#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
JSRP1	126306	genome.wustl.edu	37	19	2254190	2254190	+	Silent	SNP	T	T	A	rs533027997		TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr19:2254190T>A	ENST00000300961.6	-	4	322	c.258A>T	c.(256-258)ggA>ggT	p.G86G	JSRP1_ENST00000586471.2_Silent_p.G86G	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	86					protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCCACTCGCTCCGGCTTTCA	0.637											OREG0025137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			19											134.0	131.0	132.0					19																	2254190		2203	4300	6503	2205190	SO:0001819	synonymous_variant	126306			AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.258A>T	19.37:g.2254190T>A		Somatic	602	Capture	Illumina GAIIx	4	2205190		Silent	SNP	NULL	p.G86	ENST00000300961.6	37	c.258	CCDS12086.1	19																																																																																			-	NULL		0.637	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	JSRP1	protein_coding	OTTHUMT00000451266.2	T	NM_144616		2205190	-1	no_errors	NM_144616	genbank	human	provisional	54_36p	silent	SNP	0.439	A
SIRT6	51548	genome.wustl.edu	37	19	4174680	4174680	+	Silent	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr19:4174680C>T	ENST00000337491.2	-	8	1066	c.1002G>A	c.(1000-1002)gaG>gaA	p.E334E	SIRT6_ENST00000594279.1_3'UTR|SIRT6_ENST00000381935.3_Silent_p.E262E|SIRT6_ENST00000601488.1_3'UTR|SIRT6_ENST00000305232.6_Silent_p.E307E	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	334	Pro-rich.				histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTGGGCCGCTCCCGTTTGG	0.687																																																0			19											3.0	4.0	4.0					19																	4174680		1996	3951	5947	4125680	SO:0001819	synonymous_variant	51548			AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.1002G>A	19.37:g.4174680C>T		Somatic		Capture	Illumina GAIIx	4	4125680	B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Silent	SNP	superfamily_DHS-like NAD/FAD-binding domain,HMMPfam_SIR2	p.E334	ENST00000337491.2	37	c.1002	CCDS12122.1	19																																																																																			-	NULL		0.687	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT6	protein_coding	OTTHUMT00000457931.2	C			4125680	-1	no_errors	NM_016539	genbank	human	reviewed	54_36p	silent	SNP	0.195	T
TP53	7157	genome.wustl.edu	37	17	7578448	7578448	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr17:7578448G>T	ENST00000269305.4	-	5	671	c.482C>A	c.(481-483)gCc>gAc	p.A161D	TP53_ENST00000455263.2_Missense_Mutation_p.A161D|TP53_ENST00000445888.2_Missense_Mutation_p.A161D|TP53_ENST00000413465.2_Missense_Mutation_p.A161D|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.A161D|TP53_ENST00000420246.2_Missense_Mutation_p.A161D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	161	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).|MA -> IP (in a sporadic cancer; somatic mutation).|MA -> IS (in sporadic cancers; somatic mutation).|MA -> IT (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A161D(11)|p.0?(8)|p.A161V(8)|p.R156_I162delRVRAMAI(2)|p.V157_C176del20(1)|p.A161fs*19(1)|p.A68D(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.A29D(1)|p.A159_Q167delAMAIYKQSQ(1)|p.S149fs*72(1)|p.V157_I162delVRAMAI(1)|p.A161fs*7(1)|p.T155_A161delTRVRAMA(1)|p.A161T(1)|p.A161fs*8(1)|p.I162fs*8(1)|p.A161F(1)|p.A161G(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTGTAGATGGCCATGGCGCG	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	47	Substitution - Missense(24)|Whole gene deletion(8)|Deletion - In frame(8)|Deletion - Frameshift(7)	lung(13)|ovary(5)|central_nervous_system(4)|oesophagus(4)|bone(4)|stomach(3)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|large_intestine(2)|thyroid(1)|upper_aerodigestive_tract(1)|vulva(1)|cervix(1)|skin(1)|liver(1)	17	GRCh37	CI023564	TP53	I							53.0	53.0	53.0					17																	7578448		2203	4300	6503	7519173	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.482C>A	17.37:g.7578448G>T	ENSP00000269305:p.Ala161Asp	Somatic		Capture	Illumina GAIIx	4	7519173	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.A161D	ENST00000269305.4	37	c.482	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.32	3.358715	0.61403	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99802	0.9915	M	0.86420	2.815	0.58432	D	0.999997	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;0.999;0.992;0.999;1.0;1.0;1.0	D	0.96947	0.9692	10	0.87932	D	0	-25.6622	12.6491	0.56751	0.0804:0.0:0.9196:0.0	.	122;161;161;68;161;161;161	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	D	161;161;161;161;161;161;150;68;29;68;29;161	ENSP00000410739:A161D;ENSP00000352610:A161D;ENSP00000269305:A161D;ENSP00000398846:A161D;ENSP00000391127:A161D;ENSP00000391478:A161D;ENSP00000425104:A29D;ENSP00000423862:A68D;ENSP00000424104:A161D	ENSP00000269305:A161D	A	-	2	0	TP53	7519173	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	9.813000	0.99286	1.514000	0.48869	-0.140000	0.14226	GCC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7519173	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TAS2R1	50834	genome.wustl.edu	37	5	9629771	9629771	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr5:9629771A>T	ENST00000382492.2	-	1	692	c.374T>A	c.(373-375)cTg>cAg	p.L125Q	CTD-2001E22.1_ENST00000504182.2_RNA	NM_019599.2	NP_062545.1	Q9NYW7	TA2R1_HUMAN	taste receptor, type 2, member 1	125					chemosensory behavior (GO:0007635)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(19)|ovary(3)|prostate(1)|skin(1)|stomach(1)	39						CCATGGGACCAGCTTGGATAT	0.468																																																0			5											45.0	48.0	47.0					5																	9629771		2203	4300	6503	9682771	SO:0001583	missense	50834			AF227129	CCDS3876.1	5p15	2012-08-22			ENSG00000169777	ENSG00000169777		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14909	protein-coding gene	gene with protein product		604796				10761934, 10766242	Standard	NM_019599		Approved	T2R1, TRB7	uc003jem.1	Q9NYW7	OTTHUMG00000090500	ENST00000382492.2:c.374T>A	5.37:g.9629771A>T	ENSP00000371932:p.Leu125Gln	Somatic		Capture	Illumina GAIIx	4	9682771	Q646G8	Missense_Mutation	SNP	HMMPfam_TAS2R,superfamily_SSF81321	p.L125Q	ENST00000382492.2	37	c.374	CCDS3876.1	5	.	.	.	.	.	.	.	.	.	.	A	11.61	1.689178	0.29962	.	.	ENSG00000169777	ENST00000382492	T	0.01005	5.45	5.43	3.04	0.35103	.	0.624616	0.14195	N	0.335114	T	0.04407	0.0121	M	0.81942	2.565	0.09310	N	1	D	0.76494	0.999	D	0.70227	0.968	T	0.29274	-1.0017	9	.	.	.	.	6.6668	0.23044	0.7645:0.1549:0.0806:0.0	.	125	Q9NYW7	TA2R1_HUMAN	Q	125	ENSP00000371932:L125Q	.	L	-	2	0	TAS2R1	9682771	0.008000	0.16893	0.003000	0.11579	0.003000	0.03518	2.465000	0.45075	0.498000	0.27948	0.533000	0.62120	CTG	-	HMMPfam_TAS2R,superfamily_SSF81321		0.468	TAS2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R1	protein_coding	OTTHUMT00000206988.2	A			9682771	-1	no_errors	NM_019599	genbank	human	reviewed	54_36p	missense	SNP	0.059	T
TAS2R8	50836	genome.wustl.edu	37	12	10958741	10958741	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr12:10958741C>T	ENST00000240615.2	-	1	1151	c.839G>A	c.(838-840)gGt>gAt	p.G280D		NM_023918.1	NP_076407.1	Q9NYW2	TA2R8_HUMAN	taste receptor, type 2, member 8	280					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AAGTGAGTGACCCAAGGGGTA	0.338																																																0			12											32.0	34.0	34.0					12																	10958741		2201	4298	6499	10850008	SO:0001583	missense	50836			AF227134	CCDS8632.1	12p13	2012-08-22			ENSG00000121314	ENSG00000121314		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14915	protein-coding gene	gene with protein product		604794				10761934, 10766242	Standard	NM_023918		Approved	T2R8, TRB5	uc010shh.2	Q9NYW2	OTTHUMG00000168506	ENST00000240615.2:c.839G>A	12.37:g.10958741C>T	ENSP00000240615:p.Gly280Asp	Somatic		Capture	Illumina GAIIx	4	10850008	Q4KN29|Q645Y2	Missense_Mutation	SNP	HMMPfam_TAS2R,superfamily_SSF81321	p.G280D	ENST00000240615.2	37	c.839	CCDS8632.1	12	.	.	.	.	.	.	.	.	.	.	C	10.41	1.342703	0.24339	.	.	ENSG00000121314	ENST00000240615	T	0.37235	1.21	4.57	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.272209	0.21929	U	0.067048	T	0.60766	0.2294	M	0.86178	2.8	0.09310	N	1	D	0.67145	0.996	D	0.74348	0.983	T	0.54788	-0.8241	10	0.66056	D	0.02	.	10.9063	0.47081	0.0:0.6298:0.3701:0.0	.	280	Q9NYW2	TA2R8_HUMAN	D	280	ENSP00000240615:G280D	ENSP00000240615:G280D	G	-	2	0	TAS2R8	10850008	0.000000	0.05858	0.062000	0.19696	0.090000	0.18270	-0.175000	0.09825	1.083000	0.41159	0.655000	0.94253	GGT	-	HMMPfam_TAS2R,superfamily_SSF81321		0.338	TAS2R8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R8	protein_coding	OTTHUMT00000399932.1	C			10850008	-1	no_errors	NM_023918	genbank	human	reviewed	54_36p	missense	SNP	0.024	T
TPRXL	348825	genome.wustl.edu	37	3	14106354	14106354	+	Silent	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr3:14106354C>T	ENST00000424053.1	+	3	1225	c.678C>T	c.(676-678)agC>agT	p.S226S	TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000326972.8_Silent_p.S226S|TPRXL_ENST00000429201.1_Silent_p.S226S			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						gcagcagcagccccagcagca	0.701																																																0			3																																								14081355	SO:0001819	synonymous_variant	348825			AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.678C>T	3.37:g.14106354C>T		Somatic		Capture	Illumina GAIIx	4	14081355	Q8NAM5	Silent	SNP	NULL	p.S226	ENST00000424053.1	37	c.678		3																																																																																			-	NULL		0.701	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	TPRXL	protein_coding	OTTHUMT00000340436.1	C	NR_002223		14081355	+1	no_errors	ENST00000326972	ensembl	human	known	54_36p	silent	SNP	0.111	T
