#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LYRM4	57128	genome.wustl.edu	37	6	5260960	5260960	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr6:5260960C>A	ENST00000330636.4	-	1	212	c.7G>T	c.(7-9)Gcc>Tcc	p.A3S	LYRM4_ENST00000464010.1_Missense_Mutation_p.A3S|LYRM4_ENST00000480566.1_Missense_Mutation_p.A3S|FARS2_ENST00000274680.4_5'Flank|LYRM4_ENST00000468929.1_Missense_Mutation_p.A3S|FARS2_ENST00000324331.6_5'Flank|LYRM4_ENST00000500576.2_Missense_Mutation_p.A3S	NM_020408.4	NP_065141.3	Q9HD34	LYRM4_HUMAN	LYR motif containing 4	3					small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)				endometrium(1)	1	Ovarian(93;0.11)	all_hematologic(90;0.0901)				CGACTGGAGGCTGCCATTTTG	0.557																																					NSCLC(130;1006 2426 17608 36797)											0			6											17.0	18.0	18.0					6																	5260960		2155	4243	6398	5205959	SO:0001583	missense	57128			AF258559	CCDS4493.1, CCDS54961.1	6p25.1	2008-02-05	2006-09-19	2006-09-19	ENSG00000214113	ENSG00000214113		"""LYR motif containing"""	21365	protein-coding gene	gene with protein product		613311	"""chromosome 6 open reading frame 149"""	C6orf149			Standard	XM_005249239		Approved	CGI-203, ISD11	uc021ykw.1	Q9HD34	OTTHUMG00000014173	ENST00000330636.4:c.7G>T	6.37:g.5260960C>A	ENSP00000418787:p.Ala3Ser	Somatic		Capture	Illumina GAIIx	4	5205959	A8K543|Q5XKP1	Missense_Mutation	SNP	HMMPfam_Complex1_LYR	p.A3S	ENST00000330636.4	37	c.7	CCDS4493.1	6	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044858	0.55110	.	.	ENSG00000214113	ENST00000468929;ENST00000330636;ENST00000464010;ENST00000480566;ENST00000500576	T;T;T;T;T	0.66815	-0.23;0.87;0.76;0.84;1.45	5.04	5.04	0.67666	.	0.220720	0.25214	U	0.032294	T	0.34803	0.0910	N	0.21545	0.675	0.33764	D	0.622243	P;B	0.34864	0.473;0.39	B;B	0.28553	0.091;0.054	T	0.39961	-0.9588	10	0.36615	T	0.2	-1.0664	13.8868	0.63712	0.0:1.0:0.0:0.0	.	3;3	C9JRX8;Q9HD34	.;LYRM4_HUMAN	S	3	ENSP00000418321:A3S;ENSP00000418787:A3S;ENSP00000420026:A3S;ENSP00000419928:A3S;ENSP00000443900:A3S	ENSP00000418787:A3S	A	-	1	0	LYRM4	5205959	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.001000	0.57046	2.342000	0.79632	0.655000	0.94253	GCC	-	NULL		0.557	LYRM4-001	KNOWN	basic|CCDS	protein_coding	LYRM4	protein_coding	OTTHUMT00000353461.3	C	NM_020408		5205959	-1	no_errors	NM_020408	genbank	human	validated	54_36p	missense	SNP	1.000	A
NLRP14	338323	genome.wustl.edu	37	11	7083733	7083733	+	Splice_Site	SNP	G	G	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr11:7083733G>T	ENST00000299481.4	+	10	3320	c.2974G>T	c.(2974-2976)Ggg>Tgg	p.G992W		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	992					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TCAGAGGCTCGGGTGAGTTCA	0.408																																																0			11											117.0	110.0	112.0					11																	7083733		2201	4296	6497	7040309	SO:0001630	splice_region_variant	338323			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2975+1G>T	11.37:g.7083733G>T		Somatic		Capture	Illumina GAIIx	4	7040309	Q7RTR6	Missense_Mutation	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,HMMPfam_NACHT,superfamily_SSF52047	p.G992W	ENST00000299481.4	37	c.2974	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	G	15.05	2.719245	0.48728	.	.	ENSG00000158077	ENST00000299481	T	0.51071	0.72	4.84	2.97	0.34412	.	0.193999	0.25820	N	0.028082	T	0.46756	0.1409	N	0.25789	0.76	0.34572	D	0.71356	D	0.63880	0.993	P	0.61275	0.886	T	0.58148	-0.7687	10	0.56958	D	0.05	.	6.8572	0.24048	0.2047:0.0:0.7953:0.0	.	992	Q86W24	NAL14_HUMAN	W	992	ENSP00000299481:G992W	ENSP00000299481:G992W	G	+	1	0	NLRP14	7040309	0.941000	0.31946	0.976000	0.42696	0.657000	0.38888	1.565000	0.36386	1.412000	0.46977	0.655000	0.94253	GGG	-	superfamily_SSF52047		0.408	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	protein_coding	OTTHUMT00000384551.1	G	NM_176822	Missense_Mutation	7040309	+1	no_errors	NM_176822	genbank	human	reviewed	54_36p	missense	SNP	0.955	T
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	17	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	7518937	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic		Capture	Illumina GAIIx	4	7518937	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7518937	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.380	A
DNAH5	1767	genome.wustl.edu	37	5	13788871	13788871	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr5:13788871A>C	ENST00000265104.4	-	51	8705	c.8601T>G	c.(8599-8601)atT>atG	p.I2867M		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2867					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AATATGTGTCAATTCCACAAT	0.413									Kartagener syndrome																																							0			5											125.0	122.0	123.0					5																	13788871		2203	4300	6503	13841871	SO:0001583	missense	1767	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8601T>G	5.37:g.13788871A>C	ENSP00000265104:p.Ile2867Met	Somatic		Capture	Illumina GAIIx	4	13841871	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	HMMPfam_DHC_N1,superfamily_Spectrin,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.I2867M	ENST00000265104.4	37	c.8601	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	A	10.34	1.322461	0.23994	.	.	ENSG00000039139	ENST00000265104	T	0.23552	1.9	5.56	-1.73	0.08081	.	1.521690	0.03466	N	0.212939	T	0.23572	0.0570	L	0.59436	1.845	0.21652	N	0.999609	B	0.06786	0.001	B	0.14023	0.01	T	0.24764	-1.0151	10	0.46703	T	0.11	.	2.0606	0.03591	0.3375:0.3429:0.2088:0.1108	.	2867	Q8TE73	DYH5_HUMAN	M	2867	ENSP00000265104:I2867M	ENSP00000265104:I2867M	I	-	3	3	DNAH5	13841871	0.000000	0.05858	0.018000	0.16275	0.981000	0.71138	-1.053000	0.03500	-0.425000	0.07371	0.533000	0.62120	ATT	-	superfamily_SSF52540		0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	A	NM_001369		13841871	-1	no_errors	NM_001369	genbank	human	validated	54_36p	missense	SNP	0.177	C
THTPA	79178	genome.wustl.edu	37	14	24026133	24026133	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr14:24026133G>A	ENST00000288014.6	+	1	903	c.167G>A	c.(166-168)cGa>cAa	p.R56Q	THTPA_ENST00000554789.1_Missense_Mutation_p.R56Q|THTPA_ENST00000554970.1_Missense_Mutation_p.R56Q|THTPA_ENST00000556015.1_Missense_Mutation_p.R56Q|RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000555446.1_RNA|THTPA_ENST00000404535.3_Missense_Mutation_p.R56Q			Q9BU02	THTPA_HUMAN	thiamine triphosphatase	56	CYTH. {ECO:0000255|PROSITE- ProRule:PRU01044}.				dephosphorylation (GO:0016311)|generation of precursor metabolites and energy (GO:0006091)|small molecule metabolic process (GO:0044281)|thiamine diphosphate metabolic process (GO:0042357)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)|thiamin-triphosphatase activity (GO:0050333)			large_intestine(1)|prostate(2)	3	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)		TGGCTGCGACGACGAGAGGAT	0.577																																																0			14											66.0	53.0	57.0					14																	24026133		2203	4300	6503	23095973	SO:0001583	missense	79178			AF432862	CCDS32053.1, CCDS58306.1, CCDS58307.1	14q11.2	2011-04-28					3.6.1.28		18987	protein-coding gene	gene with protein product		611612				11827967	Standard	NR_046051		Approved	THTPASE	uc001wkh.5	Q9BU02		ENST00000288014.6:c.167G>A	14.37:g.24026133G>A	ENSP00000288014:p.Arg56Gln	Somatic		Capture	Illumina GAIIx	4	23095973	D3DS50|G3V4J3	Missense_Mutation	SNP	HMMPfam_CYTH	p.R56Q	ENST00000288014.6	37	c.167	CCDS32053.1	14	.	.	.	.	.	.	.	.	.	.	G	9.612	1.131603	0.21041	.	.	ENSG00000157306	ENST00000404535;ENST00000288014;ENST00000557630;ENST00000556015;ENST00000554970;ENST00000554789	T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04	5.91	0.559	0.17272	CYTH domain (2);CYTH-like domain (1);	0.851332	0.11028	N	0.607554	T	0.15955	0.0384	N	0.05158	-0.105	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.21518	-1.0243	10	0.19147	T	0.46	-1.673	0.7514	0.00991	0.4461:0.162:0.2362:0.1558	.	56;56	G3V4J3;Q9BU02	.;THTPA_HUMAN	Q	56	ENSP00000384580:R56Q;ENSP00000288014:R56Q;ENSP00000452281:R56Q;ENSP00000451835:R56Q;ENSP00000452465:R56Q;ENSP00000450459:R56Q	ENSP00000288014:R56Q	R	+	2	0	THTPA	23095973	0.009000	0.17119	0.783000	0.31826	0.915000	0.54546	0.573000	0.23699	0.105000	0.17753	-0.290000	0.09829	CGA	-	HMMPfam_CYTH		0.577	THTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THTPA	protein_coding	OTTHUMT00000413800.2	G			23095973	+1	no_errors	NM_024328	genbank	human	validated	54_36p	missense	SNP	0.649	A
NFE2L3	9603	genome.wustl.edu	37	7	26224974	26224974	+	Silent	SNP	T	T	C	rs374986558		TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr7:26224974T>C	ENST00000056233.3	+	4	1915	c.1656T>C	c.(1654-1656)gaT>gaC	p.D552D		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	552					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						TTTCTGTAGATGAAATTGTCG	0.403																																																0			7						T		1,4405	2.1+/-5.4	0,1,2202	121.0	111.0	114.0		1656	-1.6	1.0	7		114	0,8600		0,0,4300	no	coding-synonymous	NFE2L3	NM_004289.6		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		552/695	26224974	1,13005	2203	4300	6503	26191499	SO:0001819	synonymous_variant	9603			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1656T>C	7.37:g.26224974T>C		Somatic		Capture	Illumina GAIIx	4	26191499	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Silent	SNP	superfamily_Euk_transcr_DNA,HMMPfam_bZIP_1,HMMSmart_BRLZ,PatternScan_BZIP_BASIC	p.D552	ENST00000056233.3	37	c.1656	CCDS5396.1	7																																																																																			-	superfamily_Euk_transcr_DNA		0.403	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	protein_coding	OTTHUMT00000214088.1	T			26191499	+1	no_errors	NM_004289	genbank	human	reviewed	54_36p	silent	SNP	0.092	C
OR2B6	26212	genome.wustl.edu	37	6	27925342	27925342	+	Silent	SNP	G	G	T	rs370729151		TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr6:27925342G>T	ENST00000244623.1	+	1	324	c.324G>T	c.(322-324)ggG>ggT	p.G108G		NM_012367.1	NP_036499.1	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B, member 6	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGGCCTTGGGGGCTACTGAAT	0.453																																																0			6											64.0	63.0	63.0					6																	27925342		2203	4299	6502	28033321	SO:0001819	synonymous_variant	26212			U86275	CCDS4642.1	6p22.1	2012-08-09			ENSG00000124657	ENSG00000124657		"""GPCR / Class A : Olfactory receptors"""	8241	protein-coding gene	gene with protein product				OR2B6P, OR2B1, OR2B1P, OR2B5		9500546	Standard	NM_012367		Approved	OR6-31, dJ408B20.2, OR5-40, OR5-41	uc011dkx.2	P58173	OTTHUMG00000014497	ENST00000244623.1:c.324G>T	6.37:g.27925342G>T		Somatic		Capture	Illumina GAIIx	4	28033321	O43883|Q6IF89|Q9H5B0	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G108	ENST00000244623.1	37	c.324	CCDS4642.1	6																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.453	OR2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B6	protein_coding	OTTHUMT00000040165.1	G			28033321	+1	no_errors	NM_012367	genbank	human	provisional	54_36p	silent	SNP	0.000	T
NF2	4771	genome.wustl.edu	37	22	30090740	30090740	+	Splice_Site	SNP	G	G	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr22:30090740G>C	ENST00000338641.4	+	16	2178		c.e16-1		NF2_ENST00000361676.4_Splice_Site|NF2_ENST00000361166.4_Splice_Site|NF2_ENST00000397789.3_Splice_Site|NF2_ENST00000361452.4_Splice_Site|NF2_ENST00000347330.5_Splice_Site|NF2_ENST00000353887.4_Splice_Site|NF2_ENST00000413209.2_Splice_Site	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)						actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CTTTCTTACAGCTCACCTTGC	0.592			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																													yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	1	Unknown(1)	stomach(1)	22	GRCh37	CS961646	NF2	S							70.0	60.0	64.0					22																	30090740		2203	4300	6503	28420740	SO:0001630	splice_region_variant	4771	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.1738-1G>C	22.37:g.30090740G>C		Somatic		Capture	Illumina GAIIx	4	28420740	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Splice_Site	SNP	-	e16-1	ENST00000338641.4	37	c.1738-1	CCDS13861.1	22	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033027	0.54896	.	.	ENSG00000186575	ENST00000413209;ENST00000338641;ENST00000397822	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7093	0.69215	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF2	28420740	1.000000	0.71417	1.000000	0.80357	0.579000	0.36224	6.374000	0.73132	2.551000	0.86045	0.491000	0.48974	.	-	-		0.592	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NF2	protein_coding	OTTHUMT00000075615.3	G	NM_000268	Intron	28420740	+1	no_errors	NM_000268	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
CTB-134H23.2	0	genome.wustl.edu	37	16	29062065	29062065	+	Intron	SNP	C	C	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr16:29062065C>T	ENST00000424293.3	+	6	695																											TGAACATAGTCTGCCAGGTCA	0.478																																																0			16																																								28969566	SO:0001627	intron_variant	0																														ENST00000424293.3:c.642+37C>T	16.37:g.29062065C>T		Somatic		Capture	Illumina GAIIx	4	28969566		Silent	SNP	HMMPfam_NPIP	p.L166	ENST00000424293.3	37	c.496		16																																																																																			-	HMMPfam_NPIP		0.478	CTB-134H23.2-001	NOVEL	mRNA_end_NF|cds_end_NF|basic|appris_principal	protein_coding	ENSG00000196161	protein_coding	OTTHUMT00000409230.1	C			28969566	+1	no_errors	ENST00000354734	ensembl	human	known	54_36p	silent	SNP	0.000	T
DPCR1	135656	genome.wustl.edu	37	6	30919553	30919553	+	Silent	SNP	T	T	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr6:30919553T>A	ENST00000462446.1	+	2	3340	c.3312T>A	c.(3310-3312)ccT>ccA	p.P1104P	DPCR1_ENST00000304311.2_5'UTR|HCG21_ENST00000419481.1_RNA			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	285						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						TAGCAAAGCCTACAGAACATG	0.478																																																0			6											253.0	224.0	233.0					6																	30919553		692	1591	2283	31027532	SO:0001819	synonymous_variant	135656			AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3312T>A	6.37:g.30919553T>A		Somatic		Capture	Illumina GAIIx	4	31027532	C9IZC0|Q658M7|Q8WYN2	Silent	SNP	NULL	p.P58	ENST00000462446.1	37	c.174	CCDS4692.2	6																																																																																			-	NULL		0.478	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	DPCR1	protein_coding	OTTHUMT00000076173.3	T	NM_080870		31027532	+1	no_errors	ENST00000376299	ensembl	human	known	54_36p	silent	SNP	0.000	A
