#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
FOXD4	2298	genome.wustl.edu	37	9	117579	117579	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr9:117579C>A	ENST00000382500.2	-	1	838	c.541G>T	c.(541-543)Gac>Tac	p.D181Y		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	181					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GAGGCGGGGTCCAGGCTCCAG	0.662																																																0			9											83.0	116.0	105.0					9																	117579		2176	4266	6442	107579	SO:0001583	missense	2298			U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.541G>T	9.37:g.117579C>A	ENSP00000371940:p.Asp181Tyr	Somatic		Capture	Illumina GAIIx	4	107579	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	HMMSmart_FH,superfamily_SSF46785,HMMPfam_Fork_head,PatternScan_FORK_HEAD_2	p.D181Y	ENST00000382500.2	37	c.541	CCDS34975.1	9	.	.	.	.	.	.	.	.	.	.	.	16.05	3.012750	0.54468	.	.	ENSG00000170122	ENST00000382500	D	0.96168	-3.93	2.24	2.24	0.28232	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.39475	U	0.001354	D	0.97679	0.9239	M	0.92833	3.35	0.58432	D	0.999992	D	0.89917	1.0	D	0.83275	0.996	D	0.97211	0.9871	10	0.87932	D	0	.	8.819	0.35014	0.0:0.7654:0.2346:0.0	.	181	Q12950	FOXD4_HUMAN	Y	181	ENSP00000371940:D181Y	ENSP00000371940:D181Y	D	-	1	0	FOXD4	107579	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.401000	0.59716	1.253000	0.44018	0.291000	0.19559	GAC	-	HMMSmart_FH,superfamily_SSF46785,HMMPfam_Fork_head		0.662	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4	protein_coding	OTTHUMT00000055433.1	C	NM_207305		107579	-1	no_errors	NM_207305	genbank	human	validated	54_36p	missense	SNP	1.000	A
PAPOLB	56903	genome.wustl.edu	37	7	4900691	4900691	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr7:4900691C>T	ENST00000404991.1	-	1	934	c.748G>A	c.(748-750)Gcc>Acc	p.A250T	RADIL_ENST00000399583.3_Intron|RADIL_ENST00000536091.1_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	250					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		ACTAGCATGGCCCAGGAAACA	0.438																																																0			7											109.0	112.0	111.0					7																	4900691		2203	4300	6503	4867217	SO:0001583	missense	56903			AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.748G>A	7.37:g.4900691C>T	ENSP00000384700:p.Ala250Thr	Somatic		Capture	Illumina GAIIx	4	4867217	Q75LH1|Q8NE14	Missense_Mutation	SNP	HMMPfam_PAP_central,superfamily_SSF81301,HMMPfam_NTP_transf_2,superfamily_SSF81631,superfamily_PAP_C,HMMPfam_PAP_RNA-bind	p.A251T	ENST00000404991.1	37	c.751		7	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314291	0.81358	.	.	ENSG00000218823	ENST00000404991	.	.	.	4.22	4.22	0.49857	.	.	.	.	.	D	0.86732	0.6003	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.90575	0.4525	8	0.87932	D	0	.	14.8979	0.70656	0.0:1.0:0.0:0.0	.	251	A4D1Z6	.	T	250	.	ENSP00000384700:A250T	A	-	1	0	PAPOLB	4867217	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.664000	0.68045	2.641000	0.89580	0.591000	0.81541	GCC	-	HMMPfam_PAP_central,superfamily_SSF81631		0.438	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	PAPOLB	protein_coding	OTTHUMT00000323797.1	C	NM_020144		4867217	-1	no_errors	NM_020144	genbank	human	validated	54_36p	missense	SNP	1.000	T
KDM4B	23030	genome.wustl.edu	37	19	5039897	5039897	+	Silent	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr19:5039897C>T	ENST00000159111.4	+	4	410	c.192C>T	c.(190-192)gaC>gaT	p.D64D	KDM4B_ENST00000536461.1_Silent_p.D64D|KDM4B_ENST00000381759.4_Silent_p.D64D	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	64					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						ATGACATCGACGACGTGGTGA	0.612																																																0			19											79.0	76.0	77.0					19																	5039897		2203	4300	6503	4990897	SO:0001819	synonymous_variant	23030			AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.192C>T	19.37:g.5039897C>T		Somatic		Capture	Illumina GAIIx	4	4990897	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Silent	SNP	HMMSmart_SM00545,HMMPfam_JmjN,HMMSmart_SM00558,HMMPfam_JmjC,HMMSmart_SM00249,superfamily_FYVE/PHD zinc finger,HMMPfam_PHD,HMMSmart_SM00333,superfamily_Tudor/PWWP/MBT,HMMPfam_LBR_tudor	p.D64	ENST00000159111.4	37	c.192	CCDS12138.1	19																																																																																			-	NULL		0.612	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD2B	protein_coding	OTTHUMT00000450558.1	C	NM_015015		4990897	+1	no_errors	NM_015015	genbank	human	validated	54_36p	silent	SNP	0.830	T
TP53	7157	genome.wustl.edu	37	17	7577153	7577153	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr17:7577153C>A	ENST00000269305.4	-	8	974	c.785G>T	c.(784-786)gGt>gTt	p.G262V	TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.G262V|TP53_ENST00000455263.2_Missense_Mutation_p.G262V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.G262V|TP53_ENST00000420246.2_Missense_Mutation_p.G262V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	262	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		G -> C (in a sporadic cancer; somatic mutation).|G -> D (in sporadic cancers; somatic mutation).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> S (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation). {ECO:0000269|Ref.23}.|GN -> PD (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G262V(19)|p.0?(8)|p.G262D(4)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G262fs*83(2)|p.G262_S269delGNLLGRNS(2)|p.G262del(2)|p.G262H(1)|p.E258fs*71(1)|p.S261_L264>R(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGTAGATTACCACTACTCAG	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Substitution - Missense(24)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(4)|Unknown(3)|Complex - deletion inframe(1)	lung(8)|large_intestine(5)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(5)|ovary(5)|upper_aerodigestive_tract(4)|bone(4)|endometrium(2)|urinary_tract(2)|pancreas(2)|eye(1)|liver(1)|breast(1)|stomach(1)	17											40.0	37.0	38.0					17																	7577153		2203	4299	6502	7517878	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.785G>T	17.37:g.7577153C>A	ENSP00000269305:p.Gly262Val	Somatic		Capture	Illumina GAIIx	4	7517878	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.G262V	ENST00000269305.4	37	c.785	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565296	0.86439	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99957	-9.0;-9.0;-9.0;-9.0;-9.0;-9.0	5.03	5.03	0.67393	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99955	0.9981	M	0.90977	3.165	0.80722	D	1	D;P;D;D	0.89917	1.0;0.819;0.999;1.0	D;P;D;D	0.83275	0.996;0.537;0.996;0.992	D	0.95599	0.8661	10	0.87932	D	0	-15.6281	15.9038	0.79403	0.0:1.0:0.0:0.0	.	262;262;262;262	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	262;262;262;262;262;251;130	ENSP00000352610:G262V;ENSP00000269305:G262V;ENSP00000398846:G262V;ENSP00000391127:G262V;ENSP00000391478:G262V;ENSP00000425104:G130V	ENSP00000269305:G262V	G	-	2	0	TP53	7517878	1.000000	0.71417	0.951000	0.38953	0.085000	0.17905	7.572000	0.82409	2.619000	0.88677	0.462000	0.41574	GGT	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517878	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.996	A
SBF2	81846	genome.wustl.edu	37	11	9803138	9803138	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr11:9803138A>C	ENST00000256190.8	-	39	5504	c.5367T>G	c.(5365-5367)atT>atG	p.I1789M	SBF2-AS1_ENST00000527406.1_RNA|SBF2-AS1_ENST00000499953.2_RNA|SBF2-AS1_ENST00000498905.2_RNA|SBF2-AS1_ENST00000534671.1_RNA|SBF2-AS1_ENST00000525636.1_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1789	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		CAGCCAGATCAATGTGGCCTT	0.463																																																0			11											216.0	200.0	206.0					11																	9803138		2201	4294	6495	9759714	SO:0001583	missense	81846			AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.5367T>G	11.37:g.9803138A>C	ENSP00000256190:p.Ile1789Met	Somatic		Capture	Illumina GAIIx	4	9759714	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	HMMPfam_uDENN,HMMSmart_SM00800,HMMPfam_DENN,HMMSmart_SM00799,HMMPfam_dDENN,HMMSmart_SM00801,HMMPfam_GRAM,HMMSmart_SM00568,superfamily_PH domain-like,superfamily_(Phosphotyrosine protein) phosphatases II,HMMPfam_Myotub-related,HMMPfam_PH,HMMSmart_SM00233	p.I1789M	ENST00000256190.8	37	c.5367	CCDS31427.1	11	.	.	.	.	.	.	.	.	.	.	A	19.71	3.878248	0.72294	.	.	ENSG00000133812	ENST00000256190	D	0.84516	-1.86	5.76	-0.425	0.12317	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.92545	0.7632	H	0.95504	3.68	0.52501	D	0.999955	D	0.89917	1.0	D	0.97110	1.0	D	0.89327	0.3644	10	0.87932	D	0	.	6.159	0.20354	0.5033:0.0:0.3717:0.1251	.	1789	Q86WG5	MTMRD_HUMAN	M	1789	ENSP00000256190:I1789M	ENSP00000256190:I1789M	I	-	3	3	SBF2	9759714	0.910000	0.30920	0.997000	0.53966	0.998000	0.95712	0.116000	0.15561	-0.085000	0.12573	0.533000	0.62120	ATT	-	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233		0.463	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SBF2	protein_coding	OTTHUMT00000386911.2	A	NM_030962		9759714	-1	no_errors	NM_030962	genbank	human	reviewed	54_36p	missense	SNP	0.995	C
GCNT2	2651	genome.wustl.edu	37	6	10586456	10586456	+	Intron	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr6:10586456G>A	ENST00000379597.3	+	2	1481				GCNT2_ENST00000316170.3_Intron|GCNT2_ENST00000265012.4_Silent_p.L78L|GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000495262.1_Intron|GCNT2_ENST00000397423.2_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)						maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		AGGATTACCTGACCCAGAATC	0.448																																																0			6											131.0	128.0	129.0					6																	10586456		2203	4300	6503	10694442	SO:0001627	intron_variant	2651			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.926-35128G>A	6.37:g.10586456G>A		Somatic		Capture	Illumina GAIIx	4	10694442		Silent	SNP	HMMPfam_Branch	p.L78	ENST00000379597.3	37	c.234	CCDS34338.1	6																																																																																			-	NULL		0.448	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GCNT2	protein_coding	OTTHUMT00000327912.3	G	NM_145649		10694442	+1	no_errors	NM_145655	genbank	human	reviewed	54_36p	silent	SNP	0.356	A
FARSA	2193	genome.wustl.edu	37	19	13035072	13035072	+	Silent	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr19:13035072C>T	ENST00000314606.4	-	12	1299	c.1281G>A	c.(1279-1281)aaG>aaA	p.K427K	FARSA_ENST00000588025.1_Silent_p.K467K|FARSA_ENST00000423140.2_Silent_p.K396K	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	427					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	CCACCCACTTCTTCAGGCCTG	0.612																																																0			19											68.0	71.0	70.0					19																	13035072		2203	4300	6503	12896072	SO:0001819	synonymous_variant	2193			U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.1281G>A	19.37:g.13035072C>T		Somatic		Capture	Illumina GAIIx	4	12896072	B4E363|Q9NSD8|Q9Y4W8	Silent	SNP	"superfamily_""Winged helix"" DNA-binding domain,superfamily_Class II aaRS and biotin synthetases,HMMPfam_tRNA-synt_2d"	p.K427	ENST00000314606.4	37	c.1281	CCDS12287.1	19																																																																																			-	superfamily_Class II aaRS and biotin synthetases,HMMPfam_tRNA-synt_2d		0.612	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARSA	protein_coding	OTTHUMT00000451935.1	C	NM_004461		12896072	-1	no_errors	NM_004461	genbank	human	validated	54_36p	silent	SNP	1.000	T
SMCR8	140775	genome.wustl.edu	37	17	18219709	18219709	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr17:18219709G>C	ENST00000406438.3	+	1	1086	c.606G>C	c.(604-606)ttG>ttC	p.L202F	TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000582230.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	202						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						TGAAAGACTTGGATTACACCA	0.458																																																0			17											57.0	59.0	58.0					17																	18219709		2203	4300	6503	18160434	SO:0001583	missense	140775			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.606G>C	17.37:g.18219709G>C	ENSP00000385025:p.Leu202Phe	Somatic		Capture	Illumina GAIIx	4	18160434	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	NULL	p.L202F	ENST00000406438.3	37	c.606	CCDS11195.2	17	.	.	.	.	.	.	.	.	.	.	G	15.25	2.776539	0.49786	.	.	ENSG00000176994	ENST00000406438	D	0.88354	-2.37	6.03	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.92176	0.7519	M	0.71581	2.175	0.53688	D	0.999976	D	0.89917	1.0	D	0.91635	0.999	D	0.91481	0.5204	10	0.87932	D	0	-12.0823	5.3978	0.16278	0.0725:0.1128:0.5939:0.2208	.	202	Q8TEV9	SMCR8_HUMAN	F	202	ENSP00000385025:L202F	ENSP00000385025:L202F	L	+	3	2	SMCR8	18160434	0.989000	0.36119	1.000000	0.80357	0.993000	0.82548	0.142000	0.16096	2.861000	0.98227	0.655000	0.94253	TTG	-	NULL		0.458	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	protein_coding	OTTHUMT00000132065.2	G	NM_144775		18160434	+1	no_errors	NM_144775	genbank	human	validated	54_36p	missense	SNP	1.000	C
NF1P1	100419006	genome.wustl.edu	37	15	21122042	21122042	+	IGR	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr15:21122042C>T								POTEB2 (50399 upstream) : MIR5701-1 (23538 downstream)																							AAAAAATTGGCTTCCCAGCTT	0.333																																																0			15																																								19386674	SO:0001628	intergenic_variant	440225																															15.37:g.21122042C>T		Somatic		Capture	Illumina GAIIx	4	19386674		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.333					LOC440225			C			19386674	-1	pseudogene	XR_042334	genbank	human	model	54_36p	rna	SNP	1.000	T
ZNF737	100129842	genome.wustl.edu	37	19	20727739	20727739	+	Missense_Mutation	SNP	G	G	A	rs200133247		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr19:20727739G>A	ENST00000427401.4	-	4	1364	c.1270C>T	c.(1270-1272)Ccc>Tcc	p.P424S		NM_001159293.1	NP_001152765.1	O75373	ZN737_HUMAN	zinc finger protein 737	424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|lung(7)|ovary(1)|stomach(1)|urinary_tract(1)	13						CACTTGAAGGGTTGCTGTCCA	0.408													g|||	1	0.000199681	0.0	0.0	5008	,	,		22677	0.0		0.001	False		,,,				2504	0.0															0			19						G	SER/PRO	0,1384		0,0,692	202.0	198.0	199.0		1270	0.8	0.2	19		199	2,3180		0,2,1589	no	missense	ZNF737	NM_001159293.1	74	0,2,2281	AA,AG,GG		0.0629,0.0,0.0438	possibly-damaging	424/537	20727739	2,4564	692	1591	2283	20519579	SO:0001583	missense	0			BC015765	CCDS54238.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	32468	protein-coding gene	gene with protein product		603984					Standard	NM_001159293		Approved	ZNF102	uc002npa.3	O75373		ENST00000427401.4:c.1270C>T	19.37:g.20727739G>A	ENSP00000395733:p.Pro424Ser	Somatic		Capture	Illumina GAIIx	4	20519579	C9JHM3	RNA	SNP	-	NULL	ENST00000427401.4	37	NULL	CCDS54238.1	19	.	.	.	.	.	.	.	.	.	.	N	8.594	0.885163	0.17540	0.0	6.29E-4	ENSG00000237440	ENST00000427401	T	0.28454	1.61	0.801	0.801	0.18679	.	.	.	.	.	T	0.31638	0.0803	L	0.53617	1.68	0.31530	N	0.661271	P	0.44690	0.841	P	0.45946	0.498	T	0.39941	-0.9589	9	0.72032	D	0.01	.	6.955	0.24565	0.0:0.0:1.0:0.0	.	424	C9JHM3	.	S	424	ENSP00000395733:P424S	ENSP00000395733:P424S	P	-	1	0	ZNF737	20519579	0.986000	0.35501	0.169000	0.22859	0.171000	0.22731	2.125000	0.42016	0.170000	0.19704	0.173000	0.16961	CCC	-	-		0.408	ZNF737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100129842	protein_coding	OTTHUMT00000447844.2	G	NM_145289		20519579	-1	no_errors	XR_042310	genbank	human	model	54_36p	rna	SNP	1.000	A
RP11-271K11.5	0	genome.wustl.edu	37	17	29377266	29377266	+	RNA	SNP	G	G	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr17:29377266G>C	ENST00000583112.1	-	0	0																		p.?(1)									AGTCCAACTTGCTCAGGAGGC	0.498																																																1	Unknown(1)	central_nervous_system(1)	17																																								26401392			646030																															17.37:g.29377266G>C		Somatic		Capture	Illumina GAIIx	4	26401392		RNA	SNP	-	NULL	ENST00000583112.1	37	NULL		17																																																																																			-	-		0.498	RP11-271K11.5-002	KNOWN	basic	processed_transcript	LOC646030	pseudogene	OTTHUMT00000444574.1	G			26401392	-1	pseudogene	XR_039347	genbank	human	model	54_36p	rna	SNP	0.005	C
