#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ENO3	2027	genome.wustl.edu	37	17	4857022	4857022	+	Missense_Mutation	SNP	A	A	G	rs143749502		TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr17:4857022A>G	ENST00000323997.6	+	6	458	c.326A>G	c.(325-327)aAt>aGt	p.N109S	ENO3_ENST00000518175.1_Missense_Mutation_p.N109S|ENO3_ENST00000519584.1_Missense_Mutation_p.N66S	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	109					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						TTTGGGGCCAATGCCATCCTG	0.612																																																0			17						A	SER/ASN,SER/ASN,SER/ASN	1,4405	2.1+/-5.4	0,1,2202	121.0	116.0	117.0		197,326,326	5.6	1.0	17	dbSNP_134	117	0,8600		0,0,4300	no	missense,missense,missense	ENO3	NM_001193503.1,NM_001976.4,NM_053013.3	46,46,46	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	66/392,109/435,109/435	4857022	1,13005	2203	4300	6503	4797768	SO:0001583	missense	2027			X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.326A>G	17.37:g.4857022A>G	ENSP00000324105:p.Asn109Ser	Somatic		Capture	Illumina GAIIx	4	4797768	B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Missense_Mutation	SNP	HMMPfam_Enolase_N,superfamily_Enolase N-terminal domain-like,superfamily_Enolase C-terminal domain-like,HMMPfam_Enolase_C,PatternScan_ENOLASE	p.N109S	ENST00000323997.6	37	c.326	CCDS11062.1	17	.	.	.	.	.	.	.	.	.	.	A	28.8	4.952796	0.92660	2.27E-4	0.0	ENSG00000108515	ENST00000522798;ENST00000519602;ENST00000323997;ENST00000522249;ENST00000519584;ENST00000518175	T;T;T;T;T;T	0.59224	0.81;0.81;0.81;0.81;0.28;0.81	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.86326	0.5906	H	0.99689	4.705	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.71656	0.967;0.974;0.974	D	0.92003	0.5612	10	0.87932	D	0	-20.7403	13.9307	0.63994	1.0:0.0:0.0:0.0	.	66;16;109	P13929-3;D3DTL4;D3DTL2	.;.;.	S	109;109;109;109;66;109	ENSP00000428502:N109S;ENSP00000430055:N109S;ENSP00000324105:N109S;ENSP00000428811:N109S;ENSP00000430636:N66S;ENSP00000431087:N109S	ENSP00000324105:N109S	N	+	2	0	ENO3	4797768	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.287000	0.95975	2.233000	0.73108	0.533000	0.62120	AAT	-	HMMPfam_Enolase_N,superfamily_Enolase N-terminal domain-like		0.612	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO3	protein_coding	OTTHUMT00000216851.2	A			4797768	+1	no_errors	NM_001976	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7578442	7578442	+	Missense_Mutation	SNP	T	T	C	rs148924904		TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr17:7578442T>C	ENST00000269305.4	-	5	677	c.488A>G	c.(487-489)tAc>tGc	p.Y163C	TP53_ENST00000359597.4_Missense_Mutation_p.Y163C|TP53_ENST00000455263.2_Missense_Mutation_p.Y163C|TP53_ENST00000445888.2_Missense_Mutation_p.Y163C|TP53_ENST00000420246.2_Missense_Mutation_p.Y163C|TP53_ENST00000413465.2_Missense_Mutation_p.Y163C|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	163	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y163C(134)|p.Y70C(12)|p.Y31C(12)|p.0?(8)|p.Y163S(7)|p.V157_C176del20(1)|p.Y31S(1)|p.Y163fs*1(1)|p.Y70S(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.Y163fs*14(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.I162_Y163delIY(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGACTGCTTGTAGATGGCCAT	0.622		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	183	Substitution - Missense(167)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)	lung(49)|breast(34)|haematopoietic_and_lymphoid_tissue(14)|ovary(14)|urinary_tract(13)|large_intestine(10)|upper_aerodigestive_tract(9)|central_nervous_system(7)|oesophagus(7)|stomach(6)|biliary_tract(6)|bone(4)|pancreas(3)|soft_tissue(2)|liver(2)|endometrium(1)|salivary_gland(1)|prostate(1)	17	GRCh37	CM942135	TP53	M	rs148924904						53.0	54.0	53.0					17																	7578442		2203	4300	6503	7519167	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.488A>G	17.37:g.7578442T>C	ENSP00000269305:p.Tyr163Cys	Somatic		Capture	Illumina GAIIx	4	7519167	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.Y163C	ENST00000269305.4	37	c.488	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.54	2.567047	0.45694	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.59	3.32	0.38043	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.062225	0.64402	D	0.000003	D	0.99746	0.9899	M	0.70595	2.14	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.996;0.999;0.983;0.999;1.0;0.999;0.994	D	0.98089	1.0408	10	0.87932	D	0	-16.6607	9.5833	0.39501	0.2797:0.0:0.0:0.7203	.	124;163;163;70;163;163;163	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	163;163;163;163;163;163;152;70;31;70;31;163	ENSP00000410739:Y163C;ENSP00000352610:Y163C;ENSP00000269305:Y163C;ENSP00000398846:Y163C;ENSP00000391127:Y163C;ENSP00000391478:Y163C;ENSP00000425104:Y31C;ENSP00000423862:Y70C;ENSP00000424104:Y163C	ENSP00000269305:Y163C	Y	-	2	0	TP53	7519167	1.000000	0.71417	0.998000	0.56505	0.050000	0.14768	5.141000	0.64814	0.446000	0.26666	0.533000	0.62120	TAC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.622	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546		7519167	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PIK3CD	5293	genome.wustl.edu	37	1	9782090	9782090	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr1:9782090A>G	ENST00000377346.4	+	17	2308	c.2113A>G	c.(2113-2115)Aag>Gag	p.K705E	PIK3CD_ENST00000536656.1_Missense_Mutation_p.K729E|PIK3CD_ENST00000543390.1_3'UTR|PIK3CD_ENST00000361110.2_Missense_Mutation_p.K729E	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	705					adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	GAGCTCTCAGAAGACCCCCAA	0.637											OREG0013082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			1											71.0	79.0	76.0					1																	9782090		2203	4299	6502	9704677	SO:0001583	missense	5293				CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.2113A>G	1.37:g.9782090A>G	ENSP00000366563:p.Lys705Glu	Somatic	659	Capture	Illumina GAIIx	4	9704677	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	HMMPfam_PI3K_p85B,HMMSmart_PI3K_p85B,superfamily_SSF54236,HMMPfam_PI3K_rbd,HMMSmart_PI3K_rbd,HMMSmart_PI3K_C2,superfamily_C2_CaLB,HMMPfam_PI3K_C2,superfamily_ARM-type_fold,HMMSmart_PI3Ka,HMMPfam_PI3Ka,superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2	p.K705E	ENST00000377346.4	37	c.2113	CCDS104.1	1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.694312	0.48202	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	T;T;T	0.81415	-1.49;-1.49;-1.49	5.4	4.25	0.50352	Protein kinase-like domain (1);	0.295705	0.30959	N	0.008526	D	0.84511	0.5488	L	0.42744	1.35	0.80722	D	1	D;D;D	0.89917	1.0;0.979;0.999	D;P;D	0.91635	0.999;0.669;0.947	T	0.82748	-0.0304	10	0.40728	T	0.16	-28.8679	11.8329	0.52305	0.8534:0.1466:0.0:0.0	.	704;729;705	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	E	729;705;729;729	ENSP00000446444:K729E;ENSP00000366563:K705E;ENSP00000354410:K729E	ENSP00000353766:K729E	K	+	1	0	PIK3CD	9704677	1.000000	0.71417	1.000000	0.80357	0.601000	0.36947	7.340000	0.79292	0.868000	0.35678	0.459000	0.35465	AAG	-	superfamily_Kinase_like		0.637	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CD	protein_coding	OTTHUMT00000004235.1	A	NM_005026		9704677	+1	no_errors	NM_005026	genbank	human	validated	54_36p	missense	SNP	1.000	G
ZNF333	84449	genome.wustl.edu	37	19	14829218	14829218	+	Missense_Mutation	SNP	G	G	A	rs148150625	byFrequency	TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr19:14829218G>A	ENST00000292530.6	+	12	1170	c.1079G>A	c.(1078-1080)cGt>cAt	p.R360H	ZNF333_ENST00000540689.2_Intron|ZNF333_ENST00000536363.1_Missense_Mutation_p.R251H	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	360					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						GAGAAAATCCGTAGTGGGGAT	0.438													G|||	9	0.00179712	0.0061	0.0014	5008	,	,		19174	0.0		0.0	False		,,,				2504	0.0				NSCLC(60;75 1281 16985 25154 29885)											0			19						G	HIS/ARG	36,4370	43.1+/-76.7	0,36,2167	84.0	85.0	85.0		1079	-6.5	0.0	19	dbSNP_134	85	0,8600		0,0,4300	yes	missense	ZNF333	NM_032433.2	29	0,36,6467	AA,AG,GG		0.0,0.8171,0.2768	benign	360/666	14829218	36,12970	2203	4300	6503	14690218	SO:0001583	missense	84449				CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.1079G>A	19.37:g.14829218G>A	ENSP00000292530:p.Arg360His	Somatic		Capture	Illumina GAIIx	4	14690218	Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.R360H	ENST00000292530.6	37	c.1079	CCDS12316.1	19	6	0.0027472527472527475	5	0.01016260162601626	1	0.0027624309392265192	0	0.0	0	0.0	G	3.671	-0.067575	0.07273	0.008171	0.0	ENSG00000160961	ENST00000536363;ENST00000292530	T;T	0.06218	5.45;3.33	3.24	-6.47	0.01902	.	.	.	.	.	T	0.00724	0.0024	N	0.00082	-2.215	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38929	-0.9638	9	0.02654	T	1	.	11.5542	0.50737	0.7519:0.1113:0.1368:0.0	.	360	Q96JL9	ZN333_HUMAN	H	251;360	ENSP00000439749:R251H;ENSP00000292530:R360H	ENSP00000292530:R360H	R	+	2	0	ZNF333	14690218	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	0.540000	0.23191	-2.377000	0.00597	-0.966000	0.02617	CGT	-	NULL		0.438	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF333	protein_coding	OTTHUMT00000466496.1	G	NM_032433		14690218	+1	no_errors	NM_032433	genbank	human	validated	54_36p	missense	SNP	0.014	A
TUSC3	7991	genome.wustl.edu	37	8	15397958	15397958	+	Missense_Mutation	SNP	C	C	A	rs201741917	byFrequency	TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr8:15397958C>A	ENST00000503731.1	+	1	167	c.19C>A	c.(19-21)Cct>Act	p.P7T	TUSC3_ENST00000382020.4_Missense_Mutation_p.P7T|TUSC3_ENST00000506802.1_Missense_Mutation_p.P7T|TUSC3_ENST00000509380.1_Missense_Mutation_p.P7T|TUSC3_ENST00000503191.1_Intron	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	7					cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		CCGGGGCGCTCCTTCACGCCG	0.736																																																0			8											13.0	14.0	14.0					8																	15397958		2173	4277	6450	15442329	SO:0001583	missense	7991			AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.19C>A	8.37:g.15397958C>A	ENSP00000424544:p.Pro7Thr	Somatic		Capture	Illumina GAIIx	4	15442329	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	HMMPfam_OST3_OST6,superfamily_Thioredoxin-like	p.P7T	ENST00000503731.1	37	c.19	CCDS5994.1	8	.	.	.	.	.	.	.	.	.	.	C	18.98	3.738101	0.69304	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.47869	0.86;0.83;0.84;0.85	4.3	4.3	0.51218	.	0.160248	0.29948	N	0.010799	T	0.21962	0.0529	N	0.08118	0	0.30028	N	0.813769	B;B;P;B;B;P	0.43477	0.334;0.334;0.463;0.334;0.334;0.808	B;B;B;B;B;B	0.26202	0.01;0.01;0.023;0.01;0.01;0.067	T	0.29119	-1.0022	10	0.66056	D	0.02	-7.5642	12.5676	0.56318	0.0:1.0:0.0:0.0	.	7;7;7;7;7;7	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	T	7	ENSP00000371450:P7T;ENSP00000425777:P7T;ENSP00000423426:P7T;ENSP00000424544:P7T	ENSP00000221167:P7T	P	+	1	0	TUSC3	15442329	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.969000	0.49232	2.687000	0.91594	0.563000	0.77884	CCT	-	NULL		0.736	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TUSC3	protein_coding	OTTHUMT00000365367.1	C	NM_006765		15442329	+1	no_errors	NM_006765	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
