#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ZNF232	7775	genome.wustl.edu	37	17	5009610	5009610	+	Nonsense_Mutation	SNP	G	G	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr17:5009610G>A	ENST00000250076.3	-	5	1498	c.844C>T	c.(844-846)Cag>Tag	p.Q282*	ZNF232_ENST00000416429.2_3'UTR|ZNF232_ENST00000575898.1_Nonsense_Mutation_p.Q273*|ZNF232_ENST00000575538.1_5'Flank	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	255					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						CTTTCCTCCTGGGCAGGGGAC	0.458																																																0			17											98.0	98.0	98.0					17																	5009610		2203	4300	6503	4950334	SO:0001587	stop_gained	7775			AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.844C>T	17.37:g.5009610G>A	ENSP00000250076:p.Gln282*	Somatic		Capture	Illumina GAIIx	4	4950334		Nonsense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.Q282*	ENST00000250076.3	37	c.844	CCDS11068.1	17	.	.	.	.	.	.	.	.	.	.	G	10.47	1.359701	0.24598	.	.	ENSG00000167840	ENST00000250076	.	.	.	2.99	2.99	0.34606	.	0.000000	0.31020	N	0.008408	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	12.2055	0.54350	0.0:0.0:1.0:0.0	.	.	.	.	X	282	.	ENSP00000250076:Q282X	Q	-	1	0	ZNF232	4950334	0.145000	0.22656	0.536000	0.28039	0.184000	0.23303	3.417000	0.52714	1.958000	0.56883	0.655000	0.94253	CAG	-	superfamily_C2H2 and C2HC zinc fingers		0.458	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF232	protein_coding	OTTHUMT00000216915.1	G	NM_014519		4950334	-1	no_errors	NM_014519	genbank	human	validated	54_36p	nonsense	SNP	0.037	A
MTCL1	23255	genome.wustl.edu	37	18	8798104	8798104	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr18:8798104C>T	ENST00000306329.11	+	8	3208	c.3208C>T	c.(3208-3210)Cca>Tca	p.P1070S	SOGA2_ENST00000306285.7_Missense_Mutation_p.P66S|SOGA2_ENST00000359865.3_Missense_Mutation_p.P751S|SOGA2_ENST00000400050.3_Missense_Mutation_p.P710S|SOGA2_ENST00000518815.1_Missense_Mutation_p.P66S|SOGA2_ENST00000517570.1_Missense_Mutation_p.P710S																							GGGTGAACATCCAGAGACCCT	0.562																																																0			18											47.0	42.0	43.0					18																	8798104		2203	4300	6503	8788104	SO:0001583	missense	23255																														ENST00000306329.11:c.3208C>T	18.37:g.8798104C>T	ENSP00000305027:p.Pro1070Ser	Somatic		Capture	Illumina GAIIx	4	8788104		Missense_Mutation	SNP	NULL	p.P751S	ENST00000306329.11	37	c.2251		18	.	.	.	.	.	.	.	.	.	.	C	7.849	0.723595	0.15439	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.28	0.987	0.19790	.	0.276491	0.26453	N	0.024282	T	0.41419	0.1158	L	0.56769	1.78	0.28029	N	0.934212	B;B	0.17465	0.022;0.002	B;B	0.11329	0.005;0.006	T	0.35226	-0.9797	10	0.08837	T	0.75	-0.9157	10.1611	0.42853	0.1439:0.4368:0.4193:0.0	.	1061;751	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	S	772;710;751;710;66	ENSP00000429556:P710S;ENSP00000352927:P751S;ENSP00000382924:P710S;ENSP00000303670:P66S	ENSP00000303670:P66S	P	+	1	0	CCDC165	8788104	0.979000	0.34478	0.984000	0.44739	0.092000	0.18411	0.597000	0.24059	0.260000	0.21731	0.650000	0.86243	CCA	-	NULL		0.562	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	KIAA0802	protein_coding	OTTHUMT00000444141.1	C			8788104	+1	no_errors	NM_015210	genbank	human	predicted	54_36p	missense	SNP	0.996	T
ATP2B2	491	genome.wustl.edu	37	3	10442673	10442673	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr3:10442673G>T	ENST00000352432.4	-	4	814	c.745C>A	c.(745-747)Cgc>Agc	p.R249S	ATP2B2_ENST00000397077.1_Missense_Mutation_p.R249S|ATP2B2_ENST00000383800.4_Missense_Mutation_p.R249S|ATP2B2_ENST00000360273.2_Missense_Mutation_p.R249S|ATP2B2_ENST00000343816.4_Missense_Mutation_p.R249S			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	249					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						ACGGACTTGCGCACCTGGTCA	0.597																																					Ovarian(125;1619 1709 15675 19819 38835)											0			3											145.0	119.0	128.0					3																	10442673		2203	4300	6503	10417673	SO:0001583	missense	491			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.745C>A	3.37:g.10442673G>T	ENSP00000324172:p.Arg249Ser	Somatic		Capture	Illumina GAIIx	4	10417673	O00766|Q12994|Q16818	Missense_Mutation	SNP	HMMPfam_Cation_ATPase_N,superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A,HMMPfam_Hydrolase,superfamily_HAD-like,PatternScan_ATPASE_E1_E2,superfamily_Metal cation-transporting ATPase ATP-binding domain N,HMMPfam_Cation_ATPase_C	p.R249S	ENST00000352432.4	37	c.745	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880587	0.72294	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61;-2.61;-2.61	5.6	5.6	0.85130	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.055309	0.64402	D	0.000002	D	0.85225	0.5648	N	0.21448	0.665	0.58432	D	0.999998	P;B;B	0.37955	0.612;0.034;0.189	B;B;B	0.39971	0.287;0.12;0.315	D	0.85774	0.1357	10	0.54805	T	0.06	-20.274	19.6187	0.95647	0.0:0.0:1.0:0.0	.	249;261;249	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	S	249;249;249;249;249;215;136;249	ENSP00000324172:R249S;ENSP00000373311:R249S;ENSP00000380267:R249S;ENSP00000353414:R249S;ENSP00000344677:R249S;ENSP00000414854:R136S	ENSP00000342954:R249S	R	-	1	0	ATP2B2	10417673	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.555000	0.53727	2.627000	0.88993	0.650000	0.86243	CGC	-	superfamily_Calcium ATPase transmembrane domain M,HMMPfam_E1-E2_ATPase,superfamily_Calcium ATPase transduction domain A		0.597	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	protein_coding	OTTHUMT00000250576.2	G	NM_001683		10417673	-1	no_errors	NM_001001331	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MYOCD	93649	genome.wustl.edu	37	17	12626204	12626204	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr17:12626204G>C	ENST00000343344.4	+	5	294	c.294G>C	c.(292-294)aaG>aaC	p.K98N	MYOCD_ENST00000425538.1_Missense_Mutation_p.K98N|AC005358.1_ENST00000609971.1_Missense_Mutation_p.K2N|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	98					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CTCAGATGAAGCTGAAAAGAG	0.448																																																0			17											126.0	136.0	132.0					17																	12626204		2203	4300	6503	12566929	SO:0001583	missense	93649			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.294G>C	17.37:g.12626204G>C	ENSP00000341835:p.Lys98Asn	Somatic		Capture	Illumina GAIIx	4	12566929	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	HMMSmart_SM00707,superfamily_SAP domain,HMMPfam_SAP,HMMSmart_SM00513	p.K98N	ENST00000343344.4	37	c.294	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678539	0.68042	.	.	ENSG00000141052	ENST00000425538;ENST00000343344;ENST00000395988	T	0.51071	0.72	5.46	3.49	0.39957	.	0.313194	0.34531	N	0.003886	T	0.62454	0.2429	M	0.75264	2.295	0.40972	D	0.984709	D;D;D	0.76494	0.999;0.999;0.997	D;D;P	0.69479	0.964;0.911;0.81	T	0.64011	-0.6507	10	0.66056	D	0.02	-30.4684	7.1236	0.25458	0.3218:0.0:0.6782:0.0	.	2;98;98	Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	N	98;98;2	ENSP00000341835:K98N	ENSP00000341835:K98N	K	+	3	2	MYOCD	12566929	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.042000	0.49815	0.879000	0.35944	0.655000	0.94253	AAG	-	NULL		0.448	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	protein_coding	OTTHUMT00000129950.1	G	NM_153604		12566929	+1	no_errors	NM_153604	genbank	human	provisional	54_36p	missense	SNP	1.000	C
OR7A5	26659	genome.wustl.edu	37	19	14938717	14938717	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr19:14938717A>C	ENST00000322301.3	-	2	424	c.337T>G	c.(337-339)Ttc>Gtc	p.F113V	OR7A5_ENST00000601611.1_Intron|OR7A5_ENST00000594432.1_Missense_Mutation_p.F113V			Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A, member 5	113					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	26						GACAGGAGGAAGTTTTCAAAT	0.463																																																0			19											131.0	119.0	123.0					19																	14938717		2203	4300	6503	14799717	SO:0001583	missense	26659			X64976	CCDS12318.1	19p13.1	2012-08-09	2003-12-09			ENSG00000188269		"""GPCR / Class A : Olfactory receptors"""	8368	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily A, member 5 pseudogene"""				Standard	XM_006722722		Approved	HTPCR2	uc002mzw.3	Q15622		ENST00000322301.3:c.337T>G	19.37:g.14938717A>C	ENSP00000316955:p.Phe113Val	Somatic		Capture	Illumina GAIIx	4	14799717	B2R682|Q6IFP1|Q96R96	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.F113V	ENST00000322301.3	37	c.337	CCDS12318.1	19	.	.	.	.	.	.	.	.	.	.	a	10.84	1.464876	0.26335	.	.	ENSG00000188269	ENST00000322301	T	0.05925	3.37	3.13	2.1	0.27182	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32548	U	0.005956	T	0.05181	0.0138	L	0.38953	1.18	0.09310	N	1	B	0.31077	0.307	B	0.29524	0.103	T	0.32587	-0.9901	10	0.59425	D	0.04	.	6.4264	0.21772	0.8736:0.0:0.1264:0.0	.	113	Q15622	OR7A5_HUMAN	V	113	ENSP00000316955:F113V	ENSP00000316955:F113V	F	-	1	0	OR7A5	14799717	0.000000	0.05858	0.001000	0.08648	0.049000	0.14656	1.030000	0.30153	0.453000	0.26858	0.113000	0.15668	TTC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1		0.463	OR7A5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A5	protein_coding	OTTHUMT00000466518.1	A	NM_017506		14799717	-1	no_errors	NM_017506	genbank	human	validated	54_36p	missense	SNP	0.028	C