OTOF	9381	genome.wustl.edu	37	2	26700092	26700092	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr2:26700092T>A	ENST00000272371.2	-	21	2597	c.2471A>T	c.(2470-2472)aAg>aTg	p.K824M	OTOF_ENST00000338581.6_Missense_Mutation_p.K77M|OTOF_ENST00000339598.3_Missense_Mutation_p.K77M|OTOF_ENST00000402415.3_Missense_Mutation_p.K134M|OTOF_ENST00000403946.3_Missense_Mutation_p.K824M	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	824					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCCTCAGCTTGTCCCGCAC	0.652																																					GBM(102;732 1451 20652 24062 31372)											0			2											27.0	30.0	29.0					2																	26700092		2184	4288	6472	26553596	SO:0001583	missense	9381			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2471A>T	2.37:g.26700092T>A	ENSP00000272371:p.Lys824Met	Somatic		Capture	Illumina GAIIx	4	26553596	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	HMMSmart_SM00239,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_C2,HMMPfam_FerI,HMMPfam_FerB	p.K824M	ENST00000272371.2	37	c.2471	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	T	15.86	2.958798	0.53400	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.81078	-1.23;-1.23;-1.18;-1.45;-1.45	4.81	4.81	0.61882	.	0.046482	0.85682	D	0.000000	T	0.81983	0.4938	L	0.43923	1.385	0.49687	D	0.999815	P;B;D;B	0.69078	0.8;0.059;0.997;0.057	B;B;P;B	0.58970	0.319;0.098;0.849;0.062	T	0.80942	-0.1157	10	0.38643	T	0.18	-35.012	10.8132	0.46559	0.0:0.0:0.1585:0.8415	.	824;77;134;77	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	M	77;77;134;824;824	ENSP00000345137:K77M;ENSP00000344521:K77M;ENSP00000383906:K134M;ENSP00000272371:K824M;ENSP00000385255:K824M	ENSP00000272371:K824M	K	-	2	0	OTOF	26553596	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.846000	0.62860	1.794000	0.52575	0.418000	0.28097	AAG	-	NULL		0.652	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	T			26553596	-1	no_errors	NM_194248	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
NF1	4763	genome.wustl.edu	37	17	29665110	29665110	+	Nonsense_Mutation	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr17:29665110C>T	ENST00000358273.4	+	45	7155	c.6772C>T	c.(6772-6774)Cga>Tga	p.R2258*	NF1_ENST00000417592.2_Intron|NF1_ENST00000356175.3_Nonsense_Mutation_p.R2237*|NF1_ENST00000444181.2_Nonsense_Mutation_p.R51*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2258					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.R2258*(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TATTAGCAAACGAGTGTCTCA	0.388			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	12	Whole gene deletion(8)|Unknown(3)|Substitution - Nonsense(1)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	17	GRCh37	CI972653|CM000815	NF1	I|M							160.0	155.0	157.0					17																	29665110		2203	4300	6503	26689236	SO:0001587	stop_gained	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6772C>T	17.37:g.29665110C>T	ENSP00000351015:p.Arg2258*	Somatic		Capture	Illumina GAIIx	4	26689236	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	HMMSmart_SM00323,superfamily_GTPase activation domain GAP,HMMPfam_RasGAP,PatternScan_RAS_GTPASE_ACTIV_1,HMMSmart_SM00516	p.R2258*	ENST00000358273.4	37	c.6772	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097915	0.76870	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181	.	.	.	5.53	4.46	0.54185	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	15.806	0.78513	0.1763:0.8237:0.0:0.0	.	.	.	.	X	2258;2237;1903;51	.	ENSP00000348498:R2237X	R	+	1	2	NF1	26689236	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.529000	0.35996	2.763000	0.94921	0.563000	0.77884	CGA	-	NULL		0.388	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	C	NM_000267		26689236	+1	no_errors	NM_001042492	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
FKBP14	55033	genome.wustl.edu	37	7	30054392	30054392	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr7:30054392T>C	ENST00000222803.5	-	4	770	c.595A>G	c.(595-597)Ata>Gta	p.I199V	AC007285.6_ENST00000422239.1_RNA|AC007285.6_ENST00000419103.1_RNA	NM_017946.3	NP_060416.1	Q9NWM8	FKB14_HUMAN	FK506 binding protein 14, 22 kDa	199	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|large_intestine(2)|lung(2)	5						CTGGCAGATATAAACCCATCT	0.358																																																0			7											107.0	101.0	103.0					7																	30054392		2202	4297	6499	30020917	SO:0001583	missense	55033			AK000738	CCDS5423.1	7p15	2014-09-17	2002-08-29		ENSG00000106080	ENSG00000106080		"""EF-hand domain containing"""	18625	protein-coding gene	gene with protein product		614505	"""FK506 binding protein 14 (22 kDa)"""			12036304	Standard	NM_017946		Approved	FLJ20731, FKBP22	uc003tal.2	Q9NWM8	OTTHUMG00000023442	ENST00000222803.5:c.595A>G	7.37:g.30054392T>C	ENSP00000222803:p.Ile199Val	Somatic		Capture	Illumina GAIIx	4	30020917		Missense_Mutation	SNP	superfamily_FKBP-like,HMMPfam_FKBP_C,superfamily_EF-hand,PatternScan_EF_HAND_1,PatternScan_ER_TARGET	p.I199V	ENST00000222803.5	37	c.595	CCDS5423.1	7	.	.	.	.	.	.	.	.	.	.	T	28.4	4.914092	0.92178	.	.	ENSG00000106080	ENST00000222803	T	0.54866	0.55	5.86	5.86	0.93980	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.70185	0.3195	M	0.69185	2.1	0.80722	D	1	D	0.58620	0.983	D	0.73708	0.981	T	0.70586	-0.4831	10	0.46703	T	0.11	-20.0578	15.0909	0.72192	0.0:0.0:0.0:1.0	.	199	Q9NWM8	FKB14_HUMAN	V	199	ENSP00000222803:I199V	ENSP00000222803:I199V	I	-	1	0	FKBP14	30020917	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.583000	0.82559	2.240000	0.73641	0.533000	0.62120	ATA	-	superfamily_EF-hand,PatternScan_EF_HAND_1		0.358	FKBP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP14	protein_coding	OTTHUMT00000214229.1	T	NM_017946		30020917	-1	no_errors	NM_017946	genbank	human	validated	54_36p	missense	SNP	1.000	C
TRIM39	56658	genome.wustl.edu	37	6	30297548	30297548	+	Splice_Site	SNP	G	G	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr6:30297548G>T	ENST00000396547.1	+	2	613		c.e2+1		TRIM39-RPP21_ENST00000513556.1_Splice_Site|TRIM39_ENST00000396551.3_Splice_Site|TRIM39_ENST00000376656.4_Splice_Site|HCG18_ENST00000413358.2_RNA|TRIM39_ENST00000376659.5_Splice_Site|TRIM39_ENST00000396548.1_Splice_Site|HCG18_ENST00000426882.1_RNA|HCG18_ENST00000412685.2_RNA|TRIM39_ENST00000540416.1_Splice_Site			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39						apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						GGAGTACAAGGTGGGGAAGCA	0.522																																																0			6											50.0	53.0	52.0					6																	30297548		1508	2707	4215	30405527	SO:0001630	splice_region_variant	56658			BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.453+1G>T	6.37:g.30297548G>T		Somatic		Capture	Illumina GAIIx	4	30405527	Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Splice_Site	SNP	-	e1+1	ENST00000396547.1	37	c.453+1	CCDS34377.1	6	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419236	0.62622	.	.	ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000248167	ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000449040;ENST00000412529;ENST00000428728;ENST00000396548;ENST00000376659;ENST00000396547;ENST00000420746;ENST00000513556	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7114	0.77631	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRIM39-RPP21;TRIM39	30405527	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	8.475000	0.90417	2.646000	0.89796	0.555000	0.69702	.	-	-		0.522	TRIM39-002	KNOWN	basic|CCDS	protein_coding	TRIM39	protein_coding	OTTHUMT00000076086.2	G	NM_172016	Intron	30405527	+1	no_errors	NM_021253	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
SETD1A	9739	genome.wustl.edu	37	16	30975449	30975449	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr16:30975449C>G	ENST00000262519.8	+	6	1360	c.674C>G	c.(673-675)gCt>gGt	p.A225G		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	225					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						TCTGACACAGCTGCCTACCCA	0.622																																																0			16											78.0	76.0	77.0					16																	30975449		2197	4300	6497	30882950	SO:0001583	missense	9739			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.674C>G	16.37:g.30975449C>G	ENSP00000262519:p.Ala225Gly	Somatic		Capture	Illumina GAIIx	4	30882950	A6NP62|Q6PIF3|Q8TAJ6	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1,superfamily_SSF82199,HMMPfam_SET,HMMSmart_SET,HMMSmart_PostSET	p.A225G	ENST00000262519.8	37	c.674	CCDS32435.1	16	.	.	.	.	.	.	.	.	.	.	C	9.134	1.012033	0.19277	.	.	ENSG00000099381	ENST00000262519;ENST00000452917	D	0.94650	-3.48	4.3	4.3	0.51218	.	0.350609	0.28940	N	0.013651	D	0.87241	0.6128	N	0.08118	0	0.28032	N	0.93409	B	0.27823	0.19	B	0.24701	0.055	T	0.81634	-0.0844	10	0.48119	T	0.1	.	15.0634	0.71973	0.0:1.0:0.0:0.0	.	225	O15047	SET1A_HUMAN	G	225	ENSP00000262519:A225G	ENSP00000262519:A225G	A	+	2	0	SETD1A	30882950	0.082000	0.21442	0.932000	0.37286	0.412000	0.31113	1.751000	0.38339	2.675000	0.91044	0.561000	0.74099	GCT	-	NULL		0.622	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	protein_coding	OTTHUMT00000318244.2	C	NM_014712		30882950	+1	no_errors	NM_014712	genbank	human	provisional	54_36p	missense	SNP	0.742	G
ZNF438	220929	genome.wustl.edu	37	10	31138940	31138940	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr10:31138940C>G	ENST00000361310.3	-	6	723	c.394G>C	c.(394-396)Gca>Cca	p.A132P	ZNF438_ENST00000452305.1_Missense_Mutation_p.A122P|ZNF438_ENST00000444692.2_Missense_Mutation_p.A122P|ZNF438_ENST00000375311.1_Intron|ZNF438_ENST00000538351.2_Missense_Mutation_p.A83P|ZNF438_ENST00000442986.1_Missense_Mutation_p.A132P|ZNF438_ENST00000436087.2_Missense_Mutation_p.A132P|ZNF438_ENST00000413025.1_Missense_Mutation_p.A132P|ZNF438_ENST00000331737.6_Missense_Mutation_p.A122P			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	132					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				TTTCTTGATGCTTTGCTATTT	0.468																																																0			10											173.0	184.0	180.0					10																	31138940		2203	4300	6503	31178946	SO:0001583	missense	220929			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.394G>C	10.37:g.31138940C>G	ENSP00000354663:p.Ala132Pro	Somatic		Capture	Illumina GAIIx	4	31178946	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.A132P	ENST00000361310.3	37	c.394	CCDS7168.1	10	.	.	.	.	.	.	.	.	.	.	C	11.31	1.599662	0.28534	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351	T;T;T;T;T;T;T;T	0.10382	2.88;2.89;2.89;2.89;2.89;2.88;2.88;2.89	5.63	2.55	0.30701	.	0.795303	0.12286	N	0.482424	T	0.05273	0.0140	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.35500	-0.9786	10	0.32370	T	0.25	-9.2274	7.02	0.24908	0.0:0.7013:0.1412:0.1575	.	132;122	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	P	122;132;132;132;132;122;122;83	ENSP00000333571:A122P;ENSP00000354663:A132P;ENSP00000406934:A132P;ENSP00000412363:A132P;ENSP00000387546:A132P;ENSP00000413060:A122P;ENSP00000410898:A122P;ENSP00000445461:A83P	ENSP00000333571:A122P	A	-	1	0	ZNF438	31178946	0.000000	0.05858	0.077000	0.20336	0.954000	0.61252	0.393000	0.20817	1.386000	0.46466	0.655000	0.94253	GCA	-	NULL		0.468	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	protein_coding	OTTHUMT00000277006.1	C	NM_182755		31178946	-1	no_errors	NM_182755	genbank	human	validated	54_36p	missense	SNP	0.011	G
LTA	4049	genome.wustl.edu	37	6	31541152	31541152	+	Silent	SNP	G	G	C	rs373019200		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr6:31541152G>C	ENST00000454783.1	+	4	558	c.300G>C	c.(298-300)ctG>ctC	p.L100L	TNF_ENST00000449264.2_5'Flank|LTA_ENST00000418386.2_Silent_p.L100L	NM_001159740.2	NP_001153212.1	P01374	TNFB_HUMAN	lymphotoxin alpha	100					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|defense response to Gram-positive bacterium (GO:0050830)|humoral immune response (GO:0006959)|lymph node development (GO:0048535)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of interferon-gamma production (GO:0032729)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|membrane (GO:0016020)	receptor binding (GO:0005102)			endometrium(2)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9					Etanercept(DB00005)	ATTCTCTCCTGGTCCCCACCA	0.572																																																0			6											118.0	102.0	107.0					6																	31541152		2203	4300	6503	31649131	SO:0001819	synonymous_variant	4049			X01393	CCDS4701.1	6p21.3	2013-05-22	2013-05-22		ENSG00000226979	ENSG00000226979		"""Tumor necrosis factor (ligand) superfamily"""	6709	protein-coding gene	gene with protein product	"""TNF superfamily member 1"""	153440	"""lymphotoxin alpha (TNF superfamily, member 1)"""	TNFB		2995927, 3001529	Standard	NM_001159740		Approved	TNFSF1, LT	uc011dnu.2	P01374	OTTHUMG00000031135	ENST00000454783.1:c.300G>C	6.37:g.31541152G>C		Somatic		Capture	Illumina GAIIx	4	31649131	Q8N4C3|Q9UKS8	Silent	SNP	superfamily_TNF-like,HMMSmart_SM00207,HMMPfam_TNF,PatternScan_TNF_1	p.L100	ENST00000454783.1	37	c.300	CCDS4701.1	6																																																																																			-	superfamily_TNF-like,HMMSmart_SM00207,HMMPfam_TNF,PatternScan_TNF_1		0.572	LTA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LTA	protein_coding	OTTHUMT00000259097.1	G			31649131	+1	no_errors	NM_000595	genbank	human	reviewed	54_36p	silent	SNP	0.998	C
TESK1	7016	genome.wustl.edu	37	9	35609518	35609518	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr9:35609518C>A	ENST00000336395.5	+	10	1910	c.1660C>A	c.(1660-1662)Cca>Aca	p.P554T	TESK1_ENST00000498522.1_3'UTR|MIR4667_ENST00000578933.1_RNA|CD72_ENST00000490239.1_5'Flank	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	554					cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AGAACCCTCGCCACCCCCTTC	0.711																																																0			9											29.0	36.0	33.0					9																	35609518		2190	4292	6482	35599518	SO:0001583	missense	7016			D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.1660C>A	9.37:g.35609518C>A	ENSP00000338127:p.Pro554Thr	Somatic		Capture	Illumina GAIIx	4	35599518	Q8IXZ8	Missense_Mutation	SNP	superfamily_Kinase_like,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.P554T	ENST00000336395.5	37	c.1660	CCDS6580.1	9	.	.	.	.	.	.	.	.	.	.	C	5.299	0.240537	0.10023	.	.	ENSG00000107140	ENST00000535770;ENST00000336395	T	0.73681	-0.77	5.06	4.13	0.48395	.	0.000000	0.43110	D	0.000617	T	0.55081	0.1898	N	0.14661	0.345	0.09310	N	1	B;B	0.14438	0.01;0.004	B;B	0.10450	0.005;0.003	T	0.34800	-0.9814	10	0.20046	T	0.44	-11.3461	11.6906	0.51514	0.3131:0.6869:0.0:0.0	.	472;554	B4DQQ3;Q15569	.;TESK1_HUMAN	T	85;554	ENSP00000338127:P554T	ENSP00000338127:P554T	P	+	1	0	TESK1	35599518	0.959000	0.32827	0.856000	0.33681	0.598000	0.36846	3.807000	0.55591	2.333000	0.79357	0.563000	0.77884	CCA	-	NULL		0.711	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK1	protein_coding	OTTHUMT00000052314.1	C	NM_006285		35599518	+1	no_errors	NM_006285	genbank	human	reviewed	54_36p	missense	SNP	0.995	A
