000162654	ENST00000355754	T	0.02032	4.49	4.73	2.34	0.29019	Guanylate-binding protein, C-terminal (3);	0.315912	0.29987	N	0.010700	T	0.00967	0.0032	M	0.75085	2.285	0.09310	N	1	B	0.23806	0.091	B	0.33690	0.168	T	0.50415	-0.8831	10	0.08837	T	0.75	.	3.8562	0.08976	0.5807:0.0:0.0906:0.3287	.	443	Q96PP9	GBP4_HUMAN	A	443	ENSP00000359490:V443A	ENSP00000359490:V443A	V	-	2	0	GBP4	89426935	0.008000	0.16893	0.208000	0.23602	0.116000	0.19942	0.911000	0.28584	0.368000	0.24481	-0.333000	0.08304	GTT	-	HMMPfam_GBP_C,superfamily_GBP		0.453	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	protein_coding	OTTHUMT00000029409.1	A	NM_052941		89426935	-1	no_errors	NM_052941	genbank	human	validated	54_36p	missense	SNP	0.803	G
LIPJ	142910	genome.wustl.edu	37	10	90356624	90356624	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr10:90356624G>C	ENST00000371939.3	+	8	968	c.654G>C	c.(652-654)caG>caC	p.Q218H		NM_001010939.2	NP_001010939.2	Q5W064	LIPJ_HUMAN	lipase, family member J	218					lipid catabolic process (GO:0016042)		hydrolase activity, acting on ester bonds (GO:0016788)			large_intestine(4)|lung(4)|ovary(1)	9		all_cancers(4;2.79e-10)|Prostate(4;1.68e-15)|all_epithelial(4;1.43e-09)|Colorectal(252;0.0381)|Breast(4;0.141)|Melanoma(5;0.2)|all_hematologic(4;0.222)		Colorectal(12;1.02e-05)|COAD - Colon adenocarcinoma(12;1.54e-05)		GTCCACTACAGATTTTTGATA	0.279																																																0			10											70.0	81.0	77.0					10																	90356624		2203	4295	6498	90346604	SO:0001583	missense	142910			BC031219	CCDS31240.1	10q23.31	2008-02-04	2008-02-04	2007-02-27	ENSG00000204022	ENSG00000204022			21773	protein-coding gene	gene with protein product		613921	"""lipase-like, ab-hydrolase domain containing 1"", ""lipase, family member J"""	LIPL1			Standard	NM_001010939		Approved	bA425M17.2	uc001kff.3	Q5W064	OTTHUMG00000018691	ENST00000371939.3:c.654G>C	10.37:g.90356624G>C	ENSP00000361007:p.Gln218His	Somatic		Capture	Illumina GAIIx	4	90346604	A8MT98|Q0P671	Missense_Mutation	SNP	HMMPfam_Abhydro_lipase,superfamily_alpha/beta-Hydrolases,HMMPfam_Abhydrolase_1	p.Q218H	ENST00000371939.3	37	c.654	CCDS31240.1	10	.	.	.	.	.	.	.	.	.	.	G	7.416	0.635758	0.14386	.	.	ENSG00000204022	ENST00000371939	T	0.62105	0.05	4.12	-1.61	0.08399	Alpha/beta hydrolase fold-1 (1);	1.763170	0.03404	N	0.203790	T	0.48466	0.1501	L	0.29908	0.895	0.09310	N	1	B	0.12630	0.006	B	0.21546	0.035	T	0.34800	-0.9814	10	0.45353	T	0.12	-34.7476	4.3062	0.10947	0.2603:0.0:0.4182:0.3215	.	218	Q5W064	LIPJ_HUMAN	H	218	ENSP00000361007:Q218H	ENSP00000361007:Q218H	Q	+	3	2	LIPJ	90346604	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.696000	0.05104	-0.085000	0.12573	-0.203000	0.12734	CAG	-	superfamily_alpha/beta-Hydrolases,HMMPfam_Abhydrolase_1		0.279	LIPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPJ	protein_coding	OTTHUMT00000049248.2	G	XM_084377		90346604	+1	no_errors	NM_001010939	genbank	human	provisional	54_36p	missense	SNP	0.000	C
MRE11A	4361	genome.wustl.edu	37	11	94192749	94192749	+	Splice_Site	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr11:94192749T>C	ENST00000323929.3	-	13	1549		c.e13-2		MRE11A_ENST00000407439.3_Splice_Site|MRE11A_ENST00000393241.4_Splice_Site|MRE11A_ENST00000323977.3_Splice_Site	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)						base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				CTGCACATTCTGTAAGATACA	0.353								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																																							0			11											120.0	111.0	114.0					11																	94192749		2201	4298	6499	93832397	SO:0001630	splice_region_variant	4361	Familial Cancer Database	ATLD	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.1327-2A>G	11.37:g.94192749T>C		Somatic		Capture	Illumina GAIIx	4	93832397	O43475	Splice_Site	SNP	-	e12-2	ENST00000323929.3	37	c.1327-2	CCDS8299.1	11	.	.	.	.	.	.	.	.	.	.	T	16.40	3.113064	0.56398	.	.	ENSG00000020922	ENST00000323929;ENST00000407439;ENST00000323977;ENST00000393241	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.125	0.81386	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MRE11A	93832397	1.000000	0.71417	0.928000	0.36995	0.486000	0.33341	7.975000	0.88055	2.213000	0.71641	0.397000	0.26171	.	-	-		0.353	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	MRE11A	protein_coding	OTTHUMT00000396237.3	T	NM_005591	Intron	93832397	-1	no_errors	NM_005591	genbank	human	reviewed	54_36p	splice_site	SNP	0.993	C
DIAPH2	1730	genome.wustl.edu	37	X	96204031	96204031	+	Missense_Mutation	SNP	G	G	T	rs200944548		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chrX:96204031G>T	ENST00000324765.8	+	15	1954	c.1607G>T	c.(1606-1608)cGa>cTa	p.R536L	DIAPH2_ENST00000355827.4_Missense_Mutation_p.R536L|DIAPH2_ENST00000373054.4_Missense_Mutation_p.R532L|DIAPH2_ENST00000373049.4_Missense_Mutation_p.R536L|DIAPH2_ENST00000373061.3_Missense_Mutation_p.R536L			O60879	DIAP2_HUMAN	diaphanous-related formin 2	536					actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						CAGCAACTTCGAACCCAGGTA	0.368																																																0			X											60.0	55.0	57.0					X																	96204031		2203	4300	6503	96090687	SO:0001583	missense	1730			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.1607G>T	X.37:g.96204031G>T	ENSP00000321348:p.Arg536Leu	Somatic		Capture	Illumina GAIIx	4	96090687	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	HMMPfam_Drf_GBD,HMMPfam_Drf_FH3,superfamily_Formin homology 2 domain (FH2 domain),HMMSmart_SM00498,HMMPfam_FH2,HMMPfam_Drf_DAD	p.R536L	ENST00000324765.8	37	c.1607	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	G	13.46	2.244056	0.39697	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.22336	2.98;1.96;2.98;2.98;2.98	4.9	3.1	0.35709	.	0.294571	0.28600	N	0.014770	T	0.25938	0.0632	L	0.52206	1.635	0.35723	D	0.817287	D;P	0.56287	0.975;0.946	P;P	0.50659	0.647;0.597	T	0.19582	-1.0301	10	0.48119	T	0.1	.	8.5496	0.33444	0.2539:0.0:0.7461:0.0	.	536;536	O60879;O60879-2	DIAP2_HUMAN;.	L	536;532;536;536;536;543	ENSP00000362152:R536L;ENSP00000362145:R532L;ENSP00000348082:R536L;ENSP00000362140:R536L;ENSP00000321348:R536L	ENSP00000321348:R536L	R	+	2	0	DIAPH2	96090687	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	4.380000	0.59581	0.322000	0.23283	0.538000	0.68166	CGA	-	NULL		0.368	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	protein_coding	OTTHUMT00000058871.2	G	NM_006729, NM_007309		96090687	+1	no_errors	NM_006729	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
EML1	2009	genome.wustl.edu	37	14	100402380	100402380	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr14:100402380G>A	ENST00000262233.6	+	18	2063	c.1924G>A	c.(1924-1926)Gcc>Acc	p.A642T	EML1_ENST00000334192.4_Missense_Mutation_p.A661T|EML1_ENST00000327921.9_Missense_Mutation_p.A630T	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	642	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				GAATTTCTTAGCCATAGGCTC	0.428																																																0			14											94.0	93.0	94.0					14																	100402380		2203	4300	6503	99472133	SO:0001583	missense	2009			AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.1924G>A	14.37:g.100402380G>A	ENSP00000262233:p.Ala642Thr	Somatic		Capture	Illumina GAIIx	4	99472133	Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	HMMPfam_HELP,HMMSmart_WD40,HMMPfam_WD40,superfamily_WD40_like,PatternScan_EF_HAND_1,PatternScan_HIS_ACID_PHOSPHAT_2	p.A661T	ENST00000262233.6	37	c.1981	CCDS32155.1	14	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040678	0.93685	.	.	ENSG00000066629	ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138	T;T;T	0.70282	-0.47;-0.47;-0.47	5.2	5.2	0.72013	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90655	0.7069	H	0.98577	4.27	0.80722	D	1	D;D;D	0.76494	0.999;0.994;0.999	D;P;D	0.85130	0.997;0.896;0.997	D	0.94140	0.7396	10	0.66056	D	0.02	-29.3981	17.709	0.88316	0.0:0.0:1.0:0.0	.	630;642;661	F8W717;O00423;O00423-3	.;EMAL1_HUMAN;.	T	630;642;661;661	ENSP00000327384:A630T;ENSP00000262233:A642T;ENSP00000334314:A661T	ENSP00000262233:A642T	A	+	1	0	EML1	99472133	1.000000	0.71417	0.974000	0.42286	0.871000	0.50021	9.675000	0.98638	2.429000	0.82318	0.561000	0.74099	GCC	-	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_HIS_ACID_PHOSPHAT_2		0.428	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EML1	protein_coding	OTTHUMT00000413943.1	G	NM_001008707		99472133	+1	no_errors	NM_001008707	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
WWP1P1	339843	genome.wustl.edu	37	3	98378521	98378521	+	IGR	SNP	C	C	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:98378521C>A								AC021660.1 (35633 upstream) : ST3GAL6-AS1 (54652 downstream)																							AGTTTTGAACCCAATGTAATG	0.378																																																0			3																																								99861211	SO:0001628	intergenic_variant	339843																															3.37:g.98378521C>A		Somatic		Capture	Illumina GAIIx	4	99861211		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.378					LOC339843			C			99861211	+1	pseudogene	XR_016598	genbank	human	model	54_36p	rna	SNP	1.000	A