SPECC1	92521	genome.wustl.edu	37	17	20149327	20149327	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr17:20149327C>T	ENST00000261503.5	+	8	2491	c.2440C>T	c.(2440-2442)Cca>Tca	p.P814S	AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395530.2_Missense_Mutation_p.P733S|SPECC1_ENST00000395527.4_Missense_Mutation_p.P814S|SPECC1_ENST00000536879.1_Missense_Mutation_p.P154S	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	814					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		TCCAACACCCCCAGAGTCGGC	0.483																																																0			17											87.0	77.0	81.0					17																	20149327		2203	4300	6503	20089919	SO:0001583	missense	92521			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.2440C>T	17.37:g.20149327C>T	ENSP00000261503:p.Pro814Ser	Somatic		Capture	Illumina GAIIx	4	20089919	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,HMMSmart_SM00033	p.P814S	ENST00000261503.5	37	c.2440	CCDS32590.1	17	.	.	.	.	.	.	.	.	.	.	C	1.557	-0.537604	0.04082	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000536879;ENST00000395527	T;T	0.36699	1.24;1.24	4.5	-2.62	0.06152	.	0.587641	0.18751	N	0.132167	T	0.04952	0.0133	N	0.00101	-2.135	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.37641	-0.9697	10	0.02654	T	1	-0.004	5.4849	0.16743	0.0:0.2028:0.4656:0.3316	.	814;733;814	A8MV89;Q5M775-4;Q5M775	.;.;CYTSB_HUMAN	S	814;814;154;733	ENSP00000261503:P814S;ENSP00000438294:P154S	ENSP00000261503:P814S	P	+	1	0	SPECC1	20089919	0.001000	0.12720	0.000000	0.03702	0.442000	0.32017	-0.314000	0.08092	-0.619000	0.05648	-0.384000	0.06662	CCA	-	NULL		0.483	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTSB	protein_coding	OTTHUMT00000441206.1	C	NM_152904		20089919	+1	no_errors	NM_001033553	genbank	human	validated	54_36p	missense	SNP	0.174	T
PLXDC2	84898	genome.wustl.edu	37	10	20534434	20534434	+	Splice_Site	SNP	G	G	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr10:20534434G>A	ENST00000377252.4	+	13	2314	c.1473G>A	c.(1471-1473)gaG>gaA	p.E491E	PLXDC2_ENST00000377242.3_Splice_Site_p.E442E|PLXDC2_ENST00000377238.2_3'UTR	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	491					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						TCTTTATTGAGGTAAGTGTTG	0.428																																																0			10											247.0	219.0	229.0					10																	20534434		2203	4300	6503	20574440	SO:0001630	splice_region_variant	84898			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.1473+1G>A	10.37:g.20534434G>A		Somatic		Capture	Illumina GAIIx	4	20574440	Q96E59|Q96PD9|Q96SU9	Silent	SNP	HMMPfam_PSI,HMMSmart_SM00423	p.E491	ENST00000377252.4	37	c.1473	CCDS7132.1	10																																																																																			-	NULL		0.428	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC2	protein_coding	OTTHUMT00000047101.2	G	NM_032812	Silent	20574440	+1	no_errors	NM_032812	genbank	human	provisional	54_36p	silent	SNP	1.000	A
OTOF	9381	genome.wustl.edu	37	2	26698896	26698896	+	Silent	SNP	C	C	T	rs111033424		TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr2:26698896C>T	ENST00000272371.2	-	24	3003	c.2877G>A	c.(2875-2877)gcG>gcA	p.A959A	OTOF_ENST00000403946.3_Silent_p.A959A|OTOF_ENST00000338581.6_Silent_p.A212A|OTOF_ENST00000402415.3_Silent_p.A269A|OTOF_ENST00000339598.3_Silent_p.A212A	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	959	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGCTGGAACGCCTGCTTCT	0.642																																					GBM(102;732 1451 20652 24062 31372)											0			2						C	,,,	1,4401	2.1+/-5.4	0,1,2200	42.0	39.0	40.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	636,2877,807,636	-3.8	0.6	2	dbSNP_132	40	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	OTOF	NM_004802.3,NM_194248.2,NM_194322.2,NM_194323.2	,,,	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	,,,	212/1231,959/1998,269/1308,212/1231	26698896	1,12997	2201	4298	6499	26552400	SO:0001819	synonymous_variant	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2877G>A	2.37:g.26698896C>T		Somatic		Capture	Illumina GAIIx	4	26552400	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	HMMSmart_SM00239,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_C2,HMMPfam_FerI,HMMPfam_FerB	p.A959	ENST00000272371.2	37	c.2877	CCDS1725.1	2																																																																																			-	superfamily_C2 domain (Calcium/lipid-binding domain CaLB)		0.642	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	C			26552400	-1	no_errors	NM_194248	genbank	human	reviewed	54_36p	silent	SNP	0.982	T
ITGAD	3681	genome.wustl.edu	37	16	31422654	31422654	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr16:31422654T>C	ENST00000389202.2	+	14	1572	c.1523T>C	c.(1522-1524)gTt>gCt	p.V508A		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	508					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TGTGACGCTGTTCTCCGTGGT	0.622																																																0			16											118.0	116.0	117.0					16																	31422654		2197	4300	6497	31330155	SO:0001583	missense	3681			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1523T>C	16.37:g.31422654T>C	ENSP00000373854:p.Val508Ala	Somatic		Capture	Illumina GAIIx	4	31330155	Q15575|Q15576	Missense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.V508A	ENST00000389202.2	37	c.1523	CCDS32438.1	16	.	.	.	.	.	.	.	.	.	.	T	2.847	-0.239251	0.05944	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.70986	-0.53	4.49	3.39	0.38822	.	.	.	.	.	T	0.64283	0.2584	M	0.67625	2.065	0.09310	N	1	B;B	0.19817	0.039;0.022	B;B	0.18871	0.023;0.023	T	0.52764	-0.8532	9	0.28530	T	0.3	.	6.0824	0.19948	0.0:0.1238:0.0:0.8762	.	524;508	Q59H14;Q13349	.;ITAD_HUMAN	A	524;508	ENSP00000373854:V508A	ENSP00000373854:V508A	V	+	2	0	ITGAD	31330155	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.068000	0.14531	0.584000	0.29591	0.334000	0.21626	GTT	-	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191		0.622	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	protein_coding	OTTHUMT00000432836.1	T	NM_005353		31330155	+1	no_errors	NM_005353	genbank	human	validated	54_36p	missense	SNP	0.000	C
VARS	7407	genome.wustl.edu	37	6	31747405	31747405	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr6:31747405G>C	ENST00000375663.3	-	27	3708	c.3268C>G	c.(3268-3270)Ccc>Gcc	p.P1090A	VWA7_ENST00000375686.3_5'Flank|Y_RNA_ENST00000364685.1_RNA|VWA7_ENST00000375688.4_5'Flank|VARS_ENST00000482996.1_5'Flank|VWA7_ENST00000447450.1_5'Flank|VWA7_ENST00000467576.1_5'Flank	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	1090					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	TCCGGGTAGGGGGTAACACAG	0.672																																																0			6											32.0	39.0	36.0					6																	31747405		1506	2707	4213	31855384	SO:0001583	missense	7407			BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.3268C>G	6.37:g.31747405G>C	ENSP00000364815:p.Pro1090Ala	Somatic		Capture	Illumina GAIIx	4	31855384	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	HMMPfam_GST_N,superfamily_Glutathione S-transferase (GST) C-terminal domain,HMMPfam_GST_C,superfamily_Nucleotidylyl transferase,HMMPfam_tRNA-synt_1,PatternScan_AA_TRNA_LIGASE_I,superfamily_ValRS/IleRS/LeuRS editing domain,superfamily_Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases,HMMPfam_Anticodon_1	p.P1090A	ENST00000375663.3	37	c.3268	CCDS34412.1	6	.	.	.	.	.	.	.	.	.	.	G	1.877	-0.458845	0.04508	.	.	ENSG00000204394	ENST00000375663	T	0.11821	2.74	4.77	0.867	0.19085	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (1);Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.343317	0.30593	N	0.009287	T	0.03348	0.0097	L	0.46741	1.465	0.80722	D	1	B	0.28933	0.228	B	0.26310	0.068	T	0.38023	-0.9680	10	0.25106	T	0.35	-11.8013	4.2838	0.10844	0.273:0.3267:0.4003:0.0	.	1090	P26640	SYVC_HUMAN	A	1090	ENSP00000364815:P1090A	ENSP00000364815:P1090A	P	-	1	0	VARS	31855384	0.948000	0.32251	0.113000	0.21522	0.042000	0.13812	0.456000	0.21859	-0.018000	0.14079	0.462000	0.41574	CCC	-	superfamily_Anticodon-binding domain of a subclass of class I aminoacyl-tRNA synthetases,HMMPfam_Anticodon_1		0.672	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VARS	protein_coding	OTTHUMT00000076619.2	G	NM_006295		31855384	-1	no_errors	NM_006295	genbank	human	reviewed	54_36p	missense	SNP	0.985	C
TCP11	6954	genome.wustl.edu	37	6	35088778	35088778	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr6:35088778T>C	ENST00000512012.1	-	5	779	c.623A>G	c.(622-624)aAc>aGc	p.N208S	TCP11_ENST00000373974.4_Missense_Mutation_p.N175S|TCP11_ENST00000418521.2_Missense_Mutation_p.N145S|TCP11_ENST00000412155.2_Missense_Mutation_p.N170S|TCP11_ENST00000373979.2_Missense_Mutation_p.N146S|TCP11_ENST00000244645.3_Missense_Mutation_p.N146S|TCP11_ENST00000311875.5_Missense_Mutation_p.N221S|TCP11_ENST00000444780.2_Missense_Mutation_p.N216S			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific	208					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						GATAGTGTAGTTCACCATGTC	0.463																																																0			6											187.0	187.0	187.0					6																	35088778		2203	4300	6503	35196756	SO:0001583	missense	6954				CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560	ENST00000512012.1:c.623A>G	6.37:g.35088778T>C	ENSP00000425995:p.Asn208Ser	Somatic		Capture	Illumina GAIIx	4	35196756	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	Missense_Mutation	SNP	HMMPfam_Tcp11	p.N221S	ENST00000512012.1	37	c.662		6	.	.	.	.	.	.	.	.	.	.	T	24.1	4.490268	0.84962	.	.	ENSG00000124678	ENST00000373979;ENST00000412155;ENST00000244645;ENST00000373977;ENST00000311875;ENST00000444780;ENST00000373974;ENST00000418521;ENST00000512012;ENST00000486638	T;T;T;T;T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06;2.06;2.06;2.06;2.06	4.32	4.32	0.51571	.	0.110756	0.64402	D	0.000016	T	0.42268	0.1195	M	0.91818	3.245	0.54753	D	0.999989	P;P;P;D;P;D	0.63880	0.932;0.932;0.932;0.975;0.932;0.993	P;P;P;P;P;P	0.61328	0.817;0.817;0.817;0.887;0.884;0.854	T	0.56697	-0.7936	10	0.87932	D	0	.	13.6127	0.62088	0.0:0.0:0.0:1.0	.	175;170;216;281;208;146	B7Z7G1;E7EP29;B7Z7B5;Q5TB88;Q8WWU5;Q8WWU5-2	.;.;.;.;TCP11_HUMAN;.	S	146;170;146;170;221;216;175;145;208;67	ENSP00000363091:N146S;ENSP00000402816:N170S;ENSP00000244645:N146S;ENSP00000308708:N221S;ENSP00000404479:N216S;ENSP00000363085:N175S;ENSP00000415320:N145S;ENSP00000425995:N208S;ENSP00000421103:N67S	ENSP00000244645:N146S	N	-	2	0	TCP11	35196756	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.697000	0.68295	1.945000	0.56424	0.460000	0.39030	AAC	-	HMMPfam_Tcp11		0.463	TCP11-014	PUTATIVE	basic	protein_coding	TCP11	protein_coding	OTTHUMT00000370354.1	T	NM_001093728		35196756	-1	no_errors	NM_001093728	genbank	human	validated	54_36p	missense	SNP	1.000	C