MAPK14	1432	genome.wustl.edu	37	6	36075286	36075286	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr6:36075286C>T	ENST00000229794.4	+	11	1284	c.896C>T	c.(895-897)gCg>gTg	p.A299V	MAPK14_ENST00000468133.1_Missense_Mutation_p.A222V|MAPK14_ENST00000310795.4_Missense_Mutation_p.R273W|MAPK14_ENST00000229795.3_Missense_Mutation_p.A299V	NM_139012.2|NM_139014.2	NP_620581.1|NP_620583.1	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14	299	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cartilage condensation (GO:0001502)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to ionizing radiation (GO:0071479)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chemotaxis (GO:0006935)|chondrocyte differentiation (GO:0002062)|DNA damage checkpoint (GO:0000077)|fatty acid oxidation (GO:0019395)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoclast differentiation (GO:0030316)|p38MAPK cascade (GO:0038066)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to muramyl dipeptide (GO:0032495)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|signal transduction in response to DNA damage (GO:0042770)|skeletal muscle tissue development (GO:0007519)|stress-activated MAPK cascade (GO:0051403)|stress-induced premature senescence (GO:0090400)|striated muscle cell differentiation (GO:0051146)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|MAP kinase kinase activity (GO:0004708)|NFAT protein binding (GO:0051525)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|stomach(1)	16						AGAATTACAGCGGCCCAAGCC	0.463																																					Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)											0			6											170.0	160.0	164.0					6																	36075286		2203	4300	6503	36183264	SO:0001583	missense	1432			L35263	CCDS4815.1, CCDS4816.1, CCDS4817.1	6p21.3-p21.2	2011-06-09			ENSG00000112062	ENSG00000112062		"""Mitogen-activated protein kinase cascade / Kinases"""	6876	protein-coding gene	gene with protein product	"""p38 MAP kinase"""	600289		CSPB1, CSBP1, CSBP2		7997261	Standard	NM_139012		Approved	PRKM14, p38, Mxi2, PRKM15	uc003olq.3	Q16539	OTTHUMG00000159806	ENST00000229794.4:c.896C>T	6.37:g.36075286C>T	ENSP00000229794:p.Ala299Val	Somatic		Capture	Illumina GAIIx	4	36183264	A6ZJ92|A8K6P4|B0LPH0|B5TY32|O60776|Q13083|Q14084|Q8TDX0	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_MAPK	p.A299V	ENST00000229794.4	37	c.896	CCDS4816.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	5.978250|5.978250	0.97168|0.97168	.|.	.|.	ENSG00000112062|ENSG00000112062	ENST00000229795;ENST00000229794;ENST00000468133|ENST00000310795	T;T;T|T	0.69040|0.14266	-0.37;-0.37;-0.37|2.52	5.96|5.96	5.96|5.96	0.96718|0.96718	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.11024|0.11024	0.0269|0.0269	.|.	.|.	.|.	0.50632|0.50632	D|D	0.999888|0.999888	D;D|P	0.89917|0.47350	1.0;0.996|0.894	D;P|B	0.97110|0.39840	1.0;0.606|0.311	T|T	0.02404|0.02404	-1.1164|-1.1164	9|8	0.87932|0.87932	D|D	0|0	-8.2225|-8.2225	20.4192|20.4192	0.99033|0.99033	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	299;299|273	Q16539;Q16539-2|Q16539-4	MK14_HUMAN;.|.	V|W	299;299;222|273	ENSP00000229795:A299V;ENSP00000229794:A299V;ENSP00000419837:A222V|ENSP00000308669:R273W	ENSP00000229794:A299V|ENSP00000308669:R273W	A|R	+|+	2|1	0|2	MAPK14|MAPK14	36183264|36183264	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	7.818000|7.818000	0.86416|0.86416	2.831000|2.831000	0.97527|0.97527	0.650000|0.650000	0.86243|0.86243	GCG|CGG	-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.463	MAPK14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPK14	protein_coding	OTTHUMT00000357450.1	C	NM_001315		36183264	+1	no_errors	NM_001315	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
GRIK3	2899	genome.wustl.edu	37	1	37291203	37291203	+	Splice_Site	SNP	C	C	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:37291203C>A	ENST00000373091.3	-	11	1771		c.e11+1		GRIK3_ENST00000373093.4_Splice_Site	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				AATTGCCTTACCTGGCGATGA	0.582																																																0			1											56.0	54.0	55.0					1																	37291203		2203	4300	6503	37063790	SO:0001630	splice_region_variant	2899			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1754+1G>T	1.37:g.37291203C>A		Somatic		Capture	Illumina GAIIx	4	37063790	A9Z1Z8|B1AMS6|Q13004|Q16136	Splice_Site	SNP	-	e11+1	ENST00000373091.3	37	c.1754+1	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811830	0.90707	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0292	0.92948	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GRIK3	37063790	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.720000	0.84759	2.492000	0.84095	0.563000	0.77884	.	-	-		0.582	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	protein_coding	OTTHUMT00000012053.1	C	NM_000831	Intron	37063790	-1	no_errors	NM_000831	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
PAK6	56924	genome.wustl.edu	37	15	40558489	40558489	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr15:40558489G>A	ENST00000542403.2	+	3	762	c.651G>A	c.(649-651)atG>atA	p.M217I	PAK6_ENST00000260404.4_Missense_Mutation_p.M217I|PAK6_ENST00000560346.1_Missense_Mutation_p.M217I|PAK6_ENST00000441369.1_Missense_Mutation_p.M217I|PAK6_ENST00000455577.2_Missense_Mutation_p.M217I|PAK6_ENST00000559901.1_3'UTR|RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000453867.1_Missense_Mutation_p.M217I	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	217	Linker.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		GGCATGGAATGAAGGCTGCCA	0.667																																																0			15											19.0	22.0	21.0					15																	40558489		2193	4286	6479	38345781	SO:0001583	missense	56924			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.651G>A	15.37:g.40558489G>A	ENSP00000439597:p.Met217Ile	Somatic		Capture	Illumina GAIIx	4	38345781	A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	HMMPfam_PBD,HMMSmart_SM00285,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP	p.M217I	ENST00000542403.2	37	c.651	CCDS10054.1	15	.	.	.	.	.	.	.	.	.	.	G	8.072	0.770480	0.15983	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000455577;ENST00000260404;ENST00000542403	T;T;T;T;T	0.72835	-0.66;-0.66;-0.69;-0.66;-0.66	5.47	2.38	0.29361	.	1.427710	0.04413	N	0.366363	T	0.53318	0.1789	N	0.08118	0	0.21915	N	0.999476	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.42616	-0.9441	10	0.38643	T	0.18	.	9.6609	0.39954	0.1154:0.4507:0.4339:0.0	.	217;217	Q9NQU5;G5E9R2	PAK6_HUMAN;.	I	217	ENSP00000406873:M217I;ENSP00000401153:M217I;ENSP00000409465:M217I;ENSP00000260404:M217I;ENSP00000439597:M217I	ENSP00000260404:M217I	M	+	3	0	PAK6	38345781	0.253000	0.23982	0.210000	0.23637	0.314000	0.28054	0.028000	0.13644	0.683000	0.31428	0.555000	0.69702	ATG	-	NULL		0.667	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PAK6	protein_coding	OTTHUMT00000418355.1	G			38345781	+1	no_errors	NM_020168	genbank	human	reviewed	54_36p	missense	SNP	0.251	A
CNTNAP3	79937	genome.wustl.edu	37	9	39109165	39109165	+	Missense_Mutation	SNP	C	C	T	rs201209922		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr9:39109165C>T	ENST00000297668.6	-	15	2430	c.2357G>A	c.(2356-2358)cGc>cAc	p.R786H	CNTNAP3_ENST00000358144.2_Missense_Mutation_p.R698H|CNTNAP3_ENST00000377656.2_Missense_Mutation_p.R785H	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	786	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		ACGATCTCCGCGGCAGAGCAG	0.448																																																0			9						T	HIS/ARG	0,4406		0,0,2203	47.0	43.0	44.0		2357	-6.0	0.0	9		44	2,8598	2.2+/-6.3	0,2,4298	no	missense	CNTNAP3	NM_033655.3	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	786/1289	39109165	2,13004	2203	4300	6503	39099165	SO:0001583	missense	79937			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.2357G>A	9.37:g.39109165C>T	ENSP00000297668:p.Arg786His	Somatic		Capture	Illumina GAIIx	4	39099165	B1AMA0|Q9C0E9	Missense_Mutation	SNP	HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00181,HMMPfam_EGF,superfamily_Fibrinogen C-terminal domain-like,PatternScan_GLYCO_HORMONE_BETA_1	p.R786H	ENST00000297668.6	37	c.2357	CCDS6616.1	9	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.731735	0.00687	0.0	2.33E-4	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000358144	T;T;T	0.79554	2.26;-1.28;2.26	2.99	-5.98	0.02220	.	.	.	.	.	T	0.62600	0.2441	L	0.31120	0.905	0.22989	N	0.998465	B;B;B	0.16603	0.002;0.018;0.007	B;B;B	0.11329	0.002;0.006;0.002	T	0.44097	-0.9350	9	0.15952	T	0.53	.	7.1764	0.25747	0.0:0.4892:0.117:0.3937	.	786;785;786	Q9BZ76-2;A6NC89;Q9BZ76	.;.;CNTP3_HUMAN	H	786;785;698	ENSP00000297668:R786H;ENSP00000366884:R785H;ENSP00000350863:R698H	ENSP00000297668:R786H	R	-	2	0	CNTNAP3	39099165	0.000000	0.05858	0.010000	0.14722	0.025000	0.11179	-0.457000	0.06745	-2.729000	0.00385	-2.620000	0.00156	CGC	-	superfamily_Concanavalin A-like lectins/glucanases		0.448	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3	protein_coding	OTTHUMT00000052511.1	C	NM_033655		39099165	-1	no_errors	NM_033655	genbank	human	reviewed	54_36p	missense	SNP	0.003	T
CNTN1	1272	genome.wustl.edu	37	12	41316223	41316223	+	Silent	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr12:41316223C>T	ENST00000551295.2	+	5	510	c.393C>T	c.(391-393)agC>agT	p.S131S	CNTN1_ENST00000360099.3_Silent_p.S131S|CNTN1_ENST00000547849.1_Silent_p.S131S|CNTN1_ENST00000347616.1_Silent_p.S131S|CNTN1_ENST00000547702.1_Silent_p.S131S|CNTN1_ENST00000348761.2_Silent_p.S120S	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	131	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				CAACCCTGAGCTTTGGATGTA	0.403																																																0			12											100.0	90.0	93.0					12																	41316223		2203	4300	6503	39602490	SO:0001819	synonymous_variant	1272			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.393C>T	12.37:g.41316223C>T		Somatic		Capture	Illumina GAIIx	4	39602490	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_V-set,PatternScan_N6_MTASE,HMMPfam_I-set,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.S131	ENST00000551295.2	37	c.393	CCDS8737.1	12																																																																																			-	superfamily_Immunoglobulin,HMMSmart_SM00409		0.403	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	protein_coding	OTTHUMT00000403692.2	C	NM_001843		39602490	+1	no_errors	NM_001843	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
HKR1	284459	genome.wustl.edu	37	19	37853871	37853871	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr19:37853871C>G	ENST00000324411.4	+	6	1443	c.1174C>G	c.(1174-1176)Cgt>Ggt	p.R392G	HKR1_ENST00000541583.2_Missense_Mutation_p.R331G|HKR1_ENST00000544914.1_Missense_Mutation_p.R119G|HKR1_ENST00000591471.1_Missense_Mutation_p.R119G|HKR1_ENST00000589392.1_Missense_Mutation_p.R374G|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000392153.3_Missense_Mutation_p.R373G	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	392					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGAATGTGGGCGTGGCTTTCG	0.527																																																0			19											97.0	93.0	95.0					19																	37853871		2203	4300	6503	42545711	SO:0001583	missense	284459			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1174C>G	19.37:g.37853871C>G	ENSP00000315505:p.Arg392Gly	Somatic		Capture	Illumina GAIIx	4	42545711	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.R392G	ENST00000324411.4	37	c.1174	CCDS12502.1	19	.	.	.	.	.	.	.	.	.	.	C	9.293	1.051036	0.19827	.	.	ENSG00000181666	ENST00000544914;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T;T	0.19532	2.14;2.14;2.14;2.14	3.22	-0.711	0.11230	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.28995	0.0720	M	0.74881	2.28	0.21386	N	0.999702	P;B;D;B	0.54207	0.638;0.009;0.965;0.011	P;B;P;B	0.50231	0.499;0.018;0.635;0.03	T	0.17198	-1.0377	9	0.87932	D	0	.	4.8926	0.13735	0.5786:0.2988:0.0:0.1226	.	331;373;392;374	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	G	119;373;428;392;331	ENSP00000437774:R119G;ENSP00000375994:R373G;ENSP00000315505:R392G;ENSP00000438261:R331G	ENSP00000315505:R392G	R	+	1	0	HKR1	42545711	0.001000	0.12720	0.090000	0.20809	0.781000	0.44180	1.002000	0.29796	0.169000	0.19679	0.650000	0.86243	CGT	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.527	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HKR1	protein_coding	OTTHUMT00000458375.1	C	NM_181786		42545711	+1	no_errors	NM_181786	genbank	human	provisional	54_36p	missense	SNP	0.927	G
RET	5979	genome.wustl.edu	37	10	43600516	43600516	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr10:43600516G>A	ENST00000355710.3	+	4	974	c.742G>A	c.(742-744)Ggc>Agc	p.G248S	RET_ENST00000340058.5_Missense_Mutation_p.G248S	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	248	Cadherin. {ECO:0000255|PROSITE- ProRule:PRU00043}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CGTGCACGCCGGCGCGCGCGA	0.741		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0			10											38.0	36.0	37.0					10																	43600516		2200	4297	6497	42920522	SO:0001583	missense	5979	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.742G>A	10.37:g.43600516G>A	ENSP00000347942:p.Gly248Ser	Somatic		Capture	Illumina GAIIx	4	42920522	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.G248S	ENST00000355710.3	37	c.742	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	g	8.477	0.858800	0.17178	.	.	ENSG00000165731	ENST00000355710;ENST00000340058;ENST00000535749	T;T	0.51325	0.71;0.71	5.01	2.11	0.27256	Cadherin (4);Cadherin-like (1);	0.632770	0.17731	N	0.163897	T	0.30135	0.0755	L	0.39633	1.23	0.09310	N	1	B;B	0.18310	0.027;0.005	B;B	0.21708	0.036;0.01	T	0.21827	-1.0234	10	0.10377	T	0.69	.	3.2593	0.06843	0.1511:0.1373:0.5698:0.1418	.	248;248	P07949;P07949-2	RET_HUMAN;.	S	248	ENSP00000347942:G248S;ENSP00000344798:G248S	ENSP00000344798:G248S	G	+	1	0	RET	42920522	0.944000	0.32072	0.002000	0.10522	0.096000	0.18686	1.690000	0.37711	0.287000	0.22375	-0.273000	0.10243	GGC	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.741	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	protein_coding	OTTHUMT00000047694.2	G	NM_020975		42920522	+1	no_errors	NM_020975	genbank	human	reviewed	54_36p	missense	SNP	0.003	A
YIF1B	90522	genome.wustl.edu	37	19	38800255	38800255	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr19:38800255C>G	ENST00000339413.6	-	2	132	c.87G>C	c.(85-87)caG>caC	p.Q29H	YIF1B_ENST00000392124.3_5'UTR|YIF1B_ENST00000591755.1_Missense_Mutation_p.Q26H|YIF1B_ENST00000587361.1_5'UTR|YIF1B_ENST00000592694.1_5'UTR|YIF1B_ENST00000337679.8_Missense_Mutation_p.Q26H|YIF1B_ENST00000591784.1_5'UTR|YIF1B_ENST00000329420.8_Missense_Mutation_p.Q14H|YIF1B_ENST00000592246.1_5'UTR	NM_001039672.2|NM_001039673.2	NP_001034761.1|NP_001034762.1	Q5BJH7	YIF1B_HUMAN	Yip1 interacting factor homolog B (S. cerevisiae)	29						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)	10	all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCATGCCCGGCTGGGACACAG	0.622																																																0			19											23.0	25.0	24.0					19																	38800255		2196	4294	6490	43492095	SO:0001583	missense	90522			AL833382	CCDS12512.1, CCDS33010.1, CCDS46066.1, CCDS46067.1	19q13.2	2008-02-05							30511	protein-coding gene	gene with protein product						12975309	Standard	NM_001039672		Approved	FinGER8	uc002ohz.2	Q5BJH7		ENST00000339413.6:c.87G>C	19.37:g.38800255C>G	ENSP00000343435:p.Gln29His	Somatic		Capture	Illumina GAIIx	4	43492095	H7BXS8|Q5JPC2|Q8WY70|Q96C02|Q96IC4	Missense_Mutation	SNP	HMMPfam_YIF1	p.Q29H	ENST00000339413.6	37	c.87	CCDS33010.1	19	.	.	.	.	.	.	.	.	.	.	C	11.43	1.637803	0.29157	.	.	ENSG00000167645	ENST00000339413;ENST00000329420;ENST00000337679	T;T;T	0.56611	0.85;0.87;0.45	4.57	1.22	0.21188	.	0.510880	0.20009	N	0.101162	T	0.29458	0.0734	N	0.22421	0.69	0.27477	N	0.952697	B;B;B;B;B	0.24823	0.004;0.001;0.0;0.0;0.112	B;B;B;B;B	0.20184	0.004;0.002;0.0;0.001;0.028	T	0.10590	-1.0623	10	0.39692	T	0.17	-21.1062	1.2968	0.02071	0.177:0.4516:0.1723:0.1991	.	26;26;29;26;26	Q5BJH7-5;Q5BJH7-4;Q5BJH7;Q5BJH7-3;B7Z961	.;.;YIF1B_HUMAN;.;.	H	29;14;26	ENSP00000343435:Q29H;ENSP00000329559:Q14H;ENSP00000337411:Q26H	ENSP00000329559:Q14H	Q	-	3	2	YIF1B	43492095	1.000000	0.71417	0.980000	0.43619	0.991000	0.79684	0.742000	0.26216	0.173000	0.19788	0.442000	0.29010	CAG	-	NULL		0.622	YIF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIF1B	protein_coding	OTTHUMT00000460511.1	C	NM_033557		43492095	-1	no_errors	NM_001039672	genbank	human	validated	54_36p	missense	SNP	0.946	G