TIAM1	7074	genome.wustl.edu	37	21	32492754	32492754	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr21:32492754T>A	ENST00000286827.3	-	29	5179	c.4708A>T	c.(4708-4710)Agc>Tgc	p.S1570C	TIAM1_ENST00000541036.1_Missense_Mutation_p.S1510C	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1570					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						ACTTCCTCGCTTGCGCTCTCC	0.567																																																0			21											77.0	71.0	73.0					21																	32492754		2203	4300	6503	31414625	SO:0001583	missense	7074				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.4708A>T	21.37:g.32492754T>A	ENSP00000286827:p.Ser1570Cys	Somatic		Capture	Illumina GAIIx	4	31414625	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMPfam_RBD,HMMSmart_RBD,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,PatternScan_DH_1	p.S1570C	ENST00000286827.3	37	c.4708	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	T	15.39	2.820241	0.50633	.	.	ENSG00000156299	ENST00000286827;ENST00000541036	T;T	0.43688	0.94;0.96	4.95	1.13	0.20643	.	0.294132	0.30142	N	0.010316	T	0.28134	0.0694	N	0.22421	0.69	0.09310	N	1	P;P	0.50156	0.932;0.89	B;B	0.43331	0.416;0.215	T	0.14559	-1.0468	10	0.48119	T	0.1	.	9.3605	0.38192	0.0:0.2996:0.0:0.7004	.	1510;1570	F5GZ53;Q13009	.;TIAM1_HUMAN	C	1570;1510	ENSP00000286827:S1570C;ENSP00000441570:S1510C	ENSP00000286827:S1570C	S	-	1	0	TIAM1	31414625	0.025000	0.19082	0.108000	0.21378	0.267000	0.26476	0.585000	0.23879	-0.029000	0.13827	0.533000	0.62120	AGC	-	NULL		0.567	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	protein_coding	OTTHUMT00000192552.1	T	NM_003253		31414625	-1	no_errors	NM_003253	genbank	human	validated	54_36p	missense	SNP	0.055	A
CRYZL1	9946	genome.wustl.edu	37	21	34974579	34974579	+	Nonsense_Mutation	SNP	C	C	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr21:34974579C>A	ENST00000381554.3	-	8	623	c.538G>T	c.(538-540)Gaa>Taa	p.E180*	CRYZL1_ENST00000445393.1_Nonsense_Mutation_p.E142*|CRYZL1_ENST00000290244.5_Nonsense_Mutation_p.E165*|CRYZL1_ENST00000361534.2_Nonsense_Mutation_p.E204*|AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000381540.3_Nonsense_Mutation_p.E180*	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	180					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						TGCTTATCTTCAAGGCTGCAT	0.383																																																0			21											164.0	151.0	155.0					21																	34974579		2203	4300	6503	33896449	SO:0001587	stop_gained	9946			AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.538G>T	21.37:g.34974579C>A	ENSP00000370966:p.Glu180*	Somatic		Capture	Illumina GAIIx	4	33896449	B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Nonsense_Mutation	SNP	superfamily_GroES-like,HMMPfam_ADH_N,superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_ADH_zinc_N	p.E180*	ENST00000381554.3	37	c.538	CCDS13633.2	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.2|25.2	4.610536|4.610536	0.87258|0.87258	.|.	.|.	ENSG00000205758|ENSG00000205758	ENST00000381554;ENST00000290244;ENST00000381540;ENST00000445393;ENST00000361534;ENST00000452332;ENST00000414079;ENST00000426935;ENST00000431177|ENST00000440526	.|.	.|.	.|.	4.98|4.98	4.98|4.98	0.66077|0.66077	.|.	0.156445|.	0.56097|.	D|.	0.000029|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.72032|.	D|.	0.01|.	-24.3176|-24.3176	15.5569|15.5569	0.76203|0.76203	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	180;165;180;142;204;180;40;128;180|123	.|.	ENSP00000290244:E165X|.	E|X	-|-	1|2	0|2	CRYZL1|CRYZL1	33896449|33896449	0.999000|0.999000	0.42202|0.42202	0.998000|0.998000	0.56505|0.56505	0.998000|0.998000	0.95712|0.95712	5.280000|5.280000	0.65603|0.65603	2.455000|2.455000	0.83008|0.83008	0.655000|0.655000	0.94253|0.94253	GAA|TGA	-	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_ADH_zinc_N		0.383	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYZL1	protein_coding	OTTHUMT00000141282.2	C	NM_145858		33896449	-1	no_errors	NM_145858	genbank	human	reviewed	54_36p	nonsense	SNP	0.996	A
GALT	2592	genome.wustl.edu	37	9	34648148	34648148	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr9:34648148A>G	ENST00000378842.3	+	6	586	c.544A>G	c.(544-546)Aac>Gac	p.N182D	GALT_ENST00000556278.1_Missense_Mutation_p.N97D|IL11RA_ENST00000555003.1_5'Flank|GALT_ENST00000450095.2_Missense_Mutation_p.N73D	NM_000155.3	NP_000146.2	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase	182					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)|UDP-glucose catabolic process (GO:0006258)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	UDP-glucose:hexose-1-phosphate uridylyltransferase activity (GO:0008108)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(2)|lung(5)|upper_aerodigestive_tract(1)	16	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		GGGCTGTTCTAACCCCCACCC	0.522									Galactosemia																																							0			9											99.0	103.0	101.0					9																	34648148		2203	4300	6503	34638148	SO:0001583	missense	2592	Familial Cancer Database	Galactose-1-Phosphate Uridyltransferase Deficiency	M60091	CCDS6565.1, CCDS59122.1	9p13	2013-01-08			ENSG00000213930	ENSG00000213930	2.7.7.12		4135	protein-coding gene	gene with protein product		606999					Standard	NM_000155		Approved		uc003zve.4	P07902	OTTHUMG00000019836	ENST00000378842.3:c.544A>G	9.37:g.34648148A>G	ENSP00000368119:p.Asn182Asp	Somatic		Capture	Illumina GAIIx	4	34638148	B4E097|E7ET32|Q14355|Q14356|Q14357|Q14358|Q14359|Q14360|Q14361|Q14363|Q14364|Q14365|Q14369|Q14370|Q14371|Q14372|Q14373|Q14374|Q14375|Q14377|Q14378|Q14380|Q14381|Q14382|Q14383|Q14384|Q14385|Q14386|Q14387|Q14389|Q16766|Q53XK1|Q5VZ81|Q96BY1	Missense_Mutation	SNP	HMMPfam_GalP_UDP_transf,superfamily_HIT-like,PatternScan_GAL_P_UDP_TRANSF_I,HMMPfam_GalP_UDP_tr_C	p.N182D	ENST00000378842.3	37	c.544	CCDS6565.1	9	.	.	.	.	.	.	.	.	.	.	A	21.6	4.171782	0.78452	.	.	ENSG00000213930;ENSG00000213930;ENSG00000258728	ENST00000450095;ENST00000378842;ENST00000556278	D;D;D	0.99483	-5.99;-5.99;-5.99	4.77	4.77	0.60923	Histidine triad motif (1);Histidine triad-like motif (1);Galactose-1-phosphate uridyl transferase, N-terminal (1);	0.061993	0.64402	U	0.000007	D	0.99729	0.9894	H	0.98351	4.21	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.99;0.978;0.996	D	0.97127	0.9815	10	0.87932	D	0	-12.7742	13.6236	0.62150	1.0:0.0:0.0:0.0	.	134;73;182	B4DT62;E7ET32;P07902	.;.;GALT_HUMAN	D	73;182;97	ENSP00000401956:N73D;ENSP00000368119:N182D;ENSP00000451792:N97D	ENSP00000368119:N182D	N	+	1	0	RP11-195F19.29;GALT	34638148	1.000000	0.71417	0.989000	0.46669	0.942000	0.58702	6.368000	0.73104	2.024000	0.59613	0.533000	0.62120	AAC	-	HMMPfam_GalP_UDP_transf,superfamily_HIT-like,PatternScan_GAL_P_UDP_TRANSF_I		0.522	GALT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GALT	protein_coding	OTTHUMT00000052231.1	A	NM_000155		34638148	+1	no_errors	NM_000155	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
C5orf42	65250	genome.wustl.edu	37	5	37157917	37157917	+	Splice_Site	SNP	C	C	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr5:37157917C>A	ENST00000508244.1	-	39	7906		c.e39-1		C5orf42_ENST00000274258.7_Missense_Mutation_p.Q1502H|C5orf42_ENST00000425232.2_Splice_Site			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42							integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CAGGTAATTCCTGTAGAAGAT	0.368																																																0			5											79.0	72.0	75.0					5																	37157917		2203	4300	6503	37193674	SO:0001630	splice_region_variant	65250				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.7813-1G>T	5.37:g.37157917C>A		Somatic		Capture	Illumina GAIIx	4	37193674	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	NULL	p.Q1502H	ENST00000508244.1	37	c.4506	CCDS34146.2	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.31|13.31	2.197823|2.197823	0.38806|0.38806	.|.	.|.	ENSG00000197603|ENSG00000197603	ENST00000508244;ENST00000425232|ENST00000274258;ENST00000514429;ENST00000388739	.|T;T	.|0.24151	.|1.87;1.88	5.43|5.43	3.64|3.64	0.41730|0.41730	.|.	.|0.313409	.|0.23123	.|N	.|0.051679	.|T	.|0.12390	.|0.0301	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.17667	.|0.023	.|B	.|0.16289	.|0.015	.|T	.|0.16394	.|-1.0404	.|8	.|.	.|.	.|.	.|.	2.5498|2.5498	0.04746|0.04746	0.1569:0.4041:0.3036:0.1354|0.1569:0.4041:0.3036:0.1354	.|.	.|1502	.|Q9H799	.|CE042_HUMAN	.|H	-1|1502;1670;1502	.|ENSP00000274258:Q1502H;ENSP00000424223:Q1670H	.|.	.|Q	-|-	.|3	.|2	C5orf42|C5orf42	37193674|37193674	0.010000|0.010000	0.17322|0.17322	0.050000|0.050000	0.19076|0.19076	0.984000|0.984000	0.73092|0.73092	0.203000|0.203000	0.17315|0.17315	1.277000|1.277000	0.44412|0.44412	0.561000|0.561000	0.74099|0.74099	.|CAG	-	NULL		0.368	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	protein_coding	OTTHUMT00000360806.1	C	NM_023073	Intron	37193674	-1	no_errors	NM_023073	genbank	human	predicted	54_36p	missense	SNP	0.591	A
LOC344967	344967	genome.wustl.edu	37	4	40045197	40045197	+	RNA	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr4:40045197G>A	ENST00000381811.2	-	0	952					NR_027277.1																						CCACCAGGTGGATCAAGCTGG	0.607																																																0			4																																								39721592			0																															4.37:g.40045197G>A		Somatic		Capture	Illumina GAIIx	4	39721592		Silent	SNP	superfamily_SSF54637,HMMPfam_4HBT	p.I153	ENST00000381811.2	37	c.459		4																																																																																			-	superfamily_SSF54637		0.607	RP11-333E13.4-002	KNOWN	basic	processed_transcript	ENSG00000205794	pseudogene	OTTHUMT00000361278.1	G			39721592	-1	no_errors	ENST00000381811	ensembl	human	known	54_36p	silent	SNP	1.000	A
NHP2L1	4809	genome.wustl.edu	37	22	42073028	42073028	+	Intron	SNP	T	T	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr22:42073028T>A	ENST00000401959.1	-	4	441				NHP2L1_ENST00000463675.1_Intron|RNU6-476P_ENST00000384726.1_RNA|NHP2L1_ENST00000402458.1_Intron|NHP2L1_ENST00000355257.3_Intron|NHP2L1_ENST00000215956.5_Intron	NM_005008.3	NP_004999.1	P55769	NH2L1_HUMAN	NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ribosome biogenesis (GO:0042254)|RNA splicing (GO:0008380)	box C/D snoRNP complex (GO:0031428)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|lung(1)|prostate(1)	4						CACCGTCTAGTTTGAGAATAC	0.398																																																0			22																																								40402974	SO:0001627	intron_variant	0				CCDS14022.1, CCDS33653.1	22q13	2009-01-06	2001-11-28		ENSG00000100138	ENSG00000100138			7819	protein-coding gene	gene with protein product	"""small nuclear ribonucleoprotein 15.5kDa (U4/U6.U5)"""	601304	"""non-histone chromosome protein 2 (S. cerevisiae)-like 1"", ""sperm specific antigen 1"""	SSFA1		8978773	Standard	NM_005008		Approved	SNU13, FA-1, SPAG12, SNRNP15-5, 15.5K	uc003bav.3	P55769	OTTHUMG00000151189	ENST00000401959.1:c.125-1829A>T	22.37:g.42073028T>A		Somatic		Capture	Illumina GAIIx	4	40402974		Missense_Mutation	SNP	HMMPfam_Laps	p.K34N	ENST00000401959.1	37	c.102	CCDS14022.1	22																																																																																			-	HMMPfam_Laps		0.398	NHP2L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128533	protein_coding	OTTHUMT00000321682.1	T	NM_001003796		40402974	-1	no_errors	XM_001724102	genbank	human	model	54_36p	missense	SNP	0.821	A
SLC14A2	8170	genome.wustl.edu	37	18	43243869	43243869	+	Nonsense_Mutation	SNP	A	A	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr18:43243869A>T	ENST00000255226.6	+	11	2287	c.1471A>T	c.(1471-1473)Aaa>Taa	p.K491*	SLC14A2_ENST00000586448.1_Nonsense_Mutation_p.K491*|SLC14A2_ENST00000589658.1_5'Flank	NM_007163.3	NP_009094.3	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter), member 2	491					transmembrane transport (GO:0055085)|urea transport (GO:0015840)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|urea transmembrane transporter activity (GO:0015204)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(35)|ovary(1)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GAGGAGGAGCAAAGGTGTGCA	0.557																																																0			18											105.0	66.0	79.0					18																	43243869		2203	4300	6503	41497867	SO:0001587	stop_gained	8170			X96969	CCDS11924.1	18q12.1-q21.1	2013-05-22			ENSG00000132874	ENSG00000132874		"""Solute carriers"""	10919	protein-coding gene	gene with protein product		601611				8647271	Standard	NM_007163		Approved	HUT2, UT2	uc010dnj.3	Q15849	OTTHUMG00000132616	ENST00000255226.6:c.1471A>T	18.37:g.43243869A>T	ENSP00000255226:p.Lys491*	Somatic		Capture	Illumina GAIIx	4	41497867	A8K8Q7|Q2TBD6|Q96PH5	Nonsense_Mutation	SNP	HMMPfam_UT,PatternScan_MULTICOPPER_OXIDASE1	p.K491*	ENST00000255226.6	37	c.1471	CCDS11924.1	18	.	.	.	.	.	.	.	.	.	.	A	46	12.599660	0.99681	.	.	ENSG00000132874	ENST00000255226	.	.	.	5.35	5.35	0.76521	.	0.509754	0.19934	N	0.102789	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.9545	11.7408	0.51792	1.0:0.0:0.0:0.0	.	.	.	.	X	491	.	ENSP00000255226:K491X	K	+	1	0	SLC14A2	41497867	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	4.247000	0.58750	2.020000	0.59435	0.533000	0.62120	AAA	-	NULL		0.557	SLC14A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC14A2	protein_coding	OTTHUMT00000255858.1	A			41497867	+1	no_errors	NM_007163	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
