#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrUnknown:0T>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								12690	SO:0001628	intergenic_variant	4540																															Unknown.37:g.0T>A		Somatic		Capture	Illumina GAIIx	4	12690		Missense_Mutation	SNP	HMMPfam_Oxidored_q1_N,HMMPfam_Oxidored_q1,HMMPfam_NADH5_C	p.F118Y		37	c.353		MT																																																																																			-	HMMPfam_Oxidored_q1_N	0	0					MT-ND5			T			12690	+1	no_errors	ENST00000361567	ensembl	human	known	54_36p	missense	SNP	NULL	A
KDM5A	5927	genome.wustl.edu	37	12	404852	404852	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr12:404852G>A	ENST00000399788.2	-	26	4704	c.4342C>T	c.(4342-4344)Ctt>Ttt	p.L1448F	KDM5A_ENST00000382815.4_Missense_Mutation_p.L1448F|KDM5A_ENST00000540838.1_5'Flank	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1448					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						ACCATCATAAGTTCTTCCAGT	0.517			T	NUP98	AML																																		Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0			12											183.0	175.0	178.0					12																	404852		1898	4118	6016	275113	SO:0001583	missense	5927				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.4342C>T	12.37:g.404852G>A	ENSP00000382688:p.Leu1448Phe	Somatic		Capture	Illumina GAIIx	4	275113	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	HMMSmart_SM00545,HMMSmart_SM00501,HMMSmart_SM00249,PatternScan_ZF_PHD_1,HMMSmart_SM00558	p.L1448F	ENST00000399788.2	37	c.4342	CCDS41736.1	12	.	.	.	.	.	.	.	.	.	.	G	21.8	4.197640	0.79015	.	.	ENSG00000073614	ENST00000399788;ENST00000382815	D;D	0.92495	-3.05;-3.03	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.96056	0.8715	M	0.74467	2.265	0.58432	D	0.999993	D;D	0.76494	0.998;0.999	D;D	0.83275	0.991;0.996	D	0.96147	0.9105	10	0.87932	D	0	-13.2261	19.5762	0.95446	0.0:0.0:1.0:0.0	.	1448;1448	P29375;P29375-2	KDM5A_HUMAN;.	F	1448	ENSP00000382688:L1448F;ENSP00000372265:L1448F	ENSP00000372265:L1448F	L	-	1	0	KDM5A	275113	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.664000	0.83830	2.699000	0.92147	0.561000	0.74099	CTT	-	NULL		0.517	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JARID1A	protein_coding	OTTHUMT00000397812.1	G	NM_005056		275113	-1	no_errors	NM_001042603	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CCDC77	84318	genome.wustl.edu	37	12	550094	550094	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr12:550094G>C	ENST00000239830.4	+	12	1431	c.1252G>C	c.(1252-1254)Gaa>Caa	p.E418Q	CCDC77_ENST00000422000.1_Missense_Mutation_p.E386Q|CCDC77_ENST00000540180.1_Missense_Mutation_p.E386Q|CCDC77_ENST00000412006.2_Missense_Mutation_p.E386Q	NM_032358.3	NP_115734.1	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77	418						centrosome (GO:0005813)|membrane (GO:0016020)		p.E418Q(1)		cervix(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			CCTGGAAGTAGAAGGCTTTAA	0.433																																																1	Substitution - Missense(1)	cervix(1)	12											89.0	82.0	84.0					12																	550094		2203	4300	6503	420355	SO:0001583	missense	84318			AK027638	CCDS8503.1, CCDS44781.1	12p13.33	2006-02-16			ENSG00000120647	ENSG00000120647			28203	protein-coding gene	gene with protein product						12477932	Standard	NM_001130148		Approved	MGC13183	uc001qig.3	Q9BR77	OTTHUMG00000129214	ENST00000239830.4:c.1252G>C	12.37:g.550094G>C	ENSP00000239830:p.Glu418Gln	Somatic		Capture	Illumina GAIIx	4	420355	B4DDE8	Missense_Mutation	SNP	NULL	p.E418Q	ENST00000239830.4	37	c.1252	CCDS8503.1	12	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739935	0.69304	.	.	ENSG00000120647	ENST00000540180;ENST00000422000;ENST00000543504;ENST00000239830;ENST00000412006	T;T;T;T;T	0.44881	0.91;0.91;1.31;0.91;0.91	5.94	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.49541	0.1563	M	0.84585	2.705	0.58432	D	0.999998	P	0.36683	0.565	B	0.33254	0.16	T	0.56986	-0.7888	10	0.48119	T	0.1	-18.2775	16.9863	0.86340	0.0:0.1276:0.8724:0.0	.	418	Q9BR77	CCD77_HUMAN	Q	386;386;386;418;386	ENSP00000440554:E386Q;ENSP00000391870:E386Q;ENSP00000445873:E386Q;ENSP00000239830:E418Q;ENSP00000412925:E386Q	ENSP00000239830:E418Q	E	+	1	0	CCDC77	420355	1.000000	0.71417	0.992000	0.48379	0.882000	0.50991	7.727000	0.84838	1.479000	0.48272	0.563000	0.77884	GAA	-	NULL		0.433	CCDC77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC77	protein_coding	OTTHUMT00000251296.1	G	NM_032358		420355	+1	no_errors	NM_032358	genbank	human	validated	54_36p	missense	SNP	1.000	C
WDR37	22884	genome.wustl.edu	37	10	1142163	1142163	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr10:1142163C>A	ENST00000358220.1	+	9	847	c.703C>A	c.(703-705)Ccc>Acc	p.P235T	WDR37_ENST00000381329.1_Missense_Mutation_p.P235T|WDR37_ENST00000263150.4_Missense_Mutation_p.P235T			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	235										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		GCTGCCGACACCCCAGCCTGT	0.483																																																0			10											130.0	112.0	118.0					10																	1142163		2203	4300	6503	1132163	SO:0001583	missense	22884			AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.703C>A	10.37:g.1142163C>A	ENSP00000350954:p.Pro235Thr	Somatic		Capture	Illumina GAIIx	4	1132163	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.P235T	ENST00000358220.1	37	c.703	CCDS7057.1	10	.	.	.	.	.	.	.	.	.	.	C	19.01	3.743225	0.69418	.	.	ENSG00000047056	ENST00000358220;ENST00000381329;ENST00000263150;ENST00000436154	T;T;T;T	0.74947	-0.02;-0.81;-0.02;-0.89	5.5	5.5	0.81552	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.049623	0.85682	N	0.000000	T	0.77725	0.4173	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	0.997;0.979;1.0	P;P;D	0.85130	0.879;0.63;0.997	T	0.71705	-0.4512	10	0.13108	T	0.6	.	19.3984	0.94617	0.0:1.0:0.0:0.0	.	235;235;235	A8K976;Q9Y2I8;E7EQ49	.;WDR37_HUMAN;.	T	235;235;235;202	ENSP00000350954:P235T;ENSP00000370730:P235T;ENSP00000263150:P235T;ENSP00000404346:P202T	ENSP00000263150:P235T	P	+	1	0	WDR37	1132163	1.000000	0.71417	0.806000	0.32338	0.606000	0.37113	4.722000	0.61958	2.587000	0.87381	0.643000	0.83706	CCC	-	superfamily_WD40_like		0.483	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR37	protein_coding	OTTHUMT00000046418.1	C	NM_014023		1132163	+1	no_errors	NM_014023	genbank	human	reviewed	54_36p	missense	SNP	0.960	A
SRRM2	23524	genome.wustl.edu	37	16	2815985	2815985	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr16:2815985G>T	ENST00000301740.8	+	11	6005	c.5456G>T	c.(5455-5457)gGt>gTt	p.G1819V		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1819	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						GGAGGCTCTGGTTATCACTCA	0.632																																																0			16											38.0	45.0	43.0					16																	2815985		2198	4300	6498	2755986	SO:0001583	missense	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5456G>T	16.37:g.2815985G>T	ENSP00000301740:p.Gly1819Val	Somatic		Capture	Illumina GAIIx	4	2755986	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	HMMPfam_cwf21	p.G1819V	ENST00000301740.8	37	c.5456	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	10.40	1.339598	0.24339	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.34667	1.35	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000008	T	0.40595	0.1123	N	0.08118	0	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.50583	-0.8811	10	0.66056	D	0.02	-13.1113	14.803	0.69929	0.0:0.0:1.0:0.0	.	1819	Q9UQ35	SRRM2_HUMAN	V	1819;1819;1071	ENSP00000301740:G1819V	ENSP00000301740:G1819V	G	+	2	0	SRRM2	2755986	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.387000	0.66243	2.562000	0.86427	0.650000	0.86243	GGT	-	NULL		0.632	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	protein_coding	OTTHUMT00000436411.1	G			2755986	+1	no_errors	NM_016333	genbank	human	validated	54_36p	missense	SNP	1.000	T
FOXM1	2305	genome.wustl.edu	37	12	2968074	2968074	+	Silent	SNP	T	T	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr12:2968074T>C	ENST00000359843.3	-	9	2090	c.2022A>G	c.(2020-2022)caA>caG	p.Q674Q	Y_RNA_ENST00000410561.1_RNA|ITFG2_ENST00000545509.1_Intron|FOXM1_ENST00000342628.2_Silent_p.Q712Q|AC005841.1_ENST00000382678.3_5'Flank|FOXM1_ENST00000361953.3_Silent_p.Q659Q	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	674					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			TGAGGAGCCTTTGCGGTGATT	0.597																																																0			12											46.0	52.0	50.0					12																	2968074		2203	4300	6503	2838335	SO:0001819	synonymous_variant	2305			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.2022A>G	12.37:g.2968074T>C		Somatic		Capture	Illumina GAIIx	4	2838335	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Silent	SNP	"HMMSmart_SM00339,superfamily_""Winged helix"" DNA-binding domain,PatternScan_FORK_HEAD_1,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2"	p.Q712	ENST00000359843.3	37	c.2136	CCDS8515.1	12																																																																																			-	NULL		0.597	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	protein_coding	OTTHUMT00000398272.1	T	NM_021953		2838335	-1	no_errors	NM_202002	genbank	human	validated	54_36p	silent	SNP	0.756	C
HTT	3064	genome.wustl.edu	37	4	3188380	3188380	+	Silent	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr4:3188380G>A	ENST00000355072.5	+	38	5068	c.4923G>A	c.(4921-4923)ttG>ttA	p.L1641L		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1641					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TTGAGATTTTGGCCCCTTCCT	0.453																																																0			4											245.0	228.0	234.0					4																	3188380		1940	4138	6078	3158178	SO:0001819	synonymous_variant	3064			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.4923G>A	4.37:g.3188380G>A		Somatic		Capture	Illumina GAIIx	4	3158178	Q9UQB7	Silent	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.L1641	ENST00000355072.5	37	c.4923	CCDS43206.1	4																																																																																			-	NULL		0.453	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	protein_coding	OTTHUMT00000358234.2	G	NM_002111		3158178	+1	no_errors	NM_002111	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
SLX4	84464	genome.wustl.edu	37	16	3639991	3639991	+	Missense_Mutation	SNP	C	C	G	rs139544666	byFrequency	TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr16:3639991C>G	ENST00000294008.3	-	12	4288	c.3648G>C	c.(3646-3648)caG>caC	p.Q1216H		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	1216	Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CCTCATCCTCCTGCTGCAGCA	0.592								Direct reversal of damage																																								0			16											50.0	54.0	53.0					16																	3639991		2197	4300	6497	3579992	SO:0001583	missense	84464			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.3648G>C	16.37:g.3639991C>G	ENSP00000294008:p.Gln1216His	Somatic		Capture	Illumina GAIIx	4	3579992	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225	p.Q1216H	ENST00000294008.3	37	c.3648	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	C	1.019	-0.685509	0.03328	.	.	ENSG00000188827	ENST00000294008	T	0.18810	2.19	1.55	-2.5	0.06384	.	2.898080	0.00812	N	0.001513	T	0.12050	0.0293	N	0.12182	0.205	0.09310	N	1	B	0.21071	0.051	B	0.25405	0.06	T	0.19353	-1.0308	10	0.40728	T	0.16	.	3.6623	0.08244	0.0:0.2303:0.4246:0.3451	.	1216	Q8IY92	SLX4_HUMAN	H	1216	ENSP00000294008:Q1216H	ENSP00000294008:Q1216H	Q	-	3	2	SLX4	3579992	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.506000	0.06359	-0.711000	0.04995	0.655000	0.94253	CAG	-	NULL		0.592	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD12	protein_coding	OTTHUMT00000157301.3	C	NM_032444		3579992	-1	no_errors	NM_032444	genbank	human	provisional	54_36p	missense	SNP	0.001	G
HSPA12B	116835	genome.wustl.edu	37	20	3726608	3726608	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr20:3726608G>C	ENST00000254963.2	+	7	750	c.605G>C	c.(604-606)cGc>cCc	p.R202P	HSPA12B_ENST00000542646.1_Missense_Mutation_p.R36P	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	202							ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						GACACTGTGCGCTGGGTGTTG	0.632																																																0			20											80.0	65.0	70.0					20																	3726608		2203	4300	6503	3674608	SO:0001583	missense	116835			AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.605G>C	20.37:g.3726608G>C	ENSP00000254963:p.Arg202Pro	Somatic		Capture	Illumina GAIIx	4	3674608	D3DVX7|Q2TAK3|Q9BR52	Missense_Mutation	SNP	PatternScan_HSP70_1,PatternScan_HSP70_2,PatternScan_HSP70_3,superfamily_SSF53067	p.R202P	ENST00000254963.2	37	c.605	CCDS13061.1	20	.	.	.	.	.	.	.	.	.	.	G	33	5.199644	0.94997	.	.	ENSG00000132622	ENST00000254963;ENST00000542646;ENST00000399701	T;T;T	0.04119	3.7;3.7;3.7	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.23410	0.0566	M	0.82323	2.585	0.80722	D	1	D;D	0.55172	0.966;0.97	P;D	0.66979	0.874;0.948	T	0.00132	-1.2012	10	0.56958	D	0.05	-22.9644	16.444	0.83910	0.0:0.0:1.0:0.0	.	201;202	B7ZLP2;Q96MM6	.;HS12B_HUMAN	P	202;36;116	ENSP00000254963:R202P;ENSP00000441506:R36P;ENSP00000382608:R116P	ENSP00000254963:R202P	R	+	2	0	HSPA12B	3674608	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.124000	0.94394	2.755000	0.94549	0.655000	0.94253	CGC	-	superfamily_SSF53067		0.632	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12B	protein_coding	OTTHUMT00000077756.2	G	NM_052970		3674608	+1	no_errors	NM_052970	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
UBXN6	80700	genome.wustl.edu	37	19	4454023	4454023	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr19:4454023C>T	ENST00000301281.6	-	2	275	c.151G>A	c.(151-153)Gag>Aag	p.E51K	UBXN6_ENST00000394765.3_5'UTR|CTB-50L17.9_ENST00000592034.1_RNA	NM_025241.2	NP_079517.1	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	51						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	12						ATCTGTGCCTCATTGGTGGGT	0.667																																																0			19											73.0	93.0	86.0					19																	4454023		2203	4299	6502	4405023	SO:0001583	missense	80700			AF272893	CCDS12129.1, CCDS54201.1	19p13	2008-07-25	2008-07-25	2008-07-25		ENSG00000167671		"""UBX domain containing"""	14928	protein-coding gene	gene with protein product		611946	"""UBX domain-containing 1"", ""UBX domain containing 1"""	UBXD1		11342112	Standard	NM_025241		Approved	UBXDC2	uc002man.2	Q9BZV1		ENST00000301281.6:c.151G>A	19.37:g.4454023C>T	ENSP00000301281:p.Glu51Lys	Somatic		Capture	Illumina GAIIx	4	4405023	D6W626|Q96AH1|Q96IK9|Q9BZV0	Missense_Mutation	SNP	HMMPfam_PUB,HMMSmart_SM00580,superfamily_Ubiquitin-like,HMMSmart_SM00166,HMMPfam_UBX	p.E51K	ENST00000301281.6	37	c.151	CCDS12129.1	19	.	.	.	.	.	.	.	.	.	.	C	33	5.198054	0.94997	.	.	ENSG00000167671	ENST00000301281	T	0.49720	0.77	4.24	4.24	0.50183	.	0.060444	0.64402	D	0.000003	T	0.55162	0.1903	M	0.76574	2.34	0.80722	D	1	P	0.47762	0.9	P	0.45946	0.498	T	0.64761	-0.6331	10	0.62326	D	0.03	-38.1701	15.6441	0.77033	0.0:1.0:0.0:0.0	.	51	Q9BZV1	UBXN6_HUMAN	K	51	ENSP00000301281:E51K	ENSP00000301281:E51K	E	-	1	0	UBXN6	4405023	1.000000	0.71417	0.993000	0.49108	0.960000	0.62799	5.130000	0.64745	1.915000	0.55452	0.491000	0.48974	GAG	-	NULL		0.667	UBXN6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN6	protein_coding	OTTHUMT00000458447.3	C	NM_025241		4405023	-1	no_errors	NM_025241	genbank	human	provisional	54_36p	missense	SNP	1.000	T
PSMC1P11	442153	genome.wustl.edu	37	6	4703063	4703063	+	IGR	SNP	C	C	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr6:4703063C>A								snoU13 (58975 upstream) : CDYL (3329 downstream)																							ATCGTGTCTACATCTGTGGGC	0.502																																																0			6																																								4648062	SO:0001628	intergenic_variant	442153																															6.37:g.4703063C>A		Somatic		Capture	Illumina GAIIx	4	4648062		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.502					LOC442153			C			4648062	+1	pseudogene	XR_016425	genbank	human	model	54_36p	rna	SNP	1.000	A
WSCD1	23302	genome.wustl.edu	37	17	6021404	6021404	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr17:6021404C>T	ENST00000574946.1	+	8	1661	c.1271C>T	c.(1270-1272)gCc>gTc	p.A424V	WSCD1_ENST00000573634.1_Missense_Mutation_p.A308V|WSCD1_ENST00000317744.5_Missense_Mutation_p.A424V|WSCD1_ENST00000539421.1_Missense_Mutation_p.A424V|WSCD1_ENST00000574232.1_Missense_Mutation_p.A424V			Q658N2	WSCD1_HUMAN	WSC domain containing 1	424						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						TTTGATTCAGCCATCCTGCTA	0.557																																																0			17											82.0	77.0	78.0					17																	6021404		2203	4300	6503	5962128	SO:0001583	missense	23302				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1271C>T	17.37:g.6021404C>T	ENSP00000460825:p.Ala424Val	Somatic		Capture	Illumina GAIIx	4	5962128	A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	HMMSmart_WSC,HMMPfam_WSC,superfamily_SSF52540	p.A424V	ENST00000574946.1	37	c.1271	CCDS32538.1	17	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663475	0.88251	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.36340	1.26;1.26	5.47	5.47	0.80525	.	0.108953	0.64402	D	0.000009	T	0.50752	0.1634	L	0.43923	1.385	0.49687	D	0.999814	D	0.67145	0.996	D	0.63597	0.916	T	0.43718	-0.9374	10	0.46703	T	0.11	-29.5557	16.8089	0.85713	0.0:1.0:0.0:0.0	.	424	Q658N2	WSCD1_HUMAN	V	424	ENSP00000323087:A424V;ENSP00000446032:A424V	ENSP00000323087:A424V	A	+	2	0	WSCD1	5962128	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	5.775000	0.68915	2.583000	0.87209	0.655000	0.94253	GCC	-	superfamily_SSF52540		0.557	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSCD1	protein_coding	OTTHUMT00000438965.4	C	NM_015253		5962128	+1	no_errors	NM_015253	genbank	human	validated	54_36p	missense	SNP	0.998	T
TADA2B	93624	genome.wustl.edu	37	4	7056625	7056625	+	Silent	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr4:7056625C>T	ENST00000310074.7	+	2	1296	c.1107C>T	c.(1105-1107)taC>taT	p.Y369Y	TADA2B_ENST00000515646.1_Silent_p.Y277Y|TADA2B_ENST00000512388.1_Silent_p.Y294Y	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	369					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						CAGCCCGCTACGTGACTGTGA	0.517																																																0			4											70.0	73.0	72.0					4																	7056625		1919	4123	6042	7107526	SO:0001819	synonymous_variant	93624			AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.1107C>T	4.37:g.7056625C>T		Somatic		Capture	Illumina GAIIx	4	7107526	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Silent	SNP	HMMSmart_SM00291,PatternScan_ZF_ZZ_1,superfamily_Homeodomain-like,HMMSmart_SM00717,HMMPfam_Myb_DNA-binding	p.Y369	ENST00000310074.7	37	c.1107	CCDS47007.1	4																																																																																			-	NULL		0.517	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2B	protein_coding	OTTHUMT00000358687.2	C	NM_152293		7107526	+1	no_errors	NM_152293	genbank	human	validated	54_36p	silent	SNP	0.990	T
SLC35G6	643664	genome.wustl.edu	37	17	7385639	7385639	+	Silent	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr17:7385639C>T	ENST00000412468.2	+	2	451	c.336C>T	c.(334-336)gtC>gtT	p.V112V	ZBTB4_ENST00000311403.4_Intron|ZBTB4_ENST00000380599.4_5'Flank|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	112	EamA 1.					integral component of membrane (GO:0016021)											TGCTCAACGTCCTCAGCATTG	0.607																																																0			17											179.0	179.0	179.0					17																	7385639		2203	4300	6503	7326363	SO:0001819	synonymous_variant	643664				CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.336C>T	17.37:g.7385639C>T		Somatic		Capture	Illumina GAIIx	4	7326363		Silent	SNP	superfamily_SSF103481,HMMPfam_DUF6	p.V112	ENST00000412468.2	37	c.336	CCDS45603.1	17																																																																																			-	superfamily_SSF103481		0.607	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AMAC1L3	protein_coding		C	NM_001102614		7326363	+1	no_errors	NM_001102614	genbank	human	provisional	54_36p	silent	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577058	7577058	+	Nonsense_Mutation	SNP	C	C	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr17:7577058C>A	ENST00000269305.4	-	8	1069	c.880G>T	c.(880-882)Gag>Tag	p.E294*	TP53_ENST00000455263.2_Nonsense_Mutation_p.E294*|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.E294*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E294*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E294*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	294	Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E294*(46)|p.E294fs*51(9)|p.K291fs*48(8)|p.0?(8)|p.E294K(3)|p.E294fs*12(3)|p.?(2)|p.E294Q(2)|p.L265_K305del41(1)|p.E294>*(1)|p.G293fs*1(1)|p.R290fs*50(1)|p.R290_P295>X(1)|p.E294fs*11(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGAGGCTCCCCTTTCTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	87	Substitution - Nonsense(46)|Deletion - Frameshift(20)|Whole gene deletion(8)|Substitution - Missense(5)|Insertion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Complex - deletion inframe(1)|Complex - compound substitution(1)	upper_aerodigestive_tract(17)|lung(14)|large_intestine(10)|breast(7)|urinary_tract(6)|oesophagus(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|bone(4)|stomach(3)|central_nervous_system(2)|skin(2)|salivary_gland(1)|vulva(1)|soft_tissue(1)|endometrium(1)	17											109.0	95.0	100.0					17																	7577058		2203	4300	6503	7517783	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.880G>T	17.37:g.7577058C>A	ENSP00000269305:p.Glu294*	Somatic		Capture	Illumina GAIIx	4	7517783	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.E294*	ENST00000269305.4	37	c.880	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.130179	0.94473	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	4.29	0.51040	.	0.702099	0.13430	N	0.388474	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-17.6918	13.5106	0.61511	0.0:0.8337:0.1663:0.0	.	.	.	.	X	294;294;294;294;294;283;162	.	ENSP00000269305:E294X	E	-	1	0	TP53	7517783	0.019000	0.18553	0.006000	0.13384	0.253000	0.25986	1.700000	0.37815	1.441000	0.47550	0.561000	0.74099	GAG	-	NULL		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517783	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.009	A
VCX	26609	genome.wustl.edu	37	X	7811259	7811259	+	Silent	SNP	G	G	C	rs140123807		TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:7811259G>C	ENST00000381059.3	+	2	234	c.15G>C	c.(13-15)ccG>ccC	p.P5P	VCX_ENST00000341408.4_Silent_p.P5P	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	5					chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GTCCAAAGCCGAGAGCCTCGG	0.627													-|||	292	0.077351	0.0303	0.0331	3775	,	,		12914	0.0923		0.1163	False		,,,				2504	0.0194															0			X											29.0	29.0	29.0					X																	7811259		2157	4157	6314	7771259	SO:0001819	synonymous_variant	26609			AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.15G>C	X.37:g.7811259G>C		Somatic		Capture	Illumina GAIIx	4	7771259	A0JNS5|Q4V774|Q9P0H3	Silent	SNP	NULL	p.P5	ENST00000381059.3	37	c.15	CCDS14128.1	X																																																																																			-	NULL		0.627	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VCX	protein_coding	OTTHUMT00000071474.1	G	NM_013452		7771259	+1	no_errors	NM_013452	genbank	human	reviewed	54_36p	silent	SNP	0.000	C
PER1	5187	genome.wustl.edu	37	17	8045156	8045156	+	Silent	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr17:8045156C>G	ENST00000317276.4	-	22	3804	c.3567G>C	c.(3565-3567)cgG>cgC	p.R1189R	PER1_ENST00000581082.1_Silent_p.R1166R|PER1_ENST00000578089.1_5'Flank	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	1189	CRY binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GTTGGCCCTTCCGGACCCAGG	0.572			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																															Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0			17											70.0	81.0	77.0					17																	8045156		2203	4300	6503	7985881	SO:0001819	synonymous_variant	5187			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.3567G>C	17.37:g.8045156C>G		Somatic		Capture	Illumina GAIIx	4	7985881	B2RPA8|B4DI49|D3DTR3	Silent	SNP	HMMSmart_SM00091,superfamily_PYP-like sensor domain (PAS domain),HMMPfam_PAS_3	p.R1189	ENST00000317276.4	37	c.3567	CCDS11131.1	17																																																																																			-	NULL		0.572	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	protein_coding	OTTHUMT00000441481.2	C			7985881	-1	no_errors	NM_002616	genbank	human	reviewed	54_36p	silent	SNP	0.997	G
OR7G3	390883	genome.wustl.edu	37	19	9236799	9236799	+	Silent	SNP	C	C	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr19:9236799C>A	ENST00000305444.2	-	1	827	c.828G>T	c.(826-828)gtG>gtT	p.V276V		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						CGGTATACATCACTGATGCTA	0.458																																																0			19											99.0	89.0	93.0					19																	9236799		2203	4300	6503	9097799	SO:0001819	synonymous_variant	390883				CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.828G>T	19.37:g.9236799C>A		Somatic		Capture	Illumina GAIIx	4	9097799	Q6IFJ6|Q96R99	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V276	ENST00000305444.2	37	c.828	CCDS32899.1	19																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.458	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G3	protein_coding	OTTHUMT00000384611.1	C			9097799	-1	no_errors	NM_001001958	genbank	human	provisional	54_36p	silent	SNP	0.091	A