PTPRF	5792	genome.wustl.edu	37	1	44070598	44070598	+	Missense_Mutation	SNP	C	C	T	rs147874335		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:44070598C>T	ENST00000359947.4	+	17	3402	c.3062C>T	c.(3061-3063)gCg>gTg	p.A1021V	PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000438120.1_Missense_Mutation_p.A1012V|PTPRF_ENST00000372414.3_Missense_Mutation_p.A1021V|PTPRF_ENST00000422171.2_Missense_Mutation_p.A369V|PTPRF_ENST00000372413.3_Missense_Mutation_p.A1012V	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1021	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TTCCGGGTGGCGGCTGCAATG	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21066	0.0		0.0	False		,,,				2504	0.0															0			1						C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	117.0	120.0	119.0		3062,3035	1.3	0.9	1	dbSNP_134	119	5,8595	4.3+/-15.6	0,5,4295	yes	missense,missense	PTPRF	NM_002840.3,NM_130440.2	64,64	0,5,6498	TT,TC,CC		0.0581,0.0,0.0384	benign,benign	1021/1908,1012/1899	44070598	5,13001	2203	4300	6503	43843185	SO:0001583	missense	5792			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.3062C>T	1.37:g.44070598C>T	ENSP00000353030:p.Ala1021Val	Somatic		Capture	Illumina GAIIx	4	43843185	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.A1021V	ENST00000359947.4	37	c.3062	CCDS489.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.87|14.87	2.665441|2.665441	0.47677|0.47677	0.0|0.0	5.81E-4|5.81E-4	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407|ENST00000429895	T;T;T;T;T;T|.	0.51574|.	0.7;0.7;0.7;0.7;0.7;0.71|.	4.91|4.91	1.28|1.28	0.21552|0.21552	Fibronectin, type III (3);Immunoglobulin-like fold (1);|.	0.259629|.	0.20302|.	N|.	0.095002|.	T|T	0.26085|0.26085	0.0636|0.0636	N|N	0.14661|0.14661	0.345|0.345	0.29885|0.29885	N|N	0.825714|0.825714	B;B;B;D;P|.	0.69078|.	0.007;0.0;0.01;0.997;0.531|.	B;B;B;P;B|.	0.55345|.	0.003;0.001;0.006;0.774;0.109|.	T|T	0.29150|0.29150	-1.0021|-1.0021	10|5	0.27785|.	T|.	0.31|.	.|.	9.2697|9.2697	0.37664|0.37664	0.6451:0.2479:0.107:0.0|0.6451:0.2479:0.107:0.0	.|.	666;369;587;1012;1021|.	Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586|.	.;.;.;.;PTPRF_HUMAN|.	V|W	1021;1012;1021;1012;369;82|667	ENSP00000353030:A1021V;ENSP00000398822:A1012V;ENSP00000361491:A1021V;ENSP00000361490:A1012V;ENSP00000387885:A369V;ENSP00000361484:A82V|.	ENSP00000353030:A1021V|.	A|R	+|+	2|1	0|2	PTPRF|PTPRF	43843185|43843185	0.540000|0.540000	0.26410|0.26410	0.896000|0.896000	0.35187|0.35187	0.967000|0.967000	0.64934|0.64934	1.325000|1.325000	0.33724|0.33724	0.546000|0.546000	0.28920|0.28920	0.491000|0.491000	0.48974|0.48974	GCG|CGG	-	HMMSmart_SM00060,superfamily_Fibronectin type III		0.562	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	protein_coding	OTTHUMT00000019710.1	C			43843185	+1	no_errors	NM_002840	genbank	human	reviewed	54_36p	missense	SNP	0.510	T
FCGBP	8857	genome.wustl.edu	37	19	40433851	40433851	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr19:40433851C>T	ENST00000221347.6	-	2	425	c.418G>A	c.(418-420)Ggc>Agc	p.G140S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	140	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TACTCGGTGCCTAGGGCCTGG	0.607																																																0			19											58.0	51.0	54.0					19																	40433851		2203	4300	6503	45125691	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.418G>A	19.37:g.40433851C>T	ENSP00000221347:p.Gly140Ser	Somatic		Capture	Illumina GAIIx	4	45125691	O95784	Missense_Mutation	SNP	HMMSmart_FOLN,HMMSmart_VWD,HMMPfam_VWD,HMMPfam_C8,superfamily_Cysrich_TIL,HMMPfam_TIL,HMMPfam_TIL_assoc,HMMSmart_VWC	p.G140S	ENST00000221347.6	37	c.418	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	15.29	2.788377	0.49997	.	.	ENSG00000090920	ENST00000221347	T	0.36157	1.27	4.13	4.13	0.48395	.	0.000000	0.64402	D	0.000006	T	0.54498	0.1862	L	0.51914	1.62	0.36709	D	0.880561	D	0.89917	1.0	D	0.91635	0.999	T	0.63976	-0.6515	10	0.87932	D	0	.	16.3742	0.83379	0.0:1.0:0.0:0.0	.	140	Q9Y6R7	FCGBP_HUMAN	S	140	ENSP00000221347:G140S	ENSP00000221347:G140S	G	-	1	0	FCGBP	45125691	1.000000	0.71417	1.000000	0.80357	0.324000	0.28378	6.302000	0.72788	2.603000	0.88011	0.655000	0.94253	GGC	-	NULL		0.607	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	C	NM_003890		45125691	-1	no_errors	NM_003890	genbank	human	validated	54_36p	missense	SNP	1.000	T
CORIN	10699	genome.wustl.edu	37	4	47605609	47605609	+	Missense_Mutation	SNP	G	G	A	rs571162211		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr4:47605609G>A	ENST00000273857.4	-	20	2616	c.2617C>T	c.(2617-2619)Cgc>Tgc	p.R873C	CORIN_ENST00000508498.1_Missense_Mutation_p.R734C|CORIN_ENST00000502252.1_Missense_Mutation_p.R806C|CORIN_ENST00000505909.1_Missense_Mutation_p.R836C	NM_006587.2	NP_006578.2	Q9Y5Q5	CORIN_HUMAN	corin, serine peptidase	873	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				female pregnancy (GO:0007565)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by atrial natriuretic peptide (GO:0003050)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(18)|lung(39)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	79						TTCACAAAGCGTGTCTGCATG	0.463																																																0			4											154.0	130.0	138.0					4																	47605609		2203	4300	6503	47300366	SO:0001583	missense	10699			AF133845	CCDS3477.1, CCDS63958.1, CCDS75122.1	4p13-p12	2011-08-31	2005-08-17		ENSG00000145244	ENSG00000145244		"""Serine peptidases / Transmembrane"""	19012	protein-coding gene	gene with protein product		605236	"""corin, serine protease"""			10329693	Standard	NM_006587		Approved	PRSC, CRN, ATC2, Lrp4, TMPRSS10	uc003gxm.3	Q9Y5Q5	OTTHUMG00000099441	ENST00000273857.4:c.2617C>T	4.37:g.47605609G>A	ENSP00000273857:p.Arg873Cys	Somatic		Capture	Illumina GAIIx	4	47300366	B0ZBE3|Q2TBD2|Q4W5E5|Q4W5G6|Q9UHY2	Missense_Mutation	SNP	HMMPfam_Fz,superfamily_Frizzled cysteine-rich domain,HMMSmart_SM00063,superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,superfamily_SRCR-like,HMMSmart_SM00202,superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_SRCR_1,PatternScan_TRYPSIN_SER	p.R873C	ENST00000273857.4	37	c.2617	CCDS3477.1	4	.	.	.	.	.	.	.	.	.	.	G	13.11	2.138906	0.37728	.	.	ENSG00000145244	ENST00000273857;ENST00000508498;ENST00000502252;ENST00000505909	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	6.08	4.35	0.52113	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.452531	0.24866	N	0.034969	T	0.68329	0.2989	L	0.55481	1.735	0.58432	D	0.999994	D;D	0.89917	1.0;0.998	D;P	0.70716	0.97;0.873	T	0.65569	-0.6136	10	0.39692	T	0.17	.	11.2827	0.49203	0.0652:0.0:0.8066:0.1282	.	806;873	B4E1Y7;Q9Y5Q5	.;CORIN_HUMAN	C	873;734;806;836	ENSP00000273857:R873C;ENSP00000425597:R734C;ENSP00000424212:R806C;ENSP00000425401:R836C	ENSP00000273857:R873C	R	-	1	0	CORIN	47300366	0.956000	0.32656	0.011000	0.14972	0.072000	0.16883	3.507000	0.53371	0.882000	0.36016	0.655000	0.94253	CGC	-	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin		0.463	CORIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORIN	protein_coding	OTTHUMT00000216906.2	G			47300366	-1	no_errors	NM_006587	genbank	human	reviewed	54_36p	missense	SNP	0.150	A
COX14	84987	genome.wustl.edu	37	12	50513995	50513995	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr12:50513995A>T	ENST00000550487.1	+	2	500	c.169A>T	c.(169-171)Atg>Ttg	p.M57L	COX14_ENST00000317943.2_Missense_Mutation_p.M57L|COX14_ENST00000550654.1_Missense_Mutation_p.M57L|RP4-605O3.4_ENST00000552815.1_RNA|COX14_ENST00000548985.1_Missense_Mutation_p.M57L	NM_001257134.1|NM_032901.3	NP_001244063.1|NP_116290.1	Q96I36	COX14_HUMAN	cytochrome c oxidase assembly homolog 14 (S. cerevisiae)	57					mitochondrial respiratory chain complex IV assembly (GO:0033617)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											CTCAGGAATCATGTAGAACTG	0.567																																																0			12											50.0	46.0	48.0					12																	50513995		2203	4300	6503	48800262	SO:0001583	missense	84987				CCDS8800.1	12q13.12	2012-10-15	2012-10-15	2012-02-23		ENSG00000178449		"""Mitochondrial respiratory chain complex assembly factors"""	28216	protein-coding gene	gene with protein product		614478	"""chromosome 12 open reading frame 62"", ""COX14 cytochrome c oxidase assembly homolog (S. cerevisiae)"""	C12orf62		22243966, 22356826	Standard	NM_032901		Approved	MGC14288	uc031qhh.1	Q96I36		ENST00000550487.1:c.169A>T	12.37:g.50513995A>T	ENSP00000446524:p.Met57Leu	Somatic		Capture	Illumina GAIIx	4	48800262	B2R5G6	Missense_Mutation	SNP	NULL	p.M57L	ENST00000550487.1	37	c.169	CCDS8800.1	12	.	.	.	.	.	.	.	.	.	.	A	4.290	0.052940	0.08291	.	.	ENSG00000178449	ENST00000550487;ENST00000317943;ENST00000550654;ENST00000548985	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.55	2.77	0.32553	.	0.696719	0.11869	N	0.521588	T	0.41096	0.1144	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33059	-0.9883	9	0.02654	T	1	.	5.5759	0.17222	0.1591:0.6754:0.0:0.1655	.	57	Q96I36	CL062_HUMAN	L	57	ENSP00000446524:M57L;ENSP00000326052:M57L;ENSP00000450331:M57L;ENSP00000447776:M57L	ENSP00000326052:M57L	M	+	1	0	C12orf62	48800262	0.405000	0.25336	0.002000	0.10522	0.405000	0.30901	0.479000	0.22228	0.412000	0.25729	-0.830000	0.03078	ATG	-	NULL		0.567	COX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf62	protein_coding	OTTHUMT00000406024.2	A	NM_032901		48800262	+1	no_errors	NM_032901	genbank	human	predicted	54_36p	missense	SNP	0.065	T
USP4	7375	genome.wustl.edu	37	3	49377436	49377436	+	Missense_Mutation	SNP	G	G	A	rs143533593		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr3:49377436G>A	ENST00000265560.4	-	1	68	c.22C>T	c.(22-24)Cgt>Tgt	p.R8C	USP4_ENST00000415188.1_Missense_Mutation_p.R8C|USP4_ENST00000416417.1_Missense_Mutation_p.R8C|USP4_ENST00000351842.4_Missense_Mutation_p.R8C	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	8					negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R8C(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		GGTCGCTCACGGCAGCCTCCA	0.706																																																1	Substitution - Missense(1)	prostate(1)	3											37.0	40.0	39.0					3																	49377436		2203	4300	6503	49352440	SO:0001583	missense	7375			U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.22C>T	3.37:g.49377436G>A	ENSP00000265560:p.Arg8Cys	Somatic		Capture	Illumina GAIIx	4	49352440	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	HMMSmart_SM00695,HMMPfam_DUF1055,superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.R8C	ENST00000265560.4	37	c.22	CCDS2793.1	3	.	.	.	.	.	.	.	.	.	.	G	9.773	1.173200	0.21704	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.31247	2.01;2.14;1.5	4.83	-8.97	0.00758	.	0.732656	0.11760	U	0.532125	T	0.09247	0.0228	N	0.08118	0	0.09310	N	0.999997	P;B	0.40970	0.734;0.0	B;B	0.33196	0.159;0.0	T	0.25572	-1.0128	10	0.52906	T	0.07	2.0E-4	6.0424	0.19742	0.2657:0.513:0.1365:0.0849	.	8;8	Q13107-2;Q13107	.;UBP4_HUMAN	C	8	ENSP00000341028:R8C;ENSP00000265560:R8C;ENSP00000400623:R8C	ENSP00000265560:R8C	R	-	1	0	USP4	49352440	0.996000	0.38824	0.000000	0.03702	0.021000	0.10359	0.926000	0.28804	-1.777000	0.01283	-1.687000	0.00730	CGT	-	NULL		0.706	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP4	protein_coding	OTTHUMT00000346069.1	G	NM_199443		49352440	-1	no_errors	NM_003363	genbank	human	validated	54_36p	missense	SNP	0.111	A
RBM6	10180	genome.wustl.edu	37	3	50005100	50005100	+	Missense_Mutation	SNP	C	C	T	rs374876120		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr3:50005100C>T	ENST00000266022.4	+	3	501	c.242C>T	c.(241-243)cCg>cTg	p.P81L	RBM6_ENST00000442092.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000443081.1_5'UTR|RBM6_ENST00000441115.1_Intron|RBM6_ENST00000539992.1_Intron	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	81					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		AGAGACGGACCGCATGGTGAC	0.512																																																0			3						C	,LEU/PRO	0,4406		0,0,2203	92.0	98.0	96.0		,242	2.3	0.2	3		96	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	RBM6	NM_001167582.1,NM_005777.2	,98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,benign	,81/1124	50005100	1,13005	2203	4300	6503	49980104	SO:0001583	missense	10180			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.242C>T	3.37:g.50005100C>T	ENSP00000266022:p.Pro81Leu	Somatic		Capture	Illumina GAIIx	4	49980104	O60549|O75524|Q86SS3	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMSmart_ZnF_C2H2,HMMSmart_G_patch,HMMPfam_G-patch	p.P81L	ENST00000266022.4	37	c.242	CCDS2809.1	3	.	.	.	.	.	.	.	.	.	.	C	3.192	-0.165605	0.06461	0.0	1.16E-4	ENSG00000004534	ENST00000266022;ENST00000416583	T	0.30448	1.53	6.04	2.27	0.28462	.	0.293824	0.33180	N	0.005191	T	0.21801	0.0525	L	0.43152	1.355	0.58432	D	0.999999	B	0.09022	0.002	B	0.04013	0.001	T	0.06991	-1.0796	9	.	.	.	0.1344	7.404	0.26981	0.1244:0.6881:0.0:0.1875	.	81	P78332	RBM6_HUMAN	L	81	ENSP00000266022:P81L	.	P	+	2	0	RBM6	49980104	0.236000	0.23804	0.215000	0.23724	0.980000	0.70556	0.577000	0.23758	0.135000	0.18707	0.561000	0.74099	CCG	-	NULL		0.512	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	protein_coding	OTTHUMT00000345528.4	C	NM_005777		49980104	+1	no_errors	NM_005777	genbank	human	provisional	54_36p	missense	SNP	0.858	T
KRT79	338785	genome.wustl.edu	37	12	53224025	53224025	+	Silent	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr12:53224025C>G	ENST00000330553.5	-	3	784	c.750G>C	c.(748-750)gtG>gtC	p.V250V		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	250	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCTTCTTGAGCACCACAAACT	0.587																																																0			12											212.0	159.0	177.0					12																	53224025		2203	4300	6503	51510292	SO:0001819	synonymous_variant	338785			AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.750G>C	12.37:g.53224025C>G		Somatic		Capture	Illumina GAIIx	4	51510292	Q6P465|Q7Z793	Silent	SNP	HMMPfam_Filament,superfamily_Prefoldin,PatternScan_IF	p.V250	ENST00000330553.5	37	c.750	CCDS8839.1	12																																																																																			-	HMMPfam_Filament		0.587	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT79	protein_coding	OTTHUMT00000406376.1	C	NM_175834		51510292	-1	no_errors	NM_175834	genbank	human	validated	54_36p	silent	SNP	0.998	G
IQCF2	389123	genome.wustl.edu	37	3	51895690	51895690	+	Missense_Mutation	SNP	T	T	C	rs537390720	byFrequency	TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr3:51895690T>C	ENST00000333127.3	+	1	37	c.8T>C	c.(7-9)gTt>gCt	p.V3A	IQCF2_ENST00000429548.1_3'UTR	NM_203424.1	NP_982248.1	Q8IXL9	IQCF2_HUMAN	IQ motif containing F2	3										endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GCCATGAGGGTTCGATTTTGT	0.478																																																0			3											124.0	109.0	114.0					3																	51895690		2203	4300	6503	51870730	SO:0001583	missense	389123			AK128883	CCDS2835.1	3p21.31	2008-02-05			ENSG00000184345	ENSG00000184345			31815	protein-coding gene	gene with protein product							Standard	NM_203424		Approved		uc003dbt.1	Q8IXL9	OTTHUMG00000156914	ENST00000333127.3:c.8T>C	3.37:g.51895690T>C	ENSP00000329904:p.Val3Ala	Somatic		Capture	Illumina GAIIx	4	51870730		Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_IQ,HMMPfam_IQ	p.V3A	ENST00000333127.3	37	c.8	CCDS2835.1	3	.	.	.	.	.	.	.	.	.	.	t	14.49	2.550554	0.45383	.	.	ENSG00000184345	ENST00000333127	T	0.33216	1.42	4.37	3.21	0.36854	.	0.879461	0.09565	N	0.785001	T	0.21307	0.0513	N	0.24115	0.695	0.09310	N	1	B	0.25667	0.131	B	0.25140	0.058	T	0.23190	-1.0195	10	0.72032	D	0.01	2.0E-4	6.6783	0.23106	0.0:0.1058:0.0:0.8942	.	3	Q8IXL9	IQCF2_HUMAN	A	3	ENSP00000329904:V3A	ENSP00000329904:V3A	V	+	2	0	IQCF2	51870730	0.017000	0.18338	0.002000	0.10522	0.447000	0.32167	2.916000	0.48813	1.019000	0.39547	0.454000	0.30748	GTT	-	NULL		0.478	IQCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF2	protein_coding	OTTHUMT00000346594.1	T	NM_203424		51870730	+1	no_errors	NM_203424	genbank	human	validated	54_36p	missense	SNP	0.003	C