MMP3	4314	genome.wustl.edu	37	11	102714195	102714195	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr11:102714195T>C	ENST00000299855.5	-	1	339	c.83A>G	c.(82-84)gAc>gGc	p.D28G		NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	28					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	CATGCTGGTGTCCTCACCCCT	0.483																																																0			11											155.0	125.0	135.0					11																	102714195		2203	4299	6502	102219405	SO:0001583	missense	4314			X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.83A>G	11.37:g.102714195T>C	ENSP00000299855:p.Asp28Gly	Somatic		Capture	Illumina GAIIx	4	102219405	B2R8B8|Q3B7S0|Q6GRF8	Missense_Mutation	SNP	"HMMPfam_PG_binding_1,superfamily_PGBD-like,PatternScan_CYSTEINE_SWITCH,HMMSmart_SM00235,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Peptidase_M10,PatternScan_ZINC_PROTEASE,superfamily_Hemopexin-like domain,HMMPfam_Hemopexin,HMMSmart_SM00120,PatternScan_HEMOPEXIN"	p.D28G	ENST00000299855.5	37	c.83	CCDS8323.1	11	.	.	.	.	.	.	.	.	.	.	T	10.57	1.385973	0.25031	.	.	ENSG00000149968	ENST00000299855	T	0.13307	2.6	5.07	2.61	0.31194	Metallopeptidase, catalytic domain (1);	0.954956	0.08540	N	0.930628	T	0.07413	0.0187	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.15484	0.013	T	0.32188	-0.9916	10	0.42905	T	0.14	.	6.2832	0.21019	0.0:0.0883:0.1609:0.7508	.	28	P08254	MMP3_HUMAN	G	28	ENSP00000299855:D28G	ENSP00000299855:D28G	D	-	2	0	MMP3	102219405	0.003000	0.15002	0.010000	0.14722	0.006000	0.05464	0.660000	0.25009	1.061000	0.40601	0.528000	0.53228	GAC	-	HMMPfam_PG_binding_1		0.483	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP3	protein_coding	OTTHUMT00000109758.2	T	NM_002422		102219405	-1	no_errors	NM_002422	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
CDCA4	55038	genome.wustl.edu	37	14	105477757	105477757	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr14:105477757C>G	ENST00000336219.3	-	2	665	c.510G>C	c.(508-510)gaG>gaC	p.E170D	CDCA4_ENST00000392590.3_Missense_Mutation_p.E170D	NM_017955.3	NP_060425.2	Q9BXL8	CDCA4_HUMAN	cell division cycle associated 4	170						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)		GGTTTTTAGTCTCCAGCGTTT	0.547																																																0			14											88.0	85.0	86.0					14																	105477757		2203	4300	6503	104548802	SO:0001583	missense	55038			BG354577	CCDS9996.1	14q32.33	2014-02-14			ENSG00000170779	ENSG00000170779			14625	protein-coding gene	gene with protein product	"""hematopoietic progenitor protein"""	612270				12188893	Standard	NM_145701		Approved	FLJ20764, Hepp	uc001yqb.2	Q9BXL8	OTTHUMG00000170767	ENST00000336219.3:c.510G>C	14.37:g.105477757C>G	ENSP00000337226:p.Glu170Asp	Somatic		Capture	Illumina GAIIx	4	104548802	Q8TB18|Q9NWK7	Missense_Mutation	SNP	HMMPfam_SERTA	p.E170D	ENST00000336219.3	37	c.510	CCDS9996.1	14	.	.	.	.	.	.	.	.	.	.	C	11.04	1.520497	0.27211	.	.	ENSG00000170779	ENST00000336219;ENST00000392590	T;T	0.47528	0.84;0.84	4.62	-1.77	0.07982	.	0.052389	0.85682	D	0.000000	T	0.35770	0.0943	M	0.62723	1.935	0.40205	D	0.977567	B	0.26445	0.149	B	0.20384	0.029	T	0.06570	-1.0819	10	0.42905	T	0.14	-2.35	5.6732	0.17733	0.0:0.3296:0.4058:0.2646	.	170	Q9BXL8	CDCA4_HUMAN	D	170	ENSP00000337226:E170D;ENSP00000376369:E170D	ENSP00000337226:E170D	E	-	3	2	CDCA4	104548802	0.626000	0.27120	0.106000	0.21319	0.577000	0.36160	0.502000	0.22594	-0.169000	0.10834	0.650000	0.86243	GAG	-	NULL		0.547	CDCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA4	protein_coding	OTTHUMT00000410311.1	C	NM_145701		104548802	-1	no_errors	NM_017955	genbank	human	reviewed	54_36p	missense	SNP	0.243	G
NEURL1	9148	genome.wustl.edu	37	10	105330710	105330710	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr10:105330710G>T	ENST00000369780.4	+	2	576	c.167G>T	c.(166-168)gGg>gTg	p.G56V	NEURL_ENST00000369777.2_Missense_Mutation_p.G39V	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		56					brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CTGCCCAGCGGGGGGCTCCCA	0.647																																																0			10											80.0	91.0	87.0					10																	105330710		2203	4300	6503	105320700	SO:0001583	missense	9148																														ENST00000369780.4:c.167G>T	10.37:g.105330710G>T	ENSP00000358795:p.Gly56Val	Somatic		Capture	Illumina GAIIx	4	105320700	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	HMMSmart_SM00588,HMMPfam_Neuralized,superfamily_RING/U-box	p.G56V	ENST00000369780.4	37	c.167	CCDS7551.1	10	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145503	0.37825	.	.	ENSG00000107954	ENST00000369780;ENST00000437579;ENST00000369777	.	.	.	4.7	4.7	0.59300	.	0.121219	0.56097	D	0.000038	T	0.56543	0.1992	N	0.14661	0.345	0.80722	D	1	D	0.64830	0.994	P	0.57720	0.826	T	0.58967	-0.7542	9	0.35671	T	0.21	-24.4824	17.8246	0.88661	0.0:0.0:1.0:0.0	.	56	O76050	NEU1A_HUMAN	V	56;39;39	.	ENSP00000358792:G39V	G	+	2	0	NEURL	105320700	1.000000	0.71417	0.970000	0.41538	0.051000	0.14879	2.755000	0.47540	2.417000	0.82017	0.561000	0.74099	GGG	-	NULL		0.647	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEURL	protein_coding	OTTHUMT00000050170.1	G			105320700	+1	no_errors	NM_004210	genbank	human	validated	54_36p	missense	SNP	0.920	T
C1orf162	128346	genome.wustl.edu	37	1	112019976	112019976	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:112019976C>T	ENST00000343534.5	+	4	378	c.128C>T	c.(127-129)gCc>gTc	p.A43V	C1orf162_ENST00000464591.1_Intron|C1orf162_ENST00000369718.3_Missense_Mutation_p.A43V	NM_174896.2	NP_777556.1	Q8NEQ5	CA162_HUMAN	chromosome 1 open reading frame 162	43						integral component of membrane (GO:0016021)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5		all_cancers(81;0.00116)|all_epithelial(167;0.000761)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0236)|Colorectal(144;0.0286)|all cancers(265;0.0572)|Epithelial(280;0.0862)|COAD - Colon adenocarcinoma(174;0.112)|LUSC - Lung squamous cell carcinoma(189;0.134)		TTAATCCTTGCCTTTTGTGCT	0.433																																																0			1											133.0	115.0	121.0					1																	112019976		2203	4300	6503	111821499	SO:0001583	missense	128346			BC017973	CCDS837.1, CCDS72837.1	1p13.2	2008-02-05			ENSG00000143110	ENSG00000143110			28344	protein-coding gene	gene with protein product						12477932	Standard	XM_005270475		Approved	MGC24133	uc001ebe.3	Q8NEQ5	OTTHUMG00000011750	ENST00000343534.5:c.128C>T	1.37:g.112019976C>T	ENSP00000344218:p.Ala43Val	Somatic		Capture	Illumina GAIIx	4	111821499	Q5QNZ1	Missense_Mutation	SNP	NULL	p.A43V	ENST00000343534.5	37	c.128	CCDS837.1	1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772180	0.49680	.	.	ENSG00000143110	ENST00000343534;ENST00000369718	D;D	0.96334	-3.98;-3.98	4.77	4.77	0.60923	.	0.000000	0.45867	D	0.000338	D	0.95617	0.8575	L	0.32530	0.975	0.35545	D	0.803398	D	0.76494	0.999	D	0.70487	0.969	D	0.96579	0.9429	10	0.87932	D	0	-13.123	13.1478	0.59472	0.0:1.0:0.0:0.0	.	43	Q8NEQ5	CA162_HUMAN	V	43	ENSP00000344218:A43V;ENSP00000358732:A43V	ENSP00000344218:A43V	A	+	2	0	C1orf162	111821499	0.999000	0.42202	0.982000	0.44146	0.023000	0.10783	1.994000	0.40757	2.491000	0.84063	0.557000	0.71058	GCC	-	NULL		0.433	C1orf162-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf162	protein_coding	OTTHUMT00000032471.1	C	NM_174896		111821499	+1	no_errors	NM_174896	genbank	human	predicted	54_36p	missense	SNP	0.954	T
ANAPC1	64682	genome.wustl.edu	37	2	112566576	112566576	+	Silent	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr2:112566576T>C	ENST00000341068.3	-	29	4552	c.3780A>G	c.(3778-3780)gtA>gtG	p.V1260V		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1260					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						TCCCTTGATATACAAGGCCAA	0.478																																																0			2											1.0	1.0	1.0					2																	112566576		748	1704	2452	112283047	SO:0001819	synonymous_variant	64682			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.3780A>G	2.37:g.112566576T>C		Somatic		Capture	Illumina GAIIx	4	112283047	Q2M3H8|Q9BSE6|Q9H8D0	Silent	SNP	HMMPfam_PC_rep	p.V1260	ENST00000341068.3	37	c.3780	CCDS2093.1	2	.	.	.	.	.	.	.	.	.	.	T	6.655	0.489370	0.12641	.	.	ENSG00000153107	ENST00000427997	.	.	.	4.68	-9.36	0.00629	.	.	.	.	.	T	0.30634	0.0771	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.39078	-0.9631	4	.	.	.	-18.6621	0.077	0.00028	0.2896:0.226:0.1764:0.308	.	.	.	.	V	795	.	.	I	-	1	0	ANAPC1	112283047	0.000000	0.05858	0.362000	0.25862	0.903000	0.53119	-4.063000	0.00302	-2.363000	0.00608	-2.877000	0.00098	ATA	-	HMMPfam_PC_rep		0.478	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	protein_coding	OTTHUMT00000254045.2	T	NM_022662		112283047	-1	no_errors	NM_022662	genbank	human	validated	54_36p	silent	SNP	0.523	C