PTPRO	5800	genome.wustl.edu	37	12	15654706	15654706	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr12:15654706C>T	ENST00000281171.4	+	5	1144	c.814C>T	c.(814-816)Cct>Tct	p.P272S	PTPRO_ENST00000543886.1_Missense_Mutation_p.P272S|PTPRO_ENST00000348962.2_Missense_Mutation_p.P272S	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	272	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				AGAAGAAACCCCTGAAATTCC	0.428																																																0			12											68.0	67.0	67.0					12																	15654706		2203	4300	6503	15545973	SO:0001583	missense	5800			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.814C>T	12.37:g.15654706C>T	ENSP00000281171:p.Pro272Ser	Somatic		Capture	Illumina GAIIx	4	15545973	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.P272S	ENST00000281171.4	37	c.814	CCDS8675.1	12	.	.	.	.	.	.	.	.	.	.	C	4.616	0.114550	0.08831	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.03951	3.77;3.75	4.49	2.58	0.30949	.	0.166732	0.28290	N	0.015898	T	0.02380	0.0073	N	0.12182	0.205	0.09310	N	0.999997	B;B;B	0.34103	0.029;0.085;0.437	B;B;B	0.30401	0.013;0.039;0.115	T	0.46205	-0.9208	10	0.29301	T	0.29	.	4.9957	0.14237	0.1467:0.6256:0.0:0.2277	.	272;272;272	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	S	272	ENSP00000281171:P272S;ENSP00000343434:P272S	ENSP00000281171:P272S	P	+	1	0	PTPRO	15545973	0.001000	0.12720	0.013000	0.15412	0.666000	0.39218	0.222000	0.17699	0.466000	0.27193	-0.312000	0.09012	CCT	-	NULL		0.428	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	protein_coding	OTTHUMT00000401079.1	C			15545973	+1	no_errors	NM_030667	genbank	human	reviewed	54_36p	missense	SNP	0.005	T
ANKLE1	126549	genome.wustl.edu	37	19	17396546	17396546	+	Silent	SNP	C	C	T	rs148939227	byFrequency	TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr19:17396546C>T	ENST00000394458.3	+	8	1869	c.1593C>T	c.(1591-1593)tgC>tgT	p.C531C	ANKLE1_ENST00000433424.2_3'UTR|ANKLE1_ENST00000404085.1_Silent_p.C527C|ANKLE1_ENST00000598347.1_Intron|ANKLE1_ENST00000594072.1_Silent_p.C494C	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	531	GIY-YIG. {ECO:0000255|PROSITE- ProRule:PRU00977}.									large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						CCAGTGGTTGCGGTGTTGTGT	0.602																																																0			19						C		0,4406		0,0,2203	137.0	109.0	118.0		1593	-4.7	0.6	19	dbSNP_134	118	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ANKLE1	NM_152363.4		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		531/616	17396546	2,13004	2203	4300	6503	17257546	SO:0001819	synonymous_variant	126549			AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.1593C>T	19.37:g.17396546C>T		Somatic		Capture	Illumina GAIIx	4	17257546	A8VU82|Q8N8J8	Silent	SNP	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248,HMMPfam_LEM	p.C520	ENST00000394458.3	37	c.1560	CCDS12354.2	19																																																																																			-	NULL		0.602	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE1	protein_coding	OTTHUMT00000325392.2	C	NM_152363		17257546	+1	no_errors	NM_152363	genbank	human	validated	54_36p	silent	SNP	0.969	T
MYOD1	4654	genome.wustl.edu	37	11	17742511	17742511	+	Nonsense_Mutation	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr11:17742511C>A	ENST00000250003.3	+	2	908	c.693C>A	c.(691-693)taC>taA	p.Y231*		NM_002478.4	NP_002469.2	P15172	MYOD1_HUMAN	myogenic differentiation 1	231					cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to oxygen levels (GO:0071453)|cellular response to starvation (GO:0009267)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|myoblast fate determination (GO:0007518)|myotube cell development (GO:0014904)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|transcription from RNA polymerase II promoter (GO:0006366)	myofibril (GO:0030016)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	17						GCGCCTACTACAACGAGGCGC	0.677																																																0			11											13.0	17.0	16.0					11																	17742511		2194	4282	6476	17699087	SO:0001587	stop_gained	4654			AF027148	CCDS7826.1	11p15	2013-05-21	2005-09-12			ENSG00000129152		"""Basic helix-loop-helix proteins"""	7611	protein-coding gene	gene with protein product	"""myoblast determination protein 1"""	159970	"""myogenic factor 3"""	MYF3			Standard	NM_002478		Approved	PUM, MYOD, bHLHc1	uc001mni.3	P15172		ENST00000250003.3:c.693C>A	11.37:g.17742511C>A	ENSP00000250003:p.Tyr231*	Somatic		Capture	Illumina GAIIx	4	17699087	O75321	Nonsense_Mutation	SNP	HMMPfam_Basic,HMMSmart_BASIC,superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH	p.Y231*	ENST00000250003.3	37	c.693	CCDS7826.1	11	.	.	.	.	.	.	.	.	.	.	C	39	7.469841	0.98302	.	.	ENSG00000129152	ENST00000250003	.	.	.	4.57	4.57	0.56435	.	0.183525	0.49305	D	0.000155	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-33.4745	14.6818	0.69023	0.0:1.0:0.0:0.0	.	.	.	.	X	231	.	ENSP00000250003:Y231X	Y	+	3	2	MYOD1	17699087	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.214000	0.51161	2.374000	0.81015	0.643000	0.83706	TAC	-	NULL		0.677	MYOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOD1	protein_coding	OTTHUMT00000389387.1	C	NM_002478		17699087	+1	no_errors	NM_002478	genbank	human	reviewed	54_36p	nonsense	SNP	0.996	A
GATAD2A	54815	genome.wustl.edu	37	19	19603513	19603513	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr19:19603513G>A	ENST00000360315.3	+	4	838	c.526G>A	c.(526-528)Gcc>Acc	p.A176T	GATAD2A_ENST00000404158.1_Missense_Mutation_p.A176T|GATAD2A_ENST00000358713.3_Missense_Mutation_p.A176T|GATAD2A_ENST00000252577.5_Missense_Mutation_p.A176T|GATAD2A_ENST00000429563.2_Missense_Mutation_p.A33T|GATAD2A_ENST00000537887.1_Intron	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	176	CR1; MBD2-binding.				anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						GGAAGCCACCGCCCAGAAGGT	0.522																																																0			19											95.0	88.0	91.0					19																	19603513		2203	4300	6503	19464513	SO:0001583	missense	54815			AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.526G>A	19.37:g.19603513G>A	ENSP00000353463:p.Ala176Thr	Somatic		Capture	Illumina GAIIx	4	19464513	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_GATA_ZN_FINGER_1,HMMPfam_GATA	p.A33T	ENST00000360315.3	37	c.97	CCDS12402.2	19	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696423	0.30142	.	.	ENSG00000167491	ENST00000417582;ENST00000360315;ENST00000252577;ENST00000404158;ENST00000358713;ENST00000429563	T;T;T;T;T	0.46451	0.95;1.46;1.45;1.46;0.87	5.41	-6.79	0.01715	.	0.774966	0.12812	N	0.437120	T	0.22166	0.0534	L	0.38838	1.175	0.37796	D	0.927547	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.18398	-1.0338	10	0.13470	T	0.59	-11.434	6.6562	0.22988	0.18:0.0996:0.622:0.0983	.	33;195;176	B4DKZ7;B5MC40;Q86YP4	.;.;P66A_HUMAN	T	176;176;176;195;176;33	ENSP00000403703:A176T;ENSP00000353463:A176T;ENSP00000252577:A176T;ENSP00000351552:A176T;ENSP00000388416:A33T	ENSP00000252577:A176T	A	+	1	0	GATAD2A	19464513	0.000000	0.05858	0.003000	0.11579	0.634000	0.38068	0.132000	0.15891	-1.185000	0.02716	-0.367000	0.07326	GCC	-	NULL		0.522	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATAD2A	protein_coding	OTTHUMT00000326671.4	G	NM_017660		19464513	+1	no_errors	NM_017660	genbank	human	provisional	54_36p	missense	SNP	0.004	A