NPAS1	4861	genome.wustl.edu	37	19	47542391	47542391	+	Silent	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr19:47542391C>G	ENST00000602212.1	+	7	1006	c.786C>G	c.(784-786)gtC>gtG	p.V262V	NPAS1_ENST00000602189.1_Silent_p.V86V|NPAS1_ENST00000439365.2_Silent_p.V86V|NPAS1_ENST00000449844.2_Silent_p.V262V			Q99742	NPAS1_HUMAN	neuronal PAS domain protein 1	262					central nervous system development (GO:0007417)|maternal behavior (GO:0042711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)	6		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)		GGCTGCACGTCAAGGCCTCAG	0.627																																																0			19											56.0	54.0	55.0					19																	47542391		2203	4300	6503	52234231	SO:0001819	synonymous_variant	4861			U77968	CCDS12694.1	19q13.2-q13.3	2013-05-21				ENSG00000130751		"""Basic helix-loop-helix proteins"""	7894	protein-coding gene	gene with protein product	"""neuronal PAS1"", ""member of PAS superfamily 5"""	603346				9012850, 9079689	Standard	NM_002517		Approved	MOP5, PASD5, bHLHe11	uc002pfy.3	Q99742		ENST00000602212.1:c.786C>G	19.37:g.47542391C>G		Somatic		Capture	Illumina GAIIx	4	52234231	B4DR69|Q99632|Q9BY83	Silent	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH,HMMPfam_PAS,HMMSmart_PAS,superfamily_SSF55785,HMMPfam_PAS_3,HMMSmart_PAC	p.V262	ENST00000602212.1	37	c.786	CCDS12694.1	19																																																																																			-	NULL		0.627	NPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS1	protein_coding	OTTHUMT00000466658.1	C	NM_002517		52234231	+1	no_errors	NM_002517	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
OR5J2	282775	genome.wustl.edu	37	11	55944839	55944839	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr11:55944839C>G	ENST00000312298.1	+	1	746	c.746C>G	c.(745-747)aCc>aGc	p.T249S		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					ACTGCTGTGACCATATTCTAT	0.443																																																0			11											134.0	125.0	128.0					11																	55944839		2201	4296	6497	55701415	SO:0001583	missense	282775			AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.746C>G	11.37:g.55944839C>G	ENSP00000310788:p.Thr249Ser	Somatic		Capture	Illumina GAIIx	4	55701415	Q6IEU5	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T249S	ENST00000312298.1	37	c.746	CCDS31522.1	11	.	.	.	.	.	.	.	.	.	.	C	3.500	-0.101944	0.06967	.	.	ENSG00000174957	ENST00000312298	T	0.38240	1.15	4.26	1.15	0.20763	GPCR, rhodopsin-like superfamily (1);	0.336751	0.25236	N	0.032138	T	0.15782	0.0380	N	0.16066	0.365	0.09310	N	1	P	0.36768	0.569	B	0.35770	0.21	T	0.17048	-1.0382	10	0.15066	T	0.55	.	5.1712	0.15110	0.1208:0.3803:0.4119:0.0871	.	249	Q8NH18	OR5J2_HUMAN	S	249	ENSP00000310788:T249S	ENSP00000310788:T249S	T	+	2	0	OR5J2	55701415	0.000000	0.05858	0.072000	0.20136	0.030000	0.12068	-0.398000	0.07259	0.369000	0.24510	0.591000	0.81541	ACC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.443	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5J2	protein_coding	OTTHUMT00000391544.1	C	NM_001005492		55701415	+1	no_errors	NM_001005492	genbank	human	provisional	54_36p	missense	SNP	0.000	G
LYN	4067	genome.wustl.edu	37	8	56866545	56866545	+	Splice_Site	SNP	T	T	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr8:56866545T>G	ENST00000519728.1	+	8	1086		c.e8+2		LYN_ENST00000520220.2_Splice_Site	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase						B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	TCTGGATGGGTAAGTGTGCGG	0.517																																																0			8											96.0	94.0	94.0					8																	56866545		2203	4300	6503	57029099	SO:0001630	splice_region_variant	4067			M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.790+2T>G	8.37:g.56866545T>G		Somatic		Capture	Illumina GAIIx	4	57029099	A0AVQ5	Splice_Site	SNP	-	e7+2	ENST00000519728.1	37	c.790+2	CCDS6162.1	8	.	.	.	.	.	.	.	.	.	.	T	25.3	4.624368	0.87560	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1358	0.72566	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	LYN	57029099	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.921000	0.87530	2.049000	0.60858	0.528000	0.53228	.	-	-		0.517	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYN	protein_coding	OTTHUMT00000378155.1	T	NM_002350	Intron	57029099	+1	no_errors	NM_002350	genbank	human	validated	54_36p	splice_site	SNP	1.000	G
ZNF841	284371	genome.wustl.edu	37	19	52569725	52569725	+	Silent	SNP	T	T	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr19:52569725T>C	ENST00000426391.2	-	5	1613	c.1062A>G	c.(1060-1062)tcA>tcG	p.S354S	CTC-471J1.2_ENST00000569091.1_RNA|ZNF841_ENST00000594295.1_Silent_p.S470S|ZNF841_ENST00000359973.2_Intron|ZNF841_ENST00000389534.4_Silent_p.S470S|ZNF432_ENST00000598446.1_Intron			Q6ZN19	ZN841_HUMAN	zinc finger protein 841	354					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(3)|lung(3)	11						CTGCAAGACGTGAACGTTGAA	0.413																																																0			19											41.0	36.0	37.0					19																	52569725		692	1591	2283	57261537	SO:0001819	synonymous_variant	284371			AK131409	CCDS46161.1	19q13.41	2013-01-08			ENSG00000197608	ENSG00000197608		"""Zinc fingers, C2H2-type"", ""-"""	27611	protein-coding gene	gene with protein product							Standard	NM_001136499		Approved	LOC284371	uc010ydh.1	Q6ZN19		ENST00000426391.2:c.1062A>G	19.37:g.52569725T>C		Somatic		Capture	Illumina GAIIx	4	57261537	B9EG58|Q6ZN82|Q6ZP71|Q8N9U7	Silent	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,PatternScan_IG_MHC	p.S354	ENST00000426391.2	37	c.1062		19																																																																																			-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.413	ZNF841-001	PUTATIVE	basic	protein_coding	ZNF841	protein_coding	OTTHUMT00000462435.1	T	XM_209155		57261537	-1	no_errors	ENST00000389534	ensembl	human	known	54_36p	silent	SNP	0.000	C
SDR16C5	195814	genome.wustl.edu	37	8	57228799	57228799	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr8:57228799C>A	ENST00000303749.3	-	2	745	c.108G>T	c.(106-108)aaG>aaT	p.K36N	SDR16C5_ENST00000522671.1_Missense_Mutation_p.K36N|SDR16C5_ENST00000396721.2_Missense_Mutation_p.K36N	NM_138969.2	NP_620419.2	Q8N3Y7	RDHE2_HUMAN	short chain dehydrogenase/reductase family 16C, member 5	36					detection of light stimulus involved in visual perception (GO:0050908)|keratinocyte proliferation (GO:0043616)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	retinol dehydrogenase activity (GO:0004745)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)	16						CAGCAACGTTCTTCCGTGGCT	0.458																																																0			8											91.0	83.0	86.0					8																	57228799		2203	4300	6503	57391353	SO:0001583	missense	195814				CCDS6167.1	8q12.1	2011-09-20			ENSG00000170786	ENSG00000170786	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	30311	protein-coding gene	gene with protein product		608989				12372410	Standard	NM_138969		Approved	RDHE2, RDH-E2	uc003xsy.1	Q8N3Y7	OTTHUMG00000164311	ENST00000303749.3:c.108G>T	8.37:g.57228799C>A	ENSP00000307607:p.Lys36Asn	Somatic		Capture	Illumina GAIIx	4	57391353	B4DGK2|Q330K3|Q8TDV9|Q96LX1	Missense_Mutation	SNP	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_adh_short	p.K36N	ENST00000303749.3	37	c.108	CCDS6167.1	8	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699454	0.48307	.	.	ENSG00000170786	ENST00000396721;ENST00000303749;ENST00000522671;ENST00000538514	D;D;T	0.89617	-2.54;-2.54;0.7	5.25	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.93177	0.7827	M	0.74467	2.265	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.976;1.0;1.0	D	0.93224	0.6611	10	0.72032	D	0.01	.	11.3003	0.49302	0.0:0.8416:0.0:0.1584	.	36;36;36	Q8N3Y7-2;G3V145;Q8N3Y7	.;.;RDHE2_HUMAN	N	36	ENSP00000379947:K36N;ENSP00000307607:K36N;ENSP00000431010:K36N	ENSP00000307607:K36N	K	-	3	2	SDR16C5	57391353	1.000000	0.71417	0.981000	0.43875	0.100000	0.18952	2.107000	0.41844	2.476000	0.83614	0.563000	0.77884	AAG	-	NULL		0.458	SDR16C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDR16C5	protein_coding	OTTHUMT00000378235.1	C	NM_138969		57391353	-1	no_errors	NM_138969	genbank	human	validated	54_36p	missense	SNP	1.000	A
ADRM1	11047	genome.wustl.edu	37	20	60883116	60883116	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr20:60883116C>T	ENST00000253003.2	+	8	942	c.896C>T	c.(895-897)cCc>cTc	p.P299L	LAMA5_ENST00000492698.1_5'UTR|RP11-157P1.4_ENST00000414042.1_RNA	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1	299					positive regulation of endopeptidase activity (GO:0010950)|proteasome assembly (GO:0043248)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|protease binding (GO:0002020)|proteasome binding (GO:0070628)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|urinary_tract(1)	5	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			ATAATGGCTCCCATCCTCGCC	0.612																																																0			20											60.0	51.0	54.0					20																	60883116		2197	4295	6492	60316511	SO:0001583	missense	11047			D64154	CCDS13496.1, CCDS74747.1	20q13.33	2008-05-22			ENSG00000130706	ENSG00000130706			15759	protein-coding gene	gene with protein product		610650				8033103	Standard	NM_007002		Approved	GP110, Rpn13, ARM1	uc002yco.3	Q16186	OTTHUMG00000032904	ENST00000253003.2:c.896C>T	20.37:g.60883116C>T	ENSP00000253003:p.Pro299Leu	Somatic		Capture	Illumina GAIIx	4	60316511	A0PKB1|Q96FJ7|Q9H1P2	Missense_Mutation	SNP	HMMPfam_ARM_1	p.P299L	ENST00000253003.2	37	c.896	CCDS13496.1	20	.	.	.	.	.	.	.	.	.	.	C	36	5.704042	0.96812	.	.	ENSG00000130706	ENST00000370744;ENST00000253003	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.83390	0.5244	M	0.81614	2.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85511	0.1197	9	0.87932	D	0	-22.5039	18.7766	0.91913	0.0:1.0:0.0:0.0	.	299	Q16186	ADRM1_HUMAN	L	278;299	.	ENSP00000253003:P299L	P	+	2	0	ADRM1	60316511	1.000000	0.71417	0.996000	0.52242	0.943000	0.58893	5.685000	0.68204	2.541000	0.85698	0.561000	0.74099	CCC	-	HMMPfam_ARM_1		0.612	ADRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRM1	protein_coding	OTTHUMT00000080007.1	C			60316511	+1	no_errors	NM_007002	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MTA2	9219	genome.wustl.edu	37	11	62365832	62365832	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr11:62365832C>G	ENST00000278823.2	-	5	728	c.339G>C	c.(337-339)gaG>gaC	p.E113D	MTA2_ENST00000524902.1_5'UTR|MTA2_ENST00000527204.1_5'UTR	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	113	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.E113D(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						AGATATCTGTCTCATTCAAGA	0.522																																																1	Substitution - Missense(1)	ovary(1)	11											324.0	351.0	342.0					11																	62365832		2202	4299	6501	62122408	SO:0001583	missense	9219			AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.339G>C	11.37:g.62365832C>G	ENSP00000278823:p.Glu113Asp	Somatic		Capture	Illumina GAIIx	4	62122408	Q68DB1|Q9UQB5	Missense_Mutation	SNP	PatternScan_GATA_ZN_FINGER_1,HMMPfam_BAH,HMMSmart_BAH,HMMPfam_ELM2,HMMSmart_SANT,HMMPfam_Myb_DNA-binding,superfamily_SSF57716,HMMSmart_ZnF_GATA,HMMPfam_GATA	p.E113D	ENST00000278823.2	37	c.339	CCDS8022.1	11	.	.	.	.	.	.	.	.	.	.	C	21.1	4.094999	0.76870	.	.	ENSG00000149480	ENST00000278823	D	0.84730	-1.89	5.73	2.75	0.32379	Bromo adjacent homology (BAH) domain (3);	0.000000	0.85682	D	0.000000	D	0.88514	0.6457	M	0.66506	2.035	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	D	0.84732	0.0746	10	0.28530	T	0.3	-24.407	7.4762	0.27378	0.0:0.6357:0.0:0.3643	.	113	O94776	MTA2_HUMAN	D	113	ENSP00000278823:E113D	ENSP00000278823:E113D	E	-	3	2	MTA2	62122408	0.999000	0.42202	1.000000	0.80357	0.991000	0.79684	0.626000	0.24492	0.727000	0.32360	0.655000	0.94253	GAG	-	HMMPfam_BAH,HMMSmart_BAH		0.522	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTA2	protein_coding	OTTHUMT00000395578.1	C	NM_004739		62122408	-1	no_errors	NM_004739	genbank	human	reviewed	54_36p	missense	SNP	0.998	G
PRKCA	5578	genome.wustl.edu	37	17	64782999	64782999	+	Silent	SNP	T	T	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr17:64782999T>G	ENST00000413366.3	+	15	1646	c.1620T>G	c.(1618-1620)ggT>ggG	p.G540G	MIR634_ENST00000385208.1_RNA	NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	540	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	CATTTGATGGTGAAGATGAAG	0.433																																																0			17											103.0	91.0	95.0					17																	64782999		2203	4300	6503	62213461	SO:0001819	synonymous_variant	5578				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1620T>G	17.37:g.64782999T>G		Somatic		Capture	Illumina GAIIx	4	62213461	B5BU22|Q15137|Q32M72|Q96RE4	Silent	SNP	superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_SM00133,HMMPfam_Pkinase_C	p.G540	ENST00000413366.3	37	c.1620	CCDS11664.1	17																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase		0.433	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCA	protein_coding	OTTHUMT00000446976.1	T			62213461	+1	no_errors	NM_002737	genbank	human	reviewed	54_36p	silent	SNP	0.380	G
MDH1	4190	genome.wustl.edu	37	2	63824541	63824541	+	Missense_Mutation	SNP	G	G	A	rs533261577	byFrequency	TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr2:63824541G>A	ENST00000233114.8	+	4	643	c.208G>A	c.(208-210)Gca>Aca	p.A70T	MDH1_ENST00000539945.1_Missense_Mutation_p.A88T|MDH1_ENST00000409908.1_Intron|MDH1_ENST00000544381.1_5'UTR|MDH1_ENST00000409476.1_Intron|MDH1_ENST00000394423.1_Missense_Mutation_p.A70T	NM_005917.3	NP_005908.1	P40925	MDHC_HUMAN	malate dehydrogenase 1, NAD (soluble)	70					carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|malate metabolic process (GO:0006108)|NADH metabolic process (GO:0006734)|oxaloacetate metabolic process (GO:0006107)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	diiodophenylpyruvate reductase activity (GO:0047860)|L-malate dehydrogenase activity (GO:0030060)|malic enzyme activity (GO:0004470)|NAD binding (GO:0051287)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(4)	13						AGATGTCATCGCAACAGATAA	0.398													G|||	8	0.00159744	0.0	0.0	5008	,	,		18419	0.0		0.0	False		,,,				2504	0.0082															0			2											63.0	62.0	62.0					2																	63824541		2203	4300	6503	63678045	SO:0001583	missense	4190				CCDS1874.1, CCDS56121.1, CCDS56122.1	2p23	2012-10-02			ENSG00000014641	ENSG00000014641	1.1.1.37		6970	protein-coding gene	gene with protein product		154200					Standard	NM_005917		Approved		uc010ypv.2	P40925	OTTHUMG00000129512	ENST00000233114.8:c.208G>A	2.37:g.63824541G>A	ENSP00000233114:p.Ala70Thr	Somatic		Capture	Illumina GAIIx	4	63678045	B2R5V5|B4DUN2|B7Z3I7|F5H098|Q6I9V0	Missense_Mutation	SNP	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_Ldh_1_N,PatternScan_MDH,HMMPfam_Ldh_1_C,superfamily_LDH C-terminal domain-like	p.A70T	ENST00000233114.8	37	c.208	CCDS1874.1	2	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963867	0.53507	.	.	ENSG00000014641	ENST00000233114;ENST00000436321;ENST00000454035;ENST00000432309;ENST00000539945;ENST00000394423	D;D;D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34;-2.34;-2.34	5.47	3.6	0.41247	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.249238	0.47455	N	0.000228	D	0.84334	0.5449	L	0.58810	1.83	0.80722	D	1	P;P	0.45715	0.865;0.852	B;B	0.44133	0.314;0.442	T	0.81008	-0.1127	10	0.41790	T	0.15	-29.6508	8.6001	0.33740	0.1518:0.132:0.7162:0.0	.	88;70	F5H098;P40925	.;MDHC_HUMAN	T	70;25;71;88;88;70	ENSP00000233114:A70T;ENSP00000394504:A25T;ENSP00000409027:A71T;ENSP00000410073:A88T;ENSP00000438144:A88T;ENSP00000377945:A70T	ENSP00000233114:A70T	A	+	1	0	MDH1	63678045	1.000000	0.71417	0.792000	0.32020	0.985000	0.73830	2.404000	0.44539	0.718000	0.32166	0.655000	0.94253	GCA	-	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_Ldh_1_N		0.398	MDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDH1	protein_coding	OTTHUMT00000251687.1	G			63678045	+1	no_errors	NM_005917	genbank	human	reviewed	54_36p	missense	SNP	0.996	A