FOCAD	54914	genome.wustl.edu	37	9	20912864	20912864	+	Splice_Site	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr9:20912864G>A	ENST00000380249.1	+	25	3082		c.e25-1		FOCAD_ENST00000338382.6_Splice_Site|FOCAD_ENST00000605086.1_Splice_Site	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin							focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											GATTTTTGCAGGGAAGACTAG	0.408																																																0			9											95.0	92.0	93.0					9																	20912864		2203	4300	6503	20902864	SO:0001630	splice_region_variant	54914			AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.2719-1G>A	9.37:g.20912864G>A		Somatic		Capture	Illumina GAIIx	4	20902864	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Splice_Site	SNP	-	e22-1	ENST00000380249.1	37	c.2719-1	CCDS34993.1	9	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152900	0.78001	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8297	0.88677	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1797	20902864	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.171000	0.71926	2.826000	0.97356	0.655000	0.94253	.	-	-		0.408	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1797	protein_coding	OTTHUMT00000143442.1	G	NM_017794	Intron	20902864	+1	no_errors	NM_017794	genbank	human	validated	54_36p	splice_site	SNP	1.000	A
GOLGA6L2	283685	genome.wustl.edu	37	15	23689165	23689165	+	Missense_Mutation	SNP	G	G	A	rs192050688		TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr15:23689165G>A	ENST00000567107.1	-	5	402	c.350C>T	c.(349-351)gCg>gTg	p.A117V	GOLGA6L2_ENST00000345070.5_5'UTR|GOLGA6L2_ENST00000312015.5_Missense_Mutation_p.A117V			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	117										breast(1)|endometrium(7)	8						GTAATAGAGCGCTGTCTCCAG	0.478																																																0			15																																								21240258	SO:0001583	missense	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.350C>T	15.37:g.23689165G>A	ENSP00000454407:p.Ala117Val	Somatic		Capture	Illumina GAIIx	4	21240258	A1L301	Missense_Mutation	SNP	NULL	p.A117V	ENST00000567107.1	37	c.350		15	.	.	.	.	.	.	.	.	.	.	g	11.15	1.553234	0.27739	.	.	ENSG00000174450	ENST00000312015	T	0.14022	2.54	.	.	.	.	.	.	.	.	T	0.17577	0.0422	.	.	.	0.09310	N	0.999999	D	0.56521	0.976	P	0.52309	0.695	T	0.13656	-1.0501	5	0.33141	T	0.24	.	.	.	.	.	117	Q8N9W4	GG6L2_HUMAN	V	117	ENSP00000307928:A117V	ENSP00000307928:A117V	A	-	2	0	GOLGA6L2	21240258	0.012000	0.17670	.	.	.	.	0.129000	0.15830	.	.	.	.	GCG	-	NULL		0.478	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	uc001ywg.1	protein_coding	OTTHUMT00000431937.1	G	NM_182561		21240258	-1	no_errors	ENST00000312015	ensembl	human	known	54_36p	missense	SNP	0.011	A
ARMC3	219681	genome.wustl.edu	37	10	23292194	23292194	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr10:23292194G>A	ENST00000298032.5	+	13	1666	c.1582G>A	c.(1582-1584)Gaa>Aaa	p.E528K	ARMC3_ENST00000409049.3_Missense_Mutation_p.E528K|ARMC3_ENST00000409983.3_Missense_Mutation_p.E528K|ARMC3_ENST00000376528.4_Missense_Mutation_p.E265K	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	528						extracellular vesicular exosome (GO:0070062)		p.E528*(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TATCCTTGAAGAAGTTAACGT	0.363																																																1	Substitution - Nonsense(1)	large_intestine(1)	10											79.0	79.0	79.0					10																	23292194		2203	4300	6503	23332200	SO:0001583	missense	219681			AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1582G>A	10.37:g.23292194G>A	ENSP00000298032:p.Glu528Lys	Somatic		Capture	Illumina GAIIx	4	23332200	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_Arm,HMMSmart_SM00185	p.E528K	ENST00000298032.5	37	c.1582	CCDS7142.1	10	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507289	0.85282	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	T;T;T;T	0.49720	1.01;1.0;0.99;0.77	5.53	5.53	0.82687	Armadillo-like helical (1);	0.117086	0.56097	D	0.000038	T	0.71702	0.3371	M	0.78049	2.395	0.54753	D	0.999986	P;D	0.89917	0.849;1.0	P;D	0.83275	0.61;0.996	T	0.74822	-0.3534	10	0.87932	D	0	-7.811	19.4481	0.94855	0.0:0.0:1.0:0.0	.	528;528	Q5W041-4;Q5W041	.;ARMC3_HUMAN	K	528;528;464;528;265	ENSP00000298032:E528K;ENSP00000386943:E528K;ENSP00000387288:E528K;ENSP00000365711:E265K	ENSP00000298032:E528K	E	+	1	0	ARMC3	23332200	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.155000	0.64900	2.590000	0.87494	0.563000	0.77884	GAA	-	superfamily_ARM repeat		0.363	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARMC3	protein_coding	OTTHUMT00000047197.2	G	NM_173081		23332200	+1	no_errors	NM_173081	genbank	human	validated	54_36p	missense	SNP	1.000	A
APMAP	57136	genome.wustl.edu	37	20	24950955	24950955	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr20:24950955C>A	ENST00000217456.2	-	6	881	c.591G>T	c.(589-591)atG>atT	p.M197I	APMAP_ENST00000447138.1_Missense_Mutation_p.M197I	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	197					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										TCACAAAGGACATGTTCTTCC	0.428																																																0			20											201.0	181.0	188.0					20																	24950955		2203	4300	6503	24898955	SO:0001583	missense	57136			AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.591G>T	20.37:g.24950955C>A	ENSP00000217456:p.Met197Ile	Somatic		Capture	Illumina GAIIx	4	24898955	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	superfamily_Calcium-dependent phosphotriesterase,HMMPfam_Str_synth	p.M197I	ENST00000217456.2	37	c.591	CCDS13166.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.04|15.04	2.716068|2.716068	0.48622|0.48622	.|.	.|.	ENSG00000101474|ENSG00000101474	ENST00000451442|ENST00000217456;ENST00000447138	.|T;T	.|0.28255	.|1.62;1.62	5.45|5.45	5.45|5.45	0.79879|0.79879	.|Six-bladed beta-propeller, TolB-like (1);	.|0.190357	.|0.56097	.|D	.|0.000030	T|T	0.21761|0.21761	0.0524|0.0524	N|N	0.20445|0.20445	0.575|0.575	0.58432|0.58432	D|D	0.999991|0.999991	.|B;B;B	.|0.19331	.|0.035;0.002;0.001	.|B;B;B	.|0.10450	.|0.005;0.004;0.002	T|T	0.05007|0.05007	-1.0912|-1.0912	5|10	.|0.20519	.|T	.|0.43	-20.0609|-20.0609	16.7821|16.7821	0.85565|0.85565	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|197;181;197	.|Q9HDC9-2;A2A2F9;Q9HDC9	.|.;.;APMAP_HUMAN	F|I	182|197	.|ENSP00000217456:M197I;ENSP00000415373:M197I	.|ENSP00000217456:M197I	C|M	-|-	2|3	0|0	C20orf3|C20orf3	24898955|24898955	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.940000|0.940000	0.58332|0.58332	4.842000|4.842000	0.62831|0.62831	2.555000|2.555000	0.86185|0.86185	0.655000|0.655000	0.94253|0.94253	TGT|ATG	-	superfamily_Calcium-dependent phosphotriesterase		0.428	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf3	protein_coding	OTTHUMT00000078380.2	C	NM_020531		24898955	-1	no_errors	NM_020531	genbank	human	validated	54_36p	missense	SNP	1.000	A
EPHX2	2053	genome.wustl.edu	37	8	27369416	27369416	+	Missense_Mutation	SNP	G	G	A	rs574326427	byFrequency	TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr8:27369416G>A	ENST00000521400.1	+	6	1154	c.724G>A	c.(724-726)Gtg>Atg	p.V242M	EPHX2_ENST00000521780.1_Missense_Mutation_p.V176M|EPHX2_ENST00000517536.1_Intron|EPHX2_ENST00000518379.1_Missense_Mutation_p.V242M|EPHX2_ENST00000380476.3_Missense_Mutation_p.V189M	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	242	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		CCATGGGTACGTGACAGTAAA	0.532													G|||	3	0.000599042	0.0023	0.0	5008	,	,		19357	0.0		0.0	False		,,,				2504	0.0															0			8											226.0	197.0	207.0					8																	27369416		2203	4300	6503	27425333	SO:0001583	missense	2053			L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.724G>A	8.37:g.27369416G>A	ENSP00000430269:p.Val242Met	Somatic		Capture	Illumina GAIIx	4	27425333	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	HMMPfam_Hydrolase,superfamily_SSF56784,superfamily_SSF53474,HMMPfam_Abhydrolase_1	p.V242M	ENST00000521400.1	37	c.724	CCDS6060.1	8	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672683	0.67928	.	.	ENSG00000120915	ENST00000521400;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	T;T;T;T	0.05382	3.51;3.51;3.51;3.45	4.76	4.76	0.60689	.	0.112922	0.64402	D	0.000012	T	0.21674	0.0522	M	0.66297	2.02	0.47308	D	0.999384	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73708	0.981;0.952;0.961	T	0.00123	-1.2025	10	0.87932	D	0	-6.608	13.1479	0.59472	0.0:0.0:1.0:0.0	.	242;242;242	E5RFU2;E7ETW9;P34913	.;.;HYES_HUMAN	M	242;176;189;246;242	ENSP00000430269:V242M;ENSP00000430302:V176M;ENSP00000369843:V189M;ENSP00000427956:V242M	ENSP00000369843:V189M	V	+	1	0	EPHX2	27425333	1.000000	0.71417	0.315000	0.25238	0.129000	0.20672	4.929000	0.63455	2.480000	0.83734	0.561000	0.74099	GTG	-	superfamily_SSF53474		0.532	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX2	protein_coding	OTTHUMT00000219954.4	G			27425333	+1	no_errors	NM_001979	genbank	human	reviewed	54_36p	missense	SNP	0.769	A