MDFI	4188	genome.wustl.edu	37	6	41613925	41613925	+	Intron	SNP	G	G	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr6:41613925G>T	ENST00000373050.4	+	3	263							Q99750	MDFI_HUMAN	MyoD family inhibitor						activation of JUN kinase activity (GO:0007257)|cytoplasmic sequestering of transcription factor (GO:0042994)|dorsal/ventral axis specification (GO:0009950)|embryo development (GO:0009790)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|prostate(2)|skin(1)|urinary_tract(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.121)		Colorectal(64;0.0123)|COAD - Colon adenocarcinoma(64;0.0264)|KIRC - Kidney renal clear cell carcinoma(1;0.138)			ACCCTGCGGAGGCAGCACCAG	0.627																																																0			6											74.0	68.0	70.0					6																	41613925		2203	4300	6503	41721903	SO:0001627	intron_variant	4188			U78313	CCDS4857.1, CCDS75451.1	6p21	2008-08-29			ENSG00000112559	ENSG00000112559			6967	protein-coding gene	gene with protein product	"""inhibitor of MyoD family a"""	604971				9250874, 17289077	Standard	NM_005586		Approved	I-mfa	uc003oqq.4	Q99750	OTTHUMG00000014681	ENST00000373050.4:c.77-3432G>T	6.37:g.41613925G>T		Somatic		Capture	Illumina GAIIx	4	41721903		Missense_Mutation	SNP	PatternScan_TNFR_NGFR_1	p.E46D	ENST00000373050.4	37	c.138		6	.	.	.	.	.	.	.	.	.	.	G	19.47	3.834172	0.71373	.	.	ENSG00000112559	ENST00000432027;ENST00000419164;ENST00000373051;ENST00000441667;ENST00000230321;ENST00000543326;ENST00000446650	.	.	.	5.42	4.55	0.56014	.	0.149324	0.43747	D	0.000539	T	0.26376	0.0644	L	0.60455	1.87	0.26976	N	0.965475	P	0.45715	0.865	P	0.45406	0.479	T	0.18777	-1.0326	9	0.56958	D	0.05	-34.5455	6.2443	0.20807	0.0919:0.0:0.723:0.1851	.	46	Q99750	MDFI_HUMAN	D	46	.	ENSP00000230321:E46D	E	+	3	2	MDFI	41721903	0.964000	0.33143	0.998000	0.56505	0.916000	0.54674	0.648000	0.24828	2.539000	0.85634	0.561000	0.74099	GAG	-	NULL		0.627	MDFI-002	NOVEL	basic	protein_coding	MDFI	protein_coding	OTTHUMT00000040519.2	G	NM_005586		41721903	+1	no_errors	NM_005586	genbank	human	reviewed	54_36p	missense	SNP	0.904	T
SLC37A1	54020	genome.wustl.edu	37	21	43984817	43984817	+	Splice_Site	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr21:43984817G>A	ENST00000352133.2	+	14	2117		c.e14-1		SLC37A1_ENST00000398341.3_Splice_Site|AP001625.6_ENST00000442605.1_RNA			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1						carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						CTCCGTTGCAGGTGGGATCCT	0.662																																																0			21											81.0	81.0	81.0					21																	43984817		2203	4300	6503	42857886	SO:0001630	splice_region_variant	54020			AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.1136-1G>A	21.37:g.43984817G>A		Somatic		Capture	Illumina GAIIx	4	42857886	D3DSJ7|Q9HAQ1	Splice_Site	SNP	-	e13-1	ENST00000352133.2	37	c.1136-1	CCDS13689.1	21	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363938	0.41902	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	.	.	.	4.38	4.38	0.52667	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7145	0.77658	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC37A1	42857886	1.000000	0.71417	0.999000	0.59377	0.284000	0.27059	8.592000	0.90828	1.987000	0.57996	0.462000	0.41574	.	-	-		0.662	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC37A1	protein_coding	OTTHUMT00000195377.1	G		Intron	42857886	+1	no_errors	NM_018964	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
GLTSCR1L	23506	genome.wustl.edu	37	6	42796574	42796574	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr6:42796574T>C	ENST00000314073.5	+	6	679	c.503T>C	c.(502-504)gTg>gCg	p.V168A	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.V168A			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	168																	CCTATAGGGGTGACGCATGTG	0.478																																																0			6											146.0	134.0	138.0					6																	42796574		2203	4300	6503	42904552	SO:0001583	missense	23506			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.503T>C	6.37:g.42796574T>C	ENSP00000313933:p.Val168Ala	Somatic		Capture	Illumina GAIIx	4	42904552	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	NULL	p.V168A	ENST00000314073.5	37	c.503	CCDS34451.1	6	.	.	.	.	.	.	.	.	.	.	T	15.87	2.961925	0.53400	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.39406	1.08;1.08	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000012	T	0.49304	0.1549	L	0.54323	1.7	0.49051	D	0.999747	D;P;P	0.61697	0.99;0.756;0.607	D;P;B	0.73380	0.98;0.454;0.3	T	0.38802	-0.9644	10	0.28530	T	0.3	-13.9241	16.1025	0.81194	0.0:0.0:0.0:1.0	.	168;168;168	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	A	168	ENSP00000313933:V168A;ENSP00000377723:V168A	ENSP00000313933:V168A	V	+	2	0	KIAA0240	42904552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.055000	0.49916	2.254000	0.74563	0.533000	0.62120	GTG	-	NULL		0.478	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0240	protein_coding	OTTHUMT00000040562.3	T	NM_015349		42904552	+1	no_errors	NM_015349	genbank	human	validated	54_36p	missense	SNP	1.000	C
ABCG8	64241	genome.wustl.edu	37	2	44079924	44079924	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr2:44079924T>C	ENST00000272286.2	+	6	971	c.881T>C	c.(880-882)tTa>tCa	p.L294S		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	294	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	CCCATCTACTTAGGGGCGGCC	0.587																																																0			2											90.0	85.0	87.0					2																	44079924		2203	4300	6503	43933428	SO:0001583	missense	64241			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.881T>C	2.37:g.44079924T>C	ENSP00000272286:p.Leu294Ser	Somatic		Capture	Illumina GAIIx	4	43933428	Q53QN8	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1,HMMPfam_ABC2_membrane	p.L294S	ENST00000272286.2	37	c.881	CCDS1815.1	2	.	.	.	.	.	.	.	.	.	.	T	3.496	-0.102896	0.06967	.	.	ENSG00000143921	ENST00000272286	T	0.35048	1.33	5.57	3.14	0.36123	ABC transporter-like (1);	0.410282	0.27219	N	0.020373	T	0.10035	0.0246	N	0.01493	-0.835	0.09310	N	0.999995	B;B	0.16166	0.012;0.016	B;B	0.18871	0.023;0.01	T	0.13202	-1.0518	10	0.20519	T	0.43	.	0.0784	0.00029	0.2426:0.2139:0.249:0.2945	.	294;294	Q9H221-2;Q9H221	.;ABCG8_HUMAN	S	294	ENSP00000272286:L294S	ENSP00000272286:L294S	L	+	2	0	ABCG8	43933428	1.000000	0.71417	0.688000	0.30117	0.244000	0.25665	2.946000	0.49050	0.882000	0.36016	0.533000	0.62120	TTA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.587	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG8	protein_coding	OTTHUMT00000250671.1	T	NM_022437		43933428	+1	no_errors	NM_022437	genbank	human	reviewed	54_36p	missense	SNP	0.936	C
FCGBP	8857	genome.wustl.edu	37	19	40357690	40357690	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr19:40357690C>A	ENST00000221347.6	-	34	15630	c.15623G>T	c.(15622-15624)tGc>tTc	p.C5208F		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5208	Cys-rich.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGCTGCCTGGCATGTCAGGCC	0.617																																																0			19											71.0	57.0	62.0					19																	40357690		2203	4300	6503	45049530	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15623G>T	19.37:g.40357690C>A	ENSP00000221347:p.Cys5208Phe	Somatic		Capture	Illumina GAIIx	4	45049530	O95784	Missense_Mutation	SNP	HMMSmart_FOLN,HMMSmart_VWD,HMMPfam_VWD,HMMPfam_C8,superfamily_Cysrich_TIL,HMMPfam_TIL,HMMPfam_TIL_assoc,HMMSmart_VWC	p.C5208F	ENST00000221347.6	37	c.15623	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963787	0.92791	.	.	ENSG00000090920	ENST00000221347	T	0.61392	0.11	4.69	4.69	0.59074	Follistatin-like, N-terminal (1);	0.000000	0.85682	U	0.000000	T	0.79730	0.4496	M	0.91406	3.205	0.28345	N	0.921188	D	0.89917	1.0	D	0.97110	1.0	T	0.76366	-0.2985	10	0.87932	D	0	.	12.9978	0.58657	0.0:1.0:0.0:0.0	.	5208	Q9Y6R7	FCGBP_HUMAN	F	5208	ENSP00000221347:C5208F	ENSP00000221347:C5208F	C	-	2	0	FCGBP	45049530	0.998000	0.40836	0.777000	0.31699	0.962000	0.63368	3.798000	0.55522	2.428000	0.82296	0.655000	0.94253	TGC	-	HMMPfam_TIL_assoc,HMMSmart_FOLN		0.617	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	C	NM_003890		45049530	-1	no_errors	NM_003890	genbank	human	validated	54_36p	missense	SNP	0.031	A
ADNP	23394	genome.wustl.edu	37	20	49510368	49510368	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr20:49510368C>G	ENST00000396029.3	-	5	1450	c.883G>C	c.(883-885)Gtc>Ctc	p.V295L	ADNP_ENST00000349014.3_Missense_Mutation_p.V295L|ADNP_ENST00000371602.4_Missense_Mutation_p.V295L|ADNP_ENST00000396032.3_Missense_Mutation_p.V295L	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	295					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						AAAGACCGGACATTTCCAGAA	0.473																																																0			20											157.0	130.0	139.0					20																	49510368		2203	4300	6503	48943775	SO:0001583	missense	23394			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.883G>C	20.37:g.49510368C>G	ENSP00000379346:p.Val295Leu	Somatic		Capture	Illumina GAIIx	4	48943775	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	PatternScan_HOMEOBOX_1,HMMSmart_ZnF_C2H2,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox	p.V295L	ENST00000396029.3	37	c.883	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448137	0.43429	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.91	3.99	0.46301	.	0.290362	0.39615	N	0.001320	T	0.61337	0.2339	L	0.48642	1.525	0.40966	D	0.98466	P	0.42456	0.78	P	0.53266	0.722	T	0.56353	-0.7993	9	0.23302	T	0.38	-13.1802	12.6049	0.56516	0.0:0.866:0.0:0.134	.	295	Q9H2P0	ADNP_HUMAN	L	295	.	ENSP00000342905:V295L	V	-	1	0	ADNP	48943775	0.975000	0.34042	0.908000	0.35775	0.974000	0.67602	2.319000	0.43788	0.851000	0.35264	-0.140000	0.14226	GTC	-	NULL		0.473	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	protein_coding	OTTHUMT00000079705.2	C	NM_181442		48943775	-1	no_errors	NM_015339	genbank	human	reviewed	54_36p	missense	SNP	0.970	G
DDC	1644	genome.wustl.edu	37	7	50611679	50611679	+	Silent	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr7:50611679G>A	ENST00000444124.2	-	2	305	c.105C>T	c.(103-105)ccC>ccT	p.P35P	DDC_ENST00000357936.5_Silent_p.P35P|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000380984.4_Silent_p.P35P|DDC_ENST00000426377.1_Silent_p.P35P|DDC_ENST00000431062.1_Silent_p.P35P	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	35					catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	GCAGGTACCCGGGCTCCACGT	0.567																																																0			7											208.0	170.0	183.0					7																	50611679		2203	4300	6503	50579173	SO:0001819	synonymous_variant	1644				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.105C>T	7.37:g.50611679G>A		Somatic		Capture	Illumina GAIIx	4	50579173	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Silent	SNP	superfamily_PLP-dependent transferases,HMMPfam_Pyridoxal_deC,PatternScan_DDC_GAD_HDC_YDC	p.P35	ENST00000444124.2	37	c.105	CCDS5511.1	7	.	.	.	.	.	.	.	.	.	.	G	4.103	0.017253	0.07959	.	.	ENSG00000132437	ENST00000430300	.	.	.	5.92	-11.8	0.00035	.	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67941	-0.5540	5	.	.	.	-0.4102	10.6976	0.45907	0.3456:0.0:0.4699:0.1845	.	.	.	.	L	1	.	.	P	-	2	0	DDC	50579173	0.000000	0.05858	0.496000	0.27539	0.295000	0.27426	-3.662000	0.00400	-2.009000	0.00954	-1.708000	0.00717	CCG	-	superfamily_PLP-dependent transferases,HMMPfam_Pyridoxal_deC		0.567	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DDC	protein_coding	OTTHUMT00000342593.1	G			50579173	-1	no_errors	NM_000790	genbank	human	reviewed	54_36p	silent	SNP	0.165	A
MPO	4353	genome.wustl.edu	37	17	56357338	56357338	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr17:56357338T>G	ENST00000225275.3	-	3	462	c.286A>C	c.(286-288)Atg>Ctg	p.M96L	MPO_ENST00000340482.3_Missense_Mutation_p.M96L|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	96					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	AGGAGTTCCATGGGGCTGGCT	0.627																																																0			17											31.0	35.0	33.0					17																	56357338		2203	4300	6503	53712337	SO:0001583	missense	4353				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.286A>C	17.37:g.56357338T>G	ENSP00000225275:p.Met96Leu	Somatic		Capture	Illumina GAIIx	4	53712337	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	superfamily_Heme-dependent peroxidases,HMMPfam_An_peroxidase,PatternScan_PEROXIDASE_1	p.M96L	ENST00000225275.3	37	c.286	CCDS11604.1	17	.	.	.	.	.	.	.	.	.	.	T	11.79	1.742365	0.30865	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.69175	-0.38;-0.32	5.24	5.24	0.73138	.	0.639075	0.16786	N	0.199565	T	0.59702	0.2213	L	0.59436	1.845	0.23841	N	0.996699	B	0.06786	0.001	B	0.04013	0.001	T	0.47341	-0.9125	10	0.21540	T	0.41	-33.7565	9.6904	0.40125	0.1547:0.0:0.0:0.8453	.	96	P05164	PERM_HUMAN	L	96	ENSP00000344419:M96L;ENSP00000225275:M96L	ENSP00000225275:M96L	M	-	1	0	MPO	53712337	0.994000	0.37717	1.000000	0.80357	0.994000	0.84299	0.879000	0.28146	1.988000	0.58038	0.459000	0.35465	ATG	-	NULL		0.627	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	protein_coding	OTTHUMT00000443971.1	T			53712337	-1	no_errors	NM_000250	genbank	human	reviewed	54_36p	missense	SNP	0.995	G
CPT1C	126129	genome.wustl.edu	37	19	50208013	50208013	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr19:50208013C>T	ENST00000392518.4	+	8	1112	c.740C>T	c.(739-741)cCg>cTg	p.P247L	CPT1C_ENST00000323446.5_Missense_Mutation_p.P247L|CPT1C_ENST00000598293.1_Missense_Mutation_p.P247L|CPT1C_ENST00000405931.2_Missense_Mutation_p.P247L|CPT1C_ENST00000354199.5_Missense_Mutation_p.P247L	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	247					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		TCCCGAAATCCGCTGATGGTG	0.602																																																0			19											57.0	54.0	55.0					19																	50208013		2203	4300	6503	54899825	SO:0001583	missense	126129			AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.740C>T	19.37:g.50208013C>T	ENSP00000376303:p.Pro247Leu	Somatic		Capture	Illumina GAIIx	4	54899825	A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Missense_Mutation	SNP	superfamily_CoA-dependent acyltransferases,HMMPfam_Carn_acyltransf,PatternScan_ACYLTRANSF_C_1,PatternScan_ACYLTRANSF_C_2	p.P247L	ENST00000392518.4	37	c.740	CCDS12779.1	19	.	.	.	.	.	.	.	.	.	.	C	27.8	4.866061	0.91511	.	.	ENSG00000169169	ENST00000392518;ENST00000354199;ENST00000405931;ENST00000323446;ENST00000295404	D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57	4.14	4.14	0.48551	.	0.595761	0.14014	N	0.347272	D	0.96984	0.9015	M	0.78344	2.41	0.58432	D	0.999999	D;D;D;P	0.76494	0.999;0.986;0.992;0.929	D;B;P;D	0.71184	0.972;0.387;0.852;0.909	D	0.97066	0.9774	10	0.87932	D	0	-5.0805	15.5481	0.76123	0.0:1.0:0.0:0.0	.	85;247;247;247	C9IY45;Q8TCG5-3;Q8TCG5-2;Q8TCG5	.;.;.;CPT1C_HUMAN	L	247;247;247;247;85	ENSP00000376303:P247L;ENSP00000346138:P247L;ENSP00000384465:P247L;ENSP00000319343:P247L	ENSP00000295404:P85L	P	+	2	0	CPT1C	54899825	0.986000	0.35501	0.604000	0.28916	0.979000	0.70002	7.115000	0.77110	2.025000	0.59659	0.561000	0.74099	CCG	-	superfamily_CoA-dependent acyltransferases,HMMPfam_Carn_acyltransf		0.602	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1C	protein_coding	OTTHUMT00000465873.1	C	NM_152359		54899825	+1	no_errors	NM_152359	genbank	human	provisional	54_36p	missense	SNP	0.971	T
