#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
RPH3AL	9501	genome.wustl.edu	37	17	177350	177350	+	5'UTR	SNP	G	G	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr17:177350G>C	ENST00000331302.7	-	0	292				RPH3AL_ENST00000536489.2_5'UTR|RPH3AL_ENST00000323434.8_5'UTR	NM_001190411.1|NM_006987.3	NP_001177340.1|NP_008918.1	Q9UNE2	RPH3L_HUMAN	rabphilin 3A-like (without C2 domains)						exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of protein secretion (GO:0050714)|regulation of calcium ion-dependent exocytosis (GO:0017158)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|secretory granule membrane (GO:0030667)	cytoskeletal protein binding (GO:0008092)|metal ion binding (GO:0046872)			NS(2)|breast(1)|kidney(1)|large_intestine(1)|skin(1)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)		GGAGCACCCGGCTGGGGGTGG	0.592																																																0			17											40.0	35.0	37.0					17																	177350		2203	4300	6503	177350	SO:0001623	5_prime_UTR_variant	729034				CCDS10994.1, CCDS54059.1	17p13.3	2014-07-02			ENSG00000181031	ENSG00000181031		"""Synaptotagmins"""	10296	protein-coding gene	gene with protein product		604881				10395805	Standard	NM_006987		Approved	Noc2	uc021tmx.1	Q9UNE2	OTTHUMG00000090273	ENST00000331302.7:c.-16C>G	17.37:g.177350G>C		Somatic		Capture	Illumina GAIIx	4	177350	D3DTG7|Q9BSB3	Missense_Mutation	SNP	NULL	p.A440P	ENST00000331302.7	37	c.1318	CCDS10994.1	17																																																																																			-	NULL		0.592	RPH3AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729034	protein_coding	OTTHUMT00000206597.2	G	NM_006987		177350	+1	no_start_codon:pseudogene:no_stop_codon	XM_001129120	genbank	human	model	54_36p	missense	SNP	0.321	C
COLEC12	81035	genome.wustl.edu	37	18	335101	335101	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr18:335101G>T	ENST00000400256.3	-	6	1664	c.1457C>A	c.(1456-1458)cCa>cAa	p.P486Q		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	486	Collagen-like 2.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				TGGTCCAATTGGGCCTCTCTC	0.667																																																0			18											32.0	34.0	34.0					18																	335101		2195	4286	6481	325101	SO:0001583	missense	81035			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1457C>A	18.37:g.335101G>T	ENSP00000383115:p.Pro486Gln	Somatic		Capture	Illumina GAIIx	4	325101	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	HMMPfam_Collagen,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1	p.P486Q	ENST00000400256.3	37	c.1457	CCDS32782.1	18	.	.	.	.	.	.	.	.	.	.	G	9.953	1.220581	0.22457	.	.	ENSG00000158270	ENST00000400256	T	0.12039	2.72	5.67	5.67	0.87782	.	0.265505	0.43416	D	0.000572	T	0.21674	0.0522	L	0.52823	1.66	0.41125	D	0.985847	P	0.36789	0.57	B	0.42214	0.38	T	0.01156	-1.1434	10	0.27082	T	0.32	-3.9531	19.7698	0.96359	0.0:0.0:1.0:0.0	.	486	Q5KU26	COL12_HUMAN	Q	486	ENSP00000383115:P486Q	ENSP00000383115:P486Q	P	-	2	0	COLEC12	325101	0.997000	0.39634	0.943000	0.38184	0.057000	0.15508	3.141000	0.50593	2.659000	0.90383	0.655000	0.94253	CCA	-	NULL		0.667	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	protein_coding	OTTHUMT00000440746.1	G			325101	-1	no_errors	NM_130386	genbank	human	validated	54_36p	missense	SNP	0.935	T
GEMIN4	50628	genome.wustl.edu	37	17	650310	650310	+	Missense_Mutation	SNP	G	G	A	rs559242583	byFrequency	TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr17:650310G>A	ENST00000319004.5	-	2	1091	c.973C>T	c.(973-975)Cgg>Tgg	p.R325W	GEMIN4_ENST00000437269.1_3'UTR|GEMIN4_ENST00000576778.1_Missense_Mutation_p.R314W	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	325					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		CCCCACTCCCGCAGCAGGTGG	0.617													G|||	44	0.00878594	0.0	0.0	5008	,	,		20355	0.0		0.001	False		,,,				2504	0.044															0			17											55.0	62.0	60.0					17																	650310		2088	4207	6295	597060	SO:0001583	missense	50628			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.973C>T	17.37:g.650310G>A	ENSP00000321706:p.Arg325Trp	Somatic		Capture	Illumina GAIIx	4	597060	Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	NULL	p.R325W	ENST00000319004.5	37	c.973	CCDS45559.1	17	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592411	0.46214	.	.	ENSG00000179409	ENST00000319004	T	0.15603	2.41	5.54	2.18	0.27775	.	1.033190	0.07576	N	0.919412	T	0.20333	0.0489	L	0.43152	1.355	0.40357	D	0.979198	D	0.65815	0.995	P	0.46825	0.528	T	0.10753	-1.0616	10	0.49607	T	0.09	-8.5306	9.4904	0.38955	0.0749:0.4192:0.5059:0.0	.	325	P57678	GEMI4_HUMAN	W	325	ENSP00000321706:R325W	ENSP00000321706:R325W	R	-	1	2	GEMIN4	597060	0.785000	0.28726	0.962000	0.40283	0.658000	0.38924	1.206000	0.32321	0.649000	0.30751	-0.257000	0.10917	CGG	-	NULL		0.617	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	protein_coding	OTTHUMT00000437181.1	G	NM_015721		597060	-1	no_errors	NM_015721	genbank	human	reviewed	54_36p	missense	SNP	0.107	A
NARFL	64428	genome.wustl.edu	37	16	780487	780487	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr16:780487G>A	ENST00000251588.2	-	11	1377	c.1361C>T	c.(1360-1362)gCa>gTa	p.A454V	NARFL_ENST00000540986.1_Missense_Mutation_p.A352V|NARFL_ENST00000568545.1_Missense_Mutation_p.A352V|NARFL_ENST00000562862.1_5'UTR	NM_022493.1	NP_071938.1	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	454					hematopoietic progenitor cell differentiation (GO:0002244)|iron-sulfur cluster assembly (GO:0016226)|oxygen homeostasis (GO:0032364)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|large_intestine(1)|lung(7)	9		Hepatocellular(780;0.0218)				CAAGCGACCTGCACACTCCGA	0.672																																																0			16											76.0	72.0	73.0					16																	780487		2200	4298	6498	720488	SO:0001583	missense	64428			AY129231	CCDS10425.1	16p13.3	2009-12-17			ENSG00000103245	ENSG00000103245			14179	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 1"""	611118				16956324	Standard	NM_022493		Approved	FLJ21988, PRN, HPRN, IOP1	uc002cjr.3	Q9H6Q4	OTTHUMG00000122093	ENST00000251588.2:c.1361C>T	16.37:g.780487G>A	ENSP00000251588:p.Ala454Val	Somatic		Capture	Illumina GAIIx	4	720488	A1L385|B3KTJ3|Q53GC6|Q96S10|Q9H6J8	Missense_Mutation	SNP	superfamily_Fe-only hydrogenase,HMMPfam_Fe_hyd_lg_C	p.A454V	ENST00000251588.2	37	c.1361	CCDS10425.1	16	.	.	.	.	.	.	.	.	.	.	G	11.25	1.583825	0.28268	.	.	ENSG00000103245	ENST00000251588;ENST00000540986	T;T	0.55234	0.53;0.53	4.12	4.12	0.48240	Iron hydrogenase, small subunit-like (3);Iron hydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.57651	0.2068	M	0.67625	2.065	0.80722	D	1	P	0.41041	0.736	B	0.44278	0.445	T	0.64193	-0.6465	10	0.52906	T	0.07	-2.6129	15.8653	0.79060	0.0:0.0:1.0:0.0	.	454	Q9H6Q4	NARFL_HUMAN	V	454;352	ENSP00000251588:A454V;ENSP00000444008:A352V	ENSP00000251588:A454V	A	-	2	0	NARFL	720488	0.996000	0.38824	0.062000	0.19696	0.003000	0.03518	3.528000	0.53524	2.285000	0.76669	0.436000	0.28706	GCA	-	superfamily_Fe-only hydrogenase		0.672	NARFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARFL	protein_coding	OTTHUMT00000242855.1	G	NM_022493		720488	-1	no_errors	NM_022493	genbank	human	provisional	54_36p	missense	SNP	0.987	A
TPO	7173	genome.wustl.edu	37	2	1507728	1507728	+	Missense_Mutation	SNP	G	G	A	rs121908085		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr2:1507728G>A	ENST00000345913.4	+	14	2486	c.2395G>A	c.(2395-2397)Gag>Aag	p.E799K	TPO_ENST00000382198.1_Missense_Mutation_p.E626K|TPO_ENST00000346956.3_Intron|TPO_ENST00000349624.3_Missense_Mutation_p.E626K|TPO_ENST00000329066.4_Missense_Mutation_p.E799K|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000382201.3_Missense_Mutation_p.E742K|TPO_ENST00000337415.3_Missense_Mutation_p.E799K	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	799	EGF-like; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		E -> K (in TDH2A; dbSNP:rs121908085). {ECO:0000269|PubMed:10084596, ECO:0000269|PubMed:11061528, ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	AGATGTGAACGAGTGTGCAGA	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		14840	0.001		0.0	False		,,,				2504	0.0															0			2	GRCh37	CM951242	TPO	M	rs121908085						64.0	61.0	62.0					2																	1507728		2203	4300	6503	1486735	SO:0001583	missense	7173				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.2395G>A	2.37:g.1507728G>A	ENSP00000318820:p.Glu799Lys	Somatic		Capture	Illumina GAIIx	4	1486735	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	superfamily_Heme-dependent peroxidases,HMMPfam_An_peroxidase,PatternScan_PEROXIDASE_1,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,superfamily_EGF/Laminin,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,HMMSmart_SM00181,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.E799K	ENST00000345913.4	37	c.2395	CCDS1643.1	2	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	18.67	3.674129	0.67928	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000425083	D;D;D;D;D;D;D	0.98849	-5.18;-5.18;-5.18;-5.18;-5.18;-5.18;-5.18	4.53	4.53	0.55603	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	1.180200	0.06181	N	0.679371	D	0.99468	0.9811	M	0.93854	3.465	0.80722	A	1	D;D;D	0.89917	0.997;1.0;1.0	P;D;D	0.79784	0.715;0.989;0.993	D	0.98335	1.0535	9	0.72032	D	0.01	-31.2993	16.8599	0.86014	0.0:0.0:1.0:0.0	.	626;742;799	P07202-5;P07202-2;P07202	.;.;PERT_HUMAN	K	799;799;626;799;742;626;20	ENSP00000337263:E799K;ENSP00000318820:E799K;ENSP00000332044:E626K;ENSP00000329869:E799K;ENSP00000371636:E742K;ENSP00000371633:E626K;ENSP00000389659:E20K	ENSP00000329869:E799K	E	+	1	0	TPO	1486735	1.000000	0.71417	0.540000	0.28089	0.310000	0.27922	6.179000	0.71974	2.083000	0.62718	0.453000	0.30009	GAG	-	superfamily_EGF/Laminin,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,HMMSmart_SM00181		0.642	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	protein_coding	OTTHUMT00000206594.2	G	NM_000547		1486735	+1	no_errors	NM_000547	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
RGS12	6002	genome.wustl.edu	37	4	3416554	3416554	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr4:3416554G>T	ENST00000344733.5	+	6	3170	c.2266G>T	c.(2266-2268)Gca>Tca	p.A756S	RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000336727.3_Missense_Mutation_p.A756S|RGS12_ENST00000306648.7_Missense_Mutation_p.A154S|RGS12_ENST00000543385.1_3'UTR|RGS12_ENST00000382788.3_Missense_Mutation_p.A756S|RGS12_ENST00000338806.4_Missense_Mutation_p.A108S|RGS12_ENST00000538395.1_Missense_Mutation_p.A98S	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	756	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCATGTTCCTGCACATGACAA	0.453																																																0			4											99.0	106.0	104.0					4																	3416554		2203	4300	6503	3386352	SO:0001583	missense	6002			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2266G>T	4.37:g.3416554G>T	ENSP00000339381:p.Ala756Ser	Somatic		Capture	Illumina GAIIx	4	3386352	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,superfamily_PH domain-like,HMMSmart_SM00462,HMMPfam_PID,superfamily_Regulator of G-protein signaling RGS,HMMPfam_RGS,HMMSmart_SM00315,superfamily_Ubiquitin-like,HMMPfam_RBD,HMMSmart_SM00455,HMMPfam_GoLoco,HMMSmart_SM00390	p.A756S	ENST00000344733.5	37	c.2266	CCDS3366.1	4	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014375	0.75161	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648;ENST00000338806;ENST00000538395	T;T;T;T;T;T	0.34275	1.67;1.67;1.67;1.37;1.37;1.38	4.51	4.51	0.55191	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.059309	0.64402	D	0.000003	T	0.35422	0.0931	N	0.05534	-0.03	0.30586	N	0.761998	B;B;P;B;B;B;B	0.36768	0.124;0.014;0.569;0.201;0.124;0.287;0.167	P;B;P;P;P;P;P	0.56788	0.617;0.181;0.806;0.586;0.617;0.794;0.705	T	0.38156	-0.9674	10	0.44086	T	0.13	-15.1092	10.2847	0.43560	0.0917:0.0:0.9083:0.0	.	98;98;98;108;154;756;756	B7Z764;B7Z8B8;O14924-2;O14924-3;Q8WX95;O14924;O14924-4	.;.;.;.;.;RGS12_HUMAN;.	S	756;756;756;154;108;98	ENSP00000339381:A756S;ENSP00000338509:A756S;ENSP00000372238:A756S;ENSP00000304459:A154S;ENSP00000342133:A108S;ENSP00000438888:A98S	ENSP00000304459:A154S	A	+	1	0	RGS12	3386352	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.239000	0.65371	2.228000	0.72767	0.563000	0.77884	GCA	-	superfamily_Regulator of G-protein signaling RGS,HMMPfam_RGS,HMMSmart_SM00315		0.453	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	protein_coding	OTTHUMT00000206602.1	G	NM_002926		3386352	+1	no_errors	NM_198229	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ANKRD16	54522	genome.wustl.edu	37	10	5922318	5922318	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr10:5922318G>C	ENST00000380094.5	-	6	1414	c.871C>G	c.(871-873)Cag>Gag	p.Q291E	ANKRD16_ENST00000380092.4_Missense_Mutation_p.Q291E|ANKRD16_ENST00000191063.8_Intron	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	291										breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						AAGAGAGTCTGAATTGTACTT	0.333																																																0			10											82.0	81.0	81.0					10																	5922318		2203	4300	6503	5962324	SO:0001583	missense	54522			AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.871C>G	10.37:g.5922318G>C	ENSP00000369436:p.Gln291Glu	Somatic		Capture	Illumina GAIIx	4	5962324	A6NEF0|F8WEI4|Q9NT01	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.Q291E	ENST00000380094.5	37	c.871	CCDS31136.1	10	.	.	.	.	.	.	.	.	.	.	G	1.600	-0.526689	0.04141	.	.	ENSG00000134461	ENST00000380094;ENST00000380092	T;T	0.62498	0.02;0.02	4.53	2.31	0.28768	Ankyrin repeat-containing domain (4);	0.123358	0.53938	D	0.000041	T	0.33411	0.0862	N	0.05441	-0.05	0.58432	D	0.999997	B	0.19445	0.036	B	0.20577	0.03	T	0.04333	-1.0959	10	0.16420	T	0.52	-10.2195	4.9232	0.13880	0.0921:0.1373:0.6099:0.1607	.	291	Q6P6B7	ANR16_HUMAN	E	291	ENSP00000369436:Q291E;ENSP00000369434:Q291E	ENSP00000369434:Q291E	Q	-	1	0	ANKRD16	5962324	0.999000	0.42202	0.833000	0.33012	0.661000	0.39034	2.870000	0.48451	0.878000	0.35920	0.478000	0.44815	CAG	-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.333	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ANKRD16	protein_coding	OTTHUMT00000046611.2	G	XM_166138		5962324	-1	no_errors	NM_001009941	genbank	human	validated	54_36p	missense	SNP	0.952	C
CHD5	26038	genome.wustl.edu	37	1	6170036	6170036	+	Silent	SNP	C	C	T	rs376607024		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:6170036C>T	ENST00000262450.3	-	38	5496	c.5397G>A	c.(5395-5397)gcG>gcA	p.A1799A	CHD5_ENST00000378021.1_Silent_p.A656A	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CAATGACCAACGCCTGCTCCA	0.716																																																0			1											21.0	23.0	22.0					1																	6170036		2200	4296	6496	6092623	SO:0001819	synonymous_variant	26038			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.5397G>A	1.37:g.6170036C>T		Somatic		Capture	Illumina GAIIx	4	6092623	A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	PatternScan_CHROMO_1,HMMPfam_CHDNT,superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,HMMSmart_RING,superfamily_Chromodomain-like,HMMSmart_CHROMO,superfamily_SSF52540,HMMPfam_Chromo,HMMSmart_DEXDc,HMMPfam_SNF2_N,PatternScan_DEAH_ATP_HELICASE,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_DUF1087,HMMPfam_DUF1086,HMMPfam_CHDCT2	p.A1799	ENST00000262450.3	37	c.5397	CCDS57.1	1																																																																																			-	HMMPfam_CHDCT2		0.716	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	protein_coding	OTTHUMT00000002823.2	C	NM_015557		6092623	-1	no_errors	NM_015557	genbank	human	provisional	54_36p	silent	SNP	0.613	T
PDE4A	5141	genome.wustl.edu	37	19	10571778	10571778	+	Splice_Site	SNP	C	C	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr19:10571778C>A	ENST00000352831.6	+	11	1574	c.1464C>A	c.(1462-1464)acC>acA	p.T488T	PDE4A_ENST00000440014.2_Splice_Site_p.T427T|PDE4A_ENST00000344979.3_Splice_Site_p.T249T|PDE4A_ENST00000380702.2_Splice_Site_p.T466T|PDE4A_ENST00000293683.5_Splice_Site_p.T462T|PDE4A_ENST00000592685.1_Splice_Site_p.T466T	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	488	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	TCATCAACACCAGTGAGTGGC	0.647																																																0			19											40.0	37.0	38.0					19																	10571778		2203	4300	6503	10432778	SO:0001630	splice_region_variant	5141				CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1465+1C>A	19.37:g.10571778C>A		Somatic		Capture	Illumina GAIIx	4	10432778	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Silent	SNP	superfamily_HD-domain/PDEase-like,HMMSmart_SM00471,HMMPfam_PDEase_I,PatternScan_PDEASE_I	p.T249	ENST00000352831.6	37	c.747	CCDS45961.1	19																																																																																			-	superfamily_HD-domain/PDEase-like,HMMSmart_SM00471,HMMPfam_PDEase_I		0.647	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4A	protein_coding	OTTHUMT00000451244.1	C		Silent	10432778	+1	no_errors	NM_006202	genbank	human	validated	54_36p	silent	SNP	0.976	A