ZNF165	7718	genome.wustl.edu	37	6	28057043	28057043	+	Missense_Mutation	SNP	A	A	G	rs547337001		TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr6:28057043A>G	ENST00000377325.1	+	4	1809	c.1253A>G	c.(1252-1254)cAt>cGt	p.H418R	ZSCAN12P1_ENST00000529104.1_RNA	NM_003447.3	NP_003438.1	P49910	ZN165_HUMAN	zinc finger protein 165	418					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CTTATCAGGCATCAGAGAATT	0.443													A|||	1	0.000199681	0.0	0.0	5008	,	,		19028	0.0		0.0	False		,,,				2504	0.001															0			6											54.0	57.0	56.0					6																	28057043		2203	4300	6503	28165022	SO:0001583	missense	7718			U78722	CCDS4643.1	6p21	2013-01-09			ENSG00000197279	ENSG00000197279		"""-"", ""Zinc fingers, C2H2-type"""	12953	protein-coding gene	gene with protein product	"""cancer/testis antigen 53"""	600834				7490084	Standard	NM_003447		Approved	ZSCAN7, CT53	uc021yro.1	P49910	OTTHUMG00000014505	ENST00000377325.1:c.1253A>G	6.37:g.28057043A>G	ENSP00000366542:p.His418Arg	Somatic		Capture	Illumina GAIIx	4	28165022		Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.H418R	ENST00000377325.1	37	c.1253	CCDS4643.1	6	.	.	.	.	.	.	.	.	.	.	A	19.60	3.858750	0.71834	.	.	ENSG00000197279	ENST00000377325	D	0.86865	-2.18	2.71	2.71	0.32032	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93592	0.7954	H	0.95224	3.64	0.40778	D	0.98314	D	0.89917	1.0	D	0.91635	0.999	D	0.93980	0.7257	9	0.87932	D	0	.	10.0209	0.42041	1.0:0.0:0.0:0.0	.	418	P49910	ZN165_HUMAN	R	418	ENSP00000366542:H418R	ENSP00000366542:H418R	H	+	2	0	ZNF165	28165022	1.000000	0.71417	0.987000	0.45799	0.949000	0.60115	5.817000	0.69229	1.268000	0.44264	0.477000	0.44152	CAT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.443	ZNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF165	protein_coding	OTTHUMT00000040173.1	A	NM_003447		28165022	+1	no_errors	NM_003447	genbank	human	reviewed	54_36p	missense	SNP	0.941	G
SDC3	9672	genome.wustl.edu	37	1	31346169	31346169	+	Silent	SNP	C	C	A	rs144697438		TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr1:31346169C>A	ENST00000339394.6	-	5	1392	c.1218G>T	c.(1216-1218)ctG>ctT	p.L406L	SDC3_ENST00000336798.7_Silent_p.L348L	NM_014654.3	NP_055469.3	O75056	SDC3_HUMAN	syndecan 3	406					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)		GATAGATGAGCAGTGTGACCA	0.572																																																0			1											110.0	97.0	102.0					1																	31346169		2203	4300	6503	31118756	SO:0001819	synonymous_variant	9672			AF248634	CCDS30661.1	1p35.2	2013-09-19	2007-02-15		ENSG00000162512	ENSG00000162512		"""Proteoglycans / Cell Surface : Syndecans"""	10660	protein-coding gene	gene with protein product	"""syndecan proteoglycan 3"""	186357	"""syndecan 3 (N-syndecan)"""			1556152, 11527150	Standard	NM_014654		Approved	N-syndecan, SYND3	uc001bse.2	O75056	OTTHUMG00000043646	ENST00000339394.6:c.1218G>T	1.37:g.31346169C>A		Somatic		Capture	Illumina GAIIx	4	31118756	Q5T1Z6|Q5T1Z7|Q96CT3|Q96PR8	Silent	SNP	HMMPfam_Syndecan,HMMSmart_SM00294,PatternScan_SYNDECAN	p.L406	ENST00000339394.6	37	c.1218	CCDS30661.1	1																																																																																			-	HMMPfam_Syndecan		0.572	SDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC3	protein_coding	OTTHUMT00000102017.1	C	NM_014654		31118756	-1	no_errors	NM_014654	genbank	human	validated	54_36p	silent	SNP	1.000	A
ZNF438	220929	genome.wustl.edu	37	10	31134108	31134108	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr10:31134108A>G	ENST00000361310.3	-	7	2598	c.2269T>C	c.(2269-2271)Tgc>Cgc	p.C757R	ZNF438_ENST00000436087.2_Missense_Mutation_p.C757R|ZNF438_ENST00000442986.1_Missense_Mutation_p.C757R|ZNF438_ENST00000452305.1_Missense_Mutation_p.C747R|ZNF438_ENST00000375311.1_Missense_Mutation_p.C321R|ZNF438_ENST00000538351.2_Missense_Mutation_p.C708R|ZNF438_ENST00000444692.2_Missense_Mutation_p.C747R|ZNF438_ENST00000331737.6_Missense_Mutation_p.C747R|ZNF438_ENST00000413025.1_Missense_Mutation_p.C757R			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	757					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				GGGCCCTGGCAGGTTTCCCTT	0.532																																																0			10											127.0	136.0	133.0					10																	31134108		2203	4300	6503	31174114	SO:0001583	missense	220929			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.2269T>C	10.37:g.31134108A>G	ENSP00000354663:p.Cys757Arg	Somatic		Capture	Illumina GAIIx	4	31174114	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.C757R	ENST00000361310.3	37	c.2269	CCDS7168.1	10	.	.	.	.	.	.	.	.	.	.	A	2.547	-0.304844	0.05495	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.09817	2.99;3.0;3.0;3.0;3.0;2.99;2.99;3.0;2.94	5.31	2.27	0.28462	.	1.976250	0.01599	N	0.021947	T	0.06690	0.0171	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.33292	-0.9874	10	0.22109	T	0.4	-2.2329	6.3873	0.21568	0.2239:0.0:0.6423:0.1339	.	757;747	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	R	747;757;757;757;757;747;747;708;476;321	ENSP00000333571:C747R;ENSP00000354663:C757R;ENSP00000406934:C757R;ENSP00000412363:C757R;ENSP00000387546:C757R;ENSP00000413060:C747R;ENSP00000410898:C747R;ENSP00000445461:C708R;ENSP00000364460:C321R	ENSP00000333571:C747R	C	-	1	0	ZNF438	31174114	0.004000	0.15560	0.001000	0.08648	0.008000	0.06430	1.506000	0.35747	0.294000	0.22547	-0.177000	0.13119	TGC	-	NULL		0.532	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	protein_coding	OTTHUMT00000277006.1	A	NM_182755		31174114	-1	no_errors	NM_182755	genbank	human	validated	54_36p	missense	SNP	0.000	G
RXFP3	51289	genome.wustl.edu	37	5	33937765	33937765	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr5:33937765C>T	ENST00000330120.3	+	1	1275	c.920C>T	c.(919-921)gCg>gTg	p.A307V		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	307					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						GGAGGGGCCGCGGTAGCCGGA	0.652																																																0			5											22.0	19.0	20.0					5																	33937765		2194	4296	6490	33973522	SO:0001583	missense	51289			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.920C>T	5.37:g.33937765C>T	ENSP00000328708:p.Ala307Val	Somatic		Capture	Illumina GAIIx	4	33973522	Q14DA5	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.A307V	ENST00000330120.3	37	c.920	CCDS3900.1	5	.	.	.	.	.	.	.	.	.	.	C	2.946	-0.217756	0.06101	.	.	ENSG00000182631	ENST00000330120	T	0.71103	-0.54	5.66	1.3	0.21679	GPCR, rhodopsin-like superfamily (1);	1.351940	0.05441	N	0.547674	T	0.65186	0.2667	M	0.64170	1.965	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.46275	-0.9203	10	0.30078	T	0.28	0.5471	5.298	0.15762	0.0:0.4834:0.2742:0.2424	.	307	Q9NSD7	RL3R1_HUMAN	V	307	ENSP00000328708:A307V	ENSP00000328708:A307V	A	+	2	0	RXFP3	33973522	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	0.478000	0.22212	0.646000	0.30693	0.655000	0.94253	GCG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.652	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP3	protein_coding	OTTHUMT00000207369.1	C	NM_016568		33973522	+1	no_errors	NM_016568	genbank	human	provisional	54_36p	missense	SNP	0.001	T
AGO3	192669	genome.wustl.edu	37	1	36479559	36479559	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr1:36479559G>A	ENST00000373191.4	+	11	1665	c.1316G>A	c.(1315-1317)cGa>cAa	p.R439Q	AGO3_ENST00000246314.6_Missense_Mutation_p.R205Q|RP4-665N4.8_ENST00000466576.2_RNA|RP4-665N4.8_ENST00000479395.2_RNA	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	439					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)	p.R439Q(1)									TGGGACATGCGAGGGAAACAA	0.408																																																1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	1											142.0	131.0	135.0					1																	36479559		2203	4300	6503	36252146	SO:0001583	missense	192669			AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1316G>A	1.37:g.36479559G>A	ENSP00000362287:p.Arg439Gln	Somatic		Capture	Illumina GAIIx	4	36252146	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	HMMPfam_DUF1785,superfamily_SSF101690,HMMPfam_PAZ,superfamily_RNaseH_fold,HMMPfam_Piwi	p.R439Q	ENST00000373191.4	37	c.1316	CCDS399.1	1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.705690	0.89018	.	.	ENSG00000126070	ENST00000373191;ENST00000246314	T;T	0.05786	3.39;3.39	5.65	5.65	0.86999	.	0.054730	0.64402	D	0.000001	T	0.19208	0.0461	M	0.90425	3.115	0.80722	D	1	B	0.29253	0.239	B	0.35859	0.212	T	0.06698	-1.0812	10	0.23891	T	0.37	-6.6058	19.7916	0.96461	0.0:0.0:1.0:0.0	.	439	Q9H9G7	AGO3_HUMAN	Q	439;205	ENSP00000362287:R439Q;ENSP00000246314:R205Q	ENSP00000246314:R205Q	R	+	2	0	EIF2C3	36252146	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.858000	0.99539	2.685000	0.91497	0.650000	0.86243	CGA	-	NULL		0.408	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C3	protein_coding	OTTHUMT00000019831.4	G	NM_024852		36252146	+1	no_errors	NM_024852	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SPINT1	6692	genome.wustl.edu	37	15	41148489	41148489	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr15:41148489G>A	ENST00000344051.4	+	10	1586	c.1352G>A	c.(1351-1353)gGc>gAc	p.G451D	SPINT1_ENST00000431806.1_Missense_Mutation_p.G435D|SPINT1_ENST00000562057.1_Missense_Mutation_p.G435D			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	451					branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GATGTGTTTGGCCTGAGGCGG	0.547																																																0			15											154.0	127.0	136.0					15																	41148489		2203	4300	6503	38935781	SO:0001583	missense	6692				CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.1352G>A	15.37:g.41148489G>A	ENSP00000342098:p.Gly451Asp	Somatic		Capture	Illumina GAIIx	4	38935781	Q7Z7D2	Missense_Mutation	SNP	HMMPfam_MANEC,HMMSmart_SM00765,superfamily_BPTI-like,HMMSmart_SM00131,HMMPfam_Kunitz_BPTI,PatternScan_BPTI_KUNITZ_1,HMMPfam_Ldl_recept_a,superfamily_LDL receptor-like module,HMMSmart_SM00192,PatternScan_LDLRA_1	p.G451D	ENST00000344051.4	37	c.1352	CCDS10067.1	15	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382965	0.61845	.	.	ENSG00000166145	ENST00000344051;ENST00000536281;ENST00000431806	D;D	0.95622	-3.74;-3.76	5.38	4.47	0.54385	.	0.439592	0.28908	N	0.013753	D	0.97056	0.9038	M	0.75447	2.3	0.41356	D	0.987398	D;D;D	0.89917	1.0;0.99;1.0	D;P;D	0.91635	0.999;0.828;0.986	D	0.96753	0.9555	10	0.46703	T	0.11	-9.9339	11.8004	0.52124	0.0838:0.0:0.9162:0.0	.	435;435;451	B2RBU9;O43278-2;O43278	.;.;SPIT1_HUMAN	D	451;418;435	ENSP00000342098:G451D;ENSP00000409935:G435D	ENSP00000342098:G451D	G	+	2	0	SPINT1	38935781	0.998000	0.40836	0.919000	0.36401	0.733000	0.41908	2.889000	0.48601	1.412000	0.46977	0.561000	0.74099	GGC	-	NULL		0.547	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPINT1	protein_coding	OTTHUMT00000252359.2	G	NM_003710		38935781	+1	no_errors	NM_181642	genbank	human	reviewed	54_36p	missense	SNP	0.996	A