DNAH8	1769	genome.wustl.edu	37	6	38743608	38743608	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr6:38743608A>G	ENST00000359357.3	+	11	1446	c.1192A>G	c.(1192-1194)Ata>Gta	p.I398V	DNAH8_ENST00000449981.2_Missense_Mutation_p.I615V|DNAH8_ENST00000441566.1_Missense_Mutation_p.I398V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	398					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TATTATGGCAATAAAATTCAG	0.299																																																0			6											56.0	65.0	62.0					6																	38743608		2195	4285	6480	38851586	SO:0001583	missense	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1192A>G	6.37:g.38743608A>G	ENSP00000352312:p.Ile398Val	Somatic		Capture	Illumina GAIIx	4	38851586	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,PatternScan_THIOL_PROTEASE_HIS,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.I398V	ENST00000359357.3	37	c.1192		6	.	.	.	.	.	.	.	.	.	.	A	13.53	2.263490	0.39995	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.54071	0.59;0.59;0.59	5.93	5.93	0.95920	Dynein heavy chain, domain-1 (1);	0.061100	0.64402	D	0.000002	T	0.15089	0.0364	N	0.02539	-0.55	0.43913	D	0.996551	B	0.09022	0.002	B	0.14023	0.01	T	0.09662	-1.0664	10	0.30078	T	0.28	.	14.6242	0.68608	1.0:0.0:0.0:0.0	.	398	Q96JB1	DYH8_HUMAN	V	603;603;398;398	ENSP00000333363:I603V;ENSP00000352312:I398V;ENSP00000402294:I398V	ENSP00000333363:I603V	I	+	1	0	DNAH8	38851586	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.193000	0.58385	2.281000	0.76405	0.533000	0.62120	ATA	-	HMMPfam_DHC_N1		0.299	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	A	NM_001206927		38851586	+1	no_errors	NM_001371	genbank	human	validated	54_36p	missense	SNP	1.000	G
MED14	9282	genome.wustl.edu	37	X	40540085	40540085	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chrX:40540085A>T	ENST00000324817.1	-	20	2653	c.2535T>A	c.(2533-2535)agT>agA	p.S845R	MED14_ENST00000496531.2_5'UTR	NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	845					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGTGACAGTTACTGCAACCTG	0.333																																																0			X											128.0	111.0	117.0					X																	40540085		2203	4300	6503	40425029	SO:0001583	missense	9282			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.2535T>A	X.37:g.40540085A>T	ENSP00000323720:p.Ser845Arg	Somatic		Capture	Illumina GAIIx	4	40425029	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	HMMPfam_MED14	p.S845R	ENST00000324817.1	37	c.2535	CCDS14254.1	X	.	.	.	.	.	.	.	.	.	.	A	21.4	4.147310	0.77888	.	.	ENSG00000180182	ENST00000324817	.	.	.	6.02	4.87	0.63330	.	0.074868	0.85682	D	0.000000	T	0.57504	0.2058	L	0.40543	1.245	0.80722	D	1	D	0.67145	0.996	D	0.71656	0.974	T	0.53865	-0.8378	9	0.24483	T	0.36	.	8.0706	0.30687	0.8484:0.0:0.1516:0.0	.	845	O60244	MED14_HUMAN	R	845	.	ENSP00000323720:S845R	S	-	3	2	MED14	40425029	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.986000	0.56937	2.034000	0.60081	0.486000	0.48141	AGT	-	NULL		0.333	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	protein_coding	OTTHUMT00000060692.1	A	NM_004229		40425029	-1	no_errors	NM_004229	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
WNT7B	7477	genome.wustl.edu	37	22	46327179	46327179	+	Silent	SNP	G	G	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr22:46327179G>A	ENST00000339464.4	-	3	743	c.369C>T	c.(367-369)tgC>tgT	p.C123C	WNT7B_ENST00000409496.3_Silent_p.C127C|WNT7B_ENST00000410058.1_Silent_p.C123C|WNT7B_ENST00000410089.1_Silent_p.C107C	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	123					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		TCCCTTGGCTGCAGGCAGCGG	0.687																																																0			22											34.0	32.0	33.0					22																	46327179		2203	4300	6503	44705843	SO:0001819	synonymous_variant	7477			AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.369C>T	22.37:g.46327179G>A		Somatic		Capture	Illumina GAIIx	4	44705843	B8A596|Q96Q12	Silent	SNP	HMMPfam_wnt,HMMSmart_SM00097,PatternScan_WNT1	p.C123	ENST00000339464.4	37	c.369	CCDS33667.1	22																																																																																			-	HMMPfam_wnt,HMMSmart_SM00097		0.687	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT7B	protein_coding	OTTHUMT00000336418.1	G	NM_058238		44705843	-1	no_errors	NM_058238	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
RB1	5925	genome.wustl.edu	37	13	48881462	48881462	+	Nonsense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr13:48881462C>T	ENST00000267163.4	+	2	322	c.184C>T	c.(184-186)Cag>Tag	p.Q62*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	62					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(3)|p.Q62*(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGCATTATGTCAGAAATTAAA	0.323		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	19	Whole gene deletion(15)|Unknown(3)|Substitution - Nonsense(1)	bone(10)|eye(2)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|soft_tissue(1)|endometrium(1)|stomach(1)	13											134.0	135.0	135.0					13																	48881462		2203	4300	6503	47779463	SO:0001587	stop_gained	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.184C>T	13.37:g.48881462C>T	ENSP00000267163:p.Gln62*	Somatic		Capture	Illumina GAIIx	4	47779463	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	HMMPfam_RB_A,superfamily_Cyclin-like,HMMPfam_RB_B,HMMSmart_SM00385,HMMPfam_Rb_C	p.Q62*	ENST00000267163.4	37	c.184	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	37	5.990111	0.97179	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	4.83	4.83	0.62350	.	0.291280	0.35262	N	0.003329	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	13.7951	0.63166	0.0:1.0:0.0:0.0	.	.	.	.	X	41;62	.	ENSP00000267163:Q62X	Q	+	1	0	RB1	47779463	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.190000	0.42630	2.373000	0.80994	0.650000	0.86243	CAG	-	NULL		0.323	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C			47779463	+1	no_errors	NM_000321	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
KATNB1	10300	genome.wustl.edu	37	16	57787122	57787122	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr16:57787122G>A	ENST00000379661.3	+	11	1381	c.989G>A	c.(988-990)aGc>aAc	p.S330N		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				CCCAACCCCAGCGCCCCCCTC	0.701																																																0			16											15.0	19.0	17.0					16																	57787122		2162	4209	6371	56344623	SO:0001583	missense	10300			AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.989G>A	16.37:g.57787122G>A	ENSP00000368982:p.Ser330Asn	Somatic		Capture	Illumina GAIIx	4	56344623		Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.S330N	ENST00000379661.3	37	c.989	CCDS10788.1	16	.	.	.	.	.	.	.	.	.	.	G	5.053	0.195461	0.09599	.	.	ENSG00000140854	ENST00000379661	T	0.54866	0.55	5.19	2.09	0.27110	.	0.394526	0.29980	N	0.010720	T	0.23649	0.0572	N	0.02539	-0.55	0.09310	N	1	B	0.27498	0.18	B	0.21546	0.035	T	0.15636	-1.0430	10	0.34782	T	0.22	1.8451	9.5384	0.39237	0.0739:0.2701:0.6561:0.0	.	330	Q9BVA0	KTNB1_HUMAN	N	330	ENSP00000368982:S330N	ENSP00000368982:S330N	S	+	2	0	KATNB1	56344623	0.962000	0.33011	0.050000	0.19076	0.155000	0.21991	3.810000	0.55613	0.184000	0.20083	-0.282000	0.10007	AGC	-	NULL		0.701	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KATNB1	protein_coding	OTTHUMT00000257343.3	G			56344623	+1	no_errors	NM_005886	genbank	human	reviewed	54_36p	missense	SNP	0.038	A
GATA5	140628	genome.wustl.edu	37	20	61039909	61039909	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr20:61039909C>T	ENST00000252997.2	-	7	1238	c.1177G>A	c.(1177-1179)Gcg>Acg	p.A393T		NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	393					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			AAGGCCAGCGCACACCAGGCC	0.657																																																0			20											35.0	39.0	38.0					20																	61039909		2203	4300	6503	60473304	SO:0001583	missense	140628			BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.1177G>A	20.37:g.61039909C>T	ENSP00000252997:p.Ala393Thr	Somatic		Capture	Illumina GAIIx	4	60473304	D9ZGF7|Q17RE2|Q86VU4	Missense_Mutation	SNP	HMMPfam_GATA-N,superfamily_SSF57716,HMMSmart_ZnF_GATA,PatternScan_GATA_ZN_FINGER_1,HMMPfam_GATA	p.A393T	ENST00000252997.2	37	c.1177	CCDS13499.1	20	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106804	0.77096	.	.	ENSG00000130700	ENST00000370545;ENST00000540404;ENST00000252997	D	0.98762	-5.12	5.27	2.18	0.27775	.	0.107027	0.64402	N	0.000006	D	0.98601	0.9532	M	0.66939	2.045	0.46437	D	0.999049	D	0.89917	1.0	D	0.83275	0.996	D	0.98173	1.0453	10	0.72032	D	0.01	-9.4437	9.9129	0.41417	0.0:0.6643:0.2633:0.0724	.	393	Q9BWX5	GATA5_HUMAN	T	393;413;393	ENSP00000252997:A393T	ENSP00000252997:A393T	A	-	1	0	GATA5	60473304	1.000000	0.71417	0.808000	0.32385	0.983000	0.72400	1.250000	0.32850	0.201000	0.20466	0.555000	0.69702	GCG	-	NULL		0.657	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA5	protein_coding	OTTHUMT00000080038.2	C	NM_080473		60473304	-1	no_errors	NM_080473	genbank	human	reviewed	54_36p	missense	SNP	0.583	T
CD6	923	genome.wustl.edu	37	11	60785470	60785470	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr11:60785470C>A	ENST00000313421.7	+	11	2008	c.1822C>A	c.(1822-1824)Cag>Aag	p.Q608K	CD6_ENST00000344028.5_Missense_Mutation_p.Q576K|CD6_ENST00000452451.2_Missense_Mutation_p.Q567K|CD6_ENST00000346437.4_Missense_Mutation_p.Q535K|CD6_ENST00000352009.5_Missense_Mutation_p.Q576K	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	608					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						GGCCGGCACCCAGCCAGCCTT	0.597																																					Pancreas(169;904 2017 4767 38890 42505)											0			11											39.0	43.0	42.0					11																	60785470		2198	4288	6486	60542046	SO:0001583	missense	923				CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1822C>A	11.37:g.60785470C>A	ENSP00000323280:p.Gln608Lys	Somatic		Capture	Illumina GAIIx	4	60542046	A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	superfamily_SRCR-like,HMMSmart_SM00202,HMMPfam_SRCR,PatternScan_SRCR_1	p.Q608K	ENST00000313421.7	37	c.1822	CCDS7999.1	11	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173323	0.38413	.	.	ENSG00000013725	ENST00000344028;ENST00000346437;ENST00000313421;ENST00000452451;ENST00000352009	T;T;T;T;T	0.01685	4.9;4.87;4.94;4.69;4.8	5.18	5.18	0.71444	.	2.104890	0.02699	N	0.111525	T	0.04952	0.0133	L	0.56769	1.78	0.09310	N	1	P;P;B;P	0.46142	0.873;0.873;0.329;0.651	B;B;B;B	0.41510	0.359;0.359;0.077;0.115	T	0.51826	-0.8656	10	0.87932	D	0	.	14.1921	0.65644	0.0:1.0:0.0:0.0	.	567;576;608;608	P30203-5;P30203-4;P30203;Q8N4Q7	.;.;CD6_HUMAN;.	K	576;535;608;567;576	ENSP00000344108:Q576K;ENSP00000345566:Q535K;ENSP00000323280:Q608K;ENSP00000390676:Q567K;ENSP00000340628:Q576K	ENSP00000323280:Q608K	Q	+	1	0	CD6	60542046	0.834000	0.29399	0.105000	0.21289	0.905000	0.53344	2.413000	0.44618	2.428000	0.82296	0.313000	0.20887	CAG	-	NULL		0.597	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD6	protein_coding	OTTHUMT00000396449.1	C	NM_006725		60542046	+1	no_errors	NM_006725	genbank	human	validated	54_36p	missense	SNP	0.206	A