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037825	10037825	+	RNA	SNP	T	T	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrY:10037825T>C	ENST00000515896.1	+	0	62									RNA, 5.8S ribosomal pseudogene 6																		GCTGTGAGAATTAATGTGAAT	0.517																																																0			Y																																								10647825			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037825T>C		Somatic		Capture	Illumina GAIIx	4	10647825		Missense_Mutation	SNP	NULL	p.I7T	ENST00000515896.1	37	c.20		Y																																																																																			-	NULL		0.517	RNA5-8SP6-201	KNOWN	basic	rRNA	LOC100132755	rRNA		T			10647825	+1	no_errors	XM_001713806	genbank	human	model	54_36p	missense	SNP	1.000	C
MPDZ	8777	genome.wustl.edu	37	9	13224390	13224390	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr9:13224390T>A	ENST00000319217.7	-	4	623	c.376A>T	c.(376-378)Atc>Ttc	p.I126F	MPDZ_ENST00000541718.1_Missense_Mutation_p.I126F|MPDZ_ENST00000536827.1_Missense_Mutation_p.I126F|MPDZ_ENST00000546205.1_Missense_Mutation_p.I126F|MPDZ_ENST00000381015.4_Missense_Mutation_p.I126F|MPDZ_ENST00000447879.1_Missense_Mutation_p.I126F|MPDZ_ENST00000381022.2_Missense_Mutation_p.I126F	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	126					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		ATATTTTTGATAAGCTGATCA	0.338																																																0			9											112.0	107.0	109.0					9																	13224390		1829	4080	5909	13214390	SO:0001583	missense	8777			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.376A>T	9.37:g.13224390T>A	ENSP00000320006:p.Ile126Phe	Somatic		Capture	Illumina GAIIx	4	13214390	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	HMMPfam_L27_2,superfamily_L27 domain,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.I126F	ENST00000319217.7	37	c.376		9	.	.	.	.	.	.	.	.	.	.	T	19.39	3.817898	0.71028	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.17054	2.35;2.3;2.3;2.3;2.33;2.35;2.35	5.72	4.56	0.56223	.	0.142508	0.32055	N	0.006648	T	0.31009	0.0783	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.987;0.985;0.992	T	0.02132	-1.1208	10	0.66056	D	0.02	.	12.8182	0.57677	0.0:0.0:0.1367:0.8633	.	126;126;126	B7ZMI4;O75970-3;O75970-2	.;.;.	F	126	ENSP00000320006:I126F;ENSP00000439807:I126F;ENSP00000370410:I126F;ENSP00000444151:I126F;ENSP00000415208:I126F;ENSP00000370403:I126F;ENSP00000446358:I126F	ENSP00000320006:I126F	I	-	1	0	MPDZ	13214390	0.997000	0.39634	0.999000	0.59377	0.994000	0.84299	2.491000	0.45303	0.954000	0.37851	0.533000	0.62120	ATC	-	superfamily_PDZ domain-like		0.338	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	protein_coding	OTTHUMT00000055485.2	T	NM_003829		13214390	-1	no_errors	NM_003829	genbank	human	validated	54_36p	missense	SNP	1.000	A
WBP11	51729	genome.wustl.edu	37	12	14946678	14946678	+	Silent	SNP	T	T	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr12:14946678T>C	ENST00000261167.2	-	8	1133	c.900A>G	c.(898-900)gaA>gaG	p.E300E		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	300					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						ACTTCTTTTCTTCATTGTTGT	0.388																																																0			12											307.0	279.0	289.0					12																	14946678		2203	4300	6503	14837945	SO:0001819	synonymous_variant	51729			AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.900A>G	12.37:g.14946678T>C		Somatic		Capture	Illumina GAIIx	4	14837945	Q96AY8	Silent	SNP	HMMPfam_Wbp11	p.E300	ENST00000261167.2	37	c.900	CCDS8666.1	12																																																																																			-	NULL		0.388	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP11	protein_coding	OTTHUMT00000400850.1	T	NM_016312		14837945	-1	no_errors	NM_016312	genbank	human	reviewed	54_36p	silent	SNP	0.984	C
PSIP1	11168	genome.wustl.edu	37	9	15468318	15468318	+	Intron	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr9:15468318G>C	ENST00000380733.4	-	14	1764				PSIP1_ENST00000380738.4_Intron			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1						establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		tgagcaaccaggaagtgggta	0.413																																																0			9																																								15458318	SO:0001627	intron_variant	0			AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.1420+309C>G	9.37:g.15468318G>C		Somatic		Capture	Illumina GAIIx	4	15458318	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Missense_Mutation	SNP	NULL	p.P20R	ENST00000380733.4	37	c.59	CCDS6479.1	9																																																																																			-	NULL		0.413	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100130214	protein_coding	OTTHUMT00000055445.1	G	NM_033222		15458318	-1	no_start_codon:pseudogene	XM_001716944	genbank	human	model	54_36p	missense	SNP	0.396	C
DDI2	84301	genome.wustl.edu	37	1	15964846	15964846	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:15964846C>G	ENST00000480945.1	+	5	848	c.677C>G	c.(676-678)gCt>gGt	p.A226G		NM_032341.4	NP_115717.3	Q5TDH0	DDI2_HUMAN	DNA-damage inducible 1 homolog 2 (S. cerevisiae)	226							aspartic-type endopeptidase activity (GO:0004190)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|stomach(1)	17		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		ATGGAAGAGGCTCCGGAAAGT	0.418																																																0			1											198.0	196.0	197.0					1																	15964846		2203	4300	6503	15837433	SO:0001583	missense	84301				CCDS30607.1	1p36.13	2010-05-04	2010-05-04		ENSG00000197312	ENSG00000197312			24578	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae)"""				Standard	NM_032341		Approved	MGC14844	uc001awx.2	Q5TDH0	OTTHUMG00000002381	ENST00000480945.1:c.677C>G	1.37:g.15964846C>G	ENSP00000417748:p.Ala226Gly	Somatic		Capture	Illumina GAIIx	4	15837433	A8KAE1|Q7RTZ0|Q9BRT1	Missense_Mutation	SNP	superfamily_Ubiquitin-like,HMMPfam_ubiquitin,HMMPfam_Asp_protease,superfamily_Acid proteases	p.A226G	ENST00000480945.1	37	c.677	CCDS30607.1	1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459570	0.84317	.	.	ENSG00000197312	ENST00000480945	T	0.38887	1.11	5.58	5.58	0.84498	Peptidase aspartic (1);Peptidase aspartic, eukaryotic predicted (1);	0.000000	0.85682	U	0.000000	T	0.57592	0.2064	L	0.53249	1.67	0.80722	D	1	P	0.52316	0.952	P	0.60012	0.867	T	0.47289	-0.9129	10	0.27082	T	0.32	-29.6617	19.19	0.93663	0.0:1.0:0.0:0.0	.	226	Q5TDH0	DDI2_HUMAN	G	226	ENSP00000417748:A226G	ENSP00000417748:A226G	A	+	2	0	DDI2	15837433	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.636000	0.89361	0.460000	0.39030	GCT	-	HMMPfam_Asp_protease,superfamily_Acid proteases		0.418	DDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDI2	protein_coding	OTTHUMT00000006826.1	C	NM_032341		15837433	+1	no_errors	NM_032341	genbank	human	provisional	54_36p	missense	SNP	1.000	G
CYFIP1	23191	genome.wustl.edu	37	15	22998481	22998481	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr15:22998481A>G	ENST00000313077.7	+	28	3298	c.3173A>G	c.(3172-3174)cAt>cGt	p.H1058R	CYFIP1_ENST00000560848.1_Missense_Mutation_p.H1058R|CYFIP1_ENST00000435939.2_Missense_Mutation_p.H627R	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCCCCGCTGCATCTTGTCCCA	0.493																																																0			15											65.0	58.0	60.0					15																	22998481		2203	4300	6503	20549922	SO:0001583	missense	23191			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.3173A>G	15.37:g.22998481A>G	ENSP00000324549:p.His1058Arg	Somatic		Capture	Illumina GAIIx	4	20549922		Missense_Mutation	SNP	HMMPfam_FragX_IP	p.H1058R	ENST00000313077.7	37	c.3173	CCDS10009.1	15	.	.	.	.	.	.	.	.	.	.	A	18.31	3.595965	0.66332	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.21932	1.98;1.98	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000002	T	0.26122	0.0637	M	0.61703	1.905	0.80722	D	1	P;B	0.38420	0.63;0.31	B;B	0.38156	0.266;0.216	T	0.02269	-1.1185	10	0.30078	T	0.28	-29.6705	16.0225	0.80509	1.0:0.0:0.0:0.0	.	627;1058	Q7L576-2;Q7L576	.;CYFP1_HUMAN	R	1058;1060;627	ENSP00000324549:H1058R;ENSP00000405956:H627R	ENSP00000324549:H1058R	H	+	2	0	CYFIP1	20549922	1.000000	0.71417	0.888000	0.34837	0.261000	0.26267	9.281000	0.95811	2.198000	0.70561	0.533000	0.62120	CAT	-	HMMPfam_FragX_IP		0.493	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	protein_coding	OTTHUMT00000251136.2	A	NM_014608		20549922	+1	no_errors	NM_014608	genbank	human	validated	54_36p	missense	SNP	1.000	G
SLC6A5	9152	genome.wustl.edu	37	11	20636312	20636312	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr11:20636312A>G	ENST00000525748.1	+	6	1346	c.1073A>G	c.(1072-1074)aAt>aGt	p.N358S		NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	358					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	ACAATGGTTAATTTCACCAGC	0.398																																																0			11											179.0	161.0	167.0					11																	20636312		2203	4300	6503	20592888	SO:0001583	missense	9152			AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.1073A>G	11.37:g.20636312A>G	ENSP00000434364:p.Asn358Ser	Somatic		Capture	Illumina GAIIx	4	20592888	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	HMMPfam_SNF,PatternScan_NA_NEUROTRAN_SYMP_1,PatternScan_NA_NEUROTRAN_SYMP_2,PatternScan_ASP_GLU_RACEMASE_1	p.N358S	ENST00000525748.1	37	c.1073	CCDS7854.1	11	.	.	.	.	.	.	.	.	.	.	A	17.92	3.507148	0.64410	.	.	ENSG00000165970	ENST00000525748	T	0.74526	-0.85	5.71	5.71	0.89125	.	0.317330	0.37178	N	0.002211	T	0.66944	0.2841	L	0.35487	1.065	0.80722	D	1	B	0.18310	0.027	B	0.20384	0.029	T	0.63808	-0.6553	10	0.54805	T	0.06	.	15.65	0.77084	1.0:0.0:0.0:0.0	.	358	Q9Y345	SC6A5_HUMAN	S	358	ENSP00000434364:N358S	ENSP00000434364:N358S	N	+	2	0	SLC6A5	20592888	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.256000	0.89848	2.178000	0.69098	0.482000	0.46254	AAT	-	HMMPfam_SNF		0.398	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A5	protein_coding	OTTHUMT00000387497.2	A	NM_004211		20592888	+1	no_errors	NM_004211	genbank	human	validated	54_36p	missense	SNP	1.000	G
ZNF521	25925	genome.wustl.edu	37	18	22807395	22807395	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr18:22807395G>A	ENST00000361524.3	-	4	635	c.487C>T	c.(487-489)Cgc>Tgc	p.R163C	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Missense_Mutation_p.R163C|ZNF521_ENST00000584787.1_5'UTR	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	163					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TTTATGTGGCGATCTCGGCTG	0.483			T	PAX5	ALL																																		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0			18											135.0	124.0	128.0					18																	22807395		2203	4300	6503	21061393	SO:0001583	missense	25925			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.487C>T	18.37:g.22807395G>A	ENSP00000354794:p.Arg163Cys	Somatic		Capture	Illumina GAIIx	4	21061393	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.R163C	ENST00000361524.3	37	c.487	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	G	10.89	1.478029	0.26511	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.26660	1.72;1.72	5.98	5.1	0.69264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.51669	0.1688	M	0.70842	2.15	0.53688	D	0.999971	D	0.89917	1.0	D	0.97110	1.0	T	0.54879	-0.8227	10	0.54805	T	0.06	-38.6733	16.8083	0.85711	0.0:0.0:0.8705:0.1295	.	163	Q96K83	ZN521_HUMAN	C	163;197;163	ENSP00000354794:R163C;ENSP00000382352:R163C	ENSP00000354794:R163C	R	-	1	0	ZNF521	21061393	1.000000	0.71417	0.918000	0.36340	0.992000	0.81027	6.280000	0.72626	1.512000	0.48834	0.655000	0.94253	CGC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.483	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	protein_coding	OTTHUMT00000446781.2	G	NM_015461		21061393	-1	no_errors	NM_015461	genbank	human	validated	54_36p	missense	SNP	1.000	A
KCNJ12	3768	genome.wustl.edu	37	17	21318782	21318782	+	Missense_Mutation	SNP	G	G	A	rs78117732	byFrequency	TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr17:21318782G>A	ENST00000583088.1	+	3	1023	c.128G>A	c.(127-129)cGc>cAc	p.R43H	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R43H	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	43				R -> H (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CGCAGGTGCCGCAACCGCTTC	0.602										Prostate(3;0.18)																																						0			17																																								21259375	SO:0001583	missense	3768			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.128G>A	17.37:g.21318782G>A	ENSP00000463778:p.Arg43His	Somatic		Capture	Illumina GAIIx	4	21259375	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	HMMPfam_IRK_N,superfamily_SSF81324,HMMPfam_IRK,superfamily_Ig_E-set	p.R43H	ENST00000583088.1	37	c.128	CCDS11219.1	17	1089	0.49862637362637363	246	0.5	180	0.4972375690607735	286	0.5	377	0.4973614775725594	G	17.56	3.420800	0.62622	.	.	ENSG00000184185	ENST00000331718	T	0.35789	1.29	5.33	4.37	0.52481	Potassium channel, inwardly rectifying, Kir, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.49350	1.555	0.58432	D	0.999997	B	0.27594	0.182	B	0.20184	0.028	T	0.52997	-0.8500	10	0.54805	T	0.06	.	14.0406	0.64672	0.0731:0.0:0.9269:0.0	.	43	Q14500	IRK12_HUMAN	H	43	ENSP00000328150:R43H	ENSP00000328150:R43H	R	+	2	0	KCNJ12	21259375	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	9.690000	0.98676	1.265000	0.44215	0.591000	0.81541	CGC	-	HMMPfam_IRK_N,superfamily_SSF81324		0.602	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	protein_coding	OTTHUMT00000255060.2	G	NM_021012		21259375	+1	no_errors	NM_021012	genbank	human	validated	54_36p	missense	SNP	1.000	A
FLJ36000	284124	genome.wustl.edu	37	17	21909466	21909466	+	lincRNA	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr17:21909466G>C	ENST00000581223.2	+	0	191					NR_027084.1																						ATGCCCCACGGTAGCACATTG	0.552																																																0			17																																								21833593			0																															17.37:g.21909466G>C		Somatic		Capture	Illumina GAIIx	4	21833593		Missense_Mutation	SNP	NULL	p.V40L	ENST00000581223.2	37	c.118		17																																																																																			-	NULL		0.552	RP11-744K17.9-001	KNOWN	basic	lincRNA	LOC100128432	lincRNA	OTTHUMT00000451067.1	G			21833593	+1	no_errors	XM_001723718	genbank	human	model	54_36p	missense	SNP	0.000	C
DHRS2	10202	genome.wustl.edu	37	14	24108193	24108193	+	Silent	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr14:24108193G>C	ENST00000250383.6	+	2	596	c.120G>C	c.(118-120)gtG>gtC	p.V40V	DHRS2_ENST00000553896.1_3'UTR|DHRS2_ENST00000344777.7_Silent_p.V40V	NM_005794.3	NP_005785.1	Q13268	DHRS2_HUMAN	dehydrogenase/reductase (SDR family) member 2	40					C21-steroid hormone metabolic process (GO:0008207)|cellular response to oxidative stress (GO:0034599)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	carbonyl reductase (NADPH) activity (GO:0004090)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00659)		GGGTAGCCGTGGTCACGGGGT	0.602																																																0			14											75.0	77.0	76.0					14																	24108193		2203	4300	6503	23178033	SO:0001819	synonymous_variant	10202				CCDS9604.1, CCDS41927.1	14q11.2	2011-09-14			ENSG00000100867	ENSG00000100867		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18349	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 1"""	615194				7556196, 11944995, 16685466, 19027726	Standard	NM_182908		Approved	HEP27, SDR25C1	uc001wkt.4	Q13268	OTTHUMG00000028771	ENST00000250383.6:c.120G>C	14.37:g.24108193G>C		Somatic		Capture	Illumina GAIIx	4	23178033	D3DS54|Q53GS4|Q7Z789|Q9H2R2	Silent	SNP	superfamily_NAD(P)-bd,HMMPfam_adh_short,PatternScan_ADH_SHORT	p.V40	ENST00000250383.6	37	c.120	CCDS9604.1	14																																																																																			-	superfamily_NAD(P)-bd,HMMPfam_adh_short		0.602	DHRS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DHRS2	protein_coding	OTTHUMT00000071842.2	G	NM_182908		23178033	+1	no_errors	NM_182908	genbank	human	validated	54_36p	silent	SNP	0.995	C
UPB1	51733	genome.wustl.edu	37	22	24906749	24906749	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr22:24906749C>T	ENST00000326010.5	+	4	741	c.397C>T	c.(397-399)Ctt>Ttt	p.L133F	UPB1_ENST00000413389.2_Missense_Mutation_p.L65F	NM_016327.2	NP_057411.1	Q9UBR1	BUP1_HUMAN	ureidopropionase, beta	133	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	beta-ureidopropionase activity (GO:0003837)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	22	Colorectal(2;0.0339)					GAGAGAGAAGCTTCCTTGGAC	0.517																																																0			22											93.0	89.0	90.0					22																	24906749		2203	4300	6503	23236749	SO:0001583	missense	51733			AB013885	CCDS13827.1	22q11.2	2008-04-11			ENSG00000100024	ENSG00000100024			16297	protein-coding gene	gene with protein product		606673				10542323	Standard	XR_244378		Approved	BUP1	uc003aaf.3	Q9UBR1	OTTHUMG00000150749	ENST00000326010.5:c.397C>T	22.37:g.24906749C>T	ENSP00000324343:p.Leu133Phe	Somatic		Capture	Illumina GAIIx	4	23236749	A3KMF8|Q9UIR3	Missense_Mutation	SNP	superfamily_Carbon-nitrogen hydrolase,HMMPfam_CN_hydrolase	p.L133F	ENST00000326010.5	37	c.397	CCDS13827.1	22	.	.	.	.	.	.	.	.	.	.	C	10.26	1.300854	0.23650	.	.	ENSG00000100024	ENST00000413389;ENST00000326010	D;D	0.88664	-2.41;-2.41	5.72	5.72	0.89469	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.180522	0.49305	D	0.000146	T	0.79839	0.4515	N	0.12569	0.235	0.49582	D	0.999801	B;B	0.14012	0.009;0.002	B;B	0.15052	0.012;0.012	T	0.74372	-0.3687	10	0.09843	T	0.71	-8.1471	18.867	0.92296	0.0:1.0:0.0:0.0	.	133;65	Q9UBR1;E7EUZ5	BUP1_HUMAN;.	F	65;133	ENSP00000406057:L65F;ENSP00000324343:L133F	ENSP00000324343:L133F	L	+	1	0	UPB1	23236749	1.000000	0.71417	0.992000	0.48379	0.971000	0.66376	5.056000	0.64287	2.708000	0.92522	0.650000	0.86243	CTT	-	superfamily_Carbon-nitrogen hydrolase,HMMPfam_CN_hydrolase		0.517	UPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPB1	protein_coding	OTTHUMT00000319869.1	C			23236749	+1	no_errors	NM_016327	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
STC1	6781	genome.wustl.edu	37	8	23702428	23702428	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr8:23702428T>C	ENST00000290271.2	-	4	882	c.599A>G	c.(598-600)gAc>gGc	p.D200G	STC1_ENST00000524323.1_Missense_Mutation_p.D131G	NM_003155.2	NP_003146.1	P52823	STC1_HUMAN	stanniocalcin 1	200					bone development (GO:0060348)|cellular calcium ion homeostasis (GO:0006874)|cellular response to cAMP (GO:0071320)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|chondrocyte proliferation (GO:0035988)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endothelial cell morphogenesis (GO:0001886)|growth plate cartilage axis specification (GO:0003421)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of renal phosphate excretion (GO:1903403)|ossification (GO:0001503)|positive regulation of calcium ion import (GO:0090280)|regulation of anion transport (GO:0044070)|regulation of cardiac muscle cell contraction (GO:0086004)|response to vitamin D (GO:0033280)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26		Prostate(55;0.055)|Breast(100;0.116)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		GGCACAGTGGTCTGTCTGCAG	0.542																																																0			8											190.0	162.0	172.0					8																	23702428		2203	4300	6503	23758373	SO:0001583	missense	6781				CCDS6043.1	8p22-p12	2008-06-23			ENSG00000159167	ENSG00000159167			11373	protein-coding gene	gene with protein product		601185		STC		9480753	Standard	NM_003155		Approved		uc003xdw.1	P52823	OTTHUMG00000097853	ENST00000290271.2:c.599A>G	8.37:g.23702428T>C	ENSP00000290271:p.Asp200Gly	Somatic		Capture	Illumina GAIIx	4	23758373	B4DN22|Q71UE5	Missense_Mutation	SNP	HMMPfam_Stanniocalcin	p.D200G	ENST00000290271.2	37	c.599	CCDS6043.1	8	.	.	.	.	.	.	.	.	.	.	T	15.60	2.881765	0.51908	.	.	ENSG00000159167	ENST00000290271;ENST00000540277;ENST00000524323	.	.	.	5.98	5.98	0.97165	.	0.129792	0.64402	D	0.000001	T	0.51975	0.1706	L	0.36672	1.1	0.51012	D	0.999908	P	0.35468	0.503	B	0.37650	0.255	T	0.53443	-0.8438	9	0.48119	T	0.1	-20.2321	15.3021	0.73962	0.0:0.0:0.0:1.0	.	200	P52823	STC1_HUMAN	G	200;131;131	.	ENSP00000290271:D200G	D	-	2	0	STC1	23758373	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.162000	0.77515	2.288000	0.76882	0.528000	0.53228	GAC	-	HMMPfam_Stanniocalcin		0.542	STC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STC1	protein_coding	OTTHUMT00000215143.1	T			23758373	-1	no_errors	NM_003155	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ATP12A	479	genome.wustl.edu	37	13	25265355	25265355	+	Silent	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr13:25265355C>T	ENST00000381946.3	+	8	1202	c.1035C>T	c.(1033-1035)gcC>gcT	p.A345A	ATP12A_ENST00000218548.6_Silent_p.A351A			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	345					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		TCATTGTGGCCAATGTGCCCG	0.572																																					Pancreas(156;1582 1935 18898 22665 26498)											0			13											88.0	66.0	73.0					13																	25265355		2203	4300	6503	24163355	SO:0001819	synonymous_variant	479			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1035C>T	13.37:g.25265355C>T		Somatic		Capture	Illumina GAIIx	4	24163355	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	HMMPfam_Cation_ATPase_N,superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Cation_ATPase_C	p.A345	ENST00000381946.3	37	c.1035	CCDS31948.1	13																																																																																			-	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase		0.572	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	protein_coding	OTTHUMT00000044199.1	C	NM_001676		24163355	+1	no_errors	NM_001676	genbank	human	reviewed	54_36p	silent	SNP	0.995	T
FGR	2268	genome.wustl.edu	37	1	27942022	27942022	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:27942022C>T	ENST00000374005.3	-	9	1229	c.941G>A	c.(940-942)cGg>cAg	p.R314Q	FGR_ENST00000374004.1_Missense_Mutation_p.R314Q|FGR_ENST00000399173.1_Missense_Mutation_p.R314Q|FGR_ENST00000545953.1_Missense_Mutation_p.R248Q	NM_005248.2	NP_005239.1	P09769	FGR_HUMAN	FGR proto-oncogene, Src family tyrosine kinase	314	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|defense response to Gram-positive bacterium (GO:0050830)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of innate immune response (GO:0045088)|regulation of phagocytosis (GO:0050764)|regulation of protein kinase activity (GO:0045859)|response to virus (GO:0009615)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|Fc-gamma receptor I complex binding (GO:0034988)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphotyrosine binding (GO:0001784)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(4)	16		all_lung(284;2.05e-05)|Colorectal(325;3.46e-05)|Lung NSC(340;3.67e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CTTGTCGTGCCGCAGCAGCTT	0.637																																																0			1											82.0	70.0	74.0					1																	27942022		2203	4300	6503	27814609	SO:0001583	missense	2268			BC064382	CCDS305.1	1p36.2-p36.1	2014-06-25	2014-06-25		ENSG00000000938	ENSG00000000938		"""SH2 domain containing"""	3697	protein-coding gene	gene with protein product		164940	"""Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog"", ""v-fgr feline Gardner-Rasheed sarcoma viral oncogene homolog"", ""feline Gardner-Rasheed sarcoma viral oncogene homolog"""	SRC2		3922831	Standard	NM_001042729		Approved	c-fgr, p55c-fgr	uc001bom.3	P09769	OTTHUMG00000003516	ENST00000374005.3:c.941G>A	1.37:g.27942022C>T	ENSP00000363117:p.Arg314Gln	Somatic		Capture	Illumina GAIIx	4	27814609	D3DPL7|Q9UIQ3	Missense_Mutation	SNP	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.R314Q	ENST00000374005.3	37	c.941	CCDS305.1	1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206104	0.58234	.	.	ENSG00000000938	ENST00000374005;ENST00000545953;ENST00000399173;ENST00000374004;ENST00000374003	T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71	4.93	4.93	0.64822	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000085	T	0.07052	0.0179	N	0.05574	-0.02	0.38646	D	0.95171	D	0.54772	0.968	B	0.39771	0.309	T	0.39901	-0.9591	10	0.09843	T	0.71	.	17.097	0.86638	0.0:1.0:0.0:0.0	.	314	P09769	FGR_HUMAN	Q	314;248;314;314;314	ENSP00000363117:R314Q;ENSP00000445302:R248Q;ENSP00000382126:R314Q;ENSP00000363116:R314Q;ENSP00000363115:R314Q	ENSP00000363115:R314Q	R	-	2	0	FGR	27814609	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.715000	0.84713	2.451000	0.82905	0.491000	0.48974	CGG	-	superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc		0.637	FGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGR	protein_coding	OTTHUMT00000009772.1	C	NM_005248		27814609	-1	no_errors	NM_001042729	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MVP	9961	genome.wustl.edu	37	16	29848136	29848136	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr16:29848136A>G	ENST00000357402.5	+	7	904	c.766A>G	c.(766-768)Aca>Gca	p.T256A	MVP_ENST00000452209.2_Missense_Mutation_p.H70R|MVP_ENST00000395353.1_Missense_Mutation_p.T256A	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	256					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						AGTGCAGGACACAGAGGCCCA	0.657																																																0			16											56.0	51.0	52.0					16																	29848136		2196	4300	6496	29755637	SO:0001583	missense	9961			X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.766A>G	16.37:g.29848136A>G	ENSP00000349977:p.Thr256Ala	Somatic		Capture	Illumina GAIIx	4	29755637	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Missense_Mutation	SNP	HMMPfam_Vault	p.T256A	ENST00000357402.5	37	c.766	CCDS10656.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.83|13.83	2.354247|2.354247	0.41700|0.41700	.|.	.|.	ENSG00000013364|ENSG00000013364	ENST00000452209|ENST00000357402;ENST00000395353	T|T;T	0.62941|0.33216	-0.01|1.42;1.42	5.37|5.37	4.26|4.26	0.50523|0.50523	.|.	.|0.158693	.|0.56097	.|D	.|0.000030	T|T	0.19005|0.19005	0.0456|0.0456	N|N	0.21282|0.21282	0.65|0.65	0.22873|0.22873	N|N	0.998627|0.998627	.|B	.|0.15930	.|0.015	.|B	.|0.16289	.|0.015	T|T	0.11542|0.11542	-1.0583|-1.0583	7|10	0.87932|0.23891	D|T	0|0.37	-22.0708|-22.0708	9.891|9.891	0.41290|0.41290	0.914:0.0:0.086:0.0|0.914:0.0:0.086:0.0	.|.	.|256	.|Q14764	.|MVP_HUMAN	R|A	70|256	ENSP00000387916:H70R|ENSP00000349977:T256A;ENSP00000378760:T256A	ENSP00000387916:H70R|ENSP00000349977:T256A	H|T	+|+	2|1	0|0	MVP|MVP	29755637|29755637	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.883000|0.883000	0.51084|0.51084	2.796000|2.796000	0.47869|0.47869	2.156000|2.156000	0.67533|0.67533	0.379000|0.379000	0.24179|0.24179	CAC|ACA	-	HMMPfam_Vault		0.657	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVP	protein_coding	OTTHUMT00000109711.3	A	NM_005115		29755637	+1	no_errors	NM_005115	genbank	human	reviewed	54_36p	missense	SNP	0.995	G