RTN4RL2	349667	genome.wustl.edu	37	11	57235182	57235182	+	Silent	SNP	G	G	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr11:57235182G>T	ENST00000533205.1	+	2	141	c.132G>T	c.(130-132)gtG>gtT	p.V44V	RTN4RL2_ENST00000395120.2_Silent_p.V44V|RTN4RL2_ENST00000335099.3_Silent_p.V44V					reticulon 4 receptor-like 2											NS(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CGCCCACCGTGAGCTGCCAGG	0.682																																																0			11											114.0	104.0	108.0					11																	57235182		2201	4296	6497	56991758	SO:0001819	synonymous_variant	349667			BK001302	CCDS7957.1	11q12.1	2008-02-05			ENSG00000186907	ENSG00000186907			23053	protein-coding gene	gene with protein product		610462					Standard	NM_178570		Approved	NgR2, NGRH1	uc010rjt.2	Q86UN3	OTTHUMG00000167028	ENST00000533205.1:c.132G>T	11.37:g.57235182G>T		Somatic		Capture	Illumina GAIIx	4	56991758		Silent	SNP	superfamily_SSF52058,HMMSmart_LRRNT,HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMSmart_LRRCT	p.V44	ENST00000533205.1	37	c.132		11																																																																																			-	superfamily_SSF52058,HMMSmart_LRRNT		0.682	RTN4RL2-003	PUTATIVE	basic|exp_conf	protein_coding	RTN4RL2	protein_coding	OTTHUMT00000392538.1	G	NM_178570		56991758	+1	no_errors	NM_178570	genbank	human	provisional	54_36p	silent	SNP	0.996	T
DDB1	1642	genome.wustl.edu	37	11	61083826	61083826	+	Silent	SNP	T	T	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr11:61083826T>C	ENST00000301764.7	-	12	1738	c.1341A>G	c.(1339-1341)gaA>gaG	p.E447E	DDB1_ENST00000545930.1_5'UTR|DDB1_ENST00000450997.2_Intron	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	447	Interaction with CDT1.|WD repeat beta-propeller B; Interaction with CUL4A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						AACCCATCAGTTCGGTTTCTT	0.517								Nucleotide excision repair (NER)																																								0			11											201.0	184.0	189.0					11																	61083826		2203	4299	6502	60840402	SO:0001819	synonymous_variant	1642			AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.1341A>G	11.37:g.61083826T>C		Somatic		Capture	Illumina GAIIx	4	60840402	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Silent	SNP	HMMPfam_CPSF_A	p.E447	ENST00000301764.7	37	c.1341	CCDS31576.1	11																																																																																			-	NULL		0.517	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DDB1	protein_coding	OTTHUMT00000398816.1	T	NM_001923		60840402	-1	no_errors	NM_001923	genbank	human	validated	54_36p	silent	SNP	0.995	C
PLEKHG3	26030	genome.wustl.edu	37	14	65199547	65199547	+	Nonsense_Mutation	SNP	G	G	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr14:65199547G>T	ENST00000394691.1	+	12	1420	c.1273G>T	c.(1273-1275)Gag>Tag	p.E425*	PLEKHG3_ENST00000247226.7_Nonsense_Mutation_p.E369*			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	425							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CTGCAGCCCAGAGCGGCTGAA	0.592																																																0			14											40.0	32.0	34.0					14																	65199547		2203	4299	6502	64269300	SO:0001587	stop_gained	26030			AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.1273G>T	14.37:g.65199547G>T	ENSP00000378183:p.Glu425*	Somatic		Capture	Illumina GAIIx	4	64269300	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Nonsense_Mutation	SNP	superfamily_DH-domain,HMMPfam_RhoGEF,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.E369*	ENST00000394691.1	37	c.1105		14	.	.	.	.	.	.	.	.	.	.	G	42	9.384410	0.99155	.	.	ENSG00000126822	ENST00000247226;ENST00000394691	.	.	.	5.62	5.62	0.85841	.	0.136151	0.47093	D	0.000258	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	18.413	0.90558	0.0:0.0:1.0:0.0	.	.	.	.	X	369;425	.	ENSP00000247226:E369X	E	+	1	0	PLEKHG3	64269300	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.742000	0.91588	2.651000	0.90000	0.561000	0.74099	GAG	-	NULL		0.592	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	PLEKHG3	protein_coding	OTTHUMT00000412028.1	G	NM_015549		64269300	+1	no_errors	NM_015549	genbank	human	validated	54_36p	nonsense	SNP	1.000	T
CATSPER1	117144	genome.wustl.edu	37	11	65793220	65793220	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr11:65793220G>C	ENST00000312106.5	-	1	768	c.631C>G	c.(631-633)Caa>Gaa	p.Q211E		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	211	His-rich.				calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						TGGGGGACTTGGTGATGCTGG	0.607																																																0			11											90.0	78.0	82.0					11																	65793220		2201	4296	6497	65549796	SO:0001583	missense	117144			AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.631C>G	11.37:g.65793220G>C	ENSP00000309052:p.Gln211Glu	Somatic		Capture	Illumina GAIIx	4	65549796	Q96P76	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans	p.Q211E	ENST00000312106.5	37	c.631	CCDS8127.1	11	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.055005	0.00390	.	.	ENSG00000175294	ENST00000312106	D	0.96459	-4.02	2.86	-5.72	0.02406	.	.	.	.	.	D	0.89086	0.6615	L	0.31420	0.93	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.76895	-0.2790	9	0.30854	T	0.27	0.0013	1.3974	0.02264	0.2298:0.3712:0.1236:0.2755	.	211	Q8NEC5	CTSR1_HUMAN	E	211	ENSP00000309052:Q211E	ENSP00000309052:Q211E	Q	-	1	0	CATSPER1	65549796	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.445000	0.01011	-1.865000	0.01147	-0.373000	0.07131	CAA	-	superfamily_Voltage-gated potassium channels		0.607	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER1	protein_coding	OTTHUMT00000391055.1	G	NM_053054		65549796	-1	no_errors	NM_053054	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
DBF4P1	645084	genome.wustl.edu	37	10	65930033	65930033	+	IGR	SNP	G	G	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr10:65930033G>T								RP11-174J11.1 (132993 upstream) : RP11-179K3.2 (730860 downstream)																							TCTTACTGAAGTACTTGATTT	0.363																																																0			10																																								65600039	SO:0001628	intergenic_variant	0																															10.37:g.65930033G>T		Somatic		Capture	Illumina GAIIx	4	65600039		RNA	SNP	-	NULL		37	NULL		10																																																																																			-	-	0	0.363					LOC100129267			G			65600039	-1	pseudogene	XR_037245	genbank	human	model	54_36p	rna	SNP	0.053	T
SIPA1L1	26037	genome.wustl.edu	37	14	72205868	72205868	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr14:72205868A>T	ENST00000555818.1	+	22	5753	c.5405A>T	c.(5404-5406)gAc>gTc	p.D1802V	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.D1781V|SIPA1L1_ENST00000554874.1_3'UTR|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.D1255V|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.D1780V	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1802					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		AACACCATAGACATGAGCTAG	0.557																																																0			14											78.0	76.0	77.0					14																	72205868		2203	4300	6503	71275621	SO:0001583	missense	26037			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.5405A>T	14.37:g.72205868A>T	ENSP00000450832:p.Asp1802Val	Somatic		Capture	Illumina GAIIx	4	71275621	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	superfamily_Rap/Ran-GAP (Pfam 02145),HMMPfam_Rap_GAP,superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228	p.D1802V	ENST00000555818.1	37	c.5405	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	A	27.2	4.806998	0.90623	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	D;D;D;D	0.91945	-2.06;-2.13;-2.06;-2.94	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.95072	0.8404	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;0.998	D;D;D;D;D	0.91635	0.999;0.994;0.98;0.999;0.994	D	0.95553	0.8622	10	0.87932	D	0	-31.0419	15.9374	0.79723	1.0:0.0:0.0:0.0	.	1255;1801;1255;1781;1802	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	V	1781;1802;1780;1255	ENSP00000370630:D1781V;ENSP00000450832:D1802V;ENSP00000351352:D1780V;ENSP00000440682:D1255V	ENSP00000351352:D1802V	D	+	2	0	SIPA1L1	71275621	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.277000	0.95755	2.228000	0.72767	0.533000	0.62120	GAC	-	NULL		0.557	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	protein_coding	OTTHUMT00000412806.1	A	NM_015556		71275621	+1	no_errors	NM_015556	genbank	human	provisional	54_36p	missense	SNP	1.000	T
UBE2O	63893	genome.wustl.edu	37	17	74396252	74396252	+	Missense_Mutation	SNP	C	C	A	rs200685368		TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr17:74396252C>A	ENST00000319380.7	-	8	1195	c.1131G>T	c.(1129-1131)caG>caT	p.Q377H	UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	377					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						AGCCCTCCCCCTGGGCGCAGT	0.562																																																0			17											67.0	64.0	65.0					17																	74396252		2203	4300	6503	71907847	SO:0001583	missense	63893			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.1131G>T	17.37:g.74396252C>A	ENSP00000323687:p.Gln377His	Somatic		Capture	Illumina GAIIx	4	71907847	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	PatternScan_UBIQUITIN_CONJUGAT_1,superfamily_UBQ-conjugat/RWD-like,HMMSmart_UBCc,HMMPfam_UQ_con	p.Q377H	ENST00000319380.7	37	c.1131	CCDS32742.1	17	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225008	0.39300	.	.	ENSG00000175931	ENST00000319380	T	0.72942	-0.7	4.74	4.74	0.60224	.	0.089830	0.46758	D	0.000278	T	0.50240	0.1604	N	0.08118	0	0.30964	N	0.723328	B	0.06786	0.001	B	0.04013	0.001	T	0.54268	-0.8319	10	0.45353	T	0.12	-14.1022	12.2264	0.54463	0.0:0.9178:0.0:0.0822	.	377	Q9C0C9	UBE2O_HUMAN	H	377	ENSP00000323687:Q377H	ENSP00000323687:Q377H	Q	-	3	2	UBE2O	71907847	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.730000	0.38125	2.196000	0.70406	0.561000	0.74099	CAG	-	NULL		0.562	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2O	protein_coding	OTTHUMT00000450123.1	C	NM_022066		71907847	-1	no_errors	NM_022066	genbank	human	validated	54_36p	missense	SNP	1.000	A
RBM25	58517	genome.wustl.edu	37	14	73569920	73569920	+	Silent	SNP	C	C	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr14:73569920C>G	ENST00000261973.7	+	10	1173	c.888C>G	c.(886-888)ggC>ggG	p.G296G	RBM25_ENST00000527432.1_Silent_p.G296G	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	296	Glu-rich.|Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		aagagaaaggcaaaaaggaaa	0.438																																																0			14											47.0	47.0	47.0					14																	73569920		2203	4300	6503	72639673	SO:0001819	synonymous_variant	58517			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.888C>G	14.37:g.73569920C>G		Somatic		Capture	Illumina GAIIx	4	72639673	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Silent	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1,superfamily_PWI domain,HMMSmart_SM00311,HMMPfam_PWI	p.G296	ENST00000261973.7	37	c.888	CCDS32113.1	14																																																																																			-	superfamily_RNA-binding domain RBD		0.438	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM25	protein_coding	OTTHUMT00000394966.1	C	XM_027330		72639673	+1	no_errors	NM_021239	genbank	human	validated	54_36p	silent	SNP	1.000	G
MESDC2	23184	genome.wustl.edu	37	15	81274487	81274487	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr15:81274487G>A	ENST00000261758.4	-	2	336	c.250C>T	c.(250-252)Cac>Tac	p.H84Y		NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	84	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						GGTCTCTTGTGCTCTGGAAGA	0.418																																																0			15											187.0	165.0	172.0					15																	81274487		2203	4300	6503	79061542	SO:0001583	missense	23184			D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.250C>T	15.37:g.81274487G>A	ENSP00000261758:p.His84Tyr	Somatic		Capture	Illumina GAIIx	4	79061542	B4DW84|D3DW96|Q969U1	Missense_Mutation	SNP	HMMPfam_Mesd	p.H84Y	ENST00000261758.4	37	c.250	CCDS32308.1	15	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497910	0.64186	.	.	ENSG00000117899	ENST00000261758	.	.	.	5.19	5.19	0.71726	.	0.048575	0.85682	D	0.000000	T	0.78155	0.4239	M	0.69823	2.125	0.80722	D	1	P	0.49635	0.926	D	0.63283	0.913	T	0.80365	-0.1413	9	0.72032	D	0.01	-15.5508	18.7296	0.91730	0.0:0.0:1.0:0.0	.	84	Q14696	MESD_HUMAN	Y	84	.	ENSP00000261758:H84Y	H	-	1	0	MESDC2	79061542	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	9.389000	0.97243	2.416000	0.81992	0.555000	0.69702	CAC	-	HMMPfam_Mesd		0.418	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MESDC2	protein_coding	OTTHUMT00000417673.2	G	NM_015154		79061542	-1	no_errors	NM_015154	genbank	human	validated	54_36p	missense	SNP	1.000	A
BCO1	53630	genome.wustl.edu	37	16	81320920	81320920	+	Silent	SNP	C	C	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr16:81320920C>G	ENST00000258168.2	+	10	1784	c.1323C>G	c.(1321-1323)ctC>ctG	p.L441L	BCMO1_ENST00000425577.2_Silent_p.L372L	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						ATGACATTCTCACAAAGTCAT	0.443																																																0			16											87.0	89.0	89.0					16																	81320920		2202	4300	6502	79878421	SO:0001819	synonymous_variant	53630																														ENST00000258168.2:c.1323C>G	16.37:g.81320920C>G		Somatic		Capture	Illumina GAIIx	4	79878421		Silent	SNP	HMMPfam_RPE65	p.L441	ENST00000258168.2	37	c.1323	CCDS10934.1	16																																																																																			-	HMMPfam_RPE65		0.443	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCMO1	protein_coding	OTTHUMT00000269056.1	C			79878421	+1	no_errors	NM_017429	genbank	human	reviewed	54_36p	silent	SNP	0.725	G