LRFN2	57497	genome.wustl.edu	37	6	40360135	40360135	+	Silent	SNP	G	G	T			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr6:40360135G>T	ENST00000338305.6	-	3	2459	c.1917C>A	c.(1915-1917)ccC>ccA	p.P639P		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	639						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					GGATCCTCCAGGGGGCCCGTC	0.706																																																0			6											4.0	6.0	5.0					6																	40360135		2075	4121	6196	40468113	SO:0001819	synonymous_variant	57497			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1917C>A	6.37:g.40360135G>T		Somatic		Capture	Illumina GAIIx	4	40468113	A5PKU3|Q5SYP9	Silent	SNP	superfamily_L domain-like,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00082,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_fn3,superfamily_Fibronectin type III	p.P639	ENST00000338305.6	37	c.1917	CCDS34443.1	6																																																																																			-	NULL		0.706	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	protein_coding	OTTHUMT00000040488.1	G	XM_166372		40468113	-1	no_errors	NM_020737	genbank	human	provisional	54_36p	silent	SNP	0.925	T
CDC14C	168448	genome.wustl.edu	37	7	48964667	48964667	+	IGR	SNP	T	T	G			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr7:48964667T>G								AC004899.1 (73446 upstream) : AC010971.1 (305065 downstream)																							CACCCTATATTCCTTTCAGAG	0.398																																																0			7																																								48935213	SO:0001628	intergenic_variant	168448																															7.37:g.48964667T>G		Somatic		Capture	Illumina GAIIx	4	48935213		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.398					CDC14C			T			48935213	+1	pseudogene	NR_003595	genbank	human	provisional	54_36p	rna	SNP	0.853	G
CACNA1D	776	genome.wustl.edu	37	3	53779712	53779712	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr3:53779712C>G	ENST00000350061.5	+	24	3579	c.3068C>G	c.(3067-3069)aCc>aGc	p.T1023S	CACNA1D_ENST00000288139.4_Missense_Mutation_p.T1043S|CACNA1D_ENST00000422281.2_Missense_Mutation_p.T1023S	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1023					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ATCGTCACCACCCTCCTGCAG	0.537																																																0			3											175.0	144.0	154.0					3																	53779712		2203	4300	6503	53754752	SO:0001583	missense	776			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.3068C>G	3.37:g.53779712C>G	ENSP00000288133:p.Thr1023Ser	Somatic		Capture	Illumina GAIIx	4	53754752	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ	p.T1043S	ENST00000350061.5	37	c.3128	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593839	0.66219	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478	D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.36	5.91	5.91	0.95273	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97383	0.9144	L	0.37507	1.11	0.80722	D	1	P;P;P;P	0.51351	0.944;0.62;0.767;0.83	D;B;B;P	0.64237	0.923;0.304;0.444;0.674	D	0.97282	0.9918	10	0.48119	T	0.1	.	20.3053	0.98627	0.0:1.0:0.0:0.0	.	1023;716;1023;1043	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	S	1023;1043;1023;716	ENSP00000288133:T1023S;ENSP00000288139:T1043S;ENSP00000409174:T1023S;ENSP00000418014:T716S	ENSP00000288139:T1043S	T	+	2	0	CACNA1D	53754752	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.445000	0.80570	2.808000	0.96608	0.655000	0.94253	ACC	-	superfamily_SSF81324,HMMPfam_Ion_trans		0.537	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	protein_coding	OTTHUMT00000350557.1	C	NM_000720		53754752	+1	no_errors	NM_000720	genbank	human	validated	54_36p	missense	SNP	1.000	G
MBL2	4153	genome.wustl.edu	37	10	54527920	54527920	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr10:54527920C>T	ENST00000373968.3	-	4	788	c.724G>A	c.(724-726)Gcc>Acc	p.A242T		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	242	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						TCACAGACGGCCAGATGGGAG	0.483																																																0			10											234.0	214.0	221.0					10																	54527920		2202	4300	6502	54197926	SO:0001583	missense	4153			AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.724G>A	10.37:g.54527920C>T	ENSP00000363079:p.Ala242Thr	Somatic		Capture	Illumina GAIIx	4	54197926	Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Missense_Mutation	SNP	HMMPfam_Collagen,HMMSmart_SM00034,superfamily_C-type lectin-like,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1	p.A242T	ENST00000373968.3	37	c.724	CCDS7247.1	10	.	.	.	.	.	.	.	.	.	.	C	12.55	1.970692	0.34754	.	.	ENSG00000165471	ENST00000373968	T	0.22539	1.95	5.03	2.78	0.32641	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	0.456559	0.20595	N	0.089278	T	0.20210	0.0486	L	0.39326	1.205	0.09310	N	1	B	0.29646	0.253	B	0.42827	0.399	T	0.22871	-1.0204	10	0.22706	T	0.39	-10.0581	5.1651	0.15081	0.0:0.6409:0.0:0.3591	.	242	P11226	MBL2_HUMAN	T	242	ENSP00000363079:A242T	ENSP00000363079:A242T	A	-	1	0	MBL2	54197926	0.001000	0.12720	0.013000	0.15412	0.011000	0.07611	0.936000	0.28938	1.246000	0.43901	0.591000	0.81541	GCC	-	HMMSmart_SM00034,superfamily_C-type lectin-like,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1		0.483	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBL2	protein_coding	OTTHUMT00000048115.1	C	NM_000242		54197926	-1	no_errors	NM_000242	genbank	human	reviewed	54_36p	missense	SNP	0.002	T
WLS	79971	genome.wustl.edu	37	1	68628223	68628223	+	Intron	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr1:68628223G>A	ENST00000262348.4	-	3	633				WLS_ENST00000354777.2_Intron|WLS_ENST00000540432.1_Intron|WLS_ENST00000370976.3_Intron|GNG12-AS1_ENST00000413628.1_RNA|GNG12-AS1_ENST00000420587.1_RNA	NM_024911.6	NP_079187.3	Q5T9L3	WLS_HUMAN	wntless Wnt ligand secretion mediator						anterior/posterior axis specification (GO:0009948)|mesoderm formation (GO:0001707)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)|prostate(3)|urinary_tract(1)	20						AGCCGATGAGGCCCAGCATTT	0.587																																																0			1																																								68400811	SO:0001627	intron_variant	645291			BX538320	CCDS642.1, CCDS30750.1, CCDS53331.1	1p31.2	2013-10-03	2013-10-03	2010-03-02	ENSG00000116729	ENSG00000116729			30238	protein-coding gene	gene with protein product	"""wntless homolog"""	611514	"""chromosome 1 open reading frame 139"", ""G protein-coupled receptor 177"", ""wntless homolog (Drosophila)"""	C1orf139, GPR177		12761501	Standard	NM_024911		Approved	FLJ23091, MRP, wls, EVI, mig-14	uc001dee.3	Q5T9L3	OTTHUMG00000009153	ENST00000262348.4:c.380-3293C>T	1.37:g.68628223G>A		Somatic		Capture	Illumina GAIIx	4	68400811	B2RNT2|Q5JRS7|Q7Z2Z9|Q8NC43	RNA	SNP	-	NULL	ENST00000262348.4	37	NULL	CCDS642.1	1																																																																																			-	-		0.587	WLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC645291	protein_coding	OTTHUMT00000025368.1	G	NM_024911		68400811	-1	pseudogene	XR_017617	genbank	human	model	54_36p	rna	SNP	1.000	A
DHX38	9785	genome.wustl.edu	37	16	72137913	72137913	+	Silent	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr16:72137913G>A	ENST00000268482.3	+	14	2402	c.1893G>A	c.(1891-1893)ggG>ggA	p.G631G	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	631	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				TGACTGACGGGATCCTGCTCC	0.567																																					Melanoma(97;711 1442 7855 13832 28836)											0			16											124.0	111.0	115.0					16																	72137913		2198	4300	6498	70695414	SO:0001819	synonymous_variant	9785			AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.1893G>A	16.37:g.72137913G>A		Somatic		Capture	Illumina GAIIx	4	70695414	B4DVG8|D3DWS7|O75212|Q96HN7	Silent	SNP	HMMSmart_DEXDc,superfamily_SSF52540,PatternScan_DEAH_ATP_HELICASE,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_HA2,HMMPfam_DUF1605	p.G631	ENST00000268482.3	37	c.1893	CCDS10907.1	16																																																																																			-	HMMSmart_DEXDc,superfamily_SSF52540		0.567	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX38	protein_coding	OTTHUMT00000269004.3	G	NM_014003		70695414	+1	no_errors	NM_014003	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
ARHGEF17	9828	genome.wustl.edu	37	11	73021631	73021631	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr11:73021631G>A	ENST00000263674.3	+	1	2298	c.1948G>A	c.(1948-1950)Gca>Aca	p.A650T	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	650					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						AGGCATTGGGGCAGACCCTGA	0.637																																																0			11											72.0	62.0	65.0					11																	73021631		2200	4293	6493	72699279	SO:0001583	missense	9828			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.1948G>A	11.37:g.73021631G>A	ENSP00000263674:p.Ala650Thr	Somatic		Capture	Illumina GAIIx	4	72699279	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,superfamily_YVTN repeat-like/Quinoprotein amine dehydrogenase	p.A650T	ENST00000263674.3	37	c.1948	CCDS8221.1	11	.	.	.	.	.	.	.	.	.	.	G	2.315	-0.357057	0.05138	.	.	ENSG00000110237	ENST00000263674	T	0.50277	0.75	4.62	0.355	0.16069	.	0.245046	0.32401	N	0.006154	T	0.20901	0.0503	N	0.11560	0.145	0.27817	N	0.941945	B	0.06786	0.001	B	0.06405	0.002	T	0.18935	-1.0321	10	0.12430	T	0.62	-7.1076	6.6509	0.22961	0.598:0.0:0.402:0.0	.	650	Q96PE2	ARHGH_HUMAN	T	650	ENSP00000263674:A650T	ENSP00000263674:A650T	A	+	1	0	ARHGEF17	72699279	0.998000	0.40836	0.104000	0.21259	0.276000	0.26787	3.145000	0.50623	0.197000	0.20387	0.561000	0.74099	GCA	-	NULL		0.637	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	protein_coding	OTTHUMT00000397365.1	G	NM_014786		72699279	+1	no_errors	NM_014786	genbank	human	validated	54_36p	missense	SNP	0.911	A