STT3B	201595	genome.wustl.edu	37	3	31659440	31659440	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr3:31659440G>A	ENST00000295770.2	+	8	1341	c.1132G>A	c.(1132-1134)Gca>Aca	p.A378T	STT3B_ENST00000453168.1_3'UTR	NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	378					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						AGGTTACATTGCACCATGGAG	0.303																																																0			3											192.0	190.0	191.0					3																	31659440		2203	4300	6503	31634444	SO:0001583	missense	201595			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.1132G>A	3.37:g.31659440G>A	ENSP00000295770:p.Ala378Thr	Somatic		Capture	Illumina GAIIx	4	31634444	Q96JZ4|Q96KY7	Missense_Mutation	SNP	HMMPfam_STT3	p.A378T	ENST00000295770.2	37	c.1132	CCDS2650.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.374520	0.95923	.	.	ENSG00000163527	ENST00000295770	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.85873	0.5798	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86053	0.1527	9	0.45353	T	0.12	-13.337	20.1075	0.97898	0.0:0.0:1.0:0.0	.	378	Q8TCJ2	STT3B_HUMAN	T	378	.	ENSP00000295770:A378T	A	+	1	0	STT3B	31634444	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.550000	0.98110	2.771000	0.95319	0.580000	0.79431	GCA	-	HMMPfam_STT3		0.303	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	protein_coding	OTTHUMT00000253166.2	G	NM_178862		31634444	+1	no_errors	NM_178862	genbank	human	provisional	54_36p	missense	SNP	1.000	A
FRY	10129	genome.wustl.edu	37	13	32752460	32752460	+	Silent	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr13:32752460C>G	ENST00000380250.3	+	21	3064	c.2568C>G	c.(2566-2568)ctC>ctG	p.L856L		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	856						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TCCTCTGCCTCTTCAGCTTCC	0.547																																																0			13											103.0	113.0	110.0					13																	32752460		2200	4299	6499	31650460	SO:0001819	synonymous_variant	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.2568C>G	13.37:g.32752460C>G		Somatic		Capture	Illumina GAIIx	4	31650460	Q9Y3N6	Silent	SNP	PatternScan_GHMP_KINASES_ATP	p.L856	ENST00000380250.3	37	c.2568	CCDS41875.1	13																																																																																			-	NULL		0.547	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	protein_coding	OTTHUMT00000044405.1	C	NM_023037		31650460	+1	no_errors	NM_023037	genbank	human	validated	54_36p	silent	SNP	0.999	G
NCOA6	23054	genome.wustl.edu	37	20	33331098	33331098	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr20:33331098G>T	ENST00000374796.2	-	12	5532	c.2962C>A	c.(2962-2964)Cct>Act	p.P988T	NCOA6_ENST00000359003.2_Missense_Mutation_p.P988T			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	988	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						ATGAGTTGAGGAGGCATCTGC	0.532																																																0			20											72.0	71.0	71.0					20																	33331098		2203	4299	6502	32794759	SO:0001583	missense	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.2962C>A	20.37:g.33331098G>T	ENSP00000363929:p.Pro988Thr	Somatic		Capture	Illumina GAIIx	4	32794759	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	NULL	p.P988T	ENST00000374796.2	37	c.2962	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	G	14.99	2.701219	0.48307	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.29917	1.55;1.55	6.04	6.04	0.98038	.	0.083560	0.51477	D	0.000084	T	0.25232	0.0613	N	0.19112	0.55	0.39604	D	0.969784	D	0.53151	0.958	P	0.45071	0.468	T	0.02546	-1.1143	10	0.52906	T	0.07	-7.4425	13.7479	0.62887	0.0698:0.0:0.9302:0.0	.	988	Q14686	NCOA6_HUMAN	T	988	ENSP00000363929:P988T;ENSP00000351894:P988T	ENSP00000351894:P988T	P	-	1	0	NCOA6	32794759	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.012000	0.57131	2.873000	0.98535	0.563000	0.77884	CCT	-	NULL		0.532	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	protein_coding	OTTHUMT00000078811.2	G	NM_014071		32794759	-1	no_errors	NM_014071	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CSMD2	114784	genome.wustl.edu	37	1	34112344	34112344	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:34112344G>C	ENST00000373380.1	-	8	1517	c.1297C>G	c.(1297-1299)Ctc>Gtc	p.L433V	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.L1560V			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1520	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CGGCCTGGGAGCTGGGAGCCA	0.547																																																0			1											60.0	59.0	59.0					1																	34112344		2203	4300	6503	33884931	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.1297C>G	1.37:g.34112344G>C	ENSP00000362478:p.Leu433Val	Somatic		Capture	Illumina GAIIx	4	33884931	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,PatternScan_GLYCOSYL_HYDROL_F10,PatternScan_IG_MHC	p.L1520V	ENST00000373380.1	37	c.4558		1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796437	0.50208	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.18502	2.21;2.21	5.95	5.95	0.96441	CUB (5);	0.231294	0.36665	N	0.002473	T	0.14184	0.0343	L	0.28740	0.885	0.80722	D	1	B;B;B	0.13594	0.001;0.008;0.008	B;B;B	0.18871	0.011;0.023;0.023	T	0.09100	-1.0690	10	0.06757	T	0.87	.	19.3735	0.94500	0.0:0.0:1.0:0.0	.	433;1520;1560	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	V	1560;433	ENSP00000362479:L1560V;ENSP00000362478:L433V	ENSP00000241312:L1520V	L	-	1	0	CSMD2	33884931	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.375000	0.52410	2.825000	0.97269	0.655000	0.94253	CTC	-	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042		0.547	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	protein_coding	OTTHUMT00000030635.4	G	NM_052896		33884931	-1	no_errors	NM_052896	genbank	human	validated	54_36p	missense	SNP	1.000	C
PHF20	51230	genome.wustl.edu	37	20	34535525	34535525	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr20:34535525G>C	ENST00000374012.3	+	18	3144	c.3015G>C	c.(3013-3015)caG>caC	p.Q1005H	PHF20_ENST00000439301.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	1005					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					AGGTGCAGCAGATCGCCCTCT	0.557																																																0			20											47.0	43.0	44.0					20																	34535525		2203	4300	6503	33998939	SO:0001583	missense	51230			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.3015G>C	20.37:g.34535525G>C	ENSP00000363124:p.Gln1005His	Somatic		Capture	Illumina GAIIx	4	33998939	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	superfamily_Tudor/PWWP/MBT,HMMSmart_SM00333,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1	p.Q1005H	ENST00000374012.3	37	c.3015	CCDS13268.1	20	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177050	0.57692	.	.	ENSG00000025293	ENST00000374012	T	0.45276	0.9	5.27	4.33	0.51752	.	0.104527	0.64402	D	0.000002	T	0.58481	0.2125	M	0.68317	2.08	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.61267	-0.7097	10	0.87932	D	0	.	8.5772	0.33605	0.227:0.0:0.773:0.0	.	1005	Q9BVI0	PHF20_HUMAN	H	1005	ENSP00000363124:Q1005H	ENSP00000363124:Q1005H	Q	+	3	2	PHF20	33998939	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.397000	0.59690	1.475000	0.48197	0.650000	0.86243	CAG	-	NULL		0.557	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF20	protein_coding	OTTHUMT00000078949.2	G	NM_016436		33998939	+1	no_errors	NM_016436	genbank	human	validated	54_36p	missense	SNP	1.000	C
GRM4	2914	genome.wustl.edu	37	6	34059858	34059858	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr6:34059858C>T	ENST00000538487.2	-	3	981	c.538G>A	c.(538-540)Gcc>Acc	p.A180T	GRM4_ENST00000535756.1_Missense_Mutation_p.A47T|GRM4_ENST00000455714.2_Missense_Mutation_p.A40T|GRM4_ENST00000374181.4_Missense_Mutation_p.A180T|GRM4_ENST00000609222.1_Missense_Mutation_p.A47T|GRM4_ENST00000374177.3_Missense_Mutation_p.A111T|GRM4_ENST00000544773.2_Missense_Mutation_p.A11T	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	180	Glutamate binding. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GCTGTGGAGGCGTAGCTGATC	0.647																																																0			6											101.0	82.0	89.0					6																	34059858		2203	4300	6503	34167836	SO:0001583	missense	2914			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.538G>A	6.37:g.34059858C>T	ENSP00000440556:p.Ala180Thr	Somatic		Capture	Illumina GAIIx	4	34167836	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3	p.A180T	ENST00000538487.2	37	c.538	CCDS4787.1	6	.	.	.	.	.	.	.	.	.	.	C	28.5	4.926278	0.92319	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83	3.91	3.91	0.45181	GPCR, family 3, conserved site (1);Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000001	D	0.91157	0.7215	M	0.84082	2.675	0.80722	D	1	P;D;D;D;D;D	0.89917	0.897;0.994;1.0;0.998;0.998;1.0	P;D;D;D;D;D	0.79784	0.523;0.962;0.993;0.909;0.909;0.982	D	0.92178	0.5749	10	0.56958	D	0.05	.	16.069	0.80909	0.0:1.0:0.0:0.0	.	180;11;40;180;180;47	B7ZLU9;B7Z1T9;F5GXM5;A1L4F9;Q14833;B3KVL9	.;.;.;.;GRM4_HUMAN;.	T	180;111;47;11;180;40	ENSP00000363296:A180T;ENSP00000363292:A111T;ENSP00000437925:A47T;ENSP00000437730:A11T;ENSP00000440556:A180T;ENSP00000398456:A40T	ENSP00000363292:A111T	A	-	1	0	GRM4	34167836	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.647000	0.83462	2.001000	0.58596	0.561000	0.74099	GCC	-	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1		0.647	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	protein_coding	OTTHUMT00000040213.2	C			34167836	-1	no_errors	NM_000841	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TULP1	7287	genome.wustl.edu	37	6	35467783	35467783	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr6:35467783G>T	ENST00000229771.6	-	14	1549	c.1470C>A	c.(1468-1470)aaC>aaA	p.N490K	TULP1_ENST00000322263.4_Missense_Mutation_p.N437K|TEAD3_ENST00000338863.7_5'Flank	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	490					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						CAATCTGGAAGTTCTTGACTG	0.572																																					GBM(55;1027 1091 11115 23439)											0			6											117.0	106.0	110.0					6																	35467783		2203	4300	6503	35575761	SO:0001583	missense	7287			U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.1470C>A	6.37:g.35467783G>T	ENSP00000229771:p.Asn490Lys	Somatic		Capture	Illumina GAIIx	4	35575761	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	superfamily_Transcriptional factor tubby C-terminal domain,HMMPfam_Tub,PatternScan_TUB_1,PatternScan_TUB_2	p.N490K	ENST00000229771.6	37	c.1470	CCDS4807.1	6	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425829	0.83667	.	.	ENSG00000112041	ENST00000229771;ENST00000322263	D;D	0.95885	-3.84;-3.84	5.48	4.61	0.57282	Tubby, C-terminal (4);Tubby, C-terminal, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98566	0.9521	H	0.99379	4.54	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.98543	1.0633	10	0.87932	D	0	-24.3293	10.5037	0.44821	0.1484:0.0:0.8516:0.0	.	437;490	O00294-2;O00294	.;TULP1_HUMAN	K	490;437	ENSP00000229771:N490K;ENSP00000319414:N437K	ENSP00000229771:N490K	N	-	3	2	TULP1	35575761	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.000000	0.49481	1.315000	0.45114	0.491000	0.48974	AAC	-	superfamily_Transcriptional factor tubby C-terminal domain,HMMPfam_Tub,PatternScan_TUB_1		0.572	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP1	protein_coding	OTTHUMT00000040307.2	G			35575761	-1	no_errors	NM_003322	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
EPHA10	284656	genome.wustl.edu	37	1	38197201	38197201	+	Silent	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:38197201G>A	ENST00000373048.4	-	7	1544	c.1545C>T	c.(1543-1545)acC>acT	p.T515T	EPHA10_ENST00000540011.1_Silent_p.T10T|EPHA10_ENST00000446149.2_5'UTR|EPHA10_ENST00000330210.7_Silent_p.T10T|EPHA10_ENST00000427468.2_Silent_p.T515T	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	515	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGTTGGTGACGGTGACTGTGG	0.597																																																0			1											108.0	109.0	109.0					1																	38197201		1950	4145	6095	37969788	SO:0001819	synonymous_variant	284656			AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.1545C>T	1.37:g.38197201G>A		Somatic		Capture	Illumina GAIIx	4	37969788	A4FU89|J3KPB5|Q6NW42	Silent	SNP	HMMPfam_Ephrin_lbd,HMMSmart_SM00615,HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,PatternScan_RECEPTOR_TYR_KIN_V_1,PatternScan_RECEPTOR_TYR_KIN_V_2,HMMPfam_SAM_1,HMMSmart_SM00454,HMMSmart_SM00220,HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III,superfamily_Galactose-binding domain-like,superfamily_SAM/Pointed domain,superfamily_Protein kinase-like (PK-like),PatternScan_EGF_2	p.T515	ENST00000373048.4	37	c.1545	CCDS41305.1	1																																																																																			-	HMMPfam_fn3,HMMSmart_SM00060,superfamily_Fibronectin type III		0.597	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	EPHA10	protein_coding	OTTHUMT00000012497.2	G	NM_173641		37969788	-1	no_errors	NM_001099439	genbank	human	validated	54_36p	silent	SNP	0.029	A
MAP3K14-AS1	100133991	genome.wustl.edu	37	17	43345050	43345050	+	RNA	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr17:43345050G>T	ENST00000585780.1	+	0	2099				MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000586450.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000588160.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14_ENST00000344686.2_RNA|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000585351.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA					MAP3K14 antisense RNA 1																		GGAGGGTCTGGTGGTAATTGG	0.572																																																0			17											112.0	121.0	118.0					17																	43345050		1924	4135	6059	40700833			9020			AK311429, BC031942		17q21.31	2014-06-16			ENSG00000267278	ENSG00000267278		"""Long non-coding RNAs"""	44359	non-coding RNA	RNA, long non-coding							Standard	NR_024435		Approved		uc002iit.4		OTTHUMG00000180362		17.37:g.43345050G>T		Somatic		Capture	Illumina GAIIx	4	40700833		Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.H682Q	ENST00000585780.1	37	c.2046		17	.	.	.	.	.	.	.	.	.	.	G	8.829	0.939494	0.18281	.	.	ENSG00000006062	ENST00000344686	.	.	.	5.97	1.38	0.22167	Protein kinase-like domain (1);	0.932441	0.09247	N	0.828429	T	0.32255	0.0823	N	0.19112	0.55	0.25411	N	0.988351	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.35276	-0.9795	8	0.21014	T	0.42	.	12.0639	0.53578	0.0:0.443:0.3499:0.2071	.	683;213	Q99558;Q6ZMZ1	M3K14_HUMAN;.	Q	682	.	ENSP00000342059:H682Q	H	-	3	2	MAP3K14	40700833	0.003000	0.15002	0.014000	0.15608	0.008000	0.06430	-0.329000	0.07935	0.366000	0.24427	0.655000	0.94253	CAC	-	NULL		0.572	MAP3K14-AS1-008	KNOWN	basic	antisense	MAP3K14	antisense	OTTHUMT00000450941.1	G	NR_024434		40700833	-1	no_errors	ENST00000344686	ensembl	human	known	54_36p	missense	SNP	0.000	T
ZNF239	8187	genome.wustl.edu	37	10	44053447	44053447	+	Silent	SNP	A	A	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr10:44053447A>G	ENST00000306006.6	-	2	733	c.81T>C	c.(79-81)atT>atC	p.I27I	ZNF239_ENST00000491188.1_5'UTR|ZNF239_ENST00000426961.1_Silent_p.I27I|ZNF239_ENST00000535642.1_Silent_p.I27I|ZNF239_ENST00000374446.2_Silent_p.I27I	NM_005674.2	NP_005665.2	Q16600	ZN239_HUMAN	zinc finger protein 239	27					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GACAAGGGGAAATATCTAGTT	0.453																																																0			10											78.0	72.0	74.0					10																	44053447		1923	4106	6029	43373453	SO:0001819	synonymous_variant	8187			X82125	CCDS41502.1	10q11.22-q11.23	2013-01-08			ENSG00000196793	ENSG00000196793		"""Zinc fingers, C2H2-type"""	13031	protein-coding gene	gene with protein product		601069				8903737, 8587123	Standard	NM_005674		Approved	MOK2, HOK-2	uc009xmk.3	Q16600	OTTHUMG00000018033	ENST00000306006.6:c.81T>C	10.37:g.44053447A>G		Somatic		Capture	Illumina GAIIx	4	43373453	Q5T1G9|Q8TAS5	Silent	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.I27	ENST00000306006.6	37	c.81	CCDS41502.1	10																																																																																			-	NULL		0.453	ZNF239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF239	protein_coding	OTTHUMT00000047710.1	A			43373453	-1	no_errors	NM_001099282	genbank	human	validated	54_36p	silent	SNP	0.002	G
HNRNPA3P1	10151	genome.wustl.edu	37	10	44285668	44285668	+	IGR	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr10:44285668C>T								RP11-272J7.4 (11395 upstream) : LINC00619 (55085 downstream)																							TGCCCCATTTCTCAAAATGTT	0.438																																																0			10																																								43605674	SO:0001628	intergenic_variant	10151																															10.37:g.44285668C>T		Somatic		Capture	Illumina GAIIx	4	43605674		RNA	SNP	-	NULL		37	NULL		10																																																																																			-	-	0	0.438					HNRNPA3P1			C			43605674	-1	pseudogene	NR_002726	genbank	human	validated	54_36p	rna	SNP	1.000	T
CKAP5	9793	genome.wustl.edu	37	11	46832595	46832595	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr11:46832595C>G	ENST00000529230.1	-	5	638	c.592G>C	c.(592-594)Gct>Cct	p.A198P	CKAP5_ENST00000415402.1_Missense_Mutation_p.A198P|CKAP5_ENST00000312055.5_Missense_Mutation_p.A198P|CKAP5_ENST00000354558.3_Missense_Mutation_p.A198P			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	198					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GGTCTCAGAGCATCCCGAATC	0.383																																					Ovarian(4;85 273 2202 4844 13323)											0			11											88.0	87.0	87.0					11																	46832595		2201	4299	6500	46789171	SO:0001583	missense	9793				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.592G>C	11.37:g.46832595C>G	ENSP00000432768:p.Ala198Pro	Somatic		Capture	Illumina GAIIx	4	46789171	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.A198P	ENST00000529230.1	37	c.592	CCDS31477.1	11	.	.	.	.	.	.	.	.	.	.	C	25.9	4.681234	0.88542	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000378629;ENST00000354558	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.85	4.95	0.65309	Armadillo-like helical (1);Armadillo-type fold (1);	0.046013	0.85682	D	0.000000	T	0.66107	0.2756	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	0.963;0.988;1.0	P;P;D	0.85130	0.698;0.698;0.997	T	0.65825	-0.6074	10	0.37606	T	0.19	-9.585	15.0762	0.72080	0.0:0.9317:0.0:0.0683	.	198;198;198	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	P	198	ENSP00000432768:A198P;ENSP00000395302:A198P;ENSP00000310227:A198P;ENSP00000346566:A198P	ENSP00000310227:A198P	A	-	1	0	CKAP5	46789171	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	5.995000	0.70631	1.478000	0.48253	0.563000	0.77884	GCT	-	superfamily_ARM repeat		0.383	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	protein_coding	OTTHUMT00000390679.1	C	NM_014756		46789171	-1	no_errors	NM_001008938	genbank	human	validated	54_36p	missense	SNP	1.000	G
PSG8	440533	genome.wustl.edu	37	19	43258684	43258684	+	Missense_Mutation	SNP	T	T	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr19:43258684T>A	ENST00000306511.4	-	5	1141	c.1044A>T	c.(1042-1044)gaA>gaT	p.E348D	PSG8_ENST00000404209.4_Missense_Mutation_p.E348D|PSG8_ENST00000406636.3_Missense_Mutation_p.E226D|PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000401467.2_Missense_Mutation_p.E255D	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	348	Ig-like C2-type 3.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				AGTAGAGGACTTCTCCTGAAC	0.463																																																0			19											86.0	97.0	93.0					19																	43258684		2203	4296	6499	47950524	SO:0001583	missense	440533			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.1044A>T	19.37:g.43258684T>A	ENSP00000305005:p.Glu348Asp	Somatic		Capture	Illumina GAIIx	4	47950524	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig,HMMSmart_IGc2	p.E348D	ENST00000306511.4	37	c.1044	CCDS33037.1	19	.	.	.	.	.	.	.	.	.	.	N	0.007	-1.971001	0.00457	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000406636;ENST00000401467;ENST00000426252;ENST00000407488;ENST00000306511	T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69	1.38	0.0765	0.14403	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49029	0.1533	N	0.17345	0.48	0.09310	N	1	B;B;B;B;B;B	0.09022	0.001;0.002;0.002;0.002;0.001;0.001	B;B;B;B;B;B	0.21151	0.004;0.03;0.012;0.033;0.011;0.019	T	0.30592	-0.9973	9	0.33940	T	0.23	.	4.0816	0.09929	0.0:0.0:0.3727:0.6273	.	226;255;348;255;348;348	Q9UQ74-2;B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;.;PSG8_HUMAN;.;.;.	D	348;130;226;255;160;255;348	ENSP00000385869:E348D;ENSP00000385081:E226D;ENSP00000386090:E255D;ENSP00000305005:E348D	ENSP00000292109:E130D	E	-	3	2	PSG8	47950524	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.013000	0.13310	-0.227000	0.09884	0.248000	0.18094	GAA	-	superfamily_SSF48726,HMMSmart_IGc2,HMMPfam_ig		0.463	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	protein_coding	OTTHUMT00000464526.1	T			47950524	-1	no_errors	NM_182707	genbank	human	validated	54_36p	missense	SNP	0.005	A
WDR13	64743	genome.wustl.edu	37	X	48460328	48460328	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:48460328T>C	ENST00000218056.5	+	6	1493	c.988T>C	c.(988-990)Tct>Cct	p.S330P	WDR13_ENST00000376729.5_Missense_Mutation_p.S330P	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	330						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						CAGTGTCTTCTCTTTCCTCTT	0.627																																																0			X											60.0	52.0	54.0					X																	48460328		2203	4300	6503	48345272	SO:0001583	missense	64743			AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.988T>C	X.37:g.48460328T>C	ENSP00000218056:p.Ser330Pro	Somatic		Capture	Illumina GAIIx	4	48345272	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40	p.S330P	ENST00000218056.5	37	c.988	CCDS14302.1	X	.	.	.	.	.	.	.	.	.	.	T	18.67	3.673771	0.67928	.	.	ENSG00000101940	ENST00000376729;ENST00000218056	T;T	0.65916	-0.18;-0.18	5.4	5.4	0.78164	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75642	0.3877	M	0.75777	2.31	0.80722	D	1	D	0.69078	0.997	D	0.64042	0.921	T	0.77378	-0.2610	10	0.49607	T	0.09	-1.2105	12.3389	0.55083	0.0:0.0:0.0:1.0	.	330	Q9H1Z4	WDR13_HUMAN	P	330	ENSP00000365919:S330P;ENSP00000218056:S330P	ENSP00000218056:S330P	S	+	1	0	WDR13	48345272	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	6.951000	0.75983	1.818000	0.53035	0.352000	0.21897	TCT	-	superfamily_WD40 repeat-like		0.627	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR13	protein_coding	OTTHUMT00000060743.2	T			48345272	+1	no_errors	NM_017883	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CCNB3	85417	genome.wustl.edu	37	X	50090709	50090709	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:50090709A>G	ENST00000376042.1	+	11	4193	c.3895A>G	c.(3895-3897)Aag>Gag	p.K1299E	CCNB3_ENST00000376038.1_Missense_Mutation_p.K195E|CCNB3_ENST00000348603.2_Missense_Mutation_p.K195E|CCNB3_ENST00000276014.7_Missense_Mutation_p.K1299E			Q8WWL7	CCNB3_HUMAN	cyclin B3	1299					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					TGTCCAGGAGAAGGCTTCCAA	0.507																																																0			X											108.0	77.0	88.0					X																	50090709		2203	4300	6503	50107449	SO:0001583	missense	85417			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.3895A>G	X.37:g.50090709A>G	ENSP00000365210:p.Lys1299Glu	Somatic		Capture	Illumina GAIIx	4	50107449	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	superfamily_Cyclin-like,HMMPfam_Cyclin_N,HMMSmart_SM00385,HMMPfam_Cyclin_C	p.K1299E	ENST00000376042.1	37	c.3895	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	A	10.85	1.468254	0.26335	.	.	ENSG00000147082	ENST00000376042;ENST00000376038;ENST00000348603;ENST00000276014	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	4.61	1.92	0.25849	Cyclin, C-terminal (1);Cyclin-like (3);	0.587067	0.17606	N	0.168259	T	0.28234	0.0697	L	0.52905	1.665	0.20638	N	0.999872	B;P;P	0.45902	0.137;0.868;0.636	B;B;P	0.46452	0.18;0.391;0.517	T	0.07214	-1.0784	9	.	.	.	.	9.6877	0.40109	0.6719:0.3281:0.0:0.0	.	1299;195;1299	A8K8T9;Q8WWL7-2;Q8WWL7	.;.;CCNB3_HUMAN	E	1299;195;195;1299	ENSP00000365210:K1299E;ENSP00000365206:K195E;ENSP00000338682:K195E;ENSP00000276014:K1299E	.	K	+	1	0	CCNB3	50107449	1.000000	0.71417	0.465000	0.27155	0.634000	0.38068	1.561000	0.36342	0.546000	0.28920	-0.537000	0.04273	AAG	-	HMMPfam_Cyclin_C,superfamily_Cyclin-like,HMMSmart_SM00385		0.507	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	protein_coding	OTTHUMT00000056558.1	A			50107449	+1	no_errors	NM_033031	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TEX264	51368	genome.wustl.edu	37	3	51718563	51718563	+	Silent	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr3:51718563G>A	ENST00000415259.1	+	3	1474	c.393G>A	c.(391-393)gtG>gtA	p.V131V	TEX264_ENST00000463857.1_3'UTR|TEX264_ENST00000395057.1_Silent_p.V131V|TEX264_ENST00000416589.1_Silent_p.V131V|TEX264_ENST00000457573.1_Silent_p.V131V|TEX264_ENST00000341333.5_Silent_p.V131V			Q9Y6I9	TX264_HUMAN	testis expressed 264	131						extracellular vesicular exosome (GO:0070062)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		CCAGCCATGTGGTGACAGCCA	0.582																																																0			3											73.0	61.0	65.0					3																	51718563		2203	4300	6503	51693603	SO:0001819	synonymous_variant	51368			AF072733	CCDS2833.1, CCDS74945.1	3p21	2007-03-13	2007-03-13		ENSG00000164081	ENSG00000164081			30247	protein-coding gene	gene with protein product			"""testis expressed gene 264"", ""testis expressed sequence 264"""			12975309	Standard	NM_001243725		Approved	ZSIG11, FLJ13935	uc003dbm.4	Q9Y6I9	OTTHUMG00000156901	ENST00000415259.1:c.393G>A	3.37:g.51718563G>A		Somatic		Capture	Illumina GAIIx	4	51693603	B3KN87|Q9UKD7	Silent	SNP	superfamily_Probable bacterial effector-binding domain	p.V131	ENST00000415259.1	37	c.393	CCDS2833.1	3																																																																																			-	superfamily_Probable bacterial effector-binding domain		0.582	TEX264-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TEX264	protein_coding	OTTHUMT00000346530.1	G	NM_015926		51693603	+1	no_errors	NM_015926	genbank	human	validated	54_36p	silent	SNP	1.000	A