FLRT2	23768	genome.wustl.edu	37	14	86088906	86088906	+	Missense_Mutation	SNP	G	G	A	rs138508218	byFrequency	TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr14:86088906G>A	ENST00000330753.4	+	2	1815	c.1048G>A	c.(1048-1050)Gtc>Atc	p.V350I	FLRT2_ENST00000554746.1_Missense_Mutation_p.V350I	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	350	LRRCT.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GGGGATGGCCGTCAGGGAATT	0.532													G|||	4	0.000798722	0.0	0.0029	5008	,	,		15848	0.0		0.002	False		,,,				2504	0.0															0			14						G	ILE/VAL	2,4404	2.1+/-5.4	0,2,2201	99.0	110.0	107.0		1048	6.1	1.0	14	dbSNP_134	107	6,8594	5.0+/-18.6	0,6,4294	yes	missense	FLRT2	NM_013231.4	29	0,8,6495	AA,AG,GG		0.0698,0.0454,0.0615	benign	350/661	86088906	8,12998	2203	4300	6503	85158659	SO:0001583	missense	23768			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1048G>A	14.37:g.86088906G>A	ENSP00000332879:p.Val350Ile	Somatic		Capture	Illumina GAIIx	4	85158659	A0AV84|B7ZLP3	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRRNT,HMMSmart_LRRNT,HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMSmart_LRRCT,HMMPfam_LRRCT,HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like	p.V350I	ENST00000330753.4	37	c.1048	CCDS9877.1	14	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	3.646	-0.072460	0.07228	4.54E-4	6.98E-4	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.02446	4.29;4.29	6.07	6.07	0.98685	Cysteine-rich flanking region, C-terminal (1);	0.056273	0.64402	D	0.000001	T	0.01730	0.0055	N	0.02721	-0.515	0.47123	D	0.999324	B	0.20459	0.045	B	0.09377	0.004	T	0.48811	-0.9002	10	0.02654	T	1	-22.7057	20.6439	0.99570	0.0:0.0:1.0:0.0	.	350	O43155	FLRT2_HUMAN	I	350;350;3	ENSP00000332879:V350I;ENSP00000451050:V350I	ENSP00000332879:V350I	V	+	1	0	FLRT2	85158659	1.000000	0.71417	0.989000	0.46669	0.989000	0.77384	6.135000	0.71696	2.884000	0.98904	0.655000	0.94253	GTC	-	superfamily_SSF52058,HMMSmart_LRRCT,HMMPfam_LRRCT		0.532	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	protein_coding	OTTHUMT00000413193.1	G			85158659	+1	no_errors	NM_013231	genbank	human	reviewed	54_36p	missense	SNP	0.997	A
PDP1	54704	genome.wustl.edu	37	8	94934717	94934717	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr8:94934717G>C	ENST00000297598.4	+	2	699	c.430G>C	c.(430-432)Gat>Cat	p.D144H	PDP1_ENST00000520728.1_Missense_Mutation_p.D144H|PDP1_ENST00000517764.1_Missense_Mutation_p.D144H|PDP1_ENST00000396200.3_Missense_Mutation_p.D169H	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	144					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						GGGGGTTTTTGATGGCCATGC	0.478																																																0			8											58.0	60.0	60.0					8																	94934717		2203	4300	6503	95003893	SO:0001583	missense	54704			AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.430G>C	8.37:g.94934717G>C	ENSP00000297598:p.Asp144His	Somatic		Capture	Illumina GAIIx	4	95003893	B3KX71|J3KPU0|Q5U5K1	Missense_Mutation	SNP	superfamily_Protein serine/threonine phosphatase 2C catalytic domain,HMMSmart_SM00332,PatternScan_PP2C,HMMPfam_PP2C	p.D144H	ENST00000297598.4	37	c.430	CCDS6259.1	8	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829268	0.71258	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000517764;ENST00000518827;ENST00000521144	T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43	6.03	6.03	0.97812	Protein phosphatase 2C-like (3);	0.046017	0.85682	D	0.000000	T	0.79851	0.4517	M	0.90198	3.095	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82380	-0.0486	10	0.87932	D	0	-19.2034	20.5752	0.99366	0.0:0.0:1.0:0.0	.	195;144	B4DYX8;Q9P0J1	.;PDP1_HUMAN	H	144;144;169;144;144;144	ENSP00000297598:D144H;ENSP00000428317:D144H;ENSP00000379503:D169H;ENSP00000430380:D144H;ENSP00000430655:D144H	ENSP00000297598:D144H	D	+	1	0	PDP1	95003893	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	9.835000	0.99442	2.868000	0.98415	0.557000	0.71058	GAT	-	superfamily_Protein serine/threonine phosphatase 2C catalytic domain,HMMSmart_SM00332,PatternScan_PP2C		0.478	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PPM2C	protein_coding	OTTHUMT00000378415.2	G	NM_018444		95003893	+1	no_errors	NM_018444	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	9	98981369	98981369	+	IGR	SNP	T	T	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr9:98981369T>C								Y_RNA (115913 upstream) : HSD17B3 (16218 downstream)																							CCACCCCCACTCCCGCGCTCC	0.721																																																0			9																																								98021190	SO:0001628	intergenic_variant	650656																															9.37:g.98981369T>C		Somatic		Capture	Illumina GAIIx	4	98021190		Missense_Mutation	SNP	NULL	p.L32P		37	c.95		9																																																																																			-	NULL	0	0.721					LOC650656			T			98021190	+1	no_errors	XM_001717913	genbank	human	model	54_36p	missense	SNP	0.014	C
CTHRC1	115908	genome.wustl.edu	37	8	104384003	104384003	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr8:104384003C>G	ENST00000330295.5	+	1	261	c.119C>G	c.(118-120)gCg>gGg	p.A40G	CTHRC1_ENST00000520337.1_5'Flank|CTHRC1_ENST00000415886.2_Missense_Mutation_p.A40G	NM_138455.3	NP_612464.1	Q96CG8	CTHR1_HUMAN	collagen triple helix repeat containing 1	40					cell migration (GO:0016477)|cochlea morphogenesis (GO:0090103)|establishment of planar polarity involved in neural tube closure (GO:0090177)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|ossification involved in bone remodeling (GO:0043932)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein binding (GO:0032092)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				endometrium(1)|large_intestine(5)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)			AAGCAAAAGGCGCAGCTCCGG	0.756																																																0			8											6.0	6.0	6.0					8																	104384003		1931	3819	5750	104453179	SO:0001583	missense	115908			BC014245	CCDS6299.1, CCDS59110.1	8q22.3	2008-08-07			ENSG00000164932	ENSG00000164932			18831	protein-coding gene	gene with protein product		610635				15618538	Standard	NM_138455		Approved		uc003ylk.4	Q96CG8	OTTHUMG00000164887	ENST00000330295.5:c.119C>G	8.37:g.104384003C>G	ENSP00000330523:p.Ala40Gly	Somatic		Capture	Illumina GAIIx	4	104453179	G3V141|Q6UW91|Q8IX63	Missense_Mutation	SNP	HMMPfam_Collagen	p.A40G	ENST00000330295.5	37	c.119	CCDS6299.1	8	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977022	0.53720	.	.	ENSG00000164932	ENST00000330295;ENST00000415886	T;T	0.74526	-0.12;-0.85	4.75	4.75	0.60458	.	0.327017	0.27720	N	0.018124	T	0.59972	0.2233	N	0.19112	0.55	0.80722	D	1	B;B	0.34329	0.449;0.197	B;B	0.31869	0.137;0.042	T	0.61312	-0.7088	10	0.33940	T	0.23	-5.9573	14.9211	0.70838	0.0:1.0:0.0:0.0	.	40;40	E7EVQ5;Q96CG8	.;CTHR1_HUMAN	G	40	ENSP00000330523:A40G;ENSP00000416045:A40G	ENSP00000330523:A40G	A	+	2	0	CTHRC1	104453179	0.911000	0.30947	0.995000	0.50966	0.972000	0.66771	1.781000	0.38644	2.172000	0.68678	0.555000	0.69702	GCG	-	NULL		0.756	CTHRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTHRC1	protein_coding	OTTHUMT00000380792.1	C	NM_138455		104453179	+1	no_errors	NM_138455	genbank	human	provisional	54_36p	missense	SNP	0.882	G
CNNM2	54805	genome.wustl.edu	37	10	104679500	104679500	+	Silent	SNP	C	C	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr10:104679500C>T	ENST00000369878.4	+	1	1451	c.1263C>T	c.(1261-1263)acC>acT	p.T421T	CNNM2_ENST00000369875.3_Silent_p.T421T|CNNM2_ENST00000433628.2_Silent_p.T421T	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	421	DUF21.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TCCGGGTCACCGATCCCTACA	0.612																																																0			10											80.0	79.0	79.0					10																	104679500		2203	4300	6503	104669490	SO:0001819	synonymous_variant	54805			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1263C>T	10.37:g.104679500C>T		Somatic		Capture	Illumina GAIIx	4	104669490	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Silent	SNP	HMMPfam_DUF21,HMMPfam_CBS	p.T421	ENST00000369878.4	37	c.1263	CCDS44474.1	10																																																																																			-	HMMPfam_DUF21		0.612	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	protein_coding	OTTHUMT00000050113.3	C	NM_017649		104669490	+1	no_errors	NM_017649	genbank	human	validated	54_36p	silent	SNP	0.996	T
PIH1D3	139212	genome.wustl.edu	37	X	106466001	106466001	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chrX:106466001T>C	ENST00000372453.3	+	5	421	c.359T>C	c.(358-360)gTg>gCg	p.V120A	PIH1D3_ENST00000535523.1_Missense_Mutation_p.V120A|PIH1D3_ENST00000336387.4_Missense_Mutation_p.V120A	NM_173494.1	NP_775765.1	Q9NQM4	PIHD3_HUMAN	PIH1 domain containing 3	120																	AGACAGCAGGTGGGAACTGAA	0.378																																																0			X											132.0	129.0	130.0					X																	106466001		2203	4300	6503	106352657	SO:0001583	missense	139212			AL136112	CCDS14528.1	Xq22.3	2014-05-20	2012-07-18	2012-07-18	ENSG00000080572	ENSG00000080572			28570	protein-coding gene	gene with protein product	"""sarcoma antigen NY-SAR-97"""		"""chromosome X open reading frame 41"""	CXorf41		12601173, 24421334	Standard	NM_001169154		Approved	MGC35261, NYSAR97	uc004enc.3	Q9NQM4	OTTHUMG00000022160	ENST00000372453.3:c.359T>C	X.37:g.106466001T>C	ENSP00000361531:p.Val120Ala	Somatic		Capture	Illumina GAIIx	4	106352657	D3DUX5|Q86WE1	Missense_Mutation	SNP	NULL	p.V120A	ENST00000372453.3	37	c.359	CCDS14528.1	X	.	.	.	.	.	.	.	.	.	.	T	14.98	2.696216	0.48202	.	.	ENSG00000080572	ENST00000372453;ENST00000535523;ENST00000336387	T;T;T	0.20738	2.05;2.05;2.05	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.50034	0.1592	M	0.87269	2.87	0.53688	D	0.99997	D	0.89917	1.0	D	0.79784	0.993	T	0.57929	-0.7726	10	0.87932	D	0	0.0403	11.742	0.51799	0.0:0.0:0.0:1.0	.	120	Q9NQM4	CX041_HUMAN	A	120	ENSP00000361531:V120A;ENSP00000441930:V120A;ENSP00000337757:V120A	ENSP00000337757:V120A	V	+	2	0	CXorf41	106352657	1.000000	0.71417	0.975000	0.42487	0.209000	0.24338	4.640000	0.61368	1.674000	0.50907	0.486000	0.48141	GTG	-	NULL		0.378	PIH1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf41	protein_coding	OTTHUMT00000057832.1	T	NM_173494		106352657	+1	no_errors	NM_173494	genbank	human	predicted	54_36p	missense	SNP	1.000	C
RP11-196I18.4	0	genome.wustl.edu	37	9	109879045	109879045	+	lincRNA	SNP	C	C	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr9:109879045C>G	ENST00000427833.1	-	0	658																											TGCCTCATCCCAGGCTGAGCA	0.502																																																0			9																																								108918866			0																															9.37:g.109879045C>G		Somatic		Capture	Illumina GAIIx	4	108918866		RNA	SNP	-	NULL	ENST00000427833.1	37	NULL		9																																																																																			-	-		0.502	RP11-196I18.4-001	KNOWN	basic	lincRNA	LOC100128086	lincRNA	OTTHUMT00000053544.1	C			108918866	+1	pseudogene	XR_039419	genbank	human	model	54_36p	rna	SNP	0.005	G
CDC40	51362	genome.wustl.edu	37	6	110501769	110501769	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr6:110501769C>A	ENST00000368932.1	+	2	223	c.122C>A	c.(121-123)aCt>aAt	p.T41N	WASF1_ENST00000392586.1_5'Flank|WASF1_ENST00000392587.2_5'Flank|WASF1_ENST00000392589.1_5'Flank|CDC40_ENST00000307731.1_Missense_Mutation_p.T41N|WASF1_ENST00000359451.2_5'Flank|CDC40_ENST00000368930.1_Missense_Mutation_p.T41N|WASF1_ENST00000392588.1_5'Flank			O60508	PRP17_HUMAN	cell division cycle 40	41					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		ATGCACTTGACTAAATCGCCT	0.572																																																0			6											51.0	52.0	52.0					6																	110501769		2203	4300	6503	110608462	SO:0001583	missense	51362			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.122C>A	6.37:g.110501769C>A	ENSP00000357928:p.Thr41Asn	Somatic		Capture	Illumina GAIIx	4	110608462	B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.T41N	ENST00000368932.1	37	c.122	CCDS5081.1	6	.	.	.	.	.	.	.	.	.	.	C	13.53	2.264857	0.40095	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731;ENST00000439165	T;T;T;T	0.60548	0.31;0.18;0.18;0.31	5.54	5.54	0.83059	.	0.152878	0.56097	D	0.000027	T	0.24005	0.0581	N	0.12746	0.255	0.38202	D	0.940229	B	0.02656	0.0	B	0.01281	0.0	T	0.06954	-1.0798	10	0.16896	T	0.51	-23.3123	16.5155	0.84299	0.0:1.0:0.0:0.0	.	41	O60508	PRP17_HUMAN	N	41	ENSP00000357928:T41N;ENSP00000357929:T41N;ENSP00000357926:T41N;ENSP00000304370:T41N	ENSP00000304370:T41N	T	+	2	0	CDC40	110608462	0.997000	0.39634	0.991000	0.47740	0.878000	0.50629	3.765000	0.55272	2.884000	0.98904	0.655000	0.94253	ACT	-	NULL		0.572	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC40	protein_coding	OTTHUMT00000041791.1	C	NM_015891		110608462	+1	no_errors	NM_015891	genbank	human	reviewed	54_36p	missense	SNP	0.988	A
ATP11A	23250	genome.wustl.edu	37	13	113481088	113481088	+	Silent	SNP	C	C	A	rs144248225	byFrequency	TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr13:113481088C>A	ENST00000487903.1	+	12	1192	c.1104C>A	c.(1102-1104)gtC>gtA	p.V368V	ATP11A_ENST00000375630.2_Silent_p.V368V|ATP11A_ENST00000375645.3_Silent_p.V368V|ATP11A_ENST00000283558.8_Silent_p.V368V			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	368					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				ACGTCACGGTCGAGATGCAGA	0.542																																																0			13											142.0	123.0	129.0					13																	113481088		2203	4300	6503	112529089	SO:0001819	synonymous_variant	23250			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.1104C>A	13.37:g.113481088C>A		Somatic		Capture	Illumina GAIIx	4	112529089	Q5VXT2	Silent	SNP	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,superfamily_HAD-like,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N	p.V368	ENST00000487903.1	37	c.1104	CCDS32011.1	13	.	.	.	.	.	.	.	.	.	.	C	2.514	-0.312295	0.05422	.	.	ENSG00000068650	ENST00000418678	.	.	.	5.37	-3.46	0.04767	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.6871	0.12762	0.1916:0.379:0.3387:0.0907	.	.	.	.	X	343	.	.	S	+	2	0	ATP11A	112529089	0.988000	0.35896	0.674000	0.29902	0.147000	0.21601	0.128000	0.15810	-0.335000	0.08451	-0.321000	0.08615	TCG	-	superfamily_Calcium ATPase transmembrane domain M		0.542	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	protein_coding	OTTHUMT00000045834.3	C	NM_015205		112529089	+1	no_errors	NM_032189	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