KCNF1	3754	genome.wustl.edu	37	2	11053429	11053429	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr2:11053429C>T	ENST00000295082.1	+	1	1367	c.877C>T	c.(877-879)Cgg>Tgg	p.R293W		NM_002236.4	NP_002227.2	Q9H3M0	KCNF1_HUMAN	potassium voltage-gated channel, subfamily F, member 1	293					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|ovary(2)|skin(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.128)		GCAGGCGCTGCGGATCATGCG	0.657																																																0			2											47.0	44.0	45.0					2																	11053429		2203	4300	6503	10970880	SO:0001583	missense	3754			AF033382	CCDS1676.1	2p25	2011-07-05			ENSG00000162975	ENSG00000162975		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6246	protein-coding gene	gene with protein product		603787		KCNF		9434767, 16382104	Standard	NM_002236		Approved	Kv5.1, kH1, IK8	uc002rax.3	Q9H3M0	OTTHUMG00000119054	ENST00000295082.1:c.877C>T	2.37:g.11053429C>T	ENSP00000295082:p.Arg293Trp	Somatic		Capture	Illumina GAIIx	4	10970880	O43527|Q585L3	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_K_tetra,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.R293W	ENST00000295082.1	37	c.877	CCDS1676.1	2	.	.	.	.	.	.	.	.	.	.	c	18.41	3.618299	0.66787	.	.	ENSG00000162975	ENST00000295082	D	0.98633	-5.04	4.84	3.93	0.45458	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99375	0.9780	H	0.96970	3.915	0.54753	D	0.999981	D	0.89917	1.0	D	0.91635	0.999	D	0.98674	1.0689	10	0.87932	D	0	.	12.2699	0.54700	0.3189:0.681:0.0:0.0	.	293	Q9H3M0	KCNF1_HUMAN	W	293	ENSP00000295082:R293W	ENSP00000295082:R293W	R	+	1	2	KCNF1	10970880	1.000000	0.71417	0.868000	0.34077	0.990000	0.78478	3.894000	0.56250	1.103000	0.41568	0.556000	0.70494	CGG	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.657	KCNF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNF1	protein_coding	OTTHUMT00000239265.1	C	NM_002236		10970880	+1	no_errors	NM_002236	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZC3H7A	29066	genome.wustl.edu	37	16	11862301	11862301	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr16:11862301C>G	ENST00000396516.2	-	11	1427	c.1230G>C	c.(1228-1230)caG>caC	p.Q410H	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.Q410H			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	410						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						CATTTCTAGGCTGACTTGAAA	0.383																																																0			16											85.0	88.0	87.0					16																	11862301		2197	4300	6497	11769802	SO:0001583	missense	29066			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1230G>C	16.37:g.11862301C>G	ENSP00000379773:p.Gln410His	Somatic		Capture	Illumina GAIIx	4	11769802	D3DUG5|Q9NPE9	Missense_Mutation	SNP	superfamily_TPR-like,superfamily_CCCH zinc finger,HMMSmart_SM00356,HMMPfam_zf-CCCH,PatternScan_ZINC_FINGER_C2H2_1	p.Q410H	ENST00000396516.2	37	c.1230	CCDS10550.1	16	.	.	.	.	.	.	.	.	.	.	C	11.43	1.637680	0.29157	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.10288	2.89;2.89	5.74	2.24	0.28232	.	0.390052	0.31051	N	0.008350	T	0.07188	0.0182	L	0.41236	1.265	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.29088	-1.0023	10	0.34782	T	0.22	.	1.9851	0.03435	0.1313:0.4415:0.1856:0.2416	.	131;410	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	H	410	ENSP00000347999:Q410H;ENSP00000379773:Q410H	ENSP00000347999:Q410H	Q	-	3	2	ZC3H7A	11769802	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.474000	0.22148	0.747000	0.32809	0.655000	0.94253	CAG	-	NULL		0.383	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZC3H7A	protein_coding	OTTHUMT00000437066.1	C	NM_014153		11769802	-1	no_errors	NM_014153	genbank	human	provisional	54_36p	missense	SNP	0.998	G
BCL2L14	79370	genome.wustl.edu	37	12	12243719	12243719	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr12:12243719A>T	ENST00000308721.5	+	4	820	c.614A>T	c.(613-615)gAa>gTa	p.E205V	BCL2L14_ENST00000589718.1_Missense_Mutation_p.E205V|BCL2L14_ENST00000396369.1_Missense_Mutation_p.E205V|BCL2L14_ENST00000396367.1_Missense_Mutation_p.E205V|BCL2L14_ENST00000586576.1_Missense_Mutation_p.E238V|BCL2L14_ENST00000266434.4_Missense_Mutation_p.E205V	NM_138723.1	NP_620049.1	Q9BZR8	B2L14_HUMAN	BCL2-like 14 (apoptosis facilitator)	205					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular organelle (GO:0043229)|membrane (GO:0016020)	protein kinase binding (GO:0019901)			large_intestine(1)|lung(2)|skin(3)	6		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		ACAGATGAAGAAGAACAAATA	0.373																																																0			12											83.0	78.0	80.0					12																	12243719		2203	4300	6503	12134986	SO:0001583	missense	79370			AF281254	CCDS8645.1, CCDS8646.1	12p13-p12	2014-03-07			ENSG00000121380	ENSG00000121380			16657	protein-coding gene	gene with protein product		606126				11054413	Standard	NM_030766		Approved	BCLG, BCL-G	uc001rac.3	Q9BZR8	OTTHUMG00000159528	ENST00000308721.5:c.614A>T	12.37:g.12243719A>T	ENSP00000309132:p.Glu205Val	Somatic		Capture	Illumina GAIIx	4	12134986	A8KAD0|Q96QR5|Q9BZR7	Missense_Mutation	SNP	superfamily_Bcl-2 inhibitors of programmed cell death,HMMPfam_Bcl-2	p.E205V	ENST00000308721.5	37	c.614	CCDS8645.1	12	.	.	.	.	.	.	.	.	.	.	A	14.15	2.450110	0.43531	.	.	ENSG00000121380	ENST00000308721;ENST00000266434;ENST00000396369;ENST00000396367	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.19	5.19	0.71726	.	0.372898	0.27901	N	0.017382	T	0.49406	0.1555	M	0.72118	2.19	0.41365	D	0.987453	D;D	0.59357	0.971;0.985	P;P	0.59546	0.79;0.859	T	0.53767	-0.8392	10	0.87932	D	0	-13.7694	12.0075	0.53268	1.0:0.0:0.0:0.0	.	205;205	Q9BZR8-2;Q9BZR8	.;B2L14_HUMAN	V	205	ENSP00000309132:E205V;ENSP00000266434:E205V;ENSP00000379655:E205V;ENSP00000379653:E205V	ENSP00000266434:E205V	E	+	2	0	BCL2L14	12134986	1.000000	0.71417	0.998000	0.56505	0.567000	0.35839	5.422000	0.66453	2.268000	0.75426	0.459000	0.35465	GAA	-	superfamily_Bcl-2 inhibitors of programmed cell death		0.373	BCL2L14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L14	protein_coding	OTTHUMT00000355994.3	A	NM_030766		12134986	+1	no_errors	NM_138722	genbank	human	reviewed	54_36p	missense	SNP	0.993	T
CDRT1	374286	genome.wustl.edu	37	17	15510908	15510908	+	Silent	SNP	A	A	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr17:15510908A>G	ENST00000395906.3	-	6	1211	c.1212T>C	c.(1210-1212)aaT>aaC	p.N404N	RP11-385D13.1_ENST00000455584.2_Silent_p.N714N	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	404										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		GAATGCGAACATTGTAGGTCC	0.488																																																0			17											105.0	98.0	100.0					17																	15510908		2203	4300	6503	15451633	SO:0001819	synonymous_variant	374286			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.1212T>C	17.37:g.15510908A>G		Somatic		Capture	Illumina GAIIx	4	15451633	O43848|O95611	Silent	SNP	superfamily_F-box domain,HMMPfam_F-box,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.N404	ENST00000395906.3	37	c.1212	CCDS45619.1	17	.	.	.	.	.	.	.	.	.	.	A	0.705	-0.789168	0.02884	.	.	ENSG00000251537	ENST00000455584	.	.	.	4.99	-8.28	0.01013	.	.	.	.	.	T	0.43700	0.1259	.	.	.	0.26355	N	0.97714	.	.	.	.	.	.	T	0.44711	-0.9310	4	.	.	.	.	18.4637	0.90748	0.2684:0.0:0.7316:0.0	.	.	.	.	T	729	.	.	M	-	2	0	RP11-385D13.1	15451633	0.102000	0.21896	0.120000	0.21714	0.187000	0.23431	-0.424000	0.07025	-1.600000	0.01603	-0.441000	0.05720	ATG	-	superfamily_WD40 repeat-like		0.488	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	protein_coding	OTTHUMT00000448127.1	A	NM_006382		15451633	-1	no_errors	NM_006382	genbank	human	provisional	54_36p	silent	SNP	0.754	G
TRIM16	10626	genome.wustl.edu	37	17	15539456	15539456	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr17:15539456G>C	ENST00000578237.1	-	8	1598	c.743C>G	c.(742-744)gCc>gGc	p.A248G	TRIM16_ENST00000336708.7_Missense_Mutation_p.A248G|TRIM16_ENST00000581224.1_5'Flank|TRIM16_ENST00000416464.2_Missense_Mutation_p.A118G|TRIM16_ENST00000577886.1_Missense_Mutation_p.A32G|RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.A248G|TRIM16_ENST00000579219.1_Missense_Mutation_p.A32G			O95361	TRI16_HUMAN	tripartite motif containing 16	248					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		GATACCGTTGGCCTGGCTCAG	0.572																																																0			17											96.0	82.0	87.0					17																	15539456		2188	4294	6482	15480181	SO:0001583	missense	10626			AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.743C>G	17.37:g.15539456G>C	ENSP00000463188:p.Ala248Gly	Somatic		Capture	Illumina GAIIx	4	15480181	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Missense_Mutation	SNP	HMMSmart_SM00336,HMMPfam_zf-B_box,superfamily_B-box zinc-binding domain,HMMSmart_SM00589,HMMPfam_SPRY,HMMSmart_SM00449	p.A248G	ENST00000578237.1	37	c.743	CCDS11171.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	9.527|9.527	1.109701|1.109701	0.20714|0.20714	.|.	.|.	ENSG00000221926|ENSG00000251537	ENST00000336708;ENST00000416464|ENST00000455584	T;T|.	0.72051|.	-0.35;-0.62|.	3.97|3.97	2.98|2.98	0.34508|0.34508	.|.	0.072708|.	0.53938|.	U|.	0.000046|.	T|T	0.44993|0.44993	0.1320|0.1320	L|L	0.59436|0.59436	1.845|1.845	0.27119|0.27119	N|N	0.962194|0.962194	D;D;P|.	0.53745|.	0.962;0.962;0.734|.	P;P;B|.	0.50314|.	0.616;0.637;0.257|.	T|T	0.32079|0.32079	-0.9920|-0.9920	10|5	0.72032|.	D|.	0.01|.	.|.	8.7827|8.7827	0.34800|0.34800	0.1162:0.0:0.8838:0.0|0.1162:0.0:0.8838:0.0	.|.	118;248;262|.	B3KP96;O95361;Q59EB2|.	.;TRI16_HUMAN;.|.	G|A	248;118|263	ENSP00000338989:A248G;ENSP00000399918:A118G|.	ENSP00000338989:A248G|.	A|P	-|-	2|1	0|0	TRIM16|RP11-385D13.1	15480181|15480181	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.391000|0.391000	0.30476|0.30476	4.916000|4.916000	0.63362|0.63362	1.000000|1.000000	0.39049|0.39049	0.555000|0.555000	0.69702|0.69702	GCC|CCA	-	NULL		0.572	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM16	protein_coding	OTTHUMT00000130700.2	G	NM_006470		15480181	-1	no_errors	NM_006470	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ATPAF2	91647	genome.wustl.edu	37	17	17942245	17942245	+	Missense_Mutation	SNP	C	C	T	rs375062622		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr17:17942245C>T	ENST00000474627.3	-	1	237	c.83G>A	c.(82-84)aGt>aAt	p.S28N	GID4_ENST00000376345.3_5'Flank|ATPAF2_ENST00000585101.1_Missense_Mutation_p.S28N|GID4_ENST00000268719.4_5'Flank	NM_145691.3	NP_663729.1	Q8N5M1	ATPF2_HUMAN	ATP synthase mitochondrial F1 complex assembly factor 2	28					proton-transporting ATP synthase complex assembly (GO:0043461)	mitochondrion (GO:0005739)|nuclear speck (GO:0016607)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	8	all_neural(463;0.228)					TGGCCCCGGACTCATAGAAGC	0.687																																																0			17						C	ASN/SER	0,4404		0,0,2202	20.0	23.0	22.0		83	1.2	0.0	17		22	1,8599		0,1,4299	no	missense	ATPAF2	NM_145691.3	46	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign	28/290	17942245	1,13003	2202	4300	6502	17882970	SO:0001583	missense	91647			AF052185	CCDS32585.1	17p11.2	2012-10-12			ENSG00000171953	ENSG00000171953		"""Mitochondrial respiratory chain complex assembly factors"""	18802	protein-coding gene	gene with protein product		608918				11410595, 11997338	Standard	NM_145691		Approved	Atp12p, ATP12, LP3663, MGC29736	uc002gse.1	Q8N5M1	OTTHUMG00000059354	ENST00000474627.3:c.83G>A	17.37:g.17942245C>T	ENSP00000417190:p.Ser28Asn	Somatic		Capture	Illumina GAIIx	4	17882970	A6NDE5|A8K2J2|Q6XYC7	Missense_Mutation	SNP	HMMPfam_ATP12	p.S28N	ENST00000474627.3	37	c.83	CCDS32585.1	17	.	.	.	.	.	.	.	.	.	.	C	10.93	1.488721	0.26686	0.0	1.16E-4	ENSG00000171953	ENST00000474627;ENST00000444058	T;T	0.77098	-1.06;-1.07	4.51	1.23	0.21249	.	1.006310	0.07995	N	0.987813	T	0.52980	0.1768	N	0.08118	0	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.11329	0.006;0.004	T	0.36383	-0.9750	10	0.16420	T	0.52	0.0074	2.7451	0.05264	0.2091:0.5263:0.1609:0.1037	.	28;28	B4DG98;Q8N5M1	.;ATPF2_HUMAN	N	28	ENSP00000417190:S28N;ENSP00000397198:S28N	ENSP00000434980:S28N	S	-	2	0	ATPAF2	17882970	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	1.020000	0.30027	0.200000	0.20447	0.561000	0.74099	AGT	-	NULL		0.687	ATPAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATPAF2	protein_coding	OTTHUMT00000131934.3	C	NM_145691		17882970	-1	no_errors	NM_145691	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
BTG3	10950	genome.wustl.edu	37	21	18966581	18966581	+	Nonsense_Mutation	SNP	G	G	A	rs373951463		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr21:18966581G>A	ENST00000348354.6	-	5	845	c.589C>T	c.(589-591)Cga>Tga	p.R197*	BTG3_ENST00000339775.6_Nonsense_Mutation_p.R241*	NM_006806.4	NP_006797.3	Q14201	BTG3_HUMAN	BTG family, member 3	197					negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	8				Epithelial(23;0.000283)|all cancers(11;0.0012)|Lung(58;0.0191)|OV - Ovarian serous cystadenocarcinoma(11;0.0206)|COAD - Colon adenocarcinoma(22;0.0315)|LUSC - Lung squamous cell carcinoma(23;0.0703)|Colorectal(24;0.0971)		CCATTCCCTCGATACATTCCT	0.413																																																0			21											126.0	114.0	118.0					21																	18966581		2203	4299	6502	17888452	SO:0001587	stop_gained	10950			D64110	CCDS13569.1, CCDS46636.1	21q21.1	2006-12-16			ENSG00000154640	ENSG00000154640			1132	protein-coding gene	gene with protein product		605674				9632145	Standard	NM_006806		Approved	ANA, tob55	uc002ykk.3	Q14201	OTTHUMG00000074501	ENST00000348354.6:c.589C>T	21.37:g.18966581G>A	ENSP00000284879:p.Arg197*	Somatic		Capture	Illumina GAIIx	4	17888452	D3DSC4|Q53XV1|Q96ET7	Nonsense_Mutation	SNP	HMMSmart_SM00099,HMMPfam_BTG,PatternScan_BTG_1,PatternScan_BTG_2	p.R197*	ENST00000348354.6	37	c.589	CCDS13569.1	21	.	.	.	.	.	.	.	.	.	.	G	35	5.554022	0.96501	.	.	ENSG00000154640	ENST00000339775;ENST00000348354	.	.	.	4.27	3.34	0.38264	.	0.120895	0.36268	N	0.002691	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-7.9277	9.2524	0.37562	0.0:0.0:0.7849:0.2151	.	.	.	.	X	241;197	.	ENSP00000344609:R241X	R	-	1	2	BTG3	17888452	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.182000	0.32029	1.320000	0.45209	0.591000	0.81541	CGA	-	NULL		0.413	BTG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BTG3	protein_coding	OTTHUMT00000158196.1	G	NM_006806		17888452	-1	no_errors	NM_006806	genbank	human	reviewed	54_36p	nonsense	SNP	0.999	A
TPTE2	93492	genome.wustl.edu	37	13	20004655	20004655	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr13:20004655T>A	ENST00000400230.2	-	17	1299	c.1255A>T	c.(1255-1257)Atg>Ttg	p.M419L	TPTE2_ENST00000382975.4_Missense_Mutation_p.M379L|TPTE2_ENST00000255310.6_Missense_Mutation_p.M342L|TPTE2_ENST00000390680.2_Missense_Mutation_p.M342L|TPTE2_ENST00000457266.2_Missense_Mutation_p.M308L|TPTE2_ENST00000382977.4_Missense_Mutation_p.M419L|TPTE2_ENST00000382978.1_Missense_Mutation_p.M379L|TPTE2_ENST00000400103.2_Missense_Mutation_p.M308L			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	419	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TTTTTCTCCATTACTACTTGG	0.323																																																0			13											68.0	61.0	63.0					13																	20004655		2202	4300	6502	18902655	SO:0001583	missense	93492			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.1255A>T	13.37:g.20004655T>A	ENSP00000383089:p.Met419Leu	Somatic		Capture	Illumina GAIIx	4	18902655	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,superfamily_(Phosphotyrosine protein) phosphatases II,PatternScan_TYR_PHOSPHATASE_1,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_PTEN_C2	p.M419L	ENST00000400230.2	37	c.1255	CCDS45014.1	13	.	.	.	.	.	.	.	.	.	.	t	3.962	-0.010089	0.07727	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548;ENST00000419256	D;D;D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	2.24	2.24	0.28232	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.511109	0.20561	N	0.089915	T	0.78059	0.4224	L	0.54323	1.7	0.09310	N	1	B;B;B	0.13145	0.005;0.007;0.006	B;B;B	0.17098	0.017;0.01;0.017	T	0.63143	-0.6703	9	.	.	.	-11.0813	6.4738	0.22024	0.0:0.0:0.0:1.0	.	308;342;419	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	L	379;308;419;342;342;419;379;308;419;288	ENSP00000372438:M379L;ENSP00000382974:M308L;ENSP00000383089:M419L;ENSP00000255310:M342L;ENSP00000375098:M342L;ENSP00000372437:M419L;ENSP00000372435:M379L;ENSP00000442218:M308L	.	M	-	1	0	TPTE2	18902655	0.000000	0.05858	0.003000	0.11579	0.160000	0.22226	-0.202000	0.09451	1.288000	0.44600	0.163000	0.16589	ATG	-	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_PTEN_C2		0.323	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	protein_coding		T	NM_199254		18902655	-1	no_errors	NM_199254	genbank	human	validated	54_36p	missense	SNP	0.016	A
SYT17	51760	genome.wustl.edu	37	16	19194849	19194849	+	Splice_Site	SNP	G	G	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr16:19194849G>T	ENST00000355377.2	+	5	729		c.e5-1		SYT17_ENST00000562034.1_Splice_Site|SYT17_ENST00000568115.1_Splice_Site|SYT17_ENST00000562711.2_Splice_Site	NM_016524.2	NP_057608.2	Q9BSW7	SYT17_HUMAN	synaptotagmin XVII						exocytosis (GO:0006887)	membrane (GO:0016020)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	17						GTGGCTCTCAGGTCTTGAGTC	0.507																																																0			16											93.0	91.0	92.0					16																	19194849		2197	4300	6497	19102350	SO:0001630	splice_region_variant	51760				CCDS10575.1	16p12.3	2013-01-21			ENSG00000103528	ENSG00000103528		"""Synaptotagmins"""	24119	protein-coding gene	gene with protein product	"""B/K protein"""					10493829	Standard	NM_016524		Approved		uc002dfw.3	Q9BSW7	OTTHUMG00000131461	ENST00000355377.2:c.332-1G>T	16.37:g.19194849G>T		Somatic		Capture	Illumina GAIIx	4	19102350	O43330|Q9NZ18	Splice_Site	SNP	-	e5-1	ENST00000355377.2	37	c.332-1	CCDS10575.1	16	.	.	.	.	.	.	.	.	.	.	g	14.42	2.529615	0.44969	.	.	ENSG00000103528	ENST00000355377	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4121	0.94679	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYT17	19102350	1.000000	0.71417	0.997000	0.53966	0.535000	0.34838	7.808000	0.86044	2.573000	0.86826	0.556000	0.70494	.	-	-		0.507	SYT17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT17	protein_coding	OTTHUMT00000254286.2	G	NM_016524	Intron	19102350	+1	no_errors	NM_016524	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	16	20168370	20168370	+	IGR	SNP	C	C	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr16:20168370C>A								GPR139 (83131 upstream) : RP11-204E4.3 (51876 downstream)																							GGTCAGAGACCCTGAAATTGC	0.532																																																0			16																																								20075871	SO:0001628	intergenic_variant	0																															16.37:g.20168370C>A		Somatic		Capture	Illumina GAIIx	4	20075871		RNA	SNP	-	NULL		37	NULL		16																																																																																			-	-	0	0.532					LOC100131046			C			20075871	+1	pseudogene	XR_037711	genbank	human	model	54_36p	rna	SNP	0.956	A