AC012322.1	0	genome.wustl.edu	37	16	64295095	64295095	+	lincRNA	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr16:64295095C>T	ENST00000561657.1	-	0	584																											GAgcgccccgcggtccgtcgc	0.642																																																0			16																																								62852596			729217																															16.37:g.64295095C>T		Somatic		Capture	Illumina GAIIx	4	62852596		RNA	SNP	-	NULL	ENST00000561657.1	37	NULL		16																																																																																			-	-		0.642	AC012322.1-001	KNOWN	basic	lincRNA	LOC729217	lincRNA	OTTHUMT00000420578.1	C			62852596	-1	pseudogene	XR_015483	genbank	human	model	54_36p	rna	SNP	0.997	T
ZNF256	10172	genome.wustl.edu	37	19	58452731	58452731	+	Nonsense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr19:58452731C>T	ENST00000282308.3	-	3	1641	c.1445G>A	c.(1444-1446)tGg>tAg	p.W482*	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	482					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		ATGAACTTTCCAGTGTGAGAT	0.448																																					NSCLC(55;1313 1552 8040 11996)											0			19											87.0	86.0	86.0					19																	58452731		2203	4300	6503	63144543	SO:0001587	stop_gained	10172			AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.1445G>A	19.37:g.58452731C>T	ENSP00000282308:p.Trp482*	Somatic		Capture	Illumina GAIIx	4	63144543	B2RA92|Q53Y85|Q9BV71	Nonsense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.W482*	ENST00000282308.3	37	c.1445	CCDS12966.1	19	.	.	.	.	.	.	.	.	.	.	.	36	5.907409	0.97093	.	.	ENSG00000152454	ENST00000282308	.	.	.	2.96	-4.34	0.03666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	1.891	0.03248	0.1485:0.1766:0.1474:0.5275	.	.	.	.	X	482	.	ENSP00000282308:W482X	W	-	2	0	ZNF256	63144543	0.000000	0.05858	0.000000	0.03702	0.795000	0.44927	-4.932000	0.00169	-0.724000	0.04908	0.467000	0.42956	TGG	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.448	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF256	protein_coding	OTTHUMT00000466702.1	C			63144543	-1	no_errors	NM_005773	genbank	human	validated	54_36p	nonsense	SNP	0.000	T
CXorf65	158830	genome.wustl.edu	37	X	70323949	70323949	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chrX:70323949C>A	ENST00000374251.5	-	6	488	c.440G>T	c.(439-441)gGa>gTa	p.G147V		NM_001025265.2	NP_001020436.1	A6NEN9	CX065_HUMAN	chromosome X open reading frame 65	147										breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)	10						GTCTGATCGTCCTGATTGCTT	0.443																																																0			X											81.0	64.0	70.0					X																	70323949		2203	4300	6503	70240674	SO:0001583	missense	158830			BC144434	CCDS35324.1	Xq13.1	2009-03-06			ENSG00000204165	ENSG00000204165			33713	protein-coding gene	gene with protein product							Standard	NM_001025265		Approved		uc011mpo.2	A6NEN9	OTTHUMG00000021785	ENST00000374251.5:c.440G>T	X.37:g.70323949C>A	ENSP00000363369:p.Gly147Val	Somatic		Capture	Illumina GAIIx	4	70240674		Missense_Mutation	SNP	NULL	p.G147V	ENST00000374251.5	37	c.440	CCDS35324.1	X	.	.	.	.	.	.	.	.	.	.	C	15.16	2.749969	0.49257	.	.	ENSG00000204165	ENST00000374251;ENST00000438526	T;T	0.58940	0.63;0.3	3.87	3.87	0.44632	.	1.600030	0.03371	N	0.198953	T	0.68842	0.3045	L	0.38175	1.15	0.22926	N	0.998558	D	0.76494	0.999	D	0.66716	0.946	T	0.56444	-0.7978	10	0.62326	D	0.03	-4.8613	10.4248	0.44371	0.0:1.0:0.0:0.0	.	147	A6NEN9	CX065_HUMAN	V	147;167	ENSP00000363369:G147V;ENSP00000411354:G167V	ENSP00000363369:G147V	G	-	2	0	CXorf65	70240674	0.062000	0.20869	0.017000	0.16124	0.013000	0.08279	1.812000	0.38952	1.920000	0.55613	0.600000	0.82982	GGA	-	NULL		0.443	CXorf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf65	protein_coding	OTTHUMT00000057089.2	C	NM_001025265		70240674	-1	no_errors	NM_001025265	genbank	human	predicted	54_36p	missense	SNP	0.503	A
DCK	1633	genome.wustl.edu	37	4	71891559	71891559	+	Silent	SNP	G	G	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr4:71891559G>A	ENST00000286648.5	+	5	973	c.576G>A	c.(574-576)cgG>cgA	p.R192R	DCK_ENST00000504952.1_Silent_p.R192R|DCK_ENST00000504730.1_Intron	NM_000788.2	NP_000779.1	P27707	DCK_HUMAN	deoxycytidine kinase	192					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxycytidine kinase activity (GO:0004137)|drug binding (GO:0008144)|nucleoside kinase activity (GO:0019206)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)	9			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Cytarabine(DB00987)|Decitabine(DB01262)|Emtricitabine(DB00879)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Lamivudine(DB00709)|Nelarabine(DB01280)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	TATATTTACGGGGAAGAAATG	0.358																																																0			4											109.0	119.0	115.0					4																	71891559		2203	4299	6502	72110423	SO:0001819	synonymous_variant	1633			M60527	CCDS3548.1	4q13.3-q21.1	2008-02-05			ENSG00000156136	ENSG00000156136	2.7.1.74		2704	protein-coding gene	gene with protein product		125450				8406512	Standard	NM_000788		Approved		uc003hfx.3	P27707	OTTHUMG00000129908	ENST00000286648.5:c.576G>A	4.37:g.71891559G>A		Somatic		Capture	Illumina GAIIx	4	72110423	B2R8V6|Q5TZY7|Q6FI11	Silent	SNP	superfamily_SSF52540,HMMPfam_dNK	p.R192	ENST00000286648.5	37	c.576	CCDS3548.1	4																																																																																			-	superfamily_SSF52540,HMMPfam_dNK		0.358	DCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCK	protein_coding	OTTHUMT00000252159.2	G			72110423	+1	no_errors	NM_000788	genbank	human	reviewed	54_36p	silent	SNP	0.997	A
RAB11FIP5	26056	genome.wustl.edu	37	2	73316417	73316417	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr2:73316417C>A	ENST00000258098.6	-	2	698	c.458G>T	c.(457-459)gGc>gTc	p.G153V	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	153					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						CTCCTTCTTGCCTGGCTTGGA	0.592																																																0			2											258.0	244.0	248.0					2																	73316417		2203	4300	6503	73169925	SO:0001583	missense	26056			AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.458G>T	2.37:g.73316417C>A	ENSP00000258098:p.Gly153Val	Somatic		Capture	Illumina GAIIx	4	73169925	O94939|Q9P0M1	Missense_Mutation	SNP	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2,HMMPfam_RBD-FIP	p.G153V	ENST00000258098.6	37	c.458	CCDS1923.1	2	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507752	0.85282	.	.	ENSG00000135631	ENST00000258098	T	0.72942	-0.7	4.6	4.6	0.57074	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.84561	0.5499	M	0.80508	2.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86873	0.2037	10	0.87932	D	0	-23.9991	16.5264	0.84332	0.0:1.0:0.0:0.0	.	153;153	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	V	153	ENSP00000258098:G153V	ENSP00000258098:G153V	G	-	2	0	RAB11FIP5	73169925	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.627000	0.83176	2.570000	0.86706	0.561000	0.74099	GGC	-	superfamily_C2_CaLB		0.592	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP5	protein_coding	OTTHUMT00000251995.1	C	NM_015470		73169925	-1	no_errors	NM_015470	genbank	human	validated	54_36p	missense	SNP	1.000	A
CSPG4P13	100302666	genome.wustl.edu	37	15	78190350	78190350	+	IGR	SNP	G	G	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr15:78190350G>A								LINGO1 (78480 upstream) : CSPG4P13 (3652 downstream)																							TGAGTGGTGGGCCACACAGGC	0.647																																																0			15																																								75977405	SO:0001628	intergenic_variant	0																															15.37:g.78190350G>A		Somatic		Capture	Illumina GAIIx	4	75977405		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.647					LOC400403			G			75977405	+1	pseudogene	XR_038194	genbank	human	model	54_36p	rna	SNP	0.042	A
SLC38A10	124565	genome.wustl.edu	37	17	79257259	79257259	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr17:79257259C>G	ENST00000374759.3	-	4	690	c.307G>C	c.(307-309)Gtg>Ctg	p.V103L	SLC38A10_ENST00000546352.1_5'Flank|SLC38A10_ENST00000288439.5_Missense_Mutation_p.V103L	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	103					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TCGCCGATCACGACGTAGAAG	0.592																																																0			17											81.0	57.0	65.0					17																	79257259		2201	4298	6499	76871854	SO:0001583	missense	124565			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.307G>C	17.37:g.79257259C>G	ENSP00000363891:p.Val103Leu	Somatic		Capture	Illumina GAIIx	4	76871854	Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	HMMPfam_Aa_trans	p.V103L	ENST00000374759.3	37	c.307	CCDS42397.1	17	.	.	.	.	.	.	.	.	.	.	C	17.92	3.507392	0.64410	.	.	ENSG00000157637	ENST00000374759;ENST00000288439;ENST00000539748	T;T;T	0.01933	4.55;4.55;4.55	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.13756	0.0333	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.83275	0.952;0.996	T	0.00567	-1.1667	10	0.72032	D	0.01	-36.0892	18.1105	0.89534	0.0:1.0:0.0:0.0	.	103;103	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	L	103;103;55	ENSP00000363891:V103L;ENSP00000288439:V103L;ENSP00000439115:V55L	ENSP00000288439:V103L	V	-	1	0	SLC38A10	76871854	1.000000	0.71417	0.116000	0.21606	0.004000	0.04260	7.103000	0.77014	2.334000	0.79466	0.561000	0.74099	GTG	-	HMMPfam_Aa_trans		0.592	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	protein_coding	OTTHUMT00000397747.1	C	NM_138570		76871854	-1	no_errors	NM_001037984	genbank	human	validated	54_36p	missense	SNP	1.000	G