ATP11A	23250	genome.wustl.edu	37	13	113536171	113536171	+	3'UTR	SNP	C	C	G	rs376903583		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr13:113536171C>G	ENST00000487903.1	+	0	3547				ATP11A_ENST00000375630.2_Silent_p.T1123T|ATP11A_ENST00000375645.3_Intron			P98196	AT11A_HUMAN	ATPase, class VI, type 11A						phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CAGAATTCACCCCTCTTGCCT	0.637																																																0			13											92.0	90.0	91.0					13																	113536171		2203	4300	6503	112584172	SO:0001624	3_prime_UTR_variant	23250			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.*54C>G	13.37:g.113536171C>G		Somatic		Capture	Illumina GAIIx	4	112584172	Q5VXT2	Silent	SNP	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N	p.T1123	ENST00000487903.1	37	c.3369	CCDS32011.1	13																																																																																			-	NULL		0.637	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	protein_coding	OTTHUMT00000045834.3	C	NM_015205		112584172	+1	no_errors	NM_032189	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
STEAP3	55240	genome.wustl.edu	37	2	120005445	120005445	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr2:120005445C>G	ENST00000354888.5	+	4	1187	c.683C>G	c.(682-684)gCc>gGc	p.A228G	STEAP3_ENST00000393108.2_Missense_Mutation_p.A228G|STEAP3_ENST00000393106.2_Missense_Mutation_p.A228G|STEAP3_ENST00000393110.2_Missense_Mutation_p.A238G|STEAP3_ENST00000450943.2_Missense_Mutation_p.A228G|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000425223.2_Missense_Mutation_p.A228G|STEAP3_ENST00000393107.2_Missense_Mutation_p.A228G|STEAP3_ENST00000409811.1_Missense_Mutation_p.A228G	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	228					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						TGCTTCTATGCCTACAACTTC	0.637																																																0			2											113.0	104.0	107.0					2																	120005445		2203	4300	6503	119721915	SO:0001583	missense	55240			AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.683C>G	2.37:g.120005445C>G	ENSP00000346961:p.Ala228Gly	Somatic		Capture	Illumina GAIIx	4	119721915	A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Missense_Mutation	SNP	HMMPfam_F420_oxidored,superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_Ferric_reduct	p.A238G	ENST00000354888.5	37	c.713	CCDS2125.1	2	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885578	0.33255	.	.	ENSG00000115107	ENST00000393108;ENST00000354888;ENST00000450943;ENST00000393110;ENST00000393106;ENST00000409811;ENST00000393107;ENST00000425223	T;T;T;T;T;T;T;T	0.08984	3.22;3.22;3.03;3.22;3.22;3.03;3.22;3.22	4.72	2.86	0.33363	.	0.653279	0.15309	N	0.269173	T	0.06735	0.0172	L	0.29908	0.895	0.09310	N	1	P;B;B	0.36789	0.57;0.409;0.09	B;B;B	0.38264	0.269;0.197;0.036	T	0.34601	-0.9822	9	.	.	.	-13.7275	7.4793	0.27395	0.0:0.7252:0.0:0.2748	.	228;238;228	B8ZZX6;Q658P3-2;Q658P3	.;.;STEA3_HUMAN	G	228;228;228;238;228;228;228;228	ENSP00000376820:A228G;ENSP00000346961:A228G;ENSP00000396873:A228G;ENSP00000376822:A238G;ENSP00000376818:A228G;ENSP00000386510:A228G;ENSP00000376819:A228G;ENSP00000396214:A228G	.	A	+	2	0	STEAP3	119721915	0.573000	0.26676	0.477000	0.27303	0.721000	0.41392	0.735000	0.26115	0.551000	0.29008	0.563000	0.77884	GCC	-	NULL		0.637	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP3	protein_coding	OTTHUMT00000254193.1	C	NM_018234		119721915	+1	no_errors	NM_182915	genbank	human	validated	54_36p	missense	SNP	0.293	G
SYNPO2	171024	genome.wustl.edu	37	4	119978619	119978619	+	Missense_Mutation	SNP	T	T	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr4:119978619T>A	ENST00000307142.4	+	5	3512	c.3316T>A	c.(3316-3318)Tgg>Agg	p.W1106R	SYNPO2_ENST00000448416.2_Silent_p.L107L	NM_133477.2	NP_597734.2	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	0						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TACATCTCCTTGGGTATACCA	0.433																																																0			4											86.0	87.0	87.0					4																	119978619		2203	4300	6503	120198067	SO:0001583	missense	171024			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000307142.4:c.3316T>A	4.37:g.119978619T>A	ENSP00000306015:p.Trp1106Arg	Somatic		Capture	Illumina GAIIx	4	120198067	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.W1106R	ENST00000307142.4	37	c.3316	CCDS34054.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	21.7|21.7	4.189257|4.189257	0.78789|0.78789	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142	.|T	.|0.08102	.|3.13	5.7|5.7	4.32|4.32	0.51571|0.51571	.|.	.|0.567894	.|0.14946	.|N	.|0.289198	.|T	.|0.06188	.|0.0160	L|L	0.27053|0.27053	0.805|0.805	0.20074|0.20074	N|N	0.999936|0.999936	.|P;P	.|0.43094	.|0.697;0.799	.|B;B	.|0.41691	.|0.364;0.281	.|T	.|0.29458	.|-1.0011	.|9	.|.	.|.	.|.	-0.931|-0.931	4.7137|4.7137	0.12884|0.12884	0.0:0.1286:0.194:0.6774|0.0:0.1286:0.194:0.6774	.|.	.|1106;1106	.|B9EG60;Q9UMS6-2	.|.;.	X|R	999|1106	.|ENSP00000306015:W1106R	.|.	L|W	+|+	2|1	0|0	SYNPO2|SYNPO2	120198067|120198067	0.645000|0.645000	0.27286|0.27286	0.052000|0.052000	0.19188|0.19188	0.739000|0.739000	0.42172|0.42172	0.337000|0.337000	0.19841|0.19841	2.178000|2.178000	0.69098|0.69098	0.533000|0.533000	0.62120|0.62120	TTG|TGG	-	NULL		0.433	SYNPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNPO2	protein_coding	OTTHUMT00000364018.1	T			120198067	+1	no_errors	NM_133477	genbank	human	validated	54_36p	missense	SNP	0.491	A
SLC2A8	29988	genome.wustl.edu	37	9	130165961	130165961	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr9:130165961G>A	ENST00000373371.3	+	6	835	c.746G>A	c.(745-747)cGg>cAg	p.R249Q	SLC2A8_ENST00000373360.3_Missense_Mutation_p.R249Q|SLC2A8_ENST00000373352.1_5'UTR	NM_001271712.1|NM_014580.3	NP_001258641.1|NP_055395.2	Q9NY64	GTR8_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 8	249					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|male meiosis I (GO:0007141)|response to hypoxia (GO:0001666)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	glucose binding (GO:0005536)|glucose transmembrane transporter activity (GO:0005355)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	11						GCCCTGCTGCGGCAGCCCGGC	0.617																																																0			9											47.0	49.0	48.0					9																	130165961		2203	4300	6503	129205782	SO:0001583	missense	29988			AJ245937	CCDS6870.1, CCDS65138.1, CCDS75903.1	9q33.3	2013-05-22	2008-09-02		ENSG00000136856	ENSG00000136856		"""Solute carriers"""	13812	protein-coding gene	gene with protein product		605245	"""solute carrier family 2 (facilitated glucose transporter) member 8"""			10671487, 10821868	Standard	NM_014580		Approved	GLUTX1, GLUT8	uc004bqu.4	Q9NY64	OTTHUMG00000020702	ENST00000373371.3:c.746G>A	9.37:g.130165961G>A	ENSP00000362469:p.Arg249Gln	Somatic		Capture	Illumina GAIIx	4	129205782	Q8WUZ9|Q9NSC4	Missense_Mutation	SNP	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr,PatternScan_SUGAR_TRANSPORT_1,PatternScan_SUGAR_TRANSPORT_2	p.R249Q	ENST00000373371.3	37	c.746	CCDS6870.1	9	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572171	0.45798	.	.	ENSG00000136856	ENST00000373371;ENST00000451404;ENST00000419917;ENST00000373360;ENST00000423934;ENST00000373350;ENST00000430147	T;D;T;T;D;D	0.82803	0.02;-1.65;0.02;0.02;-1.65;-1.65	5.42	2.13	0.27403	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.250879	0.45867	N	0.000334	T	0.77329	0.4114	N	0.25825	0.765	0.31409	N	0.675761	P;D	0.64830	0.882;0.994	B;P	0.57009	0.398;0.811	T	0.73180	-0.4064	10	0.27785	T	0.31	.	4.7092	0.12865	0.2676:0.1826:0.5498:0.0	.	249;249	Q5VVV9;Q9NY64	.;GTR8_HUMAN	Q	249;86;180;249;114;114;88	ENSP00000362469:R249Q;ENSP00000392434:R86Q;ENSP00000411726:R180Q;ENSP00000362458:R249Q;ENSP00000389070:R114Q;ENSP00000391213:R88Q	ENSP00000362448:R114Q	R	+	2	0	SLC2A8	129205782	0.992000	0.36948	0.055000	0.19348	0.004000	0.04260	1.495000	0.35627	0.651000	0.30788	-0.176000	0.13171	CGG	-	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr		0.617	SLC2A8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A8	protein_coding	OTTHUMT00000054177.1	G	NM_014580		129205782	+1	no_errors	NM_014580	genbank	human	provisional	54_36p	missense	SNP	0.997	A