GDF7	151449	genome.wustl.edu	37	2	20871081	20871081	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr2:20871081C>A	ENST00000272224.3	+	2	1825	c.1249C>A	c.(1249-1251)Cca>Aca	p.P417T		NM_182828.2	NP_878248.2	Q7Z4P5	GDF7_HUMAN	growth differentiation factor 7	417					activin receptor signaling pathway (GO:0032924)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching morphogenesis of an epithelial tube (GO:0048754)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|forebrain morphogenesis (GO:0048853)|gland morphogenesis (GO:0022612)|growth (GO:0040007)|midbrain development (GO:0030901)|morphogenesis of an epithelial fold (GO:0060571)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of tendon cell differentiation (GO:2001051)|positive regulation of transcription, DNA-templated (GO:0045893)|reproductive structure development (GO:0048608)|roof plate formation (GO:0021509)|spinal cord association neuron differentiation (GO:0021527)	extracellular space (GO:0005615)				breast(1)|cervix(1)|endometrium(2)|lung(1)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCTGTGTGCCAGCGCGCCT	0.622																																																0			2											58.0	52.0	54.0					2																	20871081		2203	4300	6503	20734562	SO:0001583	missense	151449			AF522369	CCDS1701.1	2p24.1	2008-05-22			ENSG00000143869	ENSG00000143869			4222	protein-coding gene	gene with protein product		604651				10022976, 9808626	Standard	NM_182828		Approved	BMP12	uc002rdz.1	Q7Z4P5	OTTHUMG00000090781	ENST00000272224.3:c.1249C>A	2.37:g.20871081C>A	ENSP00000272224:p.Pro417Thr	Somatic		Capture	Illumina GAIIx	4	20734562		Missense_Mutation	SNP	HMMPfam_TGFb_propeptide,superfamily_Cystine-knot cytokines,HMMPfam_TGF_beta,HMMSmart_SM00204,PatternScan_TGF_BETA_1	p.P417T	ENST00000272224.3	37	c.1249	CCDS1701.1	2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365395	0.82463	.	.	ENSG00000143869	ENST00000272224	D	0.83837	-1.77	4.05	4.05	0.47172	Transforming growth factor-beta, C-terminal (3);	0.000000	0.64402	U	0.000015	D	0.95598	0.8569	H	0.99789	4.78	0.46203	D	0.998927	D	0.89917	1.0	D	0.97110	1.0	D	0.98175	1.0454	10	0.87932	D	0	.	16.7259	0.85421	0.0:1.0:0.0:0.0	.	417	Q7Z4P5	GDF7_HUMAN	T	417	ENSP00000272224:P417T	ENSP00000272224:P417T	P	+	1	0	GDF7	20734562	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.875000	0.69660	2.187000	0.69744	0.561000	0.74099	CCA	-	superfamily_Cystine-knot cytokines,HMMPfam_TGF_beta,HMMSmart_SM00204		0.622	GDF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF7	protein_coding	OTTHUMT00000207563.2	C	NM_182828		20734562	+1	no_errors	NM_182828	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ZNF208	7757	genome.wustl.edu	37	19	22157526	22157526	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr19:22157526C>G	ENST00000397126.4	-	4	458	c.310G>C	c.(310-312)Gaa>Caa	p.E104Q	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCACATTTTTCATACCTTCTC	0.323																																																0			19											61.0	60.0	60.0					19																	22157526		2036	4229	6265	21949366	SO:0001583	missense	7757			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.310G>C	19.37:g.22157526C>G	ENSP00000380315:p.Glu104Gln	Somatic		Capture	Illumina GAIIx	4	21949366		Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.E104Q	ENST00000397126.4	37	c.310	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	0.122	-1.123942	0.01770	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.07216	3.21	1.54	-2.57	0.06248	.	.	.	.	.	T	0.04907	0.0132	.	.	.	0.09310	N	1	P	0.48230	0.907	B	0.44224	0.444	T	0.35549	-0.9784	8	0.13108	T	0.6	.	5.1378	0.14943	0.0:0.366:0.0:0.634	.	104	O43345	ZN208_HUMAN	Q	104	ENSP00000380315:E104Q	ENSP00000380315:E104Q	E	-	1	0	ZNF208	21949366	0.000000	0.05858	0.000000	0.03702	0.235000	0.25334	-1.935000	0.01550	-0.424000	0.07382	0.297000	0.19635	GAA	-	NULL		0.323	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	protein_coding	OTTHUMT00000464302.1	C	NM_007153		21949366	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_007153	genbank	human	provisional	54_36p	missense	SNP	0.007	G
TNFRSF10A	8797	genome.wustl.edu	37	8	23059380	23059380	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr8:23059380G>C	ENST00000221132.3	-	4	634	c.570C>G	c.(568-570)tgC>tgG	p.C190W		NM_003844.3	NP_003835.3	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily, member 10a	190					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|signal transduction (GO:0007165)|TRAIL-activated apoptotic signaling pathway (GO:0036462)	integral component of membrane (GO:0016021)	death receptor activity (GO:0005035)|protease binding (GO:0002020)|receptor activity (GO:0004872)|TRAIL binding (GO:0045569)|transcription factor binding (GO:0008134)			NS(2)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|skin(1)	16		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		TTCCTGGTTTGCACTGACATG	0.522																																																0			8											179.0	129.0	146.0					8																	23059380		2203	4300	6503	23115325	SO:0001583	missense	8797			U90875	CCDS6039.1	8p21	2006-02-22			ENSG00000104689	ENSG00000104689		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11904	protein-coding gene	gene with protein product		603611				9311998, 9082980	Standard	NM_003844		Approved	DR4, Apo2, TRAILR-1, CD261	uc003xda.3	O00220	OTTHUMG00000097843	ENST00000221132.3:c.570C>G	8.37:g.23059380G>C	ENSP00000221132:p.Cys190Trp	Somatic		Capture	Illumina GAIIx	4	23115325	A8K5I4|Q53Y72|Q96E62	Missense_Mutation	SNP	superfamily_TNF receptor-like,HMMPfam_TNFR_c6,HMMSmart_SM00208,PatternScan_TNFR_NGFR_1,HMMSmart_SM00005,superfamily_DEATH domain,HMMPfam_Death	p.C190W	ENST00000221132.3	37	c.570	CCDS6039.1	8	.	.	.	.	.	.	.	.	.	.	G	13.31	2.197975	0.38806	.	.	ENSG00000104689	ENST00000221132	D	0.99936	-8.3	4.2	1.34	0.21922	TNFR/CD27/30/40/95 cysteine-rich region (4);	0.000000	0.85682	U	0.000000	D	0.99910	0.9957	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97595	1.0119	10	0.87932	D	0	.	6.2614	0.20901	0.3397:0.0:0.6602:0.0	.	190	O00220	TR10A_HUMAN	W	190	ENSP00000221132:C190W	ENSP00000221132:C190W	C	-	3	2	TNFRSF10A	23115325	0.998000	0.40836	0.052000	0.19188	0.017000	0.09413	1.621000	0.36986	0.020000	0.15106	0.655000	0.94253	TGC	-	superfamily_TNF receptor-like,PatternScan_TNFR_NGFR_1,HMMPfam_TNFR_c6,HMMSmart_SM00208		0.522	TNFRSF10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF10A	protein_coding	OTTHUMT00000215133.2	G	NM_003844		23115325	-1	no_errors	NM_003844	genbank	human	reviewed	54_36p	missense	SNP	0.597	C
MYO18B	84700	genome.wustl.edu	37	22	26291146	26291146	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr22:26291146G>A	ENST00000407587.2	+	28	4739	c.4570G>A	c.(4570-4572)Gac>Aac	p.D1524N	CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000597614.2_RNA|CTA-125H2.2_ENST00000608507.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000600903.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.D1523N|CTA-125H2.2_ENST00000597284.1_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.D1523N|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000596813.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000594856.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1523	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GATGCGCTTCGACTGTGCTCA	0.547																																																0			22											37.0	41.0	39.0					22																	26291146		2190	4283	6473	24621146	SO:0001583	missense	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4570G>A	22.37:g.26291146G>A	ENSP00000386096:p.Asp1524Asn	Somatic		Capture	Illumina GAIIx	4	24621146	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMPfam_IQ	p.D1523N	ENST00000407587.2	37	c.4567		22	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623551	0.66901	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;T	0.86627	-2.15;-2.15;-1.16	5.26	5.26	0.73747	.	0.251447	0.33309	N	0.005057	D	0.91744	0.7389	L	0.53249	1.67	0.37554	D	0.9188	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.982;0.983;0.998;0.992	D	0.93184	0.6577	10	0.56958	D	0.05	.	16.3609	0.83267	0.0:0.0:1.0:0.0	.	1036;1523;1524;1523	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	N	1523;1523;1524	ENSP00000441229:D1523N;ENSP00000334563:D1523N;ENSP00000386096:D1524N	ENSP00000334563:D1523N	D	+	1	0	MYO18B	24621146	1.000000	0.71417	0.945000	0.38365	0.315000	0.28087	5.788000	0.69020	2.471000	0.83476	0.563000	0.77884	GAC	-	NULL		0.547	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	protein_coding	OTTHUMT00000400691.1	G	NM_032608		24621146	+1	no_errors	NM_032608	genbank	human	reviewed	54_36p	missense	SNP	0.969	A
DNMT3A	1788	genome.wustl.edu	37	2	25505532	25505532	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr2:25505532G>A	ENST00000264709.3	-	4	563	c.226C>T	c.(226-228)Cca>Tca	p.P76S	DNMT3A_ENST00000406659.3_Missense_Mutation_p.P76S|DNMT3A_ENST00000321117.5_Missense_Mutation_p.P76S	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	76					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCATGGATGGGGACTTGGAG	0.587			"""Mis, F, N, S"""		AML																																		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0			2											49.0	58.0	55.0					2																	25505532		2202	4298	6500	25359036	SO:0001583	missense	1788				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.226C>T	2.37:g.25505532G>A	ENSP00000264709:p.Pro76Ser	Somatic		Capture	Illumina GAIIx	4	25359036	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	superfamily_Tudor/PWWP/MBT,HMMPfam_PWWP,HMMSmart_SM00293,superfamily_FYVE/PHD zinc finger,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_DNA_methylase,PatternScan_C5_MTASE_1	p.P76S	ENST00000264709.3	37	c.226	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	G	9.683	1.149874	0.21371	.	.	ENSG00000119772	ENST00000321117;ENST00000264709;ENST00000406659	D;D	0.92595	-3.07;-3.07	4.91	3.97	0.46021	.	0.530516	0.15845	N	0.241813	T	0.82144	0.4973	N	0.08118	0	0.30833	N	0.736456	B;B	0.26809	0.16;0.001	B;B	0.28305	0.088;0.001	T	0.78224	-0.2287	10	0.32370	T	0.25	-0.5263	9.6977	0.40167	0.0:0.0:0.7933:0.2067	.	76;76	Q9Y6K1-3;Q9Y6K1	.;DNM3A_HUMAN	S	76	ENSP00000324375:P76S;ENSP00000264709:P76S	ENSP00000264709:P76S	P	-	1	0	DNMT3A	25359036	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	4.107000	0.57811	2.280000	0.76307	0.563000	0.77884	CCA	-	NULL		0.587	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	protein_coding	OTTHUMT00000211587.1	G	NM_022552		25359036	-1	no_errors	NM_022552	genbank	human	reviewed	54_36p	missense	SNP	0.957	A
MAN1C1	57134	genome.wustl.edu	37	1	26079974	26079974	+	Splice_Site	SNP	G	G	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:26079974G>T	ENST00000374332.4	+	5	1164		c.e5-1		MAN1C1_ENST00000263979.3_Splice_Site|MAN1C1_ENST00000374329.1_Splice_Site|MAN1C1_ENST00000473891.1_Splice_Site	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1						cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		CTCCTTTACAGGTGTTCCGAA	0.587																																																0			1											48.0	43.0	45.0					1																	26079974		2203	4300	6503	25952561	SO:0001630	splice_region_variant	57134			AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.835-1G>T	1.37:g.26079974G>T		Somatic		Capture	Illumina GAIIx	4	25952561	A6NNE2|B2RNP2|Q9Y545	Splice_Site	SNP	-	e5-1	ENST00000374332.4	37	c.835-1	CCDS265.1	1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923876	0.73213	.	.	ENSG00000117643	ENST00000374332;ENST00000374331;ENST00000263979;ENST00000374329	.	.	.	4.93	4.02	0.46733	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5501	0.50716	0.085:0.0:0.915:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAN1C1	25952561	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	8.617000	0.90927	1.202000	0.43218	0.561000	0.74099	.	-	-		0.587	MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1C1	protein_coding	OTTHUMT00000012828.3	G	NM_020379	Intron	25952561	+1	no_errors	NM_020379	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
PLB1	151056	genome.wustl.edu	37	2	28821575	28821575	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr2:28821575G>C	ENST00000327757.5	+	35	2466	c.2422G>C	c.(2422-2424)Gcc>Ccc	p.A808P	PLB1_ENST00000422425.2_Missense_Mutation_p.A797P	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	808	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					CACGGGTGATGCCAATGACAC	0.537																																																0			2											159.0	147.0	151.0					2																	28821575		2203	4300	6503	28675079	SO:0001583	missense	151056				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2422G>C	2.37:g.28821575G>C	ENSP00000330442:p.Ala808Pro	Somatic		Capture	Illumina GAIIx	4	28675079	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	superfamily_SGNH hydrolase,PatternScan_LIPASE_GDSL_SER,HMMPfam_Lipase_GDSL	p.A808P	ENST00000327757.5	37	c.2422	CCDS33168.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.158|4.158	0.027796|0.027796	0.08054|0.08054	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000327757;ENST00000422425|ENST00000404858	T;T|.	0.14893|.	2.47;2.47|.	5.84|5.84	4.95|4.95	0.65309|0.65309	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);|.	0.397425|.	0.24568|.	N|.	0.037416|.	T|T	0.35740|0.35740	0.0942|0.0942	L|L	0.39898|0.39898	1.24|1.24	0.09310|0.09310	N|N	0.999993|0.999993	B;B|.	0.33807|.	0.135;0.426|.	B;B|.	0.31101|.	0.076;0.124|.	T|T	0.27706|0.27706	-1.0066|-1.0066	10|5	0.29301|.	T|.	0.29|.	-15.0018|-15.0018	5.2928|5.2928	0.15737|0.15737	0.0764:0.1449:0.6284:0.1503|0.0764:0.1449:0.6284:0.1503	.|.	797;808|.	Q6P1J6-3;Q6P1J6|.	.;PLB1_HUMAN|.	P|I	808;797|795	ENSP00000330442:A808P;ENSP00000416440:A797P|.	ENSP00000330442:A808P|.	A|M	+|+	1|3	0|0	PLB1|PLB1	28675079|28675079	0.029000|0.029000	0.19370|0.19370	0.023000|0.023000	0.16930|0.16930	0.016000|0.016000	0.09150|0.09150	1.734000|1.734000	0.38166|0.38166	1.452000|1.452000	0.47756|0.47756	0.561000|0.561000	0.74099|0.74099	GCC|ATG	-	superfamily_SGNH hydrolase,HMMPfam_Lipase_GDSL		0.537	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PLB1	protein_coding	OTTHUMT00000353348.2	G			28675079	+1	no_errors	NM_153021	genbank	human	validated	54_36p	missense	SNP	0.002	C
PLAGL2	5326	genome.wustl.edu	37	20	30784386	30784386	+	Nonsense_Mutation	SNP	G	G	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr20:30784386G>A	ENST00000246229.4	-	3	1624	c.1360C>T	c.(1360-1362)Caa>Taa	p.Q454*		NM_002657.3	NP_002648.1	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	454					chylomicron assembly (GO:0034378)|lipid metabolic process (GO:0006629)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|post-embryonic development (GO:0009791)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|liver(1)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GGCTGAGCTTGCAAAGTGGTA	0.612																																					Colon(163;15 1893 11280 16306 47518)											0			20											42.0	43.0	42.0					20																	30784386		2203	4300	6503	30248047	SO:0001587	stop_gained	5326				CCDS13197.1	20q11.21	2013-01-08			ENSG00000126003	ENSG00000126003		"""Zinc fingers, C2H2-type"""	9047	protein-coding gene	gene with protein product	"""C2H2-type zinc finger protein"""	604866				15585652, 17950244	Standard	NM_002657		Approved	ZNF900	uc002wxn.2	Q9UPG8	OTTHUMG00000032210	ENST00000246229.4:c.1360C>T	20.37:g.30784386G>A	ENSP00000246229:p.Gln454*	Somatic		Capture	Illumina GAIIx	4	30248047	A8K8T5|E1P5M3|Q92584	Nonsense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.Q454*	ENST00000246229.4	37	c.1360	CCDS13197.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.432237	0.96150	.	.	ENSG00000126003	ENST00000246229	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	18.5089	0.90909	0.0:0.0:1.0:0.0	.	.	.	.	X	454	.	ENSP00000246229:Q454X	Q	-	1	0	PLAGL2	30248047	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	7.663000	0.83820	2.595000	0.87683	0.655000	0.94253	CAA	-	NULL		0.612	PLAGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAGL2	protein_coding	OTTHUMT00000078615.2	G	NM_002657		30248047	-1	no_errors	NM_002657	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
SETD1A	9739	genome.wustl.edu	37	16	30982858	30982858	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr16:30982858A>G	ENST00000262519.8	+	13	3862	c.3176A>G	c.(3175-3177)gAg>gGg	p.E1059G		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1059	Ser-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						tcatcctcTGAGTCCTCCTCT	0.607																																																0			16											36.0	40.0	39.0					16																	30982858		2197	4300	6497	30890359	SO:0001583	missense	9739			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3176A>G	16.37:g.30982858A>G	ENSP00000262519:p.Glu1059Gly	Somatic		Capture	Illumina GAIIx	4	30890359	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1,superfamily_SSF82199,HMMPfam_SET,HMMSmart_SET,HMMSmart_PostSET	p.E1059G	ENST00000262519.8	37	c.3176	CCDS32435.1	16	.	.	.	.	.	.	.	.	.	.	A	12.90	2.076928	0.36662	.	.	ENSG00000099381	ENST00000262519	T	0.57595	0.39	5.09	3.9	0.45041	.	20.719700	0.00166	N	0.000011	T	0.42675	0.1213	N	0.24115	0.695	0.26051	N	0.981477	P	0.42692	0.787	B	0.38880	0.284	T	0.41627	-0.9498	10	0.48119	T	0.1	.	8.3565	0.32333	0.8006:0.1994:0.0:0.0	.	1059	O15047	SET1A_HUMAN	G	1059	ENSP00000262519:E1059G	ENSP00000262519:E1059G	E	+	2	0	SETD1A	30890359	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	2.873000	0.48475	2.221000	0.72209	0.383000	0.25322	GAG	-	NULL		0.607	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	protein_coding	OTTHUMT00000318244.2	A	NM_014712		30890359	+1	no_errors	NM_014712	genbank	human	provisional	54_36p	missense	SNP	0.925	G
PUM1	9698	genome.wustl.edu	37	1	31532112	31532112	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:31532112C>T	ENST00000257075.5	-	2	395	c.302G>A	c.(301-303)gGc>gAc	p.G101D	PUM1_ENST00000373742.2_Missense_Mutation_p.G137D|PUM1_ENST00000373747.3_Missense_Mutation_p.G101D|PUM1_ENST00000440538.2_Missense_Mutation_p.G101D|PUM1_ENST00000423018.2_Missense_Mutation_p.G101D|PUM1_ENST00000424085.2_Missense_Mutation_p.G101D|PUM1_ENST00000426105.2_Missense_Mutation_p.G101D|PUM1_ENST00000373741.4_Missense_Mutation_p.G137D	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	101					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		ATTATAGCCGCCTCCTCCACT	0.468																																																0			1											109.0	101.0	103.0					1																	31532112		2203	4300	6503	31304699	SO:0001583	missense	9698			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.302G>A	1.37:g.31532112C>T	ENSP00000257075:p.Gly101Asp	Somatic		Capture	Illumina GAIIx	4	31304699	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_PUF,HMMSmart_SM00025	p.G101D	ENST00000257075.5	37	c.302	CCDS338.1	1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536540	0.65085	.	.	ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742;ENST00000543952	T;T;T;T;T;T;T;T	0.44482	1.37;1.93;2.2;2.23;2.2;2.2;1.36;0.92	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000005	T	0.55497	0.1924	L	0.34521	1.04	0.32330	N	0.561257	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.83275	0.992;0.992;0.992;0.996;0.992;0.992	T	0.58375	-0.7647	10	0.40728	T	0.16	-8.1482	19.0661	0.93110	0.0:1.0:0.0:0.0	.	137;101;137;101;101;101	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0	.;.;.;.;PUM1_HUMAN;.	D	101;101;101;101;101;101;137;101;137;101	ENSP00000400141:G101D;ENSP00000257075:G101D;ENSP00000362852:G101D;ENSP00000391723:G101D;ENSP00000401777:G101D;ENSP00000362846:G137D;ENSP00000399440:G101D;ENSP00000362847:G137D	ENSP00000257075:G101D	G	-	2	0	PUM1	31304699	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.287000	0.65645	2.746000	0.94184	0.655000	0.94253	GGC	-	NULL		0.468	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PUM1	protein_coding	OTTHUMT00000010671.1	C			31304699	-1	no_errors	NM_001020658	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