DYX1C1	161582	genome.wustl.edu	37	15	55735541	55735541	+	Intron	SNP	G	G	A	rs112950071	byFrequency	TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr15:55735541G>A	ENST00000321149.3	-	7	1151				DYX1C1_ENST00000457155.2_Intron|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000380679.1_Intron|DYX1C1_ENST00000448430.2_Intron|DYX1C1_ENST00000348518.3_Intron	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1						cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		GGCGCCTGGCGCAGCTCCTCA	0.647													G|||	319	0.0636981	0.1051	0.0418	5008	,	,		14342	0.001		0.0716	False		,,,				2504	0.0798															0			15																																								53522833	SO:0001627	intron_variant	729120				CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.784-3762C>T	15.37:g.55735541G>A		Somatic		Capture	Illumina GAIIx	4	53522833	Q6P5Y9|Q8N1S6	Silent	SNP	superfamily_Thioesterase/thiol ester dehydrase-isomerase,HMMPfam_4HBT	p.C5	ENST00000321149.3	37	c.15	CCDS10154.1	15																																																																																			-	NULL		0.647	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729120	protein_coding	OTTHUMT00000254976.1	G	NM_130810		53522833	-1	no_errors	XM_001133204	genbank	human	model	54_36p	silent	SNP	0.431	A
PSME4	23198	genome.wustl.edu	37	2	54133754	54133754	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr2:54133754G>A	ENST00000404125.1	-	26	2979	c.2924C>T	c.(2923-2925)tCt>tTt	p.S975F	PSME4_ENST00000421748.2_Missense_Mutation_p.S119F	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	975					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TGAACTTGTAGATAAACGAAG	0.373																																																0			2											162.0	161.0	161.0					2																	54133754		2203	4300	6503	53987258	SO:0001583	missense	23198			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2924C>T	2.37:g.54133754G>A	ENSP00000384211:p.Ser975Phe	Somatic		Capture	Illumina GAIIx	4	53987258	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.S861F	ENST00000404125.1	37	c.2582	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000066	0.74818	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	T;T	0.63913	-0.07;-0.07	5.51	4.58	0.56647	Armadillo-like helical (1);Armadillo-type fold (1);	0.050448	0.85682	D	0.000000	T	0.76190	0.3953	M	0.70275	2.135	0.80722	D	1	D;P;D	0.69078	0.997;0.912;0.994	P;P;P	0.62089	0.898;0.717;0.794	T	0.79100	-0.1942	10	0.72032	D	0.01	.	16.9662	0.86286	0.0:0.1273:0.8727:0.0	.	350;119;975	Q14997-2;Q14997-3;Q14997	.;.;PSME4_HUMAN	F	119;975	ENSP00000410830:S119F;ENSP00000384211:S975F	ENSP00000384211:S975F	S	-	2	0	PSME4	53987258	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	7.540000	0.82074	2.742000	0.94016	0.650000	0.86243	TCT	-	superfamily_ARM repeat		0.373	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	protein_coding	OTTHUMT00000324163.1	G	XM_040158		53987258	-1	no_errors	NM_014614	genbank	human	validated	54_36p	missense	SNP	1.000	A
CLTC	1213	genome.wustl.edu	37	17	57756862	57756862	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr17:57756862G>C	ENST00000269122.3	+	18	3175	c.2901G>C	c.(2899-2901)agG>agC	p.R967S	CLTC_ENST00000393043.1_Missense_Mutation_p.R967S|CLTC_ENST00000579456.1_Intron	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	967	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					ATCCTTACAGGAGACCCCTAA	0.418			T	"""ALK, TFE3"""	"""ALCL, renal """																																		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0			17											82.0	77.0	79.0					17																	57756862		2203	4300	6503	55111644	SO:0001583	missense	1213			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2901G>C	17.37:g.57756862G>C	ENSP00000269122:p.Arg967Ser	Somatic		Capture	Illumina GAIIx	4	55111644	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	superfamily_Clathrin heavy-chain terminal domain,HMMPfam_Clathrin_propel,HMMPfam_Clathrin-link,superfamily_ARM repeat,HMMPfam_Clathrin,HMMSmart_SM00299,superfamily_Protein prenylyltransferase	p.R967S	ENST00000269122.3	37	c.2901	CCDS32696.1	17	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721325	0.68959	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.22336	1.96;1.96	5.6	4.4	0.53042	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.50871	0.1641	M	0.93283	3.4	0.80722	D	1	D;D	0.62365	0.991;0.98	D;D	0.81914	0.995;0.964	T	0.54098	-0.8344	10	0.54805	T	0.06	.	5.9141	0.19045	0.2179:0.1493:0.6327:0.0	.	967;967	Q00610;Q00610-2	CLH1_HUMAN;.	S	967	ENSP00000269122:R967S;ENSP00000376763:R967S	ENSP00000269122:R967S	R	+	3	2	CLTC	55111644	0.988000	0.35896	1.000000	0.80357	0.995000	0.86356	0.166000	0.16583	1.038000	0.40049	0.563000	0.77884	AGG	-	HMMPfam_Clathrin,HMMSmart_SM00299,superfamily_ARM repeat		0.418	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	protein_coding	OTTHUMT00000258859.1	G	NM_004859		55111644	+1	no_errors	NM_004859	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TRIM51	84767	genome.wustl.edu	37	11	55652991	55652991	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr11:55652991C>G	ENST00000449290.2	+	2	179	c.87C>G	c.(85-87)gaC>gaG	p.D29E	TRIM51_ENST00000244891.3_5'Flank	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	29						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										TCACCATAGACTGTGGGCACA	0.502																																																0			11											25.0	22.0	23.0					11																	55652991		692	1590	2282	55409567	SO:0001583	missense	84767			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.87C>G	11.37:g.55652991C>G	ENSP00000395086:p.Asp29Glu	Somatic		Capture	Illumina GAIIx	4	55409567	A6NMG2	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMPfam_zf-B_box,HMMSmart_SM00336,HMMPfam_SPRY	p.D36E	ENST00000449290.2	37	c.108		11	.	.	.	.	.	.	.	.	.	.	.	10.58	1.388669	0.25118	.	.	ENSG00000124900	ENST00000449290	T	0.05996	3.36	0.803	-1.61	0.08399	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	T	0.06188	0.0160	N	0.10733	0.035	0.58432	D	0.999999	D	0.71674	0.998	D	0.71870	0.975	T	0.56135	-0.8029	9	0.44086	T	0.13	.	0.7956	0.01065	0.2106:0.3766:0.2104:0.2024	.	29	Q9BSJ1	SPRY5_HUMAN	E	29	ENSP00000395086:D29E	ENSP00000395086:D29E	D	+	3	2	SPRYD5	55409567	0.001000	0.12720	0.088000	0.20740	0.091000	0.18340	-2.259000	0.01178	-2.088000	0.00861	-1.353000	0.01230	GAC	-	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4		0.502	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	SPRYD5	protein_coding	OTTHUMT00000391522.1	C	NM_032681		55409567	+1	no_start_codon	ENST00000327733	ensembl	human	known	54_36p	missense	SNP	0.690	G
OR8H3	390152	genome.wustl.edu	37	11	55890364	55890364	+	Silent	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr11:55890364C>T	ENST00000313472.3	+	1	516	c.516C>T	c.(514-516)aaC>aaT	p.N172N		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	172						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					GTGACTCAAACATAATTCATC	0.438																																																0			11											254.0	227.0	236.0					11																	55890364		2201	4296	6497	55646940	SO:0001819	synonymous_variant	390152			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.516C>T	11.37:g.55890364C>T		Somatic		Capture	Illumina GAIIx	4	55646940	Q6IFB7	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.N172	ENST00000313472.3	37	c.516	CCDS31519.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.438	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	protein_coding	OTTHUMT00000391541.1	C	NM_001005201		55646940	+1	no_errors	NM_001005201	genbank	human	provisional	54_36p	silent	SNP	0.029	T
SIGLEC12	89858	genome.wustl.edu	37	19	52003397	52003397	+	Silent	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr19:52003397G>T	ENST00000291707.3	-	2	640	c.585C>A	c.(583-585)gcC>gcA	p.A195A	SIGLEC12_ENST00000598614.1_Silent_p.A77A	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	195	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		ATGGTATATCGGCCCCTTCCT	0.542																																																0			19											147.0	131.0	136.0					19																	52003397		2203	4300	6503	56695209	SO:0001819	synonymous_variant	89858			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.585C>A	19.37:g.52003397G>T		Somatic		Capture	Illumina GAIIx	4	56695209	Q8IYH7	Silent	SNP	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_C2-set_2,HMMPfam_ig	p.A195	ENST00000291707.3	37	c.585	CCDS12833.1	19																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408		0.542	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC12	protein_coding	OTTHUMT00000384641.2	G	NM_053003		56695209	-1	no_errors	NM_053003	genbank	human	reviewed	54_36p	silent	SNP	0.001	T
TGS1	96764	genome.wustl.edu	37	8	56686213	56686213	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr8:56686213G>A	ENST00000260129.5	+	1	513	c.36G>A	c.(34-36)atG>atA	p.M12I	TMEM68_ENST00000434581.2_5'Flank|TMEM68_ENST00000521229.1_5'Flank|TMEM68_ENST00000519784.1_5'Flank|TMEM68_ENST00000523073.1_5'Flank|TMEM68_ENST00000522576.1_5'Flank|TMEM68_ENST00000334667.2_5'Flank	NM_024831.6	NP_079107.6	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase 1	12					7-methylguanosine cap hypermethylation (GO:0036261)|7-methylguanosine RNA capping (GO:0009452)|cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|regulation of transcription, DNA-templated (GO:0006355)|ribonucleoprotein complex biogenesis (GO:0022613)|ribonucleoprotein complex import into nucleus (GO:0071167)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)	RNA trimethylguanosine synthase activity (GO:0071164)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			TGGCGGAAATGTTTCTCTTCA	0.552																																					Esophageal Squamous(34;275 823 4842 34837 48447)											0			8											133.0	131.0	132.0					8																	56686213		2203	4300	6503	56848767	SO:0001583	missense	96764			AY028423	CCDS34894.1	8q11	2010-06-25	2010-06-25	2006-11-27	ENSG00000137574	ENSG00000137574	2.1.1.-		17843	protein-coding gene	gene with protein product		606461	"""nuclear receptor coactivator 6 interacting protein"", ""trimethylguanosine synthase homolog (S. cerevisiae)"""	NCOA6IP		11517327, 11983179, 19307714	Standard	NM_024831		Approved	PIMT	uc003xsj.4	Q96RS0	OTTHUMG00000164294	ENST00000260129.5:c.36G>A	8.37:g.56686213G>A	ENSP00000260129:p.Met12Ile	Somatic		Capture	Illumina GAIIx	4	56848767	A6NJQ5|Q5GH23|Q8TDG9|Q96QU3|Q9H5V3	Missense_Mutation	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_Methyltransf_15	p.M12I	ENST00000260129.5	37	c.36	CCDS34894.1	8	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388094	0.82902	.	.	ENSG00000137574	ENST00000260129	T	0.09911	2.93	4.97	4.97	0.65823	.	0.210963	0.49916	D	0.000129	T	0.29190	0.0726	M	0.63428	1.95	0.36875	D	0.889106	D	0.69078	0.997	D	0.73380	0.98	T	0.02958	-1.1089	10	0.38643	T	0.18	-22.3005	15.4472	0.75240	0.0:0.0:1.0:0.0	.	12	Q96RS0	TGS1_HUMAN	I	12	ENSP00000260129:M12I	ENSP00000260129:M12I	M	+	3	0	TGS1	56848767	0.998000	0.40836	0.964000	0.40570	0.748000	0.42578	4.114000	0.57858	2.735000	0.93741	0.655000	0.94253	ATG	-	NULL		0.552	TGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGS1	protein_coding	OTTHUMT00000378152.1	G	NM_024831		56848767	+1	no_errors	NM_024831	genbank	human	validated	54_36p	missense	SNP	0.926	A
MYADM	91663	genome.wustl.edu	37	19	54377237	54377237	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr19:54377237G>A	ENST00000391769.2	+	3	734	c.454G>A	c.(454-456)Gcc>Acc	p.A152T	MYADM_ENST00000391768.2_Missense_Mutation_p.A152T|MYADM_ENST00000391770.4_Missense_Mutation_p.A152T|MYADM_ENST00000336967.3_Missense_Mutation_p.A152T|MYADM_ENST00000391771.1_Missense_Mutation_p.A152T|AC008440.5_ENST00000413496.2_RNA	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	152	MARVEL 1. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		TGTGGCTTACGCCACCGAAGT	0.657																																																0			19											53.0	54.0	54.0					19																	54377237		2203	4299	6502	59069049	SO:0001583	missense	91663			AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.454G>A	19.37:g.54377237G>A	ENSP00000375649:p.Ala152Thr	Somatic		Capture	Illumina GAIIx	4	59069049	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	HMMPfam_MARVEL	p.A152T	ENST00000391769.2	37	c.454	CCDS12866.1	19	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753094	0.69648	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000448420;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768	T;T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64	4.21	3.16	0.36331	Marvel (1);MARVEL-like domain (1);	0.611980	0.16027	N	0.233045	T	0.46946	0.1419	M	0.67700	2.07	0.28300	N	0.923132	D	0.89917	1.0	D	0.78314	0.991	T	0.27123	-1.0083	10	0.45353	T	0.12	-27.4038	5.9073	0.19008	0.2233:0.0:0.7767:0.0	.	152	Q96S97	MYADM_HUMAN	T	152;152;152;152;152;152;115;152;152	ENSP00000398269:A152T;ENSP00000337222:A152T;ENSP00000375650:A152T;ENSP00000399722:A152T;ENSP00000416919:A152T;ENSP00000375651:A152T;ENSP00000375649:A152T;ENSP00000375648:A152T	ENSP00000337222:A152T	A	+	1	0	MYADM	59069049	0.015000	0.18098	0.916000	0.36221	0.551000	0.35334	0.721000	0.25911	2.080000	0.62538	0.313000	0.20887	GCC	-	HMMPfam_MARVEL		0.657	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYADM	protein_coding	OTTHUMT00000134337.1	G	NM_138373		59069049	+1	no_errors	NM_001020818	genbank	human	validated	54_36p	missense	SNP	0.028	A
DNAJC5	80331	genome.wustl.edu	37	20	62559773	62559773	+	Silent	SNP	C	C	T	rs189308547		TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr20:62559773C>T	ENST00000360864.4	+	2	228	c.75C>T	c.(73-75)aaC>aaT	p.N25N	DNAJC5_ENST00000369911.2_Silent_p.N25N	NM_025219.2	NP_079495.1	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	25	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|exocytosis (GO:0006887)|negative regulation of neuron apoptotic process (GO:0043524)|neurotransmitter secretion (GO:0007269)|regulated secretory pathway (GO:0045055)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)				cervix(1)|endometrium(1)|lung(1)|pancreas(1)|upper_aerodigestive_tract(1)	5	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGGACAAGAACGCAACCTCAG	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		19339	0.001		0.0	False		,,,				2504	0.0															0			20						C		1,4405	2.1+/-5.4	0,1,2202	126.0	119.0	121.0		75	-1.7	1.0	20		121	0,8600		0,0,4300	no	coding-synonymous	DNAJC5	NM_025219.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		25/199	62559773	1,13005	2203	4300	6503	62030217	SO:0001819	synonymous_variant	80331				CCDS13546.1	20q13.33	2014-09-17			ENSG00000101152	ENSG00000101152		"""Heat shock proteins / DNAJ (HSP40)"""	16235	protein-coding gene	gene with protein product		611203	"""ceroid-lipofuscinosis, neuronal 4 (Kufs disease)"""	CLN4			Standard	NM_025219		Approved	FLJ00118, FLJ13070, DNAJC5A	uc002yhf.3	Q9H3Z4	OTTHUMG00000033007	ENST00000360864.4:c.75C>T	20.37:g.62559773C>T		Somatic		Capture	Illumina GAIIx	4	62030217	A8K0M0|B3KY68|E1P5G8|Q9H3Z5|Q9H7H2	Silent	SNP	superfamily_Chaperone J-domain,HMMSmart_SM00271,HMMPfam_DnaJ,PatternScan_DNAJ_1	p.N25	ENST00000360864.4	37	c.75	CCDS13546.1	20																																																																																			-	superfamily_Chaperone J-domain,HMMSmart_SM00271,HMMPfam_DnaJ		0.502	DNAJC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC5	protein_coding	OTTHUMT00000080244.1	C	NM_025219		62030217	+1	no_errors	NM_025219	genbank	human	provisional	54_36p	silent	SNP	0.881	T
NRXN2	9379	genome.wustl.edu	37	11	64418975	64418975	+	Silent	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr11:64418975C>T	ENST00000377551.1	-	13	2881	c.2670G>A	c.(2668-2670)caG>caA	p.Q890Q	NRXN2_ENST00000377559.3_Silent_p.Q850Q|NRXN2_ENST00000409571.1_Silent_p.Q883Q|NRXN2_ENST00000265459.6_Silent_p.Q890Q|AP001092.4_ENST00000433606.1_RNA			Q9P2S2	NRX2A_HUMAN	neurexin 2	890	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CCATGTAGGGCTGGCCATTGA	0.572											OREG0021057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			11											101.0	69.0	80.0					11																	64418975		2201	4297	6498	64175551	SO:0001819	synonymous_variant	9379				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2670G>A	11.37:g.64418975C>T		Somatic	1076	Capture	Illumina GAIIx	4	64175551	A7E2C1|Q9Y2D6	Silent	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00181,HMMPfam_EGF,HMMSmart_SM00294	p.Q890	ENST00000377551.1	37	c.2670	CCDS8077.1	11																																																																																			-	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2		0.572	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	protein_coding	OTTHUMT00000104967.3	C	NM_015080		64175551	-1	no_errors	NM_015080	genbank	human	reviewed	54_36p	silent	SNP	0.996	T
VSIG4	11326	genome.wustl.edu	37	X	65253585	65253585	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:65253585C>G	ENST00000374737.4	-	2	251	c.143G>C	c.(142-144)gGc>gCc	p.G48A	VSIG4_ENST00000455586.2_Missense_Mutation_p.G48A|VSIG4_ENST00000412866.2_Missense_Mutation_p.G48A	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	48	Ig-like 1.				complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTGGGTGTAGCCTTGCAGGGG	0.547																																																0			X											120.0	81.0	94.0					X																	65253585		2203	4300	6503	65170310	SO:0001583	missense	11326			AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.143G>C	X.37:g.65253585C>G	ENSP00000363869:p.Gly48Ala	Somatic		Capture	Illumina GAIIx	4	65170310	Q6UXI4	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00406,HMMSmart_SM00408,HMMPfam_ig	p.G48A	ENST00000374737.4	37	c.143	CCDS14383.1	X	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301402	0.23736	.	.	ENSG00000155659	ENST00000374737;ENST00000455586;ENST00000412866;ENST00000423830	T;T;T;T	0.64260	-0.09;-0.09;-0.09;4.29	4.8	4.8	0.61643	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000008	T	0.76371	0.3978	M	0.74881	2.28	0.36489	D	0.868304	D;D;D;D;D	0.89917	1.0;0.999;0.988;0.999;0.999	D;P;P;D;D	0.91635	0.999;0.862;0.835;0.994;0.915	T	0.79748	-0.1673	10	0.33141	T	0.24	-14.5173	12.3711	0.55256	0.0:1.0:0.0:0.0	.	48;48;38;48;48	C9J1L3;Q9Y279-2;C9JH67;Q9Y279-3;Q9Y279	.;.;.;.;VSIG4_HUMAN	A	48	ENSP00000363869:G48A;ENSP00000411581:G48A;ENSP00000394143:G48A;ENSP00000414594:G48A	ENSP00000363869:G48A	G	-	2	0	VSIG4	65170310	0.962000	0.33011	0.677000	0.29947	0.232000	0.25224	0.741000	0.26202	1.966000	0.57179	0.523000	0.50628	GGC	-	superfamily_Immunoglobulin,HMMPfam_V-set,HMMSmart_SM00409,HMMSmart_SM00406		0.547	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VSIG4	protein_coding	OTTHUMT00000056986.1	C	NM_007268		65170310	-1	no_errors	NM_007268	genbank	human	validated	54_36p	missense	SNP	0.626	G
SPDYE21P	442572	genome.wustl.edu	37	7	66751315	66751315	+	IGR	SNP	C	C	T	rs543128197		TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr7:66751315C>T								TYW1 (46814 upstream) : PMS2P4 (9289 downstream)																							TGCATGAACCCGAGGGCCAGG	0.577													-|||	1	0.000199681	0.0	0.0014	5008	,	,		19005	0.0		0.0	False		,,,				2504	0.0															0			7																																								66388750	SO:0001628	intergenic_variant	442572																															7.37:g.66751315C>T		Somatic		Capture	Illumina GAIIx	4	66388750		Missense_Mutation	SNP	NULL	p.P322L		37	c.965		7																																																																																			-	NULL	0	0.577					LOC442572			C			66388750	+1	no_errors	XM_499314	genbank	human	model	54_36p	missense	SNP	0.000	T
SLC8A3	6547	genome.wustl.edu	37	14	70633692	70633692	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr14:70633692C>G	ENST00000381269.2	-	2	2201	c.1448G>C	c.(1447-1449)aGg>aCg	p.R483T	SLC8A3_ENST00000528359.1_Missense_Mutation_p.R483T|SLC8A3_ENST00000356921.2_Missense_Mutation_p.R483T|SLC8A3_ENST00000534137.1_Missense_Mutation_p.R483T|SLC8A3_ENST00000357887.3_Missense_Mutation_p.R483T	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	483	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ATTGCTCAACCTTACAAAGAA	0.537																																																0			14											128.0	131.0	130.0					14																	70633692		2203	4300	6503	69703445	SO:0001583	missense	6547			AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1448G>C	14.37:g.70633692C>G	ENSP00000370669:p.Arg483Thr	Somatic		Capture	Illumina GAIIx	4	69703445	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	HMMPfam_Na_Ca_ex,HMMSmart_SM00237,HMMPfam_Calx-beta	p.R483T	ENST00000381269.2	37	c.1448	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750362	0.49257	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	5.54	5.54	0.83059	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.51363	0.1670	L	0.31371	0.925	0.80722	D	1	D;D;D;D	0.71674	0.997;0.998;0.996;0.996	D;D;D;D	0.87578	0.996;0.998;0.995;0.995	T	0.52586	-0.8556	10	0.62326	D	0.03	.	19.4841	0.95022	0.0:1.0:0.0:0.0	.	483;483;483;483	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	T	483	ENSP00000349392:R483T;ENSP00000370669:R483T;ENSP00000350560:R483T;ENSP00000436688:R483T;ENSP00000433531:R483T	ENSP00000349392:R483T	R	-	2	0	SLC8A3	69703445	1.000000	0.71417	0.995000	0.50966	0.548000	0.35241	4.986000	0.63851	2.592000	0.87571	0.650000	0.86243	AGG	-	HMMSmart_SM00237,HMMPfam_Calx-beta		0.537	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	protein_coding	OTTHUMT00000390736.1	C			69703445	-1	no_errors	NM_183002	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
BAI3	577	genome.wustl.edu	37	6	69666595	69666595	+	Silent	SNP	C	C	A	rs199826937	byFrequency	TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr6:69666595C>A	ENST00000370598.1	+	8	2240	c.1419C>A	c.(1417-1419)ggC>ggA	p.G473G		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	473	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G473G(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CCTGTGATGGCGGCTGGGAAA	0.493																																																1	Substitution - coding silent(1)	pancreas(1)	6											159.0	154.0	156.0					6																	69666595		2203	4300	6503	69723316	SO:0001819	synonymous_variant	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1419C>A	6.37:g.69666595C>A		Somatic		Capture	Illumina GAIIx	4	69723316	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00008,HMMPfam_HRM,HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.G473	ENST00000370598.1	37	c.1419	CCDS4968.1	6																																																																																			-	superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1		0.493	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	protein_coding	OTTHUMT00000041120.1	C			69723316	+1	no_errors	NM_001704	genbank	human	reviewed	54_36p	silent	SNP	0.336	A
CSPG4	1464	genome.wustl.edu	37	15	75975061	75975061	+	Missense_Mutation	SNP	C	C	T	rs141642595	byFrequency	TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr15:75975061C>T	ENST00000308508.5	-	7	4762	c.4670G>A	c.(4669-4671)cGc>cAc	p.R1557H		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1557	Gly/Ser-rich (glycosaminoglycan attachment domain).			R -> P (in Ref. 1; CAA65529). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GAGGCGGAAGCGGAAGCCTCC	0.672													C|||	2	0.000399361	0.0	0.0014	5008	,	,		15605	0.0		0.001	False		,,,				2504	0.0															0			15						C	HIS/ARG	4,4390	8.1+/-20.4	0,4,2193	40.0	39.0	40.0		4670	-8.0	0.1	15	dbSNP_134	40	36,8552	23.4+/-69.3	1,34,4259	yes	missense	CSPG4	NM_001897.4	29	1,38,6452	TT,TC,CC		0.4192,0.091,0.3081	benign	1557/2323	75975061	40,12942	2197	4294	6491	73762116	SO:0001583	missense	1464			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.4670G>A	15.37:g.75975061C>T	ENSP00000312506:p.Arg1557His	Somatic		Capture	Illumina GAIIx	4	73762116	D3DW77|Q92675	Missense_Mutation	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,PatternScan_ATPASE_ALPHA_BETA	p.R1557H	ENST00000308508.5	37	c.4670	CCDS10284.1	15	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	0.026	-1.371468	0.01225	9.1E-4	0.004192	ENSG00000173546	ENST00000308508	T	0.38887	1.11	4.61	-7.99	0.01131	.	1.451320	0.04302	N	0.347461	T	0.14442	0.0349	N	0.01668	-0.77	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22977	-1.0201	10	0.30854	T	0.27	.	7.7018	0.28627	0.0822:0.1919:0.0817:0.6442	.	1557	Q6UVK1	CSPG4_HUMAN	H	1557	ENSP00000312506:R1557H	ENSP00000312506:R1557H	R	-	2	0	CSPG4	73762116	0.185000	0.23213	0.083000	0.20561	0.059000	0.15707	-0.565000	0.05929	-1.719000	0.01382	-0.266000	0.10368	CGC	-	NULL		0.672	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	protein_coding	OTTHUMT00000286472.1	C	NM_001897		73762116	-1	no_errors	NM_001897	genbank	human	reviewed	54_36p	missense	SNP	0.207	T