ALDH3A2	224	genome.wustl.edu	37	17	19552332	19552332	+	Silent	SNP	G	G	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr17:19552332G>T	ENST00000176643.6	+	1	494	c.48G>T	c.(46-48)cgG>cgT	p.R16R	ALDH3A2_ENST00000339618.4_Silent_p.R16R|ALDH3A2_ENST00000395575.2_Silent_p.R16R|Y_RNA_ENST00000578640.1_RNA|ALDH3A2_ENST00000581518.1_Silent_p.R16R|ALDH3A2_ENST00000579855.1_Silent_p.R16R			P51648	AL3A2_HUMAN	aldehyde dehydrogenase 3 family, member A2	16					cellular aldehyde metabolic process (GO:0006081)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|oxidation-reduction process (GO:0055114)|peripheral nervous system development (GO:0007422)|phytol metabolic process (GO:0033306)|sesquiterpenoid metabolic process (GO:0006714)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|peroxisome (GO:0005777)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|long-chain-alcohol oxidase activity (GO:0046577)|long-chain-aldehyde dehydrogenase activity (GO:0050061)|medium-chain-aldehyde dehydrogenase activity (GO:0052814)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|ovary(2)|prostate(1)	13	all_cancers(12;1.39e-05)|all_epithelial(12;0.00158)|Breast(13;0.245)					TGTCCGGCCGGTCGCGACCTC	0.697																																																0			17											10.0	12.0	11.0					17																	19552332		2164	4252	6416	19492924	SO:0001819	synonymous_variant	224			L47162	CCDS11210.1, CCDS32589.1	17p11.2	2010-05-07			ENSG00000072210	ENSG00000072210	1.2.1.3	"""Aldehyde dehydrogenases"""	403	protein-coding gene	gene with protein product	"""fatty aldehyde dehydrogenase"""	609523		SLS, ALDH10		7894487	Standard	NM_000382		Approved	FALDH	uc002gwa.1	P51648	OTTHUMG00000059471	ENST00000176643.6:c.48G>T	17.37:g.19552332G>T		Somatic		Capture	Illumina GAIIx	4	19492924	Q6I9T3|Q93011|Q96J37	Silent	SNP	superfamily_Aldehyde_DH/Histidinol_DH,HMMPfam_Aldedh,PatternScan_ALDEHYDE_DEHYDR_GLU,PatternScan_ALDEHYDE_DEHYDR_CYS	p.R16	ENST00000176643.6	37	c.48	CCDS11210.1	17																																																																																			-	superfamily_Aldehyde_DH/Histidinol_DH		0.697	ALDH3A2-001	KNOWN	basic|CCDS	protein_coding	ALDH3A2	protein_coding	OTTHUMT00000132268.1	G			19492924	+1	no_errors	NM_001031806	genbank	human	reviewed	54_36p	silent	SNP	0.912	T
ZNF253	56242	genome.wustl.edu	37	19	20002770	20002770	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr19:20002770G>C	ENST00000589717.1	+	4	806	c.714G>C	c.(712-714)aaG>aaC	p.K238N	ZNF253_ENST00000355650.4_Missense_Mutation_p.K162N|CTC-559E9.8_ENST00000585571.1_RNA|AC011477.1_ENST00000578823.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	238				Missing (in Ref. 1; AAC26844). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAGCCTTTAAGCAGTCCTCAA	0.408																																																0			19											45.0	49.0	48.0					19																	20002770		2169	4283	6452	19863770	SO:0001583	missense	56242			AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.714G>C	19.37:g.20002770G>C	ENSP00000468720:p.Lys238Asn	Somatic		Capture	Illumina GAIIx	4	19863770	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.K238N	ENST00000589717.1	37	c.714	CCDS42532.1	19	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.917821	0.00503	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.876	-1.75	0.08031	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22166	0.0534	N	0.21097	0.63	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.20874	-1.0262	7	.	.	.	.	3.4306	0.07426	0.2365:0.2683:0.4953:0.0	.	238	O75346	ZN253_HUMAN	N	238	.	.	K	+	3	2	ZNF253	19863770	0.000000	0.05858	0.109000	0.21407	0.109000	0.19521	-6.726000	0.00055	-0.881000	0.03992	-0.876000	0.02978	AAG	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.408	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF253	protein_coding	OTTHUMT00000460802.1	G	NM_021047		19863770	+1	no_errors	NM_021047	genbank	human	provisional	54_36p	missense	SNP	0.001	C
HTR6	3362	genome.wustl.edu	37	1	20005164	20005164	+	Silent	SNP	G	G	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr1:20005164G>A	ENST00000289753.1	+	2	1286	c.819G>A	c.(817-819)ctG>ctA	p.L273L		NM_000871.1	NP_000862.1	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled	273					brain development (GO:0007420)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|long-term synaptic potentiation (GO:0060291)|negative regulation of acetylcholine secretion, neurotransmission (GO:0014058)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|synaptic transmission (GO:0007268)	cilium (GO:0005929)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)|serotonin receptor activity (GO:0004993)			endometrium(1)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Mianserin(DB06148)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Quetiapine(DB01224)|Sertindole(DB06144)|Ziprasidone(DB00246)	TGGGCATCCTGCTGGGCATGT	0.632																																					Esophageal Squamous(168;1879 2619 6848 21062)											0			1											79.0	61.0	67.0					1																	20005164		2203	4300	6503	19877751	SO:0001819	synonymous_variant	3362			L41147	CCDS197.1	1p36-p35	2012-08-08	2012-02-03		ENSG00000158748	ENSG00000158748		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5301	protein-coding gene	gene with protein product		601109	"""5-hydroxytryptamine (serotonin) receptor 6"""			8522988	Standard	NM_000871		Approved	5-HT6, 5-HT6R	uc001bcl.3	P50406	OTTHUMG00000002713	ENST00000289753.1:c.819G>A	1.37:g.20005164G>A		Somatic		Capture	Illumina GAIIx	4	19877751	Q13640|Q5TGZ1	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L273	ENST00000289753.1	37	c.819	CCDS197.1	1																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.632	HTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR6	protein_coding	OTTHUMT00000007704.1	G	NM_000871		19877751	+1	no_errors	NM_000871	genbank	human	provisional	54_36p	silent	SNP	1.000	A
BCR	613	genome.wustl.edu	37	22	23629403	23629403	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr22:23629403G>C	ENST00000305877.8	+	11	3215	c.2464G>C	c.(2464-2466)Gag>Cag	p.E822Q	BCR_ENST00000359540.3_Missense_Mutation_p.E822Q	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	822	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GTCGGAGCAGGAGTCACTGCT	0.627			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0			22											164.0	115.0	132.0					22																	23629403		2193	4287	6480	21959403	SO:0001583	missense	613				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.2464G>C	22.37:g.23629403G>C	ENSP00000303507:p.Glu822Gln	Somatic		Capture	Illumina GAIIx	4	21959403	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	superfamily_Bcr-Abl oncoprotein oligomerization domain,HMMPfam_Bcr-Abl_Oligo,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,PatternScan_DH_1,superfamily_PH domain-like,HMMSmart_SM00233,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.E822Q	ENST00000305877.8	37	c.2464	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	G	30	5.054028	0.93793	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.21932	1.98;1.98	4.42	4.42	0.53409	Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.48857	0.1523	M	0.82193	2.58	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.992;1.0	D;D;D;D	0.97110	0.987;0.987;0.943;1.0	T	0.48364	-0.9042	10	0.26408	T	0.33	.	16.8994	0.86109	0.0:0.0:1.0:0.0	.	411;440;822;822	B4E065;Q12844;P11274-2;P11274	.;.;.;BCR_HUMAN	Q	822;822;487	ENSP00000303507:E822Q;ENSP00000352535:E822Q	ENSP00000303507:E822Q	E	+	1	0	BCR	21959403	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.456000	0.97628	2.383000	0.81215	0.655000	0.94253	GAG	-	superfamily_PH domain-like,HMMSmart_SM00233		0.627	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	protein_coding	OTTHUMT00000075819.1	G	NM_004327		21959403	+1	no_errors	NM_004327	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RNF17	56163	genome.wustl.edu	37	13	25363856	25363856	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr13:25363856A>G	ENST00000255324.5	+	9	933	c.881A>G	c.(880-882)gAg>gGg	p.E294G	RNF17_ENST00000255326.4_3'UTR|RNF17_ENST00000255325.6_Missense_Mutation_p.E294G|RNF17_ENST00000381921.1_Missense_Mutation_p.E294G	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	294					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		AATTGCAGTGAGATCATCTGT	0.308																																																0			13											160.0	162.0	161.0					13																	25363856		2203	4296	6499	24261856	SO:0001583	missense	56163			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.881A>G	13.37:g.25363856A>G	ENSP00000255324:p.Glu294Gly	Somatic		Capture	Illumina GAIIx	4	24261856	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	superfamily_RING/U-box,PatternScan_ZF_RING_1,HMMPfam_TUDOR,superfamily_Tudor/PWWP/MBT,HMMSmart_SM00333,superfamily_Staphylococcal nuclease	p.E294G	ENST00000255324.5	37	c.881	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	A	19.49	3.838389	0.71373	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000255325;ENST00000255326	T;T;T	0.37915	2.19;2.21;1.17	4.86	4.86	0.63082	.	0.303544	0.31404	N	0.007720	T	0.46328	0.1387	L	0.34521	1.04	0.35105	D	0.765602	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.963;0.998	T	0.54456	-0.8291	10	0.33141	T	0.24	.	12.1151	0.53860	1.0:0.0:0.0:0.0	.	294;294;294	B7Z7S1;Q9BXT8;Q9BXT8-2	.;RNF17_HUMAN;.	G	294;294;153;295;294	ENSP00000255324:E294G;ENSP00000371346:E294G;ENSP00000255325:E295G	ENSP00000255324:E294G	E	+	2	0	RNF17	24261856	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.005000	0.63972	2.054000	0.61138	0.533000	0.62120	GAG	-	NULL		0.308	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	protein_coding	OTTHUMT00000044217.1	A	NM_031994		24261856	+1	no_errors	NM_031277	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ASXL2	55252	genome.wustl.edu	37	2	25972785	25972785	+	Missense_Mutation	SNP	T	T	C	rs200858310		TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr2:25972785T>C	ENST00000435504.4	-	12	1933	c.1640A>G	c.