ZPR1	8882	genome.wustl.edu	37	11	116655120	116655120	+	Nonsense_Mutation	SNP	C	C	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr11:116655120C>A	ENST00000227322.3	-	9	924	c.865G>T	c.(865-867)Gag>Tag	p.E289*		NM_003904.3	NP_003895.1	O75312	ZPR1_HUMAN		289					apoptotic process involved in development (GO:1902742)|axon development (GO:0061564)|Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA endoreduplication (GO:0042023)|inner cell mass cell proliferation (GO:0001833)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of motor neuron apoptotic process (GO:2000672)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of RNA splicing (GO:0033120)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|pre-mRNA catabolic process (GO:1990261)|regulation of myelination (GO:0031641)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|trophectodermal cell proliferation (GO:0001834)	axon (GO:0030424)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|SMN complex (GO:0032797)	translation initiation factor binding (GO:0031369)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		CCACAGTTCTCGCAGTTGGTA	0.473																																																0			11											128.0	113.0	118.0					11																	116655120		2201	4296	6497	116160330	SO:0001587	stop_gained	8882																														ENST00000227322.3:c.865G>T	11.37:g.116655120C>A	ENSP00000227322:p.Glu289*	Somatic		Capture	Illumina GAIIx	4	116160330	Q2TAA0	Nonsense_Mutation	SNP	HMMPfam_zf-ZPR1,HMMSmart_Zpr1	p.E289*	ENST00000227322.3	37	c.865	CCDS8375.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.024299|6.024299	0.97211|0.97211	.|.	.|.	ENSG00000109917|ENSG00000109917	ENST00000227322|ENST00000429220	.|.	.|.	.|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.089131|.	0.85682|.	D|.	0.000000|.	.|T	.|0.80369	.|0.4610	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77856	.|-0.2432	.|3	0.59425|.	D|.	0.04|.	-18.8889|-18.8889	20.3081|20.3081	0.98638|0.98638	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	289|215	.|.	ENSP00000227322:E289X|.	E|R	-|-	1|2	0|0	ZNF259|ZNF259	116160330|116160330	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.731000|0.731000	0.41821|0.41821	7.398000|7.398000	0.79919|0.79919	2.795000|2.795000	0.96236|0.96236	0.655000|0.655000	0.94253|0.94253	GAG|CGA	-	HMMPfam_zf-ZPR1,HMMSmart_Zpr1		0.473	ZNF259-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF259	protein_coding	OTTHUMT00000106283.2	C			116160330	-1	no_errors	NM_003904	genbank	human	provisional	54_36p	nonsense	SNP	1.000	A
DSCAML1	57453	genome.wustl.edu	37	11	117302344	117302344	+	Silent	SNP	G	G	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr11:117302344G>T	ENST00000321322.6	-	31	5461	c.5460C>A	c.(5458-5460)cgC>cgA	p.R1820R	DSCAML1_ENST00000527706.1_Silent_p.R1550R	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1760					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AGGTGAGGGTGCGGGCAGGTG	0.627																																																0			11											136.0	131.0	133.0					11																	117302344		2201	4296	6497	116807554	SO:0001819	synonymous_variant	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.5460C>A	11.37:g.117302344G>T		Somatic		Capture	Illumina GAIIx	4	116807554	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_I-set,HMMSmart_SM00406,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.R1820	ENST00000321322.6	37	c.5460	CCDS8384.1	11																																																																																			-	NULL		0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	protein_coding	OTTHUMT00000392907.2	G	NM_020693		116807554	-1	no_errors	NM_020693	genbank	human	provisional	54_36p	silent	SNP	0.986	T
SLC25A43	203427	genome.wustl.edu	37	X	118544163	118544163	+	Silent	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chrX:118544163G>A	ENST00000217909.7	+	3	872	c.528G>A	c.(526-528)ccG>ccA	p.P176P	SLC25A43_ENST00000488158.1_3'UTR|SLC25A43_ENST00000336249.7_Intron	NM_145305.2	NP_660348.2	Q8WUT9	S2543_HUMAN	solute carrier family 25, member 43	176					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	9						GTGCTCTCCCGTTCTCTGCTG	0.507																																																0			X											149.0	132.0	138.0					X																	118544163		2203	4300	6503	118428191	SO:0001819	synonymous_variant	203427			BC019584	CCDS14577.1	Xq24	2013-05-22			ENSG00000077713	ENSG00000077713		"""Solute carriers"""	30557	protein-coding gene	gene with protein product		300641				16949250	Standard	NM_145305		Approved		uc004erd.3	Q8WUT9	OTTHUMG00000022272	ENST00000217909.7:c.528G>A	X.37:g.118544163G>A		Somatic		Capture	Illumina GAIIx	4	118428191	O75854|Q8N9L5	Silent	SNP	superfamily_Mitochondrial carrier,HMMPfam_Mito_carr	p.P176	ENST00000217909.7	37	c.528	CCDS14577.1	X																																																																																			-	superfamily_Mitochondrial carrier,HMMPfam_Mito_carr		0.507	SLC25A43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A43	protein_coding	OTTHUMT00000058028.1	G	NM_145305		118428191	+1	no_errors	NM_145305	genbank	human	provisional	54_36p	silent	SNP	0.860	A
HIP1R	9026	genome.wustl.edu	37	12	123344702	123344702	+	Missense_Mutation	SNP	G	G	A	rs368260275	byFrequency	TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr12:123344702G>A	ENST00000253083.4	+	26	2629	c.2504G>A	c.(2503-2505)cGg>cAg	p.R835Q		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	835	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		CAGGCTATCCGGCTCCTGGTG	0.647											OREG0022225	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	2	0.000399361	0.0	0.0	5008	,	,		16548	0.002		0.0	False		,,,				2504	0.0															0			12						G	GLN/ARG	2,4378		0,2,2188	21.0	18.0	19.0		2504	5.3	1.0	12		19	0,8584		0,0,4292	no	missense	HIP1R	NM_003959.1	43	0,2,6480	AA,AG,GG		0.0,0.0457,0.0154	probably-damaging	835/1069	123344702	2,12962	2190	4292	6482	121910655	SO:0001583	missense	9026			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.2504G>A	12.37:g.123344702G>A	ENSP00000253083:p.Arg835Gln	Somatic	1526	Capture	Illumina GAIIx	4	121910655	A6NHQ6|Q6NXG8|Q9UED9	Missense_Mutation	SNP	HMMPfam_ANTH,superfamily_ENTH_VHS,HMMSmart_ENTH,superfamily_SSF109885,HMMSmart_ILWEQ,HMMPfam_I_LWEQ	p.R835Q	ENST00000253083.4	37	c.2504	CCDS31922.1	12	.	.	.	.	.	.	.	.	.	.	G	17.43	3.386999	0.61956	4.57E-4	0.0	ENSG00000130787	ENST00000253083	T	0.29917	1.55	5.33	5.33	0.75918	I/LWEQ (4);	0.000000	0.85682	D	0.000000	T	0.18257	0.0438	N	0.17631	0.505	0.80722	D	1	P	0.45715	0.865	B	0.33121	0.158	T	0.06267	-1.0836	10	0.15952	T	0.53	-53.4231	18.63	0.91357	0.0:0.0:1.0:0.0	.	835	O75146	HIP1R_HUMAN	Q	835	ENSP00000253083:R835Q	ENSP00000253083:R835Q	R	+	2	0	HIP1R	121910655	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	5.084000	0.64462	2.486000	0.83907	0.655000	0.94253	CGG	-	superfamily_SSF109885,HMMSmart_ILWEQ,HMMPfam_I_LWEQ		0.647	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1R	protein_coding	OTTHUMT00000400935.1	G	NM_003959		121910655	+1	no_errors	NM_003959	genbank	human	validated	54_36p	missense	SNP	1.000	A
C11orf63	79864	genome.wustl.edu	37	11	122756665	122756665	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr11:122756665T>G	ENST00000531316.1	+	1	200	c.108T>G	c.(106-108)caT>caG	p.H36Q	C11orf63_ENST00000227349.2_Missense_Mutation_p.H36Q|C11orf63_ENST00000307257.6_Missense_Mutation_p.H36Q			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	36					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		AAGACTTACATCGGATTTCAA	0.428																																																0			11											95.0	99.0	98.0					11																	122756665		2202	4299	6501	122261875	SO:0001583	missense	79864			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.108T>G	11.37:g.122756665T>G	ENSP00000431669:p.His36Gln	Somatic		Capture	Illumina GAIIx	4	122261875	A8K6G0|Q96GB5|Q9H5D6	Missense_Mutation	SNP	NULL	p.H36Q	ENST00000531316.1	37	c.108	CCDS8438.1	11	.	.	.	.	.	.	.	.	.	.	T	11.88	1.771705	0.31320	.	.	ENSG00000109944	ENST00000307257;ENST00000227349;ENST00000531316	T;T	0.44083	0.93;0.93	5.91	-1.89	0.07689	.	0.750729	0.11931	N	0.515687	T	0.37544	0.1007	M	0.65975	2.015	0.09310	N	1	B;B	0.27700	0.186;0.186	B;B	0.30029	0.047;0.11	T	0.41734	-0.9492	10	0.72032	D	0.01	-4.7537	6.5902	0.22642	0.0:0.4207:0.1412:0.4382	.	36;36	Q6NUN7;Q6NUN7-2	CK063_HUMAN;.	Q	36	ENSP00000227349:H36Q;ENSP00000431669:H36Q	ENSP00000227349:H36Q	H	+	3	2	C11orf63	122261875	0.000000	0.05858	0.002000	0.10522	0.285000	0.27093	-0.772000	0.04694	-0.336000	0.08438	-0.316000	0.08728	CAT	-	NULL		0.428	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf63	protein_coding	OTTHUMT00000387511.1	T	NM_024806		122261875	+1	no_errors	NM_024806	genbank	human	validated	54_36p	missense	SNP	0.002	G
CASR	846	genome.wustl.edu	37	3	121980902	121980902	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr3:121980902G>C	ENST00000490131.1	+	4	1392	c.1020G>C	c.(1018-1020)agG>agC	p.R340S	CASR_ENST00000296154.5_Missense_Mutation_p.R340S|CASR_ENST00000498619.1_Missense_Mutation_p.R340S	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	340					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TCCATCCCAGGAAGTCTGTCC	0.517																																																0			3											57.0	56.0	56.0					3																	121980902		2203	4300	6503	123463592	SO:0001583	missense	846			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1020G>C	3.37:g.121980902G>C	ENSP00000418685:p.Arg340Ser	Somatic		Capture	Illumina GAIIx	4	123463592	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_G_PROTEIN_RECEP_F3_1,HMMPfam_NCD3G,PatternScan_G_PROTEIN_RECEP_F3_2,HMMPfam_7tm_3,PatternScan_G_PROTEIN_RECEP_F3_3	p.R340S	ENST00000490131.1	37	c.1020	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	G	2.536	-0.307448	0.05458	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.86230	-2.09;-2.09;-2.09	6.07	-2.99	0.05497	Extracellular ligand-binding receptor (1);	0.171984	0.64402	N	0.000010	T	0.51398	0.1672	N	0.00514	-1.41	0.35985	D	0.836297	B;B	0.16603	0.0;0.018	B;B	0.15870	0.005;0.014	T	0.56098	-0.8035	10	0.02654	T	1	.	6.5648	0.22505	0.4688:0.2216:0.3096:0.0	.	340;340	E7ENE0;P41180	.;CASR_HUMAN	S	340	ENSP00000418685:R340S;ENSP00000420194:R340S;ENSP00000296154:R340S	ENSP00000296154:R340S	R	+	3	2	CASR	123463592	0.998000	0.40836	0.953000	0.39169	0.997000	0.91878	0.446000	0.21694	-0.587000	0.05890	0.655000	0.94253	AGG	-	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor		0.517	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	protein_coding	OTTHUMT00000355761.1	G	NM_000388		123463592	+1	no_errors	NM_000388	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
PANX3	116337	genome.wustl.edu	37	11	124487278	124487278	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr11:124487278A>T	ENST00000284288.2	+	3	500	c.433A>T	c.(433-435)Agc>Tgc	p.S145C		NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	145					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		GTTCATCATCAGCGAACTGGA	0.562																																																0			11											93.0	77.0	82.0					11																	124487278		2201	4299	6500	123992488	SO:0001583	missense	116337			AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.433A>T	11.37:g.124487278A>T	ENSP00000284288:p.Ser145Cys	Somatic		Capture	Illumina GAIIx	4	123992488		Missense_Mutation	SNP	NULL	p.S145C	ENST00000284288.2	37	c.433	CCDS8447.1	11	.	.	.	.	.	.	.	.	.	.	A	24.8	4.570521	0.86542	.	.	ENSG00000154143	ENST00000284288	T	0.32272	1.46	4.92	4.92	0.64577	.	0.136022	0.64402	D	0.000005	T	0.34542	0.0901	L	0.36672	1.1	0.39371	D	0.966098	D	0.63880	0.993	P	0.57371	0.819	T	0.28964	-1.0027	10	0.66056	D	0.02	-4.9243	5.392	0.16249	0.7658:0.0:0.2342:0.0	.	145	Q96QZ0	PANX3_HUMAN	C	145	ENSP00000284288:S145C	ENSP00000284288:S145C	S	+	1	0	PANX3	123992488	1.000000	0.71417	0.994000	0.49952	0.971000	0.66376	7.088000	0.76901	1.840000	0.53500	0.374000	0.22700	AGC	-	NULL		0.562	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANX3	protein_coding	OTTHUMT00000387064.1	A			123992488	+1	no_errors	NM_052959	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ARHGAP32	9743	genome.wustl.edu	37	11	128839371	128839371	+	Nonsense_Mutation	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr11:128839371G>A	ENST00000310343.9	-	22	5694	c.5695C>T	c.(5695-5697)Cag>Tag	p.Q1899*	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Nonsense_Mutation_p.Q1550*|ARHGAP32_ENST00000527272.1_Nonsense_Mutation_p.Q1550*	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1899	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CCAGCTCCCTGGGGATAAGGG	0.532																																																0			11											80.0	79.0	79.0					11																	128839371		2201	4297	6498	128344581	SO:0001587	stop_gained	9743			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.5695C>T	11.37:g.128839371G>A	ENSP00000310561:p.Gln1899*	Somatic		Capture	Illumina GAIIx	4	128344581	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Nonsense_Mutation	SNP	superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP	p.Q1550*	ENST00000310343.9	37	c.4648	CCDS44769.1	11	.	.	.	.	.	.	.	.	.	.	G	40	8.291575	0.98745	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	.	.	.	5.84	3.82	0.43975	.	0.729658	0.13041	N	0.418497	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.5937	0.39561	0.0805:0.144:0.7756:0.0	.	.	.	.	X	1899;1550;1550	.	ENSP00000310561:Q1899X	Q	-	1	0	ARHGAP32	128344581	0.576000	0.26700	0.982000	0.44146	0.847000	0.48162	1.058000	0.30504	2.760000	0.94817	0.655000	0.94253	CAG	-	NULL		0.532	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICS	protein_coding	OTTHUMT00000386151.3	G	NM_014715		128344581	-1	no_errors	NM_014715	genbank	human	validated	54_36p	nonsense	SNP	0.728	A
CRAT	1384	genome.wustl.edu	37	9	131870173	131870173	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr9:131870173C>T	ENST00000318080.2	-	2	505	c.211G>A	c.(211-213)Gat>Aat	p.D71N	CRAT_ENST00000464290.1_5'UTR|CRAT_ENST00000393384.3_Missense_Mutation_p.D71N|AL158151.2_ENST00000408594.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	71					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	TGAAACTCATCCACCAGCTGC	0.652																																																0			9											88.0	79.0	82.0					9																	131870173		2203	4300	6503	130909994	SO:0001583	missense	1384			X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.211G>A	9.37:g.131870173C>T	ENSP00000315013:p.Asp71Asn	Somatic		Capture	Illumina GAIIx	4	130909994	Q5T952|Q9BW16	Missense_Mutation	SNP	superfamily_CoA-dependent acyltransferases,HMMPfam_Carn_acyltransf,PatternScan_ACYLTRANSF_C_1,PatternScan_ACYLTRANSF_C_2	p.D71N	ENST00000318080.2	37	c.211	CCDS6919.1	9	.	.	.	.	.	.	.	.	.	.	c	21.7	4.190111	0.78789	.	.	ENSG00000095321	ENST00000351352;ENST00000318080;ENST00000393384	T;T	0.41758	0.99;0.99	5.23	5.23	0.72850	.	0.378748	0.29558	N	0.011804	T	0.35537	0.0935	L	0.31065	0.9	0.47737	D	0.999509	B;B	0.26708	0.157;0.0	B;B	0.29663	0.105;0.001	T	0.09773	-1.0659	10	0.30854	T	0.27	-8.1599	17.7903	0.88550	0.0:1.0:0.0:0.0	.	71;71	A6PVN3;P43155	.;CACP_HUMAN	N	71	ENSP00000315013:D71N;ENSP00000377045:D71N	ENSP00000315013:D71N	D	-	1	0	CRAT	130909994	1.000000	0.71417	0.998000	0.56505	0.825000	0.46686	2.543000	0.45752	2.436000	0.82500	0.457000	0.33378	GAT	-	superfamily_CoA-dependent acyltransferases,HMMPfam_Carn_acyltransf		0.652	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	protein_coding	OTTHUMT00000253700.1	C			130909994	-1	no_errors	NM_000755	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