TMEM60	85025	genome.wustl.edu	37	7	77423646	77423646	+	Silent	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr7:77423646G>A	ENST00000257663.3	-	2	421	c.45C>T	c.(43-45)ttC>ttT	p.F15F		NM_032936.3	NP_116325.1	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	15						integral component of membrane (GO:0016021)		p.F15L(1)		endometrium(1)|large_intestine(1)|lung(2)	4						AGAGTAGTGTGAAAAGCCAGG	0.403																																																1	Substitution - Missense(1)	lung(1)	7											72.0	72.0	72.0					7																	77423646		2203	4300	6503	77261582	SO:0001819	synonymous_variant	85025			AF260336	CCDS5593.1	7q11.23	2005-07-25	2005-07-25	2005-07-25	ENSG00000135211	ENSG00000135211			21754	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 35"""	C7orf35			Standard	NM_032936		Approved	DC32	uc003ugn.3	Q9H2L4	OTTHUMG00000130689	ENST00000257663.3:c.45C>T	7.37:g.77423646G>A		Somatic		Capture	Illumina GAIIx	4	77261582	A4D1C3|Q86UM0	Silent	SNP	NULL	p.F15	ENST00000257663.3	37	c.45	CCDS5593.1	7																																																																																			-	NULL		0.403	TMEM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM60	protein_coding	OTTHUMT00000253185.2	G	NM_032936		77261582	-1	no_errors	NM_032936	genbank	human	validated	54_36p	silent	SNP	1.000	A
FAM213A	84293	genome.wustl.edu	37	10	82187242	82187242	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr10:82187242C>T	ENST00000372181.1	+	4	1036	c.566C>T	c.(565-567)tCa>tTa	p.S189L	FAM213A_ENST00000372185.1_Missense_Mutation_p.S178L|FAM213A_ENST00000372187.5_Missense_Mutation_p.S189L|FAM213A_ENST00000372188.1_Missense_Mutation_p.S189L	NM_001243778.1|NM_001243782.1	NP_001230707.1|NP_001230711.1	Q9BRX8	F213A_HUMAN	family with sequence similarity 213, member A	189					oxidation-reduction process (GO:0055114)|regulation of osteoclast differentiation (GO:0045670)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)										GTGGTGGGATCAGGAAAGCAG	0.527																																																0			10											110.0	90.0	96.0					10																	82187242		2203	4300	6503	82177222	SO:0001583	missense	84293			AF086462	CCDS7368.1, CCDS58089.1	10q23.1	2011-12-08	2011-12-08	2011-12-08	ENSG00000122378	ENSG00000122378			28651	protein-coding gene	gene with protein product	"""peroxiredoxin-like 2 activated in M-CSF stimulated monocytes"""		"""chromosome 10 open reading frame 58"""	C10orf58		11483580, 19951071	Standard	NM_032333		Approved	MGC4248, PAMM	uc001kce.4	Q9BRX8	OTTHUMG00000018614	ENST00000372181.1:c.566C>T	10.37:g.82187242C>T	ENSP00000361254:p.Ser189Leu	Somatic		Capture	Illumina GAIIx	4	82177222	B2RD81|Q6UW08|Q8N2K3|Q8NBK9|Q96JR0	Missense_Mutation	SNP	superfamily_Thiordxn-like_fd	p.S189L	ENST00000372181.1	37	c.566	CCDS7368.1	10	.	.	.	.	.	.	.	.	.	.	C	15.37	2.812462	0.50527	.	.	ENSG00000122378	ENST00000372188;ENST00000372187;ENST00000372185;ENST00000372181	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.97	5.97	0.96955	.	0.792236	0.12298	N	0.481436	T	0.51381	0.1671	L	0.59436	1.845	0.38933	D	0.957977	P	0.36837	0.571	B	0.37198	0.243	T	0.55866	-0.8073	10	0.66056	D	0.02	-3.8503	17.9177	0.88957	0.0:1.0:0.0:0.0	.	189	Q9BRX8	PAMM_HUMAN	L	189;189;178;189	ENSP00000361262:S189L;ENSP00000361261:S189L;ENSP00000361259:S178L;ENSP00000361254:S189L	ENSP00000361254:S189L	S	+	2	0	C10orf58	82177222	0.926000	0.31397	0.969000	0.41365	0.730000	0.41778	3.130000	0.50508	2.828000	0.97474	0.655000	0.94253	TCA	-	NULL		0.527	FAM213A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C10orf58	protein_coding	OTTHUMT00000049077.2	C			82177222	+1	no_errors	NM_032333	genbank	human	validated	54_36p	missense	SNP	0.715	T
SEMA4D	10507	genome.wustl.edu	37	9	91995988	91995988	+	Missense_Mutation	SNP	C	C	T	rs150298124		TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr9:91995988C>T	ENST00000450295.1	-	15	2421	c.1645G>A	c.(1645-1647)Gat>Aat	p.D549N	SEMA4D_ENST00000343780.4_Missense_Mutation_p.D549N|SEMA4D_ENST00000438547.2_Missense_Mutation_p.D549N|SEMA4D_ENST00000420987.1_Missense_Mutation_p.D549N|SEMA4D_ENST00000339861.4_Missense_Mutation_p.D549N|SEMA4D_ENST00000455551.2_Missense_Mutation_p.D549N|SEMA4D_ENST00000422704.2_Missense_Mutation_p.D549N|SEMA4D_ENST00000356444.2_Missense_Mutation_p.D549N			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	549	PSI.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						ACAGAAGCATCGCCGCTCATC	0.572																																																0			9											157.0	135.0	142.0					9																	91995988		2203	4300	6503	91185808	SO:0001583	missense	10507			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.1645G>A	9.37:g.91995988C>T	ENSP00000416523:p.Asp549Asn	Somatic		Capture	Illumina GAIIx	4	91185808	B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMPfam_PSI,HMMSmart_PSI,superfamily_Plexin-like_fold,superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig	p.D549N	ENST00000450295.1	37	c.1645	CCDS6685.1	9	.	.	.	.	.	.	.	.	.	.	C	13.60	2.286006	0.40394	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000455551;ENST00000343780;ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	T;T;T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97	4.96	4.07	0.47477	.	0.245616	0.45361	D	0.000372	T	0.27489	0.0675	L	0.39397	1.21	0.09310	N	0.99999	D;P	0.64830	0.994;0.95	P;P	0.55391	0.775;0.706	T	0.08046	-1.0741	10	0.23891	T	0.37	.	12.3636	0.55217	0.0:0.9193:0.0:0.0807	.	549;549	Q92854-2;Q92854	.;SEM4D_HUMAN	N	549	ENSP00000344923:D549N;ENSP00000391733:D549N;ENSP00000411981:D549N;ENSP00000343418:D549N;ENSP00000416523:D549N;ENSP00000405102:D549N;ENSP00000348822:D549N;ENSP00000388768:D549N	ENSP00000344923:D549N	D	-	1	0	SEMA4D	91185808	0.978000	0.34361	0.061000	0.19648	0.161000	0.22273	2.983000	0.49345	1.307000	0.44944	0.561000	0.74099	GAT	-	HMMPfam_PSI,HMMSmart_PSI,superfamily_Plexin-like_fold		0.572	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA4D	protein_coding	OTTHUMT00000342411.1	C	NM_006378		91185808	-1	no_errors	NM_006378	genbank	human	validated	54_36p	missense	SNP	0.049	T
MUC17	140453	genome.wustl.edu	37	7	100686898	100686898	+	Silent	SNP	T	T	G			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr7:100686898T>G	ENST00000306151.4	+	3	12265	c.12201T>G	c.(12199-12201)ccT>ccG	p.P4067P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4067					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTACATTTCCTCCTGCTCACT	0.547																																																0			7											333.0	264.0	287.0					7																	100686898		2203	4300	6503	100473618	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.12201T>G	7.37:g.100686898T>G		Somatic		Capture	Illumina GAIIx	4	100473618	O14761|Q685J2|Q8TDH7	Silent	SNP	superfamily_EGF/Laminin,PatternScan_EGF_1,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.P4067	ENST00000306151.4	37	c.12201	CCDS34711.1	7																																																																																			-	NULL		0.547	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	T	NM_001040105		100473618	+1	no_errors	NM_001040105	genbank	human	provisional	54_36p	silent	SNP	0.066	G
STAB2	55576	genome.wustl.edu	37	12	104089393	104089393	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr12:104089393G>T	ENST00000388887.2	+	32	3645	c.3441G>T	c.(3439-3441)atG>atT	p.M1147I		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TGGAACAGATGCCTGACTATT	0.507																																																0			12											142.0	138.0	140.0					12																	104089393		2203	4300	6503	102613523	SO:0001583	missense	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.3441G>T	12.37:g.104089393G>T	ENSP00000373539:p.Met1147Ile	Somatic		Capture	Illumina GAIIx	4	102613523		Missense_Mutation	SNP	HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_alliinase,superfamily_SSF57196,HMMPfam_EGF,superfamily_BIgH3_FAS1,HMMPfam_Fasciclin,HMMSmart_FAS1,HMMPfam_Laminin_EGF,PatternScan_EGF_LAM_1,superfamily_Grow_fac_recept,HMMPfam_EGF_2,HMMSmart_LINK,HMMPfam_Xlink,superfamily_C-type_lectin_fold,PatternScan_LINK_1	p.M1147I	ENST00000388887.2	37	c.3441	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	18.20	3.572209	0.65765	.	.	ENSG00000136011	ENST00000388887	T	0.62639	0.01	6.17	5.29	0.74685	FAS1 domain (3);Growth factor, receptor (1);	0.135389	0.64402	D	0.000003	T	0.69691	0.3139	L	0.39898	1.24	0.39080	D	0.960892	D	0.63880	0.993	D	0.70227	0.968	T	0.67023	-0.5775	10	0.18276	T	0.48	.	15.5968	0.76590	0.0655:0.0:0.9345:0.0	.	1147	Q8WWQ8	STAB2_HUMAN	I	1147	ENSP00000373539:M1147I	ENSP00000373539:M1147I	M	+	3	0	STAB2	102613523	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.568000	0.82369	1.627000	0.50400	0.655000	0.94253	ATG	-	superfamily_BIgH3_FAS1		0.507	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	protein_coding	OTTHUMT00000407089.1	G			102613523	+1	no_errors	NM_017564	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PPRC1	23082	genome.wustl.edu	37	10	103899913	103899913	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr10:103899913G>C	ENST00000278070.2	+	5	1687	c.1648G>C	c.(1648-1650)Gct>Cct	p.A550P	PPRC1_ENST00000370012.1_5'Flank|PPRC1_ENST00000413464.2_Missense_Mutation_p.A550P	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	550					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		AAGTAGTCCTGCTAAAGAAGG	0.552																																																0			10											76.0	79.0	78.0					10																	103899913		2203	4300	6503	103889903	SO:0001583	missense	23082			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.1648G>C	10.37:g.103899913G>C	ENSP00000278070:p.Ala550Pro	Somatic		Capture	Illumina GAIIx	4	103889903	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.A550P	ENST00000278070.2	37	c.1648	CCDS7529.1	10	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638704	0.87760	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.57436	0.4;0.4	5.6	-0.891	0.10573	.	1.012530	0.07907	N	0.973662	T	0.37073	0.0990	L	0.29908	0.895	0.09310	N	1	B;B;B	0.15473	0.013;0.009;0.013	B;B;B	0.12156	0.007;0.007;0.007	T	0.32561	-0.9902	10	0.66056	D	0.02	.	4.8351	0.13460	0.3151:0.2709:0.414:0.0	.	550;430;550	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	P	550	ENSP00000278070:A550P;ENSP00000399743:A550P	ENSP00000278070:A550P	A	+	1	0	PPRC1	103889903	0.001000	0.12720	0.001000	0.08648	0.921000	0.55340	0.483000	0.22292	-0.348000	0.08286	0.455000	0.32223	GCT	-	NULL		0.552	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	protein_coding	OTTHUMT00000050021.1	G	NM_015062		103889903	+1	no_errors	NM_015062	genbank	human	reviewed	54_36p	missense	SNP	0.072	C