EEF1A1	1915	genome.wustl.edu	37	6	74229211	74229211	+	Nonsense_Mutation	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr6:74229211C>T	ENST00000316292.9	-	2	1164	c.173G>A	c.(172-174)tGg>tAg	p.W58*	EEF1A1_ENST00000331523.2_Nonsense_Mutation_p.W58*|EEF1A1_ENST00000491404.1_5'Flank|EEF1A1_ENST00000309268.6_Nonsense_Mutation_p.W58*	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	58	tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						ATCCAAGACCCAGGCATACTT	0.433											OREG0003890	type=REGULATORY REGION|Gene=LOC477388|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			6											74.0	83.0	80.0					6																	74229211		2201	4295	6496	74285932	SO:0001587	stop_gained	1915			BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.173G>A	6.37:g.74229211C>T	ENSP00000339063:p.Trp58*	Somatic	1151	Capture	Illumina GAIIx	4	74285932	P04719|P04720|Q6IQ15	Nonsense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GTP_EFTU,PatternScan_EFACTOR_GTP,superfamily_Translation proteins,HMMPfam_GTP_EFTU_D2,HMMPfam_GTP_EFTU_D3,superfamily_EF-Tu/eEF-1alpha/eIF2-gamma C-terminal domain	p.W58*	ENST00000316292.9	37	c.173	CCDS4980.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.335604	0.95758	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977;ENST00000456206;ENST00000356303;ENST00000455918	.	.	.	3.86	3.86	0.44501	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3557	0.83234	0.0:1.0:0.0:0.0	.	.	.	.	X	58	.	ENSP00000339053:W58X	W	-	2	0	EEF1A1	74285932	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.364000	0.79526	2.148000	0.66965	0.555000	0.69702	TGG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GTP_EFTU		0.433	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A1	protein_coding	OTTHUMT00000041210.2	C	NM_001402		74285932	-1	no_errors	NM_001402	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
IDH3A	3419	genome.wustl.edu	37	15	78452527	78452527	+	Nonsense_Mutation	SNP	A	A	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr15:78452527A>T	ENST00000299518.2	+	4	351	c.268A>T	c.(268-270)Aag>Tag	p.K90*	IDH3A_ENST00000558535.1_3'UTR|IDH3A_ENST00000559205.1_Intron|IDH3A_ENST00000558554.1_Nonsense_Mutation_p.K90*|IDH3A_ENST00000441490.2_Intron	NM_005530.2	NP_005521.1	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha	90					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	12						GTCCATGGATAAGAACAAGAT	0.453																																																0			15											67.0	62.0	63.0					15																	78452527		2196	4293	6489	76239582	SO:0001587	stop_gained	3419				CCDS10297.1	15q25.1-q25.2	2008-07-18			ENSG00000166411	ENSG00000166411	1.1.1.41		5384	protein-coding gene	gene with protein product	"""H-IDH alpha"", ""isocitric dehydrogenase"", ""isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial"", ""NAD+-specific ICDH"", ""NAD(H)-specific isocitrate dehydrogenase alpha subunit"", ""isocitrate dehydrogenase (NAD+) alpha chain"""	601149				8833160	Standard	NM_005530		Approved		uc002bdd.3	P50213	OTTHUMG00000143732	ENST00000299518.2:c.268A>T	15.37:g.78452527A>T	ENSP00000299518:p.Lys90*	Somatic		Capture	Illumina GAIIx	4	76239582	D3DW83|Q9H3X0	Nonsense_Mutation	SNP	superfamily_Isocitrate/Isopropylmalate dehydrogenase-like,HMMPfam_Iso_dh,PatternScan_IDH_IMDH	p.K90*	ENST00000299518.2	37	c.268	CCDS10297.1	15	.	.	.	.	.	.	.	.	.	.	A	38	6.994569	0.97990	.	.	ENSG00000166411	ENST00000299518	.	.	.	5.62	5.62	0.85841	.	0.043739	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.6591	15.0195	0.71617	1.0:0.0:0.0:0.0	.	.	.	.	X	90	.	ENSP00000299518:K90X	K	+	1	0	IDH3A	76239582	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.707000	0.68370	2.137000	0.66172	0.459000	0.35465	AAG	-	superfamily_Isocitrate/Isopropylmalate dehydrogenase-like,HMMPfam_Iso_dh		0.453	IDH3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH3A	protein_coding	OTTHUMT00000289799.4	A	NM_005530		76239582	+1	no_errors	NM_005530	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
HGS	9146	genome.wustl.edu	37	17	79660960	79660961	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G|C	G|C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr17:79660960_79660961GC>TT	ENST00000329138.4	+	11	1036_1037	c.901_902GC>TT	c.(901-903)GCg>TTg	p.A301L		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	301	Interaction with SNX1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			GGCCTCCTCAGCGCCCCCCGCC	0.649																																																0			17																																								77271365|77271366	SO:0001583	missense	9146			D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		Exception_encountered	17.37:g.79660960_79660961delinsTT	ENSP00000331201:p.Ala301Leu	Somatic		Capture	Illumina GAIIx	4	77271365|77271366	Q9NR36	Missense_Mutation	SNP	HMMPfam_VHS,superfamily_ENTH/VHS domain,HMMSmart_SM00288,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00064,HMMPfam_FYVE,HMMPfam_UIM|HMMPfam_FYVE,HMMSmart_SM00064,HMMPfam_VHS,HMMPfam_UIM,superfamily_ENTH/VHS domain,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00288	p.A301S|p.A301V	ENST00000329138.4	37	c.901|c.902	CCDS11784.1	17																																																																																			-	NULL		0.649	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGS	protein_coding	OTTHUMT00000440541.1	G|C	NM_004712		77271365|77271366	+1	no_errors	NM_004712	genbank	human	provisional	54_36p	missense	SNP	0.992|0.994	T
CYSLTR1	10800	genome.wustl.edu	37	X	77529003	77529003	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:77529003C>A	ENST00000373304.3	-	3	533	c.241G>T	c.(241-243)Gtc>Ttc	p.V81F		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	81					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	ACATAATAGACCACACGGAGA	0.418																																																0			X											72.0	56.0	62.0					X																	77529003		2203	4299	6502	77415659	SO:0001583	missense	10800			AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.241G>T	X.37:g.77529003C>A	ENSP00000362401:p.Val81Phe	Somatic		Capture	Illumina GAIIx	4	77415659	B2R954|D3DTE4|Q5JS94|Q8IV19	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.V81F	ENST00000373304.3	37	c.241	CCDS14439.1	X	.	.	.	.	.	.	.	.	.	.	c	14.62	2.588310	0.46110	.	.	ENSG00000173198	ENST00000373304	T	0.37584	1.19	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.369251	0.27936	N	0.017256	T	0.33556	0.0867	L	0.35288	1.05	0.30219	N	0.797007	P	0.47841	0.901	P	0.49332	0.607	T	0.10474	-1.0628	10	0.10111	T	0.7	.	13.8027	0.63212	0.0:1.0:0.0:0.0	.	81	Q9Y271	CLTR1_HUMAN	F	81	ENSP00000362401:V81F	ENSP00000362401:V81F	V	-	1	0	CYSLTR1	77415659	0.987000	0.35691	0.997000	0.53966	0.941000	0.58515	2.459000	0.45023	1.823000	0.53134	0.452000	0.29995	GTC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.418	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYSLTR1	protein_coding	OTTHUMT00000057315.1	C			77415659	-1	no_errors	NM_006639	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
GPR174	84636	genome.wustl.edu	37	X	78427491	78427491	+	Silent	SNP	A	A	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:78427491A>C	ENST00000276077.1	+	1	1023	c.987A>C	c.(985-987)acA>acC	p.T329T		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	329						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						CCACCATGACACCTGAATTAT	0.413										HNSCC(63;0.18)																																						0			X											65.0	57.0	59.0					X																	78427491		2203	4300	6503	78314147	SO:0001819	synonymous_variant	84636			AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.987A>C	X.37:g.78427491A>C		Somatic		Capture	Illumina GAIIx	4	78314147	Q2M3F7	Silent	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.T329	ENST00000276077.1	37	c.987	CCDS14443.1	X																																																																																			-	NULL		0.413	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR174	protein_coding	OTTHUMT00000057327.1	A	NM_032553		78314147	+1	no_errors	NM_032553	genbank	human	provisional	54_36p	silent	SNP	0.019	C
EFTUD1	79631	genome.wustl.edu	37	15	82444003	82444003	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr15:82444003T>G	ENST00000268206.7	-	18	2960	c.2792A>C	c.(2791-2793)cAa>cCa	p.Q931P	EFTUD1_ENST00000359445.3_Missense_Mutation_p.Q880P	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	931					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						GCAGCCATCTTGTAGCTCTTG	0.463																																																0			15											140.0	140.0	140.0					15																	82444003		1957	4155	6112	80231058	SO:0001583	missense	79631			AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.2792A>C	15.37:g.82444003T>G	ENSP00000268206:p.Gln931Pro	Somatic		Capture	Illumina GAIIx	4	80231058	A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GTP_EFTU,superfamily_Translation proteins,superfamily_EF-G C-terminal domain-like,superfamily_Ribosomal protein S5 domain 2-like,HMMPfam_EFG_IV,HMMPfam_EFG_C	p.Q931P	ENST00000268206.7	37	c.2792	CCDS42071.1	15	.	.	.	.	.	.	.	.	.	.	T	9.809	1.182685	0.21870	.	.	ENSG00000140598	ENST00000268206;ENST00000359445	T;T	0.64085	-0.08;0.18	5.8	0.418	0.16429	Ribosomal protein S5 domain 2-type fold (1);	2.080720	0.02297	N	0.070792	T	0.51261	0.1664	L	0.40543	1.245	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29701	-1.0003	10	0.49607	T	0.09	-8.9229	2.4607	0.04540	0.1119:0.1283:0.2321:0.5277	.	880;931	Q7Z2Z2-2;Q7Z2Z2	.;ETUD1_HUMAN	P	931;880	ENSP00000268206:Q931P;ENSP00000352418:Q880P	ENSP00000268206:Q931P	Q	-	2	0	EFTUD1	80231058	0.000000	0.05858	0.001000	0.08648	0.894000	0.52154	0.032000	0.13732	0.092000	0.17331	0.477000	0.44152	CAA	-	superfamily_Ribosomal protein S5 domain 2-like		0.463	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	protein_coding	OTTHUMT00000419252.1	T	NM_024580		80231058	-1	no_errors	NM_024580	genbank	human	validated	54_36p	missense	SNP	0.010	G
CYB5R4	51167	genome.wustl.edu	37	6	84619802	84619802	+	Intron	SNP	T	T	A	rs191174469		TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr6:84619802T>A	ENST00000369681.5	+	4	552				CYB5R4_ENST00000369679.4_Missense_Mutation_p.L109Q	NM_016230.3	NP_057314.2	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4						cell development (GO:0048468)|detection of oxygen (GO:0003032)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NAD(P)H oxidase activity (GO:0016174)|NADPH-hemoprotein reductase activity (GO:0003958)|oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor (GO:0016653)			breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	23		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		CTCTGGCACCTGTAGAGCTGA	0.423																																					Esophageal Squamous(86;1289 1332 25971 40349 52675)											0			6											55.0	50.0	51.0					6																	84619802		876	1991	2867	84676521	SO:0001627	intron_variant	51167			AF169803	CCDS5000.2	6q14.2	2012-09-19		2005-07-13	ENSG00000065615	ENSG00000065615	1.6.2.2		20147	protein-coding gene	gene with protein product		608343	"""NADPH cytochrome B5 oxidoreductase"""	NCB5OR		10611283	Standard	NM_016230		Approved	b5+b5R, dJ676J13.1	uc003pkf.3	Q7L1T6	OTTHUMG00000015118	ENST00000369681.5:c.412+993T>A	6.37:g.84619802T>A		Somatic		Capture	Illumina GAIIx	4	84676521	B1AEM2|Q5TGI9|Q9NUE4|Q9UHI9	Missense_Mutation	SNP	superfamily_Cytochrome b5-like heme/steroid binding domain,HMMPfam_Cyt-b5,PatternScan_CYTOCHROME_B5_1	p.L109Q	ENST00000369681.5	37	c.326	CCDS5000.2	6	.	.	.	.	.	.	.	.	.	.	T	3.501	-0.101810	0.06967	.	.	ENSG00000065615	ENST00000369679	D	0.83419	-1.72	1.59	1.59	0.23543	.	.	.	.	.	T	0.69233	0.3088	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.63747	-0.6567	6	0.87932	D	0	.	5.2784	0.15663	0.0:0.0:0.0:1.0	.	.	.	.	Q	109	ENSP00000358693:L109Q	ENSP00000358693:L109Q	L	+	2	0	CYB5R4	84676521	0.022000	0.18835	0.036000	0.18154	0.054000	0.15201	1.510000	0.35790	0.968000	0.38212	0.455000	0.32223	CTG	-	NULL		0.423	CYB5R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R4	protein_coding	OTTHUMT00000041362.4	T	NM_016230		84676521	+1	no_errors	ENST00000369679	ensembl	human	known	54_36p	missense	SNP	0.008	A
PRSS23	11098	genome.wustl.edu	37	11	86518981	86518981	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr11:86518981C>T	ENST00000280258.5	+	2	721	c.296C>T	c.(295-297)aCg>aTg	p.T99M	PRSS23_ENST00000441050.1_Missense_Mutation_p.T67M|PRSS23_ENST00000533902.2_Intron	NM_007173.4	NP_009104.1	O95084	PRS23_HUMAN	protease, serine, 23	99						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CGCACAGAGACGCAGGTGGGC	0.542																																																0			11											59.0	54.0	56.0					11																	86518981		2201	4299	6500	86196629	SO:0001583	missense	11098			AF015287	CCDS8278.1	11q14.2	2010-05-12			ENSG00000150687	ENSG00000150687		"""Serine peptidases / Serine peptidases"""	14370	protein-coding gene	gene with protein product							Standard	XM_005273727		Approved	SPUVE, SIG13	uc001pcb.3	O95084		ENST00000280258.5:c.296C>T	11.37:g.86518981C>T	ENSP00000280258:p.Thr99Met	Somatic		Capture	Illumina GAIIx	4	86196629	B2RDJ1|B4E2J3|Q6IBI0	Missense_Mutation	SNP	superfamily_Trypsin-like serine proteases,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS	p.T99M	ENST00000280258.5	37	c.296	CCDS8278.1	11	.	.	.	.	.	.	.	.	.	.	C	22.2	4.256908	0.80246	.	.	ENSG00000150687	ENST00000527521;ENST00000280258;ENST00000441050	.	.	.	5.8	5.8	0.92144	Peptidase S1/S6, chymotrypsin/Hap (1);	0.000000	0.85682	D	0.000000	D	0.83078	0.5176	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.82168	-0.0591	8	.	.	.	-16.5162	20.0545	0.97645	0.0:1.0:0.0:0.0	.	67;99	B4E2J3;O95084	.;PRS23_HUMAN	M	99;99;67	.	.	T	+	2	0	PRSS23	86196629	1.000000	0.71417	0.963000	0.40424	0.897000	0.52465	7.395000	0.79876	2.748000	0.94277	0.655000	0.94253	ACG	-	NULL		0.542	PRSS23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS23	protein_coding	OTTHUMT00000393805.2	C	NM_007173		86196629	+1	no_errors	NM_007173	genbank	human	validated	54_36p	missense	SNP	1.000	T
GTF2B	2959	genome.wustl.edu	37	1	89323153	89323153	+	Nonsense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:89323153G>A	ENST00000370500.5	-	6	671	c.553C>T	c.(553-555)Cga>Tga	p.R185*	GTF2B_ENST00000494819.1_5'UTR	NM_001514.5	NP_001505.1	Q00403	TF2B_HUMAN	general transcription factor IIB	185					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)	core promoter binding (GO:0001047)|thyroid hormone receptor binding (GO:0046966)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		TTAGAAATTCGTGATACGGCA	0.299																																																0			1											29.0	31.0	30.0					1																	89323153		2203	4300	6503	89095741	SO:0001587	stop_gained	2959			M76766	CCDS715.1	1p22-p21	2010-03-23			ENSG00000137947	ENSG00000137947		"""General transcription factors"""	4648	protein-coding gene	gene with protein product		189963				1876184, 8162052	Standard	NM_001514		Approved	TFIIB	uc001dmo.4	Q00403	OTTHUMG00000010611	ENST00000370500.5:c.553C>T	1.37:g.89323153G>A	ENSP00000359531:p.Arg185*	Somatic		Capture	Illumina GAIIx	4	89095741	A8K1A7|Q5JS30	Nonsense_Mutation	SNP	superfamily_Zinc beta-ribbon,HMMPfam_TFIIB_Zn_Ribbon,superfamily_Cyclin-like,HMMSmart_SM00385,HMMPfam_TFIIB,PatternScan_TFIIB	p.R185*	ENST00000370500.5	37	c.553	CCDS715.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111188	0.77210	.	.	ENSG00000137947	ENST00000370500;ENST00000448623;ENST00000418217	.	.	.	5.53	3.53	0.40419	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.5937	9.1646	0.37043	0.0785:0.0:0.6693:0.2522	.	.	.	.	X	185;184;180	.	ENSP00000359531:R185X	R	-	1	2	GTF2B	89095741	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.827000	0.48112	1.467000	0.48044	0.561000	0.74099	CGA	-	superfamily_Cyclin-like,HMMSmart_SM00385,HMMPfam_TFIIB		0.299	GTF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2B	protein_coding	OTTHUMT00000029279.1	G	NM_001514		89095741	-1	no_errors	NM_001514	genbank	human	reviewed	54_36p	nonsense	SNP	0.998	A
SPATA31E1	286234	genome.wustl.edu	37	9	90500105	90500105	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr9:90500105G>A	ENST00000325643.5	+	4	769	c.703G>A	c.(703-705)Gca>Aca	p.A235T		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	235	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AAAATGCCCTGCAACCCAGCC	0.612																																																0			9											97.0	108.0	104.0					9																	90500105		2203	4300	6503	89689925	SO:0001583	missense	286234			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.703G>A	9.37:g.90500105G>A	ENSP00000322640:p.Ala235Thr	Somatic		Capture	Illumina GAIIx	4	89689925	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NULL	p.A235T	ENST00000325643.5	37	c.703	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	.	6.109	0.388418	0.11581	.	.	ENSG00000177992	ENST00000325643	T	0.03635	3.86	0.781	0.781	0.18561	.	.	.	.	.	T	0.03651	0.0104	L	0.44542	1.39	0.09310	N	1	P	0.45715	0.865	P	0.44518	0.452	T	0.32455	-0.9906	9	0.10377	T	0.69	.	4.8363	0.13466	0.0:0.0:1.0:0.0	.	235	Q6ZUB1	CI079_HUMAN	T	235	ENSP00000322640:A235T	ENSP00000322640:A235T	A	+	1	0	C9orf79	89689925	0.055000	0.20627	0.015000	0.15790	0.027000	0.11550	0.889000	0.28282	0.675000	0.31264	0.455000	0.32223	GCA	-	NULL		0.612	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf79	protein_coding	OTTHUMT00000052954.2	G	NM_178828		89689925	+1	no_errors	NM_178828	genbank	human	validated	54_36p	missense	SNP	0.004	A
ZNF644	84146	genome.wustl.edu	37	1	91489961	91489961	+	5'Flank	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:91489961G>A	ENST00000370440.1	-	0	0				ZNF644_ENST00000337393.5_5'Flank|ZNF644_ENST00000467231.1_5'Flank|ZNF644_ENST00000361321.5_5'Flank|ZNF644_ENST00000347275.5_5'Flank			Q9H582	ZN644_HUMAN	zinc finger protein 644						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TTGGCACTCTGAAGGGAGCTG	0.458																																																0			1																																								91262549	SO:0001631	upstream_gene_variant	646784			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078		1.37:g.91489961G>A	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	91262549	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	RNA	SNP	-	NULL	ENST00000370440.1	37	NULL	CCDS731.1	1																																																																																			-	-		0.458	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC646784	protein_coding	OTTHUMT00000027846.2	G	NM_032186		91262549	+1	pseudogene	XR_017249	genbank	human	model	54_36p	rna	SNP	1.000	A
FAT3	120114	genome.wustl.edu	37	11	92534588	92534588	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr11:92534588G>T	ENST00000298047.6	+	9	8426	c.8409G>T	c.(8407-8409)aaG>aaT	p.K2803N	FAT3_ENST00000409404.2_Missense_Mutation_p.K2803N|FAT3_ENST00000525166.1_Missense_Mutation_p.K2653N			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2803	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TAGATATCAAGGTATTGGATT	0.433										TCGA Ovarian(4;0.039)																																						0			11											64.0	63.0	63.0					11																	92534588		1899	4117	6016	92174236	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8409G>T	11.37:g.92534588G>T	ENSP00000298047:p.Lys2803Asn	Somatic		Capture	Illumina GAIIx	4	92174236	B5MDB0|Q96AU6	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.K2803N	ENST00000298047.6	37	c.8409		11	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101652	0.56183	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.60920	0.15;0.15;0.15	5.98	5.98	0.97165	.	.	.	.	.	T	0.66645	0.2810	L	0.38692	1.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62158	-0.6913	9	0.33940	T	0.23	.	14.5724	0.68220	0.0694:0.0:0.9306:0.0	.	2803	Q8TDW7-3	.	N	2803;2803;2653	ENSP00000298047:K2803N;ENSP00000387040:K2803N;ENSP00000432586:K2653N	ENSP00000298047:K2803N	K	+	3	2	FAT3	92174236	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.830000	0.39131	2.837000	0.97791	0.591000	0.81541	AAG	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_Cadherin-like,HMMSmart_SM00112,PatternScan_CADHERIN_1		0.433	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		G	NM_001008781		92174236	+1	no_errors	NM_001008781	genbank	human	validated	54_36p	missense	SNP	1.000	T
CHD1	1105	genome.wustl.edu	37	5	98224789	98224789	+	Missense_Mutation	SNP	C	C	G	rs199914342		TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr5:98224789C>G	ENST00000284049.3	-	15	2483	c.2334G>C	c.(2332-2334)gaG>gaC	p.E778D	RNU6-402P_ENST00000410678.1_RNA	NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	778					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	CTTGTAAGGCCTCCTGTTTAT	0.308																																																0			5											63.0	68.0	66.0					5																	98224789		2203	4300	6503	98252689	SO:0001583	missense	1105			AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.2334G>C	5.37:g.98224789C>G	ENSP00000284049:p.Glu778Asp	Somatic		Capture	Illumina GAIIx	4	98252689	Q17RZ3	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,superfamily_Chromo domain-like,HMMSmart_SM00298,HMMPfam_Chromo,PatternScan_CHROMO_1,HMMSmart_SM00487,HMMPfam_SNF2_N,HMMSmart_SM00490,HMMPfam_Helicase_C,superfamily_Homeodomain-like	p.E778D	ENST00000284049.3	37	c.2334	CCDS34204.1	5	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897160	0.33535	.	.	ENSG00000153922	ENST00000284049	T	0.75938	-0.98	5.82	4.04	0.47022	.	0.000000	0.33916	U	0.004434	T	0.58104	0.2099	N	0.25060	0.705	0.58432	D	0.999999	B	0.15719	0.014	B	0.15484	0.013	T	0.51772	-0.8663	10	0.13108	T	0.6	.	12.6381	0.56694	0.0:0.865:0.0:0.135	.	778	O14646	CHD1_HUMAN	D	778	ENSP00000284049:E778D	ENSP00000284049:E778D	E	-	3	2	CHD1	98252689	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.421000	0.44688	1.476000	0.48215	0.650000	0.86243	GAG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.308	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1	protein_coding	OTTHUMT00000370295.1	C	NM_001270		98252689	-1	no_errors	NM_001270	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ARPC1B	10095	genome.wustl.edu	37	7	98984376	98984376	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr7:98984376G>A	ENST00000451682.1	+	5	442	c.133G>A	c.(133-135)Gtg>Atg	p.V45M	ARPC1B_ENST00000252725.5_Missense_Mutation_p.V45M|ARPC1A_ENST00000432884.2_3'UTR|ARPC1B_ENST00000474880.1_3'UTR			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	45					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			ATGGACCAAGGTGCACGAGCT	0.582																																																0			7											162.0	144.0	150.0					7																	98984376		2203	4300	6503	98822312	SO:0001583	missense	10095			AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.133G>A	7.37:g.98984376G>A	ENSP00000389631:p.Val45Met	Somatic		Capture	Illumina GAIIx	4	98822312	Q9BU00	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40	p.V45M	ENST00000451682.1	37	c.133	CCDS5661.1	7	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120445	0.56613	.	.	ENSG00000130429	ENST00000443222;ENST00000414376;ENST00000252725;ENST00000455009;ENST00000418347;ENST00000417330;ENST00000431816;ENST00000427217;ENST00000458033;ENST00000451682	T;T;T;T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05	5.17	5.17	0.71159	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.321566	0.32687	N	0.005766	T	0.71065	0.3296	M	0.70903	2.155	0.37279	D	0.907757	B;B	0.30281	0.275;0.275	P;P	0.45881	0.496;0.496	T	0.74714	-0.3572	10	0.46703	T	0.11	-25.8127	12.4073	0.55447	0.0777:0.0:0.9223:0.0	.	45;45	A4D275;O15143	.;ARC1B_HUMAN	M	45	ENSP00000413173:V45M;ENSP00000398620:V45M;ENSP00000252725:V45M;ENSP00000410238:V45M;ENSP00000413067:V45M;ENSP00000403324:V45M;ENSP00000398110:V45M;ENSP00000403211:V45M;ENSP00000388802:V45M;ENSP00000389631:V45M	ENSP00000252725:V45M	V	+	1	0	ARPC1B	98822312	1.000000	0.71417	0.999000	0.59377	0.840000	0.47671	5.328000	0.65887	2.577000	0.86979	0.561000	0.74099	GTG	-	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40		0.582	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARPC1B	protein_coding	OTTHUMT00000335894.1	G	NM_005720		98822312	+1	no_errors	NM_005720	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GPR15	2838	genome.wustl.edu	37	3	98251144	98251144	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr3:98251144G>C	ENST00000284311.3	+	1	402	c.267G>C	c.(265-267)tgG>tgC	p.W89C		NM_005290.1	NP_005281.1	P49685	GPR15_HUMAN	G protein-coupled receptor 15	89					G-protein coupled receptor signaling pathway (GO:0007186)|T cell migration (GO:0072678)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		TGCCTCTCTGGGTGGATAAAG	0.502																																																0			3											81.0	82.0	82.0					3																	98251144		2203	4300	6503	99733834	SO:0001583	missense	2838				CCDS2931.1	3q11.2-q13.1	2014-01-30			ENSG00000154165	ENSG00000154165		"""GPCR / Class A : Orphans"""	4469	protein-coding gene	gene with protein product		601166				8838812	Standard	NM_005290		Approved		uc011bgy.3	P49685	OTTHUMG00000160017	ENST00000284311.3:c.267G>C	3.37:g.98251144G>C	ENSP00000284311:p.Trp89Cys	Somatic		Capture	Illumina GAIIx	4	99733834	Q3MIL4|Q6ISN6	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.W89C	ENST00000284311.3	37	c.267	CCDS2931.1	3	.	.	.	.	.	.	.	.	.	.	G	18.57	3.653063	0.67472	.	.	ENSG00000154165	ENST00000284311	T	0.73575	-0.76	4.8	4.8	0.61643	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000168	D	0.89403	0.6705	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91851	0.5491	10	0.87932	D	0	-11.3975	15.7547	0.78015	0.0:0.0:1.0:0.0	.	89	P49685	GPR15_HUMAN	C	89	ENSP00000284311:W89C	ENSP00000284311:W89C	W	+	3	0	GPR15	99733834	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.816000	0.86201	2.656000	0.90262	0.591000	0.81541	TGG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.502	GPR15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR15	protein_coding	OTTHUMT00000358907.1	G			99733834	+1	no_errors	NM_005290	genbank	human	provisional	54_36p	missense	SNP	1.000	C