NRP1	8829	genome.wustl.edu	37	10	33491639	33491639	+	Intron	SNP	A	A	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr10:33491639A>G	ENST00000265371.4	-	12	2390				NRP1_ENST00000374822.4_Intron|NRP1_ENST00000374821.5_Intron|NRP1_ENST00000374823.5_Missense_Mutation_p.F682L|NRP1_ENST00000395995.1_Intron|NRP1_ENST00000374875.1_Intron|NRP1_ENST00000374867.2_Intron			O14786	NRP1_HUMAN	neuropilin 1						angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	GCTATTAAGAACAACTCATCT	0.423																																					Melanoma(104;886 1489 44640 45944 51153)											0			10																																								33531645	SO:0001627	intron_variant	8829			AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.1864+179T>C	10.37:g.33491639A>G		Somatic		Capture	Illumina GAIIx	4	33531645	B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Missense_Mutation	SNP	superfamily_CUB,HMMPfam_CUB,HMMSmart_CUB,superfamily_Gal_bind_like,HMMSmart_FA58C,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2	p.F682L	ENST00000265371.4	37	c.2044	CCDS7177.1	10	.	.	.	.	.	.	.	.	.	.	A	14.58	2.577484	0.45902	.	.	ENSG00000099250	ENST00000374823	D	0.89485	-2.52	4.83	-1.99	0.07457	.	.	.	.	.	D	0.82829	0.5122	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.71404	-0.4603	8	0.87932	D	0	.	10.795	0.46455	0.434:0.0:0.566:0.0	.	682	Q5T7F0	.	L	682	ENSP00000363956:F682L	ENSP00000363956:F682L	F	-	1	0	NRP1	33531645	0.001000	0.12720	0.000000	0.03702	0.097000	0.18754	0.489000	0.22387	-0.271000	0.09272	0.528000	0.53228	TTC	-	NULL		0.423	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NRP1	protein_coding	OTTHUMT00000051203.2	A			33531645	-1	no_errors	ENST00000374818	ensembl	human	known	54_36p	missense	SNP	0.001	G
ERBB2	2064	genome.wustl.edu	37	17	37868208	37868208	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr17:37868208C>T	ENST00000269571.5	+	8	1088	c.929C>T	c.(928-930)tCc>tTc	p.S310F	ERBB2_ENST00000584450.1_Missense_Mutation_p.S310F|ERBB2_ENST00000406381.2_Missense_Mutation_p.S280F|ERBB2_ENST00000584601.1_Missense_Mutation_p.S280F|ERBB2_ENST00000540042.1_Missense_Mutation_p.S280F|ERBB2_ENST00000578199.1_Missense_Mutation_p.S280F|ERBB2_ENST00000540147.1_Missense_Mutation_p.S280F|ERBB2_ENST00000541774.1_Missense_Mutation_p.S295F|ERBB2_ENST00000445658.2_Missense_Mutation_p.S34F			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	310					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.S310F(6)|p.S310Y(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	GACGTGGGATCCTGCACCCTC	0.582		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																													Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	7	Substitution - Missense(7)	lung(4)|urinary_tract(1)|ovary(1)|breast(1)	17											251.0	204.0	220.0					17																	37868208		2203	4300	6503	35121734	SO:0001583	missense	2064			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.929C>T	17.37:g.37868208C>T	ENSP00000269571:p.Ser310Phe	Somatic		Capture	Illumina GAIIx	4	35121734	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	superfamily_L domain-like,HMMPfam_Recep_L_domain,superfamily_Growth factor receptor domain,HMMPfam_Furin-like,HMMSmart_SM00261,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,PatternScan_EF_HAND_1,HMMPfam_YLP	p.S310F	ENST00000269571.5	37	c.929	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586908	0.46110	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147;ENST00000540042	T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	5.83	5.83	0.93111	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	.	.	.	.	T	0.79375	0.4435	M	0.70842	2.15	0.53688	D	0.999977	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;0.997	D;D;D;D;D	0.79108	0.955;0.988;0.975;0.992;0.92	T	0.79438	-0.1803	9	0.59425	D	0.04	.	18.8848	0.92372	0.0:1.0:0.0:0.0	.	34;280;295;310;310	B4DTR1;F5H1T4;P04626-4;P04626;Q9UK79	.;.;.;ERBB2_HUMAN;.	F	280;295;34;310;280;280	ENSP00000385185:S280F;ENSP00000446466:S295F;ENSP00000404047:S34F;ENSP00000269571:S310F;ENSP00000443562:S280F;ENSP00000446382:S280F	ENSP00000269571:S310F	S	+	2	0	ERBB2	35121734	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	6.178000	0.71968	2.766000	0.95052	0.491000	0.48974	TCC	-	superfamily_Growth factor receptor domain,HMMPfam_Furin-like		0.582	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	protein_coding	OTTHUMT00000445621.2	C			35121734	+1	no_errors	NM_004448	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
EZH1	2145	genome.wustl.edu	37	17	40858140	40858140	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr17:40858140T>G	ENST00000428826.2	-	16	1845	c.1724A>C	c.(1723-1725)tAt>tCt	p.Y575S	EZH1_ENST00000592743.1_Missense_Mutation_p.Y575S|EZH1_ENST00000415827.2_Missense_Mutation_p.Y566S|EZH1_ENST00000435174.1_Missense_Mutation_p.Y436S|EZH1_ENST00000590783.1_Intron|EZH1_ENST00000590078.1_Missense_Mutation_p.Y505S|EZH1_ENST00000585893.1_Missense_Mutation_p.Y535S			Q92800	EZH1_HUMAN	enhancer of zeste 1 polycomb repressive complex 2 subunit	575	CXC. {ECO:0000255|PROSITE- ProRule:PRU00970}.|Cys-rich.				anatomical structure morphogenesis (GO:0009653)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)			breast(1)|endometrium(4)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	27		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)		CACTGCCAGATAGCAAGGACA	0.522																																																0			17											173.0	126.0	142.0					17																	40858140		2203	4300	6503	38111666	SO:0001583	missense	2145				CCDS32659.1	17q21.1-q21.3	2014-05-28	2014-05-28			ENSG00000108799		"""Chromatin-modifying enzymes / K-methyltransferases"""	3526	protein-coding gene	gene with protein product		601674	"""enhancer of zeste (Drosophila) homolog 1"", ""enhancer of zeste homolog 1 (Drosophila)"""			8921387	Standard	NM_001991		Approved	KIAA0388, KMT6B	uc002iaz.3	Q92800		ENST00000428826.2:c.1724A>C	17.37:g.40858140T>G	ENSP00000404658:p.Tyr575Ser	Somatic		Capture	Illumina GAIIx	4	38111666	A6NCH6|B4DIJ1|B4DIZ7|B4DSS2|B4E3R7|O43287|Q14459|Q53XP3	Missense_Mutation	SNP	HMMSmart_SM00717,PatternScan_AP_NUCLEASE_F2_1,superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317	p.Y575S	ENST00000428826.2	37	c.1724	CCDS32659.1	17	.	.	.	.	.	.	.	.	.	.	T	27.9	4.871042	0.91587	.	.	ENSG00000108799	ENST00000264646;ENST00000428826;ENST00000415827;ENST00000435174	T;T	0.80033	-1.33;-1.33	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.90741	0.7094	M	0.86573	2.825	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.998	D;D;D;D;D	0.91635	0.999;0.991;0.991;0.991;0.98	D	0.92378	0.5911	10	0.87932	D	0	.	15.4593	0.75342	0.0:0.0:0.0:1.0	.	436;535;581;505;575	Q92800-5;Q92800-3;Q92800-2;Q92800-4;Q92800	.;.;.;.;EZH1_HUMAN	S	578;575;535;436	ENSP00000404658:Y575S;ENSP00000404071:Y436S	ENSP00000264646:Y578S	Y	-	2	0	EZH1	38111666	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.864000	0.87037	2.229000	0.72834	0.533000	0.62120	TAT	-	superfamily_SET domain		0.522	EZH1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EZH1	protein_coding	OTTHUMT00000452347.1	T	NM_001991		38111666	-1	no_errors	NM_001991	genbank	human	validated	54_36p	missense	SNP	1.000	G
EEF1A1P7	390924	genome.wustl.edu	37	19	35873201	35873201	+	IGR	SNP	A	A	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr19:35873201A>T								GPR42 (9346 upstream) : AC002511.1 (23307 downstream)																							AAGAAATTTGAGAAGAAGGCT	0.453																																																0			19																																								40565041	SO:0001628	intergenic_variant	0																															19.37:g.35873201A>T		Somatic		Capture	Illumina GAIIx	4	40565041		RNA	SNP	-	NULL		37	NULL		19																																																																																			-	-	0	0.453					ENSG00000221435			A			40565041	+1	no_errors	ENST00000408508	ensembl	human	novel	54_36p	rna	SNP	1.000	T
TREML3P	340206	genome.wustl.edu	37	6	41185623	41185623	+	RNA	SNP	G	G	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr6:41185623G>T	ENST00000564680.1	-	0	62									triggering receptor expressed on myeloid cells-like 3, pseudogene																		GCTGACACCAGGATTTGGGCT	0.517																																																0			6																																								41293601			340206			AF534825		6p21.1	2012-04-20	2012-04-20	2012-04-20	ENSG00000184106	ENSG00000184106			30806	pseudogene	pseudogene	"""TREM like transcript 3"""	609716	"""triggering receptor expressed on myeloid cells-like 3"""	TREML3		12645956	Standard	NR_027256		Approved	TLT3	uc003oqb.3		OTTHUMG00000177313		6.37:g.41185623G>T		Somatic		Capture	Illumina GAIIx	4	41293601		Silent	SNP	superfamily_Immunoglobulin	p.S21	ENST00000564680.1	37	c.63		6																																																																																			-	superfamily_Immunoglobulin		0.517	TREML3P-002	KNOWN	basic	processed_transcript	TREML3	pseudogene	OTTHUMT00000436224.1	G			41293601	-1	no_start_codon	ENST00000332842	ensembl	human	known	54_36p	silent	SNP	0.000	T
IKBKB	3551	genome.wustl.edu	37	8	42171902	42171902	+	Missense_Mutation	SNP	C	C	T	rs374916045		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr8:42171902C>T	ENST00000520810.1	+	9	941	c.755C>T	c.(754-756)aCg>aTg	p.T252M	IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000520835.1_Missense_Mutation_p.T250M|IKBKB_ENST00000416505.2_Missense_Mutation_p.T193M|IKBKB_ENST00000379708.3_Missense_Mutation_p.T29M	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	252	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TTGAATGGAACGGTGAAGTTT	0.408																																																0			8						C	MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	288.0	252.0	264.0		749,578,755	2.9	0.0	8		264	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	IKBKB	NM_001190720.2,NM_001242778.1,NM_001556.2	81,81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	250/755,193/698,252/757	42171902	1,13005	2203	4300	6503	42291059	SO:0001583	missense	3551			AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.755C>T	8.37:g.42171902C>T	ENSP00000430684:p.Thr252Met	Somatic		Capture	Illumina GAIIx	4	42291059	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	PatternScan_PROTEIN_KINASE_ATP,superfamily_Kinase_like,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST,HMMPfam_ubiquitin	p.T252M	ENST00000520810.1	37	c.755	CCDS6128.1	8	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029345	0.54790	0.0	1.16E-4	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	T;T;T;T	0.66280	-0.2;-0.2;-0.2;2.93	5.95	2.87	0.33458	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.667620	0.16214	N	0.224323	T	0.58595	0.2133	L	0.38838	1.175	0.09310	N	1	P;P;P;D;P;D	0.54601	0.702;0.749;0.834;0.967;0.507;0.967	B;B;B;P;B;P	0.53809	0.367;0.397;0.169;0.735;0.404;0.735	T	0.47289	-0.9129	10	0.51188	T	0.08	.	6.4459	0.21875	0.1862:0.6394:0.1001:0.0743	.	193;250;29;203;252;252	B4E0U4;O14920-2;B3KRB7;Q59GL9;O14920;Q32ND9	.;.;.;.;IKKB_HUMAN;.	M	252;193;250;29	ENSP00000430684:T252M;ENSP00000404920:T193M;ENSP00000430868:T250M;ENSP00000369030:T29M	ENSP00000369030:T29M	T	+	2	0	IKBKB	42291059	0.023000	0.18921	0.004000	0.12327	0.619000	0.37552	2.281000	0.43452	1.521000	0.48983	0.655000	0.94253	ACG	-	superfamily_Kinase_like		0.408	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKB	protein_coding	OTTHUMT00000377214.1	C			42291059	+1	no_errors	NM_001556	genbank	human	validated	54_36p	missense	SNP	0.945	T
SIK1	150094	genome.wustl.edu	37	21	44836782	44836782	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr21:44836782T>A	ENST00000270162.6	-	14	2324	c.2192A>T	c.(2191-2193)cAc>cTc	p.H731L		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	731					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	AATGTGCAGGTGTGTGTCCAG	0.756																																																0			21											9.0	10.0	9.0					21																	44836782		2141	4167	6308	43661210	SO:0001583	missense	150094			BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.2192A>T	21.37:g.44836782T>A	ENSP00000270162:p.His731Leu	Somatic		Capture	Illumina GAIIx	4	43661210	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Missense_Mutation	SNP	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_UBA	p.H731L	ENST00000270162.6	37	c.2192	CCDS33575.1	21	.	.	.	.	.	.	.	.	.	.	T	11.50	1.655955	0.29425	.	.	ENSG00000142178	ENST00000270162	T	0.71698	-0.59	5.07	3.86	0.44501	.	0.181720	0.49305	D	0.000146	T	0.54515	0.1863	L	0.32530	0.975	0.40338	D	0.979008	B	0.21606	0.058	B	0.18561	0.022	T	0.53809	-0.8386	10	0.37606	T	0.19	.	6.2884	0.21047	0.0:0.0825:0.1606:0.757	.	731	P57059	SIK1_HUMAN	L	731	ENSP00000270162:H731L	ENSP00000270162:H731L	H	-	2	0	SIK1	43661210	1.000000	0.71417	0.987000	0.45799	0.007000	0.05969	2.131000	0.42074	1.904000	0.55121	0.533000	0.62120	CAC	-	NULL		0.756	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK1	protein_coding	OTTHUMT00000195654.1	T	NM_173354		43661210	-1	no_errors	NM_173354	genbank	human	validated	54_36p	missense	SNP	1.000	A
KDM4A	9682	genome.wustl.edu	37	1	44134890	44134890	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:44134890C>T	ENST00000372396.3	+	10	1417	c.1283C>T	c.(1282-1284)aCg>aTg	p.T428M		NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	428					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						TATGAGATGACGGAGTGCCCG	0.547																																																0			1											143.0	138.0	140.0					1																	44134890		2203	4300	6503	43907477	SO:0001583	missense	9682			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.1283C>T	1.37:g.44134890C>T	ENSP00000361473:p.Thr428Met	Somatic		Capture	Illumina GAIIx	4	43907477	Q5VVB1	Missense_Mutation	SNP	HMMSmart_SM00545,HMMPfam_JmjN,HMMSmart_SM00558,HMMPfam_JmjC,HMMSmart_SM00249,superfamily_FYVE/PHD zinc finger,HMMPfam_PHD,HMMSmart_SM00333,superfamily_Tudor/PWWP/MBT	p.T428M	ENST00000372396.3	37	c.1283	CCDS491.1	1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.749974	0.49257	.	.	ENSG00000066135	ENST00000372396	T	0.15834	2.39	5.23	3.07	0.35406	.	1.011120	0.07892	N	0.971293	T	0.11367	0.0277	L	0.43152	1.355	0.27068	N	0.963381	P;D	0.53151	0.658;0.958	B;B	0.32289	0.116;0.143	T	0.23511	-1.0186	10	0.48119	T	0.1	-2.9444	5.3714	0.16142	0.2463:0.6522:0.0:0.1015	.	428;428	B4DT38;O75164	.;KDM4A_HUMAN	M	428	ENSP00000361473:T428M	ENSP00000361473:T428M	T	+	2	0	KDM4A	43907477	0.168000	0.22989	1.000000	0.80357	0.993000	0.82548	1.050000	0.30404	1.340000	0.45581	0.561000	0.74099	ACG	-	NULL		0.547	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD2A	protein_coding	OTTHUMT00000019960.1	C	NM_014663		43907477	+1	no_errors	NM_014663	genbank	human	reviewed	54_36p	missense	SNP	0.990	T
POMGNT1	55624	genome.wustl.edu	37	1	46660041	46660041	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:46660041T>G	ENST00000371984.3	-	9	941	c.784A>C	c.(784-786)Aac>Cac	p.N262H	POMGNT1_ENST00000535522.1_Missense_Mutation_p.N240H|POMGNT1_ENST00000371992.1_Missense_Mutation_p.N262H|POMGNT1_ENST00000396420.3_3'UTR|POMGNT1_ENST00000485714.1_5'Flank|POMGNT1_ENST00000371986.3_Missense_Mutation_p.N262H	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)	262					protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					CGGCGACGGTTCAGCTCTGTG	0.602																																																0			1											76.0	75.0	75.0					1																	46660041		2203	4300	6503	46432628	SO:0001583	missense	55624				CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.784A>C	1.37:g.46660041T>G	ENSP00000361052:p.Asn262His	Somatic		Capture	Illumina GAIIx	4	46432628	D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Missense_Mutation	SNP	superfamily_Nucleotide-diphospho-sugar transferases,HMMPfam_GNT-I	p.N262H	ENST00000371984.3	37	c.784	CCDS531.1	1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517506	0.85495	.	.	ENSG00000085998	ENST00000371984;ENST00000371992;ENST00000535522;ENST00000371986	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.90113	0.6911	M	0.72118	2.19	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.997	D;D;D	0.70016	0.967;0.928;0.921	D	0.91028	0.4862	10	0.66056	D	0.02	-32.9003	15.8259	0.78706	0.0:0.0:0.0:1.0	.	240;262;262	F5H827;Q5VST3;Q8WZA1	.;.;PMGT1_HUMAN	H	262;262;240;262	ENSP00000361052:N262H;ENSP00000361060:N262H;ENSP00000443767:N240H;ENSP00000361054:N262H	ENSP00000361052:N262H	N	-	1	0	POMGNT1	46432628	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.555000	0.82223	2.141000	0.66446	0.454000	0.30748	AAC	-	NULL		0.602	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT1	protein_coding	OTTHUMT00000020146.1	T	NM_017739		46432628	-1	no_errors	NM_017739	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CACNA1F	778	genome.wustl.edu	37	X	49066098	49066098	+	Silent	SNP	G	G	A	rs368972015		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chrX:49066098G>A	ENST00000376265.2	-	41	4906	c.4845C>T	c.(4843-4845)tcC>tcT	p.S1615S	CACNA1F_ENST00000323022.5_Silent_p.S1604S|CACNA1F_ENST00000376251.1_Silent_p.S1550S	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1615					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTGAAGGGCGGAAGAGGTGC	0.557																																																0			X						G		1,3833		0,1,1631,570	64.0	46.0	52.0		4845	2.8	1.0	X		52	0,6728		0,0,2428,1872	no	coding-synonymous	CACNA1F	NM_005183.2		0,1,4059,2442	AA,AG,GG,G		0.0,0.0261,0.0095		1615/1978	49066098	1,10561	2202	4300	6502	48953042	SO:0001819	synonymous_variant	778			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.4845C>T	X.37:g.49066098G>A		Somatic		Capture	Illumina GAIIx	4	48953042	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ	p.S1615	ENST00000376265.2	37	c.4845	CCDS35253.1	X																																																																																			-	NULL		0.557	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	protein_coding	OTTHUMT00000358157.1	G	NM_005183		48953042	-1	no_errors	NM_005183	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