GCC2	9648	genome.wustl.edu	37	2	109098183	109098183	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr2:109098183G>C	ENST00000309863.6	+	10	3805	c.3091G>C	c.(3091-3093)Gag>Cag	p.E1031Q		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	1031					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						AAAGCAGTCAGAGCAACTGGA	0.313																																																0			2											47.0	53.0	51.0					2																	109098183		2203	4298	6501	108464615	SO:0001583	missense	9648			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.3091G>C	2.37:g.109098183G>C	ENSP00000307939:p.Glu1031Gln	Somatic		Capture	Illumina GAIIx	4	108464615	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	HMMPfam_GRIP,HMMSmart_Grip	p.E1031Q	ENST00000309863.6	37	c.3091	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	G	12.05	1.822714	0.32237	.	.	ENSG00000135968	ENST00000309863	T	0.36699	1.24	5.4	4.46	0.54185	.	0.000000	0.64402	D	0.000001	T	0.55862	0.1947	M	0.65975	2.015	0.41165	D	0.986127	D	0.76494	0.999	D	0.70716	0.97	T	0.55224	-0.8174	10	0.45353	T	0.12	.	14.2917	0.66284	0.0:0.1481:0.8519:0.0	.	1031	Q8IWJ2	GCC2_HUMAN	Q	1031	ENSP00000307939:E1031Q	ENSP00000307939:E1031Q	E	+	1	0	GCC2	108464615	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	5.812000	0.69194	2.681000	0.91329	0.650000	0.86243	GAG	-	NULL		0.313	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	protein_coding	OTTHUMT00000358516.3	G	NM_014635		108464615	+1	no_errors	NM_181453	genbank	human	reviewed	54_36p	missense	SNP	0.950	C
ZCCHC16	340595	genome.wustl.edu	37	X	111698666	111698666	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chrX:111698666C>T	ENST00000340433.2	+	1	940	c.710C>T	c.(709-711)tCc>tTc	p.S237F		NM_001004308.2	NP_001004308.2	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	237							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	27						TTGTTGGCTTCCTTGATCCAA	0.532																																																0			X											175.0	165.0	168.0					X																	111698666		2203	4300	6503	111585322	SO:0001583	missense	340595			AK128465	CCDS35369.1	Xq23	2008-05-02			ENSG00000187823	ENSG00000187823		"""Zinc fingers, CCHC domain containing"""	25214	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_001004308		Approved	Mart4, Mar4, FLJ46608	uc004epo.1	Q6ZR62	OTTHUMG00000159706	ENST00000340433.2:c.710C>T	X.37:g.111698666C>T	ENSP00000340590:p.Ser237Phe	Somatic		Capture	Illumina GAIIx	4	111585322	B2RPG1	Missense_Mutation	SNP	HMMSmart_ZnF_C2HC	p.S237F	ENST00000340433.2	37	c.710	CCDS35369.1	X	.	.	.	.	.	.	.	.	.	.	C	8.493	0.862536	0.17178	.	.	ENSG00000187823	ENST00000340433	T	0.34667	1.35	4.12	3.24	0.37175	.	0.443794	0.16885	N	0.195545	T	0.52125	0.1715	M	0.69823	2.125	0.09310	N	1	D	0.61697	0.99	D	0.63192	0.912	T	0.35051	-0.9804	10	0.46703	T	0.11	-8.8677	8.8301	0.35078	0.0:0.7762:0.2238:0.0	.	237	Q6ZR62	ZCH16_HUMAN	F	237	ENSP00000340590:S237F	ENSP00000340590:S237F	S	+	2	0	ZCCHC16	111585322	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.285000	0.08410	1.080000	0.41073	0.529000	0.55759	TCC	-	NULL		0.532	ZCCHC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC16	protein_coding	OTTHUMT00000356964.1	C	NM_001004308		111585322	+1	no_errors	NM_001004308	genbank	human	validated	54_36p	missense	SNP	0.002	T
KIAA1958	158405	genome.wustl.edu	37	9	115421709	115421709	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr9:115421709G>A	ENST00000337530.6	+	4	1807	c.1511G>A	c.(1510-1512)aGc>aAc	p.S504N	KIAA1958_ENST00000536272.1_Missense_Mutation_p.S532N	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	504										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						AGCACCTTCAGCTCCTCCACC	0.577																																																0			9											45.0	42.0	43.0					9																	115421709		2203	4300	6503	114461530	SO:0001583	missense	158405			AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.1511G>A	9.37:g.115421709G>A	ENSP00000336940:p.Ser504Asn	Somatic		Capture	Illumina GAIIx	4	114461530	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	NULL	p.S504N	ENST00000337530.6	37	c.1511	CCDS35108.1	9	.	.	.	.	.	.	.	.	.	.	G	8.498	0.863645	0.17250	.	.	ENSG00000165185	ENST00000337530;ENST00000536272	.	.	.	5.51	3.64	0.41730	.	.	.	.	.	T	0.14527	0.0351	N	0.03608	-0.345	0.19775	N	0.999952	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29761	-1.0001	8	0.16420	T	0.52	.	5.7779	0.18289	0.2246:0.1437:0.6318:0.0	.	532;504	B7ZKW6;Q8N8K9	.;K1958_HUMAN	N	504;532	.	ENSP00000336940:S504N	S	+	2	0	KIAA1958	114461530	0.667000	0.27484	0.979000	0.43373	0.998000	0.95712	0.865000	0.27940	0.675000	0.31264	0.655000	0.94253	AGC	-	NULL		0.577	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	KIAA1958	protein_coding	OTTHUMT00000053690.1	G	NM_133465		114461530	+1	no_errors	NM_133465	genbank	human	predicted	54_36p	missense	SNP	0.981	A
ALG1L	200810	genome.wustl.edu	37	3	125649450	125649450	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr3:125649450C>G	ENST00000340333.3	-	5	461	c.298G>C	c.(298-300)Gaa>Caa	p.E100Q	FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like	100							transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						CCATTTTCTTCATGTTTCACC	0.597																																																0			3											54.0	57.0	56.0					3																	125649450		1370	2315	3685	127132140	SO:0001583	missense	200810			BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.298G>C	3.37:g.125649450C>G	ENSP00000340009:p.Glu100Gln	Somatic		Capture	Illumina GAIIx	4	127132140	D3DNA5	Missense_Mutation	SNP	NULL	p.E100Q	ENST00000340333.3	37	c.298	CCDS33840.1	3	.	.	.	.	.	.	.	.	.	.	.	15.91	2.972642	0.53614	.	.	ENSG00000189366	ENST00000340333	D	0.84660	-1.88	2.11	2.11	0.27256	.	0.342911	0.33057	N	0.005330	D	0.88592	0.6478	M	0.75447	2.3	0.32598	N	0.526301	D	0.53619	0.961	P	0.58577	0.841	D	0.89058	0.3460	10	0.46703	T	0.11	-4.8454	9.9027	0.41357	0.0:1.0:0.0:0.0	.	100	Q6GMV1	ALG1L_HUMAN	Q	100	ENSP00000340009:E100Q	ENSP00000340009:E100Q	E	-	1	0	ALG1L	127132140	1.000000	0.71417	0.958000	0.39756	0.102000	0.19082	4.609000	0.61148	1.182000	0.42928	0.162000	0.16502	GAA	-	NULL		0.597	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC200810	protein_coding	OTTHUMT00000356347.1	C	NM_001015050		127132140	-1	no_errors	NM_001015050	genbank	human	predicted	54_36p	missense	SNP	1.000	G
C3orf27	23434	genome.wustl.edu	37	3	128292556	128292556	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr3:128292556T>A	ENST00000356020.2	-	3	983	c.17A>T	c.(16-18)cAt>cTt	p.H6L		NM_007354.2	NP_031380.1	O15544	GR6_HUMAN	chromosome 3 open reading frame 27	6										large_intestine(2)|lung(5)|prostate(1)	8				GBM - Glioblastoma multiforme(114;0.176)		CACTATCTGATGGAGCGCTTC	0.532																																																0			3											25.0	25.0	25.0					3																	128292556		2203	4300	6503	129775246	SO:0001583	missense	23434			AF008192	CCDS3050.1	3q21	2005-12-19			ENSG00000198685	ENSG00000198685			17099	protein-coding gene	gene with protein product						9307271	Standard	NR_125802		Approved	GR6	uc003ekq.3	O15544	OTTHUMG00000159688	ENST00000356020.2:c.17A>T	3.37:g.128292556T>A	ENSP00000348302:p.His6Leu	Somatic		Capture	Illumina GAIIx	4	129775246		Missense_Mutation	SNP	NULL	p.H6L	ENST00000356020.2	37	c.17	CCDS3050.1	3	.	.	.	.	.	.	.	.	.	.	T	14.89	2.669410	0.47677	.	.	ENSG00000198685	ENST00000356020	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	T	0.44603	0.1301	N	0.08118	0	0.31808	N	0.627492	D	0.89917	1.0	D	0.87578	0.998	T	0.57254	-0.7843	8	0.87932	D	0	.	13.4717	0.61285	0.0:0.0:0.0:1.0	.	6	O15544	GR6_HUMAN	L	6	.	ENSP00000348302:H6L	H	-	2	0	C3orf27	129775246	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	5.329000	0.65892	1.574000	0.49760	0.402000	0.26972	CAT	-	NULL		0.532	C3orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf27	protein_coding	OTTHUMT00000356924.1	T	NM_007354		129775246	-1	no_errors	NM_007354	genbank	human	provisional	54_36p	missense	SNP	1.000	A
PTGDS	5730	genome.wustl.edu	37	9	139872144	139872144	+	Splice_Site	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr9:139872144G>A	ENST00000371625.3	+	1	188	c.114G>A	c.(112-114)aaG>aaA	p.K38K	PTGDS_ENST00000224167.2_Splice_Site_p.K38K|RP11-229P13.19_ENST00000413913.2_RNA	NM_000954.5	NP_000945.3	P41222	PTGDS_HUMAN	prostaglandin D2 synthase 21kDa (brain)	38					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|rough endoplasmic reticulum (GO:0005791)	fatty acid binding (GO:0005504)|prostaglandin-D synthase activity (GO:0004667)|retinoid binding (GO:0005501)|transporter activity (GO:0005215)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		AGCAGGACAAGGTGAGGGGCT	0.657																																																0			9											26.0	21.0	22.0					9																	139872144		2184	4293	6477	138991965	SO:0001630	splice_region_variant	5730			AA621632	CCDS7019.1	9q34.2-q34.3	2011-11-15	2002-08-29		ENSG00000107317	ENSG00000107317	5.3.99.2	"""Lipocalins"""	9592	protein-coding gene	gene with protein product	"""lipocalin-type prostaglandin D synthase"""	176803	"""prostaglandin D2 synthase (21kD, brain)"""			1902577	Standard	NM_000954		Approved	PGDS, L-PGDS	uc004cke.3	P41222	OTTHUMG00000020957	ENST00000371625.3:c.114+1G>A	9.37:g.139872144G>A		Somatic		Capture	Illumina GAIIx	4	138991965	B2R727|Q5SQ10|Q7M4P3|Q9UC22|Q9UCC9|Q9UCD9	Silent	SNP	superfamily_Lipocalins,PatternScan_LIPOCALIN,HMMPfam_Lipocalin	p.K38	ENST00000371625.3	37	c.114	CCDS7019.1	9																																																																																			-	superfamily_Lipocalins,PatternScan_LIPOCALIN		0.657	PTGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDS	protein_coding	OTTHUMT00000055188.1	G	NM_000954	Silent	138991965	+1	no_errors	NM_000954	genbank	human	reviewed	54_36p	silent	SNP	0.611	A