(1639-1641)cAg>cGg	p.Q547R	ASXL2_ENST00000272341.4_Missense_Mutation_p.Q287R|ASXL2_ENST00000336112.4_Missense_Mutation_p.Q519R|ASXL2_ENST00000404843.1_Missense_Mutation_p.Q287R			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	547					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTAGTCTCCTGTGGACCCGC	0.488													T|||	1	0.000199681	0.0	0.0	5008	,	,		18383	0.0		0.001	False		,,,				2504	0.0															0			2						T	ARG/GLN	0,3718		0,0,1859	106.0	102.0	103.0		1640	0.4	0.1	2		103	22,8156		0,22,4067	yes	missense	ASXL2	NM_018263.4	43	0,22,5926	CC,CT,TT		0.269,0.0,0.1849	possibly-damaging	547/1436	25972785	22,11874	1859	4089	5948	25826289	SO:0001583	missense	55252					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.1640A>G	2.37:g.25972785T>C	ENSP00000391447:p.Gln547Arg	Somatic		Capture	Illumina GAIIx	4	25826289	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	NULL	p.Q547R	ENST00000435504.4	37	c.1640		2	.	.	.	.	.	.	.	.	.	.	T	2.626	-0.287513	0.05605	0.0	0.00269	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.18502	2.21;2.21;2.25;2.25	6.01	0.398	0.16319	.	0.750686	0.12658	N	0.449866	T	0.11153	0.0272	L	0.51422	1.61	0.09310	N	0.999996	B;P	0.38335	0.007;0.627	B;B	0.35114	0.007;0.196	T	0.20974	-1.0259	10	0.17369	T	0.5	-1.0704	2.3487	0.04278	0.2372:0.0681:0.2328:0.4619	.	287;547	Q76L83-2;Q76L83	.;ASXL2_HUMAN	R	547;519;287;287	ENSP00000391447:Q547R;ENSP00000337250:Q519R;ENSP00000383920:Q287R;ENSP00000272341:Q287R	ENSP00000272341:Q287R	Q	-	2	0	ASXL2	25826289	0.989000	0.36119	0.058000	0.19502	0.007000	0.05969	1.200000	0.32247	0.116000	0.18110	-0.297000	0.09499	CAG	-	NULL		0.488	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	protein_coding	OTTHUMT00000325593.3	T	NM_018263		25826289	-1	no_errors	NM_018263	genbank	human	validated	54_36p	missense	SNP	0.352	C
STIM2	57620	genome.wustl.edu	37	4	26862754	26862754	+	Missense_Mutation	SNP	C	C	T	rs114264770	byFrequency	TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr4:26862754C>T	ENST00000382009.3	+	1	442	c.175C>T	c.(175-177)Cac>Tac	p.H59Y	RP11-293A21.1_ENST00000467484.1_RNA|STIM2_ENST00000412829.2_Missense_Mutation_p.H59Y|STIM2_ENST00000467011.1_5'UTR|RP11-293A21.1_ENST00000472346.1_RNA|RP11-293A21.1_ENST00000489096.1_RNA|STIM2_ENST00000465503.1_5'UTR|STIM2_ENST00000237364.5_Missense_Mutation_p.H59Y|STIM2_ENST00000467087.1_5'UTR	NM_001169118.1	NP_001162589.1	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	0					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				gCTGCGCTTTCACCCGGCTTC	0.786													C|||	801	0.159944	0.0862	0.2334	5008	,	,		5803	0.1964		0.2147	False		,,,				2504	0.1135															0			4						C	,,	152,2666		0,152,1257	2.0	2.0	2.0		,,	0.5	0.0	4	dbSNP_132	2	836,5464		48,740,2362	no	utr-5,utr-5,utr-5	STIM2	NM_001169117.1,NM_001169118.1,NM_020860.3	,,	48,892,3619	TT,TC,CC		13.2698,5.3939,10.8357	,,	,,	26862754	988,8130	1409	3150	4559	26471852	SO:0001583	missense	57620			AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000382009.3:c.175C>T	4.37:g.26862754C>T	ENSP00000371439:p.His59Tyr	Somatic		Capture	Illumina GAIIx	4	26471852	A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	superfamily_SAM/Pointed domain,HMMPfam_SAM_2	p.H59Y	ENST00000382009.3	37	c.175		4	418	0.19139194139194138	55	0.11178861788617886	90	0.24861878453038674	106	0.1853146853146853	167	0.22031662269129287	C	0.174	-1.068784	0.01934	0.053939	0.132698	ENSG00000109689	ENST00000382009;ENST00000237364;ENST00000412829	T;T;T	0.78003	-1.1;-1.1;-1.14	1.45	0.528	0.17089	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.03157	-1.1066	7	0.30078	T	0.28	.	5.5234	0.16945	0.0:0.6465:0.3535:0.0	.	59;59;59	A6H8L7;E9PGD0;F5GXJ4	.;.;.	Y	59	ENSP00000371439:H59Y;ENSP00000237364:H59Y;ENSP00000404812:H59Y	ENSP00000237364:H59Y	H	+	1	0	STIM2	26471852	0.000000	0.05858	0.000000	0.03702	0.197000	0.23852	0.022000	0.13511	0.161000	0.19458	0.281000	0.19383	CAC	-	NULL		0.786	STIM2-202	KNOWN	basic|appris_principal	protein_coding	STIM2	protein_coding		C	NM_020860		26471852	+1	no_errors	NM_020860	genbank	human	reviewed	54_36p	missense	SNP	0.427	T
STIM2	57620	genome.wustl.edu	37	4	26862782	26862782	+	Missense_Mutation	SNP	C	C	G	rs75058604	byFrequency	TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr4:26862782C>G	ENST00000382009.3	+	1	470	c.203C>G	c.(202-204)cCc>cGc	p.P68R	RP11-293A21.1_ENST00000467484.1_RNA|STIM2_ENST00000412829.2_Missense_Mutation_p.P68R|STIM2_ENST00000467011.1_5'UTR|RP11-293A21.1_ENST00000472346.1_RNA|RP11-293A21.1_ENST00000489096.1_RNA|STIM2_ENST00000465503.1_5'UTR|STIM2_ENST00000237364.5_Missense_Mutation_p.P68R|STIM2_ENST00000467087.1_5'UTR	NM_001169118.1	NP_001162589.1	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	0	EF-hand.				activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				CGCCTTCATCCCGCCTCGACT	0.776													C|||	801	0.159944	0.0862	0.2334	5008	,	,		6604	0.1964		0.2147	False		,,,				2504	0.1135															0			4						C	,,	200,3052		2,196,1428	2.0	3.0	3.0		,,	1.9	0.6	4	dbSNP_131	3	1030,5920		75,880,2520	no	utr-5,utr-5,utr-5	STIM2	NM_001169117.1,NM_001169118.1,NM_020860.3	,,	77,1076,3948	GG,GC,CC		14.8201,6.1501,12.0565	,,	,,	26862782	1230,8972	1626	3475	5101	26471880	SO:0001583	missense	57620			AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000382009.3:c.203C>G	4.37:g.26862782C>G	ENSP00000371439:p.Pro68Arg	Somatic		Capture	Illumina GAIIx	4	26471880	A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Missense_Mutation	SNP	superfamily_SAM/Pointed domain,HMMPfam_SAM_2	p.P68R	ENST00000382009.3	37	c.203		4	399	0.18269230769230768	49	0.09959349593495935	80	0.22099447513812154	104	0.18181818181818182	166	0.21899736147757257	C	12.45	1.940815	0.34283	0.061501	0.148201	ENSG00000109689	ENST00000382009;ENST00000237364;ENST00000412829	T;T;D	0.82081	-1.49;-1.49;-1.57	2.89	1.88	0.25563	.	.	.	.	.	T	0.00073	0.0002	.	.	.	0.42626	P	0.006635999999999975	P;P;P	0.45768	0.789;0.789;0.866	B;B;B	0.38106	0.136;0.136;0.265	T	0.03112	-1.1071	7	0.37606	T	0.19	.	4.224	0.10572	0.0:0.7853:0.0:0.2147	.	68;68;68	A6H8L7;E9PGD0;F5GXJ4	.;.;.	R	68	ENSP00000371439:P68R;ENSP00000237364:P68R;ENSP00000404812:P68R	ENSP00000237364:P68R	P	+	2	0	STIM2	26471880	0.229000	0.23729	0.633000	0.29310	0.036000	0.12997	0.308000	0.19314	1.457000	0.47850	0.281000	0.19383	CCC	-	NULL		0.776	STIM2-202	KNOWN	basic|appris_principal	protein_coding	STIM2	protein_coding		C	NM_020860		26471880	+1	no_errors	NM_020860	genbank	human	reviewed	54_36p	missense	SNP	0.845	G
STX12	23673	genome.wustl.edu	37	1	28099860	28099860	+	Silent	SNP	C	C	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr1:28099860C>T	ENST00000373943.4	+	1	167	c.42C>T	c.(40-42)ccC>ccT	p.P14P	RP3-426I6.5_ENST00000602607.1_RNA|STX12_ENST00000468761.1_3'UTR	NM_177424.2	NP_803173.1	Q86Y82	STX12_HUMAN	syntaxin 12	14					cholesterol efflux (GO:0033344)|intracellular protein transport (GO:0006886)|protein stabilization (GO:0050821)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|central_nervous_system(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)		ACCCGGGGCCCTCGGGGCCCC	0.652																																					Ovarian(5;5 342 2097 9488 34083)											0			1											18.0	23.0	22.0					1																	28099860		2196	4291	6487	27972447	SO:0001819	synonymous_variant	23673			BC046999	CCDS310.1	1p35.3	2008-05-14			ENSG00000117758	ENSG00000117758			11430	protein-coding gene	gene with protein product		606892				9507000	Standard	NM_177424		Approved	STX13, STX14	uc001bou.4	Q86Y82	OTTHUMG00000003730	ENST00000373943.4:c.42C>T	1.37:g.28099860C>T		Somatic		Capture	Illumina GAIIx	4	27972447	B1AJQ7|O95564	Silent	SNP	HMMSmart_SM00503,superfamily_t-snare proteins,HMMPfam_Syntaxin,HMMSmart_SM00397,HMMPfam_SNARE,PatternScan_SYNTAXIN	p.P14	ENST00000373943.4	37	c.42	CCDS310.1	1																																																																																			-	HMMSmart_SM00503		0.652	STX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX12	protein_coding	OTTHUMT00000010519.1	C	NM_177424		27972447	+1	no_errors	NM_177424	genbank	human	validated	54_36p	silent	SNP	0.955	T