NUDT22	84304	genome.wustl.edu	37	11	63994371	63994371	+	Missense_Mutation	SNP	G	G	A	rs143695088		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr11:63994371G>A	ENST00000279206.3	+	2	403	c.247G>A	c.(247-249)Ggc>Agc	p.G83S	TRPT1_ENST00000317459.6_5'Flank|TRPT1_ENST00000546133.1_5'Flank|TRPT1_ENST00000394546.2_5'Flank|TRPT1_ENST00000394547.3_5'Flank|TRPT1_ENST00000541278.1_5'Flank|NUDT22_ENST00000441250.2_Missense_Mutation_p.G83S|TRPT1_ENST00000546089.1_5'Flank|TRPT1_ENST00000540472.1_5'Flank|RP11-783K16.14_ENST00000534988.1_RNA	NM_001128612.2|NM_032344.2	NP_001122084.1|NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 22	83							hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8						CCTGCGCCTGGGCCTTACTTC	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		17720	0.001		0.0	False		,,,				2504	0.0															0			11											44.0	47.0	46.0					11																	63994371		2201	4296	6497	63750947	SO:0001583	missense	84304			BC006129	CCDS8061.1, CCDS44640.1	11q13.1	2008-02-05			ENSG00000149761	ENSG00000149761		"""Nudix motif containing"""	28189	protein-coding gene	gene with protein product						12477932	Standard	NM_032344		Approved	MGC13045	uc009ype.4	Q9BRQ3	OTTHUMG00000167791	ENST00000279206.3:c.247G>A	11.37:g.63994371G>A	ENSP00000279206:p.Gly83Ser	Somatic		Capture	Illumina GAIIx	4	63750947	C9JY06|Q71RD5	Missense_Mutation	SNP	NULL	p.G83S	ENST00000279206.3	37	c.247	CCDS8061.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	32	5.139906	0.94560	.	.	ENSG00000149761	ENST00000539325;ENST00000279206;ENST00000441250;ENST00000428347;ENST00000536237	T;T;T;T	0.70516	-0.49;0.39;0.4;-0.4	4.55	4.55	0.56014	.	0.051850	0.85682	D	0.000000	D	0.83917	0.5358	M	0.78049	2.395	0.54753	D	0.999988	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.992;0.992;0.995	D	0.86154	0.1589	10	0.72032	D	0.01	-0.9284	16.6018	0.84817	0.0:0.0:1.0:0.0	.	83;83;83	Q9BRQ3-2;C9JY06;Q9BRQ3	.;.;NUD22_HUMAN	S	83	ENSP00000444022:G83S;ENSP00000279206:G83S;ENSP00000407970:G83S;ENSP00000401085:G83S	ENSP00000279206:G83S	G	+	1	0	NUDT22	63750947	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	9.009000	0.93606	2.528000	0.85240	0.491000	0.48974	GGC	-	NULL		0.662	NUDT22-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	NUDT22	protein_coding	OTTHUMT00000396304.2	G	NM_032344		63750947	+1	no_errors	NM_032344	genbank	human	validated	54_36p	missense	SNP	1.000	A
EHD1	10938	genome.wustl.edu	37	11	64627570	64627570	+	Silent	SNP	G	G	A	rs374259413		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr11:64627570G>A	ENST00000320631.3	-	3	995	c.741C>T	c.(739-741)ccC>ccT	p.P247P	EHD1_ENST00000359393.2_Silent_p.P247P	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	247	Dynamin-type G.				blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						TGACCACCTCGGGGGTGTTGA	0.622																																																0			11											94.0	93.0	93.0					11																	64627570		2201	4297	6498	64384146	SO:0001819	synonymous_variant	10938			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.741C>T	11.37:g.64627570G>A		Somatic		Capture	Illumina GAIIx	4	64384146	O14611|Q2M3Q4|Q9UNR3	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N,superfamily_EF-hand,HMMSmart_SM00027,PatternScan_EF_HAND_1	p.P247	ENST00000320631.3	37	c.741	CCDS8084.1	11																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.622	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	protein_coding	OTTHUMT00000143229.2	G	NM_006795		64384146	-1	no_errors	NM_006795	genbank	human	reviewed	54_36p	silent	SNP	0.811	A
DYSF	8291	genome.wustl.edu	37	2	71801345	71801345	+	Silent	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr2:71801345G>A	ENST00000258104.3	+	30	3469	c.3192G>A	c.(3190-3192)gcG>gcA	p.A1064A	DYSF_ENST00000409762.1_Silent_p.A1081A|DYSF_ENST00000410020.3_Silent_p.A1082A|DYSF_ENST00000394120.2_Silent_p.A1065A|DYSF_ENST00000409744.1_Silent_p.A1051A|DYSF_ENST00000409651.1_Silent_p.A1096A|DYSF_ENST00000409366.1_Silent_p.A1065A|DYSF_ENST00000429174.2_Silent_p.A1064A|DYSF_ENST00000410041.1_Silent_p.A1082A|DYSF_ENST00000413539.2_Silent_p.A1095A|DYSF_ENST00000409582.3_Silent_p.A1081A	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1064	Arg-rich.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						AGGCGGAGGCGGAGGGCGAGG	0.657																																																0			2											47.0	57.0	54.0					2																	71801345		2201	4294	6495	71654853	SO:0001819	synonymous_variant	8291			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3192G>A	2.37:g.71801345G>A		Somatic		Capture	Illumina GAIIx	4	71654853	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	HMMSmart_SM00239,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_C2,HMMPfam_FerI,HMMPfam_FerA,HMMPfam_FerB,HMMSmart_SM00693,HMMSmart_SM00694	p.A1064	ENST00000258104.3	37	c.3192	CCDS1918.1	2																																																																																			-	NULL		0.657	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	protein_coding	OTTHUMT00000251970.3	G	NM_003494		71654853	+1	no_errors	NM_003494	genbank	human	reviewed	54_36p	silent	SNP	0.042	A
GCNT4	51301	genome.wustl.edu	37	5	74325582	74325582	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr5:74325582T>C	ENST00000322348.4	-	1	1142	c.281A>G	c.(280-282)gAc>gGc	p.D94G		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	94					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		GTCAATGATGTCCCTTCTTCT	0.403																																																0			5											174.0	163.0	167.0					5																	74325582		2203	4300	6503	74361338	SO:0001583	missense	51301			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.281A>G	5.37:g.74325582T>C	ENSP00000317027:p.Asp94Gly	Somatic		Capture	Illumina GAIIx	4	74361338		Missense_Mutation	SNP	HMMPfam_Branch	p.D94G	ENST00000322348.4	37	c.281	CCDS4026.1	5	.	.	.	.	.	.	.	.	.	.	.	9.297	1.052098	0.19827	.	.	ENSG00000176928	ENST00000322348	T	0.42513	0.97	6.17	2.36	0.29203	.	1.859620	0.02066	N	0.051132	T	0.37128	0.0992	L	0.38175	1.15	0.09310	N	1	B	0.15141	0.012	B	0.14023	0.01	T	0.20672	-1.0268	10	0.31617	T	0.26	-9.0173	8.9327	0.35680	0.0:0.0629:0.2517:0.6854	.	94	Q9P109	GCNT4_HUMAN	G	94	ENSP00000317027:D94G	ENSP00000317027:D94G	D	-	2	0	GCNT4	74361338	0.012000	0.17670	0.091000	0.20842	0.980000	0.70556	1.239000	0.32719	0.171000	0.19730	0.533000	0.62120	GAC	-	NULL		0.403	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT4	protein_coding	OTTHUMT00000254040.1	T	NM_016591		74361338	-1	no_errors	NM_016591	genbank	human	validated	54_36p	missense	SNP	0.010	C
TRPM6	140803	genome.wustl.edu	37	9	77390934	77390934	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr9:77390934G>A	ENST00000360774.1	-	24	3505	c.3268C>T	c.(3268-3270)Cgc>Tgc	p.R1090C	TRPM6_ENST00000361255.3_Missense_Mutation_p.R1085C|TRPM6_ENST00000449912.2_Missense_Mutation_p.R1085C|TRPM6_ENST00000451710.3_Missense_Mutation_p.R1090C|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.R1090C|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1090					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						ATGATGTAGCGATAGCGGTTG	0.493																																																0			9											118.0	127.0	124.0					9																	77390934		2203	4300	6503	76580754	SO:0001583	missense	140803			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3268C>T	9.37:g.77390934G>A	ENSP00000354006:p.Arg1090Cys	Somatic		Capture	Illumina GAIIx	4	76580754	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	HMMPfam_Ion_trans,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00811,HMMPfam_Alpha_kinase	p.R1090C	ENST00000360774.1	37	c.3268	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.120843	0.94385	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.55588	0.6;0.6;0.6;0.6;0.51	5.76	5.76	0.90799	.	0.046412	0.85682	D	0.000000	T	0.72779	0.3503	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.67900	0.932;0.931;0.954	T	0.74426	-0.3669	10	0.87932	D	0	.	19.9561	0.97218	0.0:0.0:1.0:0.0	.	1090;1085;1085	Q9BX84;Q9BX84-3;Q9BX84-2	TRPM6_HUMAN;.;.	C	1090;1090;1085;1085;1090;753;753	ENSP00000354006:R1090C;ENSP00000407341:R1090C;ENSP00000396672:R1085C;ENSP00000354962:R1085C;ENSP00000366060:R1090C	ENSP00000309693:R753C	R	-	1	0	TRPM6	76580754	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.827000	0.86722	2.725000	0.93324	0.591000	0.81541	CGC	-	NULL		0.493	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	protein_coding	OTTHUMT00000052693.1	G	NM_017662		76580754	-1	no_errors	NM_017662	genbank	human	validated	54_36p	missense	SNP	1.000	A
SAMD9L	219285	genome.wustl.edu	37	7	92763495	92763495	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr7:92763495C>G	ENST00000318238.4	-	5	3006	c.1790G>C	c.(1789-1791)aGa>aCa	p.R597T	SAMD9L_ENST00000437805.1_Missense_Mutation_p.R597T|SAMD9L_ENST00000411955.1_Missense_Mutation_p.R597T	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	597					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CATCTTCATTCTTGTTTGTAG	0.348																																																0			7											90.0	88.0	89.0					7																	92763495		2203	4298	6501	92601431	SO:0001583	missense	219285			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.1790G>C	7.37:g.92763495C>G	ENSP00000326247:p.Arg597Thr	Somatic		Capture	Illumina GAIIx	4	92601431	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/Pointed domain	p.R597T	ENST00000318238.4	37	c.1790	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	C	11.71	1.719589	0.30503	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.17691	2.26;2.26;2.26	4.75	4.75	0.60458	.	0.000000	0.64402	D	0.000001	T	0.40694	0.1127	M	0.68593	2.085	0.24853	N	0.992392	D	0.76494	0.999	D	0.69479	0.964	T	0.18461	-1.0336	10	0.72032	D	0.01	-21.8495	17.5192	0.87782	0.0:1.0:0.0:0.0	.	597	Q8IVG5	SAM9L_HUMAN	T	597	ENSP00000326247:R597T;ENSP00000405760:R597T;ENSP00000408796:R597T	ENSP00000326247:R597T	R	-	2	0	SAMD9L	92601431	1.000000	0.71417	0.819000	0.32651	0.389000	0.30415	5.483000	0.66838	2.466000	0.83321	0.467000	0.42956	AGA	-	NULL		0.348	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	protein_coding	OTTHUMT00000341730.1	C	NM_152703		92601431	-1	no_errors	NM_152703	genbank	human	validated	54_36p	missense	SNP	0.039	G
IL1RL1	9173	genome.wustl.edu	37	2	102968130	102968130	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr2:102968130G>A	ENST00000233954.1	+	11	1691	c.1420G>A	c.(1420-1422)Gac>Aac	p.D474N		NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	474	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						CATCCAGAACGACGCCAAGGT	0.542																																																0			2											87.0	74.0	78.0					2																	102968130		2203	4300	6503	102334562	SO:0001583	missense	9173			D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.1420G>A	2.37:g.102968130G>A	ENSP00000233954:p.Asp474Asn	Somatic		Capture	Illumina GAIIx	4	102334562	A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR	p.D474N	ENST00000233954.1	37	c.1420	CCDS2057.1	2	.	.	.	.	.	.	.	.	.	.	G	7.513	0.655165	0.14580	.	.	ENSG00000115602	ENST00000233954	T	0.02323	4.34	4.73	2.82	0.32997	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.356168	0.28671	N	0.014537	T	0.02156	0.0067	L	0.31294	0.92	0.80722	D	1	P	0.39782	0.688	B	0.36092	0.217	T	0.64141	-0.6477	10	0.20519	T	0.43	.	7.1413	0.25558	0.2242:0.0:0.7758:0.0	.	474	Q01638	ILRL1_HUMAN	N	474	ENSP00000233954:D474N	ENSP00000233954:D474N	D	+	1	0	IL1RL1	102334562	0.953000	0.32496	0.984000	0.44739	0.062000	0.15995	1.517000	0.35867	0.506000	0.28125	0.455000	0.32223	GAC	-	superfamily_Toll/Interleukin receptor TIR domain,HMMSmart_SM00255,HMMPfam_TIR		0.542	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL1	protein_coding	OTTHUMT00000253296.1	G	NM_016232		102334562	+1	no_errors	NM_016232	genbank	human	reviewed	54_36p	missense	SNP	0.985	A
UBR5	51366	genome.wustl.edu	37	8	103317451	103317451	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr8:103317451G>T	ENST00000520539.1	-	21	3295	c.2689C>A	c.(2689-2691)Caa>Aaa	p.Q897K	UBR5_ENST00000220959.4_Missense_Mutation_p.Q897K|UBR5_ENST00000521922.1_Missense_Mutation_p.Q891K	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	897					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			ACAACCGCTTGCTCAAGATTC	0.403																																					Ovarian(131;96 1741 5634 7352 27489)											0			8											160.0	158.0	159.0					8																	103317451		2203	4300	6503	103386627	SO:0001583	missense	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.2689C>A	8.37:g.103317451G>T	ENSP00000429084:p.Gln897Lys	Somatic		Capture	Illumina GAIIx	4	103386627	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	HMMPfam_zf-UBR,HMMSmart_ZnF_UBR1,superfamily_HECT,superfamily_PABP_HYD,HMMPfam_PABP,HMMSmart_PolyA,HMMSmart_HECTc,HMMPfam_HECT	p.Q897K	ENST00000520539.1	37	c.2689	CCDS34933.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.75|12.75	2.031781|2.031781	0.35797|0.35797	.|.	.|.	ENSG00000104517|ENSG00000104517	ENST00000519365|ENST00000520539;ENST00000220959;ENST00000521922	.|T;T;T	.|0.42900	.|0.96;0.96;0.96	4.88|4.88	4.88|4.88	0.63580|0.63580	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.34424|0.34424	0.0897|0.0897	N|N	0.03608|0.03608	-0.345|-0.345	0.80722|0.80722	D|D	1|1	.|P;P	.|0.40332	.|0.713;0.713	.|P;P	.|0.51742	.|0.678;0.678	T|T	0.32481|0.32481	-0.9905|-0.9905	5|10	.|0.18710	.|T	.|0.47	.|.	18.0346|18.0346	0.89296|0.89296	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|891;897	.|E7EMW7;O95071	.|.;UBR5_HUMAN	E|K	12|897;897;891	.|ENSP00000429084:Q897K;ENSP00000220959:Q897K;ENSP00000427819:Q891K	.|ENSP00000220959:Q897K	A|Q	-|-	2|1	0|0	UBR5|UBR5	103386627|103386627	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.869000|9.869000	0.99810|0.99810	2.268000|2.268000	0.75426|0.75426	0.305000|0.305000	0.20034|0.20034	GCA|CAA	-	NULL		0.403	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	protein_coding	OTTHUMT00000380075.2	G	NM_015902		103386627	-1	no_errors	NM_015902	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
IGHV1-2	28474	genome.wustl.edu	37	14	106452766	106452766	+	RNA	SNP	T	T	A	rs112806369	byFrequency	TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr14:106452766T>A	ENST00000390594.2	-	0	319									immunoglobulin heavy variable 1-2																		ATGGTGACCCTGCCCTGAAAC	0.562													.|||	1608	0.321086	0.1831	0.3516	5008	,	,		8257	0.3095		0.4642	False		,,,				2504	0.3507															0			14						T		952,3150		113,726,1212	179.0	172.0	175.0			-2.1	0.3	14	dbSNP_132	175	3836,4538		916,2004,1267	no	intergenic				1029,2730,2479	AA,AT,TT		45.8085,23.2082,38.3777			106452766	4788,7688	2051	4187	6238	105523811			0			X07448		14q32.33	2012-02-08			ENSG00000211934	ENSG00000211934		"""Immunoglobulins / IGH locus"""	5550	other	immunoglobulin gene							Standard	NG_001019		Approved	V35			OTTHUMG00000152320		14.37:g.106452766T>A		Somatic		Capture	Illumina GAIIx	4	105523811		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00406	p.R86W	ENST00000390594.2	37	c.256		14																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00406		0.562	IGHV1-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211934	IG_V_gene	OTTHUMT00000325882.1	T	NG_001019		105523811	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390594	ensembl	human	known	54_36p	missense	SNP	0.017	A
MID2	11043	genome.wustl.edu	37	X	107084583	107084583	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chrX:107084583G>A	ENST00000262843.6	+	2	1236	c.688G>A	c.(688-690)Gca>Aca	p.A230T	MID2_ENST00000443968.2_Missense_Mutation_p.A230T	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	230					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						CCATCAGGTCGCATCCCTGAA	0.448																																																0			X											75.0	60.0	65.0					X																	107084583		2203	4300	6503	106971239	SO:0001583	missense	11043				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.688G>A	X.37:g.107084583G>A	ENSP00000262843:p.Ala230Thr	Somatic		Capture	Illumina GAIIx	4	106971239	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMSmart_SM00336,HMMPfam_zf-B_box,superfamily_B-box zinc-binding domain,HMMSmart_SM00502,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMPfam_SPRY,HMMSmart_SM00449	p.A210T	ENST00000262843.6	37	c.628	CCDS14532.2	X	.	.	.	.	.	.	.	.	.	.	G	8.147	0.786515	0.16189	.	.	ENSG00000080561	ENST00000451923;ENST00000262843;ENST00000443968	T;T;T	0.40476	1.03;1.03;1.03	5.94	5.94	0.96194	Zinc finger, B-box (3);	0.059273	0.64402	D	0.000001	T	0.28532	0.0706	L	0.33137	0.985	0.41172	D	0.986171	B;P	0.34997	0.333;0.479	B;B	0.23419	0.046;0.035	T	0.12066	-1.0562	10	0.09590	T	0.72	.	16.5117	0.84287	0.0:0.0:1.0:0.0	.	230;230	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	T	210;230;230	ENSP00000410730:A210T;ENSP00000262843:A230T;ENSP00000413976:A230T	ENSP00000262843:A230T	A	+	1	0	MID2	106971239	1.000000	0.71417	0.437000	0.26809	0.933000	0.57130	4.954000	0.63631	2.506000	0.84524	0.600000	0.82982	GCA	-	HMMPfam_zf-B_box,HMMSmart_SM00336,superfamily_B-box zinc-binding domain		0.448	MID2-001	KNOWN	basic|CCDS	protein_coding	MID2	protein_coding	OTTHUMT00000057852.2	G	NM_012216		106971239	+1	no_errors	NM_012216	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