ANAPC2	29882	genome.wustl.edu	37	9	140081941	140081941	+	Silent	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr9:140081941G>A	ENST00000323927.2	-	2	736	c.732C>T	c.(730-732)agC>agT	p.S244S	SSNA1_ENST00000322310.5_5'Flank	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	244					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		ACAAGACCTGGCTGAGCTGAT	0.622																																																0			9											81.0	71.0	74.0					9																	140081941		2203	4300	6503	139201762	SO:0001819	synonymous_variant	29882			AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.732C>T	9.37:g.140081941G>A		Somatic		Capture	Illumina GAIIx	4	139201762	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Silent	SNP	"HMMPfam_Cullin,superfamily_Cullin homology domain,HMMSmart_SM00182,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_APC2"	p.S244	ENST00000323927.2	37	c.732	CCDS7033.1	9																																																																																			-	NULL		0.622	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC2	protein_coding	OTTHUMT00000055315.1	G	NM_013366		139201762	-1	no_errors	NM_013366	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
NRG2	9542	genome.wustl.edu	37	5	139232565	139232565	+	Missense_Mutation	SNP	G	G	A	rs199663558		TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr5:139232565G>A	ENST00000361474.1	-	7	1564	c.1340C>T	c.(1339-1341)cCg>cTg	p.P447L	CTB-35F21.4_ENST00000504413.1_RNA|NRG2_ENST00000289422.7_Missense_Mutation_p.P455L|NRG2_ENST00000340391.3_Missense_Mutation_p.P244L|NRG2_ENST00000545385.1_Missense_Mutation_p.P449L|NRG2_ENST00000358522.3_Missense_Mutation_p.P449L|NRG2_ENST00000289409.4_Missense_Mutation_p.P441L|NRG2_ENST00000541337.1_Missense_Mutation_p.P381L|NRG2_ENST00000394770.1_3'UTR	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	447					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGATGGGCCGGGCACATGTT	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		19993	0.001		0.0	False		,,,				2504	0.0															0			5						G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	0,4406		0,0,2203	87.0	87.0	87.0		1142,1340,1322,1364,1346	5.2	1.0	5		87	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	NRG2	NM_001184935.1,NM_004883.2,NM_013981.3,NM_013982.2,NM_013983.2	98,98,98,98,98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	381/785,447/851,441/845,455/859,449/853	139232565	1,13005	2203	4300	6503	139212749	SO:0001583	missense	9542				CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.1340C>T	5.37:g.139232565G>A	ENSP00000354910:p.Pro447Leu	Somatic		Capture	Illumina GAIIx	4	139212749		Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_Neuregulin	p.P455L	ENST00000361474.1	37	c.1364	CCDS4217.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	19.69	3.874005	0.72180	0.0	1.16E-4	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000340391;ENST00000289409;ENST00000358522	T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6	5.19	5.19	0.71726	Neuregulin 1-related, C-terminal (1);	0.251877	0.32120	N	0.006544	T	0.53417	0.1795	L	0.54323	1.7	0.80722	D	1	P;P;P;P	0.52061	0.938;0.95;0.892;0.938	B;P;B;B	0.47206	0.405;0.541;0.405;0.405	T	0.52881	-0.8516	10	0.36615	T	0.2	-10.1262	13.5187	0.61555	0.0:0.0:0.8448:0.1552	.	441;447;449;455	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	L	381;455;447;455;449;244;441;449	ENSP00000444235:P381L;ENSP00000289422:P455L;ENSP00000354910:P447L;ENSP00000438753:P449L;ENSP00000342660:P244L;ENSP00000289409:P441L;ENSP00000351323:P449L	ENSP00000289409:P441L	P	-	2	0	NRG2	139212749	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	4.322000	0.59215	2.416000	0.81992	0.467000	0.42956	CCG	-	HMMPfam_Neuregulin		0.632	NRG2-001	KNOWN	basic|CCDS	protein_coding	NRG2	protein_coding	OTTHUMT00000251340.1	G	NM_013982		139212749	-1	no_errors	NM_013982	genbank	human	reviewed	54_36p	missense	SNP	0.914	A
PCDHB3	56132	genome.wustl.edu	37	5	140482498	140482498	+	Silent	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr5:140482498G>A	ENST00000231130.2	+	1	2265	c.2265G>A	c.(2263-2265)ctG>ctA	p.L755L	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	755					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGTGTGTCTGACTGGAGGCT	0.597																																																0			5											41.0	42.0	41.0					5																	140482498		2191	4275	6466	140462682	SO:0001819	synonymous_variant	56132			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2265G>A	5.37:g.140482498G>A		Somatic		Capture	Illumina GAIIx	4	140462682	B2R8P2	Silent	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin-like,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.L755	ENST00000231130.2	37	c.2265	CCDS4245.1	5																																																																																			-	NULL		0.597	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	protein_coding	OTTHUMT00000251817.2	G	NM_018937		140462682	+1	no_errors	NM_018937	genbank	human	reviewed	54_36p	silent	SNP	0.355	A
SLC52A2	79581	genome.wustl.edu	37	8	145583350	145583350	+	Silent	SNP	C	C	T			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr8:145583350C>T	ENST00000532887.1	+	3	781	c.198C>T	c.(196-198)acC>acT	p.T66T	SLC52A2_ENST00000540505.1_5'UTR|FBXL6_ENST00000455319.2_5'Flank|FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000530047.1_Silent_p.T66T|SLC52A2_ENST00000329994.2_Silent_p.T66T|SLC52A2_ENST00000526752.1_Intron|SLC52A2_ENST00000527078.1_Silent_p.T66T|SLC52A2_ENST00000402965.1_Silent_p.T66T|SLC52A2_ENST00000526891.1_3'UTR|FBXL6_ENST00000331890.5_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	66					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	TGGTGGTGACCCTCTGGAGGA	0.657																																																0			8											132.0	125.0	128.0					8																	145583350		2203	4300	6503	145554158	SO:0001819	synonymous_variant	79581			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.198C>T	8.37:g.145583350C>T		Somatic		Capture	Illumina GAIIx	4	145554158	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Silent	SNP	HMMPfam_DUF1011	p.T66	ENST00000532887.1	37	c.198	CCDS6423.1	8																																																																																			-	NULL		0.657	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPR172A	protein_coding	OTTHUMT00000382405.1	C	NM_024531		145554158	+1	no_errors	NM_024531	genbank	human	validated	54_36p	silent	SNP	0.976	T
SLC52A2	79581	genome.wustl.edu	37	8	145583713	145583713	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr8:145583713C>A	ENST00000532887.1	+	3	1144	c.561C>A	c.(559-561)ttC>ttA	p.F187L	SLC52A2_ENST00000540505.1_Missense_Mutation_p.F99L|FBXL6_ENST00000455319.2_5'Flank|FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000530047.1_Missense_Mutation_p.F187L|SLC52A2_ENST00000329994.2_Missense_Mutation_p.F187L|SLC52A2_ENST00000526752.1_Intron|SLC52A2_ENST00000527078.1_Missense_Mutation_p.F187L|SLC52A2_ENST00000402965.1_Missense_Mutation_p.F187L|FBXL6_ENST00000331890.5_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	187					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	CGCTCGACTTCCTTGAGCGTT	0.677																																																0			8											49.0	53.0	52.0					8																	145583713		2203	4298	6501	145554521	SO:0001583	missense	79581			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.561C>A	8.37:g.145583713C>A	ENSP00000436768:p.Phe187Leu	Somatic		Capture	Illumina GAIIx	4	145554521	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	HMMPfam_DUF1011	p.F187L	ENST00000532887.1	37	c.561	CCDS6423.1	8	.	.	.	.	.	.	.	.	.	.	C	0.034	-1.315934	0.01331	.	.	ENSG00000185803	ENST00000530047;ENST00000527078;ENST00000402965;ENST00000532887;ENST00000329994;ENST00000540505	T;T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77;-0.54	4.34	2.1	0.27182	.	0.071969	0.56097	D	0.000032	T	0.49695	0.1572	N	0.13198	0.31	0.09310	N	0.999998	B	0.06786	0.001	B	0.08055	0.003	T	0.20174	-1.0283	9	.	.	.	.	4.792	0.13254	0.0:0.5763:0.1857:0.238	.	187	Q9HAB3	RFT3_HUMAN	L	187;187;187;187;187;99	ENSP00000435820:F187L;ENSP00000434728:F187L;ENSP00000385961:F187L;ENSP00000436768:F187L;ENSP00000333638:F187L;ENSP00000440400:F99L	.	F	+	3	2	GPR172A	145554521	0.000000	0.05858	0.936000	0.37596	0.098000	0.18820	-0.554000	0.06006	0.815000	0.34398	0.462000	0.41574	TTC	-	NULL		0.677	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPR172A	protein_coding	OTTHUMT00000382405.1	C	NM_024531		145554521	+1	no_errors	NM_024531	genbank	human	validated	54_36p	missense	SNP	0.001	A
SLC52A2	79581	genome.wustl.edu	37	8	145583754	145583754	+	Missense_Mutation	SNP	C	C	G	rs552024614	byFrequency	TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr8:145583754C>G	ENST00000532887.1	+	3	1185	c.602C>G	c.(601-603)aCt>aGt	p.T201S	SLC52A2_ENST00000540505.1_Missense_Mutation_p.T113S|FBXL6_ENST00000455319.2_5'Flank|SLC52A2_ENST00000530047.1_Missense_Mutation_p.T201S|SLC52A2_ENST00000329994.2_Missense_Mutation_p.T201S|SLC52A2_ENST00000526752.1_Intron|SLC52A2_ENST00000527078.1_Missense_Mutation_p.T201S|SLC52A2_ENST00000402965.1_Missense_Mutation_p.T201S|FBXL6_ENST00000331890.5_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	201					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	TGGGCACTGACTGCCCTTCTG	0.652																																																0			8											60.0	61.0	61.0					8																	145583754		2203	4297	6500	145554562	SO:0001583	missense	79581			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.602C>G	8.37:g.145583754C>G	ENSP00000436768:p.Thr201Ser	Somatic		Capture	Illumina GAIIx	4	145554562	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	HMMPfam_DUF1011	p.T201S	ENST00000532887.1	37	c.602	CCDS6423.1	8	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.805663	0.00606	.	.	ENSG00000185803	ENST00000530047;ENST00000527078;ENST00000402965;ENST00000532887;ENST00000329994;ENST00000540505	T;T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78;-0.54	4.49	3.53	0.40419	.	0.613542	0.17303	N	0.179189	T	0.48077	0.1480	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.12156	0.007	T	0.19712	-1.0297	9	.	.	.	.	4.8584	0.13571	0.2133:0.6774:0.0:0.1093	.	201	Q9HAB3	RFT3_HUMAN	S	201;201;201;201;201;113	ENSP00000435820:T201S;ENSP00000434728:T201S;ENSP00000385961:T201S;ENSP00000436768:T201S;ENSP00000333638:T201S;ENSP00000440400:T113S	.	T	+	2	0	GPR172A	145554562	0.000000	0.05858	0.253000	0.24343	0.136000	0.21042	0.124000	0.15728	2.055000	0.61198	0.462000	0.41574	ACT	-	NULL		0.652	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPR172A	protein_coding	OTTHUMT00000382405.1	C	NM_024531		145554562	+1	no_errors	NM_024531	genbank	human	validated	54_36p	missense	SNP	0.010	G