NOC4L	79050	genome.wustl.edu	37	12	132632456	132632456	+	Missense_Mutation	SNP	C	C	T	rs141988623		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr12:132632456C>T	ENST00000330579.1	+	6	676	c.635C>T	c.(634-636)aCg>aTg	p.T212M	NOC4L_ENST00000538784.1_5'Flank|NOC4L_ENST00000535343.1_3'UTR	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	212					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		AATGCCTTCACGCTGCTGTCT	0.687																																																0			12							MET/THR	1,4379		0,1,2189	26.0	28.0	27.0		635	3.3	0.4	12	dbSNP_134	27	0,8590		0,0,4295	no	missense	NOC4L	NM_024078.1	81	0,1,6484	TT,TC,CC		0.0,0.0228,0.0077	benign	212/517	132632456	1,12969	2190	4295	6485	131198409	SO:0001583	missense	79050				CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.635C>T	12.37:g.132632456C>T	ENSP00000328854:p.Thr212Met	Somatic		Capture	Illumina GAIIx	4	131198409	Q8N2S5|Q96I14	Missense_Mutation	SNP	HMMPfam_CBF	p.T212M	ENST00000330579.1	37	c.635	CCDS9277.1	12	.	.	.	.	.	.	.	.	.	.	c	6.761	0.509321	0.12883	2.28E-4	0.0	ENSG00000184967	ENST00000330579;ENST00000541954	T;T	0.65732	-0.17;1.54	5.09	3.28	0.37604	.	0.453783	0.24597	N	0.037173	T	0.52693	0.1750	M	0.69823	2.125	0.80722	D	1	P	0.36412	0.552	B	0.24541	0.054	T	0.51616	-0.8683	10	0.51188	T	0.08	-15.3472	7.851	0.29455	0.0:0.8093:0.0:0.1907	.	212	Q9BVI4	NOC4L_HUMAN	M	212;179	ENSP00000328854:T212M;ENSP00000438255:T179M	ENSP00000328854:T212M	T	+	2	0	NOC4L	131198409	0.857000	0.29778	0.407000	0.26434	0.027000	0.11550	2.049000	0.41288	0.554000	0.29061	-0.198000	0.12761	ACG	-	NULL		0.687	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOC4L	protein_coding	OTTHUMT00000398999.1	C	NM_024078		131198409	+1	no_errors	NM_024078	genbank	human	provisional	54_36p	missense	SNP	0.999	T
MAP3K19	80122	genome.wustl.edu	37	2	135738852	135738852	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr2:135738852G>T	ENST00000375845.3	-	9	3489	c.3459C>A	c.(3457-3459)aaC>aaA	p.N1153K	MAP3K19_ENST00000392917.3_Missense_Mutation_p.N285K|MAP3K19_ENST00000392918.3_Missense_Mutation_p.N287K|MAP3K19_ENST00000315513.3_Missense_Mutation_p.N14K|MAP3K19_ENST00000358371.4_Missense_Mutation_p.N1040K|MAP3K19_ENST00000392915.1_3'UTR|MAP3K19_ENST00000375844.3_Missense_Mutation_p.N335K	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1153	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.N505K(1)|p.N1153K(1)									GCCCAAAACGGTTTATAATAC	0.418																																																2	Substitution - Missense(2)	endometrium(2)	2											121.0	119.0	119.0					2																	135738852		2203	4300	6503	135455322	SO:0001583	missense	80122			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3459C>A	2.37:g.135738852G>T	ENSP00000365005:p.Asn1153Lys	Somatic		Capture	Illumina GAIIx	4	135455322	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.N1153K	ENST00000375845.3	37	c.3459	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	G	5.425	0.263546	0.10294	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000437365;ENST00000315513	T;T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.75	2.62	0.31277	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.126714	0.35739	N	0.003019	T	0.24236	0.0587	N	0.01874	-0.695	0.25502	N	0.987544	B;B;B;B;B	0.30439	0.09;0.237;0.274;0.274;0.279	B;B;B;B;B	0.28709	0.02;0.093;0.088;0.088;0.076	T	0.38134	-0.9675	10	0.02654	T	1	.	4.3464	0.11134	0.3953:0.0:0.455:0.1496	.	285;1040;287;335;1153	B7ZMH9;Q56UN5-3;Q56UN5-4;Q56UN5-5;Q56UN5	.;.;.;.;YSK4_HUMAN	K	1153;1040;335;287;285;543;14	ENSP00000365005:N1153K;ENSP00000351140:N1040K;ENSP00000365004:N335K;ENSP00000376650:N287K;ENSP00000376649:N285K;ENSP00000392827:N543K;ENSP00000321160:N14K	ENSP00000321160:N14K	N	-	3	2	YSK4	135455322	0.993000	0.37304	0.999000	0.59377	0.753000	0.42808	1.007000	0.29860	0.306000	0.22856	-0.253000	0.11424	AAC	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.418	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YSK4	protein_coding	OTTHUMT00000158244.1	G	NM_025052		135455322	-1	no_errors	NM_025052	genbank	human	validated	54_36p	missense	SNP	0.062	T
TRIM24	8805	genome.wustl.edu	37	7	138261140	138261140	+	Silent	SNP	A	A	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr7:138261140A>C	ENST00000343526.4	+	13	2252	c.2037A>C	c.(2035-2037)gtA>gtC	p.V679V	TRIM24_ENST00000415680.2_Silent_p.V645V			O15164	TIF1A_HUMAN	tripartite motif containing 24	679					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						TGACTAGTGTACACCCCCCAA	0.393																																					Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)											0			7											152.0	137.0	142.0					7																	138261140		2203	4300	6503	137911680	SO:0001819	synonymous_variant	8805			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.2037A>C	7.37:g.138261140A>C		Somatic		Capture	Illumina GAIIx	4	137911680	A4D1R7|A4D1R8|O95854	Silent	SNP	superfamily_RING/U-box,HMMPfam_zf-C3HC4,HMMSmart_SM00184,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_SM00336,HMMSmart_SM00502,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.V679	ENST00000343526.4	37	c.2037	CCDS5847.1	7																																																																																			-	NULL		0.393	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM24	protein_coding	OTTHUMT00000341814.1	A	NM_015905		137911680	+1	no_errors	NM_015905	genbank	human	reviewed	54_36p	silent	SNP	0.983	C
SLC35G2	80723	genome.wustl.edu	37	3	136573892	136573892	+	Missense_Mutation	SNP	T	T	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:136573892T>C	ENST00000446465.2	+	2	1218	c.590T>C	c.(589-591)aTg>aCg	p.M197T	RP11-85F14.5_ENST00000461864.1_RNA|SLC35G2_ENST00000393079.3_Missense_Mutation_p.M197T|RP11-85F14.5_ENST00000474250.1_RNA|RP11-85F14.5_ENST00000470236.1_RNA	NM_025246.2	NP_079522.2			solute carrier family 35, member G2																		GGGACCACTATGTGGAGAGCC	0.398																																																0			3											124.0	118.0	120.0					3																	136573892		2203	4300	6503	138056582	SO:0001583	missense	80723			BC022557	CCDS3091.1	3q22.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000168917	ENSG00000168917		"""Solute carriers"""	28480	protein-coding gene	gene with protein product			"""transmembrane protein 22"""	TMEM22		11230166	Standard	NM_001097600		Approved	MGC3295, DKFZp564K2464	uc003erf.4	Q8TBE7	OTTHUMG00000159787	ENST00000446465.2:c.590T>C	3.37:g.136573892T>C	ENSP00000400839:p.Met197Thr	Somatic		Capture	Illumina GAIIx	4	138056582		Missense_Mutation	SNP	HMMPfam_DUF6,superfamily_SSF103481	p.M197T	ENST00000446465.2	37	c.590	CCDS3091.1	3	.	.	.	.	.	.	.	.	.	.	T	8.109	0.778395	0.16120	.	.	ENSG00000168917	ENST00000446465;ENST00000393079	T;T	0.51071	0.72;0.72	5.69	5.69	0.88448	Drug/metabolite transporter (1);	0.038007	0.85682	D	0.000000	T	0.31263	0.0791	N	0.08118	0	0.80722	D	1	B	0.17268	0.021	B	0.21151	0.033	T	0.11717	-1.0576	10	0.52906	T	0.07	.	14.7734	0.69696	0.0:0.0:0.0:1.0	.	197	Q8TBE7	TMM22_HUMAN	T	197	ENSP00000400839:M197T;ENSP00000376794:M197T	ENSP00000376794:M197T	M	+	2	0	TMEM22	138056582	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.642000	0.83385	2.167000	0.68274	0.482000	0.46254	ATG	-	HMMPfam_DUF6,superfamily_SSF103481		0.398	SLC35G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM22	protein_coding	OTTHUMT00000357317.1	T	NM_025246		138056582	+1	no_errors	NM_001097599	genbank	human	validated	54_36p	missense	SNP	1.000	C
PCDHB19P	84054	genome.wustl.edu	37	5	140621688	140621688	+	IGR	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr5:140621688G>C								PCDHB18 (4587 upstream) : PCDHB15 (3458 downstream)																							GGCATCTGGTGGACGTGAGCG	0.582																																																0			5																																								140601872	SO:0001628	intergenic_variant	84054																															5.37:g.140621688G>C		Somatic		Capture	Illumina GAIIx	4	140601872		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.582					PCDHB19P			G			140601872	+1	pseudogene	NR_001282	genbank	human	validated	54_36p	rna	SNP	0.991	C
HPS3	84343	genome.wustl.edu	37	3	148875272	148875272	+	Missense_Mutation	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:148875272G>A	ENST00000296051.2	+	9	1785	c.1645G>A	c.(1645-1647)Gaa>Aaa	p.E549K	HPS3_ENST00000460120.1_Missense_Mutation_p.E384K	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	549					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			AGAGCTTTTGGAAGCATTTAA	0.517									Hermansky-Pudlak syndrome																																							0			3											90.0	83.0	86.0					3																	148875272		2203	4300	6503	150357962	SO:0001583	missense	84343	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.1645G>A	3.37:g.148875272G>A	ENSP00000296051:p.Glu549Lys	Somatic		Capture	Illumina GAIIx	4	150357962	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	NULL	p.E549K	ENST00000296051.2	37	c.1645	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189206	0.78789	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.64438	-0.1;-0.1	5.68	5.68	0.88126	.	0.280166	0.39759	N	0.001270	T	0.61590	0.2359	M	0.67953	2.075	0.37617	D	0.921143	P;P	0.36010	0.532;0.532	B;B	0.38755	0.281;0.281	T	0.63047	-0.6724	10	0.24483	T	0.36	-6.736	13.4761	0.61310	0.0806:0.0:0.9194:0.0	.	384;549	G5E9V4;Q969F9	.;HPS3_HUMAN	K	549;384	ENSP00000296051:E549K;ENSP00000418230:E384K	ENSP00000296051:E549K	E	+	1	0	HPS3	150357962	1.000000	0.71417	0.856000	0.33681	0.998000	0.95712	5.639000	0.67868	2.702000	0.92279	0.655000	0.94253	GAA	-	NULL		0.517	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	protein_coding	OTTHUMT00000356151.1	G	NM_032383		150357962	+1	no_errors	NM_032383	genbank	human	reviewed	54_36p	missense	SNP	0.678	A