THRSP	7069	genome.wustl.edu	37	11	77775072	77775072	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr11:77775072G>A	ENST00000281030.2	+	1	166	c.145G>A	c.(145-147)Gcc>Acc	p.A49T	NDUFC2-KCTD14_ENST00000530054.1_Intron|NDUFC2-KCTD14_ENST00000528251.1_Intron	NM_003251.3	NP_003242.1	Q92748	THRSP_HUMAN	thyroid hormone responsive	49					lipid metabolic process (GO:0006629)|regulation of lipid biosynthetic process (GO:0046890)|regulation of transcription, DNA-templated (GO:0006355)|regulation of triglyceride biosynthetic process (GO:0010866)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)			TGGGGGCCAGGCCCAGGCTGA	0.642																																																0			11											85.0	87.0	87.0					11																	77775072		2200	4292	6492	77452720	SO:0001583	missense	7069			Y08409	CCDS8256.1	11q14.1	2012-06-19	2010-06-25		ENSG00000151365	ENSG00000151365			11800	protein-coding gene	gene with protein product	"""SPOT14 homolog (rat)"""	601926	"""thyroid hormone responsive SPOT14 (rat) homolog"", ""lipogenic protein 1"""	LPGP1		9003802	Standard	NM_003251		Approved	SPOT14, Lpgp, S14, THRP	uc001oyx.3	Q92748	OTTHUMG00000166632	ENST00000281030.2:c.145G>A	11.37:g.77775072G>A	ENSP00000281030:p.Ala49Thr	Somatic		Capture	Illumina GAIIx	4	77452720	B2R4W7	Missense_Mutation	SNP	HMMPfam_Spot_14	p.A49T	ENST00000281030.2	37	c.145	CCDS8256.1	11	.	.	.	.	.	.	.	.	.	.	G	4.987	0.183395	0.09495	.	.	ENSG00000151365	ENST00000281030	.	.	.	5.11	3.13	0.36017	.	1.070810	0.07169	N	0.852123	T	0.27384	0.0672	.	.	.	0.09310	N	1	B	0.19445	0.036	B	0.23419	0.046	T	0.18209	-1.0344	8	0.13470	T	0.59	-17.91	10.5331	0.44988	0.1672:0.0:0.8328:0.0	.	49	Q92748	THRSP_HUMAN	T	49	.	ENSP00000281030:A49T	A	+	1	0	THRSP	77452720	0.000000	0.05858	0.009000	0.14445	0.003000	0.03518	0.387000	0.20718	1.338000	0.45544	0.561000	0.74099	GCC	-	HMMPfam_Spot_14		0.642	THRSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THRSP	protein_coding	OTTHUMT00000390939.1	G	NM_003251		77452720	+1	no_errors	NM_003251	genbank	human	reviewed	54_36p	missense	SNP	0.023	A
KCTD21	283219	genome.wustl.edu	37	11	77884985	77884985	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr11:77884985T>C	ENST00000340067.3	-	2	894	c.616A>G	c.(616-618)Aag>Gag	p.K206E	KCTD21-AS1_ENST00000528468.1_RNA|KCTD21-AS1_ENST00000600795.1_RNA|KCTD21-AS1_ENST00000530261.1_RNA|KCTD21-AS1_ENST00000523626.2_RNA	NM_001029859.1	NP_001025030.1	Q4G0X4	KCD21_HUMAN	potassium channel tetramerization domain containing 21	206					protein homooligomerization (GO:0051260)					breast(1)|endometrium(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(2)	11	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			CAGAGCCTCTTGAGGTTCTGC	0.577																																																0			11											121.0	126.0	124.0					11																	77884985		2200	4292	6492	77562633	SO:0001583	missense	283219			AK095233	CCDS31645.1	11q14.1	2013-06-20	2013-06-20			ENSG00000188997			27452	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 21"""			21472142	Standard	XM_005273925		Approved	KCASH2	uc001ozb.3	Q4G0X4		ENST00000340067.3:c.616A>G	11.37:g.77884985T>C	ENSP00000339340:p.Lys206Glu	Somatic		Capture	Illumina GAIIx	4	77562633	B4DTR0	Missense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMSmart_BTB,HMMPfam_K_tetra	p.K206E	ENST00000340067.3	37	c.616	CCDS31645.1	11	.	.	.	.	.	.	.	.	.	.	T	16.54	3.153030	0.57259	.	.	ENSG00000188997	ENST00000340067	T	0.77489	-1.1	5.88	5.88	0.94601	.	0.097719	0.44483	D	0.000451	T	0.61350	0.2340	N	0.14661	0.345	0.32133	N	0.586526	P	0.43788	0.817	B	0.36666	0.23	T	0.69124	-0.5228	10	0.31617	T	0.26	.	14.8672	0.70425	0.0:0.0:0.0:1.0	.	206	Q4G0X4	KCD21_HUMAN	E	206	ENSP00000339340:K206E	ENSP00000339340:K206E	K	-	1	0	KCTD21	77562633	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.555000	0.53727	2.250000	0.74265	0.454000	0.30748	AAG	-	NULL		0.577	KCTD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD21	protein_coding	OTTHUMT00000390057.1	T	NM_001029859		77562633	-1	no_errors	NM_001029859	genbank	human	provisional	54_36p	missense	SNP	1.000	C
POLR3A	11128	genome.wustl.edu	37	10	79737337	79737337	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr10:79737337C>G	ENST00000372371.3	-	31	4209	c.4072G>C	c.(4072-4074)Ggg>Cgg	p.G1358R		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	1358					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TTGAAGAGCCCGGTTCCAATG	0.493																																																0			10											124.0	121.0	122.0					10																	79737337		2203	4300	6503	79407343	SO:0001583	missense	11128			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.4072G>C	10.37:g.79737337C>G	ENSP00000361446:p.Gly1358Arg	Somatic		Capture	Illumina GAIIx	4	79407343	Q8IW34|Q8TCW5	Missense_Mutation	SNP	superfamily_SSF64484,HMMPfam_RNA_pol_Rpb1_1,HMMSmart_RPOLA_N,HMMPfam_RNA_pol_Rpb1_2,HMMPfam_RNA_pol_Rpb1_3,HMMPfam_RNA_pol_Rpb1_4,HMMPfam_RNA_pol_Rpb1_5	p.G1358R	ENST00000372371.3	37	c.4072	CCDS7354.1	10	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962920	0.92791	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	D	0.86562	-2.14	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.95834	0.8644	H	0.95260	3.645	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96843	0.9619	9	.	.	.	-25.0465	19.3013	0.94145	0.0:1.0:0.0:0.0	.	1358	O14802	RPC1_HUMAN	R	1358;1337	ENSP00000361446:G1358R	.	G	-	1	0	POLR3A	79407343	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.038000	0.76537	2.569000	0.86673	0.655000	0.94253	GGG	-	superfamily_SSF64484		0.493	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3A	protein_coding	OTTHUMT00000048923.1	C	NM_007055		79407343	-1	no_errors	NM_007055	genbank	human	validated	54_36p	missense	SNP	1.000	G
SEMA3A	10371	genome.wustl.edu	37	7	83636709	83636709	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr7:83636709A>C	ENST00000265362.4	-	10	1414	c.1100T>G	c.(1099-1101)gTg>gGg	p.V367G	SEMA3A_ENST00000436949.1_Missense_Mutation_p.V367G	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	367	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TTGATAAGGCACCCATTGATA	0.433																																																0			7											147.0	129.0	135.0					7																	83636709		2203	4300	6503	83474645	SO:0001583	missense	10371			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1100T>G	7.37:g.83636709A>C	ENSP00000265362:p.Val367Gly	Somatic		Capture	Illumina GAIIx	4	83474645		Missense_Mutation	SNP	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMSmart_PSI,superfamily_Plexin-like_fold,superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig	p.V367G	ENST00000265362.4	37	c.1100	CCDS5599.1	7	.	.	.	.	.	.	.	.	.	.	A	18.21	3.572513	0.65765	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.11495	2.77;2.77	4.4	4.4	0.53042	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.20577	0.0495	L	0.39397	1.21	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	T	0.03818	-1.1001	10	0.18710	T	0.47	.	13.9342	0.64015	1.0:0.0:0.0:0.0	.	367	Q14563	SEM3A_HUMAN	G	367	ENSP00000265362:V367G;ENSP00000415260:V367G	ENSP00000265362:V367G	V	-	2	0	SEMA3A	83474645	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.468000	0.80943	1.751000	0.51876	0.459000	0.35465	GTG	-	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema		0.433	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	protein_coding	OTTHUMT00000253355.2	A	NM_006080		83474645	-1	no_errors	NM_006080	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DBF4	10926	genome.wustl.edu	37	7	87537420	87537420	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr7:87537420A>T	ENST00000265728.1	+	12	2471	c.1967A>T	c.(1966-1968)gAt>gTt	p.D656V		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	656					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				GAAAATTCAGATAATCTGTTA	0.333																																																0			7											49.0	52.0	51.0					7																	87537420		2203	4297	6500	87375356	SO:0001583	missense	10926			AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.1967A>T	7.37:g.87537420A>T	ENSP00000265728:p.Asp656Val	Somatic		Capture	Illumina GAIIx	4	87375356	A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Missense_Mutation	SNP	HMMPfam_zf-DBF,HMMSmart_SM00586	p.D656V	ENST00000265728.1	37	c.1967	CCDS5611.1	7	.	.	.	.	.	.	.	.	.	.	A	8.186	0.794873	0.16327	.	.	ENSG00000006634	ENST00000265728	T	0.35973	1.28	4.11	2.96	0.34315	.	0.170585	0.39020	N	0.001486	T	0.19406	0.0466	N	0.08118	0	0.09310	N	1	B;B	0.23650	0.072;0.089	B;B	0.29440	0.064;0.102	T	0.19976	-1.0289	10	0.87932	D	0	-3.8378	7.4115	0.27019	0.8971:0.0:0.1029:0.0	.	432;656	B7Z8C6;Q9UBU7	.;DBF4A_HUMAN	V	656	ENSP00000265728:D656V	ENSP00000265728:D656V	D	+	2	0	DBF4	87375356	0.454000	0.25728	0.705000	0.30386	0.362000	0.29581	1.079000	0.30766	0.630000	0.30394	0.533000	0.62120	GAT	-	NULL		0.333	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBF4	protein_coding	OTTHUMT00000253678.1	A	NM_006716		87375356	+1	no_errors	NM_006716	genbank	human	validated	54_36p	missense	SNP	0.457	T
ANKRD11	29123	genome.wustl.edu	37	16	89351486	89351486	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr16:89351486A>T	ENST00000301030.4	-	9	1924	c.1464T>A	c.(1462-1464)agT>agA	p.S488R	ANKRD11_ENST00000378330.2_Missense_Mutation_p.S488R	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	488	Ser-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CATCCTCCCCACTCTCTGAGG	0.587																																																0			16											28.0	32.0	31.0					16																	89351486		2197	4299	6496	87878987	SO:0001583	missense	29123			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1464T>A	16.37:g.89351486A>T	ENSP00000301030:p.Ser488Arg	Somatic		Capture	Illumina GAIIx	4	87878987	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.S488R	ENST00000301030.4	37	c.1464	CCDS32513.1	16	.	.	.	.	.	.	.	.	.	.	A	14.00	2.405892	0.42715	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000330736	T;T	0.40225	1.04;1.04	5.58	-6.62	0.01813	.	0.091863	0.64402	D	0.000001	T	0.52517	0.1739	L	0.59436	1.845	0.80722	D	1	D;D	0.76494	0.999;0.996	D;P	0.68192	0.956;0.895	T	0.63910	-0.6530	10	0.87932	D	0	.	15.9378	0.79729	0.6779:0.0:0.3221:0.0	.	107;488	Q7Z5E5;Q6UB99	.;ANR11_HUMAN	R	488;488;107	ENSP00000301030:S488R;ENSP00000367581:S488R	ENSP00000301030:S488R	S	-	3	2	ANKRD11	87878987	0.000000	0.05858	0.001000	0.08648	0.156000	0.22039	-1.859000	0.01657	-0.930000	0.03752	-0.624000	0.04008	AGT	-	superfamily_Ankyrin repeat		0.587	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	protein_coding	OTTHUMT00000430462.3	A	NM_013275		87878987	-1	no_errors	NM_013275	genbank	human	validated	54_36p	missense	SNP	0.860	T
SAMD9L	219285	genome.wustl.edu	37	7	92761517	92761517	+	Silent	SNP	G	G	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr7:92761517G>A	ENST00000318238.4	-	5	4984	c.3768C>T	c.(3766-3768)caC>caT	p.H1256H	SAMD9L_ENST00000411955.1_Silent_p.H1256H|SAMD9L_ENST00000437805.1_Silent_p.H1256H	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1256					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			AATTTTTTAGGTGGGATGTGA	0.333																																																0			7											71.0	72.0	72.0					7																	92761517		2203	4300	6503	92599453	SO:0001819	synonymous_variant	219285			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3768C>T	7.37:g.92761517G>A		Somatic		Capture	Illumina GAIIx	4	92599453	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Silent	SNP	superfamily_SAM/Pointed domain	p.H1256	ENST00000318238.4	37	c.3768	CCDS34681.1	7																																																																																			-	NULL		0.333	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	protein_coding	OTTHUMT00000341730.1	G	NM_152703		92599453	-1	no_errors	NM_152703	genbank	human	validated	54_36p	silent	SNP	0.002	A