SLC52A2	79581	genome.wustl.edu	37	8	145583844	145583844	+	Nonsense_Mutation	SNP	C	C	G			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr8:145583844C>G	ENST00000532887.1	+	3	1275	c.692C>G	c.(691-693)tCa>tGa	p.S231*	SLC52A2_ENST00000540505.1_Nonsense_Mutation_p.S143*|FBXL6_ENST00000455319.2_5'Flank|SLC52A2_ENST00000530047.1_Nonsense_Mutation_p.S231*|SLC52A2_ENST00000329994.2_Nonsense_Mutation_p.S231*|SLC52A2_ENST00000526752.1_Intron|SLC52A2_ENST00000527078.1_Nonsense_Mutation_p.S231*|SLC52A2_ENST00000402965.1_Nonsense_Mutation_p.S231*|FBXL6_ENST00000331890.5_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	231					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	GAGTTAGGATCAGGCCTCCAG	0.627																																																0			8											54.0	57.0	56.0					8																	145583844		2203	4299	6502	145554652	SO:0001587	stop_gained	79581			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.692C>G	8.37:g.145583844C>G	ENSP00000436768:p.Ser231*	Somatic		Capture	Illumina GAIIx	4	145554652	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Nonsense_Mutation	SNP	HMMPfam_DUF1011	p.S231*	ENST00000532887.1	37	c.692	CCDS6423.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.916390	0.97099	.	.	ENSG00000185803	ENST00000530047;ENST00000527078;ENST00000526338;ENST00000402965;ENST00000532887;ENST00000329994;ENST00000540505	.	.	.	4.49	2.59	0.31030	.	1.287600	0.05044	N	0.476908	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	11.1158	0.48259	0.3249:0.6751:0.0:0.0	.	.	.	.	X	231;231;67;231;231;231;143	.	ENSP00000333638:S231X	S	+	2	0	GPR172A	145554652	0.000000	0.05858	0.001000	0.08648	0.214000	0.24535	0.511000	0.22739	0.295000	0.22570	0.462000	0.41574	TCA	-	NULL		0.627	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPR172A	protein_coding	OTTHUMT00000382405.1	C	NM_024531		145554652	+1	no_errors	NM_024531	genbank	human	validated	54_36p	nonsense	SNP	0.000	G
SLC52A2	79581	genome.wustl.edu	37	8	145584055	145584055	+	Silent	SNP	C	C	T			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr8:145584055C>T	ENST00000532887.1	+	3	1486	c.903C>T	c.(901-903)tcC>tcT	p.S301S	SLC52A2_ENST00000540505.1_Silent_p.S213S|FBXL6_ENST00000455319.2_5'Flank|SLC52A2_ENST00000530047.1_Silent_p.S301S|SLC52A2_ENST00000329994.2_Silent_p.S301S|SLC52A2_ENST00000526752.1_Intron|SLC52A2_ENST00000527078.1_Silent_p.S301S|SLC52A2_ENST00000402965.1_Silent_p.S301S|FBXL6_ENST00000331890.5_5'Flank			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	301					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	AGAGCTTTTCCTGCTTACCCT	0.647																																																0			8											79.0	72.0	74.0					8																	145584055		2203	4297	6500	145554863	SO:0001819	synonymous_variant	79581			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.903C>T	8.37:g.145584055C>T		Somatic		Capture	Illumina GAIIx	4	145554863	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Silent	SNP	HMMPfam_DUF1011	p.S301	ENST00000532887.1	37	c.903	CCDS6423.1	8																																																																																			-	HMMPfam_DUF1011		0.647	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPR172A	protein_coding	OTTHUMT00000382405.1	C	NM_024531		145554863	+1	no_errors	NM_024531	genbank	human	validated	54_36p	silent	SNP	1.000	T
MMAA	166785	genome.wustl.edu	37	4	146545154	146545154	+	Intron	SNP	C	C	G			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr4:146545154C>G	ENST00000281317.5	+	1	1145					NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type						cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AACTTATAATCTGATGACTCA	0.388																																																0			4																																								146764604	SO:0001627	intron_variant	729497			AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.-66+4595C>G	4.37:g.146545154C>G		Somatic		Capture	Illumina GAIIx	4	146764604	B3KX40|Q495G7	RNA	SNP	-	NULL	ENST00000281317.5	37	NULL	CCDS3766.1	4																																																																																			-	-		0.388	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729497	protein_coding	OTTHUMT00000364668.2	C			146764604	-1	pseudogene	XR_015940	genbank	human	model	54_36p	rna	SNP	0.004	G
DLX2	1746	genome.wustl.edu	37	2	172965648	172965648	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr2:172965648G>A	ENST00000234198.4	-	3	971	c.610C>T	c.(610-612)Cgg>Tgg	p.R204W	AC104801.1_ENST00000448117.1_lincRNA|DLX2_ENST00000466293.2_3'UTR	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	204					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|cartilage development (GO:0051216)|cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic cranial skeleton morphogenesis (GO:0048701)|hippocampus development (GO:0021766)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)			AACTTGGACCGGCGGTTCTGG	0.542																																					GBM(188;775 2993 11256 23072)											0			2											37.0	38.0	38.0					2																	172965648		2141	4151	6292	172673894	SO:0001583	missense	1746			U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844		"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""			1354641	Standard	NM_004405		Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.610C>T	2.37:g.172965648G>A	ENSP00000234198:p.Arg204Trp	Somatic		Capture	Illumina GAIIx	4	172673894	B4DMK4|B7ZA14	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.R204W	ENST00000234198.4	37	c.610	CCDS2248.1	2	.	.	.	.	.	.	.	.	.	.	g	25.5	4.648960	0.87958	.	.	ENSG00000115844	ENST00000234198	D	0.99167	-5.51	4.8	4.8	0.61643	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99486	0.9817	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98221	1.0478	10	0.87932	D	0	-15.7063	13.3491	0.60591	0.0:0.0:0.8413:0.1587	.	204	Q07687	DLX2_HUMAN	W	204	ENSP00000234198:R204W	ENSP00000234198:R204W	R	-	1	2	DLX2	172673894	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.497000	0.60367	2.196000	0.70406	0.457000	0.33378	CGG	-	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1		0.542	DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX2	protein_coding	OTTHUMT00000255368.3	G			172673894	-1	no_errors	NM_004405	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ATP11B	23200	genome.wustl.edu	37	3	182575809	182575809	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr3:182575809G>C	ENST00000323116.5	+	11	1255	c.995G>C	c.(994-996)aGc>aCc	p.S332T		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	332					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			CAAAGAAATAGCAGTAAGGTA	0.378																																																0			3											83.0	78.0	80.0					3																	182575809		2203	4300	6503	184058503	SO:0001583	missense	23200			AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.995G>C	3.37:g.182575809G>C	ENSP00000321195:p.Ser332Thr	Somatic		Capture	Illumina GAIIx	4	184058503	Q96FN1|Q9UKK7	Missense_Mutation	SNP	HMMPfam_E1-E2_ATPase,superfamily_SSF81653,superfamily_SSF56784,HMMPfam_Hydrolase,PatternScan_ATPASE_E1_E2,superfamily_SSF81660	p.S332T	ENST00000323116.5	37	c.995	CCDS33896.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.52|12.52	1.963836|1.963836	0.34659|0.34659	.|.	.|.	ENSG00000058063|ENSG00000058063	ENST00000498086|ENST00000323116	.|T	.|0.63255	.|-0.03	5.48|5.48	5.48|5.48	0.80851|0.80851	.|ATPase, P-type, ATPase-associated domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.47002|0.47002	0.1422|0.1422	N|N	0.11284|0.11284	0.12|0.12	0.80722|0.80722	D|D	1|1	.|B	.|0.22541	.|0.071	.|B	.|0.30401	.|0.115	T|T	0.40421|0.40421	-0.9564|-0.9564	5|10	.|0.11485	.|T	.|0.65	.|.	19.3533|19.3533	0.94401|0.94401	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|332	.|Q9Y2G3	.|AT11B_HUMAN	P|T	133|332	.|ENSP00000321195:S332T	.|ENSP00000321195:S332T	A|S	+|+	1|2	0|0	ATP11B|ATP11B	184058503|184058503	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.457000|7.457000	0.80775|0.80775	2.588000|2.588000	0.87417|0.87417	0.563000|0.563000	0.77884|0.77884	GCA|AGC	-	NULL		0.378	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP11B	protein_coding	OTTHUMT00000350598.1	G	NM_014616		184058503	+1	no_errors	NM_014616	genbank	human	validated	54_36p	missense	SNP	1.000	C
IPO9	55705	genome.wustl.edu	37	1	201798345	201798345	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2532-01A-01D-1526-09	TCGA-36-2532-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	63680058-ad96-4f00-9dcb-a3b40d325b05	ddf31ba0-e9f0-44c4-ad17-6ab67ef831ac	g.chr1:201798345C>T	ENST00000361565.4	+	1	77	c.8C>T	c.(7-9)gCg>gTg	p.A3V	IPO9-AS1_ENST00000413035.1_RNA|IPO9-AS1_ENST00000421449.1_RNA|IPO9-AS1_ENST00000421159.1_RNA|IPO9_ENST00000464348.1_3'UTR	NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	3					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						AAGATGGCGGCGGCGGCGGCA	0.711																																																0			1											4.0	7.0	6.0					1																	201798345		1859	3746	5605	200064968	SO:0001583	missense	55705			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.8C>T	1.37:g.201798345C>T	ENSP00000354742:p.Ala3Val	Somatic		Capture	Illumina GAIIx	4	200064968	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_IBN_N	p.A3V	ENST00000361565.4	37	c.8	CCDS1415.1	1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.873567	0.91664	.	.	ENSG00000198700	ENST00000361565	.	.	.	4.31	4.31	0.51392	.	0.138458	0.48767	D	0.000167	T	0.22820	0.0551	N	0.08118	0	0.45161	D	0.998171	P	0.47302	0.893	B	0.32211	0.142	T	0.10730	-1.0617	9	0.30078	T	0.28	-11.4358	14.6597	0.68861	0.0:1.0:0.0:0.0	.	3	Q96P70	IPO9_HUMAN	V	3	.	ENSP00000354742:A3V	A	+	2	0	IPO9	200064968	1.000000	0.71417	0.984000	0.44739	0.994000	0.84299	4.347000	0.59373	2.387000	0.81309	0.561000	0.74099	GCG	-	NULL		0.711	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO9	protein_coding	OTTHUMT00000087088.1	C	NM_018085		200064968	+1	no_errors	NM_018085	genbank	human	validated	54_36p	missense	SNP	1.000	T