SLC4A2	6522	genome.wustl.edu	37	7	150769178	150769178	+	Silent	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr7:150769178G>A	ENST00000485713.1	+	16	3530	c.2490G>A	c.(2488-2490)ttG>ttA	p.L830L	SLC4A2_ENST00000392826.2_Silent_p.L821L|SLC4A2_ENST00000310317.5_Silent_p.L748L|SLC4A2_ENST00000413384.2_Silent_p.L830L|SLC4A2_ENST00000461735.1_Silent_p.L816L|RP11-148K1.12_ENST00000485974.1_RNA	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	830	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCGCCTTCTTGATCTCACTCA	0.617																																																0			7											148.0	151.0	150.0					7																	150769178		2203	4300	6503	150400111	SO:0001819	synonymous_variant	6522				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.2490G>A	7.37:g.150769178G>A		Somatic		Capture	Illumina GAIIx	4	150400111	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Silent	SNP	superfamily_Phoshotransferase/anion transport protein,HMMPfam_Band_3_cyto,HMMPfam_HCO3_cotransp,PatternScan_ANION_EXCHANGER_1,PatternScan_ANION_EXCHANGER_2	p.L830	ENST00000485713.1	37	c.2490	CCDS5917.1	7																																																																																			-	HMMPfam_HCO3_cotransp,PatternScan_ANION_EXCHANGER_2		0.617	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	protein_coding	OTTHUMT00000351039.1	G	NM_003040		150400111	+1	no_errors	NM_003040	genbank	human	validated	54_36p	silent	SNP	1.000	A
KMT2C	58508	genome.wustl.edu	37	7	151846077	151846077	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr7:151846077G>T	ENST00000262189.6	-	52	13153	c.12935C>A	c.(12934-12936)gCt>gAt	p.A4312D	KMT2C_ENST00000355193.2_Missense_Mutation_p.A4369D	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4312					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGCTTCAAAAGCAGGAGGGAA	0.557																																																0			7											51.0	47.0	48.0					7																	151846077		2203	4300	6503	151477010	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12935C>A	7.37:g.151846077G>T	ENSP00000262189:p.Ala4312Asp	Somatic		Capture	Illumina GAIIx	4	151477010	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	PatternScan_HMGI_Y,HMMPfam_AT_hook,HMMSmart_SM00249,superfamily_FYVE/PHD zinc finger,HMMPfam_PHD,HMMSmart_SM00184,PatternScan_ZF_PHD_1,PatternScan_ATPASE_ALPHA_BETA,HMMSmart_SM00398,HMMPfam_HMG_box,HMMPfam_FYRN,HMMSmart_SM00541,HMMPfam_FYRC,HMMSmart_SM00542,superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00508	p.A4312D	ENST00000262189.6	37	c.12935	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.16|16.16	3.043345|3.043345	0.55003|0.55003	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.89343|.	-1.84;-1.82;-2.5|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.000000|.	0.44285|.	U|.	0.000466|.	T|.	0.75436|.	0.3849|.	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;1.0;1.0|.	D;D;D|.	0.91635|.	0.955;0.999;0.999|.	T|.	0.73534|.	-0.3952|.	10|.	0.32370|.	T|.	0.25|.	.|.	19.4364|19.4364	0.94798|0.94798	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	4312;3430;4369|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	D|X	4312;4369;929|1872	ENSP00000262189:A4312D;ENSP00000347325:A4369D;ENSP00000410411:A929D|.	ENSP00000262189:A4312D|.	A|C	-|-	2|3	0|2	MLL3|MLL3	151477010|151477010	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.919000|0.919000	0.55068|0.55068	9.357000|9.357000	0.97099|0.97099	2.590000|2.590000	0.87494|0.87494	0.650000|0.650000	0.86243|0.86243	GCT|TGC	-	NULL		0.557	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	protein_coding	OTTHUMT00000318887.3	G			151477010	-1	no_errors	NM_170606	genbank	human	reviewed	54_36p	missense	SNP	0.998	T
SLC6A8	6535	genome.wustl.edu	37	X	152958573	152958573	+	Silent	SNP	C	C	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chrX:152958573C>A	ENST00000253122.5	+	5	1331	c.855C>A	c.(853-855)gcC>gcA	p.A285A	SLC6A8_ENST00000430077.2_Silent_p.A170A|SLC6A8_ENST00000485324.1_3'UTR	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	285				A -> P (in Ref. 1; AAC41688). {ECO:0000305}.	cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	TGCCTGGCGCCCTGGATGGCA	0.632																																																0			X											72.0	54.0	60.0					X																	152958573		2203	4299	6502	152611767	SO:0001819	synonymous_variant	6535				CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.855C>A	X.37:g.152958573C>A		Somatic		Capture	Illumina GAIIx	4	152611767	B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Silent	SNP	HMMPfam_SNF,PatternScan_NA_NEUROTRAN_SYMP_1,PatternScan_NA_NEUROTRAN_SYMP_2	p.A285	ENST00000253122.5	37	c.855	CCDS14726.1	X	.	.	.	.	.	.	.	.	.	.	c	5.678	0.309592	0.10733	.	.	ENSG00000130821	ENST00000413787	T	0.77489	-1.1	4.88	0.671	0.17929	.	.	.	.	.	T	0.76314	0.3970	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.72050	-0.4407	6	0.87932	D	0	.	3.1426	0.06461	0.3357:0.2906:0.0:0.3737	.	.	.	.	H	22	ENSP00000400463:P22H	ENSP00000400463:P22H	P	+	2	0	SLC6A8	152611767	0.000000	0.05858	0.055000	0.19348	0.703000	0.40648	-1.627000	0.02033	0.131000	0.18576	0.468000	0.43344	CCC	-	HMMPfam_SNF		0.632	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A8	protein_coding	OTTHUMT00000061003.1	C			152611767	+1	no_errors	NM_005629	genbank	human	reviewed	54_36p	silent	SNP	0.040	A
PLXNA3	55558	genome.wustl.edu	37	X	153689044	153689044	+	Missense_Mutation	SNP	A	A	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chrX:153689044A>T	ENST00000369682.3	+	2	696	c.521A>T	c.(520-522)aAg>aTg	p.K174M		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	174	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTCGACGGCAAGTCGGAGTAC	0.607																																																0			X											69.0	73.0	72.0					X																	153689044		2202	4296	6498	153342238	SO:0001583	missense	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.521A>T	X.37:g.153689044A>T	ENSP00000358696:p.Lys174Met	Somatic		Capture	Illumina GAIIx	4	153342238	Q5HY36	Missense_Mutation	SNP	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMPfam_PSI,HMMSmart_PSI,superfamily_Plexin-like_fold,HMMSmart_IPT,superfamily_Ig_E-set,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_Rho_GAP	p.K174M	ENST00000369682.3	37	c.521	CCDS14752.1	X	.	.	.	.	.	.	.	.	.	.	A	15.89	2.966850	0.53507	.	.	ENSG00000130827	ENST00000369682	T	0.04654	3.58	4.77	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.20129	0.0484	M	0.87758	2.905	0.50632	D	0.99988	D	0.58268	0.982	D	0.64776	0.929	T	0.00411	-1.1756	10	0.72032	D	0.01	.	7.8076	0.29211	0.9005:0.0:0.0995:0.0	.	174	P51805	PLXA3_HUMAN	M	174	ENSP00000358696:K174M	ENSP00000358696:K174M	K	+	2	0	PLXNA3	153342238	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	4.348000	0.59379	1.882000	0.54519	0.383000	0.25322	AAG	-	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema		0.607	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	protein_coding	OTTHUMT00000081634.1	A	NM_017514		153342238	+1	no_errors	NM_017514	genbank	human	validated	54_36p	missense	SNP	1.000	T
TRIM46	80128	genome.wustl.edu	37	1	155148389	155148389	+	Missense_Mutation	SNP	G	G	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:155148389G>T	ENST00000334634.4	+	3	351	c.351G>T	c.(349-351)aaG>aaT	p.K117N	TRIM46_ENST00000368382.1_Missense_Mutation_p.K94N|TRIM46_ENST00000392451.2_Missense_Mutation_p.K117N|TRIM46_ENST00000368383.3_Missense_Mutation_p.K117N|TRIM46_ENST00000543729.1_Missense_Mutation_p.K124N|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000545012.1_5'UTR|KRTCAP2_ENST00000295682.4_5'Flank|KRTCAP2_ENST00000490672.1_5'Flank|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000368385.4_Missense_Mutation_p.K117N	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	117						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTGGGAGGAAGCGAGGTGCTT	0.577																																																0			1											134.0	138.0	136.0					1																	155148389		2203	4300	6503	153415013	SO:0001583	missense	80128				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.351G>T	1.37:g.155148389G>T	ENSP00000334657:p.Lys117Asn	Somatic		Capture	Illumina GAIIx	4	153415013	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	superfamily_RING/U-box,HMMPfam_zf-C3HC4,HMMSmart_SM00184,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_SM00336,superfamily_B-box zinc-binding domain,HMMPfam_fn3,superfamily_Fibronectin type III	p.K117N	ENST00000334634.4	37	c.351	CCDS1097.1	1	.	.	.	.	.	.	.	.	.	.	g	11.27	1.588088	0.28268	.	.	ENSG00000163462	ENST00000543729;ENST00000430513;ENST00000368385;ENST00000392451;ENST00000368383;ENST00000368382;ENST00000334634	T;T;T;T;T;T	0.59364	0.82;0.58;0.76;0.5;0.27;0.32	4.73	-2.14	0.07123	Zinc finger, RING-type (1);	0.245522	0.39210	N	0.001425	T	0.38268	0.1034	L	0.27053	0.805	0.80722	D	1	P;D;P;D;P	0.63046	0.764;0.992;0.895;0.986;0.764	B;P;B;P;B	0.59357	0.174;0.811;0.264;0.856;0.224	T	0.33979	-0.9847	10	0.26408	T	0.33	.	10.2275	0.43233	0.517:0.0:0.483:0.0	.	104;117;94;117;117	F5H5Z2;Q5VT61;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.;.;.;TRI46_HUMAN;.	N	124;104;117;117;117;94;117	ENSP00000442719:K124N;ENSP00000357369:K117N;ENSP00000376245:K117N;ENSP00000357367:K117N;ENSP00000357366:K94N;ENSP00000334657:K117N	ENSP00000334657:K117N	K	+	3	2	TRIM46	153415013	0.896000	0.30565	0.993000	0.49108	0.517000	0.34286	-0.039000	0.12124	-0.236000	0.09753	-0.766000	0.03442	AAG	-	superfamily_RING/U-box,HMMSmart_SM00184		0.577	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	protein_coding	OTTHUMT00000086728.1	G	NM_025058		153415013	+1	no_errors	NM_025058	genbank	human	validated	54_36p	missense	SNP	1.000	T