COL17A1	1308	genome.wustl.edu	37	10	105798222	105798222	+	Silent	SNP	C	C	T	rs368653483		TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr10:105798222C>T	ENST00000353479.5	-	45	3302	c.3012G>A	c.(3010-3012)ccG>ccA	p.P1004P	COL17A1_ENST00000369733.3_Silent_p.P959P	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1004	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TGATAGAGCCCGGAGGCCCAG	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		15229	0.0		0.0	False		,,,				2504	0.001															0			10											94.0	104.0	101.0					10																	105798222		2200	4296	6496	105788212	SO:0001819	synonymous_variant	1308			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.3012G>A	10.37:g.105798222C>T		Somatic		Capture	Illumina GAIIx	4	105788212	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	HMMPfam_Collagen	p.P1004	ENST00000353479.5	37	c.3012	CCDS7554.1	10																																																																																			-	NULL		0.607	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	protein_coding	OTTHUMT00000050181.1	C	NM_130778, NM_000494		105788212	-1	no_errors	NM_000494	genbank	human	reviewed	54_36p	silent	SNP	0.777	T
COG5	10466	genome.wustl.edu	37	7	106876940	106876940	+	Silent	SNP	A	A	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr7:106876940A>T	ENST00000347053.3	-	17	2126	c.2076T>A	c.(2074-2076)ccT>ccA	p.P692P	COG5_ENST00000297135.3_Silent_p.P713P|COG5_ENST00000393603.2_Silent_p.P713P	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	692					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						CTTCACCAAGAGGTCTTATGA	0.388																																																0			7											90.0	86.0	87.0					7																	106876940		2203	4300	6503	106664176	SO:0001819	synonymous_variant	10466			AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.2076T>A	7.37:g.106876940A>T		Somatic		Capture	Illumina GAIIx	4	106664176	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Silent	SNP	HMMPfam_COG5	p.P713	ENST00000347053.3	37	c.2139	CCDS5743.1	7																																																																																			-	NULL		0.388	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COG5	protein_coding	OTTHUMT00000060216.4	A			106664176	-1	no_errors	NM_006348	genbank	human	validated	54_36p	silent	SNP	0.998	T
NPNT	255743	genome.wustl.edu	37	4	106863581	106863581	+	Nonsense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr4:106863581G>A	ENST00000379987.2	+	8	1097	c.881G>A	c.(880-882)tGg>tAg	p.W294*	NPNT_ENST00000514622.1_Nonsense_Mutation_p.W294*|NPNT_ENST00000305572.8_Nonsense_Mutation_p.W294*|NPNT_ENST00000506666.1_Nonsense_Mutation_p.W324*|NPNT_ENST00000427316.2_Nonsense_Mutation_p.W324*|NPNT_ENST00000453617.2_Nonsense_Mutation_p.W311*	NM_001033047.2	NP_001028219.1	Q6UXI9	NPNT_HUMAN	nephronectin	294					branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to tumor necrosis factor (GO:0071356)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|pilomotor reflex (GO:0097195)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|ureteric bud development (GO:0001657)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integrin alpha8-beta1 complex (GO:0034678)|proteinaceous extracellular matrix (GO:0005578)|smooth muscle contractile fiber (GO:0030485)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			kidney(5)|large_intestine(2)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	21		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		GGAAGTACTTGGTGGCCTCCG	0.418																																																0			4											122.0	109.0	113.0					4																	106863581		2203	4300	6503	107083030	SO:0001587	stop_gained	255743				CCDS34046.1, CCDS54784.1, CCDS54785.1, CCDS54786.1, CCDS54787.1	4q25	2005-10-07							27405	protein-coding gene	gene with protein product		610306				15754038	Standard	NM_001033047		Approved	EGFL6L, POEM	uc011cfd.2	Q6UXI9		ENST00000379987.2:c.881G>A	4.37:g.106863581G>A	ENSP00000369323:p.Trp294*	Somatic		Capture	Illumina GAIIx	4	107083030	A6NFT9|A8K1W4|B4DIT4|B4DYK3|B4E2H7|B4E3H2|D6RCA1|E9PCK8|E9PCQ1|E9PE64|E9PF04	Nonsense_Mutation	SNP	superfamily_Growth factor receptor domain,HMMSmart_SM00181,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,superfamily_EGF/Laminin,HMMSmart_SM00137,HMMPfam_MAM	p.W294*	ENST00000379987.2	37	c.881	CCDS34046.1	4	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692770	0.68271	.	.	ENSG00000168743	ENST00000379987;ENST00000453617;ENST00000427316;ENST00000514622;ENST00000305572;ENST00000506666;ENST00000503451	.	.	.	4.98	3.23	0.37069	.	0.457975	0.25801	N	0.028209	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	7.2425	0.26104	0.2791:0.0:0.7209:0.0	.	.	.	.	X	294;311;324;294;294;324;341	.	ENSP00000302557:W294X	W	+	2	0	NPNT	107083030	0.139000	0.22563	0.559000	0.28332	0.008000	0.06430	1.310000	0.33551	0.594000	0.29761	0.555000	0.69702	TGG	-	NULL		0.418	NPNT-001	KNOWN	basic|CCDS	protein_coding	NPNT	protein_coding	OTTHUMT00000364083.1	G	NM_198278		107083030	+1	no_errors	NM_001033047	genbank	human	validated	54_36p	nonsense	SNP	0.089	A
COL4A5	1287	genome.wustl.edu	37	X	107923973	107923973	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:107923973G>C	ENST00000361603.2	+	43	4233	c.3989G>C	c.(3988-3990)gGa>gCa	p.G1330A	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1336A	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1330	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGTGTTCCAGGATTCCCAGGT	0.408									Alport syndrome with Diffuse Leiomyomatosis																																							0			X											80.0	76.0	78.0					X																	107923973		2203	4300	6503	107810629	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3989G>C	X.37:g.107923973G>C	ENSP00000354505:p.Gly1330Ala	Somatic		Capture	Illumina GAIIx	4	107810629	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	HMMPfam_Collagen,superfamily_C-type_lectin_fold,HMMPfam_C4,HMMSmart_C4	p.G1336A	ENST00000361603.2	37	c.4007	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	G	24.7	4.565487	0.86439	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99607	-6.27;-6.27	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.99829	0.9923	H	0.98577	4.27	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.996	D	0.96530	0.9392	10	0.87932	D	0	.	18.1049	0.89517	0.0:0.0:1.0:0.0	.	1333;1330	E7EVY4;P29400	.;CO4A5_HUMAN	A	1336;1330;1336	ENSP00000331902:G1336A;ENSP00000354505:G1330A	ENSP00000331902:G1336A	G	+	2	0	COL4A5	107810629	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.067000	0.93955	2.212000	0.71576	0.523000	0.50628	GGA	-	HMMPfam_Collagen		0.408	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	protein_coding	OTTHUMT00000057880.2	G			107810629	+1	no_errors	NM_033380	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
IRS4	8471	genome.wustl.edu	37	X	107977049	107977049	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:107977049G>T	ENST00000372129.2	-	1	2602	c.2526C>A	c.(2524-2526)gaC>gaA	p.D842E	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	842					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AGACTTCTTTGTCTAGGCCCC	0.498																																																0			X											173.0	178.0	176.0					X																	107977049		2203	4300	6503	107863705	SO:0001583	missense	8471			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2526C>A	X.37:g.107977049G>T	ENSP00000361202:p.Asp842Glu	Somatic		Capture	Illumina GAIIx	4	107863705		Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMPfam_IRS,HMMSmart_PTBI	p.D842E	ENST00000372129.2	37	c.2526	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	G	6.101	0.386902	0.11581	.	.	ENSG00000133124	ENST00000372129	T	0.17213	2.29	5.18	2.16	0.27623	.	1.194070	0.05806	N	0.613116	T	0.08313	0.0207	N	0.11255	0.115	0.19575	N	0.999964	B	0.02656	0.0	B	0.04013	0.001	T	0.27606	-1.0069	10	0.02654	T	1	-2.8764	7.8366	0.29374	0.0:0.115:0.3223:0.5627	.	842	O14654	IRS4_HUMAN	E	842	ENSP00000361202:D842E	ENSP00000361202:D842E	D	-	3	2	IRS4	107863705	0.990000	0.36364	0.172000	0.22920	0.839000	0.47603	2.197000	0.42696	0.543000	0.28864	-0.222000	0.12452	GAC	-	NULL		0.498	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	protein_coding	OTTHUMT00000057879.1	G	NM_003604		107863705	-1	no_errors	NM_003604	genbank	human	reviewed	54_36p	missense	SNP	0.279	T
RAB20	55647	genome.wustl.edu	37	13	111176091	111176091	+	Missense_Mutation	SNP	C	C	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr13:111176091C>A	ENST00000267328.3	-	2	839	c.626G>T	c.(625-627)aGa>aTa	p.R209I		NM_017817.1	NP_060287.1	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family	209					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)	GTP binding (GO:0005525)			endometrium(2)|large_intestine(2)|lung(3)	7	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			CCTCTCAGCTCTCTGCTGTAA	0.537																																																0			13											148.0	122.0	130.0					13																	111176091		2203	4300	6503	109974092	SO:0001583	missense	55647			AK000436	CCDS9512.1	13q34	2008-07-18			ENSG00000139832	ENSG00000139832		"""RAB, member RAS oncogene"""	18260	protein-coding gene	gene with protein product						11697911	Standard	NM_017817		Approved	FLJ20429	uc001vqy.3	Q9NX57	OTTHUMG00000017343	ENST00000267328.3:c.626G>T	13.37:g.111176091C>A	ENSP00000267328:p.Arg209Ile	Somatic		Capture	Illumina GAIIx	4	109974092	Q5T9X5|Q9NX49	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMPfam_Ras,HMMSmart_SM00175,HMMSmart_SM00174	p.R209I	ENST00000267328.3	37	c.626	CCDS9512.1	13	.	.	.	.	.	.	.	.	.	.	C	14.04	2.415588	0.42817	.	.	ENSG00000139832	ENST00000267328	T	0.68181	-0.31	5.21	3.46	0.39613	.	0.181051	0.64402	D	0.000015	T	0.56077	0.1961	M	0.66939	2.045	0.58432	D	0.999994	P	0.35656	0.514	B	0.26864	0.074	T	0.51803	-0.8659	10	0.38643	T	0.18	-22.1009	6.8859	0.24199	0.0:0.5999:0.0:0.4001	.	209	Q9NX57	RAB20_HUMAN	I	209	ENSP00000267328:R209I	ENSP00000267328:R209I	R	-	2	0	RAB20	109974092	0.757000	0.28394	0.493000	0.27502	0.211000	0.24417	1.218000	0.32467	0.565000	0.29255	0.561000	0.74099	AGA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.537	RAB20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB20	protein_coding	OTTHUMT00000045760.2	C	NM_017817		109974092	-1	no_errors	NM_017817	genbank	human	provisional	54_36p	missense	SNP	0.952	A
MUSK	4593	genome.wustl.edu	37	9	113562774	113562774	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr9:113562774G>A	ENST00000374448.4	+	15	2250	c.2116G>A	c.(2116-2118)Gcc>Acc	p.A706T	MUSK_ENST00000189978.5_Missense_Mutation_p.A706T|MUSK_ENST00000416899.2_Missense_Mutation_p.A698T	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	706	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						GCTTTGCATTGCCAGGCAGGT	0.582																																																0			9											111.0	115.0	113.0					9																	113562774		2007	4162	6169	112602595	SO:0001583	missense	4593			AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.2116G>A	9.37:g.113562774G>A	ENSP00000363571:p.Ala706Thr	Somatic		Capture	Illumina GAIIx	4	112602595	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Missense_Mutation	SNP	PatternScan_TUBULIN_B_AUTOREG,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_Fz,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.A706T	ENST00000374448.4	37	c.2116	CCDS48005.1	9	.	.	.	.	.	.	.	.	.	.	G	21.1	4.100999	0.76983	.	.	ENSG00000030304	ENST00000189978;ENST00000374448;ENST00000543335;ENST00000374447;ENST00000545907;ENST00000416899	T	0.53857	0.6	5.45	5.45	0.79879	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.054964	0.85682	D	0.000000	T	0.71484	0.3345	M	0.74546	2.27	0.80722	D	1	P	0.51933	0.949	P	0.60609	0.877	T	0.73924	-0.3829	10	0.72032	D	0.01	.	18.6395	0.91390	0.0:0.0:1.0:0.0	.	706	O15146	MUSK_HUMAN	T	712;706;706;620;620;704	ENSP00000363571:A706T	ENSP00000189978:A712T	A	+	1	0	MUSK	112602595	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	7.016000	0.76393	2.705000	0.92388	0.650000	0.86243	GCC	-	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220		0.582	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUSK	protein_coding		G			112602595	+1	no_errors	NM_005592	genbank	human	validated	54_36p	missense	SNP	1.000	A
OR2K2	26248	genome.wustl.edu	37	9	114090591	114090591	+	Silent	SNP	G	G	T	rs139925839		TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr9:114090591G>T	ENST00000374428.1	-	1	209	c.210C>A	c.(208-210)ggC>ggA	p.G70G	OR2K2_ENST00000302681.1_Silent_p.G41G			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						GAGTGCTGTTGCCCAAGAGCG	0.408																																																0			9						G		1,4405	2.1+/-5.4	0,1,2202	87.0	86.0	86.0		123	-5.0	0.8	9	dbSNP_134	86	0,8600		0,0,4300	no	coding-synonymous	OR2K2	NM_205859.1		0,1,6502	TT,TG,GG		0.0,0.0227,0.0077		41/317	114090591	1,13005	2203	4300	6503	113130412	SO:0001819	synonymous_variant	26248			X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.210C>A	9.37:g.114090591G>T		Somatic		Capture	Illumina GAIIx	4	113130412	Q2TA61|Q5VYK4|Q6IFI5	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G41	ENST00000374428.1	37	c.123		9																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.408	OR2K2-201	KNOWN	basic	protein_coding	OR2K2	protein_coding		G	NM_205859		113130412	-1	no_errors	NM_205859	genbank	human	provisional	54_36p	silent	SNP	0.539	T
TDRD1	56165	genome.wustl.edu	37	10	115980603	115980603	+	Splice_Site	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr10:115980603G>T	ENST00000369280.1	+	19	3230		c.e19+1		TDRD1_ENST00000369281.2_Splice_Site|TDRD1_ENST00000369282.1_Splice_Site|TDRD1_ENST00000422662.1_Splice_Site|TDRD1_ENST00000251864.2_Splice_Site			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1						DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GGACTTCAAGGTAACATTTTA	0.308																																																0			10											55.0	56.0	55.0					10																	115980603		2203	4300	6503	115970593	SO:0001630	splice_region_variant	56165			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.2770+1G>T	10.37:g.115980603G>T		Somatic		Capture	Illumina GAIIx	4	115970593	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Splice_Site	SNP	-	e18+1	ENST00000369280.1	37	c.2770+1		10	.	.	.	.	.	.	.	.	.	.	G	16.28	3.078040	0.55753	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.8935	0.35449	0.1249:0.0:0.8751:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TDRD1	115970593	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	4.432000	0.59922	2.707000	0.92482	0.563000	0.77884	.	-	-		0.308	TDRD1-001	KNOWN	basic	protein_coding	TDRD1	protein_coding	OTTHUMT00000050457.2	G		Intron	115970593	+1	no_errors	NM_198795	genbank	human	reviewed	54_36p	splice_site	SNP	0.969	T
SLC25A43	203427	genome.wustl.edu	37	X	118587010	118587010	+	Silent	SNP	T	T	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:118587010T>C	ENST00000217909.7	+	5	1352	c.1008T>C	c.(1006-1008)ccT>ccC	p.P336P	SLC25A43_ENST00000488158.1_3'UTR|SLC25A43_ENST00000336249.7_3'UTR	NM_145305.2	NP_660348.2	Q8WUT9	S2543_HUMAN	solute carrier family 25, member 43	336					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	9						AACCGAAGCCTAAAAAACCAA	0.423																																																0			X											73.0	75.0	74.0					X																	118587010		2203	4299	6502	118471038	SO:0001819	synonymous_variant	203427			BC019584	CCDS14577.1	Xq24	2013-05-22			ENSG00000077713	ENSG00000077713		"""Solute carriers"""	30557	protein-coding gene	gene with protein product		300641				16949250	Standard	NM_145305		Approved		uc004erd.3	Q8WUT9	OTTHUMG00000022272	ENST00000217909.7:c.1008T>C	X.37:g.118587010T>C		Somatic		Capture	Illumina GAIIx	4	118471038	O75854|Q8N9L5	Silent	SNP	superfamily_Mitochondrial carrier,HMMPfam_Mito_carr	p.P336	ENST00000217909.7	37	c.1008	CCDS14577.1	X																																																																																			-	NULL		0.423	SLC25A43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A43	protein_coding	OTTHUMT00000058028.1	T	NM_145305		118471038	+1	no_errors	NM_145305	genbank	human	provisional	54_36p	silent	SNP	0.236	C
XIAP	331	genome.wustl.edu	37	X	123034352	123034352	+	Missense_Mutation	SNP	T	T	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:123034352T>C	ENST00000371199.3	+	6	1408	c.1109T>C	c.(1108-1110)aTc>aCc	p.I370T	XIAP_ENST00000468691.1_3'UTR|XIAP_ENST00000355640.3_Missense_Mutation_p.I370T|XIAP_ENST00000434753.3_Missense_Mutation_p.I370T	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	370					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						GATGATACCATCTTCCAAAAT	0.299									X-linked Lymphoproliferative syndrome																																							0			X											39.0	37.0	37.0					X																	123034352		2202	4297	6499	122862033	SO:0001583	missense	331	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.1109T>C	X.37:g.123034352T>C	ENSP00000360242:p.Ile370Thr	Somatic		Capture	Illumina GAIIx	4	122862033	D3DTF2|Q9NQ14	Missense_Mutation	SNP	PatternScan_ZF_RING_1,superfamily_SSF57924,HMMSmart_BIR,PatternScan_BIR_REPEAT_1,HMMPfam_BIR,HMMSmart_RING	p.I370T	ENST00000371199.3	37	c.1109	CCDS14606.1	X	.	.	.	.	.	.	.	.	.	.	t	11.20	1.569782	0.28003	.	.	ENSG00000101966	ENST00000434753;ENST00000371199;ENST00000355640	T;T;T	0.28255	1.62;1.62;1.62	4.7	3.53	0.40419	.	0.353829	0.24488	N	0.038092	T	0.29223	0.0727	M	0.65975	2.015	0.09310	N	0.999999	B	0.10296	0.003	B	0.10450	0.005	T	0.21075	-1.0256	10	0.32370	T	0.25	-29.9185	7.8753	0.29590	0.0:0.0972:0.0:0.9028	.	370	P98170	XIAP_HUMAN	T	370	ENSP00000395230:I370T;ENSP00000360242:I370T;ENSP00000347858:I370T	ENSP00000347858:I370T	I	+	2	0	XIAP	122862033	0.973000	0.33851	0.809000	0.32408	0.821000	0.46438	3.024000	0.49674	0.657000	0.30906	0.350000	0.21858	ATC	-	superfamily_SSF57924		0.299	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	XIAP	protein_coding	OTTHUMT00000058165.5	T	NM_001167		122862033	+1	no_errors	NM_001167	genbank	human	reviewed	54_36p	missense	SNP	0.121	C
OR10G8	219869	genome.wustl.edu	37	11	123901140	123901140	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr11:123901140G>T	ENST00000431524.1	+	1	844	c.811G>T	c.(811-813)Gtg>Ttg	p.V271L		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GGATGGAGTTGTGGCCGTTTT	0.517																																																0			11											136.0	126.0	129.0					11																	123901140		2201	4299	6500	123406350	SO:0001583	missense	219869			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.811G>T	11.37:g.123901140G>T	ENSP00000389072:p.Val271Leu	Somatic		Capture	Illumina GAIIx	4	123406350	B2RNJ3|Q6IEV2	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.V271L	ENST00000431524.1	37	c.811	CCDS31704.1	11	.	.	.	.	.	.	.	.	.	.	G	9.599	1.128324	0.21041	.	.	ENSG00000234560	ENST00000431524	T	0.37235	1.21	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35870	N	0.002925	T	0.34803	0.0910	N	0.24115	0.695	0.09310	N	1	P	0.52692	0.955	P	0.59546	0.859	T	0.04961	-1.0915	10	0.66056	D	0.02	.	4.8695	0.13625	0.1185:0.0:0.6684:0.2132	.	271	Q8NGN5	O10G8_HUMAN	L	271	ENSP00000389072:V271L	ENSP00000389072:V271L	V	+	1	0	OR10G8	123406350	0.000000	0.05858	0.211000	0.23655	0.144000	0.21451	-0.109000	0.10840	1.611000	0.50210	0.557000	0.71058	GTG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.517	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G8	protein_coding	OTTHUMT00000387270.1	G	NM_001004464		123406350	+1	no_errors	NM_001004464	genbank	human	provisional	54_36p	missense	SNP	0.126	T
ADAM12	8038	genome.wustl.edu	37	10	127806692	127806692	+	Missense_Mutation	SNP	C	C	T	rs369702251		TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr10:127806692C>T	ENST00000368679.4	-	6	836	c.527G>A	c.(526-528)cGg>cAg	p.R176Q	ADAM12_ENST00000368676.4_Missense_Mutation_p.R176Q	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	176					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		ACATGATCCCCGGACGCTTTT	0.458																																																0			10						C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	201.0	176.0	185.0		527,527	3.1	0.1	10		185	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADAM12	NM_021641.3,NM_003474.4	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	176/739,176/910	127806692	1,13005	2203	4300	6503	127796682	SO:0001583	missense	8038			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.527G>A	10.37:g.127806692C>T	ENSP00000357668:p.Arg176Gln	Somatic		Capture	Illumina GAIIx	4	127796682	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMPfam_Disintegrin,HMMSmart_SM00050,superfamily_Blood coagulation inhibitor (disintegrin),PatternScan_DISINTEGRIN_1,HMMSmart_SM00608,HMMPfam_ADAM_CR,HMMPfam_EGF_2"	p.R176Q	ENST00000368679.4	37	c.527	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	C	7.496	0.651600	0.14516	0.0	1.16E-4	ENSG00000148848	ENST00000368679;ENST00000368676;ENST00000448723	T;T;T	0.21734	4.77;1.99;3.68	5.03	3.13	0.36017	.	0.694155	0.13701	N	0.368781	T	0.08223	0.0205	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.09022	0.001;0.002;0.002;0.002;0.0	B;B;B;B;B	0.08055	0.001;0.003;0.003;0.003;0.001	T	0.37776	-0.9691	10	0.13470	T	0.59	.	3.0964	0.06311	0.1715:0.5125:0.2191:0.0969	.	173;173;176;173;176	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	Q	176;176;173	ENSP00000357668:R176Q;ENSP00000357665:R176Q;ENSP00000391268:R173Q	ENSP00000357665:R176Q	R	-	2	0	ADAM12	127796682	0.385000	0.25172	0.099000	0.21106	0.007000	0.05969	0.980000	0.29513	0.660000	0.30964	0.655000	0.94253	CGG	-	NULL		0.458	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	protein_coding	OTTHUMT00000050961.1	C			127796682	-1	no_errors	NM_003474	genbank	human	reviewed	54_36p	missense	SNP	0.005	T
XPNPEP2	7512	genome.wustl.edu	37	X	128880698	128880698	+	Intron	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:128880698G>C	ENST00000371106.3	+	6	682				XPNPEP2_ENST00000371105.3_Silent_p.T177T	NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound							anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						CCATGCTAACGAGGGTGACTC	0.483																																																0			X											150.0	129.0	136.0					X																	128880698		2203	4299	6502	128708379	SO:0001627	intron_variant	7512			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.490+41G>C	X.37:g.128880698G>C		Somatic		Capture	Illumina GAIIx	4	128708379	A0AV16|O75994	Silent	SNP	superfamily_SSF53092,HMMPfam_Creatinase_N	p.T177	ENST00000371106.3	37	c.531	CCDS14613.1	X																																																																																			-	NULL		0.483	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP2	protein_coding	OTTHUMT00000058210.1	G	NM_003399		128708379	+1	no_errors	ENST00000371105	ensembl	human	known	54_36p	silent	SNP	0.000	C
PTGES2	80142	genome.wustl.edu	37	9	130884693	130884693	+	Missense_Mutation	SNP	A	A	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr9:130884693A>C	ENST00000338961.6	-	6	1697	c.953T>G	c.(952-954)gTg>gGg	p.V318G	PTGES2_ENST00000483625.1_5'Flank|PTGES2_ENST00000277462.5_Missense_Mutation_p.V127G	NM_001256335.1|NM_025072.6	NP_001243264.1|NP_079348.1	Q9H7Z7	PGES2_HUMAN	prostaglandin E synthase 2	318	GST C-terminal.				cell redox homeostasis (GO:0045454)|positive regulation of transcription, DNA-templated (GO:0045893)|prostaglandin biosynthetic process (GO:0001516)|secretion (GO:0046903)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|glutathione binding (GO:0043295)|heme binding (GO:0020037)|lyase activity (GO:0016829)|prostaglandin-E synthase activity (GO:0050220)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(2)	4						GTCCTTGCCCACAGCAGCCAC	0.652																																																0			9											119.0	112.0	114.0					9																	130884693		2203	4300	6503	129924514	SO:0001583	missense	80142			AK024100	CCDS6891.1	9q34.12	2008-05-06	2002-06-13	2002-06-14	ENSG00000148334	ENSG00000148334			17822	protein-coding gene	gene with protein product		608152	"""chromosome 9 open reading frame 15"""	C9orf15		11866447	Standard	NM_025072		Approved	FLJ14038	uc004bti.4	Q9H7Z7	OTTHUMG00000020730	ENST00000338961.6:c.953T>G	9.37:g.130884693A>C	ENSP00000345341:p.Val318Gly	Somatic		Capture	Illumina GAIIx	4	129924514	Q53EW9|Q5SYV6|Q96GI0|Q96GL2	Missense_Mutation	SNP	superfamily_Thiordxn-like_fd,HMMPfam_Glutaredoxin,PatternScan_GLUTAREDOXIN_1,superfamily_GST_C_like,HMMPfam_GST_C	p.V318G	ENST00000338961.6	37	c.953	CCDS6891.1	9	.	.	.	.	.	.	.	.	.	.	A	25.6	4.655729	0.88056	.	.	ENSG00000148334	ENST00000338961;ENST00000277462	T;T	0.47528	0.84;0.84	5.07	5.07	0.68467	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.181621	0.48286	D	0.000186	T	0.64182	0.2575	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.66368	-0.5941	10	0.56958	D	0.05	-0.7539	14.0186	0.64539	1.0:0.0:0.0:0.0	.	318	Q9H7Z7	PGES2_HUMAN	G	318;127	ENSP00000345341:V318G;ENSP00000277462:V127G	ENSP00000277462:V127G	V	-	2	0	PTGES2	129924514	1.000000	0.71417	0.996000	0.52242	0.871000	0.50021	8.637000	0.91014	1.918000	0.55548	0.459000	0.35465	GTG	-	superfamily_GST_C_like,HMMPfam_GST_C		0.652	PTGES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES2	protein_coding	OTTHUMT00000054339.1	A			129924514	-1	no_errors	NM_025072	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