MDC1	9656	genome.wustl.edu	37	6	30680632	30680632	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr6:30680632C>G	ENST00000376406.3	-	5	1734	c.1087G>C	c.(1087-1089)Gca>Cca	p.A363P	MDC1_ENST00000376405.2_Missense_Mutation_p.A363P|MDC1-AS1_ENST00000442150.1_RNA|MDC1_ENST00000494654.1_5'Flank	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	363	Required for nuclear localization (NLS1).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						AGGCCTGGTGCTCCAGGACCC	0.557								Other conserved DNA damage response genes																																								0			6											93.0	105.0	101.0					6																	30680632		1510	2709	4219	30788611	SO:0001583	missense	9656			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.1087G>C	6.37:g.30680632C>G	ENSP00000365588:p.Ala363Pro	Somatic		Capture	Illumina GAIIx	4	30788611	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	superfamily_SMAD/FHA domain,HMMSmart_SM00240,HMMPfam_FHA,superfamily_BRCT domain,HMMPfam_BRCT	p.A363P	ENST00000376406.3	37	c.1087	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761560	0.49468	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.04809	3.66;3.55	3.79	1.04	0.20106	.	.	.	.	.	T	0.04952	0.0133	L	0.56769	1.78	0.09310	N	1	D;P;D;P	0.71674	0.994;0.95;0.998;0.899	P;P;P;P	0.59115	0.829;0.735;0.852;0.466	T	0.28038	-1.0056	9	0.72032	D	0.01	-0.7784	5.9717	0.19357	0.0:0.668:0.0:0.332	.	363;235;363;363	Q14676-2;B4DYH4;Q14676;Q14676-4	.;.;MDC1_HUMAN;.	P	363;363;363;235	ENSP00000365588:A363P;ENSP00000365587:A363P	ENSP00000365587:A363P	A	-	1	0	MDC1	30788611	0.000000	0.05858	0.001000	0.08648	0.849000	0.48306	-0.671000	0.05250	0.212000	0.20703	0.561000	0.74099	GCA	-	NULL		0.557	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	protein_coding	OTTHUMT00000076103.1	C	NM_014641		30788611	-1	no_errors	NM_014641	genbank	human	reviewed	54_36p	missense	SNP	0.005	G
SYNJ1	8867	genome.wustl.edu	37	21	34067449	34067449	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr21:34067449C>G	ENST00000322229.7	-	4	622	c.623G>C	c.(622-624)aGc>aCc	p.S208T	SYNJ1_ENST00000357345.3_Missense_Mutation_p.S208T|SYNJ1_ENST00000382491.3_Missense_Mutation_p.S208T|SYNJ1_ENST00000382499.2_Missense_Mutation_p.S247T|SYNJ1_ENST00000433931.2_Missense_Mutation_p.S247T			O43426	SYNJ1_HUMAN	synaptojanin 1	208	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						TCGTTCACAGCTTAATCTTGA	0.398																																																0			21											152.0	133.0	140.0					21																	34067449		2203	4300	6503	32989320	SO:0001583	missense	8867			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.623G>C	21.37:g.34067449C>G	ENSP00000322234:p.Ser208Thr	Somatic		Capture	Illumina GAIIx	4	32989320	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	HMMPfam_Syja_N,superfamily_DNase I-like,HMMSmart_SM00128,HMMPfam_Exo_endo_phos,HMMPfam_DUF1866,superfamily_RNA-binding domain RBD	p.S208T	ENST00000322229.7	37	c.623	CCDS54484.1	21	.	.	.	.	.	.	.	.	.	.	C	29.0	4.971295	0.92919	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236	T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46;-0.46	4.96	4.96	0.65561	Synaptojanin, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.89090	0.6616	H	0.98178	4.165	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.998	D;D;D;D;D	0.87578	0.997;0.998;0.991;0.998;0.941	D	0.93256	0.6639	10	0.87932	D	0	.	18.6311	0.91360	0.0:1.0:0.0:0.0	.	208;247;208;208;208	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	T	208;208;247;247;208;208	ENSP00000371931:S208T;ENSP00000349903:S208T;ENSP00000371939:S247T;ENSP00000409667:S247T;ENSP00000322234:S208T;ENSP00000413649:S208T	ENSP00000322234:S208T	S	-	2	0	SYNJ1	32989320	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.214000	0.77958	2.486000	0.83907	0.558000	0.71614	AGC	-	HMMPfam_Syja_N		0.398	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	protein_coding		C			32989320	-1	no_errors	NM_003895	genbank	human	validated	54_36p	missense	SNP	1.000	G
MEAF6	64769	genome.wustl.edu	37	1	37975112	37975112	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr1:37975112G>A	ENST00000296214.5	-	3	265	c.238C>T	c.(238-240)Cgg>Tgg	p.R80W	MEAF6_ENST00000475828.1_5'UTR|MEAF6_ENST00000373074.1_Missense_Mutation_p.R58W|MEAF6_ENST00000448519.2_Missense_Mutation_p.R80W|MEAF6_ENST00000373073.4_Missense_Mutation_p.R80W|MEAF6_ENST00000373075.2_Missense_Mutation_p.R80W	NM_001270875.1	NP_001257804.1	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6	80					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						TTAAACTTCCGGTTCCTTCGA	0.473																																																0			1											192.0	190.0	191.0					1																	37975112		2203	4300	6503	37747699	SO:0001583	missense	64769			BC016328	CCDS418.1, CCDS59195.1, CCDS59196.1	1p35.3-p33	2011-08-12	2009-07-13	2009-07-13	ENSG00000163875	ENSG00000163875			25674	protein-coding gene	gene with protein product	"""Esa1p-associated factor 6 homolog (S. cerevisiae)"", ""centromere protein 28"""	611001	"""chromosome 1 open reading frame 149"""	C1orf149		8619474, 9110174, 12963728, 14966270, 16387653	Standard	NM_022756		Approved	NY-SAR-91, FLJ11730, Eaf6, CENP-28	uc001cbe.2	Q9HAF1	OTTHUMG00000004223	ENST00000296214.5:c.238C>T	1.37:g.37975112G>A	ENSP00000296214:p.Arg80Trp	Somatic		Capture	Illumina GAIIx	4	37747699	B1AK64|Q4F967|Q7Z311|Q86WE3	Missense_Mutation	SNP	HMMPfam_NuA4	p.R80W	ENST00000296214.5	37	c.238	CCDS59196.1	1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.517279	0.64634	.	.	ENSG00000163875	ENST00000373075;ENST00000296214;ENST00000373074;ENST00000373073;ENST00000448519	.	.	.	4.66	3.67	0.42095	.	0.126252	0.52532	D	0.000062	T	0.77471	0.4135	M	0.87900	2.915	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;P	0.75484	0.976;0.986;0.976;0.875	T	0.79167	-0.1915	9	0.72032	D	0.01	-2.725	6.6869	0.23150	0.0872:0.0:0.6103:0.3024	.	80;80;80;58	Q9HAF1-2;Q9HAF1;Q9HAF1-3;B1AK63	.;EAF6_HUMAN;.;.	W	80;80;58;80;80	.	ENSP00000296214:R80W	R	-	1	2	MEAF6	37747699	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.072000	0.50049	2.304000	0.77564	0.484000	0.47621	CGG	-	HMMPfam_NuA4		0.473	MEAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf149	protein_coding	OTTHUMT00000012161.1	G	NM_022756		37747699	-1	no_errors	NM_022756	genbank	human	predicted	54_36p	missense	SNP	0.998	A
RPGR	6103	genome.wustl.edu	37	X	38182167	38182167	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chrX:38182167G>C	ENST00000339363.3	-	3	353	c.186C>G	c.(184-186)aaC>aaG	p.N62K	TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Missense_Mutation_p.N62K|RPGR_ENST00000338898.3_Missense_Mutation_p.N62K|RPGR_ENST00000378505.2_Missense_Mutation_p.N62K|RPGR_ENST00000342811.3_Missense_Mutation_p.N62K|RPGR_ENST00000318842.7_Missense_Mutation_p.N62K			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	62					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						GACCCCAGTTGTTACTGCCAA	0.358																																																0			X											142.0	124.0	130.0					X																	38182167		2202	4300	6502	38067111	SO:0001583	missense	6103			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.186C>G	X.37:g.38182167G>C	ENSP00000343671:p.Asn62Lys	Somatic		Capture	Illumina GAIIx	4	38067111	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	superfamily_RCC1/BLIP-II,PatternScan_RCC1_2,HMMPfam_RCC1	p.N62K	ENST00000339363.3	37	c.186		X	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040461	0.75732	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000338898;ENST00000318842;ENST00000342811;ENST00000378505	D;D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42;-2.42	5.86	5.86	0.93980	.	0.000000	0.85682	U	0.000000	D	0.96756	0.8941	H	0.96970	3.915	0.50313	D	0.999869	D;D	0.89917	1.0;0.979	D;D	0.97110	1.0;0.967	D	0.97760	1.0220	10	0.72032	D	0.01	.	19.1659	0.93557	0.0:0.0:1.0:0.0	.	62;62	E9PE28;Q92834-2	.;.	K	62	ENSP00000343671:N62K;ENSP00000308783:N62K;ENSP00000340208:N62K;ENSP00000322219:N62K;ENSP00000339531:N62K;ENSP00000367766:N62K	ENSP00000308783:N62K	N	-	3	2	RPGR	38067111	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.932000	0.48940	2.477000	0.83638	0.594000	0.82650	AAC	-	superfamily_RCC1/BLIP-II,HMMPfam_RCC1		0.358	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	protein_coding		G	NM_000328		38067111	-1	no_errors	NM_001034853	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DDHD2	23259	genome.wustl.edu	37	8	38095663	38095663	+	Silent	SNP	G	G	T	rs149994413	byFrequency	TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr8:38095663G>T	ENST00000397166.2	+	5	1083	c.558G>T	c.(556-558)acG>acT	p.T186T	DDHD2_ENST00000520272.2_Silent_p.T186T	NM_015214.2	NP_056029.2	O94830	DDHD2_HUMAN	DDHD domain containing 2	186			T -> M (in dbSNP:rs2306899). {ECO:0000269|PubMed:9872452}.		cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)|urinary_tract(2)	28	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			CAACACCCACGGAGCAGGGTC	0.408																																																0			8											213.0	193.0	200.0					8																	38095663		2203	4300	6503	38214820	SO:0001819	synonymous_variant	23259			AK056525	CCDS34883.1	8p11.23	2014-03-03	2004-04-05	2004-04-07				"""Sterile alpha motif (SAM) domain containing"""	29106	protein-coding gene	gene with protein product		615003	"""SAM, WWE and DDHD domain containing 1"""	SAMWD1		9872452, 11788596, 19632984, 20932832	Standard	NM_015214		Approved	KIAA0725, SPG54	uc003xlc.3	O94830		ENST00000397166.2:c.558G>T	8.37:g.38095663G>T		Somatic		Capture	Illumina GAIIx	4	38214820	B3KWV2|B3KXB5|Q9H8X7	Silent	SNP	HMMPfam_WWE,HMMSmart_SM00454,HMMPfam_SAM_1,superfamily_SAM/Pointed domain,HMMPfam_DDHD	p.T186	ENST00000397166.2	37	c.558	CCDS34883.1	8																																																																																			-	NULL		0.408	DDHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDHD2	protein_coding	OTTHUMT00000377251.2	G	XM_291291		38214820	+1	no_errors	NM_015214	genbank	human	provisional	54_36p	silent	SNP	0.768	T