ALDH16A1	126133	genome.wustl.edu	37	19	49972172	49972172	+	Missense_Mutation	SNP	C	C	T	rs139039890	byFrequency	TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr19:49972172C>T	ENST00000293350.4	+	16	2339	c.2176C>T	c.(2176-2178)Cgg>Tgg	p.R726W	ALDH16A1_ENST00000540132.1_Missense_Mutation_p.R563W|CTD-3148I10.9_ENST00000599536.1_Intron|ALDH16A1_ENST00000455361.2_Missense_Mutation_p.R675W|ALDH16A1_ENST00000433981.2_Missense_Mutation_p.R561W	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	726						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		GACAGGAGACCGGGACCATCT	0.602													C|||	10	0.00199681	0.0076	0.0	5008	,	,		15599	0.0		0.0	False		,,,				2504	0.0															0			19						C	TRP/ARG,TRP/ARG	20,4386	27.2+/-55.0	0,20,2183	148.0	130.0	136.0		2023,2176	3.8	0.9	19	dbSNP_134	136	0,8600		0,0,4300	yes	missense,missense	ALDH16A1	NM_001145396.1,NM_153329.3	101,101	0,20,6483	TT,TC,CC		0.0,0.4539,0.1538	probably-damaging,probably-damaging	675/752,726/803	49972172	20,12986	2203	4300	6503	54663984	SO:0001583	missense	126133			AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.2176C>T	19.37:g.49972172C>T	ENSP00000293350:p.Arg726Trp	Somatic		Capture	Illumina GAIIx	4	54663984	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	superfamily_ALDH-like,HMMPfam_Aldedh	p.R726W	ENST00000293350.4	37	c.2176	CCDS12766.1	19	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	C	19.90	3.913589	0.72983	0.004539	0.0	ENSG00000161618	ENST00000293350;ENST00000455361;ENST00000540132;ENST00000433981	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	4.8	3.76	0.43208	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.393425	0.23780	N	0.044629	T	0.45657	0.1353	M	0.83774	2.66	0.43283	D	0.995255	D;D;D	0.76494	0.999;0.998;0.998	D;P;P	0.68765	0.96;0.828;0.896	T	0.53947	-0.8366	10	0.66056	D	0.02	-9.2078	9.1545	0.36985	0.0:0.8975:0.0:0.1025	.	563;675;726	F5H4B6;B4DLQ1;Q8IZ83	.;.;A16A1_HUMAN	W	726;675;563;561	ENSP00000293350:R726W;ENSP00000410142:R675W;ENSP00000445088:R563W;ENSP00000398675:R561W	ENSP00000293350:R726W	R	+	1	2	ALDH16A1	54663984	0.031000	0.19500	0.909000	0.35828	0.976000	0.68499	1.345000	0.33953	1.166000	0.42689	0.456000	0.33151	CGG	-	superfamily_ALDH-like,HMMPfam_Aldedh		0.602	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH16A1	protein_coding	OTTHUMT00000465358.1	C	NM_153329		54663984	+1	no_errors	NM_153329	genbank	human	validated	54_36p	missense	SNP	0.985	T
NABP2	79035	genome.wustl.edu	37	12	56620151	56620151	+	Silent	SNP	C	C	T	rs202142173		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr12:56620151C>T	ENST00000380198.2	+	5	882	c.384C>T	c.(382-384)gaC>gaT	p.D128D	NABP2_ENST00000267023.4_Silent_p.D128D|NABP2_ENST00000341463.5_Silent_p.D128D			Q9BQ15	SOSB1_HUMAN	nucleic acid binding protein 2	128					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)|SOSS complex (GO:0070876)	single-stranded DNA binding (GO:0003697)										TGCAGAACGACAGCAACCCTT	0.542													c|||	1	0.000199681	0.0	0.0	5008	,	,		15244	0.0		0.001	False		,,,				2504	0.0															0			12											234.0	186.0	202.0					12																	56620151		2203	4300	6503	54906418	SO:0001819	synonymous_variant	79035			BC006171	CCDS8911.1	12q13.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000139579	ENSG00000139579			28412	protein-coding gene	gene with protein product	"""single strand DNA-binding protein 1"", ""sensor of single-strand DNA complex subunit B1"""	612104	"""oligonucleotide/oligosaccharide-binding fold containing 2B"""	OBFC2B			Standard	NM_024068		Approved	MGC2731, SSB1, hSSB1, SOSS-B1	uc001ski.3	Q9BQ15	OTTHUMG00000152527	ENST00000380198.2:c.384C>T	12.37:g.56620151C>T		Somatic		Capture	Illumina GAIIx	4	54906418	A6NDF8|Q6XYC8	Silent	SNP	superfamily_Nucleic acid-binding proteins,HMMPfam_tRNA_anti	p.D128	ENST00000380198.2	37	c.384	CCDS8911.1	12																																																																																			-	NULL		0.542	NABP2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OBFC2B	protein_coding	OTTHUMT00000326610.1	C	NM_024068		54906418	+1	no_errors	NM_024068	genbank	human	validated	54_36p	silent	SNP	1.000	T
RAX	30062	genome.wustl.edu	37	18	56939652	56939652	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr18:56939652C>G	ENST00000334889.3	-	2	670	c.484G>C	c.(484-486)Gac>Cac	p.D162H	RAX_ENST00000256852.7_Intron	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	162					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		CTGTACACGTCCGGGTAGTGG	0.627																																					GBM(150;770 1898 17679 24325 37807)											0			18											71.0	70.0	70.0					18																	56939652		2203	4300	6503	55090632	SO:0001583	missense	30062			AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.484G>C	18.37:g.56939652C>G	ENSP00000334813:p.Asp162His	Somatic		Capture	Illumina GAIIx	4	55090632	Q86V11	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1,HMMPfam_OAR	p.D162H	ENST00000334889.3	37	c.484	CCDS11972.1	18	.	.	.	.	.	.	.	.	.	.	C	36	5.721796	0.96839	.	.	ENSG00000134438	ENST00000334889	D	0.96041	-3.89	6.04	6.04	0.98038	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98516	0.9505	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99047	1.0826	10	0.87932	D	0	.	19.3507	0.94384	0.0:1.0:0.0:0.0	.	162	Q9Y2V3	RX_HUMAN	H	162	ENSP00000334813:D162H	ENSP00000334813:D162H	D	-	1	0	RAX	55090632	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.797000	0.85911	2.873000	0.98535	0.561000	0.74099	GAC	-	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox		0.627	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAX	protein_coding	OTTHUMT00000256128.2	C			55090632	-1	no_errors	NM_013435	genbank	human	validated	54_36p	missense	SNP	1.000	G
RNY4P29	100873823	genome.wustl.edu	37	13	59103056	59103056	+	RNA	SNP	A	A	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr13:59103056A>G	ENST00000410801.1	-	0	0									RNA, Ro-associated Y4 pseudogene 29																		CAAAAAGAGTATGAAAGCTAT	0.393																																																0			13																																								58001057			341689					13q21.1	2011-08-03			ENSG00000222733	ENSG00000222733			42497	pseudogene	RNA, pseudogene							Standard	NG_032603		Approved						13.37:g.59103056A>G		Somatic		Capture	Illumina GAIIx	4	58001057		RNA	SNP	-	NULL	ENST00000410801.1	37	NULL		13																																																																																			-	-		0.393	RNY4P29-201	KNOWN	basic	misc_RNA	LOC341689	misc_RNA		A			58001057	+1	no_errors	XR_017487	genbank	human	model	54_36p	rna	SNP	0.515	G
VN1R6P	653753	genome.wustl.edu	37	19	53819253	53819253	+	IGR	SNP	G	G	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr19:53819253G>A								FAM90A28P (7356 upstream) : ZNF845 (17748 downstream)																							CTCATGAGCTGTGACCCCAGT	0.393																																																0			19																																								58511065	SO:0001628	intergenic_variant	0																															19.37:g.53819253G>A		Somatic		Capture	Illumina GAIIx	4	58511065		RNA	SNP	-	NULL		37	NULL		19																																																																																			-	-	0	0.393					LOC653753			G			58511065	+1	pseudogene	XR_039415	genbank	human	model	54_36p	rna	SNP	0.000	A
OR4D6	219983	genome.wustl.edu	37	11	59224755	59224755	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr11:59224755G>T	ENST00000300127.2	+	1	345	c.322G>T	c.(322-324)Ggt>Tgt	p.G108C		NM_001004708.1	NP_001004708.1	Q8NGJ1	OR4D6_HUMAN	olfactory receptor, family 4, subfamily D, member 6	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	34						CCACTTTGCTGGTGGGGCAGA	0.468																																																0			11											164.0	163.0	163.0					11																	59224755		2201	4295	6496	58981331	SO:0001583	missense	219983			AB065803	CCDS31562.1	11q12.1	2012-08-09			ENSG00000166884	ENSG00000166884		"""GPCR / Class A : Olfactory receptors"""	15175	protein-coding gene	gene with protein product							Standard	NM_001004708		Approved		uc010rku.2	Q8NGJ1	OTTHUMG00000167340	ENST00000300127.2:c.322G>T	11.37:g.59224755G>T	ENSP00000300127:p.Gly108Cys	Somatic		Capture	Illumina GAIIx	4	58981331	B2RNP7|Q6IFF5|Q96R74	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G108C	ENST00000300127.2	37	c.322	CCDS31562.1	11	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430560	0.62844	.	.	ENSG00000166884	ENST00000300127	T	0.00406	7.55	6.0	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000047	T	0.01353	0.0044	M	0.90595	3.13	0.25499	N	0.987574	D	0.58970	0.984	P	0.60473	0.875	T	0.14896	-1.0456	10	0.72032	D	0.01	-8.2848	14.1113	0.65123	0.0727:0.0:0.9273:0.0	.	108	Q8NGJ1	OR4D6_HUMAN	C	108	ENSP00000300127:G108C	ENSP00000300127:G108C	G	+	1	0	OR4D6	58981331	0.616000	0.27035	0.998000	0.56505	0.998000	0.95712	2.768000	0.47645	1.542000	0.49330	0.650000	0.86243	GGT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.468	OR4D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D6	protein_coding	OTTHUMT00000394234.1	G	NM_001004708		58981331	+1	no_errors	NM_001004708	genbank	human	provisional	54_36p	missense	SNP	0.001	T
ZP1	22917	genome.wustl.edu	37	11	60637083	60637083	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr11:60637083C>T	ENST00000278853.5	+	3	392	c.392C>T	c.(391-393)gCt>gTt	p.A131V		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	131					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						GCACAAGACGCTACTCTGATC	0.582																																																0			11											143.0	137.0	139.0					11																	60637083		2203	4299	6502	60393659	SO:0001583	missense	22917			BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.392C>T	11.37:g.60637083C>T	ENSP00000278853:p.Ala131Val	Somatic		Capture	Illumina GAIIx	4	60393659		Missense_Mutation	SNP	superfamily_P_trefoil,PatternScan_P_TREFOIL,HMMPfam_Zona_pellucida,HMMSmart_ZP,PatternScan_ZP_1	p.A131V	ENST00000278853.5	37	c.392	CCDS31572.1	11	.	.	.	.	.	.	.	.	.	.	C	1.401	-0.578099	0.03854	.	.	ENSG00000149506	ENST00000278853	T	0.20598	2.06	4.5	-2.81	0.05805	.	1.558530	0.04267	N	0.341366	T	0.04363	0.0120	N	0.00210	-1.845	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44283	-0.9338	10	0.02654	T	1	-3.2458	10.8189	0.46593	0.0:0.1498:0.0:0.8502	.	131	P60852	ZP1_HUMAN	V	131	ENSP00000278853:A131V	ENSP00000278853:A131V	A	+	2	0	ZP1	60393659	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.035000	0.12205	-0.382000	0.07870	0.460000	0.39030	GCT	-	NULL		0.582	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZP1	protein_coding	OTTHUMT00000396329.1	C	NM_207341		60393659	+1	no_errors	NM_207341	genbank	human	validated	54_36p	missense	SNP	0.000	T
ANK3	288	genome.wustl.edu	37	10	61967941	61967941	+	Silent	SNP	G	G	A	rs117138204	byFrequency	TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr10:61967941G>A	ENST00000280772.2	-	10	1238	c.1047C>T	c.(1045-1047)tgC>tgT	p.C349C	ANK3_ENST00000503366.1_Silent_p.C332C|ANK3_ENST00000373827.2_Silent_p.C343C	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	349					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GAAGCTGGACGCAGTTTAAAT	0.448													G|||	14	0.00279553	0.003	0.0029	5008	,	,		18128	0.0		0.008	False		,,,				2504	0.0															0			10						G	,,	22,4384	28.1+/-56.4	0,22,2181	170.0	133.0	146.0		1029,996,1047	-2.8	1.0	10	dbSNP_132	146	74,8526	44.9+/-103.4	1,72,4227	no	coding-synonymous,coding-synonymous,coding-synonymous	ANK3	NM_001204403.1,NM_001204404.1,NM_020987.3	,,	1,94,6408	AA,AG,GG		0.8605,0.4993,0.7381	,,	343/1862,332/1869,349/4378	61967941	96,12910	2203	4300	6503	61637947	SO:0001819	synonymous_variant	288			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.1047C>T	10.37:g.61967941G>A		Somatic		Capture	Illumina GAIIx	4	61637947	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK,HMMPfam_ZU5,HMMSmart_ZU5,superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death	p.C349	ENST00000280772.2	37	c.1047	CCDS7258.1	10																																																																																			-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.448	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	G	NM_020987		61637947	-1	no_errors	NM_020987	genbank	human	reviewed	54_36p	silent	SNP	0.994	A
PPP6R3	55291	genome.wustl.edu	37	11	68371006	68371006	+	Intron	SNP	G	G	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr11:68371006G>T	ENST00000393800.2	+	22	2704				PPP6R3_ENST00000265636.5_Intron|PPP6R3_ENST00000265637.4_Intron|PPP6R3_ENST00000393799.2_Missense_Mutation_p.G821V|PPP6R3_ENST00000393801.3_Intron|PPP6R3_ENST00000524845.1_Intron|PPP6R3_ENST00000527403.2_Intron|PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000529710.1_Intron|PPP6R3_ENST00000524904.1_Intron	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3						regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TTATTGGGAGGATGGTGGGGC	0.423																																																0			11											47.0	41.0	43.0					11																	68371006		2200	4294	6494	68127582	SO:0001627	intron_variant	55291			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.2450+46G>T	11.37:g.68371006G>T		Somatic		Capture	Illumina GAIIx	4	68127582	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	HMMPfam_SAPS	p.G821V	ENST00000393800.2	37	c.2462	CCDS53672.1	11	.	.	.	.	.	.	.	.	.	.	G	7.836	0.720983	0.15372	.	.	ENSG00000110075	ENST00000393799	T	0.21543	2.0	4.67	0.312	0.15837	.	0.856525	0.09132	U	0.844245	T	0.14570	0.0352	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34453	-0.9828	7	0.33940	T	0.23	.	3.5692	0.07910	0.0913:0.312:0.4363:0.1604	.	.	.	.	V	821	ENSP00000377388:G821V	ENSP00000377388:G821V	G	+	2	0	PPP6R3	68127582	0.153000	0.22777	0.000000	0.03702	0.001000	0.01503	0.659000	0.24994	-0.125000	0.11703	-0.175000	0.13238	GGA	-	NULL		0.423	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAPS3	protein_coding	OTTHUMT00000395275.1	G	NM_018312		68127582	+1	no_errors	ENST00000393801	ensembl	human	known	54_36p	missense	SNP	0.377	T
LOC102724392	102724392	genome.wustl.edu	37	5	70671702	70671702	+	lincRNA	SNP	A	A	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr5:70671702A>C	ENST00000502659.2	-	0	698				RP11-136K7.3_ENST00000518473.1_lincRNA|PMCHL2_ENST00000450213.2_RNA																							TCTGGTTATAAAACCTTATCT	0.383																																																0			5																																								70707458			5370																															5.37:g.70671702A>C		Somatic		Capture	Illumina GAIIx	4	70707458		Missense_Mutation	SNP	HMMPfam_Pro-MCH	p.K24Q	ENST00000502659.2	37	c.70		5																																																																																			-	HMMPfam_Pro-MCH		0.383	RP11-136K7.2-001	KNOWN	basic	lincRNA	PMCHL2	lincRNA	OTTHUMT00000374679.1	A			70707458	+1	no_errors	ENST00000306564	ensembl	human	known	54_36p	missense	SNP	0.928	C
TJP2	9414	genome.wustl.edu	37	9	71840954	71840954	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr9:71840954C>T	ENST00000377245.4	+	7	1281	c.1073C>T	c.(1072-1074)aCt>aTt	p.T358I	TJP2_ENST00000535702.1_Missense_Mutation_p.T362I|TJP2_ENST00000348208.4_Missense_Mutation_p.T358I|TJP2_ENST00000539225.1_Missense_Mutation_p.T389I|TJP2_ENST00000265384.7_Missense_Mutation_p.T358I|TJP2_ENST00000453658.2_Missense_Mutation_p.T335I	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	358	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						GGGACTGTAACTGAGAACATG	0.343																																																0			9											63.0	66.0	65.0					9																	71840954		2203	4300	6503	71030774	SO:0001583	missense	9414			L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.1073C>T	9.37:g.71840954C>T	ENSP00000366453:p.Thr358Ile	Somatic		Capture	Illumina GAIIx	4	71030774	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,superfamily_SH3-domain,HMMPfam_SH3_2,HMMSmart_SM00072,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Guanylate_kin	p.T358I	ENST00000377245.4	37	c.1073	CCDS6627.1	9	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411000	0.83340	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000265384;ENST00000535702;ENST00000539225	T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17	6.04	5.14	0.70334	PDZ/DHR/GLGF (4);	0.092145	0.85682	D	0.000000	T	0.55081	0.1898	L	0.47190	1.495	0.80722	D	1	D;D;D;D;D	0.76494	0.995;0.982;0.973;0.999;0.995	D;D;P;D;D	0.75484	0.929;0.945;0.626;0.986;0.947	T	0.58758	-0.7580	10	0.72032	D	0.01	.	17.5323	0.87818	0.0:0.8764:0.1236:0.0	.	389;362;358;358;358	F5H301;F5H886;Q9UDY2-2;Q9UDY2;Q9UDY2-5	.;.;.;ZO2_HUMAN;.	I	335;358;358;358;362;389	ENSP00000392178:T335I;ENSP00000366453:T358I;ENSP00000345893:T358I;ENSP00000265384:T358I;ENSP00000442090:T362I;ENSP00000438262:T389I	ENSP00000265384:T358I	T	+	2	0	TJP2	71030774	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	4.966000	0.63715	1.560000	0.49568	0.563000	0.77884	ACT	-	superfamily_PDZ domain-like,HMMSmart_SM00228,HMMPfam_PDZ		0.343	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP2	protein_coding	OTTHUMT00000052572.2	C	NM_201629		71030774	+1	no_errors	NM_004817	genbank	human	validated	54_36p	missense	SNP	1.000	T
ENAM	10117	genome.wustl.edu	37	4	71508977	71508977	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr4:71508977T>A	ENST00000396073.3	+	9	2115	c.1834T>A	c.(1834-1836)Tca>Aca	p.S612T	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	612					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			CAGGGAAAACTCACCATACCT	0.448																																																0			4											149.0	155.0	153.0					4																	71508977		2203	4300	6503	71727841	SO:0001583	missense	10117			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1834T>A	4.37:g.71508977T>A	ENSP00000379383:p.Ser612Thr	Somatic		Capture	Illumina GAIIx	4	71727841	Q17RI5|Q9H3D1	Missense_Mutation	SNP	NULL	p.S612T	ENST00000396073.3	37	c.1834	CCDS3544.2	4	.	.	.	.	.	.	.	.	.	.	T	9.540	1.113239	0.20795	.	.	ENSG00000132464	ENST00000396073	T	0.34472	1.36	5.31	0.128	0.14733	.	0.923924	0.09077	N	0.851833	T	0.47395	0.1443	M	0.83603	2.65	0.09310	N	1	P	0.48911	0.917	P	0.52793	0.709	T	0.35425	-0.9789	10	0.27785	T	0.31	-1.6695	4.014	0.09636	0.0:0.3073:0.1834:0.5093	.	612	Q9NRM1	ENAM_HUMAN	T	612	ENSP00000379383:S612T	ENSP00000379383:S612T	S	+	1	0	ENAM	71727841	0.000000	0.05858	0.003000	0.11579	0.199000	0.23934	-0.547000	0.06055	-0.090000	0.12462	0.533000	0.62120	TCA	-	NULL		0.448	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	protein_coding	OTTHUMT00000252166.3	T	NM_031889		71727841	+1	no_errors	NM_031889	genbank	human	validated	54_36p	missense	SNP	0.000	A