A4GNT	51146	genome.wustl.edu	37	3	137843212	137843212	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr3:137843212G>A	ENST00000236709.3	-	3	1118	c.917C>T	c.(916-918)aCa>aTa	p.T306I		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	306					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						TTCCACCAGTGTGTTGCTTCC	0.532																																																0			3											122.0	129.0	127.0					3																	137843212		2203	4300	6503	139325902	SO:0001583	missense	51146			AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.917C>T	3.37:g.137843212G>A	ENSP00000236709:p.Thr306Ile	Somatic		Capture	Illumina GAIIx	4	139325902	Q0VDK1|Q0VDK2	Missense_Mutation	SNP	HMMPfam_Gly_transf_sug,HMMPfam_Gb3_synth	p.T306I	ENST00000236709.3	37	c.917	CCDS3097.1	3	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829021	0.50845	.	.	ENSG00000118017	ENST00000236709	T	0.72835	-0.69	5.53	4.65	0.58169	Alpha 1,4-glycosyltransferase domain (1);	0.074401	0.56097	D	0.000039	D	0.85410	0.5690	M	0.84683	2.71	0.38093	D	0.937015	D	0.89917	1.0	D	0.78314	0.991	D	0.88742	0.3244	10	0.52906	T	0.07	-21.2296	16.5938	0.84789	0.0:0.1301:0.8699:0.0	.	306	Q9UNA3	A4GCT_HUMAN	I	306	ENSP00000236709:T306I	ENSP00000236709:T306I	T	-	2	0	A4GNT	139325902	0.998000	0.40836	0.911000	0.35937	0.291000	0.27294	3.006000	0.49529	1.307000	0.44944	0.563000	0.77884	ACA	-	HMMPfam_Gb3_synth		0.532	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A4GNT	protein_coding	OTTHUMT00000357557.1	G	NM_016161		139325902	-1	no_errors	NM_016161	genbank	human	reviewed	54_36p	missense	SNP	0.974	A
ZMAT2	153527	genome.wustl.edu	37	5	140080055	140080055	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr5:140080055G>C	ENST00000274712.3	+	1	137	c.10G>C	c.(10-12)Ggc>Cgc	p.G4R		NM_144723.1	NP_653324.1	Q96NC0	ZMAT2_HUMAN	zinc finger, matrin-type 2	4						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(1)|liver(1)|lung(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATGGCGTCGGGCAGCGGGGT	0.547																																																0			5											139.0	145.0	143.0					5																	140080055		2203	4300	6503	140060239	SO:0001583	missense	153527			AK055683	CCDS4239.1	5q31	2012-10-05	2010-09-15		ENSG00000146007	ENSG00000146007		"""Zinc fingers, matrin-type"""	26433	protein-coding gene	gene with protein product						12477932	Standard	NM_144723		Approved	FLJ31121, hSNU23, Snu23	uc003lgy.1	Q96NC0	OTTHUMG00000129503	ENST00000274712.3:c.10G>C	5.37:g.140080055G>C	ENSP00000274712:p.Gly4Arg	Somatic		Capture	Illumina GAIIx	4	140060239		Missense_Mutation	SNP	HMMSmart_SM00451,superfamily_C2H2 and C2HC zinc fingers,PatternScan_ZINC_FINGER_C2H2_1	p.G4R	ENST00000274712.3	37	c.10	CCDS4239.1	5	.	.	.	.	.	.	.	.	.	.	g	17.80	3.478541	0.63849	.	.	ENSG00000146007	ENST00000274712	.	.	.	5.43	4.56	0.56223	.	0.233910	0.44902	D	0.000414	T	0.53206	0.1782	L	0.39898	1.24	0.54753	D	0.999987	B	0.24823	0.112	B	0.25884	0.064	T	0.51568	-0.8689	9	0.39692	T	0.17	-5.7252	13.0385	0.58885	0.0775:0.0:0.9225:0.0	.	4	Q96NC0	ZMAT2_HUMAN	R	4	.	ENSP00000274712:G4R	G	+	1	0	ZMAT2	140060239	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	4.079000	0.57613	1.530000	0.49136	0.650000	0.86243	GGC	-	NULL		0.547	ZMAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT2	protein_coding	OTTHUMT00000468143.1	G	NM_144723		140060239	+1	no_errors	NM_144723	genbank	human	provisional	54_36p	missense	SNP	1.000	C
CACNA1B	774	genome.wustl.edu	37	9	140968008	140968008	+	Silent	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr9:140968008G>A	ENST00000371372.1	+	33	4888	c.4743G>A	c.(4741-4743)caG>caA	p.Q1581Q	CACNA1B_ENST00000371355.4_Silent_p.Q1582Q|CACNA1B_ENST00000277551.2_Silent_p.Q1581Q|CACNA1B_ENST00000371357.1_Silent_p.Q1580Q|CACNA1B_ENST00000371365.2_5'Flank|CACNA1B_ENST00000277549.5_Silent_p.Q775Q|CACNA1B_ENST00000371363.1_Silent_p.Q1579Q	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1581					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TGCTCCGCCAGGGCTACACCA	0.577																																																0			9											74.0	82.0	79.0					9																	140968008		2094	4224	6318	140087829	SO:0001819	synonymous_variant	774			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4743G>A	9.37:g.140968008G>A		Somatic		Capture	Illumina GAIIx	4	140087829	B1AQK5	Silent	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ	p.Q1581	ENST00000371372.1	37	c.4743	CCDS59522.1	9																																																																																			-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.577	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	protein_coding	OTTHUMT00000055380.1	G	NM_000718		140087829	+1	no_errors	NM_000718	genbank	human	validated	54_36p	silent	SNP	1.000	A
PCDHB2	56133	genome.wustl.edu	37	5	140476266	140476266	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr5:140476266T>G	ENST00000194155.4	+	1	2040	c.1892T>G	c.(1891-1893)cTg>cGg	p.L631R		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	631	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCGCCAGGCTGCTGAGGGAG	0.701																																																0			5											43.0	46.0	45.0					5																	140476266		2172	4245	6417	140456450	SO:0001583	missense	56133			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1892T>G	5.37:g.140476266T>G	ENSP00000194155:p.Leu631Arg	Somatic		Capture	Illumina GAIIx	4	140456450	Q4KMU1	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.L631R	ENST00000194155.4	37	c.1892	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	T	11.08	1.532942	0.27387	.	.	ENSG00000112852	ENST00000194155	T	0.47869	0.83	4.29	-5.81	0.02340	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.43010	0.1228	N	0.10837	0.055	0.09310	N	1	D	0.57257	0.979	P	0.61070	0.883	T	0.53585	-0.8418	9	0.54805	T	0.06	.	15.5738	0.76359	0.0:0.6379:0.0:0.3621	.	631	Q9Y5E7	PCDB2_HUMAN	R	631	ENSP00000194155:L631R	ENSP00000194155:L631R	L	+	2	0	PCDHB2	140456450	0.000000	0.05858	0.936000	0.37596	0.913000	0.54294	-2.093000	0.01353	-1.177000	0.02744	-0.451000	0.05528	CTG	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.701	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	protein_coding	OTTHUMT00000251801.2	T	NM_018936		140456450	+1	no_errors	NM_018936	genbank	human	reviewed	54_36p	missense	SNP	0.003	G
PCDHB8	56128	genome.wustl.edu	37	5	140559367	140559367	+	Silent	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr5:140559367C>G	ENST00000239444.2	+	1	1997	c.1752C>G	c.(1750-1752)ggC>ggG	p.G584G	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	584	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGAGCCGGGCTACCTGGTGA	0.701																																																0			5											7.0	14.0	12.0					5																	140559367		1766	3747	5513	140539551	SO:0001819	synonymous_variant	56128			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1752C>G	5.37:g.140559367C>G		Somatic		Capture	Illumina GAIIx	4	140539551	B9EGV1	Silent	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.G584	ENST00000239444.2	37	c.1752	CCDS4250.1	5																																																																																			-	superfamily_Cadherin,HMMPfam_Cadherin		0.701	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	protein_coding	OTTHUMT00000251816.2	C	NM_019120		140539551	+1	no_errors	NM_019120	genbank	human	reviewed	54_36p	silent	SNP	0.983	G
MROH5	389690	genome.wustl.edu	37	8	142477543	142477543	+	RNA	SNP	T	T	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr8:142477543T>C	ENST00000430863.1	-	0	2358					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GTGAGCAGCATCTCGGAGGCT	0.697																																																0			8											29.0	33.0	32.0					8																	142477543		2024	4169	6193	142546725			389690					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142477543T>C		Somatic		Capture	Illumina GAIIx	4	142546725		Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.M760V	ENST00000430863.1	37	c.2278		8																																																																																			-	superfamily_ARM repeat		0.697	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	polymorphic_pseudogene	OTTHUMT00000342412.4	T	NM_207414		142546725	-1	pseudogene	NM_207414	genbank	human	validated	54_36p	missense	SNP	0.208	C
GJA8	2703	genome.wustl.edu	37	1	147380991	147380991	+	Silent	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:147380991G>A	ENST00000369235.1	+	1	909	c.909G>A	c.(907-909)aaG>aaA	p.K303K	GJA8_ENST00000240986.4_Silent_p.K303K			P48165	CXA8_HUMAN	gap junction protein, alpha 8, 50kDa	303					cell-cell signaling (GO:0007267)|lens development in camera-type eye (GO:0002088)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)	37	all_hematologic(923;0.0276)					TCGAGGAGAAGATCAGCACAG	0.587																																					Melanoma(76;1255 1795 8195 52096)											0			1											37.0	36.0	37.0					1																	147380991		2202	4300	6502	145847615	SO:0001819	synonymous_variant	2703			U34802	CCDS30834.1	1q21.1	2008-02-05	2007-01-16		ENSG00000121634	ENSG00000121634		"""Ion channels / Gap junction proteins (connexins)"""	4281	protein-coding gene	gene with protein product	"""connexin 50"""	600897	"""gap junction protein, alpha 8, 50kD (connexin 50)"", ""gap junction protein, alpha 8, 50kDa (connexin 50)"""	CAE1, CZP1, CAE		9497259, 7796604	Standard	NM_005267		Approved	CX50	uc001epu.2	P48165	OTTHUMG00000024085	ENST00000369235.1:c.909G>A	1.37:g.147380991G>A		Somatic		Capture	Illumina GAIIx	4	145847615	A7L5M5|Q5VVN9|Q9NP25	Silent	SNP	HMMPfam_Connexin,HMMSmart_CNX,PatternScan_CONNEXINS_1,HMMPfam_Connexin_CCC,PatternScan_CONNEXINS_2,HMMPfam_Connexin50	p.K303	ENST00000369235.1	37	c.909	CCDS30834.1	1																																																																																			-	HMMPfam_Connexin50		0.587	GJA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA8	protein_coding	OTTHUMT00000060647.1	G	NM_005267		145847615	+1	no_errors	NM_005267	genbank	human	validated	54_36p	silent	SNP	0.912	A
GABRA3	2556	genome.wustl.edu	37	X	151336984	151336984	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chrX:151336984C>T	ENST00000370314.4	-	10	1433	c.1195G>A	c.(1195-1197)Gtg>Atg	p.V399M	GABRA3_ENST00000535043.1_Missense_Mutation_p.V399M|RP11-329E24.6_ENST00000453915.1_RNA	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	399					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	GTGGTCCCCACGATGTTGAAG	0.522																																					NSCLC(142;2578 2613 10251 16743)											0			X											271.0	219.0	237.0					X																	151336984		2203	4300	6503	151087640	SO:0001583	missense	2556				CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.1195G>A	X.37:g.151336984C>T	ENSP00000359337:p.Val399Met	Somatic		Capture	Illumina GAIIx	4	151087640	Q8TAF9	Missense_Mutation	SNP	superfamily_Neur_chan_LBD,HMMPfam_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL,superfamily_Neu_channel_TM,HMMPfam_Neur_chan_memb	p.V399M	ENST00000370314.4	37	c.1195	CCDS14706.1	X	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202606	0.58234	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	D;D;D	0.81821	-1.54;-1.54;-1.54	4.71	4.71	0.59529	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.406771	0.27193	N	0.020492	T	0.74673	0.3747	N	0.08118	0	0.46149	D	0.998891	D	0.64830	0.994	P	0.57009	0.811	T	0.75602	-0.3261	10	0.30078	T	0.28	.	14.4152	0.67145	0.0:1.0:0.0:0.0	.	399	P34903	GBRA3_HUMAN	M	399	ENSP00000359337:V399M;ENSP00000359334:V399M;ENSP00000443527:V399M	ENSP00000359334:V399M	V	-	1	0	GABRA3	151087640	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	7.726000	0.84824	2.069000	0.61940	0.597000	0.82753	GTG	-	superfamily_Neu_channel_TM,HMMPfam_Neur_chan_memb		0.522	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA3	protein_coding	OTTHUMT00000060921.1	C	NM_000808		151087640	-1	no_errors	NM_000808	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PLEKHG1	57480	genome.wustl.edu	37	6	151152186	151152186	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr6:151152186G>C	ENST00000358517.2	+	15	2150	c.1939G>C	c.(1939-1941)Ggg>Cgg	p.G647R	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.G647R			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	647							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GACTCCCTTTGGGTCATCCAT	0.453																																																0			6											48.0	42.0	44.0					6																	151152186		2203	4300	6503	151193879	SO:0001583	missense	57480			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1939G>C	6.37:g.151152186G>C	ENSP00000351318:p.Gly647Arg	Somatic		Capture	Illumina GAIIx	4	151193879	Q5T1F2	Missense_Mutation	SNP	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.G647R	ENST00000358517.2	37	c.1939	CCDS34552.1	6	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241379	0.58995	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.60040	0.22;0.22	5.28	5.28	0.74379	.	0.308856	0.37304	N	0.002143	T	0.63604	0.2525	L	0.60455	1.87	0.47341	D	0.999392	P;D;D	0.59767	0.933;0.986;0.986	P;P;P	0.56398	0.542;0.797;0.797	T	0.67872	-0.5558	10	0.87932	D	0	.	18.9666	0.92698	0.0:0.0:1.0:0.0	.	454;647;647	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	R	647	ENSP00000356297:G647R;ENSP00000351318:G647R	ENSP00000351318:G647R	G	+	1	0	PLEKHG1	151193879	1.000000	0.71417	0.999000	0.59377	0.240000	0.25518	8.784000	0.91818	2.496000	0.84212	0.555000	0.69702	GGG	-	NULL		0.453	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG1	protein_coding	OTTHUMT00000042691.1	G			151193879	+1	no_errors	NM_001029884	genbank	human	provisional	54_36p	missense	SNP	0.995	C
MED12L	116931	genome.wustl.edu	37	3	151102843	151102843	+	Missense_Mutation	SNP	A	A	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr3:151102843A>G	ENST00000474524.1	+	34	4885	c.4847A>G	c.(4846-4848)gAa>gGa	p.E1616G	MED12L_ENST00000273432.4_Missense_Mutation_p.E1476G|P2RY12_ENST00000302632.3_5'Flank	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1616						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AAGCGATCAGAAAGTATTGAC	0.403																																																0			3											113.0	112.0	112.0					3																	151102843		2203	4300	6503	152585533	SO:0001583	missense	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4847A>G	3.37:g.151102843A>G	ENSP00000417235:p.Glu1616Gly	Somatic		Capture	Illumina GAIIx	4	152585533	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	HMMPfam_Med12	p.E1616G	ENST00000474524.1	37	c.4847	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	A	18.24	3.580907	0.65992	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.61510	0.32;0.1	5.63	5.63	0.86233	.	0.052972	0.85682	D	0.000000	T	0.47710	0.1460	N	0.22421	0.69	0.53688	D	0.999976	P;B;P	0.37525	0.486;0.361;0.598	B;B;B	0.38225	0.268;0.244;0.188	T	0.54193	-0.8330	10	0.72032	D	0.01	-26.5968	15.5314	0.75964	1.0:0.0:0.0:0.0	.	1476;1615;1616	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	G	1616;1476	ENSP00000417235:E1616G;ENSP00000273432:E1476G	ENSP00000273432:E1476G	E	+	2	0	MED12L	152585533	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.500000	0.81588	2.145000	0.66743	0.533000	0.62120	GAA	-	NULL		0.403	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	protein_coding	OTTHUMT00000357707.2	A	NM_053002		152585533	+1	no_errors	NM_053002	genbank	human	validated	54_36p	missense	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152671323	152671323	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr6:152671323G>C	ENST00000367255.5	-	72	12482	c.11881C>G	c.(11881-11883)Cag>Gag	p.Q3961E	SYNE1_ENST00000341594.5_Missense_Mutation_p.Q3885E|SYNE1_ENST00000448038.1_Intron|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q3961E|SYNE1_ENST00000423061.1_Intron	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3961					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCCAATTGCTGGGTGATTGTC	0.552										HNSCC(10;0.0054)																																						0			6											111.0	98.0	103.0					6																	152671323		2203	4300	6503	152713016	SO:0001583	missense	23345			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11881C>G	6.37:g.152671323G>C	ENSP00000356224:p.Gln3961Glu	Somatic		Capture	Illumina GAIIx	4	152713016	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,superfamily_Spectrin repeat,HMMSmart_SM00150,HMMPfam_Spectrin,HMMPfam_KASH	p.Q3961E	ENST00000367255.5	37	c.11881	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025928	0.75390	.	.	ENSG00000131018	ENST00000367255;ENST00000265368;ENST00000341594	T;T;T	0.33654	1.4;1.4;1.4	5.93	5.93	0.95920	.	0.000000	0.56097	D	0.000023	T	0.46014	0.1371	M	0.64997	1.995	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.77557	0.99;0.99;0.99	T	0.22695	-1.0209	10	0.07990	T	0.79	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	3961;3961;3961	B7ZBC3;Q8NF91;E7EQI5	.;SYNE1_HUMAN;.	E	3961;3961;3885	ENSP00000356224:Q3961E;ENSP00000265368:Q3961E;ENSP00000341887:Q3885E	ENSP00000265368:Q3961E	Q	-	1	0	SYNE1	152713016	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.447000	0.97595	2.826000	0.97356	0.655000	0.94253	CAG	-	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150		0.552	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	G	NM_182961		152713016	-1	no_errors	NM_182961	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MFAP3	4238	genome.wustl.edu	37	5	153433236	153433236	+	Missense_Mutation	SNP	A	A	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr5:153433236A>C	ENST00000436816.1	+	3	1271	c.1052A>C	c.(1051-1053)aAc>aCc	p.N351T	MFAP3_ENST00000322602.5_Missense_Mutation_p.N351T|MFAP3_ENST00000439768.2_Missense_Mutation_p.N205T	NM_001242336.1|NM_005927.4	NP_001229265.1|NP_005918.1	P55082	MFAP3_HUMAN	microfibrillar-associated protein 3	351					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)	7	Renal(175;0.00488)	Lung NSC(249;0.00145)|all_lung(500;0.00226)|all_neural(177;0.122)|Breast(839;0.14)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;9.69e-06)|GBM - Glioblastoma multiforme(465;0.0201)		TCTAACTGTAACTACAAAGAT	0.423																																																0			5											86.0	85.0	85.0					5																	153433236		2203	4300	6503	153413429	SO:0001583	missense	4238				CCDS4324.1, CCDS47319.1	5q32-q33.2	2013-01-11			ENSG00000037749	ENSG00000037749		"""Immunoglobulin superfamily / I-set domain containing"""	7034	protein-coding gene	gene with protein product		600491				7782085	Standard	NM_005927		Approved		uc010jib.2	P55082	OTTHUMG00000130149	ENST00000436816.1:c.1052A>C	5.37:g.153433236A>C	ENSP00000409933:p.Asn351Thr	Somatic		Capture	Illumina GAIIx	4	153413429	B2RDK0|B4DKA1|Q9NXA7	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig	p.N351T	ENST00000436816.1	37	c.1052	CCDS4324.1	5	.	.	.	.	.	.	.	.	.	.	A	7.866	0.727171	0.15439	.	.	ENSG00000037749	ENST00000439768;ENST00000436816;ENST00000322602	T;T	0.17054	2.3;2.3	5.9	-2.98	0.05513	.	1.032830	0.07636	N	0.929455	T	0.08088	0.0202	N	0.22421	0.69	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.40308	-0.9570	9	.	.	.	-0.0346	0.6411	0.00810	0.1976:0.3054:0.2097:0.2873	.	351	P55082	MFAP3_HUMAN	T	205;351;351	ENSP00000409933:N351T;ENSP00000322956:N351T	.	N	+	2	0	MFAP3	153413429	0.000000	0.05858	0.088000	0.20740	0.764000	0.43329	-0.085000	0.11250	-0.115000	0.11915	0.528000	0.53228	AAC	-	NULL		0.423	MFAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP3	protein_coding	OTTHUMT00000252457.2	A	NM_005927		153413429	+1	no_errors	NM_005927	genbank	human	validated	54_36p	missense	SNP	0.003	C
ITK	3702	genome.wustl.edu	37	5	156659396	156659396	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr5:156659396T>G	ENST00000422843.3	+	8	912	c.760T>G	c.(760-762)Ttg>Gtg	p.L254V	AC010609.1_ENST00000410154.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	254	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	AAAACTTCTTTTGGACACAGT	0.368			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	0			5											60.0	56.0	58.0					5																	156659396		2203	4300	6503	156591974	SO:0001583	missense	3702			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.760T>G	5.37:g.156659396T>G	ENSP00000398655:p.Leu254Val	Somatic		Capture	Illumina GAIIx	4	156591974	B2R752|Q32ML7	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMSmart_SM00107,HMMPfam_BTK,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.L254V	ENST00000422843.3	37	c.760	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	T	12.28	1.890630	0.33348	.	.	ENSG00000113263	ENST00000422843	D	0.89485	-2.52	5.28	1.65	0.23941	Src homology-3 domain (1);SH2 motif (4);	0.229124	0.41712	D	0.000835	D	0.83862	0.5346	L	0.53671	1.685	0.09310	N	1	B	0.30146	0.27	B	0.34931	0.192	T	0.75473	-0.3305	10	0.72032	D	0.01	.	3.5541	0.07858	0.1939:0.2578:0.0:0.5483	.	254	Q08881	ITK_HUMAN	V	254	ENSP00000398655:L254V	ENSP00000398655:L254V	L	+	1	2	ITK	156591974	0.439000	0.25610	0.792000	0.32020	0.724000	0.41520	0.173000	0.16724	0.114000	0.18032	0.460000	0.39030	TTG	-	superfamily_SH3-domain,superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2		0.368	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	protein_coding	OTTHUMT00000252569.2	T			156591974	+1	no_errors	NM_005546	genbank	human	reviewed	54_36p	missense	SNP	0.949	G
SPTA1	6708	genome.wustl.edu	37	1	158655040	158655040	+	Missense_Mutation	SNP	C	C	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:158655040C>T	ENST00000368147.4	-	2	302	c.122G>A	c.(121-123)cGg>cAg	p.R41Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	41			R -> W (in EL2; Tunis). {ECO:0000269|PubMed:2568861}.		actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTCAGCGACCCGCTCCTTGAA	0.493																																																0			1											124.0	124.0	124.0					1																	158655040		1924	4137	6061	156921664	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.122G>A	1.37:g.158655040C>T	ENSP00000357129:p.Arg41Gln	Somatic		Capture	Illumina GAIIx	4	156921664	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_EF-hand,HMMPfam_efhand_Ca_insen	p.R41Q	ENST00000368147.4	37	c.122	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.534835	0.45073	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.34275	1.37;1.37	4.98	-2.08	0.07254	.	1.276770	0.06291	N	0.699140	T	0.08802	0.0218	N	0.16478	0.41	0.35320	D	0.784645	B	0.06786	0.001	B	0.06405	0.002	T	0.37596	-0.9699	10	0.25106	T	0.35	.	10.406	0.44256	0.3303:0.5659:0.0:0.1038	.	41	P02549	SPTA1_HUMAN	Q	41	ENSP00000357130:R41Q;ENSP00000357129:R41Q	ENSP00000357129:R41Q	R	-	2	0	SPTA1	156921664	1.000000	0.71417	0.539000	0.28077	0.969000	0.65631	2.322000	0.43814	-0.154000	0.11118	-0.518000	0.04402	CGG	-	superfamily_Spectrin repeat,HMMPfam_Spectrin		0.493	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	C	NM_003126		156921664	-1	no_errors	NM_003126	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CLCN3	1182	genome.wustl.edu	37	4	170601324	170601324	+	Missense_Mutation	SNP	G	G	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr4:170601324G>A	ENST00000513761.1	+	3	843	c.284G>A	c.(283-285)cGa>cAa	p.R95Q	CLCN3_ENST00000360642.3_Missense_Mutation_p.R95Q|CLCN3_ENST00000347613.4_Missense_Mutation_p.R95Q|CLCN3_ENST00000504131.2_Missense_Mutation_p.R78Q	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	95					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		GATTGGGTGCGAGAAAAATGT	0.323																																																0			4											114.0	111.0	112.0					4																	170601324		2203	4300	6503	170837899	SO:0001583	missense	1182			X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.284G>A	4.37:g.170601324G>A	ENSP00000424603:p.Arg95Gln	Somatic		Capture	Illumina GAIIx	4	170837899	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	superfamily_Cl-channel_core,HMMPfam_Voltage_CLC,HMMPfam_CBS,HMMSmart_CBS,superfamily_SSF54631	p.R95Q	ENST00000513761.1	37	c.284	CCDS34101.1	4	.	.	.	.	.	.	.	.	.	.	G	31	5.093304	0.94149	.	.	ENSG00000109572	ENST00000511092;ENST00000513761;ENST00000347613;ENST00000360642;ENST00000512813;ENST00000538301;ENST00000504131;ENST00000507875	T;D;D;D;T;D;D	0.92099	0.73;-2.97;-2.97;-2.97;0.73;-2.97;-2.97	4.87	4.0	0.46444	.	0.278487	0.35124	N	0.003422	D	0.91955	0.7452	N	0.20445	0.575	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.989;0.996;0.978;0.997	D;P;P;P;D	0.67900	0.954;0.641;0.814;0.657;0.912	D	0.92764	0.6226	10	0.66056	D	0.02	-3.2662	14.9369	0.70964	0.0:0.1439:0.856:0.0	.	95;78;68;95;95	B7Z932;B9EGJ9;E9PE15;P51790;P51790-2	.;.;.;CLCN3_HUMAN;.	Q	95;95;95;95;95;95;78;68	ENSP00000425160:R95Q;ENSP00000424603:R95Q;ENSP00000261514:R95Q;ENSP00000353857:R95Q;ENSP00000425823:R95Q;ENSP00000424540:R78Q;ENSP00000425323:R68Q	ENSP00000261514:R95Q	R	+	2	0	CLCN3	170837899	1.000000	0.71417	0.599000	0.28851	0.991000	0.79684	7.662000	0.83803	0.994000	0.38892	0.462000	0.41574	CGA	-	NULL		0.323	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLCN3	protein_coding	OTTHUMT00000363210.2	G			170837899	+1	no_errors	NM_173872	genbank	human	validated	54_36p	missense	SNP	0.992	A