MGAT4A	11320	genome.wustl.edu	37	2	99256314	99256314	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr2:99256314C>A	ENST00000264968.3	-	11	1642	c.1279G>T	c.(1279-1281)Gac>Tac	p.D427Y	MGAT4A_ENST00000414521.2_Missense_Mutation_p.D299Y|MGAT4A_ENST00000409391.1_Missense_Mutation_p.D427Y|MGAT4A_ENST00000393487.1_Missense_Mutation_p.D427Y			Q9UM21	MGT4A_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A	427					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	19						AAGATGTAGTCTCCAGCTATC	0.393																																																0			2											94.0	88.0	90.0					2																	99256314		2203	4300	6503	98622746	SO:0001583	missense	11320			AB000616	CCDS2036.1, CCDS54380.1	2q12	2013-02-25	2005-11-16		ENSG00000071073	ENSG00000071073	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7047	protein-coding gene	gene with protein product		604623	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme A"""			10024668	Standard	NM_001160154		Approved	GnT-Iva, GnT-4a	uc002sze.3	Q9UM21	OTTHUMG00000130563	ENST00000264968.3:c.1279G>T	2.37:g.99256314C>A	ENSP00000264968:p.Asp427Tyr	Somatic		Capture	Illumina GAIIx	4	98622746	B4E2R6|D3DVH6|E9PEN2|Q53S97|Q86Z15	Missense_Mutation	SNP	HMMPfam_Glyco_transf_54	p.D427Y	ENST00000264968.3	37	c.1279	CCDS2036.1	2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631508	0.87660	.	.	ENSG00000071073	ENST00000393487;ENST00000414521;ENST00000264968;ENST00000409391	T;T;T;T	0.37058	1.22;1.3;1.22;1.22	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.62696	0.2449	M	0.87097	2.86	0.80722	D	1	D;D	0.69078	0.997;0.986	P;P	0.57371	0.819;0.733	T	0.68930	-0.5279	10	0.72032	D	0.01	-4.1317	18.9218	0.92528	0.0:1.0:0.0:0.0	.	299;427	E9PEN2;Q9UM21	.;MGT4A_HUMAN	Y	427;299;427;427	ENSP00000377127:D427Y;ENSP00000404889:D299Y;ENSP00000264968:D427Y;ENSP00000386841:D427Y	ENSP00000264968:D427Y	D	-	1	0	MGAT4A	98622746	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.735000	0.84939	2.717000	0.92951	0.563000	0.77884	GAC	-	NULL		0.393	MGAT4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4A	protein_coding	OTTHUMT00000252988.2	C	NM_012214		98622746	-1	no_errors	NM_012214	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ST3GAL6	10402	genome.wustl.edu	37	3	98489735	98489735	+	Silent	SNP	G	G	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr3:98489735G>T	ENST00000483910.1	+	3	391	c.102G>T	c.(100-102)gtG>gtT	p.V34V	ST3GAL6_ENST00000265261.6_5'UTR|ST3GAL6_ENST00000394162.1_Silent_p.V34V|ST3GAL6_ENST00000462152.1_Intron|ST3GAL6_ENST00000468553.1_Silent_p.V34V	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6	34					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						TGGCACCTGTGGAAATGAAAC	0.448																																																0			3											108.0	105.0	106.0					3																	98489735		2203	4300	6503	99972425	SO:0001819	synonymous_variant	10402			AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.102G>T	3.37:g.98489735G>T		Somatic		Capture	Illumina GAIIx	4	99972425	B2RCH2|B3KMI1|D3DN39|F8W6U0	Silent	SNP	HMMPfam_Glyco_transf_29	p.V34	ENST00000483910.1	37	c.102	CCDS2933.1	3																																																																																			-	NULL		0.448	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL6	protein_coding	OTTHUMT00000353013.2	G	NM_006100		99972425	+1	no_errors	NM_006100	genbank	human	provisional	54_36p	silent	SNP	0.530	T
NXF3	56000	genome.wustl.edu	37	X	102342144	102342144	+	Intron	SNP	A	A	G			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chrX:102342144A>G	ENST00000395065.3	-	2	130				NXF3_ENST00000425463.2_Intron|NXF3_ENST00000425644.1_Intron	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3						mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						AAAACTATTTAAAAATGCTAA	0.388																																																0			X																																								102228800	SO:0001627	intron_variant	0			AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.29-2333T>C	X.37:g.102342144A>G		Somatic		Capture	Illumina GAIIx	4	102228800	B4DYS7|Q5H9I1|Q9H1A9	RNA	SNP	-	NULL	ENST00000395065.3	37	NULL	CCDS14503.1	X																																																																																			-	-		0.388	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128601	protein_coding	OTTHUMT00000057684.1	A	NM_022052		102228800	+1	pseudogene	XR_039021	genbank	human	model	54_36p	rna	SNP	0.197	G
ODF1	4956	genome.wustl.edu	37	8	103572819	103572819	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr8:103572819C>G	ENST00000285402.3	+	2	616	c.460C>G	c.(460-462)Cgg>Ggg	p.R154G	ODF1_ENST00000518835.1_Intron	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	154					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			GTCGGCTGAGCGGGAGAACAG	0.473																																																0			8											166.0	142.0	150.0					8																	103572819		2203	4300	6503	103641995	SO:0001583	missense	4956			M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.460C>G	8.37:g.103572819C>G	ENSP00000285402:p.Arg154Gly	Somatic		Capture	Illumina GAIIx	4	103641995	Q3SX72	Missense_Mutation	SNP	superfamily_HSP20_chap	p.R154G	ENST00000285402.3	37	c.460	CCDS6293.1	8	.	.	.	.	.	.	.	.	.	.	C	17.56	3.421041	0.62622	.	.	ENSG00000155087	ENST00000285402	D	0.92805	-3.11	5.27	3.38	0.38709	Heat shock protein Hsp20 (2);	0.000000	0.49916	D	0.000124	D	0.92456	0.7605	L	0.34521	1.04	0.80722	D	1	D	0.58268	0.982	D	0.74023	0.982	D	0.91311	0.5074	10	0.62326	D	0.03	-16.4235	10.4145	0.44314	0.3694:0.6306:0.0:0.0	.	154	Q14990	ODFP1_HUMAN	G	154	ENSP00000285402:R154G	ENSP00000285402:R154G	R	+	1	2	ODF1	103641995	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.703000	0.37846	0.542000	0.28846	0.555000	0.69702	CGG	-	superfamily_HSP20_chap		0.473	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF1	protein_coding	OTTHUMT00000379884.1	C			103641995	+1	no_errors	NM_024410	genbank	human	reviewed	54_36p	missense	SNP	0.988	G
TUBE1	51175	genome.wustl.edu	37	6	112394072	112394072	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr6:112394072C>T	ENST00000368662.5	-	10	1061	c.983G>A	c.(982-984)aGt>aAt	p.S328N	TUBE1_ENST00000604814.1_5'UTR	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1	328					centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	GTGATCTTTACTAAAGGCATC	0.363																																																0			6											110.0	116.0	114.0					6																	112394072		2203	4300	6503	112500765	SO:0001583	missense	51175			AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.983G>A	6.37:g.112394072C>T	ENSP00000357651:p.Ser328Asn	Somatic		Capture	Illumina GAIIx	4	112500765	Q5H8W8|Q8NEG3	Missense_Mutation	SNP	superfamily_Tubulin nucleotide-binding domain-like,HMMPfam_Tubulin,PatternScan_TUBULIN,superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C	p.S328N	ENST00000368662.5	37	c.983	CCDS5100.1	6	.	.	.	.	.	.	.	.	.	.	C	30	5.051649	0.93793	.	.	ENSG00000074935	ENST00000368662	D	0.81659	-1.52	6.16	6.16	0.99307	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81791	0.4897	L	0.57536	1.79	0.80722	D	1	P	0.47106	0.89	P	0.48952	0.596	T	0.82735	-0.0310	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	328	Q9UJT0	TBE_HUMAN	N	328	ENSP00000357651:S328N	ENSP00000357651:S328N	S	-	2	0	TUBE1	112500765	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.043000	0.71004	2.937000	0.99478	0.650000	0.86243	AGT	-	superfamily_Tubulin C-terminal domain-like,HMMPfam_Tubulin_C		0.363	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBE1	protein_coding	OTTHUMT00000041867.1	C	NM_016262		112500765	-1	no_errors	NM_016262	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PGGT1B	5229	genome.wustl.edu	37	5	114552671	114552671	+	Splice_Site	SNP	C	C	G			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr5:114552671C>G	ENST00000419445.1	-	8	864		c.e8-1		PGGT1B_ENST00000514178.1_Splice_Site|PGGT1B_ENST00000379615.3_Splice_Site	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit						negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		TTTTTAGAAGCTGAAATGACA	0.328																																																0			5											44.0	47.0	46.0					5																	114552671		2202	4300	6502	114580570	SO:0001630	splice_region_variant	5229				CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.844-1G>C	5.37:g.114552671C>G		Somatic		Capture	Illumina GAIIx	4	114580570	Q5MJP9	Splice_Site	SNP	-	e8-1	ENST00000419445.1	37	c.844-1	CCDS4116.1	5	.	.	.	.	.	.	.	.	.	.	C	24.0	4.478828	0.84747	.	.	ENSG00000164219	ENST00000419445;ENST00000379615	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1791	0.93615	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PGGT1B	114580570	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.743000	0.85020	2.521000	0.84997	0.585000	0.79938	.	-	-		0.328	PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGGT1B	protein_coding	OTTHUMT00000250855.2	C	NM_005023	Intron	114580570	-1	no_errors	NM_005023	genbank	human	validated	54_36p	splice_site	SNP	1.000	G
CFAP44	55779	genome.wustl.edu	37	3	113098286	113098286	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr3:113098286A>T	ENST00000295868.2	-	17	2327	c.2165T>A	c.(2164-2166)tTt>tAt	p.F722Y	WDR52_ENST00000475568.1_5'Flank|WDR52_ENST00000393845.2_Missense_Mutation_p.F722Y	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						ctcctcctGAAATTCTTTTTC	0.453																																																0			3											106.0	105.0	105.0					3																	113098286		2203	4300	6503	114580976	SO:0001583	missense	55779																														ENST00000295868.2:c.2165T>A	3.37:g.113098286A>T	ENSP00000295868:p.Phe722Tyr	Somatic		Capture	Illumina GAIIx	4	114580976		Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.F722Y	ENST00000295868.2	37	c.2165	CCDS2972.1	3	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.759445	0.00657	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.44482	2.83;0.92	5.42	1.49	0.22878	WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.20251	0.0487	N	0.22421	0.69	0.09310	N	1	B	0.27068	0.167	B	0.25614	0.062	T	0.27872	-1.0061	9	0.02654	T	1	.	4.0442	0.09764	0.6717:0.131:0.0715:0.1257	.	722	Q96MT7	WDR52_HUMAN	Y	722	ENSP00000377428:F722Y;ENSP00000295868:F722Y	ENSP00000295868:F722Y	F	-	2	0	WDR52	114580976	0.000000	0.05858	0.000000	0.03702	0.151000	0.21798	0.128000	0.15810	0.479000	0.27511	-0.400000	0.06385	TTT	-	NULL		0.453	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR52	protein_coding	OTTHUMT00000354128.3	A			114580976	-1	no_errors	NM_018338	genbank	human	provisional	54_36p	missense	SNP	0.002	T