TRPA1	8989	genome.wustl.edu	37	8	72964842	72964842	+	Missense_Mutation	SNP	C	C	G	rs148585412		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr8:72964842C>G	ENST00000262209.4	-	14	2010	c.1803G>C	c.(1801-1803)agG>agC	p.R601S	RP11-383H13.1_ENST00000537896.1_3'UTR|RP11-383H13.1_ENST00000524152.1_3'UTR|RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	601					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ACCTTTTGCTCCTGATGATCG	0.423																																																0			8											131.0	115.0	121.0					8																	72964842		2203	4300	6503	73127396	SO:0001583	missense	8989			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1803G>C	8.37:g.72964842C>G	ENSP00000262209:p.Arg601Ser	Somatic		Capture	Illumina GAIIx	4	73127396	A6NIN6	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,PatternScan_EF_HAND_1,HMMPfam_Ion_trans	p.R601S	ENST00000262209.4	37	c.1803	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	C	10.93	1.489301	0.26686	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.61980	0.06;0.06	4.98	1.0	0.19881	Ankyrin repeat-containing domain (1);	0.319914	0.39615	N	0.001308	T	0.48277	0.1491	L	0.56769	1.78	0.30827	N	0.737157	B	0.32302	0.363	B	0.27380	0.079	T	0.48969	-0.8987	10	0.07990	T	0.79	-9.1522	10.2318	0.43260	0.0:0.6417:0.0:0.3583	.	601	O75762	TRPA1_HUMAN	S	453;601	ENSP00000428151:R453S;ENSP00000262209:R601S	ENSP00000262209:R601S	R	-	3	2	TRPA1	73127396	0.957000	0.32711	0.723000	0.30687	0.570000	0.35934	0.359000	0.20233	0.212000	0.20703	0.585000	0.79938	AGG	-	superfamily_Ankyrin repeat,HMMSmart_SM00248		0.423	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	protein_coding	OTTHUMT00000379079.2	C	NM_007332		73127396	-1	no_errors	NM_007332	genbank	human	reviewed	54_36p	missense	SNP	0.708	G
CSPG4	1464	genome.wustl.edu	37	15	75975295	75975295	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr15:75975295T>A	ENST00000308508.5	-	6	4629	c.4537A>T	c.(4537-4539)Atc>Ttc	p.I1513F		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1513	Gly/Ser-rich (glycosaminoglycan attachment domain).				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GGCTGCTCGATGGTGTAGACC	0.692																																																0			15											20.0	21.0	21.0					15																	75975295		2191	4292	6483	73762350	SO:0001583	missense	1464			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.4537A>T	15.37:g.75975295T>A	ENSP00000312506:p.Ile1513Phe	Somatic		Capture	Illumina GAIIx	4	73762350	D3DW77|Q92675	Missense_Mutation	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,PatternScan_ATPASE_ALPHA_BETA	p.I1513F	ENST00000308508.5	37	c.4537	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	.	15.90	2.970384	0.53614	.	.	ENSG00000173546	ENST00000308508	T	0.39056	1.1	4.05	-1.28	0.09318	.	0.406771	0.20804	N	0.085377	T	0.28134	0.0694	M	0.63843	1.955	0.46849	D	0.999221	P	0.35383	0.498	B	0.30572	0.117	T	0.05716	-1.0868	10	0.42905	T	0.14	.	1.0331	0.01542	0.1479:0.1712:0.3061:0.3749	.	1513	Q6UVK1	CSPG4_HUMAN	F	1513	ENSP00000312506:I1513F	ENSP00000312506:I1513F	I	-	1	0	CSPG4	73762350	0.998000	0.40836	0.950000	0.38849	0.416000	0.31233	0.396000	0.20867	-0.330000	0.08514	0.254000	0.18369	ATC	-	NULL		0.692	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	protein_coding	OTTHUMT00000286472.1	T	NM_001897		73762350	-1	no_errors	NM_001897	genbank	human	reviewed	54_36p	missense	SNP	0.331	A
XRRA1	143570	genome.wustl.edu	37	11	74632354	74632354	+	Silent	SNP	G	G	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr11:74632354G>C	ENST00000340360.6	-	8	868	c.537C>G	c.(535-537)gcC>gcG	p.A179A	XRRA1_ENST00000527087.1_Silent_p.A179A|XRRA1_ENST00000533598.1_5'UTR|XRRA1_ENST00000321448.8_5'UTR	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						AATCACAGATGGCCTCCACAG	0.522																																																0			11											86.0	89.0	88.0					11																	74632354		2035	4190	6225	74310002	SO:0001819	synonymous_variant	143570			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.537C>G	11.37:g.74632354G>C		Somatic		Capture	Illumina GAIIx	4	74310002		Silent	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1	p.A179	ENST00000340360.6	37	c.537	CCDS44680.1	11																																																																																			-	superfamily_L domain-like		0.522	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	protein_coding	OTTHUMT00000384715.1	G	NM_182969		74310002	-1	no_errors	NM_182969	genbank	human	validated	54_36p	silent	SNP	1.000	C
ENTHD2	146705	genome.wustl.edu	37	17	79205240	79205240	+	Silent	SNP	C	C	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr17:79205240C>A	ENST00000300714.3	-	10	909	c.852G>T	c.(850-852)ctG>ctT	p.L284L	AC027601.1_ENST00000569559.1_RNA|AC027601.1_ENST00000575922.1_RNA|ENTHD2_ENST00000374769.2_Silent_p.L200L	NM_144679.2	NP_653280.1	Q96N21	AP4AT_HUMAN	ENTH domain containing 2	284						cytoplasmic vesicle (GO:0031410)											GGCAGGTCAGCAGCTGCAGCA	0.677																																																0			17											29.0	20.0	23.0					17																	79205240		2185	4274	6459	76819835	SO:0001819	synonymous_variant	146705			AK056090	CCDS11779.1	17q25.3	2012-07-18	2012-07-18	2012-07-18	ENSG00000167302	ENSG00000167302			26458	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 56"""	C17orf56			Standard	NM_144679		Approved	FLJ31528	uc002jzu.2	Q96N21	OTTHUMG00000177866	ENST00000300714.3:c.852G>T	17.37:g.79205240C>A		Somatic		Capture	Illumina GAIIx	4	76819835	Q6ZQU0|Q6ZSQ9	Silent	SNP	superfamily_ENTH/VHS domain	p.L284	ENST00000300714.3	37	c.852	CCDS11779.1	17																																																																																			-	NULL		0.677	ENTHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf56	protein_coding	OTTHUMT00000439315.1	C	NM_144679		76819835	-1	no_errors	NM_144679	genbank	human	predicted	54_36p	silent	SNP	1.000	A
FAM46A	55603	genome.wustl.edu	37	6	82460166	82460166	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr6:82460166A>C	ENST00000320172.6	-	3	889	c.575T>G	c.(574-576)gTt>gGt	p.V192G	FAM46A_ENST00000369756.3_Missense_Mutation_p.V273G|FAM46A_ENST00000369754.3_Missense_Mutation_p.V211G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	192					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		GCACACTTTAACCATTTTCTG	0.363																																																0			6											33.0	35.0	34.0					6																	82460166		2198	4299	6497	82516885	SO:0001583	missense	55603			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.575T>G	6.37:g.82460166A>C	ENSP00000318298:p.Val192Gly	Somatic		Capture	Illumina GAIIx	4	82516885	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	HMMPfam_DUF1693	p.V192G	ENST00000320172.6	37	c.575	CCDS34489.1	6	.	.	.	.	.	.	.	.	.	.	A	17.57	3.422199	0.62622	.	.	ENSG00000112773	ENST00000369754;ENST00000320172;ENST00000369756	T;T;T	0.34859	1.34;1.34;1.34	5.64	5.64	0.86602	Domain of unknown function DUF1693 (1);	0.000000	0.85682	D	0.000000	T	0.61640	0.2363	M	0.90369	3.11	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.994	T	0.71738	-0.4502	10	0.87932	D	0	-18.6386	15.8494	0.78916	1.0:0.0:0.0:0.0	.	192;211	Q96IP4;Q96IP4-2	FA46A_HUMAN;.	G	211;192;273	ENSP00000358769:V211G;ENSP00000318298:V192G;ENSP00000358771:V273G	ENSP00000318298:V192G	V	-	2	0	FAM46A	82516885	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.339000	0.96797	2.148000	0.66965	0.533000	0.62120	GTT	-	HMMPfam_DUF1693		0.363	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	protein_coding	OTTHUMT00000041331.1	A			82516885	-1	no_errors	NM_017633	genbank	human	validated	54_36p	missense	SNP	1.000	C
PROS1	5627	genome.wustl.edu	37	3	93603626	93603626	+	Missense_Mutation	SNP	C	C	G	rs199469499		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr3:93603626C>G	ENST00000394236.3	-	12	1754	c.1438G>C	c.(1438-1440)Gag>Cag	p.E480Q	PROS1_ENST00000407433.1_Missense_Mutation_p.E349Q	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	480					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	GAGCCCTTCTCCACAGTAACC	0.343																																																0			3											121.0	114.0	116.0					3																	93603626		2203	4300	6503	95086316	SO:0001583	missense	5627				CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.1438G>C	3.37:g.93603626C>G	ENSP00000377783:p.Glu480Gln	Somatic		Capture	Illumina GAIIx	4	95086316	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	HMMSmart_GLA,superfamily_VitK_dep_GLA,HMMPfam_Gla,PatternScan_GLA_1,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMSmart_EGF_CA,HMMPfam_EGF_CA,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_1,HMMPfam_Laminin_G_2	p.E480Q	ENST00000394236.3	37	c.1438	CCDS2923.1	3	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898831	0.72754	.	.	ENSG00000184500	ENST00000394236;ENST00000407433	T;T	0.80393	-1.37;-1.37	3.78	3.78	0.43462	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.87051	0.6081	M	0.84219	2.685	0.58432	D	0.999991	D	0.64830	0.994	P	0.56343	0.796	D	0.86865	0.2032	10	0.30078	T	0.28	.	15.42	0.75003	0.0:1.0:0.0:0.0	.	480	P07225	PROS_HUMAN	Q	480;349	ENSP00000377783:E480Q;ENSP00000385794:E349Q	ENSP00000377783:E480Q	E	-	1	0	PROS1	95086316	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	5.554000	0.67294	1.950000	0.56595	0.561000	0.74099	GAG	-	superfamily_ConA_like_lec_gl		0.343	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROS1	protein_coding	OTTHUMT00000317762.1	C	NM_000313		95086316	-1	no_errors	NM_000313	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CPN1	1369	genome.wustl.edu	37	10	101835745	101835745	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr10:101835745C>T	ENST00000370418.3	-	2	594	c.343G>A	c.(343-345)Gtc>Atc	p.V115I		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	115	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		ATGAGCTGGACGATGCGCTGG	0.617																																																0			10											145.0	118.0	127.0					10																	101835745		2203	4300	6503	101825735	SO:0001583	missense	1369			X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.343G>A	10.37:g.101835745C>T	ENSP00000359446:p.Val115Ile	Somatic		Capture	Illumina GAIIx	4	101825735	B1AP59	Missense_Mutation	SNP	superfamily_Zn-dependent exopeptidases,HMMSmart_SM00631,HMMPfam_Peptidase_M14,PatternScan_CARBOXYPEPT_ZN_1,PatternScan_CARBOXYPEPT_ZN_2,superfamily_Carboxypeptidase regulatory domain	p.V115I	ENST00000370418.3	37	c.343	CCDS7486.1	10	.	.	.	.	.	.	.	.	.	.	C	4.315	0.057800	0.08339	.	.	ENSG00000120054	ENST00000370418	T	0.11063	2.81	5.59	-3.82	0.04281	Peptidase M14, carboxypeptidase A (2);	1.329010	0.04728	N	0.420632	T	0.10594	0.0259	L	0.46157	1.445	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.36672	-0.9738	10	0.39692	T	0.17	-31.586	8.4018	0.32590	0.0:0.212:0.2154:0.5727	.	115	P15169	CBPN_HUMAN	I	115	ENSP00000359446:V115I	ENSP00000359446:V115I	V	-	1	0	CPN1	101825735	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.232000	0.09055	-1.210000	0.02627	-0.768000	0.03414	GTC	-	superfamily_Zn-dependent exopeptidases,HMMSmart_SM00631,HMMPfam_Peptidase_M14		0.617	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPN1	protein_coding	OTTHUMT00000049828.1	C	NM_001308		101825735	-1	no_errors	NM_001308	genbank	human	reviewed	54_36p	missense	SNP	0.096	T
CASP1	834	genome.wustl.edu	37	11	104905082	104905082	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr11:104905082C>G	ENST00000533400.1	-	2	162	c.127G>C	c.(127-129)Gta>Cta	p.V43L	CASP1_ENST00000527979.1_Missense_Mutation_p.V27L|CASP1_ENST00000525825.1_Missense_Mutation_p.V43L|CASP1_ENST00000598974.1_Missense_Mutation_p.V43L|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000446369.1_Intron|CASP1_ENST00000436863.3_Missense_Mutation_p.V43L|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000534497.1_Intron|CASP1_ENST00000531166.1_Intron|CASP1_ENST00000526568.1_Intron|CASP1_ENST00000393136.4_Missense_Mutation_p.V43L|CASP1_ENST00000593315.1_Missense_Mutation_p.V43L|CASP1_ENST00000353247.5_Intron|CASP1_ENST00000528974.1_Missense_Mutation_p.V4L	NM_001257118.1	NP_001244047.1	P29466	CASP1_HUMAN	caspase 1, apoptosis-related cysteine peptidase	43	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic substance (GO:0071310)|execution phase of apoptosis (GO:0097194)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|membrane hyperpolarization (GO:0060081)|mitochondrial depolarization (GO:0051882)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|programmed necrotic cell death (GO:0097300)|proteolysis (GO:0006508)|pyroptosis (GO:0070269)|regulation of inflammatory response (GO:0050727)|response to ATP (GO:0033198)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|IPAF inflammasome complex (GO:0072557)|NLRP1 inflammasome complex (GO:0072558)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|endopeptidase activity (GO:0004175)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)	TCACGTTTTACTTTCTCCATC	0.418																																					NSCLC(41;1246 1743 4934)											0			11											323.0	300.0	308.0					11																	104905082		2202	4299	6501	104410292	SO:0001583	missense	834			U13697	CCDS8329.1, CCDS8330.1, CCDS8331.1, CCDS8332.1, CCDS53704.1	11q23	2012-02-29	2012-02-29		ENSG00000137752	ENSG00000137752		"""Caspases"""	1499	protein-coding gene	gene with protein product	"""caspase-1"", ""interleukin 1, beta, convertase"""	147678	"""caspase 1, apoptosis-related cysteine protease (interleukin 1, beta, convertase)"", ""caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)"""	IL1BC		1373520, 9250871	Standard	NM_033292		Approved	ICE	uc001pim.5	P29466	OTTHUMG00000048072	ENST00000533400.1:c.127G>C	11.37:g.104905082C>G	ENSP00000433138:p.Val43Leu	Somatic		Capture	Illumina GAIIx	4	104410292	B5MDZ1|Q53EY6|Q6DMQ1|Q6GSS3|Q6PI75|Q9UCN3	Missense_Mutation	SNP	HMMSmart_SM00114,superfamily_DEATH domain,HMMPfam_CARD,PatternScan_AMP_BINDING,superfamily_Caspase-like,HMMSmart_SM00115,HMMPfam_Peptidase_C14,PatternScan_CASPASE_HIS,PatternScan_CASPASE_CYS	p.V43L	ENST00000533400.1	37	c.127	CCDS8330.1	11	.	.	.	.	.	.	.	.	.	.	.	6.506	0.461500	0.12342	.	.	ENSG00000137752	ENST00000527979;ENST00000533400;ENST00000436863;ENST00000393136;ENST00000525825;ENST00000528974	T;T;T;T;T;T	0.46451	0.87;1.78;1.78;1.78;1.78;0.87	4.83	-4.05	0.03998	DEATH-like (2);Caspase Recruitment (3);	0.519770	0.21002	N	0.081843	T	0.48696	0.1514	L	0.60845	1.875	0.09310	N	1	P;B;B;B;B	0.38992	0.653;0.01;0.0;0.002;0.007	P;B;B;B;B	0.53649	0.731;0.032;0.002;0.032;0.017	T	0.51787	-0.8661	10	0.37606	T	0.19	.	12.5221	0.56065	0.0:0.2829:0.0:0.7171	.	43;4;43;43;27	B4DKN4;B4DVD8;P29466-2;P29466;G3V169	.;.;.;CASP1_HUMAN;.	L	27;43;43;43;43;4	ENSP00000432340:V27L;ENSP00000433138:V43L;ENSP00000410076:V43L;ENSP00000376844:V43L;ENSP00000434779:V43L;ENSP00000434259:V4L	ENSP00000376844:V43L	V	-	1	0	CASP1	104410292	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.675000	0.05227	-1.119000	0.02958	-0.259000	0.10710	GTA	-	HMMSmart_SM00114,superfamily_DEATH domain,HMMPfam_CARD		0.418	CASP1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CASP1	protein_coding	OTTHUMT00000388116.1	C	NM_033292		104410292	-1	no_errors	NM_033292	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
COL17A1	1308	genome.wustl.edu	37	10	105840428	105840428	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr10:105840428C>A	ENST00000353479.5	-	2	294	c.4G>T	c.(4-6)Gat>Tat	p.D2Y	COL17A1_ENST00000369733.3_Missense_Mutation_p.D2Y|COL17A1_ENST00000393211.3_Missense_Mutation_p.D2Y	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	2	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TTGGTTACATCCATACCATAG	0.328																																																0			10											132.0	122.0	125.0					10																	105840428		2203	4300	6503	105830418	SO:0001583	missense	1308			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.4G>T	10.37:g.105840428C>A	ENSP00000340937:p.Asp2Tyr	Somatic		Capture	Illumina GAIIx	4	105830418	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	HMMPfam_Collagen	p.D2Y	ENST00000353479.5	37	c.4	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131357	0.56828	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872;ENST00000393211	T;T;T	0.50001	0.76;0.76;0.76	5.21	5.21	0.72293	.	0.000000	0.48286	D	0.000188	T	0.67748	0.2926	M	0.69823	2.125	0.46061	D	0.998843	D;D;D	0.76494	0.999;0.999;0.998	D;D;P	0.66497	0.944;0.91;0.879	T	0.71244	-0.4650	10	0.87932	D	0	-11.6445	18.1205	0.89569	0.0:1.0:0.0:0.0	.	2;2;2	Q9UMD9-2;A2A2Y8;Q9UMD9	.;.;COHA1_HUMAN	Y	2	ENSP00000340937:D2Y;ENSP00000358748:D2Y;ENSP00000376905:D2Y	ENSP00000340937:D2Y	D	-	1	0	COL17A1	105830418	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	4.918000	0.63376	2.599000	0.87857	0.655000	0.94253	GAT	-	NULL		0.328	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	protein_coding	OTTHUMT00000050181.1	C	NM_130778, NM_000494		105830418	-1	no_errors	NM_000494	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CD8BP	927	genome.wustl.edu	37	2	107120750	107120750	+	RNA	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr2:107120750C>T	ENST00000416057.1	+	0	587							A6NJW9	CD8BL_HUMAN	CD8b molecule pseudogene						immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TCCAGGCCGGCGGAGGAGAGC	0.607																																																0			2																																								106487182			0					2q12.2	2012-10-03	2006-03-28	2006-03-09	ENSG00000254126	ENSG00000254126			1708	pseudogene	pseudogene			"""CD8 antigen, beta polypeptide 2, pseudogene (p37)"""	CD8B2		1541829	Standard	NG_002423		Approved			A6NJW9	OTTHUMG00000153183		2.37:g.107120750C>T		Somatic		Capture	Illumina GAIIx	4	106487182		Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_V-set,HMMSmart_IG	p.R198W	ENST00000416057.1	37	c.592		2																																																																																			-	NULL		0.607	CD8BP-002	KNOWN	basic	processed_transcript	CD8BP	pseudogene	OTTHUMT00000331218.1	C	XM_166000		106487182	+1	no_errors	ENST00000303432	ensembl	human	known	54_36p	missense	SNP	0.847	T