TTN	7273	genome.wustl.edu	37	2	179495042	179495042	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr2:179495042C>G	ENST00000591111.1	-	189	39508	c.39284G>C	c.(39283-39285)tGt>tCt	p.C13095S	TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.C5671S|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.C5796S|TTN_ENST00000589042.1_Missense_Mutation_p.C14736S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.C5863S|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.C12168S|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13095					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCCAGGCGACAGTTGTGCAA	0.398																																																0			2											77.0	82.0	81.0					2																	179495042		1853	4076	5929	179203287	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.39284G>C	2.37:g.179495042C>G	ENSP00000465570:p.Cys13095Ser	Somatic		Capture	Illumina GAIIx	4	179203287	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_IG_MHC,HMMSmart_SM00406,HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_fn3,HMMSmart_SM00060,HMMPfam_PPAK,PatternScan_PROTEIN_KINASE_TYR,superfamily_Fibronectin type III,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Protein kinase-like (PK-like),superfamily_WD40 repeat-like,HMMPfam_I-set,HMMPfam_ig,HMMPfam_Titin_Z,HMMPfam_Pkinase,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses	p.C10718S	ENST00000591111.1	37	c.32153		2	.	.	.	.	.	.	.	.	.	.	C	13.89	2.370788	0.42003	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	6.04	6.04	0.98038	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.33089	0.0851	L	0.60455	1.87	0.33601	D	0.602381	P;P;P;P	0.42827	0.791;0.791;0.791;0.791	B;B;B;B	0.32677	0.15;0.15;0.15;0.15	T	0.56275	-0.8006	9	0.87932	D	0	.	13.458	0.61210	0.2559:0.7441:0.0:0.0	.	5671;5796;5863;13095	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	12168;5671;5863;5796;5671	ENSP00000343764:C12168S;ENSP00000434586:C5671S;ENSP00000340554:C5863S;ENSP00000352154:C5796S	ENSP00000340554:C5863S	C	-	2	0	TTN	179203287	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.294000	0.59043	2.873000	0.98535	0.563000	0.77884	TGT	-	HMMSmart_SM00409,superfamily_Concanavalin A-like lectins/glucanases,superfamily_WD40 repeat-like,HMMPfam_I-set,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179203287	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	0.997	G
TTN	7273	genome.wustl.edu	37	2	179581915	179581915	+	Missense_Mutation	SNP	G	G	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr2:179581915G>T	ENST00000591111.1	-	86	24819	c.24595C>A	c.(24595-24597)Ctc>Atc	p.L8199I	TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.L8516I|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L7272I			Q8WZ42	TITIN_HUMAN	titin	12383	Ig-like 64.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTACTTTGAGAACTGTCAGA	0.483																																																0			2											66.0	67.0	66.0					2																	179581915		1919	4126	6045	179290160	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.24595C>A	2.37:g.179581915G>T	ENSP00000465570:p.Leu8199Ile	Somatic		Capture	Illumina GAIIx	4	179290160	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_IG_MHC,HMMSmart_SM00406,HMMSmart_SM00408,HMMSmart_SM00409,HMMPfam_fn3,HMMSmart_SM00060,HMMPfam_PPAK,PatternScan_PROTEIN_KINASE_TYR,superfamily_Fibronectin type III,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Protein kinase-like (PK-like),superfamily_WD40 repeat-like,HMMPfam_I-set,HMMPfam_ig,HMMPfam_Titin_Z,HMMPfam_Pkinase,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses	p.L7272I	ENST00000591111.1	37	c.21814		2	.	.	.	.	.	.	.	.	.	.	G	14.55	2.570279	0.45798	.	.	ENSG00000155657	ENST00000342992	T	0.67523	-0.27	5.52	5.52	0.82312	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77003	0.4067	L	0.49640	1.575	0.80722	D	1	P	0.49447	0.924	P	0.58454	0.839	T	0.77970	-0.2387	9	0.87932	D	0	.	19.8125	0.96553	0.0:0.0:1.0:0.0	.	8199	Q8WZ42	TITIN_HUMAN	I	7272	ENSP00000343764:L7272I	ENSP00000343764:L7272I	L	-	1	0	TTN	179290160	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.660000	0.74417	2.745000	0.94114	0.655000	0.94253	CTC	-	HMMSmart_SM00406,HMMSmart_SM00408,HMMSmart_SM00409,superfamily_Concanavalin A-like lectins/glucanases,superfamily_WD40 repeat-like,HMMPfam_I-set,superfamily_Immunoglobulin,superfamily_vWA-like,superfamily_Positive stranded ssRNA viruses		0.483	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179290160	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	1.000	T
ZNF804A	91752	genome.wustl.edu	37	2	185800771	185800771	+	Missense_Mutation	SNP	T	T	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr2:185800771T>G	ENST00000302277.6	+	4	1242	c.648T>G	c.(646-648)ttT>ttG	p.F216L		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	216							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GCTTTTCTTTTGCATTTCCAA	0.423																																																0			2											66.0	67.0	66.0					2																	185800771		2203	4300	6503	185509016	SO:0001583	missense	91752			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.648T>G	2.37:g.185800771T>G	ENSP00000303252:p.Phe216Leu	Somatic		Capture	Illumina GAIIx	4	185509016	A7E253|Q6ZN26	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.F216L	ENST00000302277.6	37	c.648	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	T	20.9	4.067710	0.76301	.	.	ENSG00000170396	ENST00000302277	T	0.40756	1.02	5.32	4.16	0.48862	.	0.000000	0.56097	D	0.000027	T	0.62804	0.2458	M	0.78456	2.415	0.42510	D	0.99296	D	0.89917	1.0	D	0.83275	0.996	T	0.65664	-0.6113	10	0.87932	D	0	-18.1002	10.3046	0.43672	0.0:0.0779:0.0:0.9221	.	216	Q7Z570	Z804A_HUMAN	L	216	ENSP00000303252:F216L	ENSP00000303252:F216L	F	+	3	2	ZNF804A	185509016	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.547000	0.53663	0.862000	0.35528	0.383000	0.25322	TTT	-	NULL		0.423	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	protein_coding	OTTHUMT00000255871.1	T	NM_194250		185509016	+1	no_errors	NM_194250	genbank	human	provisional	54_36p	missense	SNP	1.000	G
WDR75	84128	genome.wustl.edu	37	2	190327258	190327258	+	Missense_Mutation	SNP	G	G	A	rs148423434		TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr2:190327258G>A	ENST00000314761.4	+	9	887	c.827G>A	c.(826-828)cGc>cAc	p.R276H		NM_032168.1	NP_115544.1	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	276						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			GTAGAGTGGCGCGATGCAACA	0.448																																																0			2						G	HIS/ARG	0,4406		0,0,2203	152.0	154.0	153.0		827	5.2	1.0	2	dbSNP_134	153	1,8599	1.2+/-3.3	0,1,4299	no	missense	WDR75	NM_032168.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	276/831	190327258	1,13005	2203	4300	6503	190035503	SO:0001583	missense	84128			AK091546	CCDS2298.1	2q32.2	2013-01-09			ENSG00000115368	ENSG00000115368		"""WD repeat domain containing"""	25725	protein-coding gene	gene with protein product	"""UTP17, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_032168		Approved	FLJ12519, NET16, UTP17	uc002uql.1	Q8IWA0	OTTHUMG00000132660	ENST00000314761.4:c.827G>A	2.37:g.190327258G>A	ENSP00000314193:p.Arg276His	Somatic		Capture	Illumina GAIIx	4	190035503	Q96J10|Q9H8U8|Q9H9U5|Q9H9V8|Q9UIX2	Missense_Mutation	SNP	PatternScan_WD_REPEATS_1,HMMSmart_WD40,superfamily_WD40_like,HMMPfam_WD40	p.R276H	ENST00000314761.4	37	c.827	CCDS2298.1	2	.	.	.	.	.	.	.	.	.	.	G	10.16	1.273158	0.23221	0.0	1.16E-4	ENSG00000115368	ENST00000314761	T	0.04654	3.58	5.24	5.24	0.73138	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.268005	0.39615	N	0.001318	T	0.02888	0.0086	N	0.11427	0.14	0.34402	D	0.695368	B;B	0.24721	0.11;0.11	B;B	0.17722	0.013;0.019	T	0.34601	-0.9822	10	0.44086	T	0.13	-15.4448	8.4812	0.33043	0.0861:0.1579:0.756:0.0	.	276;276	A8K330;Q8IWA0	.;WDR75_HUMAN	H	276	ENSP00000314193:R276H	ENSP00000314193:R276H	R	+	2	0	WDR75	190035503	0.997000	0.39634	0.962000	0.40283	0.122000	0.20287	2.590000	0.46154	2.723000	0.93209	0.655000	0.94253	CGC	-	superfamily_WD40_like,HMMSmart_WD40		0.448	WDR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR75	protein_coding	OTTHUMT00000255913.1	G	NM_032168		190035503	+1	no_errors	NM_032168	genbank	human	provisional	54_36p	missense	SNP	0.754	A
PPP1R15B	84919	genome.wustl.edu	37	1	204378710	204378710	+	Missense_Mutation	SNP	C	C	G			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:204378710C>G	ENST00000367188.4	-	1	2209	c.1830G>C	c.(1828-1830)caG>caC	p.Q610H	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	610					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TCCCCAACAGCTGCACCTTAC	0.463																																																0			1											69.0	68.0	68.0					1																	204378710		2203	4300	6503	202645333	SO:0001583	missense	84919			AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1830G>C	1.37:g.204378710C>G	ENSP00000356156:p.Gln610His	Somatic		Capture	Illumina GAIIx	4	202645333	Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	HMMPfam_CReP_N,HMMPfam_PP1c_bdg	p.Q610H	ENST00000367188.4	37	c.1830	CCDS1445.1	1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.458071	0.26161	.	.	ENSG00000158615	ENST00000367188;ENST00000543650	T	0.24538	1.85	5.04	-3.63	0.04529	Protein phosphatase 1, regulatory subunit 15A/B, C-terminal (1);	0.698726	0.14303	N	0.328139	T	0.21962	0.0529	L	0.45581	1.43	0.09310	N	1	P	0.40144	0.704	B	0.42462	0.388	T	0.15206	-1.0445	10	0.44086	T	0.13	-0.806	9.7903	0.40702	0.1381:0.6542:0.0:0.2077	.	610	Q5SWA1	PR15B_HUMAN	H	610;520	ENSP00000356156:Q610H	ENSP00000356156:Q610H	Q	-	3	2	PPP1R15B	202645333	0.000000	0.05858	0.001000	0.08648	0.778000	0.44026	-1.244000	0.02902	-0.645000	0.05458	-0.302000	0.09304	CAG	-	HMMPfam_PP1c_bdg		0.463	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15B	protein_coding	OTTHUMT00000087974.1	C	NM_032833		202645333	-1	no_errors	NM_032833	genbank	human	validated	54_36p	missense	SNP	0.302	G
OPN3	23596	genome.wustl.edu	37	1	241761112	241761112	+	Missense_Mutation	SNP	G	G	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr1:241761112G>C	ENST00000366554.2	-	3	987	c.881C>G	c.(880-882)tCg>tGg	p.S294W	OPN3_ENST00000469376.1_5'UTR|OPN3_ENST00000331838.5_Missense_Mutation_p.S215W	NM_014322.2	NP_055137.2	Q9H1Y3	OPN3_HUMAN	opsin 3	294					detection of light stimulus (GO:0009583)|detection of visible light (GO:0009584)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(5)|lung(5)	11	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			AAAGAGGTACGAAACAATAGA	0.398																																																0			1											159.0	147.0	151.0					1																	241761112		2203	4300	6503	239827735	SO:0001583	missense	23596			AF140242	CCDS31072.1	1q43	2014-06-13	2008-04-16		ENSG00000054277	ENSG00000054277		"""GPCR / Class A : Opsin receptors"""	14007	protein-coding gene	gene with protein product	"""panopsin"", ""protein phosphatase 1, regulatory subunit 116"""	606695	"""encephalopsin"""	ECPN		10234000, 11401433	Standard	NM_014322		Approved	ERO, NMO-1, encephalopsin, PPP1R116	uc001hza.3	Q9H1Y3	OTTHUMG00000039691	ENST00000366554.2:c.881C>G	1.37:g.241761112G>C	ENSP00000355512:p.Ser294Trp	Somatic		Capture	Illumina GAIIx	4	239827735	Q8IX08|Q9Y344	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,PatternScan_OPSIN	p.S294W	ENST00000366554.2	37	c.881	CCDS31072.1	1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.688207	0.48097	.	.	ENSG00000054277	ENST00000366554;ENST00000331838	T;T	0.72835	-0.69;-0.69	4.49	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.150622	0.45126	D	0.000396	T	0.78978	0.4369	L	0.43152	1.355	0.80722	D	1	D	0.69078	0.997	D	0.69654	0.965	T	0.81955	-0.0696	10	0.87932	D	0	.	17.1598	0.86801	0.0:0.0:1.0:0.0	.	294	Q9H1Y3	OPN3_HUMAN	W	294;215	ENSP00000355512:S294W;ENSP00000328018:S215W	ENSP00000328018:S215W	S	-	2	0	OPN3	239827735	1.000000	0.71417	0.760000	0.31359	0.027000	0.11550	5.778000	0.68940	2.210000	0.71456	0.655000	0.94253	TCG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_OPSIN		0.398	OPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN3	protein_coding	OTTHUMT00000095713.1	G	NM_014322		239827735	-1	no_errors	NM_014322	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RNF151	146310	genome.wustl.edu	37	16	2018849	2018850	+	Frame_Shift_Ins	INS	-	-	C			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr16:2018849_2018850insC	ENST00000569714.1	+	4	669_670	c.661_662insC	c.(661-663)gagfs	p.E221fs	RNF151_ENST00000321392.3_Frame_Shift_Ins_p.E220fs|RNF151_ENST00000569210.2_3'UTR	NM_174903.4	NP_777563.2	Q2KHN1	RN151_HUMAN	ring finger protein 151	221					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|lung(1)	2						CCCACAGGAGGAGGCCGAGGCT	0.619																																																0			16																																								1958851	SO:0001589	frameshift_variant	146310			BC029501	CCDS58405.1	16p13.3	2013-01-09			ENSG00000179580	ENSG00000179580		"""RING-type (C3HC4) zinc fingers"""	23235	protein-coding gene	gene with protein product						12477932	Standard	NM_174903		Approved		uc002cnt.1	Q2KHN1	OTTHUMG00000176852	Exception_encountered	16.37:g.2018849_2018850insC	ENSP00000456566:p.Glu221fs	Somatic		Capture	Illumina GAIIx	4	1958850	Q8NHS5	Frame_Shift_Ins	INS	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,superfamily_Traf_like	p.E221fs	ENST00000569714.1	37	c.661_662	CCDS58405.1	16																																																																																			-	NULL		0.619	RNF151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF151	protein_coding	OTTHUMT00000434030.1	-	NM_174903		1958851	+1	no_errors	NM_174903	genbank	human	provisional	54_36p	frame_shift_ins	INS	0.849:0.822	C
SMG1	23049	genome.wustl.edu	37	16	18875078	18875100	+	Frame_Shift_Del	DEL	TTGAGATGTAGCACTCACATGCT	TTGAGATGTAGCACTCACATGCT	-	rs560105140	byFrequency	TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	TTGAGATGTAGCACTCACATGCT	TTGAGATGTAGCACTCACATGCT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr16:18875078_18875100delTTGAGATGTAGCACTCACATGCT	ENST00000446231.2	-	25	3979_4001	c.3567_3589delAGCATGTGAGTGCTACATCTCAA	c.(3565-3591)aaagcatgtgagtgctacatctcaattfs	p.KACECYISI1189fs	SMG1_ENST00000389467.3_Frame_Shift_Del_p.KACECYISI1189fs			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1189	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CAATCGGCAATTGAGATGTAGCACTCACATGCTTTATTTCCTA	0.408																																																0			16																																								18782601	SO:0001589	frameshift_variant	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.3567_3589delAGCATGTGAGTGCTACATCTCAA	16.37:g.18875078_18875100delTTGAGATGTAGCACTCACATGCT	ENSP00000402515:p.Lys1189fs	Somatic		Capture	Illumina GAIIx	4	18782579	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Frame_Shift_Del	DEL	superfamily_ARM repeat,HMMPfam_HEAT,superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,PatternScan_PI3_4_KINASE_2,HMMPfam_FATC	p.K1189fs	ENST00000446231.2	37	c.3589_3567	CCDS45430.1	16																																																																																			(deletion:cds_exon[18782473,18782674])	superfamily_ARM repeat		0.408	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	protein_coding	OTTHUMT00000391817.1	TTGAGATGTAGCACTCACATGCT	NM_015092		18782601	-1	no_errors	NM_015092	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.817:0.588:0.993:0.994:0.987:0.999:1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.996:0.921:1.000:1.000:0.998	-
MED15	51586	genome.wustl.edu	37	22	20920813	20920814	+	In_Frame_Ins	INS	-	-	CAG	rs67182670|rs361923|rs535773989|rs539945336	byFrequency	TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr22:20920813_20920814insCAG	ENST00000263205.7	+	7	819_820	c.750_751insCAG	c.(751-753)cag>CAGcag	p.251_251Q>QQ	MED15_ENST00000541476.1_In_Frame_Ins_p.225_225Q>QQ|MED15_ENST00000425759.2_In_Frame_Ins_p.140_140Q>QQ|MED15_ENST00000382974.2_In_Frame_Ins_p.180_180Q>QQ|MED15_ENST00000406969.1_In_Frame_Ins_p.225_225Q>QQ|MED15_ENST00000292733.7_In_Frame_Ins_p.251_251Q>QQ|MED15_ENST00000478831.1_3'UTR|MED15_ENST00000542773.1_In_Frame_Ins_p.56_56Q>QQ	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	251	Poly-Gln.			Missing (in Ref. 3; BAB85034). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q250_Q251insQ(4)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			aacaacagcaacagcagcagca	0.589																																																4	Insertion - In frame(4)	ovary(2)|large_intestine(2)	22																																								19250814	SO:0001652	inframe_insertion	51586			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.784_786dupCAG	22.37:g.20920820_20920822dupCAG	ENSP00000263205:p.Gln262dup	Somatic		Capture	Illumina GAIIx	4	19250813	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	In_Frame_Ins	INS	HMMPfam_ARC105_Med_act	p.254in_frame_insQ	ENST00000263205.7	37	c.750_751	CCDS33602.1	22																																																																																			-	NULL		0.589	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	protein_coding	OTTHUMT00000320177.2	-	NM_015889		19250814	+1	no_errors	NM_001003891	genbank	human	reviewed	54_36p	in_frame_ins	INS	0.997:0.998	CAG
RPL14	9045	genome.wustl.edu	37	3	40503520	40503521	+	In_Frame_Ins	INS	-	-	CTGCTG	rs370958149|rs369485042|rs200018880|rs147295890|rs57354599|rs111899316	byFrequency	TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr3:40503520_40503521insCTGCTG	ENST00000396203.2	+	6	577_578	c.445_446insCTGCTG	c.(445-447)act>aCTGCTGct	p.159_160insAA	RPL14_ENST00000338970.6_In_Frame_Ins_p.159_160insAA|RPL14_ENST00000416518.1_3'UTR	NM_001034996.2	NP_001030168.1	P50914	RL14_HUMAN	ribosomal protein L14	159			A -> AA.|A -> AAA.|A -> AAAA.|A -> AAAAA.|A -> AAAAAA. {ECO:0000269|PubMed:11875025, ECO:0000269|PubMed:9480843, ECO:0000269|Ref.5}.|A -> AAAAAAAA.|Missing. {ECO:0000269|PubMed:8549859, ECO:0000269|Ref.10}.		cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)								KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TACTAAGGGTActgctgctgct	0.47														358	0.0714856	0.0333	0.0821	5008	,	,		14209	0.1131		0.0328	False		,,,				2504	0.1125															0			3																																								40478525	SO:0001652	inframe_insertion	9045			D87735	CCDS33739.1, CCDS43070.1	3p22-p21.2	2008-07-18			ENSG00000188846	ENSG00000188846		"""L ribosomal proteins"""	10305	protein-coding gene	gene with protein product	"""CAG-ISL 7"", ""60S ribosomal protein L14"""					9480843	Standard	NM_003973		Approved	L14, hRL14, RL14, CTG-B33	uc003ckg.4	P50914	OTTHUMG00000156046	ENST00000396203.2:c.470_475dupCTGCTG	3.37:g.40503521_40503526dupCTGCTG	ENSP00000379506:p.Ala158_Ala159dup	Somatic		Capture	Illumina GAIIx	4	40478524	Q45RF0|Q53G20|Q8TBD5|Q8WUT0|Q92579|Q96GR0|Q9BSB8|Q9BW65|Q9BYF6	In_Frame_Ins	INS	HMMPfam_Ribosomal_L14e	p.153in_frame_insAA	ENST00000396203.2	37	c.445_446	CCDS43070.1	3																																																																																			-	NULL		0.470	RPL14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL14	protein_coding	OTTHUMT00000342889.2	-	NM_003973		40478525	+1	no_errors	NM_001034996	genbank	human	reviewed	54_36p	in_frame_ins	INS	0.360:0.270	CTGCTG
RP11-866E20.3	0	genome.wustl.edu	37	18	57683905	57683913	+	lincRNA	DEL	AAAAAAAAA	AAAAAAAAA	-	rs556690739|rs58027961|rs71177091|rs61119951	byFrequency	TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	AAAAAAAAA	AAAAAAAAA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr18:57683905_57683913delAAAAAAAAA	ENST00000585691.1	+	0	3524				RNU6-567P_ENST00000516746.1_RNA																							actccgtctcaaaaaaaaaaaaaaaaaaa	0.416																																																0			18																																								55834893			728115																															18.37:g.57683914_57683922delAAAAAAAAA		Somatic		Capture	Illumina GAIIx	4	55834885		RNA	DEL	-	NULL	ENST00000585691.1	37	NULL		18																																																																																			(deletion:rna[55832836,55835854])	-		0.416	RP11-866E20.3-001	KNOWN	basic	lincRNA	LOC728115	lincRNA	OTTHUMT00000449078.1	AAAAAAAAA			55834893	-1	pseudogene	XR_038858	genbank	human	model	54_36p	rna	DEL	0.023:0.025:0.028:0.029:0.031:0.032:0.033:0.033:0.033	-
CTTNBP2	83992	genome.wustl.edu	37	7	117431847	117431848	+	Frame_Shift_Ins	INS	-	-	T			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr7:117431847_117431848insT	ENST00000160373.3	-	4	1493_1494	c.1402_1403insA	c.(1402-1404)agtfs	p.S468fs	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	468	Pro-rich.				brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TGACGGAGGACTTTGGGTAGTA	0.47																																																0			7																																								117219084	SO:0001589	frameshift_variant	83992				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1403dupA	7.37:g.117431850_117431850dupT	ENSP00000160373:p.Ser468fs	Somatic		Capture	Illumina GAIIx	4	117219083	O43389|Q7LG11|Q9C0A5	Frame_Shift_Ins	INS	HMMPfam_CortBP2,superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.S468fs	ENST00000160373.3	37	c.1403_1402	CCDS5774.1	7																																																																																			-	HMMPfam_CortBP2		0.470	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	protein_coding	OTTHUMT00000059201.4	-	NM_033427		117219084	-1	no_errors	NM_033427	genbank	human	reviewed	54_36p	frame_shift_ins	INS	1.000:1.000	T
CNTNAP5	129684	genome.wustl.edu	37	2	125232356	125232356	+	Frame_Shift_Del	DEL	C	C	-			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr2:125232356delC	ENST00000431078.1	+	7	1323	c.959delC	c.(958-960)accfs	p.T320fs		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	320	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.T320I(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AAACCTGGGACCTTTTTAAAG	0.368																																																1	Substitution - Missense(1)	ovary(1)	2											46.0	42.0	43.0					2																	125232356		1808	4073	5881	124948826	SO:0001589	frameshift_variant	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.959delC	2.37:g.125232356delC	ENSP00000399013:p.Thr320fs	Somatic		Capture	Illumina GAIIx	4	124948826	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Frame_Shift_Del	DEL	PatternScan_FA58C_1,PatternScan_FIBRIN_AG_C_DOMAIN,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_FA58C,superfamily_Gal_bind_like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_2,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMSmart_EGF,HMMPfam_EGF,superfamily_Fibrinogen_a/b/g_C	p.L322fs	ENST00000431078.1	37	c.959	CCDS46401.1	2																																																																																			(deletion:cds_exon[124948786,124948926])	superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2		0.368	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	C			124948826	+1	no_errors	NM_130773	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000	-
LARP1	23367	genome.wustl.edu	37	5	154172335	154172336	+	Frame_Shift_Ins	INS	-	-	A			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr5:154172335_154172336insA	ENST00000336314.4	+	4	511_512	c.487_488insA	c.(487-489)cgafs	p.R163fs		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	240					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GGATTGCCAGCGAGGCGGGCAG	0.515																																																0			5																																								154152529	SO:0001589	frameshift_variant	23367			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	Exception_encountered	5.37:g.154172335_154172336insA	ENSP00000336721:p.Arg163fs	Somatic		Capture	Illumina GAIIx	4	154152528	O94836|Q8N4M2|Q8NB73|Q9UFD7	Frame_Shift_Ins	INS	"superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00715,HMMPfam_La,PatternScan_CYTOCHROME_B5_1,HMMSmart_SM00684"	p.R240fs	ENST00000336314.4	37	c.718_719	CCDS4328.1	5																																																																																			-	NULL		0.515	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	protein_coding	OTTHUMT00000252509.1	-	NM_033551		154152529	+1	no_errors	NM_033551	genbank	human	validated	54_36p	frame_shift_ins	INS	0.999:0.986	A
TIAM2	26230	genome.wustl.edu	37	6	155578171	155578171	+	Frame_Shift_Del	DEL	A	A	-			TCGA-30-1718-01A-01W-0633-09	TCGA-30-1718-10A-01W-0633-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	12be6c2a-d39a-405a-ba8e-9c22bc759202	637618e3-c2a3-416b-82c1-a86b025e8bff	g.chr6:155578171delA	ENST00000461783.3	+	29	6295	c.5022delA	c.(5020-5022)ctafs	p.L1674fs	TIAM2_ENST00000360366.4_Frame_Shift_Del_p.L1698fs|TIAM2_ENST00000528391.2_Frame_Shift_Del_p.L1018fs|TIAM2_ENST00000367174.2_Frame_Shift_Del_p.L1050fs|TIAM2_ENST00000456877.2_Frame_Shift_Del_p.L986fs|RP11-477D19.2_ENST00000435295.1_RNA|TIAM2_ENST00000456144.1_Frame_Shift_Del_p.L1703fs|TIAM2_ENST00000529824.2_Frame_Shift_Del_p.L1703fs|TIAM2_ENST00000318981.5_Frame_Shift_Del_p.L1674fs|TIAM2_ENST00000275246.7_Frame_Shift_Del_p.L599fs			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1674					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		ATTCTGTTCTAGAGCGAGAAT	0.453																																																0			6											79.0	78.0	78.0					6																	155578171		2203	4300	6503	155619863	SO:0001589	frameshift_variant	26230				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.5022delA	6.37:g.155578171delA	ENSP00000437188:p.Leu1674fs	Somatic		Capture	Illumina GAIIx	4	155619863	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Frame_Shift_Del	DEL	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,HMMSmart_SM00455,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,PatternScan_DH_1	p.E1675fs	ENST00000461783.3	37	c.5022	CCDS34558.1	6																																																																																			(deletion:cds_exon[155619310,155619947])	NULL		0.453	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	protein_coding	OTTHUMT00000387980.2	A	NM_012454		155619863	+1	no_errors	NM_012454	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.821	-