TLR6	10333	genome.wustl.edu	37	4	38828762	38828762	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr4:38828762C>G	ENST00000381950.1	-	1	2398	c.2333G>C	c.(2332-2334)aGa>aCa	p.R778T	TLR6_ENST00000436693.2_Missense_Mutation_p.R778T			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	778	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAAAGCGGCTCTAATGTTAGC	0.383																																																0			4											61.0	63.0	62.0					4																	38828762		2203	4300	6503	38505157	SO:0001583	missense	10333				CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.2333G>C	4.37:g.38828762C>G	ENSP00000371376:p.Arg778Thr	Somatic		Capture	Illumina GAIIx	4	38505157	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRRCT,HMMPfam_LRRCT,superfamily_TIR,HMMSmart_TIR,HMMPfam_TIR	p.R778T	ENST00000381950.1	37	c.2333	CCDS3446.1	4	.	.	.	.	.	.	.	.	.	.	C	15.53	2.860269	0.51482	.	.	ENSG00000174130	ENST00000436693;ENST00000381950;ENST00000508542	D;D	0.87256	-2.23;-2.23	4.94	3.17	0.36434	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.138332	0.49916	N	0.000131	D	0.93887	0.8044	M	0.92738	3.34	0.54753	D	0.999987	D	0.76494	0.999	D	0.78314	0.991	D	0.93270	0.6651	10	0.87932	D	0	.	9.5575	0.39348	0.0:0.7776:0.1439:0.0785	.	778	Q9Y2C9	TLR6_HUMAN	T	778;778;462	ENSP00000389600:R778T;ENSP00000371376:R778T	ENSP00000371376:R778T	R	-	2	0	TLR6	38505157	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	2.078000	0.41567	0.638000	0.30545	0.561000	0.74099	AGA	-	superfamily_TIR,HMMSmart_TIR,HMMPfam_TIR		0.383	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR6	protein_coding	OTTHUMT00000250431.1	C			38505157	-1	no_errors	NM_006068	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
INHBA	3624	genome.wustl.edu	37	7	41729641	41729641	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr7:41729641C>A	ENST00000242208.4	-	3	1134	c.888G>T	c.(886-888)caG>caT	p.Q296H	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Missense_Mutation_p.Q296H	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	296					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						ACTGCCGGGCCTGCAGCATGA	0.567										TSP Lung(11;0.080)																																						0			7											90.0	91.0	91.0					7																	41729641		2203	4300	6503	41696166	SO:0001583	missense	3624				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.888G>T	7.37:g.41729641C>A	ENSP00000242208:p.Gln296His	Somatic		Capture	Illumina GAIIx	4	41696166	Q14599	Missense_Mutation	SNP	HMMPfam_TGFb_propeptide,superfamily_Cystine-knot cytokines,HMMPfam_TGF_beta,HMMSmart_SM00204,PatternScan_TGF_BETA_1	p.Q296H	ENST00000242208.4	37	c.888	CCDS5464.1	7	.	.	.	.	.	.	.	.	.	.	.	9.223	1.033828	0.19590	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.78816	-1.21;-1.21	5.82	4.0	0.46444	.	0.267746	0.36628	N	0.002486	T	0.71022	0.3291	N	0.25332	0.735	0.33589	D	0.600865	P	0.48911	0.917	P	0.56343	0.796	T	0.71500	-0.4574	10	0.15499	T	0.54	-26.1711	5.12	0.14856	0.2511:0.5333:0.0:0.2156	.	296	P08476	INHBA_HUMAN	H	296	ENSP00000242208:Q296H;ENSP00000397197:Q296H	ENSP00000242208:Q296H	Q	-	3	2	INHBA	41696166	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.606000	0.36826	1.467000	0.48044	0.484000	0.47621	CAG	-	NULL		0.567	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBA	protein_coding	OTTHUMT00000250793.1	C			41696166	-1	no_errors	NM_002192	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ABCC10	89845	genome.wustl.edu	37	6	43400295	43400295	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr6:43400295G>C	ENST00000372530.4	+	3	792	c.577G>C	c.(577-579)Ggg>Cgg	p.G193R	ABCC10_ENST00000244533.3_Missense_Mutation_p.G150R|ABCC10_ENST00000443426.2_Intron	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	193					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GGCAGCTCCTGGGGGACCACG	0.622																																																0			6											67.0	69.0	69.0					6																	43400295		2202	4300	6502	43508273	SO:0001583	missense	89845			U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.577G>C	6.37:g.43400295G>C	ENSP00000361608:p.Gly193Arg	Somatic		Capture	Illumina GAIIx	4	43508273	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Missense_Mutation	SNP	superfamily_ABC_TM_1,HMMPfam_ABC_membrane,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.G150R	ENST00000372530.4	37	c.448	CCDS56430.1	6	.	.	.	.	.	.	.	.	.	.	G	3.454	-0.111457	0.06881	.	.	ENSG00000124574	ENST00000372530;ENST00000244533	T;T	0.39592	1.07;1.07	5.76	1.97	0.26223	.	0.419207	0.28262	N	0.015991	T	0.08403	0.0209	L	0.27053	0.805	0.09310	N	1	B;B	0.25390	0.047;0.125	B;B	0.24848	0.039;0.056	T	0.33752	-0.9856	10	0.15066	T	0.55	-18.2958	4.287	0.10860	0.2254:0.0:0.5054:0.2692	.	150;193	Q5T3U5-2;Q5T3U5	.;MRP7_HUMAN	R	193;150	ENSP00000361608:G193R;ENSP00000244533:G150R	ENSP00000244533:G150R	G	+	1	0	ABCC10	43508273	0.996000	0.38824	0.100000	0.21137	0.114000	0.19823	-0.232000	0.09055	0.361000	0.24292	-0.314000	0.08810	GGG	-	NULL		0.622	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC10	protein_coding	OTTHUMT00000040603.2	G	NM_033450		43508273	+1	no_errors	NM_033450	genbank	human	reviewed	54_36p	missense	SNP	0.109	C
LARS2	23395	genome.wustl.edu	37	3	45559524	45559524	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr3:45559524C>T	ENST00000415258.1	+	17	2315	c.2174C>T	c.(2173-2175)gCc>gTc	p.A725V	LARS2_ENST00000265537.3_Missense_Mutation_p.A725V|LARS2_ENST00000414984.1_Missense_Mutation_p.A682V|LARS2_ENST00000467936.1_3'UTR			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	725					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	AAAGCTGAGGCCAGGAAGCTC	0.512																																																0			3											55.0	51.0	53.0					3																	45559524		2203	4300	6503	45534528	SO:0001583	missense	23395			AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.2174C>T	3.37:g.45559524C>T	ENSP00000408576:p.Ala725Val	Somatic		Capture	Illumina GAIIx	4	45534528		Missense_Mutation	SNP	superfamily_SSF52374,HMMPfam_tRNA-synt_1g,PatternScan_AA_TRNA_LIGASE_I,superfamily_ValRS_IleRS_edit,HMMPfam_tRNA-synt_1,superfamily_tRNAsyn_1a_bind,HMMPfam_Anticodon_1	p.A725V	ENST00000415258.1	37	c.2174	CCDS2728.1	3	.	.	.	.	.	.	.	.	.	.	C	16.66	3.183941	0.57800	.	.	ENSG00000011376	ENST00000265537;ENST00000415258;ENST00000414984	T;T;T	0.30714	1.52;1.52;1.52	5.66	2.89	0.33648	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.170070	0.51477	D	0.000098	T	0.37404	0.1002	M	0.65975	2.015	0.58432	D	0.999995	P;P	0.38745	0.645;0.645	P;P	0.44477	0.451;0.451	T	0.23904	-1.0175	10	0.59425	D	0.04	-12.2462	10.7379	0.46137	0.0:0.6696:0.2628:0.0676	.	682;725	E9PHM2;Q15031	.;SYLM_HUMAN	V	725;725;682	ENSP00000265537:A725V;ENSP00000408576:A725V;ENSP00000412893:A682V	ENSP00000265537:A725V	A	+	2	0	LARS2	45534528	1.000000	0.71417	0.333000	0.25482	0.944000	0.59088	2.935000	0.48963	0.732000	0.32470	0.655000	0.94253	GCC	-	superfamily_tRNAsyn_1a_bind,HMMPfam_Anticodon_1		0.512	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LARS2	protein_coding	OTTHUMT00000345001.1	C	NM_015340		45534528	+1	no_errors	NM_015340	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CBLN1	869	genome.wustl.edu	37	16	49315292	49315292	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr16:49315292C>A	ENST00000219197.6	-	1	450	c.85G>T	c.(85-87)Gtg>Ttg	p.V29L	CBLN1_ENST00000536749.1_Missense_Mutation_p.V29L	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	29					cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)				breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				CCCTCCAGCACGATGGGCTCC	0.731																																																0			16											26.0	27.0	26.0					16																	49315292		2199	4299	6498	47872793	SO:0001583	missense	869			M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.85G>T	16.37:g.49315292C>A	ENSP00000219197:p.Val29Leu	Somatic		Capture	Illumina GAIIx	4	47872793	B2RAN9|P02682|Q52M09	Missense_Mutation	SNP	HMMSmart_SM00110,superfamily_TNF-like,HMMPfam_C1q	p.V29L	ENST00000219197.6	37	c.85	CCDS10736.1	16	.	.	.	.	.	.	.	.	.	.	C	11.58	1.681331	0.29872	.	.	ENSG00000102924	ENST00000219197;ENST00000536749	D;D	0.82081	-1.57;-1.57	3.88	3.88	0.44766	.	0.144445	0.45361	D	0.000370	T	0.68805	0.3041	L	0.35542	1.07	0.41283	D	0.98692	B	0.12013	0.005	B	0.12156	0.007	T	0.59327	-0.7475	10	0.10377	T	0.69	-14.8922	6.6575	0.22996	0.0:0.715:0.1843:0.1007	.	29	P23435	CBLN1_HUMAN	L	29	ENSP00000219197:V29L;ENSP00000444651:V29L	ENSP00000219197:V29L	V	-	1	0	CBLN1	47872793	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	1.136000	0.31467	1.994000	0.58287	0.462000	0.41574	GTG	-	NULL		0.731	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN1	protein_coding	OTTHUMT00000256845.4	C	NM_004352		47872793	-1	no_errors	NM_004352	genbank	human	validated	54_36p	missense	SNP	1.000	A