USP26	83844	genome.wustl.edu	37	X	132162152	132162152	+	Nonsense_Mutation	SNP	T	T	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chrX:132162152T>A	ENST00000511190.1	-	6	566	c.97A>T	c.(97-99)Aag>Tag	p.K33*	USP26_ENST00000370832.1_Nonsense_Mutation_p.K33*|USP26_ENST00000406273.1_Nonsense_Mutation_p.K33*	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	33					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					TCTTTCTTCTTTCTTTCCACT	0.373																																					NSCLC(104;342 1621 36940 47097 52632)											0			X											62.0	63.0	62.0					X																	132162152		2202	4295	6497	131989818	SO:0001587	stop_gained	83844			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.97A>T	X.37:g.132162152T>A	ENSP00000423390:p.Lys33*	Somatic		Capture	Illumina GAIIx	4	131989818	B9WRT6|Q5H9H4	Nonsense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.K33*	ENST00000511190.1	37	c.97	CCDS14635.1	X	.	.	.	.	.	.	.	.	.	.	T	18.53	3.645010	0.67358	.	.	ENSG00000134588	ENST00000370832;ENST00000511190;ENST00000406273	.	.	.	4.15	0.361	0.16107	.	0.686384	0.12021	N	0.506896	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-5.5231	3.4011	0.07324	0.0:0.2218:0.2005:0.5776	.	.	.	.	X	33	.	ENSP00000359869:K33X	K	-	1	0	USP26	131989818	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.022000	0.13511	-0.036000	0.13669	-1.698000	0.00723	AAG	-	NULL		0.373	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP26	protein_coding	OTTHUMT00000359441.1	T	NM_031907		131989818	-1	no_errors	NM_031907	genbank	human	reviewed	54_36p	nonsense	SNP	0.002	A
SNURFL	727686	genome.wustl.edu	37	X	138444354	138444354	+	IGR	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chrX:138444354G>A								FGF13 (158085 upstream) : F9 (168562 downstream)																							CAGCTGCACTGAGCAACCAAG	0.483																																																0			X																																								138272020	SO:0001628	intergenic_variant	0																															X.37:g.138444354G>A		Somatic		Capture	Illumina GAIIx	4	138272020		Silent	SNP	HMMPfam_SNURF	p.L32		37	c.96		X																																																																																			-	HMMPfam_SNURF	0	0.483					CXorf19			G			138272020	+1	no_stop_codon	ENST00000309296	ensembl	human	known	54_36p	silent	SNP	0.951	A
PSD2	84249	genome.wustl.edu	37	5	139193782	139193782	+	Silent	SNP	A	A	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr5:139193782A>T	ENST00000274710.3	+	4	1054	c.849A>T	c.(847-849)tcA>tcT	p.S283S		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	283	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGGCCTGTCAGACTCAGACT	0.632																																																0			5											105.0	97.0	100.0					5																	139193782		2203	4300	6503	139173966	SO:0001819	synonymous_variant	84249			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.849A>T	5.37:g.139193782A>T		Somatic		Capture	Illumina GAIIx	4	139173966	D3DQD3|Q8N3J8	Silent	SNP	HMMSmart_SM00222,HMMPfam_Sec7,superfamily_Sec7 domain,HMMPfam_PH,HMMSmart_SM00233,superfamily_PH domain-like	p.S283	ENST00000274710.3	37	c.849	CCDS4216.1	5																																																																																			-	HMMSmart_SM00222,HMMPfam_Sec7		0.632	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	protein_coding	OTTHUMT00000251339.1	A	NM_032289		139173966	+1	no_errors	NM_032289	genbank	human	provisional	54_36p	silent	SNP	0.969	T
PCDHB1	29930	genome.wustl.edu	37	5	140432711	140432711	+	Silent	SNP	C	C	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr5:140432711C>G	ENST00000306549.3	+	1	1733	c.1656C>G	c.(1654-1656)gtC>gtG	p.V552V		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	552	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGTGGTTGTCCTAGATGACA	0.498																																																0			5											97.0	94.0	95.0					5																	140432711		2203	4300	6503	140412895	SO:0001819	synonymous_variant	29930			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1656C>G	5.37:g.140432711C>G		Somatic		Capture	Illumina GAIIx	4	140412895	Q2M257	Silent	SNP	HMMSmart_CA,HMMPfam_Cadherin_2,superfamily_Cadherin,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.V552	ENST00000306549.3	37	c.1656	CCDS4243.1	5																																																																																			-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1		0.498	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	protein_coding	OTTHUMT00000251822.2	C	NM_013340		140412895	+1	no_errors	NM_013340	genbank	human	reviewed	54_36p	silent	SNP	0.266	G
FAT2	2196	genome.wustl.edu	37	5	150887122	150887122	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr5:150887122G>T	ENST00000261800.5	-	22	12122	c.12110C>A	c.(12109-12111)cCc>cAc	p.P4037H	CTC-251D13.1_ENST00000606930.1_RNA	NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	4037					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTGGATCTCGGGAGTGACTAG	0.547																																																0			5											48.0	45.0	46.0					5																	150887122		2203	4300	6503	150867315	SO:0001583	missense	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.12110C>A	5.37:g.150887122G>T	ENSP00000261800:p.Pro4037His	Somatic		Capture	Illumina GAIIx	4	150867315	O75091|Q9NSR7	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2	p.P4037H	ENST00000261800.5	37	c.12110	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	G	12.84	2.059218	0.36373	.	.	ENSG00000086570	ENST00000261800	T	0.74002	-0.8	5.46	4.59	0.56863	Concanavalin A-like lectin/glucanase, subgroup (1);	0.235349	0.29916	N	0.010865	T	0.80132	0.4567	M	0.66939	2.045	0.33145	D	0.544954	P;D	0.76494	0.93;0.999	P;P	0.55667	0.533;0.781	D	0.85983	0.1484	10	0.66056	D	0.02	.	11.608	0.51043	0.0819:0.0:0.9181:0.0	.	4037;1142	Q9NYQ8;E9PDJ8	FAT2_HUMAN;.	H	4037	ENSP00000261800:P4037H	ENSP00000261800:P4037H	P	-	2	0	FAT2	150867315	0.999000	0.42202	0.861000	0.33841	0.048000	0.14542	3.773000	0.55333	1.301000	0.44836	-0.136000	0.14681	CCC	-	superfamily_EGF/Laminin		0.547	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	G	NM_001447		150867315	-1	no_errors	NM_001447	genbank	human	reviewed	54_36p	missense	SNP	0.948	T
NPR1	4881	genome.wustl.edu	37	1	153651993	153651993	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr1:153651993C>G	ENST00000368680.3	+	1	881	c.409C>G	c.(409-411)Ctg>Gtg	p.L137V		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	137					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	GGTCCCGCTGCTGACCGCCGG	0.736																																					Pancreas(141;1349 1870 15144 15830 40702)											0			1											2.0	3.0	2.0					1																	153651993		1573	3175	4748	151918617	SO:0001583	missense	4881			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.409C>G	1.37:g.153651993C>G	ENSP00000357669:p.Leu137Val	Somatic		Capture	Illumina GAIIx	4	151918617	B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor,PatternScan_ANF_RECEPTORS,HMMSmart_SM00219,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Pkinase,HMMSmart_SM00044,superfamily_Adenylyl and guanylyl cyclase catalytic domain,HMMPfam_Guanylate_cyc,PatternScan_GUANYLATE_CYCLASE_1	p.L137V	ENST00000368680.3	37	c.409	CCDS1051.1	1	.	.	.	.	.	.	.	.	.	.	C	9.832	1.188554	0.21954	.	.	ENSG00000169418	ENST00000368680	T	0.80738	-1.41	4.14	4.14	0.48551	Extracellular ligand-binding receptor (1);	0.215492	0.32328	N	0.006254	T	0.45438	0.1342	N	0.10760	0.04	0.80722	D	1	B	0.16603	0.018	B	0.20577	0.03	T	0.46965	-0.9153	10	0.28530	T	0.3	.	9.3918	0.38378	0.2132:0.7868:0.0:0.0	.	137	P16066	ANPRA_HUMAN	V	137	ENSP00000357669:L137V	ENSP00000357669:L137V	L	+	1	2	NPR1	151918617	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	1.341000	0.33907	1.836000	0.53414	0.462000	0.41574	CTG	-	superfamily_Periplasmic binding protein-like I,HMMPfam_ANF_receptor		0.736	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	protein_coding	OTTHUMT00000090034.1	C	NM_000906		151918617	+1	no_errors	NM_000906	genbank	human	validated	54_36p	missense	SNP	1.000	G
FBXW7	55294	genome.wustl.edu	37	4	153258956	153258956	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr4:153258956C>G	ENST00000281708.4	-	5	2088	c.859G>C	c.(859-861)Gag>Cag	p.E287Q	FBXW7_ENST00000393956.3_Missense_Mutation_p.E111Q|FBXW7_ENST00000296555.5_Missense_Mutation_p.E169Q|RP11-461L13.2_ENST00000605147.1_RNA|FBXW7_ENST00000603841.1_Missense_Mutation_p.E287Q|FBXW7_ENST00000263981.5_Missense_Mutation_p.E207Q|FBXW7_ENST00000603548.1_Missense_Mutation_p.E287Q	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	287	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATCTTTACCTCTTTAGGGAGC	0.343			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	4											149.0	145.0	146.0					4																	153258956		2203	4300	6503	153478406	SO:0001583	missense	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.859G>C	4.37:g.153258956C>G	ENSP00000281708:p.Glu287Gln	Somatic		Capture	Illumina GAIIx	4	153478406	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	superfamily_WD40 repeat-like,superfamily_F-box domain,HMMPfam_F-box,HMMSmart_SM00256,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.E287Q	ENST00000281708.4	37	c.859	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445532	0.84101	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39	5.63	5.63	0.86233	F-box domain, cyclin-like (2);F-box domain, Skp2-like (1);	0.046212	0.85682	D	0.000000	D	0.87446	0.6179	H	0.94734	3.575	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.73380	0.971;0.98;0.966;0.966	D	0.90460	0.4445	10	0.87932	D	0	-22.6201	19.6704	0.95910	0.0:1.0:0.0:0.0	.	111;287;169;207	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	Q	287;169;207;111	ENSP00000281708:E287Q;ENSP00000296555:E169Q;ENSP00000263981:E207Q;ENSP00000377528:E111Q	ENSP00000263981:E207Q	E	-	1	0	FBXW7	153478406	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	7.760000	0.85248	2.641000	0.89580	0.650000	0.86243	GAG	-	superfamily_WD40 repeat-like,superfamily_F-box domain,HMMPfam_F-box,HMMSmart_SM00256		0.343	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	protein_coding	OTTHUMT00000469956.1	C			153478406	-1	no_errors	NM_033632	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
KIAA0907	22889	genome.wustl.edu	37	1	155895441	155895441	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr1:155895441G>C	ENST00000368321.3	-	7	898	c.875C>G	c.(874-876)cCt>cGt	p.P292R	SCARNA4_ENST00000516999.1_RNA|KIAA0907_ENST00000368319.3_Missense_Mutation_p.P292R|KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368320.3_Missense_Mutation_p.P292R	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	292							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			AATATACATAGGTTCAAAAGC	0.463																																																0			1											80.0	80.0	80.0					1																	155895441		2203	4300	6503	154162065	SO:0001583	missense	22889			BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.875C>G	1.37:g.155895441G>C	ENSP00000357304:p.Pro292Arg	Somatic		Capture	Illumina GAIIx	4	154162065	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	superfamily_Eukaryotic type KH-domain (KH-domain type I)	p.P292R	ENST00000368321.3	37	c.875	CCDS30885.1	1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580156	0.86645	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	T;T;T	0.46819	0.86;0.86;0.86	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.68577	0.3016	M	0.86097	2.795	0.80722	D	1	D;D;D	0.65815	0.985;0.995;0.988	D;D;D	0.69307	0.954;0.963;0.952	T	0.70605	-0.4826	10	0.54805	T	0.06	-8.6402	19.6917	0.96005	0.0:0.0:1.0:0.0	.	292;292;292	Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;K0907_HUMAN	R	292	ENSP00000357304:P292R;ENSP00000357303:P292R;ENSP00000357302:P292R	ENSP00000357302:P292R	P	-	2	0	KIAA0907	154162065	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.471000	0.97696	2.751000	0.94390	0.650000	0.86243	CCT	-	superfamily_Eukaryotic type KH-domain (KH-domain type I)		0.463	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0907	protein_coding	OTTHUMT00000039583.1	G	NM_014949		154162065	-1	no_errors	NM_014949	genbank	human	predicted	54_36p	missense	SNP	1.000	C
CD302	9936	genome.wustl.edu	37	2	160636685	160636685	+	Silent	SNP	C	C	T	rs146987171		TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr2:160636685C>T	ENST00000259053.4	-	4	343	c.300G>A	c.(298-300)gcG>gcA	p.A100A	LY75_ENST00000553424.1_Silent_p.A1685A|LY75-CD302_ENST00000504764.1_Silent_p.A1741A|LY75-CD302_ENST00000505052.1_Silent_p.A1685A|CD302_ENST00000429078.2_Intron|CD302_ENST00000480212.1_5'UTR|LY75_ENST00000554112.1_Silent_p.A1741A	NM_001198764.1|NM_014880.4	NP_001185693.1|NP_055695.2	Q8IX05	CD302_HUMAN	CD302 molecule	100	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				phagocytosis (GO:0006909)	cell cortex (GO:0005938)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)	p.A100A(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						ACTTGAAACTCGCATCTGTCA	0.348																																																1	Substitution - coding silent(1)	lung(1)	2						C	,,,,	1,4403	2.1+/-5.4	0,1,2201	97.0	88.0	91.0		5223,5055,,189,300	-6.4	0.0	2	dbSNP_134	91	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous,coding-synonymous,intron,coding-synonymous,coding-synonymous	CD302,LY75-CD302	NM_001198759.1,NM_001198760.1,NM_001198763.1,NM_001198764.1,NM_014880.4	,,,,	0,3,6499	TT,TC,CC		0.0233,0.0227,0.0231	,,,,	1741/1874,1685/1818,,63/196,100/233	160636685	3,13001	2202	4300	6502	160344931	SO:0001819	synonymous_variant	9936			AY314007	CCDS33308.1, CCDS56139.1, CCDS74595.1	2q24.2	2011-08-30	2006-03-28		ENSG00000241399	ENSG00000241399		"""CD molecules"", ""C-type lectin domain containing"""	30843	protein-coding gene	gene with protein product	"""C-type lectin domain family 13, member A"""	612246	"""CD302 antigen"""			7584026, 7584028	Standard	NM_014880		Approved	DCL-1, KIAA0022, BIMLEC, CLEC13A		Q8IX05	OTTHUMG00000154080	ENST00000259053.4:c.300G>A	2.37:g.160636685C>T		Somatic		Capture	Illumina GAIIx	4	160344931	A8K5G4|B4E2T9|Q15009	Silent	SNP	superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C	p.A100	ENST00000259053.4	37	c.300	CCDS33308.1	2																																																																																			-	superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C		0.348	CD302-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD302	protein_coding	OTTHUMT00000333760.1	C	NM_014880		160344931	-1	no_errors	NM_014880	genbank	human	validated	54_36p	silent	SNP	0.178	T