OR10T2	128360	genome.wustl.edu	37	1	158368525	158368525	+	Missense_Mutation	SNP	A	A	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:158368525A>C	ENST00000334438.1	-	1	731	c.732T>G	c.(730-732)caT>caG	p.H244Q		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	244						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					CCACAGTGAGATGTGAGGCAC	0.493																																																0			1											112.0	102.0	106.0					1																	158368525		2203	4300	6503	156635149	SO:0001583	missense	128360			AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.732T>G	1.37:g.158368525A>C	ENSP00000334115:p.His244Gln	Somatic		Capture	Illumina GAIIx	4	156635149	Q6IF98	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.H244Q	ENST00000334438.1	37	c.732	CCDS30895.1	1	.	.	.	.	.	.	.	.	.	.	A	11.31	1.601245	0.28534	.	.	ENSG00000186306	ENST00000334438	T	0.00307	8.17	4.57	1.44	0.22558	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43919	D	0.000516	T	0.00384	0.0012	H	0.97158	3.95	0.25381	N	0.988612	P	0.50943	0.94	P	0.61201	0.885	T	0.34079	-0.9843	10	0.87932	D	0	.	7.3394	0.26627	0.3768:0.0:0.6232:0.0	.	244	Q8NGX3	O10T2_HUMAN	Q	244	ENSP00000334115:H244Q	ENSP00000334115:H244Q	H	-	3	2	OR10T2	156635149	1.000000	0.71417	0.997000	0.53966	0.539000	0.34962	0.818000	0.27295	0.553000	0.29044	-0.763000	0.03452	CAT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.493	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10T2	protein_coding	OTTHUMT00000046371.1	A	NM_001004475		156635149	-1	no_errors	NM_001004475	genbank	human	provisional	54_36p	missense	SNP	1.000	C
ATP1A4	480	genome.wustl.edu	37	1	160136403	160136403	+	Missense_Mutation	SNP	C	C	T	rs150693480		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:160136403C>T	ENST00000368081.4	+	8	1604	c.1133C>T	c.(1132-1134)aCg>aTg	p.T378M		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	378					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTGGGCTCCACGTCCACCATC	0.597																																																0			1						C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	133.0	108.0	117.0		1133	4.3	1.0	1	dbSNP_134	117	0,8600		0,0,4300	no	missense	ATP1A4	NM_144699.3	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	378/1030	160136403	1,13005	2203	4300	6503	158403027	SO:0001583	missense	480			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.1133C>T	1.37:g.160136403C>T	ENSP00000357060:p.Thr378Met	Somatic		Capture	Illumina GAIIx	4	158403027	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N,superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Cation_ATPase_C	p.T378M	ENST00000368081.4	37	c.1133	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.211627	0.79240	2.27E-4	0.0	ENSG00000132681	ENST00000368081	D	0.93426	-3.22	4.35	4.35	0.52113	HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.96565	0.8879	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97031	0.9750	10	0.87932	D	0	.	14.7749	0.69724	0.0:1.0:0.0:0.0	.	378	Q13733	AT1A4_HUMAN	M	378	ENSP00000357060:T378M	ENSP00000357060:T378M	T	+	2	0	ATP1A4	158403027	1.000000	0.71417	0.986000	0.45419	0.724000	0.41520	7.580000	0.82523	2.427000	0.82271	0.650000	0.86243	ACG	-	superfamily_Calcium ATPase transmembrane domain M,superfamily_HAD-like,HMMPfam_Hydrolase		0.597	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	protein_coding	OTTHUMT00000077415.1	C	NM_144699		158403027	+1	no_errors	NM_144699	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
KPNA4	3840	genome.wustl.edu	37	3	160233298	160233298	+	Missense_Mutation	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:160233298C>G	ENST00000334256.4	-	12	1279	c.974G>C	c.(973-975)tGt>tCt	p.C325S	SCARNA7_ENST00000458797.1_RNA	NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)	325	NLS binding site (minor). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			AAGAGCATCACAGTTCAAAAC	0.368																																																0			3											124.0	105.0	111.0					3																	160233298		2203	4300	6503	161715992	SO:0001583	missense	3840			AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.974G>C	3.37:g.160233298C>G	ENSP00000334373:p.Cys325Ser	Somatic		Capture	Illumina GAIIx	4	161715992	A8K4S6|D3DNM2|O00190	Missense_Mutation	SNP	HMMPfam_IBB,superfamily_ARM repeat,HMMPfam_Arm,HMMSmart_SM00185	p.C325S	ENST00000334256.4	37	c.974	CCDS3191.1	3	.	.	.	.	.	.	.	.	.	.	C	17.77	3.471260	0.63625	.	.	ENSG00000186432	ENST00000334256;ENST00000483437	T;T	0.66995	-0.24;-0.24	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.042337	0.85682	D	0.000000	T	0.62097	0.2400	L	0.37561	1.115	0.80722	D	1	B	0.28258	0.205	B	0.32090	0.14	T	0.56583	-0.7955	10	0.32370	T	0.25	-1.3555	19.8667	0.96806	0.0:1.0:0.0:0.0	.	325	O00629	IMA4_HUMAN	S	325;30	ENSP00000334373:C325S;ENSP00000417172:C30S	ENSP00000334373:C325S	C	-	2	0	KPNA4	161715992	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.668000	0.83897	2.773000	0.95371	0.655000	0.94253	TGT	-	superfamily_ARM repeat,HMMPfam_Arm,HMMSmart_SM00185		0.368	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA4	protein_coding	OTTHUMT00000352960.1	C	NM_002268		161715992	-1	no_errors	NM_002268	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SCN1A	6323	genome.wustl.edu	37	2	166848638	166848638	+	Missense_Mutation	SNP	C	C	T			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr2:166848638C>T	ENST00000303395.4	-	26	5146	c.5147G>A	c.(5146-5148)tGc>tAc	p.C1716Y	AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.C1705Y|SCN1A_ENST00000423058.2_Missense_Mutation_p.C1716Y|SCN1A_ENST00000409050.1_Missense_Mutation_p.C1688Y|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1716			C -> R (in EIEE6; dbSNP:rs121917926). {ECO:0000269|PubMed:17561957}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTGGAATAGGCAGATCATGCT	0.463																																																0			2											224.0	218.0	220.0					2																	166848638		2203	4300	6503	166556884	SO:0001583	missense	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.5147G>A	2.37:g.166848638C>T	ENSP00000303540:p.Cys1716Tyr	Somatic		Capture	Illumina GAIIx	4	166556884	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,HMMSmart_IQ,HMMPfam_IQ,PatternScan_RIBONUCLEASE_P	p.C1705Y	ENST00000303395.4	37	c.5114	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.400935	0.83120	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.97186	-4.28;-4.28;-4.28;-4.28	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000002	D	0.99001	0.9659	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99282	1.0896	10	0.87932	D	0	.	20.0589	0.97667	0.0:1.0:0.0:0.0	.	1705	P35498-2	.	Y	1716;1716;1705;1688	ENSP00000407030:C1716Y;ENSP00000303540:C1716Y;ENSP00000364554:C1705Y;ENSP00000386312:C1688Y	ENSP00000303540:C1716Y	C	-	2	0	SCN1A	166556884	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.603000	0.82811	2.732000	0.93576	0.650000	0.86243	TGC	-	superfamily_SSF81324,HMMPfam_Ion_trans		0.463	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	C	NM_006920		166556884	-1	no_errors	NM_006920	genbank	human	validated	54_36p	missense	SNP	1.000	T
SAMD7	344658	genome.wustl.edu	37	3	169644857	169644857	+	Silent	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:169644857C>G	ENST00000428432.2	+	6	1196	c.807C>G	c.(805-807)acC>acG	p.T269T	SAMD7_ENST00000335556.3_Silent_p.T269T	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	269										NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			ACACCACTACCCTGAAAGCAA	0.532																																																0			3											68.0	67.0	67.0					3																	169644857		2203	4300	6503	171127551	SO:0001819	synonymous_variant	344658			BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.807C>G	3.37:g.169644857C>G		Somatic		Capture	Illumina GAIIx	4	171127551		Silent	SNP	superfamily_SAM_homology,HMMSmart_SAM,HMMPfam_SAM_1	p.T269	ENST00000428432.2	37	c.807	CCDS3209.1	3																																																																																			-	NULL		0.532	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD7	protein_coding	OTTHUMT00000351959.1	C	NM_182610		171127551	+1	no_errors	NM_182610	genbank	human	provisional	54_36p	silent	SNP	0.001	G