PPP1R21	129285	genome.wustl.edu	37	2	48701861	48701861	+	Silent	SNP	G	G	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr2:48701861G>C	ENST00000294952.8	+	12	1285	c.1128G>C	c.(1126-1128)gcG>gcC	p.A376A	PPP1R21_ENST00000449090.2_Silent_p.A376A|PPP1R21_ENST00000281394.4_Silent_p.A376A	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	376						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						GCACATCTGCGTTAAGAGCCA	0.413																																																0			2											145.0	131.0	136.0					2																	48701861		2203	4300	6503	48555365	SO:0001819	synonymous_variant	129285			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.1128G>C	2.37:g.48701861G>C		Somatic		Capture	Illumina GAIIx	4	48555365	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Silent	SNP	HMMPfam_KLRAQ,HMMPfam_TTKRSYEDQ	p.A376	ENST00000294952.8	37	c.1128	CCDS46278.1	2																																																																																			-	HMMPfam_TTKRSYEDQ		0.413	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRAQ1	protein_coding	OTTHUMT00000251238.4	G	NM_152994		48555365	+1	no_errors	NM_152994	genbank	human	validated	54_36p	silent	SNP	0.008	C
FRMPD2	143162	genome.wustl.edu	37	10	49459740	49459740	+	Intron	SNP	A	A	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr10:49459740A>G	ENST00000374201.3	-	2	328				FRMPD2_ENST00000305531.3_Missense_Mutation_p.I5T|FRMPD2_ENST00000407470.4_Intron	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2						tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CATGCCTACAATAAAGACATG	0.597																																																0			10											71.0	61.0	64.0					10																	49459740		2203	4300	6503	49129746	SO:0001627	intron_variant	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.26-6T>C	10.37:g.49459740A>G		Somatic		Capture	Illumina GAIIx	4	49129746	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	HMMSmart_KIND,superfamily_SSF54236,HMMSmart_B41,HMMPfam_FERM_N,superfamily_FERM_3-hlx,HMMPfam_FERM_M,superfamily_SSF50729,HMMPfam_FERM_C,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ	p.I5T	ENST00000374201.3	37	c.14	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	A	0.062	-1.221152	0.01530	.	.	ENSG00000170324	ENST00000305531	T	0.65364	-0.15	0.565	0.565	0.17309	.	.	.	.	.	T	0.49864	0.1582	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.40776	-0.9545	4	.	.	.	.	.	.	.	.	.	.	.	T	5	ENSP00000307079:I5T	.	I	-	2	0	FRMPD2	49129746	0.001000	0.12720	0.075000	0.20258	0.029000	0.11900	0.507000	0.22675	0.470000	0.27294	0.460000	0.39030	ATT	-	NULL		0.597	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	protein_coding	OTTHUMT00000047923.3	A	NM_152428		49129746	-1	no_errors	ENST00000305531	ensembl	human	known	54_36p	missense	SNP	0.270	G
CPT1B	1375	genome.wustl.edu	37	22	51008064	51008064	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr22:51008064T>C	ENST00000360719.2	-	18	2313	c.2176A>G	c.(2176-2178)Att>Gtt	p.I726V	CPT1B_ENST00000457250.1_Missense_Mutation_p.I692V|CPT1B_ENST00000395650.2_Missense_Mutation_p.I726V|CHKB-CPT1B_ENST00000453634.1_3'UTR|CPT1B_ENST00000405237.3_Missense_Mutation_p.I726V|CPT1B_ENST00000440709.1_Missense_Mutation_p.I645V|CPT1B_ENST00000434492.2_Missense_Mutation_p.I521V|CPT1B_ENST00000312108.7_Missense_Mutation_p.I726V	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	726					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		TCGCCTGCAATCATGTAGGAA	0.502																																					Esophageal Squamous(170;988 1933 25577 30295 48163)											0			22											142.0	122.0	129.0					22																	51008064		2203	4300	6503	49354930	SO:0001583	missense	1375			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.2176A>G	22.37:g.51008064T>C	ENSP00000353945:p.Ile726Val	Somatic		Capture	Illumina GAIIx	4	49354930	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	superfamily_CoA-dependent acyltransferases,HMMPfam_Carn_acyltransf,PatternScan_ACYLTRANSF_C_1,PatternScan_ACYLTRANSF_C_2	p.I726V	ENST00000360719.2	37	c.2176	CCDS14098.1	22	.	.	.	.	.	.	.	.	.	.	T	11.25	1.584634	0.28268	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000457250;ENST00000440709;ENST00000434492;ENST00000395650	D;D;D;D;D;D;D	0.90069	-2.61;-2.61;-2.61;-2.61;-2.61;-2.61;-2.61	5.09	5.09	0.68999	.	0.108144	0.64402	D	0.000008	D	0.86351	0.5912	L	0.42744	1.35	0.53688	D	0.999978	P;B;B;B	0.46952	0.887;0.096;0.299;0.198	P;B;B;B	0.48738	0.588;0.163;0.158;0.192	D	0.83956	0.0319	10	0.30854	T	0.27	-19.1413	8.3561	0.32331	0.1753:0.0:0.0:0.8247	.	645;692;521;726	E9PCP2;B7Z4U4;A2RRE8;Q92523	.;.;.;CPT1B_HUMAN	V	726;726;726;692;645;521;726	ENSP00000385486:I726V;ENSP00000312189:I726V;ENSP00000353945:I726V;ENSP00000409342:I692V;ENSP00000414713:I645V;ENSP00000410966:I521V;ENSP00000379011:I726V	ENSP00000312189:I726V	I	-	1	0	CPT1B	49354930	1.000000	0.71417	0.988000	0.46212	0.560000	0.35617	4.441000	0.59981	1.916000	0.55485	0.459000	0.35465	ATT	-	HMMPfam_Carn_acyltransf,superfamily_CoA-dependent acyltransferases		0.502	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	protein_coding	OTTHUMT00000317264.5	T	NM_152246		49354930	-1	no_errors	NM_004377	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
MAGED1	9500	genome.wustl.edu	37	X	51644798	51644798	+	Silent	SNP	G	G	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chrX:51644798G>A	ENST00000375722.1	+	12	2361	c.2109G>A	c.(2107-2109)ggG>ggA	p.G703G	MAGED1_ENST00000326587.7_Silent_p.G703G|MAGED1_ENST00000375772.3_Silent_p.G703G|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375695.2_Silent_p.G759G			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	703					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CTGTGTCTGGGCCCTGGAGCT	0.562										Multiple Myeloma(10;0.10)																																						0			X											92.0	85.0	88.0					X																	51644798		2203	4300	6503	51661538	SO:0001819	synonymous_variant	9500			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.2109G>A	X.37:g.51644798G>A		Somatic		Capture	Illumina GAIIx	4	51661538	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Silent	SNP	HMMPfam_MAGE	p.G759	ENST00000375722.1	37	c.2277	CCDS14337.1	X																																																																																			-	NULL		0.562	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	protein_coding	OTTHUMT00000056593.1	G	NM_001005332		51661538	+1	no_errors	NM_001005333	genbank	human	reviewed	54_36p	silent	SNP	0.999	A
HOXC13	3229	genome.wustl.edu	37	12	54338822	54338822	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr12:54338822C>A	ENST00000243056.3	+	2	931	c.775C>A	c.(775-777)Cgc>Agc	p.R259S		NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	259					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						CAGCTACCGGCGCGGGCGCAA	0.607			T	NUP98	AML																																		Dom	yes		12	12q13.3	3229	homeo box C13		L	0			12											75.0	83.0	80.0					12																	54338822		2203	4300	6503	52625089	SO:0001583	missense	3229				CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.775C>A	12.37:g.54338822C>A	ENSP00000243056:p.Arg259Ser	Somatic		Capture	Illumina GAIIx	4	52625089	Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.R259S	ENST00000243056.3	37	c.775	CCDS8865.1	12	.	.	.	.	.	.	.	.	.	.	C	22.3	4.271963	0.80469	.	.	ENSG00000123364	ENST00000243056	D	0.95690	-3.78	4.95	4.0	0.46444	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97396	0.9148	M	0.86502	2.82	0.58432	D	0.999996	D	0.65815	0.995	D	0.71656	0.974	D	0.96969	0.9707	10	0.87932	D	0	.	10.619	0.45467	0.3189:0.6811:0.0:0.0	.	259	P31276	HXC13_HUMAN	S	259	ENSP00000243056:R259S	ENSP00000243056:R259S	R	+	1	0	HOXC13	52625089	0.974000	0.33945	0.998000	0.56505	0.930000	0.56654	2.322000	0.43814	2.755000	0.94549	0.655000	0.94253	CGC	-	superfamily_Homeodomain_like		0.607	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC13	protein_coding	OTTHUMT00000358865.2	C			52625089	+1	no_errors	NM_017410	genbank	human	reviewed	54_36p	missense	SNP	0.995	A