RPH3A	22895	genome.wustl.edu	37	12	113314560	113314560	+	Missense_Mutation	SNP	G	G	A	rs370825883		TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr12:113314560G>A	ENST00000389385.4	+	13	1557	c.1060G>A	c.(1060-1062)Gga>Aga	p.G354R	RPH3A_ENST00000543106.2_Missense_Mutation_p.G354R|RPH3A_ENST00000551052.1_Missense_Mutation_p.G350R|RPH3A_ENST00000415485.3_Missense_Mutation_p.G354R|RPH3A_ENST00000548866.1_Missense_Mutation_p.G305R|RPH3A_ENST00000447659.2_Missense_Mutation_p.G305R|RPH3A_ENST00000420983.2_Missense_Mutation_p.G354R|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	354	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		CCACCCCTCCGGACCCTATTC	0.662																																																0			12						G	ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	52.0	50.0	51.0		1060,1048	4.4	0.0	12		51	0,8600		0,0,4300	no	missense,missense	RPH3A	NM_001143854.1,NM_014954.3	125,125	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	354/695,350/691	113314560	1,13005	2203	4300	6503	111798943	SO:0001583	missense	22895			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1060G>A	12.37:g.113314560G>A	ENSP00000374036:p.Gly354Arg	Somatic		Capture	Illumina GAIIx	4	111798943	B7Z3C3|Q96AE0	Missense_Mutation	SNP	HMMPfam_RPH3A_effector,superfamily_FYVE_PHD_ZnF,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.G350R	ENST00000389385.4	37	c.1048	CCDS44979.1	12	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305430	0.60305	2.27E-4	0.0	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983;ENST00000549913;ENST00000552755	T;T;T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06;0.06;0.06	5.29	4.4	0.53042	.	0.320980	0.26119	N	0.026229	T	0.67116	0.2859	L	0.59436	1.845	0.19775	N	0.999957	D;D;D;D	0.65815	0.987;0.992;0.992;0.995	P;P;P;P	0.56398	0.727;0.631;0.631;0.797	T	0.58312	-0.7658	10	0.17369	T	0.5	.	11.8154	0.52207	0.0865:0.0:0.9135:0.0	.	305;354;354;350	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	R	354;354;305;350;354;305;354;6;6	ENSP00000440384:G354R;ENSP00000374036:G354R;ENSP00000413254:G305R;ENSP00000448297:G350R;ENSP00000405357:G354R;ENSP00000450347:G305R;ENSP00000408889:G354R	ENSP00000374036:G354R	G	+	1	0	RPH3A	111798943	0.549000	0.26481	0.004000	0.12327	0.004000	0.04260	2.370000	0.44240	1.220000	0.43490	0.511000	0.50034	GGA	-	NULL		0.662	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	protein_coding	OTTHUMT00000405561.1	G	NM_014954		111798943	+1	no_errors	NM_014954	genbank	human	validated	54_36p	missense	SNP	0.153	A
DNAJC25	548645	genome.wustl.edu	37	9	114393962	114393962	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr9:114393962G>C	ENST00000313525.3	+	1	331	c.275G>C	c.(274-276)cGg>cCg	p.R92P	DNAJC25_ENST00000556107.1_Missense_Mutation_p.R92P|DNAJC25-GNG10_ENST00000374294.3_Missense_Mutation_p.R92P|LRRC37A5P_ENST00000374304.1_RNA	NM_001015882.2	NP_001015882.2	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	92	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(1)|skin(4)	8						GGCCCCGGGCGGACGCCGCAG	0.736																																																0			9											2.0	2.0	2.0					9																	114393962		1526	3230	4756	113433783	SO:0001583	missense	0				CCDS43862.1	9q31.3	2011-09-02			ENSG00000059769	ENSG00000059769		"""Heat shock proteins / DNAJ (HSP40)"""	34187	protein-coding gene	gene with protein product							Standard	NM_001015882		Approved	bA16L21.2.1	uc004bfl.3	Q9H1X3	OTTHUMG00000020491	ENST00000313525.3:c.275G>C	9.37:g.114393962G>C	ENSP00000320650:p.Arg92Pro	Somatic		Capture	Illumina GAIIx	4	113433783	Q5QTD8|Q96BN9	Missense_Mutation	SNP	superfamily_DnaJ_N,HMMSmart_DnaJ,HMMPfam_DnaJ,HMMSmart_GGL,HMMPfam_G-gamma	p.R92P	ENST00000313525.3	37	c.275	CCDS43862.1	9	.	.	.	.	.	.	.	.	.	.	G	12.78	2.039239	0.35989	.	.	ENSG00000059769;ENSG00000059769;ENSG00000244115	ENST00000313525;ENST00000556107;ENST00000374294	T	0.46819	0.86	3.6	0.586	0.17434	Heat shock protein DnaJ, N-terminal (5);	0.853808	0.10347	N	0.685637	T	0.29652	0.0740	N	0.14661	0.345	0.09310	N	1	B;B	0.28350	0.008;0.208	B;B	0.34418	0.014;0.182	T	0.33292	-0.9874	10	0.62326	D	0.03	.	4.1126	0.10065	0.277:0.0:0.5559:0.1672	.	92;92	Q9H1X3-3;Q9H1X3	.;DJC25_HUMAN	P	92	ENSP00000320650:R92P	ENSP00000320650:R92P	R	+	2	0	DNAJC25-GNG10;DNAJC25	113433783	0.020000	0.18652	0.151000	0.22473	0.968000	0.65278	0.609000	0.24238	0.272000	0.22027	0.462000	0.41574	CGG	-	superfamily_DnaJ_N,HMMSmart_DnaJ,HMMPfam_DnaJ		0.736	DNAJC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC25-GNG10	protein_coding	OTTHUMT00000156218.3	G	NM_001015882		113433783	+1	no_errors	NM_004125	genbank	human	validated	54_36p	missense	SNP	0.990	C
CCDC80	151887	genome.wustl.edu	37	3	112358642	112358642	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr3:112358642T>A	ENST00000206423.3	-	2	1064	c.111A>T	c.(109-111)aaA>aaT	p.K37N	CCDC80_ENST00000439685.2_Missense_Mutation_p.K37N|CCDC80_ENST00000475181.1_5'UTR	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	37					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						CCAAAGGCACTTTCCGTCCTC	0.567																																																0			3											74.0	66.0	68.0					3																	112358642		2203	4300	6503	113841332	SO:0001583	missense	151887			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.111A>T	3.37:g.112358642T>A	ENSP00000206423:p.Lys37Asn	Somatic		Capture	Illumina GAIIx	4	113841332	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	NULL	p.K37N	ENST00000206423.3	37	c.111	CCDS2968.1	3	.	.	.	.	.	.	.	.	.	.	T	16.09	3.025670	0.54683	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594	T;T	0.51325	0.71;0.71	5.25	0.171	0.15026	.	0.573870	0.19205	N	0.120090	T	0.34048	0.0884	L	0.27053	0.805	0.09310	N	1	P;P;P	0.39665	0.59;0.682;0.455	B;B;B	0.41332	0.354;0.261;0.193	T	0.22312	-1.0220	10	0.72032	D	0.01	-7.3251	9.0171	0.36177	0.0:0.2978:0.0:0.7022	.	48;37;37	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	N	37	ENSP00000206423:K37N;ENSP00000411814:K37N	ENSP00000206423:K37N	K	-	3	2	CCDC80	113841332	0.100000	0.21855	0.003000	0.11579	0.751000	0.42716	0.717000	0.25851	-0.100000	0.12241	0.528000	0.53228	AAA	-	NULL		0.567	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	protein_coding	OTTHUMT00000354219.1	T	NM_199511		113841332	-1	no_errors	NM_199511	genbank	human	validated	54_36p	missense	SNP	0.006	A
ZFP37	7539	genome.wustl.edu	37	9	115805102	115805102	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr9:115805102T>A	ENST00000374227.3	-	4	1823	c.1796A>T	c.(1795-1797)aAa>aTa	p.K599I	ZFP37_ENST00000553380.1_Missense_Mutation_p.K614I|ZFP37_ENST00000555206.1_Missense_Mutation_p.K600I	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	599					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TTCATAGGGTTTTTCTCCAGT	0.363																																																0			9											181.0	163.0	169.0					9																	115805102		2203	4300	6503	114844923	SO:0001583	missense	7539			AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.1796A>T	9.37:g.115805102T>A	ENSP00000363344:p.Lys599Ile	Somatic		Capture	Illumina GAIIx	4	114844923	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	HMMSmart_KRAB,HMMPfam_KRAB,superfamily_Krueppel-associated_box,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.K599I	ENST00000374227.3	37	c.1796	CCDS6787.1	9	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306476	0.60305	.	.	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	T;T;T	0.27720	1.65;1.65;1.65	4.25	4.25	0.50352	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44902	D	0.000413	T	0.59555	0.2202	M	0.88842	2.985	0.34703	D	0.726902	D;D;D	0.76494	0.979;0.979;0.999	D;D;D	0.87578	0.984;0.984;0.998	T	0.75246	-0.3385	10	0.72032	D	0.01	-17.3853	11.9811	0.53121	0.0:0.0:0.0:1.0	.	600;614;599	G3V3L7;Q9Y6Q3-2;Q9Y6Q3	.;.;ZFP37_HUMAN	I	599;600;614	ENSP00000363344:K599I;ENSP00000451310:K600I;ENSP00000452552:K614I	ENSP00000363344:K599I	K	-	2	0	ZFP37	114844923	0.292000	0.24362	1.000000	0.80357	0.989000	0.77384	0.608000	0.24223	2.142000	0.66516	0.533000	0.62120	AAA	-	superfamily_SSF57667		0.363	ZFP37-001	KNOWN	basic|CCDS	protein_coding	ZFP37	protein_coding	OTTHUMT00000055439.1	T	NM_003408		114844923	-1	no_errors	NM_003408	genbank	human	provisional	54_36p	missense	SNP	0.998	A
ORM2	5005	genome.wustl.edu	37	9	117092749	117092749	+	Silent	SNP	T	T	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr9:117092749T>C	ENST00000431067.2	+	2	186	c.150T>C	c.(148-150)ttT>ttC	p.F50F	ORM2_ENST00000412657.1_Missense_Mutation_p.S189P	NM_000608.2	NP_000599.1	P19652	A1AG2_HUMAN	orosomucoid 2	50					acute-phase response (GO:0006953)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7		Myeloproliferative disorder(63;0.163)			Chlorpromazine(DB00477)|Oxycodone(DB00497)|Thalidomide(DB01041)	CATCGGCCTTTCGAAACGAGG	0.502																																					NSCLC(65;867 1308 1814 2391 12508)											0			9											38.0	55.0	50.0					9																	117092749		2195	4296	6491	116132570	SO:0001819	synonymous_variant	5005				CCDS6804.1	9q32	2013-09-19			ENSG00000228278	ENSG00000228278		"""Lipocalins"""	8499	protein-coding gene	gene with protein product	"""alpha-1-acid glycoprotein, type 2"""	138610				4711474, 2970990	Standard	NM_000608		Approved	AGP-B, AGP-B', AGP2		P19652	OTTHUMG00000021014	ENST00000431067.2:c.150T>C	9.37:g.117092749T>C		Somatic		Capture	Illumina GAIIx	4	116132570	B2R5L2|Q16571|Q5T538|Q6IB74	Silent	SNP	superfamily_Lipocalins,HMMPfam_Lipocalin	p.F50	ENST00000431067.2	37	c.150	CCDS6804.1	9	.	.	.	.	.	.	.	.	.	.	-	4.680	0.126469	0.08931	.	.	ENSG00000228278	ENST00000412657	T	0.38077	1.16	3.11	-6.22	0.02058	.	.	.	.	.	T	0.26702	0.0653	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37549	-0.9701	6	0.87932	D	0	-6.878	2.0303	0.03528	0.2585:0.4735:0.1294:0.1386	.	.	.	.	P	189	ENSP00000407099:S189P	ENSP00000407099:S189P	S	+	1	0	ORM2	116132570	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.943000	0.01539	-1.742000	0.01342	-0.726000	0.03593	TCG	-	superfamily_Lipocalins,HMMPfam_Lipocalin		0.502	ORM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORM2	protein_coding	OTTHUMT00000055432.1	T	NM_000608		116132570	+1	no_errors	NM_000608	genbank	human	reviewed	54_36p	silent	SNP	0.000	C
TECTA	7007	genome.wustl.edu	37	11	121000761	121000761	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr11:121000761G>T	ENST00000392793.1	+	10	3053	c.2782G>T	c.(2782-2784)Ggg>Tgg	p.G928W	TECTA_ENST00000264037.2_Missense_Mutation_p.G928W			O75443	TECTA_HUMAN	tectorin alpha	928	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGAGTGCCATGGGGTGGTGAA	0.587																																																0			11											72.0	69.0	70.0					11																	121000761		2203	4299	6502	120505971	SO:0001583	missense	7007			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2782G>T	11.37:g.121000761G>T	ENSP00000376543:p.Gly928Trp	Somatic		Capture	Illumina GAIIx	4	120505971		Missense_Mutation	SNP	HMMSmart_SM00539,HMMPfam_NIDO,HMMSmart_SM00215,HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMPfam_TIL,HMMSmart_SM00181,PatternScan_EGF_2,PatternScan_FA58C_2,HMMPfam_Zona_pellucida,HMMSmart_SM00241,PatternScan_ZP_1,superfamily_EGF/Laminin	p.G928W	ENST00000392793.1	37	c.2782	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	14.92	2.678789	0.47886	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.77098	-1.07;-1.07	5.78	3.93	0.45458	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	0.420496	0.27482	N	0.019179	T	0.79528	0.4461	L	0.45137	1.4	0.09310	N	1	D	0.64830	0.994	P	0.62885	0.908	T	0.69235	-0.5198	10	0.72032	D	0.01	.	6.4303	0.21792	0.2004:0.0:0.6661:0.1335	.	928	O75443	TECTA_HUMAN	W	928	ENSP00000376543:G928W;ENSP00000264037:G928W	ENSP00000264037:G928W	G	+	1	0	TECTA	120505971	0.391000	0.25221	0.057000	0.19452	0.995000	0.86356	0.956000	0.29202	0.816000	0.34421	0.650000	0.86243	GGG	-	HMMPfam_C8		0.587	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	protein_coding	OTTHUMT00000313850.1	G	NM_005422		120505971	+1	no_errors	NM_005422	genbank	human	reviewed	54_36p	missense	SNP	0.206	T
LHX2	9355	genome.wustl.edu	37	9	126777578	126777578	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr9:126777578G>C	ENST00000373615.4	+	3	1240	c.501G>C	c.(499-501)ttG>ttC	p.L167F		NM_004789.3	NP_004780.3	P50458	LHX2_HUMAN	LIM homeobox 2	167	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|cerebral cortex development (GO:0021987)|dorsal/ventral pattern formation (GO:0009953)|mesoderm development (GO:0007498)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural tube closure (GO:0001843)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|retina development in camera-type eye (GO:0060041)|telencephalon regionalization (GO:0021978)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)	10						ACTGCCGCTTGCACTTCGAGG	0.647																																																0			9											86.0	82.0	83.0					9																	126777578		2203	4300	6503	125817399	SO:0001583	missense	9355			U11701	CCDS6853.1	9q33.3	2011-06-20			ENSG00000106689	ENSG00000106689		"""Homeoboxes / LIM class"""	6594	protein-coding gene	gene with protein product		603759				8649822, 10051612	Standard	NM_004789		Approved	LH-2, hLhx2	uc004boe.1	P50458	OTTHUMG00000020647	ENST00000373615.4:c.501G>C	9.37:g.126777578G>C	ENSP00000362717:p.Leu167Phe	Somatic		Capture	Illumina GAIIx	4	125817399	O95860|Q52M57|Q8N1Z3	Missense_Mutation	SNP	superfamily_SSF57716,HMMSmart_LIM,PatternScan_LIM_DOMAIN_1,HMMPfam_LIM,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.L167F	ENST00000373615.4	37	c.501	CCDS6853.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.92|12.92	2.082980|2.082980	0.36758|0.36758	.|.	.|.	ENSG00000106689|ENSG00000106689	ENST00000446480|ENST00000373615	.|D	.|0.87412	.|-2.25	5.15|5.15	5.15|5.15	0.70609|0.70609	.|Zinc finger, LIM-type (4);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.88396|0.88396	0.6425|0.6425	L|L	0.52905|0.52905	1.665|1.665	0.39368|0.39368	D|D	0.966036|0.966036	.|P;D	.|0.57899	.|0.801;0.981	.|P;P	.|0.52672	.|0.629;0.706	D|D	0.89610|0.89610	0.3841|0.3841	5|10	.|0.59425	.|D	.|0.04	.|.	12.8098|12.8098	0.57634|0.57634	0.0:0.2793:0.7207:0.0|0.0:0.2793:0.7207:0.0	.|.	.|167;167	.|B3KNJ5;P50458	.|.;LHX2_HUMAN	P|F	173|167	.|ENSP00000362717:L167F	.|ENSP00000362717:L167F	A|L	+|+	1|3	0|2	LHX2|LHX2	125817399|125817399	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.299000|2.299000	0.43611|0.43611	2.388000|2.388000	0.81334|0.81334	0.462000|0.462000	0.41574|0.41574	GCA|TTG	-	HMMSmart_LIM,HMMPfam_LIM		0.647	LHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX2	protein_coding	OTTHUMT00000054010.2	G			125817399	+1	no_errors	NM_004789	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
TMEM132D	121256	genome.wustl.edu	37	12	130185032	130185032	+	Silent	SNP	G	G	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr12:130185032G>A	ENST00000422113.2	-	2	617	c.291C>T	c.(289-291)taC>taT	p.Y97Y	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	97					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.Y97Y(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGAAAGGCCCGTAGCTGGCAT	0.488																																																1	Substitution - coding silent(1)	large_intestine(1)	12											65.0	65.0	65.0					12																	130185032		2203	4300	6503	128750985	SO:0001819	synonymous_variant	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.291C>T	12.37:g.130185032G>A		Somatic		Capture	Illumina GAIIx	4	128750985	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	NULL	p.Y97	ENST00000422113.2	37	c.291	CCDS9266.1	12																																																																																			-	NULL		0.488	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	protein_coding	OTTHUMT00000399592.1	G	NM_133448		128750985	-1	no_errors	NM_133448	genbank	human	validated	54_36p	silent	SNP	1.000	A
NCS1	23413	genome.wustl.edu	37	9	132984935	132984935	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr9:132984935T>G	ENST00000372398.3	+	5	400	c.314T>G	c.(313-315)tTc>tGc	p.F105C	NCS1_ENST00000458469.1_Missense_Mutation_p.F87C	NM_014286.3	NP_055101.2	P62166	NCS1_HUMAN	neuronal calcium sensor 1	105	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion transmembrane transport (GO:0070588)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of exocytosis (GO:0045921)|regulation of neuron projection development (GO:0010975)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|voltage-gated calcium channel activity (GO:0005245)			large_intestine(1)|lung(4)|stomach(1)	6						ACAGGGGCCTTCAAGCTCTAC	0.557																																					Melanoma(30;182 1162 22581 33240)											0			9											125.0	100.0	109.0					9																	132984935		2203	4300	6503	132024756	SO:0001583	missense	23413			AF186409	CCDS6932.1	9q34.11	2013-01-10	2010-01-27	2010-01-27	ENSG00000107130	ENSG00000107130		"""EF-hand domain containing"""	3953	protein-coding gene	gene with protein product		603315	"""frequenin (Drosophila) homolog"", ""frequenin homolog (Drosophila)"""	FREQ		11092894	Standard	NM_014286		Approved	NCS-1	uc004bzi.2	P62166	OTTHUMG00000020801	ENST00000372398.3:c.314T>G	9.37:g.132984935T>G	ENSP00000361475:p.Phe105Cys	Somatic		Capture	Illumina GAIIx	4	132024756	E9PAY3|P36610|Q9UK26	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1	p.F105C	ENST00000372398.3	37	c.314	CCDS6932.1	9	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701533	0.68501	.	.	ENSG00000107130	ENST00000372398;ENST00000458469	D;D	0.92397	-3.03;-3.03	4.77	4.77	0.60923	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.97704	0.9247	H	0.98936	4.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98776	1.0730	10	0.87932	D	0	.	13.5008	0.61454	0.0:0.0:0.0:1.0	.	87;105	E9PAY3;P62166	.;NCS1_HUMAN	C	105;87	ENSP00000361475:F105C;ENSP00000404103:F87C	ENSP00000361475:F105C	F	+	2	0	NCS1	132024756	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	7.775000	0.85489	1.786000	0.52430	0.379000	0.24179	TTC	-	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand		0.557	NCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREQ	protein_coding	OTTHUMT00000054637.1	T	NM_014286		132024756	+1	no_errors	NM_014286	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FAM78A	286336	genome.wustl.edu	37	9	134136439	134136439	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr9:134136439T>C	ENST00000372271.3	-	2	989	c.622A>G	c.(622-624)Acg>Gcg	p.T208A	FAM78A_ENST00000247295.4_5'UTR|FAM78A_ENST00000372269.3_Missense_Mutation_p.T205A	NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A	208										NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		CAGTGCAGCGTCTGCAGGATG	0.652																																																0			9											100.0	91.0	94.0					9																	134136439		2203	4300	6503	133126260	SO:0001583	missense	286336			AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.622A>G	9.37:g.134136439T>C	ENSP00000361345:p.Thr208Ala	Somatic		Capture	Illumina GAIIx	4	133126260	Q86VQ9|Q9H7P4	Missense_Mutation	SNP	NULL	p.T208A	ENST00000372271.3	37	c.622	CCDS6941.2	9	.	.	.	.	.	.	.	.	.	.	T	24.1	4.493173	0.84962	.	.	ENSG00000126882	ENST00000372269;ENST00000372271;ENST00000464831	D;D;D	0.94417	-3.42;-3.42;-3.42	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	D	0.96706	0.8925	M	0.74881	2.28	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.75484	0.986;0.985	D	0.97234	0.9886	10	0.87932	D	0	-27.9987	13.7403	0.62845	0.0:0.0:0.0:1.0	.	208;205	Q5JUQ0;Q5JUQ2	FA78A_HUMAN;.	A	205;208;177	ENSP00000361343:T205A;ENSP00000361345:T208A;ENSP00000419959:T177A	ENSP00000361343:T205A	T	-	1	0	FAM78A	133126260	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.997000	0.88414	1.894000	0.54839	0.379000	0.24179	ACG	-	NULL		0.652	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78A	protein_coding	OTTHUMT00000054720.1	T	NM_033387		133126260	-1	no_errors	NM_033387	genbank	human	validated	54_36p	missense	SNP	1.000	C