EIF4G1	1981	genome.wustl.edu	37	3	184045201	184045201	+	Missense_Mutation	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:184045201G>C	ENST00000346169.2	+	24	3897	c.3626G>C	c.(3625-3627)aGc>aCc	p.S1209T	EIF4G1_ENST00000352767.3_Missense_Mutation_p.S1216T|EIF4G1_ENST00000411531.1_Missense_Mutation_p.S1170T|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000350481.5_Missense_Mutation_p.S1045T|EIF4G1_ENST00000434061.2_Missense_Mutation_p.S1014T|EIF4G1_ENST00000435046.2_Missense_Mutation_p.S1013T|EIF4G1_ENST00000424196.1_Missense_Mutation_p.S1216T|SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000427845.1_Missense_Mutation_p.S1123T|EIF4G1_ENST00000414031.1_Missense_Mutation_p.S1169T|EIF4G1_ENST00000382330.3_Missense_Mutation_p.S1216T|EIF4G1_ENST00000342981.4_Missense_Mutation_p.S1210T|EIF4G1_ENST00000319274.6_Missense_Mutation_p.S1209T|EIF4G1_ENST00000441154.1_Missense_Mutation_p.S1046T|EIF4G1_ENST00000392537.2_Missense_Mutation_p.S1122T	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	1209					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AAGGCAGCTAGCCTCACGGAG	0.652																																																0			3											30.0	34.0	33.0					3																	184045201		2201	4298	6499	185527895	SO:0001583	missense	1981			D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.3626G>C	3.37:g.184045201G>C	ENSP00000316879:p.Ser1209Thr	Somatic		Capture	Illumina GAIIx	4	185527895	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_MIF4G,HMMSmart_SM00543,HMMPfam_MA3,HMMSmart_SM00544,HMMSmart_SM00515,HMMPfam_W2	p.S1209T	ENST00000346169.2	37	c.3626	CCDS3259.1	3	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354970	0.61293	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000382330;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.05081	3.72;3.73;3.64;3.73;3.54;3.73;3.64;3.72;3.72;3.73;3.73;3.52;3.5;3.51	5.2	5.2	0.72013	.	0.232224	0.41001	D	0.000972	T	0.12305	0.0299	L	0.50333	1.59	0.58432	D	0.999999	P;P;P	0.45715	0.865;0.865;0.865	P;P;P	0.45913	0.497;0.497;0.497	T	0.01188	-1.1424	10	0.45353	T	0.12	-11.7154	18.9316	0.92568	0.0:0.0:1.0:0.0	.	1216;1210;1209	E9PFM1;D3DNT2;Q04637	.;.;IF4G1_HUMAN	T	1209;1169;1122;1216;1045;1216;1123;1210;1209;1216;1170;1046;1014;1013	ENSP00000316879:S1209T;ENSP00000391935:S1169T;ENSP00000376320:S1122T;ENSP00000371767:S1216T;ENSP00000317600:S1045T;ENSP00000338020:S1216T;ENSP00000407682:S1123T;ENSP00000343450:S1210T;ENSP00000323737:S1209T;ENSP00000416255:S1216T;ENSP00000395974:S1170T;ENSP00000399858:S1046T;ENSP00000411826:S1014T;ENSP00000404754:S1013T	ENSP00000323737:S1209T	S	+	2	0	EIF4G1	185527895	1.000000	0.71417	0.965000	0.40720	0.224000	0.24922	8.865000	0.92300	2.691000	0.91804	0.655000	0.94253	AGC	-	NULL		0.652	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	EIF4G1	protein_coding	OTTHUMT00000345733.1	G	NM_182917		185527895	+1	no_errors	NM_182917	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FAM171B	165215	genome.wustl.edu	37	2	187626817	187626817	+	Missense_Mutation	SNP	C	C	T	rs369639086		TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr2:187626817C>T	ENST00000304698.5	+	8	1951	c.1748C>T	c.(1747-1749)aCg>aTg	p.T583M		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	583						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GAGAACTTTACGCAGACCTTG	0.468													C|||	1	0.000199681	0.0	0.0	5008	,	,		21761	0.0		0.001	False		,,,				2504	0.0															0			2						C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	90.0	84.0	86.0		1748	6.0	1.0	2		86	1,8599	1.2+/-3.3	0,1,4299	no	missense	FAM171B	NM_177454.3	81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging	583/827	187626817	2,13004	2203	4300	6503	187335062	SO:0001583	missense	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.1748C>T	2.37:g.187626817C>T	ENSP00000304108:p.Thr583Met	Somatic		Capture	Illumina GAIIx	4	187335062	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	HMMPfam_UPF0560	p.T583M	ENST00000304698.5	37	c.1748	CCDS33347.1	2	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439760	0.43326	2.27E-4	1.16E-4	ENSG00000144369	ENST00000304698	T	0.31247	1.5	6.03	6.03	0.97812	.	0.054081	0.64402	D	0.000001	T	0.20047	0.0482	L	0.29908	0.895	0.49915	D	0.999831	P;P	0.48350	0.909;0.909	B;B	0.37047	0.24;0.24	T	0.01639	-1.1306	10	0.49607	T	0.09	-20.3761	9.7448	0.40440	0.0:0.7796:0.1427:0.0777	.	583;584	Q6P995;A8K122	F171B_HUMAN;.	M	583	ENSP00000304108:T583M	ENSP00000304108:T583M	T	+	2	0	FAM171B	187335062	0.998000	0.40836	0.995000	0.50966	0.993000	0.82548	3.701000	0.54793	2.854000	0.98071	0.655000	0.94253	ACG	-	HMMPfam_UPF0560		0.468	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	protein_coding	OTTHUMT00000334679.1	C	NM_177454		187335062	+1	no_errors	NM_177454	genbank	human	validated	54_36p	missense	SNP	0.998	T
ATP13A5	344905	genome.wustl.edu	37	3	193042677	193042677	+	Silent	SNP	G	G	C			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr3:193042677G>C	ENST00000342358.4	-	14	1767	c.1650C>G	c.(1648-1650)ctC>ctG	p.L550L		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	550						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CAAACATTTTGAGGTCCAGAG	0.507																																																0			3											174.0	186.0	182.0					3																	193042677		2203	4300	6503	194525371	SO:0001819	synonymous_variant	344905			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1650C>G	3.37:g.193042677G>C		Somatic		Capture	Illumina GAIIx	4	194525371	Q6UWS4|Q6ZWL0	Silent	SNP	superfamily_SSF81665,HMMPfam_Cation_ATPase_N,HMMPfam_E1-E2_ATPase,superfamily_SSF81653,PatternScan_ATPASE_E1_E2,superfamily_SSF81660,superfamily_SSF56784	p.L550	ENST00000342358.4	37	c.1650	CCDS33914.1	3																																																																																			-	superfamily_SSF81665,superfamily_SSF81660		0.507	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	protein_coding	OTTHUMT00000343012.1	G	NM_198505		194525371	-1	no_errors	NM_198505	genbank	human	provisional	54_36p	silent	SNP	1.000	C
HSPD1	3329	genome.wustl.edu	37	2	198363399	198363399	+	Splice_Site	SNP	C	C	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr2:198363399C>G	ENST00000388968.3	-	2	441	c.174G>C	c.(172-174)aaG>aaC	p.K58N	HSPD1_ENST00000544407.1_Splice_Site_p.K58N|HSPE1_ENST00000409468.1_5'Flank|HSPE1_ENST00000233893.5_5'Flank|HSPD1_ENST00000345042.2_Splice_Site_p.K58N|HSPE1_ENST00000409729.1_5'Flank|HSPE1-MOB4_ENST00000604458.1_5'Flank	NM_002156.4	NP_002147.2	P10809	CH60_HUMAN	heat shock 60kDa protein 1 (chaperonin)	58					'de novo' protein folding (GO:0006458)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|ATP catabolic process (GO:0006200)|B cell activation (GO:0042113)|B cell cytokine production (GO:0002368)|B cell proliferation (GO:0042100)|chaperone-mediated protein complex assembly (GO:0051131)|isotype switching to IgG isotypes (GO:0048291)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell mediated immune response to tumor cell (GO:0002842)|protein maturation (GO:0051604)|protein refolding (GO:0042026)|protein stabilization (GO:0050821)|response to unfolded protein (GO:0006986)|T cell activation (GO:0042110)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lipopolysaccharide receptor complex (GO:0046696)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chaperone binding (GO:0051087)|DNA replication origin binding (GO:0003688)|double-stranded RNA binding (GO:0003725)|lipopolysaccharide binding (GO:0001530)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)|unfolded protein binding (GO:0051082)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(7)|skin(1)	17			Epithelial(96;0.225)			ATACTGGTACCTTTGGCCCCA	0.378																																																0			2											49.0	53.0	52.0					2																	198363399		2203	4300	6503	198071644	SO:0001630	splice_region_variant	3329			M34664	CCDS33357.1	2q33.1	2011-09-02	2002-08-29		ENSG00000144381	ENSG00000144381		"""Heat Shock Proteins / Chaperonins"""	5261	protein-coding gene	gene with protein product		118190	"""heat shock 60kD protein 1 (chaperonin)"", ""spastic paraplegia 13 (autosomal dominant)"""	SPG13		1980192, 11898127	Standard	NM_002156		Approved	GROEL, HSP60	uc002uui.3	P10809	OTTHUMG00000154463	ENST00000388968.3:c.174+1G>C	2.37:g.198363399C>G		Somatic		Capture	Illumina GAIIx	4	198071644	B2R5M6|B7Z712|Q38L19|Q9UCR6	Missense_Mutation	SNP	superfamily_GroEL-ATPase,HMMPfam_Cpn60_TCP1,superfamily_SSF54849,superfamily_SSF52029,PatternScan_CHAPERONINS_CPN60	p.K58N	ENST00000388968.3	37	c.174	CCDS33357.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.080654	0.94050	.	.	ENSG00000144381	ENST00000388968;ENST00000345042;ENST00000430176;ENST00000452200;ENST00000544407;ENST00000426480;ENST00000428204;ENST00000439605;ENST00000418022	T;T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-0.57	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.93644	0.7970	H	0.97758	4.07	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.96003	0.8995	10	0.87932	D	0	-10.1837	18.2266	0.89918	0.0:1.0:0.0:0.0	.	58;58;58;58	B7Z712;B7Z597;B3GQS7;P10809	.;.;.;CH60_HUMAN	N	58;58;58;58;58;100;58;58;58	ENSP00000373620:K58N;ENSP00000340019:K58N;ENSP00000393670:K58N;ENSP00000412717:K58N;ENSP00000441296:K58N;ENSP00000414446:K100N;ENSP00000396460:K58N;ENSP00000402478:K58N;ENSP00000412227:K58N	ENSP00000340019:K58N	K	-	3	2	HSPD1	198071644	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.776000	0.85560	2.384000	0.81235	0.650000	0.86243	AAG	-	superfamily_GroEL-ATPase,HMMPfam_Cpn60_TCP1		0.378	HSPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPD1	protein_coding	OTTHUMT00000335324.2	C	NM_002156	Missense_Mutation	198071644	-1	no_errors	NM_002156	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