AMPD2	271	genome.wustl.edu	37	1	110168957	110168957	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:110168957G>T	ENST00000256578.3	+	5	961	c.601G>T	c.(601-603)Ggt>Tgt	p.G201C	AMPD2_ENST00000358729.4_Missense_Mutation_p.G126C|AMPD2_ENST00000528454.1_Missense_Mutation_p.G83C|AMPD2_ENST00000393688.3_Missense_Mutation_p.G82C|AMPD2_ENST00000342115.4_Missense_Mutation_p.G120C|AMPD2_ENST00000528667.1_Missense_Mutation_p.G201C|AMPD2_ENST00000526301.1_3'UTR|RP5-1160K1.6_ENST00000369843.3_RNA	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	201					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		CAAGGAACAGGGTGAGGGGCA	0.632																																																0			1											38.0	38.0	38.0					1																	110168957		2203	4300	6503	109970480	SO:0001583	missense	271			S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.601G>T	1.37:g.110168957G>T	ENSP00000256578:p.Gly201Cys	Somatic		Capture	Illumina GAIIx	4	109970480	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	superfamily_Metallo-dependent hydrolases,HMMPfam_A_deaminase,PatternScan_A_DEAMINASE	p.G201C	ENST00000256578.3	37	c.601	CCDS805.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.42|13.42	2.232999|2.232999	0.39498|0.39498	.|.	.|.	ENSG00000116337|ENSG00000116337	ENST00000342115;ENST00000528667;ENST00000531203;ENST00000256578;ENST00000358729;ENST00000527846;ENST00000528454;ENST00000393688|ENST00000369840	D;D;D;T;T;D|.	0.85629|.	-1.98;-1.99;-1.99;1.17;1.17;-2.01|.	5.07|5.07	-2.4|-2.4	0.06583|0.06583	.|.	1.360640|1.360640	0.04367|0.04367	N|N	0.358520|0.358520	T|T	0.05227|0.05227	0.0139|0.0139	N|N	0.08118|0.08118	0|0	0.19575|0.19575	N|N	0.999969|0.999969	D;P;P;P|.	0.57257|.	0.979;0.948;0.913;0.948|.	P;B;B;P|.	0.50192|.	0.634;0.443;0.339;0.613|.	T|T	0.20505|0.20505	-1.0273|-1.0273	10|6	0.56958|.	D|.	0.05|.	-0.1671|-0.1671	5.9461|5.9461	0.19219|0.19219	0.4442:0.2388:0.317:0.0|0.4442:0.2388:0.317:0.0	.|.	126;82;201;120|.	Q01433-4;Q01433-3;Q01433;Q01433-2|.	.;.;AMPD2_HUMAN;.|.	C|V	120;201;83;201;126;168;83;82|171	ENSP00000345498:G120C;ENSP00000436541:G201C;ENSP00000256578:G201C;ENSP00000351573:G126C;ENSP00000437164:G83C;ENSP00000377292:G82C|.	ENSP00000256578:G201C|.	G|G	+|+	1|2	0|0	AMPD2|AMPD2	109970480|109970480	0.001000|0.001000	0.12720|0.12720	0.201000|0.201000	0.23476|0.23476	0.729000|0.729000	0.41735|0.41735	-0.019000|-0.019000	0.12546|0.12546	-0.312000|-0.312000	0.08741|0.08741	0.462000|0.462000	0.41574|0.41574	GGT|GGG	-	NULL		0.632	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPD2	protein_coding	OTTHUMT00000390615.1	G			109970480	+1	no_errors	NM_004037	genbank	human	validated	54_36p	missense	SNP	0.230	T
GPR6	2830	genome.wustl.edu	37	6	110300600	110300600	+	Silent	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr6:110300600G>A	ENST00000275169.3	+	1	303	c.285G>A	c.(283-285)gcG>gcA	p.A95A	GPR6_ENST00000414000.2_Silent_p.A110A	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	95					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		TGGTGGTGGCGCTCATCGCGT	0.672																																																0			6											77.0	72.0	74.0					6																	110300600		2203	4300	6503	110407293	SO:0001819	synonymous_variant	2830				CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.285G>A	6.37:g.110300600G>A		Somatic		Capture	Illumina GAIIx	4	110407293	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A95	ENST00000275169.3	37	c.285	CCDS5079.1	6																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.672	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR6	protein_coding	OTTHUMT00000041774.1	G			110407293	+1	no_errors	NM_005284	genbank	human	validated	54_36p	silent	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	3	110401864	110401864	+	IGR	SNP	G	G	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr3:110401864G>C								RNU6ATAC15P (131052 upstream) : Y_RNA (44003 downstream)																							TTATGATGTAGATGCCATCAC	0.448																																																0			3																																								111884554	SO:0001628	intergenic_variant	389141																															3.37:g.110401864G>C		Somatic		Capture	Illumina GAIIx	4	111884554		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.448					LOC389141			G			111884554	-1	pseudogene	XR_016945	genbank	human	model	54_36p	rna	SNP	1.000	C
NUTF2P4	128322	genome.wustl.edu	37	1	113290988	113290988	+	IGR	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:113290988C>T								FAM19A3 (21131 upstream) : RP11-426L16.8 (71807 downstream)																							CAGCTTAAGGCGGATGAAGAC	0.527																																																0			1																																								113092511	SO:0001628	intergenic_variant	128322																															1.37:g.113290988C>T		Somatic		Capture	Illumina GAIIx	4	113092511		Missense_Mutation	SNP	superfamily_NTF2-like,HMMPfam_NTF2,PatternScan_WD_REPEATS_1	p.A91V		37	c.272		1																																																																																			-	superfamily_NTF2-like,HMMPfam_NTF2	0	0.527					LOC128322			C			113092511	+1	no_errors	XM_060943	genbank	human	model	54_36p	missense	SNP	1.000	T
SLC9C1	285335	genome.wustl.edu	37	3	111927095	111927095	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr3:111927095A>T	ENST00000305815.5	-	16	2168	c.1916T>A	c.(1915-1917)aTc>aAc	p.I639N	SLC9C1_ENST00000487372.1_Missense_Mutation_p.I591N	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	639	Ion transport-like.				cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										GCTGTGGTAGATTACATTTAA	0.299																																																0			3											111.0	132.0	125.0					3																	111927095		2203	4297	6500	113409785	SO:0001583	missense	285335			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.1916T>A	3.37:g.111927095A>T	ENSP00000306627:p.Ile639Asn	Somatic		Capture	Illumina GAIIx	4	113409785	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	HMMPfam_Na_H_Exchanger,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,PatternScan_WD_REPEATS_1,superfamily_cAMP-binding domain-like,HMMPfam_cNMP_binding	p.I639N	ENST00000305815.5	37	c.1916	CCDS33817.1	3	.	.	.	.	.	.	.	.	.	.	A	14.35	2.508452	0.44660	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	D;D	0.97256	-4.31;-4.31	5.69	3.33	0.38152	.	0.434052	0.22235	N	0.062773	D	0.96374	0.8817	L	0.41492	1.28	0.09310	N	0.999994	D;D	0.62365	0.991;0.976	P;P	0.62382	0.901;0.564	D	0.90974	0.4822	10	0.87932	D	0	-11.2644	7.4569	0.27272	0.8291:0.0:0.1709:0.0	.	591;639	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	N	639;591	ENSP00000306627:I639N;ENSP00000420688:I591N	ENSP00000306627:I639N	I	-	2	0	SLC9A10	113409785	0.213000	0.23551	0.049000	0.19019	0.003000	0.03518	1.156000	0.31712	0.524000	0.28502	-0.315000	0.08773	ATC	-	superfamily_Voltage-gated potassium channels		0.299	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A10	protein_coding	OTTHUMT00000354066.1	A	NM_183061		113409785	-1	no_errors	NM_183061	genbank	human	validated	54_36p	missense	SNP	0.002	T
CCDC112	153733	genome.wustl.edu	37	5	114607081	114607081	+	Silent	SNP	A	A	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr5:114607081A>G	ENST00000512261.1	-	8	1328	c.912T>C	c.(910-912)caT>caC	p.H304H	CCDC112_ENST00000395557.4_Silent_p.H304H|CCDC112_ENST00000506442.1_Silent_p.H304H|CCDC112_ENST00000379611.5_Silent_p.H387H			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	304										endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		GTTCTTTCTGATGTTTTTTCT	0.353																																																0			5											147.0	153.0	151.0					5																	114607081		2202	4300	6502	114634980	SO:0001819	synonymous_variant	153733			BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.912T>C	5.37:g.114607081A>G		Somatic		Capture	Illumina GAIIx	4	114634980	Q6A334	Silent	SNP	NULL	p.H387	ENST00000512261.1	37	c.1161	CCDS4117.1	5																																																																																			-	NULL		0.353	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	CCDC112	protein_coding	OTTHUMT00000370999.1	A	NM_152549		114634980	-1	no_errors	NM_001040440	genbank	human	validated	54_36p	silent	SNP	0.723	G
DSCAML1	57453	genome.wustl.edu	37	11	117302345	117302345	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr11:117302345C>T	ENST00000321322.6	-	31	5460	c.5459G>A	c.(5458-5460)cGc>cAc	p.R1820H	DSCAML1_ENST00000527706.1_Missense_Mutation_p.R1550H	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1760					axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GGTGAGGGTGCGGGCAGGTGT	0.627																																																0			11											137.0	131.0	133.0					11																	117302345		2201	4296	6497	116807555	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.5459G>A	11.37:g.117302345C>T	ENSP00000315465:p.Arg1820His	Somatic		Capture	Illumina GAIIx	4	116807555	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_I-set,HMMSmart_SM00406,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3	p.R1820H	ENST00000321322.6	37	c.5459	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	C	10.76	1.441562	0.25900	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.61040	0.17;0.14	4.82	4.82	0.62117	.	.	.	.	.	T	0.35008	0.0917	N	0.04508	-0.205	0.80722	D	1	B	0.12630	0.006	B	0.06405	0.002	T	0.21245	-1.0251	9	0.11182	T	0.66	.	17.6813	0.88243	0.0:1.0:0.0:0.0	.	1760	Q8TD84	DSCL1_HUMAN	H	1550;1820;1527	ENSP00000434335:R1550H;ENSP00000315465:R1820H	ENSP00000315465:R1820H	R	-	2	0	DSCAML1	116807555	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	5.876000	0.69667	2.499000	0.84300	0.561000	0.74099	CGC	-	NULL		0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	protein_coding	OTTHUMT00000392907.2	C	NM_020693		116807555	-1	no_errors	NM_020693	genbank	human	provisional	54_36p	missense	SNP	0.999	T
TBCEL	219899	genome.wustl.edu	37	11	120918333	120918333	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr11:120918333C>T	ENST00000529397.1	+	3	330	c.230C>T	c.(229-231)tCg>tTg	p.S77L	TBCEL_ENST00000422003.2_Missense_Mutation_p.S77L	NM_001130047.1	NP_001123519.1	Q5QJ74	TBCEL_HUMAN	tubulin folding cofactor E-like	77						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)			TECTA/TBCEL(2)	endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		Breast(109;0.00526)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.89e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.121)		GCTCATGTGTCGGAACTAGAT	0.413																																																0			11											136.0	122.0	127.0					11																	120918333		2203	4299	6502	120423543	SO:0001583	missense	219899			BC020501	CCDS31692.1	11q23.3	2008-02-05	2006-11-21	2006-11-21		ENSG00000154114			28115	protein-coding gene	gene with protein product		610451	"""leucine rich repeat containing 35"", ""tubulin-specific chaperone e-like"""	LRRC35		15728251	Standard	NM_152715		Approved	MGC10233	uc001pxo.3	Q5QJ74		ENST00000529397.1:c.230C>T	11.37:g.120918333C>T	ENSP00000437184:p.Ser77Leu	Somatic		Capture	Illumina GAIIx	4	120423543	Q0VAN6	Missense_Mutation	SNP	PatternScan_UBIQUITIN_1,superfamily_SSF52047,superfamily_SSF54236	p.S77L	ENST00000529397.1	37	c.230	CCDS31692.1	11	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804776	0.50315	.	.	ENSG00000154114	ENST00000529397;ENST00000528512;ENST00000422003;ENST00000524726	T;T;T	0.17691	2.26;2.26;2.26	5.59	5.59	0.84812	.	0.270334	0.38663	N	0.001619	T	0.12987	0.0315	N	0.22421	0.69	0.51482	D	0.999921	B	0.10296	0.003	B	0.09377	0.004	T	0.08764	-1.0706	10	0.29301	T	0.29	-0.0398	14.7685	0.69657	0.0:0.9289:0.0:0.0711	.	77	Q5QJ74	TBCEL_HUMAN	L	77	ENSP00000437184:S77L;ENSP00000403925:S77L;ENSP00000432783:S77L	ENSP00000284259:S77L	S	+	2	0	TBCEL	120423543	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	4.601000	0.61090	2.625000	0.88918	0.585000	0.79938	TCG	-	superfamily_SSF52047		0.413	TBCEL-005	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TBCEL	protein_coding	OTTHUMT00000387688.1	C	NM_152715		120423543	+1	no_errors	NM_152715	genbank	human	validated	54_36p	missense	SNP	0.984	T
ADAMTS19	171019	genome.wustl.edu	37	5	129072808	129072808	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr5:129072808G>A	ENST00000274487.4	+	23	3666	c.3521G>A	c.(3520-3522)cGa>cAa	p.R1174Q	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1174	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GTGTACTGCCGAGTGATACGT	0.478																																																0			5											136.0	124.0	128.0					5																	129072808		2203	4300	6503	129100707	SO:0001583	missense	171019			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3521G>A	5.37:g.129072808G>A	ENSP00000274487:p.Arg1174Gln	Somatic		Capture	Illumina GAIIx	4	129100707		Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMSmart_SM00608,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_PLAC"	p.R1174Q	ENST00000274487.4	37	c.3521	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	G	16.74	3.207390	0.58343	.	.	ENSG00000145808	ENST00000274487	T	0.42131	0.98	4.12	4.12	0.48240	PLAC (2);	0.000000	0.52532	D	0.000072	T	0.39572	0.1083	N	0.14661	0.345	0.34972	D	0.753226	D	0.71674	0.998	P	0.60609	0.877	T	0.43426	-0.9392	9	.	.	.	.	11.2192	0.48844	0.0858:0.0:0.9142:0.0	.	1174	Q8TE59	ATS19_HUMAN	Q	1174	ENSP00000274487:R1174Q	.	R	+	2	0	ADAMTS19	129100707	0.990000	0.36364	1.000000	0.80357	0.574000	0.36063	3.173000	0.50839	2.599000	0.87857	0.650000	0.86243	CGA	-	HMMPfam_PLAC		0.478	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	protein_coding	OTTHUMT00000250979.2	G	NM_133638		129100707	+1	no_errors	NM_133638	genbank	human	reviewed	54_36p	missense	SNP	0.884	A
LOC401010	401010	genome.wustl.edu	37	2	132202348	132202348	+	IGR	SNP	A	A	G	rs576826168	byFrequency	TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr2:132202348A>G								AC073869.19 (35726 upstream) : RP11-109E12.1 (17045 downstream)																							GCTTCTGGAGAGTATTCGGAC	0.672													.|||	8	0.00159744	0.0008	0.0029	5008	,	,		8418	0.0		0.005	False		,,,				2504	0.0															0			2																																								131918818	SO:0001628	intergenic_variant	401010																															2.37:g.132202348A>G		Somatic		Capture	Illumina GAIIx	4	131918818		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.672					LOC401010			A			131918818	-1	pseudogene	NR_002826	genbank	human	validated	54_36p	rna	SNP	0.093	G