DDX31	64794	genome.wustl.edu	37	9	135545542	135545542	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr9:135545542C>T	ENST00000372159.3	-	1	246	c.95G>A	c.(94-96)aGa>aAa	p.R32K	DDX31_ENST00000310532.2_Missense_Mutation_p.R32K|DDX31_ENST00000372153.1_Missense_Mutation_p.R32K|GTF3C4_ENST00000372146.4_5'UTR|DDX31_ENST00000544003.1_5'Flank|DDX31_ENST00000480876.1_5'UTR|GTF3C4_ENST00000483873.2_5'UTR	NM_022779.7	NP_073616.6	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	32						nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		CAGCCCCTCTCTGCGTCCCTC	0.677																																																0			9											12.0	11.0	11.0					9																	135545542		2170	4238	6408	134535363	SO:0001583	missense	64794			AF427339	CCDS6951.1, CCDS6952.1	9q34.2	2012-04-17	2003-06-13		ENSG00000125485	ENSG00000125485		"""DEAD-boxes"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16715	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 25"""		"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31"""				Standard	NM_022779		Approved	FLJ13633, FLJ23349, FLJ14578, PPP1R25	uc004cbq.1	Q9H8H2	OTTHUMG00000020843	ENST00000372159.3:c.95G>A	9.37:g.135545542C>T	ENSP00000361232:p.Arg32Lys	Somatic		Capture	Illumina GAIIx	4	134535363	Q5K6N2|Q5K6N3|Q5K6N4|Q5VZJ4|Q5VZJ9|Q96E91|Q96NY2|Q96SX5|Q9H5K6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,PatternScan_DEAD_ATP_HELICASE,HMMSmart_SM00490,HMMPfam_Helicase_C	p.R32K	ENST00000372159.3	37	c.95	CCDS6951.1	9	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448168	0.43429	.	.	ENSG00000125485	ENST00000372159;ENST00000372155;ENST00000372153;ENST00000310532	T;T;T	0.05580	4.27;3.82;3.42	2.62	-2.2	0.06994	.	.	.	.	.	T	0.03915	0.0110	N	0.19112	0.55	0.20764	N	0.999852	B;B;B	0.29552	0.01;0.248;0.003	B;B;B	0.26202	0.01;0.067;0.005	T	0.39663	-0.9603	9	0.51188	T	0.08	.	7.1116	0.25392	0.0:0.5775:0.0:0.4225	.	32;32;32	Q9H8H2-2;Q9H8H2-3;Q9H8H2	.;.;DDX31_HUMAN	K	32	ENSP00000361232:R32K;ENSP00000361226:R32K;ENSP00000310539:R32K	ENSP00000310539:R32K	R	-	2	0	DDX31	134535363	0.000000	0.05858	0.000000	0.03702	0.086000	0.17979	-0.070000	0.11523	-0.541000	0.06257	0.462000	0.41574	AGA	-	NULL		0.677	DDX31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DDX31	protein_coding	OTTHUMT00000054794.1	C	NM_138620		134535363	-1	no_errors	NM_022779	genbank	human	reviewed	54_36p	missense	SNP	0.001	T
ARHGEF5	7984	genome.wustl.edu	37	7	144060494	144060494	+	Silent	SNP	A	A	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr7:144060494A>G	ENST00000056217.5	+	2	906	c.732A>G	c.(730-732)ggA>ggG	p.G244G	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	244					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GGGGGGAAGGAACTCTGAGGG	0.527																																																0			7											19.0	21.0	20.0					7																	144060494		2053	4053	6106	143691427	SO:0001819	synonymous_variant	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.732A>G	7.37:g.144060494A>G		Somatic		Capture	Illumina GAIIx	4	143691427	A6NNJ2|Q6ZML7	Silent	SNP	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,PatternScan_DH_1,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2	p.G244	ENST00000056217.5	37	c.732	CCDS34771.1	7																																																																																			-	NULL		0.527	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	protein_coding	OTTHUMT00000349981.1	A	NM_005435		143691427	+1	no_errors	NM_005435	genbank	human	reviewed	54_36p	silent	SNP	0.002	G
PLXNB3	5365	genome.wustl.edu	37	X	153033787	153033787	+	Silent	SNP	G	G	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chrX:153033787G>A	ENST00000361971.5	+	4	1284	c.1170G>A	c.(1168-1170)ctG>ctA	p.L390L	PLXNB3_ENST00000538776.1_Silent_p.L43L|PLXNB3_ENST00000538543.1_Intron|U52111.14_ENST00000416854.1_RNA|PLXNB3_ENST00000538966.1_Silent_p.L413L|U52111.14_ENST00000434284.1_RNA|PLXNB3_ENST00000538282.1_Silent_p.L43L	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	390	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGCCTCTGCTGAAGCTCG	0.667																																																0			X											27.0	31.0	29.0					X																	153033787		2199	4291	6490	152686981	SO:0001819	synonymous_variant	5365			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.1170G>A	X.37:g.153033787G>A		Somatic		Capture	Illumina GAIIx	4	152686981	B7Z3E6|F5H773|Q9HDA4	Silent	SNP	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMPfam_PSI,HMMSmart_PSI,superfamily_Plexin-like_fold,superfamily_Ig_E-set,HMMSmart_IPT,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_Rho_GAP	p.L390	ENST00000361971.5	37	c.1170	CCDS14729.1	X																																																																																			-	superfamily_Sema,HMMSmart_Sema		0.667	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	protein_coding	OTTHUMT00000061063.1	G			152686981	+1	no_errors	NM_005393	genbank	human	provisional	54_36p	silent	SNP	0.018	A
Unknown	0	genome.wustl.edu	37	1	166246762	166246762	+	IGR	SNP	G	G	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:166246762G>T								FAM78B (110556 upstream) : RP11-479J7.2 (57358 downstream)																							CCTTGAGTGGGCTGGGTGTTG	0.517																																																0			1																																								164513386	SO:0001628	intergenic_variant	284685																															1.37:g.166246762G>T		Somatic		Capture	Illumina GAIIx	4	164513386		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.517					LOC284685			G			164513386	-1	pseudogene	XR_017685	genbank	human	model	54_36p	rna	SNP	1.000	T
XPR1	9213	genome.wustl.edu	37	1	180793950	180793950	+	Silent	SNP	C	C	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:180793950C>G	ENST00000367590.4	+	8	1023	c.825C>G	c.(823-825)ggC>ggG	p.G275G	XPR1_ENST00000367589.3_Silent_p.G275G	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	275					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)	p.G275G(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						ATCGGGGTGGCTTTCTTCTGA	0.363																																																1	Substitution - coding silent(1)	breast(1)	1											144.0	143.0	143.0					1																	180793950		2203	4300	6503	179060573	SO:0001819	synonymous_variant	9213			AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.825C>G	1.37:g.180793950C>G		Somatic		Capture	Illumina GAIIx	4	179060573	O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Silent	SNP	HMMPfam_SPX,HMMPfam_EXS	p.G275	ENST00000367590.4	37	c.825	CCDS1340.1	1																																																																																			-	HMMPfam_EXS		0.363	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPR1	protein_coding	OTTHUMT00000084996.2	C	NM_004736		179060573	+1	no_errors	NM_004736	genbank	human	validated	54_36p	silent	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179641962	179641962	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr2:179641962T>G	ENST00000591111.1	-	27	4952	c.4728A>C	c.(4726-4728)aaA>aaC	p.K1576N	TTN_ENST00000359218.5_Missense_Mutation_p.K1530N|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K1530N|TTN_ENST00000589042.1_Missense_Mutation_p.K1576N|TTN_ENST00000342992.6_Missense_Mutation_p.K1576N|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.K1576N|TTN_ENST00000460472.2_Missense_Mutation_p.K1530N|TTN-AS1_ENST00000610005.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12433	Ig-like 7.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGCTCTGACTTTCATTTCAA	0.383																																																0			2											156.0	150.0	152.0					2																	179641962		2203	4300	6503	179350207	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4728A>C	2.37:g.179641962T>G	ENSP00000465570:p.Lys1576Asn	Somatic		Capture	Illumina GAIIx	4	179350207	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_Titin_Z,HMMPfam_ig,PatternScan_IG_MHC,PatternScan_THIOL_PROTEASE_HIS	p.K1576N	ENST00000591111.1	37	c.4728		2	.	.	.	.	.	.	.	.	.	.	T	11.58	1.682412	0.29872	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	5.9	4.74	0.60224	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56746	0.2006	L	0.39566	1.225	0.27991	N	0.935643	B;B;B;B;B	0.14438	0.002;0.002;0.002;0.002;0.01	B;B;B;B;B	0.17433	0.007;0.007;0.007;0.007;0.018	T	0.54403	-0.8299	9	0.87932	D	0	.	7.38	0.26849	0.1809:0.0671:0.0:0.752	.	1530;1530;1530;1576;1576	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	N	1576;1530;1530;1530;1530;1576	ENSP00000343764:K1576N;ENSP00000434586:K1530N;ENSP00000340554:K1530N;ENSP00000352154:K1530N;ENSP00000354117:K1576N	ENSP00000340554:K1530N	K	-	3	2	TTN	179350207	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.448000	0.35112	1.057000	0.40506	0.528000	0.53228	AAA	-	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IG		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378		179350207	-1	no_errors	NM_133379	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
USP13	8975	genome.wustl.edu	37	3	179470151	179470151	+	Silent	SNP	C	C	G			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr3:179470151C>G	ENST00000263966.3	+	14	2259	c.1788C>G	c.(1786-1788)ccC>ccG	p.P596P	USP13_ENST00000482333.1_Intron|USP13_ENST00000496897.1_Silent_p.P531P	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	596	USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			ACTGGGTTCCCAAAAAATTTG	0.408																																																0			3											194.0	180.0	185.0					3																	179470151		2203	4300	6503	180952845	SO:0001819	synonymous_variant	8975			U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1788C>G	3.37:g.179470151C>G		Somatic		Capture	Illumina GAIIx	4	180952845	A8K2S3|B4DYF3|D3DNS2|Q96B25	Silent	SNP	HMMSmart_ZnF_UBP,HMMPfam_zf-UBP,superfamily_SSF54001,HMMPfam_UCH,PatternScan_UCH_2_1,HMMPfam_UBA,HMMSmart_UBA,superfamily_UBA_like,PatternScan_UCH_2_2	p.P596	ENST00000263966.3	37	c.1788	CCDS3235.1	3																																																																																			-	superfamily_SSF54001,HMMPfam_UCH		0.408	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP13	protein_coding	OTTHUMT00000349617.1	C			180952845	+1	no_errors	NM_003940	genbank	human	validated	54_36p	silent	SNP	0.979	G
PLEKHA6	22874	genome.wustl.edu	37	1	204199581	204199581	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:204199581C>A	ENST00000272203.3	-	18	2859	c.2543G>T	c.(2542-2544)aGc>aTc	p.S848I	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.S868I	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	848										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GGGGGCCGGGCTGGCCGGGAG	0.657																																																0			1											12.0	14.0	13.0					1																	204199581		2192	4272	6464	202466204	SO:0001583	missense	22874			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.2543G>T	1.37:g.204199581C>A	ENSP00000272203:p.Ser848Ile	Somatic		Capture	Illumina GAIIx	4	202466204	A7MD51|Q5VTI6	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.S848I	ENST00000272203.3	37	c.2543	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	C	18.11	3.549939	0.65311	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.12774	2.65;3.12	5.24	5.24	0.73138	.	0.345626	0.28021	N	0.016919	T	0.13543	0.0328	L	0.47716	1.5	0.35293	D	0.782367	P	0.49447	0.924	B	0.41860	0.368	T	0.12528	-1.0544	10	0.54805	T	0.06	-26.1779	9.2775	0.37709	0.0:0.8383:0.0:0.1617	.	848	Q9Y2H5	PKHA6_HUMAN	I	848;868	ENSP00000272203:S848I;ENSP00000402046:S868I	ENSP00000272203:S848I	S	-	2	0	PLEKHA6	202466204	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	1.727000	0.38095	2.435000	0.82474	0.462000	0.41574	AGC	-	NULL		0.657	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	protein_coding	OTTHUMT00000087889.3	C	NM_014935		202466204	-1	no_errors	NM_014935	genbank	human	validated	54_36p	missense	SNP	0.986	A
YOD1	55432	genome.wustl.edu	37	1	207224211	207224211	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:207224211G>C	ENST00000315927.4	-	1	211	c.165C>G	c.(163-165)gaC>gaG	p.D55E	PFKFB2_ENST00000411990.2_Intron|PFKFB2_ENST00000367080.3_5'Flank|YOD1_ENST00000391927.1_Intron|YOD1_ENST00000367084.1_Intron|PFKFB2_ENST00000367079.2_5'Flank	NM_018566.3	NP_061036.3	Q5VVQ6	OTU1_HUMAN	YOD1 deubiquitinase	55	UBX-like.				cellular amino acid metabolic process (GO:0006520)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)		Lys48-specific deubiquitinase activity (GO:1990380)|metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			cervix(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(3)	11	Prostate(682;0.19)					CATGGGTGCCGTCCTTGGCCT	0.701																																																0			1											13.0	16.0	15.0					1																	207224211		2194	4286	6480	205290834	SO:0001583	missense	55432				CCDS31002.1, CCDS60402.1	1q32.2	2013-06-04	2013-06-04		ENSG00000180667	ENSG00000180667		"""OTU domain containing"""	25035	protein-coding gene	gene with protein product		612023	"""YOD1 OTU deubiquinating enzyme 1 homolog ( yeast)"", ""YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)"""				Standard	NM_001276320		Approved	DKFZp451J1719, OTUD2, DUBA8	uc001hfe.1	Q5VVQ6	OTTHUMG00000036032	ENST00000315927.4:c.165C>G	1.37:g.207224211G>C	ENSP00000326813:p.Asp55Glu	Somatic		Capture	Illumina GAIIx	4	205290834	B2RNX3|Q5VVQ5|Q6ZRS6|Q86T63|Q9P1L8	Missense_Mutation	SNP	superfamily_Ubiquitin-like,superfamily_Cysteine proteinases,HMMPfam_OTU,PatternScan_ZINC_FINGER_C2H2_1	p.D55E	ENST00000315927.4	37	c.165	CCDS31002.1	1	.	.	.	.	.	.	.	.	.	.	G	7.794	0.712113	0.15306	.	.	ENSG00000180667	ENST00000315927	.	.	.	5.69	-7.28	0.01456	.	0.286306	0.42053	N	0.000767	T	0.30135	0.0755	N	0.17082	0.46	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.07849	-1.0751	8	.	.	.	-19.7424	11.2458	0.48996	0.2266:0.1998:0.5737:0.0	.	55	Q5VVQ6	OTU1_HUMAN	E	55	.	.	D	-	3	2	YOD1	205290834	0.050000	0.20438	0.864000	0.33941	0.987000	0.75469	-0.634000	0.05477	-1.352000	0.02194	-1.074000	0.02243	GAC	-	superfamily_Ubiquitin-like		0.701	YOD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	YOD1	protein_coding	OTTHUMT00000087837.1	G	NM_018566		205290834	-1	no_errors	NM_018566	genbank	human	validated	54_36p	missense	SNP	0.921	C
IRS1	3667	genome.wustl.edu	37	2	227662615	227662615	+	Silent	SNP	G	G	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr2:227662615G>A	ENST00000305123.5	-	1	1860	c.840C>T	c.(838-840)atC>atT	p.I280I	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	280	Ser-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGGGGACGCTGATGGGGTTAG	0.652											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			2											72.0	78.0	76.0					2																	227662615		2203	4300	6503	227370859	SO:0001819	synonymous_variant	3667				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.840C>T	2.37:g.227662615G>A		Somatic	2321	Capture	Illumina GAIIx	4	227370859		Silent	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMPfam_IRS,HMMSmart_PTBI	p.I280	ENST00000305123.5	37	c.840	CCDS2463.1	2																																																																																			-	NULL		0.652	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	protein_coding	OTTHUMT00000256886.3	G	NM_005544		227370859	-1	no_errors	NM_005544	genbank	human	validated	54_36p	silent	SNP	1.000	A
SPHKAP	80309	genome.wustl.edu	37	2	228884300	228884300	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr2:228884300C>A	ENST00000392056.3	-	7	1316	c.1270G>T	c.(1270-1272)Gta>Tta	p.V424L	SPHKAP_ENST00000344657.5_Missense_Mutation_p.V424L	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	424						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GAACTTCCTACAGAAACACTG	0.438																																																0			2											117.0	112.0	114.0					2																	228884300		2203	4300	6503	228592544	SO:0001583	missense	80309				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1270G>T	2.37:g.228884300C>A	ENSP00000375909:p.Val424Leu	Somatic		Capture	Illumina GAIIx	4	228592544	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	HMMPfam_AKAP_110	p.V424L	ENST00000392056.3	37	c.1270	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	9.648	1.140876	0.21205	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.11712	2.75;2.75	5.76	1.36	0.22044	.	0.859197	0.10483	N	0.669348	T	0.13329	0.0323	M	0.67953	2.075	0.09310	N	1	B;B	0.18310	0.003;0.027	B;B	0.15484	0.002;0.013	T	0.21621	-1.0240	10	0.48119	T	0.1	-0.4759	8.9752	0.35930	0.0:0.6766:0.1119:0.2115	.	424;424	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	L	424	ENSP00000375909:V424L;ENSP00000339886:V424L	ENSP00000339886:V424L	V	-	1	0	SPHKAP	228592544	0.000000	0.05858	0.346000	0.25655	0.786000	0.44442	0.224000	0.17738	0.341000	0.23771	0.655000	0.94253	GTA	-	NULL		0.438	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	C	NM_030623		228592544	-1	no_errors	NM_030623	genbank	human	validated	54_36p	missense	SNP	0.010	A
ERO1LB	56605	genome.wustl.edu	37	1	236389793	236389793	+	Nonsense_Mutation	SNP	C	C	T			TCGA-36-2530-01A-01D-1526-09	TCGA-36-2530-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	990deb59-4f7f-422d-b470-b116edd32d33	4e3f49a5-cb83-4014-8840-ce71b8427e09	g.chr1:236389793C>T	ENST00000354619.5	-	12	1029	c.828G>A	c.(826-828)tgG>tgA	p.W276*		NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	276					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	TATTAGGTCCCCAACTGGGCT	0.363																																																0			1											60.0	61.0	61.0					1																	236389793		2202	4298	6500	234456416	SO:0001587	stop_gained	56605			AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.828G>A	1.37:g.236389793C>T	ENSP00000346635:p.Trp276*	Somatic		Capture	Illumina GAIIx	4	234456416	B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Nonsense_Mutation	SNP	superfamily_ERO1,HMMPfam_ERO1	p.W276*	ENST00000354619.5	37	c.828	CCDS31064.1	1	.	.	.	.	.	.	.	.	.	.	C	38	6.791039	0.97841	.	.	ENSG00000086619	ENST00000354619;ENST00000264181	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.948	19.5134	0.95153	0.0:1.0:0.0:0.0	.	.	.	.	X	276;1	.	ENSP00000264181:W1X	W	-	3	0	ERO1LB	234456416	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.464000	0.80887	2.609000	0.88269	0.579000	0.79373	TGG	-	superfamily_ERO1,HMMPfam_ERO1		0.363	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERO1LB	protein_coding	OTTHUMT00000096371.1	C	NM_019891		234456416	-1	no_errors	NM_019891	genbank	human	provisional	54_36p	nonsense	SNP	1.000	T