QTRTD1	79691	genome.wustl.edu	37	3	113795662	113795662	+	Nonsense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr3:113795662C>T	ENST00000493014.1	+	3	369	c.301C>T	c.(301-303)Cga>Tga	p.R101*	QTRTD1_ENST00000479882.1_Nonsense_Mutation_p.R84*|QTRTD1_ENST00000485050.1_Nonsense_Mutation_p.R219*|QTRTD1_ENST00000281273.4_Nonsense_Mutation_p.R207*	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						GAGGTCAGCACGAGAGACAGC	0.488																																																0			3											129.0	116.0	120.0					3																	113795662		2203	4300	6503	115278352	SO:0001587	stop_gained	79691			AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.301C>T	3.37:g.113795662C>T	ENSP00000419169:p.Arg101*	Somatic		Capture	Illumina GAIIx	4	115278352		Nonsense_Mutation	SNP	superfamily_tRNA_ribo_trans,HMMPfam_TGT	p.R207*	ENST00000493014.1	37	c.619	CCDS58845.1	3	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040685	0.75732	.	.	ENSG00000151576	ENST00000485050;ENST00000281273;ENST00000479882;ENST00000493014;ENST00000482307	.	.	.	5.71	1.29	0.21616	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5791	7.8238	0.29303	0.3127:0.5347:0.0:0.1526	.	.	.	.	X	219;207;84;101;136	.	ENSP00000281273:R207X	R	+	1	2	QTRTD1	115278352	0.990000	0.36364	1.000000	0.80357	0.999000	0.98932	1.151000	0.31651	0.299000	0.22661	0.655000	0.94253	CGA	-	superfamily_tRNA_ribo_trans,HMMPfam_TGT		0.488	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	QTRTD1	protein_coding	OTTHUMT00000354711.1	C	NM_024638		115278352	+1	no_errors	NM_024638	genbank	human	provisional	54_36p	nonsense	SNP	0.862	T
CTTNBP2	83992	genome.wustl.edu	37	7	117364609	117364609	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr7:117364609C>A	ENST00000160373.3	-	19	4530	c.4439G>T	c.(4438-4440)aGc>aTc	p.S1480I		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1480					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		ACCTTCAGTGCTTAGGTCTGG	0.498																																																0			7											81.0	69.0	73.0					7																	117364609		2203	4300	6503	117151845	SO:0001583	missense	83992				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4439G>T	7.37:g.117364609C>A	ENSP00000160373:p.Ser1480Ile	Somatic		Capture	Illumina GAIIx	4	117151845	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	HMMPfam_CortBP2,superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.S1480I	ENST00000160373.3	37	c.4439	CCDS5774.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.25|12.25	1.880682|1.880682	0.33255|0.33255	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000160373	.|T	.|0.64438	.|-0.1	5.24|5.24	2.21|2.21	0.28008|0.28008	.|.	.|0.310653	.|0.44097	.|D	.|0.000490	T|T	0.55878|0.55878	0.1948|0.1948	M|M	0.77103|0.77103	2.36|2.36	0.09310|0.09310	N|N	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.08055	.|0.003	T|T	0.45056|0.45056	-0.9287|-0.9287	5|10	.|0.25751	.|T	.|0.34	-14.5453|-14.5453	6.2089|6.2089	0.20617|0.20617	0.0:0.6265:0.1363:0.2372|0.0:0.6265:0.1363:0.2372	.|.	.|1480	.|Q8WZ74	.|CTTB2_HUMAN	N|I	967|1480	.|ENSP00000160373:S1480I	.|ENSP00000160373:S1480I	K|S	-|-	3|2	2|0	CTTNBP2|CTTNBP2	117151845|117151845	0.001000|0.001000	0.12720|0.12720	0.724000|0.724000	0.30704|0.30704	0.124000|0.124000	0.20399|0.20399	0.311000|0.311000	0.19380|0.19380	0.680000|0.680000	0.31366|0.31366	0.655000|0.655000	0.94253|0.94253	AAG|AGC	-	NULL		0.498	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	protein_coding	OTTHUMT00000059201.4	C	NM_033427		117151845	-1	no_errors	NM_033427	genbank	human	reviewed	54_36p	missense	SNP	0.002	A
ERCC3	2071	genome.wustl.edu	37	2	128018872	128018872	+	Missense_Mutation	SNP	C	C	T	rs587778275		TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr2:128018872C>T	ENST00000285398.2	-	13	2090	c.1996G>A	c.(1996-1998)Gac>Aac	p.D666N	ERCC3_ENST00000493187.2_Missense_Mutation_p.D602N	NM_000122.1	NP_000113.1	P19447	ERCC3_HUMAN	excision repair cross-complementation group 3	666	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				7-methylguanosine mRNA capping (GO:0006370)|apoptotic process (GO:0006915)|DNA repair (GO:0006281)|DNA topological change (GO:0006265)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA duplex unwinding (GO:0000717)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein localization (GO:0008104)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' DNA helicase activity (GO:0043138)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|damaged DNA binding (GO:0003684)|dATP binding (GO:0032564)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|peptide binding (GO:0042277)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	31	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		TCCTGTGTGTCCTGGGATACC	0.423			"""Mis, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (B)	2	2q21	2071	"""excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing)"""		E	0			2											194.0	165.0	175.0					2																	128018872		2203	4300	6503	127735342	SO:0001583	missense	2071	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	M31899	CCDS2144.1	2q21	2014-09-17	2014-03-07		ENSG00000163161	ENSG00000163161		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	3435	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group B complementing"""	133510	"""excision repair cross-complementing rodent repair deficiency, complementation group 3"""			8202161	Standard	NM_000122		Approved	XPB, BTF2, RAD25, TFIIH, GTF2H	uc002toh.1	P19447	OTTHUMG00000131530	ENST00000285398.2:c.1996G>A	2.37:g.128018872C>T	ENSP00000285398:p.Asp666Asn	Somatic		Capture	Illumina GAIIx	4	127735342	Q53QM0	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_ResIII,HMMSmart_SM00490,HMMPfam_Helicase_C	p.D666N	ENST00000285398.2	37	c.1996	CCDS2144.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.504244	0.96371	.	.	ENSG00000163161	ENST00000285398;ENST00000493187	T;T	0.75821	-0.97;-0.97	4.45	4.45	0.53987	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85894	0.5803	M	0.87971	2.92	0.80722	D	1	D	0.71674	0.998	P	0.58013	0.831	D	0.89193	0.3552	10	0.87932	D	0	-30.9709	17.6458	0.88148	0.0:1.0:0.0:0.0	.	666	P19447	ERCC3_HUMAN	N	666;602	ENSP00000285398:D666N;ENSP00000444796:D602N	ENSP00000285398:D666N	D	-	1	0	ERCC3	127735342	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.298000	0.78815	2.455000	0.83008	0.563000	0.77884	GAC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.423	ERCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC3	protein_coding	OTTHUMT00000331028.1	C	NM_000122		127735342	-1	no_errors	NM_000122	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SPRR1B	6699	genome.wustl.edu	37	1	153004916	153004916	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr1:153004916C>A	ENST00000307098.4	+	2	160	c.95C>A	c.(94-96)cCa>cAa	p.P32Q	SPRR1B_ENST00000392661.3_Missense_Mutation_p.P32Q	NM_003125.2	NP_003116.2	P22528	SPR1B_HUMAN	small proline-rich protein 1B	32	6 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|ovary(2)|skin(2)	9	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCTCAGGAACCATGCATCCCC	0.632																																																0			1											154.0	151.0	152.0					1																	153004916		2203	4300	6503	151271540	SO:0001583	missense	6699			M84757	CCDS30863.1	1q21-q22	2010-06-25	2010-06-25		ENSG00000169469	ENSG00000169469			11260	protein-coding gene	gene with protein product	"""cornifin"""	182266		SPRR1		8325635, 1438308	Standard	NM_003125		Approved	GADD33	uc001fba.3	P22528	OTTHUMG00000013869	ENST00000307098.4:c.95C>A	1.37:g.153004916C>A	ENSP00000306461:p.Pro32Gln	Somatic		Capture	Illumina GAIIx	4	151271540	B2R5H7|P22529|P22530|Q5T524	Missense_Mutation	SNP	HMMPfam_Cornifin	p.P32Q	ENST00000307098.4	37	c.95	CCDS30863.1	1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.608029	0.28623	.	.	ENSG00000169469	ENST00000307098;ENST00000392661	T;T	0.11169	2.8;2.8	4.56	1.32	0.21799	.	.	.	.	.	T	0.02571	0.0078	.	.	.	0.09310	N	1	B	0.14012	0.009	B	0.16289	0.015	T	0.43360	-0.9396	8	0.87932	D	0	0.0447	4.9972	0.14245	0.3679:0.5303:0.0:0.1019	.	32	P22528	SPR1B_HUMAN	Q	32	ENSP00000306461:P32Q;ENSP00000376429:P32Q	ENSP00000306461:P32Q	P	+	2	0	SPRR1B	151271540	0.490000	0.26012	0.002000	0.10522	0.273000	0.26683	-0.754000	0.04787	0.454000	0.26884	0.655000	0.94253	CCA	-	HMMPfam_Cornifin		0.632	SPRR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRR1B	protein_coding	OTTHUMT00000038906.1	C	NM_003125		151271540	+1	no_errors	NM_003125	genbank	human	provisional	54_36p	missense	SNP	0.005	A
TKTL1	8277	genome.wustl.edu	37	X	153541113	153541113	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chrX:153541113G>T	ENST00000369915.3	+	6	1042	c.853G>T	c.(853-855)Gtt>Ttt	p.V285F	TKTL1_ENST00000369912.2_Missense_Mutation_p.V229F|TKTL1_ENST00000217905.7_Intron	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	285					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGATTACAGAGTTGGTGACAA	0.438																																																0			X											87.0	72.0	77.0					X																	153541113		2203	4300	6503	153194307	SO:0001583	missense	8277			X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.853G>T	X.37:g.153541113G>T	ENSP00000358931:p.Val285Phe	Somatic		Capture	Illumina GAIIx	4	153194307	A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	superfamily_Thiamin diphosphate-binding fold (THDP-binding),HMMPfam_Transketolase_N,HMMPfam_Transket_pyr,PatternScan_TRANSKETOLASE_2,superfamily_TK C-terminal domain-like,HMMPfam_Transketolase_C	p.V285F	ENST00000369915.3	37	c.853	CCDS35448.1	X	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384791	0.42308	.	.	ENSG00000007350	ENST00000369915;ENST00000441970;ENST00000369912	T;T	0.42900	0.96;0.96	4.52	-2.19	0.07015	.	0.862099	0.10216	N	0.701528	T	0.28499	0.0705	L	0.43152	1.355	0.09310	N	1	P;P	0.40050	0.7;0.7	B;B	0.35813	0.211;0.211	T	0.13764	-1.0497	10	0.49607	T	0.09	-4.6118	5.8893	0.18899	0.6449:0.0:0.2024:0.1527	.	279;285	B7Z7I0;P51854	.;TKTL1_HUMAN	F	285;229;229	ENSP00000358931:V285F;ENSP00000358928:V229F	ENSP00000358928:V229F	V	+	1	0	TKTL1	153194307	0.000000	0.05858	0.000000	0.03702	0.786000	0.44442	-1.248000	0.02890	-0.504000	0.06577	0.190000	0.17370	GTT	-	superfamily_Thiamin diphosphate-binding fold (THDP-binding)		0.438	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL1	protein_coding	OTTHUMT00000058923.1	G	NM_012253		153194307	+1	no_errors	NM_012253	genbank	human	validated	54_36p	missense	SNP	0.000	T