TMEM71	137835	genome.wustl.edu	37	8	133734347	133734347	+	Missense_Mutation	SNP	G	G	C	rs529129801		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr8:133734347G>C	ENST00000356838.3	-	7	776	c.634C>G	c.(634-636)Caa>Gaa	p.Q212E	TMEM71_ENST00000377901.4_Missense_Mutation_p.Q168E|TMEM71_ENST00000523829.1_Missense_Mutation_p.Q231E	NM_144649.2	NP_653250.2	Q6P5X7	TMM71_HUMAN	transmembrane protein 71	231						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			AAGACCTCTTGCAACAACCTG	0.353																																																0			8											103.0	103.0	103.0					8																	133734347		2203	4300	6503	133803529	SO:0001583	missense	137835			AK057631	CCDS6366.1, CCDS47921.1	8q24.22	2005-09-02				ENSG00000165071			26572	protein-coding gene	gene with protein product						12477932	Standard	NM_144649		Approved	FLJ33069	uc003ytn.3	Q6P5X7		ENST00000356838.3:c.634C>G	8.37:g.133734347G>C	ENSP00000349296:p.Gln212Glu	Somatic		Capture	Illumina GAIIx	4	133803529	Q3KRC2|Q8WVZ4|Q96LX9	Missense_Mutation	SNP	NULL	p.Q212E	ENST00000356838.3	37	c.634	CCDS6366.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.822|1.822	-0.471919|-0.471919	0.04445|0.04445	.|.	.|.	ENSG00000165071|ENSG00000165071	ENST00000522780|ENST00000523829;ENST00000356838;ENST00000377901	.|.	.|.	.|.	5.72|5.72	0.381|0.381	0.16228|0.16228	.|.	.|1.835530	.|0.02098	.|N	.|0.053651	T|T	0.28699|0.28699	0.0711|0.0711	N|N	0.25647|0.25647	0.755|0.755	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.13594	.|0.008;0.001;0.008	.|B;B;B	.|0.12156	.|0.002;0.001;0.007	T|T	0.22277|0.22277	-1.0221|-1.0221	5|9	.|0.02654	.|T	.|1	9.3289|9.3289	9.4688|9.4688	0.38829|0.38829	0.0:0.4447:0.3053:0.25|0.0:0.4447:0.3053:0.25	.|.	.|231;168;212	.|Q6P5X7;Q6P5X7-3;Q6P5X7-2	.|TMM71_HUMAN;.;.	W|E	68|231;212;168	.|.	.|ENSP00000349296:Q212E	C|Q	-|-	3|1	2|0	TMEM71|TMEM71	133803529|133803529	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.014000|0.014000	0.08584|0.08584	0.266000|0.266000	0.18534|0.18534	0.108000|0.108000	0.17862|0.17862	0.650000|0.650000	0.86243|0.86243	TGC|CAA	-	NULL		0.353	TMEM71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM71	protein_coding	OTTHUMT00000379591.1	G	NM_144649		133803529	-1	no_errors	NM_144649	genbank	human	validated	54_36p	missense	SNP	0.001	C
GPR112	139378	genome.wustl.edu	37	X	135428631	135428631	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chrX:135428631T>G	ENST00000394143.1	+	6	3057	c.2766T>G	c.(2764-2766)agT>agG	p.S922R	GPR112_ENST00000370652.1_Missense_Mutation_p.S922R|GPR112_ENST00000287534.4_Missense_Mutation_p.S859R|GPR112_ENST00000394141.1_Missense_Mutation_p.S717R|GPR112_ENST00000412101.1_Missense_Mutation_p.S717R	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	922					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CACCTAGGAGTTCATACAATG	0.378																																																0			X											106.0	104.0	105.0					X																	135428631		2202	4299	6501	135256297	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.2766T>G	X.37:g.135428631T>G	ENSP00000377699:p.Ser922Arg	Somatic		Capture	Illumina GAIIx	4	135256297	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	superfamily_ConA_like_lec_gl,HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.S922R	ENST00000394143.1	37	c.2766	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	T	9.911	1.209595	0.22289	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.35605	1.33;1.33;1.3;1.43;1.3	2.53	0.0586	0.14328	.	.	.	.	.	T	0.27169	0.0666	L	0.29908	0.895	0.09310	N	1	P;P;P	0.43701	0.815;0.815;0.718	P;P;B	0.45099	0.469;0.469;0.278	T	0.14364	-1.0475	9	0.59425	D	0.04	.	4.3429	0.11119	0.0:0.3499:0.0:0.6501	.	859;717;922	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	R	922;922;717;859;717	ENSP00000377699:S922R;ENSP00000359686:S922R;ENSP00000416526:S717R;ENSP00000287534:S859R;ENSP00000377697:S717R	ENSP00000287534:S859R	S	+	3	2	GPR112	135256297	0.003000	0.15002	0.006000	0.13384	0.397000	0.30659	0.004000	0.13106	-0.061000	0.13110	0.235000	0.17854	AGT	-	NULL		0.378	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	protein_coding	OTTHUMT00000286639.1	T			135256297	+1	no_errors	NM_153834	genbank	human	validated	54_36p	missense	SNP	0.008	G
GYPB	2994	genome.wustl.edu	37	4	145038082	145038082	+	Intron	SNP	G	G	C	rs140973108		TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr4:145038082G>C	ENST00000283126.7	-	1	93				GYPA_ENST00000512064.1_Silent_p.L81L|GYPA_ENST00000512789.1_Silent_p.L29L|GYPA_ENST00000503627.1_Silent_p.L49L|GYPA_ENST00000324022.10_Silent_p.L61L|GYPA_ENST00000535709.1_Silent_p.L68L|RP11-673E1.4_ENST00000506982.1_RNA|GYPA_ENST00000504786.1_Silent_p.L62L|GYPA_ENST00000360771.4_Silent_p.L94L			P06028	GLPB_HUMAN	glycophorin B (MNS blood group)							integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.L94L(1)		breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					CAAAAATAATGAGTGTTATCT	0.348																																																1	Substitution - coding silent(1)	lung(1)	4											111.0	115.0	113.0					4																	145038082		2203	4300	6503	145257532	SO:0001627	intron_variant	2993				CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000283126.7:c.37+23669C>G	4.37:g.145038082G>C		Somatic		Capture	Illumina GAIIx	4	145257532	B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Silent	SNP	HMMPfam_Glycophorin_A,PatternScan_GLYCOPHORIN_A	p.L94	ENST00000283126.7	37	c.282		4																																																																																			-	HMMPfam_Glycophorin_A		0.348	GYPB-201	KNOWN	basic|appris_principal	protein_coding	GYPA	protein_coding		G	NM_002100		145257532	-1	no_errors	NM_002099	genbank	human	reviewed	54_36p	silent	SNP	0.001	C
AFF2	2334	genome.wustl.edu	37	X	147967464	147967464	+	Silent	SNP	T	T	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chrX:147967464T>C	ENST00000370460.2	+	8	1787	c.1308T>C	c.(1306-1308)ctT>ctC	p.L436L	AFF2_ENST00000342251.3_Silent_p.L403L|AFF2_ENST00000370457.5_Silent_p.L403L|AFF2_ENST00000286437.5_Silent_p.L77L|AFF2_ENST00000370458.1_Silent_p.L397L	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	436					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					AAGATGACCTTGAGCCTGTGA	0.483																																																0			X											334.0	280.0	299.0					X																	147967464		2203	4300	6503	147775157	SO:0001819	synonymous_variant	2334			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1308T>C	X.37:g.147967464T>C		Somatic		Capture	Illumina GAIIx	4	147775157	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	HMMPfam_AF-4	p.L436	ENST00000370460.2	37	c.1308	CCDS14684.1	X																																																																																			-	HMMPfam_AF-4		0.483	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	protein_coding	OTTHUMT00000058673.2	T	NM_002025		147775157	+1	no_errors	NM_002025	genbank	human	validated	54_36p	silent	SNP	0.998	C
ATF6	22926	genome.wustl.edu	37	1	161789467	161789467	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:161789467A>T	ENST00000367942.3	+	8	1021	c.954A>T	c.(952-954)gaA>gaT	p.E318D		NM_007348.3	NP_031374.2	P18850	ATF6A_HUMAN	activating transcription factor 6	318	Basic motif.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response (GO:0006990)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to stress (GO:0006950)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(14)|ovary(3)|skin(1)|stomach(1)	34	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)		Pseudoephedrine(DB00852)	AAAATCGAGAATCCGCTTGTC	0.378																																																0			1											66.0	66.0	66.0					1																	161789467		2203	4300	6503	160056091	SO:0001583	missense	22926			AB015856	CCDS1235.1	1q22-q23	2013-01-10			ENSG00000118217	ENSG00000118217		"""basic leucine zipper proteins"""	791	protein-coding gene	gene with protein product	"""activating transcription factor 6 alpha"""	605537				9837962, 9271374, 11256944	Standard	NM_007348		Approved	ATF6A	uc001gbs.3	P18850	OTTHUMG00000023961	ENST00000367942.3:c.954A>T	1.37:g.161789467A>T	ENSP00000356919:p.Glu318Asp	Somatic		Capture	Illumina GAIIx	4	160056091	O15139|Q5VW62|Q6IPB5|Q9UEC9	Missense_Mutation	SNP	HMMSmart_BRLZ,HMMPfam_bZIP_1,PatternScan_BZIP_BASIC	p.E318D	ENST00000367942.3	37	c.954	CCDS1235.1	1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.027551	0.75390	.	.	ENSG00000118217	ENST00000367942	T	0.60548	0.18	5.19	2.28	0.28536	Basic-leucine zipper (bZIP) transcription factor (3);bZIP transcription factor, bZIP-1 (1);	0.050709	0.85682	D	0.000000	T	0.64549	0.2608	M	0.85373	2.75	0.58432	D	0.999993	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.66324	-0.5952	9	0.59425	D	0.04	-10.0701	6.9984	0.24795	0.3793:0.0:0.6207:0.0	.	318;319	P18850;Q59H30	ATF6A_HUMAN;.	D	318	ENSP00000356919:E318D	ENSP00000356919:E318D	E	+	3	2	ATF6	160056091	1.000000	0.71417	0.963000	0.40424	0.985000	0.73830	3.250000	0.51445	0.191000	0.20236	-0.248000	0.11899	GAA	-	HMMSmart_BRLZ,HMMPfam_bZIP_1,PatternScan_BZIP_BASIC		0.378	ATF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF6	protein_coding	OTTHUMT00000060304.2	A	NM_007348		160056091	+1	no_errors	NM_007348	genbank	human	validated	54_36p	missense	SNP	1.000	T
QSOX1	5768	genome.wustl.edu	37	1	180163347	180163347	+	Splice_Site	SNP	G	G	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:180163347G>C	ENST00000367602.3	+	11	1362		c.e11-1		QSOX1_ENST00000367600.5_Splice_Site			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1						cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTGCCCTGTAGCCAAGGCCAA	0.677																																																0			1											34.0	28.0	30.0					1																	180163347		2203	4299	6502	178429970	SO:0001630	splice_region_variant	5768			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.1289-1G>C	1.37:g.180163347G>C		Somatic		Capture	Illumina GAIIx	4	178429970	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Splice_Site	SNP	-	e11-1	ENST00000367602.3	37	c.1289-1	CCDS1337.1	1	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968594	0.34754	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	.	.	.	3.88	3.88	0.44766	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0826	0.42399	0.1039:0.0:0.8961:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	QSOX1	178429970	1.000000	0.71417	0.879000	0.34478	0.583000	0.36354	5.955000	0.70306	2.117000	0.64856	0.462000	0.41574	.	-	-		0.677	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX1	protein_coding	OTTHUMT00000085289.1	G	NM_002826	Intron	178429970	+1	no_errors	NM_002826	genbank	human	reviewed	54_36p	splice_site	SNP	0.168	C
BRINP3	339479	genome.wustl.edu	37	1	190067657	190067657	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:190067657G>A	ENST00000367462.3	-	8	2023	c.1792C>T	c.(1792-1794)Cgg>Tgg	p.R598W	BRINP3_ENST00000534846.1_Missense_Mutation_p.R496W	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	598					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AACTTAGTCCGCTCCCAGTCT	0.473																																																0			1											189.0	194.0	192.0					1																	190067657		2203	4300	6503	188334280	SO:0001583	missense	339479			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1792C>T	1.37:g.190067657G>A	ENSP00000356432:p.Arg598Trp	Somatic		Capture	Illumina GAIIx	4	188334280	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	HMMPfam_MACPF,HMMSmart_SM00457	p.R598W	ENST00000367462.3	37	c.1792	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653328	0.47362	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.21543	2.25;2.0	5.61	3.59	0.41128	.	0.134805	0.51477	D	0.000094	T	0.31389	0.0795	L	0.55481	1.735	0.36261	D	0.854522	D;D	0.67145	0.996;0.993	P;P	0.53549	0.729;0.539	T	0.45160	-0.9280	10	0.87932	D	0	.	12.1978	0.54307	0.0:0.0:0.691:0.309	.	496;598	B7Z260;Q76B58	.;FAM5C_HUMAN	W	598;496	ENSP00000356432:R598W;ENSP00000438022:R496W	ENSP00000356432:R598W	R	-	1	2	FAM5C	188334280	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.855000	0.39378	1.336000	0.45506	0.585000	0.79938	CGG	-	NULL		0.473	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5C	protein_coding	OTTHUMT00000086278.1	G	NM_199051		188334280	-1	no_errors	NM_199051	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ARID4B	51742	genome.wustl.edu	37	1	235397796	235397796	+	Silent	SNP	A	A	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:235397796A>C	ENST00000264183.3	-	9	1094	c.597T>G	c.(595-597)ccT>ccG	p.P199P	ARID4B_ENST00000366603.2_Silent_p.P199P|ARID4B_ENST00000349213.3_Silent_p.P199P	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	199					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CACTACAATCAGGACAAACCA	0.308																																																0			1											38.0	37.0	37.0					1																	235397796		2202	4295	6497	233464419	SO:0001819	synonymous_variant	51742			AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.597T>G	1.37:g.235397796A>C		Somatic		Capture	Illumina GAIIx	4	233464419	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Silent	SNP	HMMSmart_SM00333,HMMPfam_RBB1NT,superfamily_ARID-like,HMMPfam_ARID,HMMSmart_SM00501	p.P199	ENST00000264183.3	37	c.597	CCDS31061.1	1																																																																																			-	HMMPfam_RBB1NT		0.308	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID4B	protein_coding	OTTHUMT00000095566.3	A	NM_016374		233464419	-1	no_errors	NM_016374	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
HEATR1	55127	genome.wustl.edu	37	1	236751310	236751310	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:236751310C>G	ENST00000366582.3	-	13	1678	c.1564G>C	c.(1564-1566)Gtt>Ctt	p.V522L	HEATR1_ENST00000366581.2_Missense_Mutation_p.V522L	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	522					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CGGGCTAAAACAGCTTCTTTT	0.338																																																0			1											117.0	110.0	112.0					1																	236751310		2203	4300	6503	234817933	SO:0001583	missense	55127			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1564G>C	1.37:g.236751310C>G	ENSP00000355541:p.Val522Leu	Somatic		Capture	Illumina GAIIx	4	234817933	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_HEAT,HMMPfam_BP28CT	p.V522L	ENST00000366582.3	37	c.1564	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	C	10.28	1.307272	0.23821	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.52526	0.66;0.79	5.8	-1.82	0.07857	Armadillo-like helical (1);Armadillo-type fold (1);	0.626741	0.16146	N	0.227477	T	0.28863	0.0716	N	0.19112	0.55	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.17137	-1.0379	10	0.13108	T	0.6	.	14.5577	0.68113	0.0:0.0951:0.0:0.9049	.	522	Q9H583	HEAT1_HUMAN	L	522	ENSP00000355541:V522L;ENSP00000355540:V522L	ENSP00000355540:V522L	V	-	1	0	HEATR1	234817933	0.460000	0.25776	0.977000	0.42913	0.989000	0.77384	-0.662000	0.05305	-0.668000	0.05296	0.650000	0.86243	GTT	-	NULL		0.338	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	protein_coding	OTTHUMT00000096635.1	C	XM_375853		234817933	-1	no_errors	NM_018072	genbank	human	validated	54_36p	missense	SNP	0.939	G
C1orf101	257044	genome.wustl.edu	37	1	244755027	244755027	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2543-01A-01D-1526-09	TCGA-36-2543-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	c0e2ee16-f147-4b50-8efe-48f5303a1dee	23e88e28-f8a7-4d32-8b1e-0aad28fc8135	g.chr1:244755027T>C	ENST00000366534.4	+	15	2237	c.2183T>C	c.(2182-2184)aTt>aCt	p.I728T	C1orf101_ENST00000366533.4_Missense_Mutation_p.I728T|C1orf101_ENST00000473875.1_3'UTR|AC099757.1_ENST00000458882.1_RNA|C1orf101_ENST00000366531.3_Missense_Mutation_p.I577T	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	728						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			TCATACGTGATTGAAAAGTAA	0.254																																																0			1											61.0	63.0	62.0					1																	244755027		2200	4288	6488	242821650	SO:0001583	missense	257044			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.2183T>C	1.37:g.244755027T>C	ENSP00000355492:p.Ile728Thr	Somatic		Capture	Illumina GAIIx	4	242821650	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	NULL	p.I728T	ENST00000366534.4	37	c.2183	CCDS44340.1	1	.	.	.	.	.	.	.	.	.	.	T	16.02	3.003235	0.54254	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042;ENST00000366531	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	4.51	4.51	0.55191	.	0.256618	0.26844	N	0.022205	T	0.59824	0.2222	M	0.65975	2.015	0.28834	N	0.896985	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.87578	0.998;0.975;0.988;0.998	T	0.57213	-0.7850	10	0.87932	D	0	.	10.3777	0.44092	0.0:0.0:0.0:1.0	.	648;728;728;577	B1AQM6;Q5SY80;Q5SY80-2;B4DZR4	.;CA101_HUMAN;.;.	T	728;728;728;648;577	ENSP00000355492:I728T;ENSP00000355491:I728T;ENSP00000395796:I648T;ENSP00000355489:I577T	ENSP00000355489:I577T	I	+	2	0	C1orf101	242821650	1.000000	0.71417	0.985000	0.45067	0.830000	0.47004	3.177000	0.50871	2.011000	0.59026	0.482000	0.46254	ATT	-	NULL		0.254	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	protein_coding	OTTHUMT00000096701.1	T	NM_173807		242821650	+1	no_errors	NM_173807	genbank	human	validated	54_36p	missense	SNP	0.806	C