C2orf47	79568	genome.wustl.edu	37	2	200820527	200820527	+	Silent	SNP	G	G	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr2:200820527G>A	ENST00000392290.1	+	1	202	c.6G>A	c.(4-6)gcG>gcA	p.A2A	C2orf47_ENST00000295079.2_Silent_p.A2A|TYW5_ENST00000354611.4_5'Flank|C2orf69_ENST00000491721.1_3'UTR|TYW5_ENST00000452512.2_5'Flank			Q8WWC4	CB047_HUMAN	chromosome 2 open reading frame 47	2						mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|large_intestine(1)|lung(5)	9						TAAAAATGGCGCTGGCCGCTC	0.637																																																0			2											31.0	37.0	35.0					2																	200820527		2194	4298	6492	200528772	SO:0001819	synonymous_variant	79568			BC017959	CCDS2329.1	2q33.1	2011-03-08			ENSG00000162972	ENSG00000162972			26198	protein-coding gene	gene with protein product						12477932	Standard	NM_024520		Approved	DKFZp666A212, FLJ22555	uc002uvm.3	Q8WWC4	OTTHUMG00000132771	ENST00000392290.1:c.6G>A	2.37:g.200820527G>A		Somatic		Capture	Illumina GAIIx	4	200528772	Q658V9|Q9H671	Silent	SNP	NULL	p.A2	ENST00000392290.1	37	c.6	CCDS2329.1	2																																																																																			-	NULL		0.637	C2orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf47	protein_coding	OTTHUMT00000256146.1	G	NM_024520		200528772	+1	no_errors	NM_024520	genbank	human	predicted	54_36p	silent	SNP	1.000	A
CR2	1380	genome.wustl.edu	37	1	207646195	207646195	+	Missense_Mutation	SNP	C	C	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:207646195C>A	ENST00000367058.3	+	10	1838	c.1649C>A	c.(1648-1650)aCc>aAc	p.T550N	CR2_ENST00000367059.3_Missense_Mutation_p.T550N|CR2_ENST00000458541.2_Missense_Mutation_p.N524K|CR2_ENST00000367057.3_Missense_Mutation_p.T550N	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	550	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CCATATGGAACCACGGTCACT	0.473																																																0			1											80.0	78.0	79.0					1																	207646195		2203	4300	6503	205712818	SO:0001583	missense	1380			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1649C>A	1.37:g.207646195C>A	ENSP00000356025:p.Thr550Asn	Somatic		Capture	Illumina GAIIx	4	205712818	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP	p.T550N	ENST00000367058.3	37	c.1649	CCDS1478.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.33|12.33	1.904430|1.904430	0.33628|0.33628	.|.	.|.	ENSG00000117322|ENSG00000117322	ENST00000458541|ENST00000367058;ENST00000367057;ENST00000367059	T|T;T;T	0.30981|0.66099	1.51|-0.19;-0.19;-0.19	5.75|5.75	3.89|3.89	0.44902|0.44902	.|Complement control module (2);Sushi/SCR/CCP (3);	.|.	.|.	.|.	.|.	T|T	0.65428|0.65428	0.2690|0.2690	L|L	0.27944|0.27944	0.81|0.81	0.28098|0.28098	N|N	0.931533|0.931533	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.994;0.997;0.99	T|T	0.56092|0.56092	-0.8036|-0.8036	7|9	0.14252|0.62326	T|D	0.57|0.03	.|.	7.8674|7.8674	0.29545|0.29545	0.0:0.8192:0.0:0.1808|0.0:0.8192:0.0:0.1808	.|.	.|550;550;550;550	.|C9JHD2;Q5SR47;P20023;P20023-3	.|.;.;CR2_HUMAN;.	K|N	524|550	ENSP00000404222:N524K|ENSP00000356025:T550N;ENSP00000356024:T550N;ENSP00000356026:T550N	ENSP00000404222:N524K|ENSP00000356024:T550N	N|T	+|+	3|2	2|0	CR2|CR2	205712818|205712818	0.961000|0.961000	0.32948|0.32948	0.615000|0.615000	0.29064|0.29064	0.257000|0.257000	0.26127|0.26127	2.409000|2.409000	0.44583|0.44583	1.445000|1.445000	0.47624|0.47624	-0.136000|-0.136000	0.14681|0.14681	AAC|ACC	-	superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP		0.473	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	protein_coding	OTTHUMT00000088274.1	C	NM_001877		205712818	+1	no_errors	NM_001006658	genbank	human	validated	54_36p	missense	SNP	0.705	A
ASIC4	55515	genome.wustl.edu	37	2	220396852	220396852	+	Splice_Site	SNP	T	T	A			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr2:220396852T>A	ENST00000347842.3	+	3	1250		c.e3+2		ASIC4_ENST00000358078.4_Splice_Site|ASIC4_ENST00000473709.1_Splice_Site	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4						ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										GAACAGCGGGTGAGCATCTCC	0.632																																																0			2											51.0	54.0	53.0					2																	220396852		2203	4300	6503	220105096	SO:0001630	splice_region_variant	55515			AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1236+2T>A	2.37:g.220396852T>A		Somatic		Capture	Illumina GAIIx	4	220105096	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Splice_Site	SNP	-	e3+2	ENST00000347842.3	37	c.1236+2	CCDS2442.1	2	.	.	.	.	.	.	.	.	.	.	T	16.80	3.223384	0.58668	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	.	.	.	3.8	2.63	0.31362	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.9255	0.35637	0.0:0.0916:0.0:0.9084	.	.	.	.	.	-1	.	.	.	+	.	.	ACCN4	220105096	1.000000	0.71417	0.987000	0.45799	0.907000	0.53573	6.044000	0.71012	0.654000	0.30846	-0.379000	0.06801	.	-	-		0.632	ASIC4-001	KNOWN	basic|CCDS	protein_coding	ACCN4	protein_coding	OTTHUMT00000130263.1	T	NM_018674	Intron	220105096	+1	no_errors	NM_018674	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
C1orf101	257044	genome.wustl.edu	37	1	244716019	244716019	+	Missense_Mutation	SNP	G	G	A	rs573139470	byFrequency	TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:244716019G>A	ENST00000366534.4	+	9	986	c.932G>A	c.(931-933)cGt>cAt	p.R311H	C1orf101_ENST00000366531.3_Missense_Mutation_p.R160H|C1orf101_ENST00000366533.4_Missense_Mutation_p.R311H|C1orf101_ENST00000473875.1_Intron	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	311						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			AAGAGTTTTCGTGGATTTATA	0.363													g|||	4	0.000798722	0.0	0.0	5008	,	,		14209	0.002		0.0	False		,,,				2504	0.002															0			1											120.0	122.0	121.0					1																	244716019		2203	4300	6503	242782642	SO:0001583	missense	257044			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.932G>A	1.37:g.244716019G>A	ENSP00000355492:p.Arg311His	Somatic		Capture	Illumina GAIIx	4	242782642	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	NULL	p.R311H	ENST00000366534.4	37	c.932	CCDS44340.1	1	.	.	.	.	.	.	.	.	.	.	g	7.429	0.638284	0.14386	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042;ENST00000366531	T;T;T	0.30714	1.53;1.53;1.52	5.71	-11.4	0.00090	.	4.479770	0.00166	N	0.000010	T	0.09291	0.0229	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.17623	-1.0363	10	0.16420	T	0.52	.	2.7512	0.05281	0.4969:0.2298:0.118:0.1552	.	231;311;311	B1AQM6;Q5SY80;Q5SY80-2	.;CA101_HUMAN;.	H	311;311;311;231;160	ENSP00000355492:R311H;ENSP00000355491:R311H;ENSP00000395796:R231H	ENSP00000355489:R160H	R	+	2	0	C1orf101	242782642	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.579000	0.00907	-3.038000	0.00264	-2.249000	0.00283	CGT	-	NULL		0.363	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	protein_coding	OTTHUMT00000096701.1	G	NM_173807		242782642	+1	no_errors	NM_173807	genbank	human	validated	54_36p	missense	SNP	0.000	A
OR2M1P	388762	genome.wustl.edu	37	1	248285509	248285509	+	IGR	SNP	T	T	G			TCGA-29-2434-01A-01D-1526-09	TCGA-29-2434-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	271336aa-136d-4bcf-b597-60310d444925	dc6a0714-4edc-497f-a832-7d6e2414ddf1	g.chr1:248285509T>G								OR2L13 (21285 upstream) : OR2M5 (22940 downstream)																							GCAAGTCCATTTCTATGGCTG	0.488																																																0			1																																								246352132	SO:0001628	intergenic_variant	388762																															1.37:g.248285509T>G		Somatic		Capture	Illumina GAIIx	4	246352132		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.488					OR2M1P			T			246352132	+1	pseudogene	NR_002141	genbank	human	provisional	54_36p	rna	SNP	0.010	G