ACVR1C	130399	genome.wustl.edu	37	2	158399269	158399269	+	Nonsense_Mutation	SNP	G	G	C			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr2:158399269G>C	ENST00000243349.8	-	6	1409	c.1049C>G	c.(1048-1050)tCa>tGa	p.S350*	ACVR1C_ENST00000348328.5_Nonsense_Mutation_p.S193*|ACVR1C_ENST00000409680.3_Nonsense_Mutation_p.S300*|ACVR1C_ENST00000335450.7_Nonsense_Mutation_p.S270*	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						GTTCAGTATTGAATCATGCTT	0.418																																																0			2											236.0	217.0	224.0					2																	158399269		2203	4300	6503	158107515	SO:0001587	stop_gained	130399			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.1049C>G	2.37:g.158399269G>C	ENSP00000243349:p.Ser350*	Somatic		Capture	Illumina GAIIx	4	158107515		Nonsense_Mutation	SNP	superfamily_Snake toxin-like,HMMPfam_Activin_recp,HMMPfam_TGF_beta_GS,HMMSmart_SM00467,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMSmart_SM00219,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.S350*	ENST00000243349.8	37	c.1049	CCDS2205.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.477894	0.97598	.	.	ENSG00000123612	ENST00000243349;ENST00000409680;ENST00000348328;ENST00000335450	.	.	.	5.77	5.77	0.91146	.	0.000000	0.44483	D	0.000453	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.9422	0.97170	0.0:0.0:1.0:0.0	.	.	.	.	X	350;300;193;270	.	ENSP00000243349:S350X	S	-	2	0	ACVR1C	158107515	1.000000	0.71417	0.975000	0.42487	0.973000	0.67179	8.004000	0.88535	2.890000	0.99128	0.650000	0.86243	TCA	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMSmart_SM00219,HMMPfam_Pkinase		0.418	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1C	protein_coding	OTTHUMT00000254924.2	G	NM_145259		158107515	-1	no_errors	NM_145259	genbank	human	validated	54_36p	nonsense	SNP	1.000	C
BNIP1	662	genome.wustl.edu	37	5	172590743	172590743	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr5:172590743C>T	ENST00000351486.5	+	6	537	c.506C>T	c.(505-507)aCg>aTg	p.T169M	BNIP1_ENST00000352523.6_Missense_Mutation_p.T178M|BNIP1_ENST00000231668.9_Missense_Mutation_p.T212M|BNIP1_ENST00000393770.4_Missense_Mutation_p.T135M	NM_001205.2	NP_001196.2	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 1	169					apoptotic process (GO:0006915)|autophagy (GO:0006914)|endoplasmic reticulum membrane fusion (GO:0016320)|endoplasmic reticulum organization (GO:0007029)|execution phase of apoptosis (GO:0097194)|negative regulation of apoptotic process (GO:0043066)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	11	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TCTTCACGAACGATCCTGGAT	0.507																																																0			5											66.0	65.0	65.0					5																	172590743		2203	4300	6503	172523349	SO:0001583	missense	662			AF083957	CCDS4384.1, CCDS4385.1, CCDS4386.1, CCDS43400.1	5q33-q34	2008-02-05	2002-08-29		ENSG00000113734	ENSG00000113734			1082	protein-coding gene	gene with protein product		603291	"""BCL2/adenovirus E1B 19kD-interacting protein 1"""			7954800, 15272311	Standard	NM_013979		Approved	Nip1, SEC20	uc003mcj.4	Q12981	OTTHUMG00000130521	ENST00000351486.5:c.506C>T	5.37:g.172590743C>T	ENSP00000239215:p.Thr169Met	Somatic		Capture	Illumina GAIIx	4	172523349	D3DQM3|D3DQM4|D3DQM5|D3DQM6|O75622|O75623|O75624|Q6K044|Q96FG4	Missense_Mutation	SNP	HMMPfam_Sec20	p.T212M	ENST00000351486.5	37	c.635	CCDS4384.1	5	.	.	.	.	.	.	.	.	.	.	C	27.2	4.805830	0.90623	.	.	ENSG00000113734	ENST00000231668;ENST00000351486;ENST00000352523;ENST00000393770	T;T;T;T	0.51071	0.74;0.72;0.76;0.72	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.67021	0.2849	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.76494	0.999;0.974;0.972;0.997	P;P;P;P	0.56916	0.809;0.803;0.534;0.803	T	0.68439	-0.5408	10	0.52906	T	0.07	.	19.9084	0.97016	0.0:1.0:0.0:0.0	.	135;178;169;212	Q12981-2;Q12981-3;Q12981;Q12981-1	.;.;SEC20_HUMAN;.	M	212;169;178;135	ENSP00000231668:T212M;ENSP00000239215:T169M;ENSP00000239214:T178M;ENSP00000377365:T135M	ENSP00000231668:T212M	T	+	2	0	BNIP1	172523349	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	7.487000	0.81328	2.711000	0.92665	0.650000	0.86243	ACG	-	HMMPfam_Sec20		0.507	BNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNIP1	protein_coding	OTTHUMT00000252939.1	C	NM_013979		172523349	+1	no_errors	NM_013979	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
NCF2	4688	genome.wustl.edu	37	1	183539950	183539950	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr1:183539950C>T	ENST00000367535.3	-	6	885	c.634G>A	c.(634-636)Gac>Aac	p.D212N	NCF2_ENST00000413720.1_Missense_Mutation_p.D167N|NCF2_ENST00000367536.1_Missense_Mutation_p.D212N|NCF2_ENST00000418089.1_Missense_Mutation_p.D131N	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	212					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	GAGAAACTGTCTTGATCCACC	0.517																																																0			1											166.0	137.0	147.0					1																	183539950		2203	4300	6503	181806573	SO:0001583	missense	4688			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.634G>A	1.37:g.183539950C>T	ENSP00000356505:p.Asp212Asn	Somatic		Capture	Illumina GAIIx	4	181806573	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	superfamily_SSF48452,HMMPfam_TPR_1,HMMSmart_TPR,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_SSF54277,HMMPfam_PB1,HMMSmart_PB1	p.D212N	ENST00000367535.3	37	c.634	CCDS1356.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.189509	0.94923	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535	T;T;T;T	0.73469	-0.75;-0.43;-0.39;-0.75	5.19	5.19	0.71726	.	0.091349	0.64402	D	0.000001	D	0.83225	0.5208	L	0.50993	1.605	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.992	T	0.81920	-0.0712	10	0.37606	T	0.19	2.5473	18.7499	0.91810	0.0:1.0:0.0:0.0	.	131;167;212	E9PHJ2;E9PHX3;P19878	.;.;NCF2_HUMAN	N	212;240;167;131;212	ENSP00000356506:D212N;ENSP00000399294:D167N;ENSP00000407217:D131N;ENSP00000356505:D212N	ENSP00000356505:D212N	D	-	1	0	NCF2	181806573	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.588000	0.74076	2.411000	0.81874	0.655000	0.94253	GAC	-	NULL		0.517	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF2	protein_coding	OTTHUMT00000085483.1	C	NM_000433		181806573	-1	no_errors	NM_000433	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
HES1	3280	genome.wustl.edu	37	3	193854818	193854818	+	Silent	SNP	G	G	A			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr3:193854818G>A	ENST00000232424.3	+	3	509	c.273G>A	c.(271-273)ctG>ctA	p.L91L		NM_005524.3	NP_005515.1	P30042	ES1_HUMAN	hes family bHLH transcription factor 1	0						mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		TCCGGAACCTGCAGCGGGCGC	0.627																																																0			3											48.0	51.0	50.0					3																	193854818		2203	4300	6503	195337512	SO:0001819	synonymous_variant	3280			L19314	CCDS3305.1	3q28-q29	2013-10-17	2013-10-17	2003-01-10	ENSG00000114315	ENSG00000114315		"""Basic helix-loop-helix proteins"""	5192	protein-coding gene	gene with protein product		139605	"""hairy homolog (Drosophila)"", ""hairy and enhancer of split 1, (Drosophila)"""	HRY		8020957	Standard	NM_005524		Approved	FLJ20408, HES-1, Hes1, bHLHb39	uc003ftq.2	Q14469	OTTHUMG00000155984	ENST00000232424.3:c.273G>A	3.37:g.193854818G>A		Somatic		Capture	Illumina GAIIx	4	195337512	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Silent	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH,HMMPfam_Hairy_orange,HMMSmart_ORANGE	p.L91	ENST00000232424.3	37	c.273	CCDS3305.1	3																																																																																			-	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH		0.627	HES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HES1	protein_coding	OTTHUMT00000342632.1	G			195337512	+1	no_errors	NM_005524	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
TOMM20	9804	genome.wustl.edu	37	1	235283208	235283208	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2538-01A-01D-1526-09	TCGA-36-2538-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	db4480de-2a4a-479b-b4cc-ac0e684c3348	a18e2616-db9b-4fa1-910f-92ca7e83b966	g.chr1:235283208C>T	ENST00000366607.4	-	3	395	c.175G>A	c.(175-177)Gac>Aac	p.D59N	TOMM20_ENST00000467767.1_5'UTR	NM_014765.2	NP_055580.1	Q15388	TOM20_HUMAN	translocase of outer mitochondrial membrane 20 homolog (yeast)	59					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)|unfolded protein binding (GO:0051082)			lung(2)|prostate(1)	3	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;6.33e-05)|Epithelial(3;8.26e-05)			TCTTTAAGGTCAGGTAACTGG	0.328																																																0			1											44.0	44.0	44.0					1																	235283208		2201	4299	6500	233349831	SO:0001583	missense	9804				CCDS1603.1	1q42	2008-07-18			ENSG00000173726	ENSG00000173726			20947	protein-coding gene	gene with protein product	"""translocase of outer mitochondrial membrane 20 homolog type II"""	601848				7498524, 7589431, 15733919	Standard	NM_014765		Approved	KIAA0016, TOM20, MOM19, MAS20	uc001hwl.3	Q15388	OTTHUMG00000039619	ENST00000366607.4:c.175G>A	1.37:g.235283208C>T	ENSP00000355566:p.Asp59Asn	Somatic		Capture	Illumina GAIIx	4	233349831	A8K195|Q498B3|Q6IBT4	Missense_Mutation	SNP	HMMPfam_MAS20,superfamily_Mitochondrial import receptor subunit Tom20	p.D59N	ENST00000366607.4	37	c.175	CCDS1603.1	1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803590	0.70682	.	.	ENSG00000173726	ENST00000366607	T	0.47177	0.85	6.03	6.03	0.97812	Mitochondrial outer membrane translocase complex, subunit Tom20 domain (2);	0.043561	0.85682	N	0.000000	T	0.55049	0.1896	M	0.66297	2.02	0.80722	D	1	P	0.35844	0.524	B	0.41466	0.358	T	0.45279	-0.9272	10	0.21014	T	0.42	-15.3785	20.5666	0.99351	0.0:1.0:0.0:0.0	.	59	Q15388	TOM20_HUMAN	N	59	ENSP00000355566:D59N	ENSP00000355566:D59N	D	-	1	0	TOMM20	233349831	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	6.087000	0.71362	2.854000	0.98071	0.655000	0.94253	GAC	-	HMMPfam_MAS20,superfamily_Mitochondrial import receptor subunit Tom20		0.328	TOMM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM20	protein_coding	OTTHUMT00000095551.1	C	NM_014765		233349831	-1	no_errors	NM_014765	genbank	human	validated	54_36p	missense	SNP	1.000	T