GTF3C3	9330	genome.wustl.edu	37	2	197653978	197653978	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr2:197653978C>A	ENST00000263956.3	-	6	932	c.843G>T	c.(841-843)ttG>ttT	p.L281F	GTF3C3_ENST00000470386.1_5'UTR|GTF3C3_ENST00000409364.3_Missense_Mutation_p.L281F	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	281					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CAGATGGAGACAAAAGGTTTA	0.413																																																0			2											123.0	112.0	115.0					2																	197653978		2203	4300	6503	197362223	SO:0001583	missense	9330			AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.843G>T	2.37:g.197653978C>A	ENSP00000263956:p.Leu281Phe	Somatic		Capture	Illumina GAIIx	4	197362223	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	HMMSmart_SM00028,superfamily_Protein prenylyltransferase,HMMPfam_TPR_2,superfamily_TPR-like,HMMPfam_TPR_1	p.L281F	ENST00000263956.3	37	c.843	CCDS2316.1	2	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350169	0.61183	.	.	ENSG00000119041	ENST00000263956;ENST00000409364	T;T	0.37752	1.18;1.18	4.87	2.92	0.33932	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000006	T	0.29882	0.0747	N	0.19112	0.55	0.53688	D	0.999974	P;D	0.57899	0.928;0.981	P;P	0.54210	0.642;0.745	T	0.02491	-1.1151	10	0.16420	T	0.52	-11.4301	9.1172	0.36764	0.0:0.7485:0.0:0.2515	.	281;281	Q9Y5Q9-2;Q9Y5Q9	.;TF3C3_HUMAN	F	281	ENSP00000263956:L281F;ENSP00000386465:L281F	ENSP00000263956:L281F	L	-	3	2	GTF3C3	197362223	1.000000	0.71417	0.998000	0.56505	0.944000	0.59088	1.983000	0.40648	1.289000	0.44618	0.591000	0.81541	TTG	-	superfamily_Protein prenylyltransferase,HMMSmart_SM00028		0.413	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C3	protein_coding	OTTHUMT00000256104.1	C			197362223	-1	no_errors	NM_012086	genbank	human	provisional	54_36p	missense	SNP	0.998	A
ZNF281	23528	genome.wustl.edu	37	1	200378734	200378734	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr1:200378734C>G	ENST00000294740.3	-	2	224	c.100G>C	c.(100-102)Ggc>Cgc	p.G34R	ZNF281_ENST00000367353.1_Missense_Mutation_p.G34R|ZNF281_ENST00000367352.3_Missense_Mutation_p.G34R	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	34	Gly-rich.				embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						ccgctgctgccgccgccgccg	0.677																																																0			1											7.0	5.0	6.0					1																	200378734		1501	3211	4712	198645357	SO:0001583	missense	23528			AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.100G>C	1.37:g.200378734C>G	ENSP00000294740:p.Gly34Arg	Somatic		Capture	Illumina GAIIx	4	198645357	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.G34R	ENST00000294740.3	37	c.100	CCDS1402.1	1	.	.	.	.	.	.	.	.	.	.	c	2.335	-0.352569	0.05173	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352	D;D;D	0.97209	-1.97;-1.97;-4.29	4.15	1.23	0.21249	.	0.373876	0.17671	U	0.165971	D	0.89863	0.6838	N	0.08118	0	0.09310	N	0.999997	B;B	0.18461	0.028;0.028	B;B	0.15052	0.012;0.012	T	0.82983	-0.0186	10	0.66056	D	0.02	-15.2041	5.5396	0.17031	0.0:0.5906:0.1813:0.2281	.	34;34	A6NF48;Q9Y2X9	.;ZN281_HUMAN	R	34	ENSP00000294740:G34R;ENSP00000356322:G34R;ENSP00000356321:G34R	ENSP00000294740:G34R	G	-	1	0	ZNF281	198645357	0.433000	0.25562	0.953000	0.39169	0.176000	0.22953	-1.287000	0.02785	0.161000	0.19458	-1.808000	0.00615	GGC	-	NULL		0.677	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF281	protein_coding	OTTHUMT00000086879.2	C	NM_012482		198645357	-1	no_errors	NM_012482	genbank	human	provisional	54_36p	missense	SNP	0.947	G
RAPH1	65059	genome.wustl.edu	37	2	204304868	204304868	+	Silent	SNP	C	C	T			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr2:204304868C>T	ENST00000319170.5	-	14	3344	c.3045G>A	c.(3043-3045)aaG>aaA	p.K1015K	RAPH1_ENST00000374493.3_Silent_p.K1067K|ABI2_ENST00000295851.5_3'UTR|RAPH1_ENST00000457812.1_Intron	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	1015					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GTAGGGTCTCCTTGCTGGGAG	0.562																																																0			2											62.0	69.0	67.0					2																	204304868		2203	4300	6503	204013113	SO:0001819	synonymous_variant	65059			AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.3045G>A	2.37:g.204304868C>T		Somatic		Capture	Illumina GAIIx	4	204013113	Q96Q37|Q9C0I2	Silent	SNP	HMMSmart_SM00314,HMMPfam_RA,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.K1015	ENST00000319170.5	37	c.3045	CCDS2359.1	2																																																																																			-	NULL		0.562	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPH1	protein_coding	OTTHUMT00000256363.2	C	NM_025252		204013113	-1	no_errors	NM_213589	genbank	human	validated	54_36p	silent	SNP	0.998	T
CTLA4	1493	genome.wustl.edu	37	2	204736161	204736161	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr2:204736161G>A	ENST00000302823.3	+	3	675	c.518G>A	c.(517-519)gGg>gAg	p.G173E	CTLA4_ENST00000427473.2_Intron|CTLA4_ENST00000487393.1_Intron|CTLA4_ENST00000295854.6_Intron|CTLA4_ENST00000472206.1_Intron	NM_005214.4	NP_005205.2	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	173					B cell receptor signaling pathway (GO:0050853)|cellular response to DNA damage stimulus (GO:0006974)|immune response (GO:0006955)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of immune response (GO:0050777)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of apoptotic process (GO:0043065)|T cell costimulation (GO:0031295)	clathrin-coated endocytic vesicle (GO:0045334)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				large_intestine(4)|lung(4)|skin(1)	9					Ipilimumab(DB06186)	GTTAGTTCGGGGTTGTTTTTT	0.478																																																0			2											199.0	188.0	192.0					2																	204736161		2203	4300	6503	204444406	SO:0001583	missense	1493				CCDS2362.1, CCDS42803.1	2q33	2014-02-03			ENSG00000163599	ENSG00000163599		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	2505	protein-coding gene	gene with protein product		123890	"""celiac disease 3"", ""insulin-dependent diabetes mellitus 12"""	CELIAC3, IDDM12		3220103, 8817351	Standard	NM_005214		Approved	CD152, CD, GSE, CD28, ICOS	uc002vak.2	P16410	OTTHUMG00000132877	ENST00000302823.3:c.518G>A	2.37:g.204736161G>A	ENSP00000303939:p.Gly173Glu	Somatic		Capture	Illumina GAIIx	4	204444406	A0N1S0|E9PDH0|O95653|Q0PP65|Q52MC1|Q53TD5|Q5S005|Q8WXJ1|Q96P43|Q9UKN9	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IGv,HMMPfam_V-set	p.G173E	ENST00000302823.3	37	c.518	CCDS2362.1	2	.	.	.	.	.	.	.	.	.	.	G	12.49	1.954878	0.34471	.	.	ENSG00000163599	ENST00000302823	T	0.32753	1.44	5.42	4.51	0.55191	.	0.282910	0.34652	N	0.003800	T	0.28433	0.0703	N	0.24115	0.695	0.80722	D	1	D	0.56968	0.978	P	0.50825	0.651	T	0.02596	-1.1136	10	0.72032	D	0.01	-16.1986	10.4498	0.44516	0.0:0.1441:0.7066:0.1493	.	173	P16410	CTLA4_HUMAN	E	173	ENSP00000303939:G173E	ENSP00000303939:G173E	G	+	2	0	CTLA4	204444406	1.000000	0.71417	0.789000	0.31954	0.991000	0.79684	3.273000	0.51623	2.560000	0.86352	0.650000	0.86243	GGG	-	NULL		0.478	CTLA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTLA4	protein_coding	OTTHUMT00000256365.1	G	NM_005214		204444406	+1	no_errors	NM_005214	genbank	human	reviewed	54_36p	missense	SNP	0.912	A
BATF3	55509	genome.wustl.edu	37	1	212860168	212860168	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr1:212860168G>A	ENST00000243440.1	-	3	571	c.349C>T	c.(349-351)Cgg>Tgg	p.R117W	BATF3_ENST00000478275.1_5'UTR	NM_018664.2	NP_061134.1	Q9NR55	BATF3_HUMAN	basic leucine zipper transcription factor, ATF-like 3	117					dendritic cell differentiation (GO:0097028)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to virus (GO:0009615)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0046)|all cancers(67;0.00785)|GBM - Glioblastoma multiforme(131;0.0731)|Epithelial(68;0.0781)		GGGTCCGGCCGGGGAGGCACT	0.612																																																0			1											67.0	64.0	65.0					1																	212860168		2203	4300	6503	210926791	SO:0001583	missense	55509			AF255346	CCDS1508.1	1q32.3	2013-01-10			ENSG00000123685	ENSG00000123685		"""basic leucine zipper proteins"""	28915	protein-coding gene	gene with protein product	"""Jun dimerization protein 1"""	612470				10878360, 12087103	Standard	NM_018664		Approved	JUNDM1, SNFT, JDP1	uc001hjl.2	Q9NR55	OTTHUMG00000036807	ENST00000243440.1:c.349C>T	1.37:g.212860168G>A	ENSP00000243440:p.Arg117Trp	Somatic		Capture	Illumina GAIIx	4	210926791		Missense_Mutation	SNP	HMMPfam_bZIP_1,HMMSmart_BRLZ,PatternScan_BZIP_BASIC	p.R117W	ENST00000243440.1	37	c.349	CCDS1508.1	1	.	.	.	.	.	.	.	.	.	.	G	13.10	2.135748	0.37728	.	.	ENSG00000123685	ENST00000243440	T	0.59083	0.29	0.694	0.694	0.18062	.	0.626663	0.12454	N	0.467499	T	0.69115	0.3075	L	0.60455	1.87	0.37955	D	0.932788	D	0.89917	1.0	D	0.75020	0.985	T	0.72033	-0.4412	9	0.62326	D	0.03	-0.182	.	.	.	.	117	Q9NR55	BATF3_HUMAN	W	117	ENSP00000243440:R117W	ENSP00000243440:R117W	R	-	1	2	BATF3	210926791	0.997000	0.39634	0.703000	0.30354	0.708000	0.40852	0.529000	0.23019	0.647000	0.30713	0.655000	0.94253	CGG	-	NULL		0.612	BATF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BATF3	protein_coding	OTTHUMT00000089403.1	G	NM_018664		210926791	-1	no_errors	NM_018664	genbank	human	reviewed	54_36p	missense	SNP	0.279	A
ERBB4	2066	genome.wustl.edu	37	2	212251599	212251599	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr2:212251599T>C	ENST00000342788.4	-	27	3770	c.3460A>G	c.(3460-3462)Atg>Gtg	p.M1154V	ERBB4_ENST00000436443.1_Missense_Mutation_p.M1138V|ERBB4_ENST00000402597.1_Missense_Mutation_p.M1144V	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1154					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TTGTCTCGCATAGGAGTCATG	0.473										TSP Lung(8;0.080)																																						0			2											179.0	166.0	170.0					2																	212251599		2203	4300	6503	211959844	SO:0001583	missense	2066			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3460A>G	2.37:g.212251599T>C	ENSP00000342235:p.Met1154Val	Somatic		Capture	Illumina GAIIx	4	211959844	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	superfamily_L domain-like,HMMPfam_Recep_L_domain,HMMSmart_SM00261,HMMPfam_Furin-like,superfamily_Growth factor receptor domain,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,HMMPfam_YLP	p.M1154V	ENST00000342788.4	37	c.3460	CCDS2394.1	2	.	.	.	.	.	.	.	.	.	.	T	15.47	2.843366	0.51057	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.74209	-0.81;-0.82;-0.81	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.66655	0.2811	L	0.44542	1.39	0.58432	D	0.999996	B;B;B;B	0.17667	0.023;0.004;0.023;0.014	B;B;B;B	0.18561	0.022;0.015;0.022;0.01	T	0.61855	-0.6977	10	0.13470	T	0.59	.	15.7872	0.78315	0.0:0.0:0.0:1.0	.	1128;1144;1138;1154	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	V	1154;1138;1144	ENSP00000342235:M1154V;ENSP00000403204:M1138V;ENSP00000385565:M1144V	ENSP00000342235:M1154V	M	-	1	0	ERBB4	211959844	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.241000	0.78201	2.131000	0.65755	0.379000	0.24179	ATG	-	NULL		0.473	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	protein_coding	OTTHUMT00000256597.1	T	NM_001042599		211959844	-1	no_errors	NM_005235	genbank	human	reviewed	54_36p	missense	SNP	0.997	C
PTPN14	5784	genome.wustl.edu	37	1	214656066	214656066	+	Intron	SNP	C	C	T	rs77576710	byFrequency	TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr1:214656066C>T	ENST00000366956.5	-	2	41					NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14						lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		AGACTCTCCTCCTCTATTTTT	0.363																																					Colon(92;557 1424 24372 34121 40073)											0			1																																								212722689	SO:0001627	intron_variant	643454			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.154-17766G>A	1.37:g.214656066C>T		Somatic		Capture	Illumina GAIIx	4	212722689	Q5VSI0	RNA	SNP	-	NULL	ENST00000366956.5	37	NULL	CCDS1514.1	1																																																																																			-	-		0.363	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643454	protein_coding	OTTHUMT00000089918.2	C	NM_005401		212722689	-1	pseudogene	XR_042294	genbank	human	model	54_36p	rna	SNP	0.972	T
PSEN2	5664	genome.wustl.edu	37	1	227079449	227079449	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2539-01A-01D-1526-09	TCGA-36-2539-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df50e3ca-95af-4da4-a694-95572185a36a	f97d6470-9722-4ce9-8fa5-d7e120e125e6	g.chr1:227079449G>A	ENST00000366783.3	+	11	1412	c.976G>A	c.(976-978)Gac>Aac	p.D326N	PSEN2_ENST00000472139.2_Missense_Mutation_p.D182N|PSEN2_ENST00000340188.4_Missense_Mutation_p.D293N|PSEN2_ENST00000366782.1_Missense_Mutation_p.D359N|PSEN2_ENST00000422240.2_Missense_Mutation_p.D325N|PSEN2_ENST00000471728.1_3'UTR|PSEN2_ENST00000391872.2_Missense_Mutation_p.D359N	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	326					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				CCCAGAAGAAGACTCCTATGA	0.527																																																0			1											82.0	81.0	81.0					1																	227079449		2203	4300	6503	225146072	SO:0001583	missense	5664			BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.976G>A	1.37:g.227079449G>A	ENSP00000355747:p.Asp326Asn	Somatic		Capture	Illumina GAIIx	4	225146072	A8K8D4|B1AP21|Q96P32	Missense_Mutation	SNP	HMMPfam_Presenilin,HMMSmart_SM00730	p.D326N	ENST00000366783.3	37	c.976	CCDS1556.1	1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116501	0.56505	.	.	ENSG00000143801	ENST00000366783;ENST00000340188;ENST00000422240;ENST00000366782;ENST00000391872;ENST00000472139	D;D;D;D;D;D	0.99760	-6.65;-6.37;-6.63;-6.66;-6.66;-6.32	4.78	4.78	0.61160	.	0.896444	0.09680	N	0.769882	D	0.99004	0.9660	L	0.56769	1.78	0.80722	D	1	B;B	0.10296	0.0;0.003	B;B	0.17098	0.004;0.017	D	0.98550	1.0636	10	0.07644	T	0.81	.	13.1864	0.59684	0.0:0.0:1.0:0.0	.	325;326	A8K8D4;P49810	.;PSN2_HUMAN	N	326;293;325;359;359;182	ENSP00000355747:D326N;ENSP00000339860:D293N;ENSP00000403737:D325N;ENSP00000355746:D359N;ENSP00000375745:D359N;ENSP00000427806:D182N	ENSP00000339860:D293N	D	+	1	0	PSEN2	225146072	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.877000	0.63086	2.483000	0.83821	0.655000	0.94253	GAC	-	HMMPfam_Presenilin,HMMSmart_SM00730		0.527	PSEN2-001	KNOWN	basic|CCDS	protein_coding	PSEN2	protein_coding	OTTHUMT00000091539.1	G	NM_000447		225146072	+1	no_errors	NM_000447	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