SMUG1	23583	genome.wustl.edu	37	12	54576197	54576197	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr12:54576197G>A	ENST00000508394.2	-	3	558	c.496C>T	c.(496-498)Cct>Tct	p.P166S	SMUG1_ENST00000505128.1_3'UTR|SMUG1_ENST00000401977.2_Missense_Mutation_p.P166S|SMUG1_ENST00000243112.5_Intron|SMUG1_ENST00000506595.1_Intron|SMUG1_ENST00000514196.1_Intron|SMUG1_ENST00000513838.1_Intron|SMUG1_ENST00000514685.1_Intron|SMUG1_ENST00000505662.1_5'UTR|SMUG1_ENST00000337581.3_Missense_Mutation_p.P166S	NM_001243787.1|NM_001243788.1|NM_014311.2	NP_001230716.1|NP_001230717.1|NP_055126.1	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional uracil-DNA glycosylase 1	166				Missing (in Ref. 3; BAC03670). {ECO:0000305}.	base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA N-glycosylase activity (GO:0019104)|oxidized pyrimidine nucleobase lesion DNA N-glycosylase activity (GO:0000703)|single-strand selective uracil DNA N-glycosylase activity (GO:0017065)|uracil DNA N-glycosylase activity (GO:0004844)			kidney(1)|large_intestine(4)|lung(1)	6						AAAAGCAGAGGGCATAGATTG	0.557								Base excision repair (BER), DNA glycosylases																																								0			12											84.0	85.0	84.0					12																	54576197		2203	4300	6503	52862464	SO:0001583	missense	23583			AF125182	CCDS8874.1, CCDS58239.1	12q13.13	2013-10-28			ENSG00000123415	ENSG00000123415			17148	protein-coding gene	gene with protein product		607753				10074426, 11526119	Standard	NM_014311		Approved	UNG3, FDG, HMUDG	uc009znf.2	Q53HV7	OTTHUMG00000160068	ENST00000508394.2:c.496C>T	12.37:g.54576197G>A	ENSP00000424191:p.Pro166Ser	Somatic		Capture	Illumina GAIIx	4	52862464	A8K2K9|O95862|Q0D2M0|Q8NB71|Q9BWC8	Missense_Mutation	SNP	superfamily_DNA glycosylase,HMMPfam_UDG	p.P166S	ENST00000508394.2	37	c.496	CCDS8874.1	12	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366666	0.82463	.	.	ENSG00000123415	ENST00000337581;ENST00000508394;ENST00000401977;ENST00000504338	T;T;T;T	0.62639	0.01;0.01;0.01;0.01	4.86	4.86	0.63082	Uracil-DNA glycosylase-like (3);	0.051284	0.85682	D	0.000000	D	0.82953	0.5149	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86832	0.2011	10	0.72032	D	0.01	.	17.1702	0.86827	0.0:0.0:1.0:0.0	.	166	Q53HV7	SMUG1_HUMAN	S	166	ENSP00000338606:P166S;ENSP00000424191:P166S;ENSP00000384828:P166S;ENSP00000423083:P166S	ENSP00000338606:P166S	P	-	1	0	SMUG1	52862464	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.574000	0.90763	2.415000	0.81967	0.563000	0.77884	CCT	-	superfamily_DNA glycosylase,HMMPfam_UDG		0.557	SMUG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMUG1	protein_coding	OTTHUMT00000359074.3	G	NM_014311		52862464	-1	no_errors	NM_014311	genbank	human	provisional	54_36p	missense	SNP	1.000	A
FAM120C	54954	genome.wustl.edu	37	X	54161410	54161410	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chrX:54161410G>T	ENST00000375180.2	-	7	1526	c.1470C>A	c.(1468-1470)agC>agA	p.S490R	FAM120C_ENST00000328235.4_Missense_Mutation_p.S490R	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	490							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						TGGCAAAGGGGCTGTTCTGCA	0.527																																																0			X											79.0	69.0	73.0					X																	54161410		2203	4300	6503	54178135	SO:0001583	missense	54954			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.1470C>A	X.37:g.54161410G>T	ENSP00000364324:p.Ser490Arg	Somatic		Capture	Illumina GAIIx	4	54178135	B2RMT7	Missense_Mutation	SNP	NULL	p.S490R	ENST00000375180.2	37	c.1470	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	G	7.523	0.657004	0.14580	.	.	ENSG00000184083	ENST00000375180;ENST00000328235	T;T	0.47869	0.83;0.83	5.78	3.08	0.35506	.	0.370184	0.36200	N	0.002731	T	0.18964	0.0455	N	0.08118	0	0.21473	N	0.999671	P;P	0.36909	0.573;0.573	B;B	0.26202	0.067;0.067	T	0.12372	-1.0550	10	0.21540	T	0.41	-0.5703	5.9806	0.19405	0.2253:0.1371:0.6377:0.0	.	490;490	F8W881;Q9NX05	.;F120C_HUMAN	R	490	ENSP00000364324:S490R;ENSP00000329896:S490R	ENSP00000329896:S490R	S	-	3	2	FAM120C	54178135	0.980000	0.34600	0.772000	0.31596	0.313000	0.28021	1.185000	0.32065	0.228000	0.21019	0.600000	0.82982	AGC	-	NULL		0.527	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	protein_coding	OTTHUMT00000056795.2	G	NM_017848		54178135	-1	no_errors	NM_017848	genbank	human	validated	54_36p	missense	SNP	0.874	T
GCH1	2643	genome.wustl.edu	37	14	55326408	55326408	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr14:55326408T>A	ENST00000491895.2	-	3	688	c.500A>T	c.(499-501)aAa>aTa	p.K167I	GCH1_ENST00000543643.2_Missense_Mutation_p.K167I|GCH1_ENST00000536224.2_Missense_Mutation_p.K167I|GCH1_ENST00000395514.1_Missense_Mutation_p.K167I|GCH1_ENST00000254299.4_5'UTR|RNU6ATAC9P_ENST00000516210.1_RNA	NM_000161.2	NP_000152.1	P30793	GCH1_HUMAN	GTP cyclohydrolase 1	167					7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|dopamine biosynthetic process (GO:0042416)|GTP catabolic process (GO:0006184)|metabolic process (GO:0008152)|negative regulation of blood pressure (GO:0045776)|neuromuscular process controlling posture (GO:0050884)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric-oxide synthase activity (GO:0051000)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|pteridine-containing compound biosynthetic process (GO:0042559)|regulation of blood pressure (GO:0008217)|regulation of lung blood pressure (GO:0014916)|regulation of nitric-oxide synthase activity (GO:0050999)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to pain (GO:0048265)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|tetrahydrofolate biosynthetic process (GO:0046654)|vasodilation (GO:0042311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|coenzyme binding (GO:0050662)|GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(2)|lung(7)|skin(2)	11						CCTCGCAAGTTTGCTGAGGCC	0.433																																					Pancreas(198;1245 2204 4807 21567 38372)											0			14											125.0	109.0	115.0					14																	55326408		2203	4300	6503	54396158	SO:0001583	missense	2643			U19523	CCDS9720.1, CCDS41954.1, CCDS45110.1	14q22.1-q22.2	2014-04-01	2008-08-01		ENSG00000131979	ENSG00000131979	3.5.4.16		4193	protein-coding gene	gene with protein product	"""dopa-responsive dystonia"""	600225	"""dystonia 14"""	GCH, DYT5, DYT14		7874165, 8695054	Standard	XM_005267530		Approved	GTPCH1, DYT5a	uc001xbi.1	P30793	OTTHUMG00000029754	ENST00000491895.2:c.500A>T	14.37:g.55326408T>A	ENSP00000419045:p.Lys167Ile	Somatic		Capture	Illumina GAIIx	4	54396158	Q6FHY7|Q9Y4I8	Missense_Mutation	SNP	superfamily_Tetrahydrobiopterin biosynthesis enzymes-like,PatternScan_GTP_CYCLOHYDROL_1_1,HMMPfam_GTP_cyclohydroI,PatternScan_GTP_CYCLOHYDROL_1_2	p.K167I	ENST00000491895.2	37	c.500	CCDS9720.1	14	.	.	.	.	.	.	.	.	.	.	T	27.9	4.870229	0.91587	.	.	ENSG00000131979	ENST00000395514;ENST00000543643;ENST00000491895;ENST00000536224;ENST00000395524	D;D;D;D	0.99842	-7.1;-7.1;-7.1;-7.1	5.1	5.1	0.69264	GTP cyclohydrolase I/Nitrile oxidoreductase (1);	0.098474	0.64402	D	0.000002	D	0.99906	0.9955	H	0.99156	4.45	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.997;0.999;0.999	D	0.96101	0.9069	10	0.87932	D	0	-10.3992	14.2002	0.65699	0.0:0.0:0.0:1.0	.	167;167;167;167	F8W9F6;P30793-2;P30793-4;P30793	.;.;.;GCH1_HUMAN	I	167	ENSP00000378890:K167I;ENSP00000444011:K167I;ENSP00000419045:K167I;ENSP00000445246:K167I	ENSP00000378890:K167I	K	-	2	0	GCH1	54396158	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.478000	0.81082	2.127000	0.65507	0.459000	0.35465	AAA	-	superfamily_Tetrahydrobiopterin biosynthesis enzymes-like,HMMPfam_GTP_cyclohydroI		0.433	GCH1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	GCH1	protein_coding	OTTHUMT00000276895.3	T			54396158	-1	no_errors	NM_000161	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PCK1	5105	genome.wustl.edu	37	20	56136665	56136665	+	Silent	SNP	C	C	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr20:56136665C>T	ENST00000319441.4	+	2	362	c.198C>T	c.(196-198)ctC>ctT	p.L66L	PCK1_ENST00000543666.1_5'UTR|PCK1_ENST00000535860.1_5'UTR	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	66					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			AGGGCATCCTCAGGCGGCTGA	0.612																																																0			20											72.0	71.0	71.0					20																	56136665		2203	4300	6503	55570071	SO:0001819	synonymous_variant	5105				CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.198C>T	20.37:g.56136665C>T		Somatic		Capture	Illumina GAIIx	4	55570071	A8K437|B4DT64|Q8TCA3|Q9UJD2	Silent	SNP	superfamily_PEP_carboxykinase_N,HMMPfam_PEPCK,superfamily_SSF53795,PatternScan_PEPCK_GTP	p.L66	ENST00000319441.4	37	c.198	CCDS13460.1	20																																																																																			-	superfamily_PEP_carboxykinase_N,HMMPfam_PEPCK		0.612	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK1	protein_coding	OTTHUMT00000079851.2	C			55570071	+1	no_errors	NM_002591	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
OR5AK2	390181	genome.wustl.edu	37	11	56756895	56756895	+	Nonsense_Mutation	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr11:56756895C>A	ENST00000326855.2	+	1	549	c.507C>A	c.(505-507)tgC>tgA	p.C169*		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	169						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						TGTCCTTCTGCAAGTCCAATA	0.423																																																0			11											324.0	290.0	301.0					11																	56756895		2201	4296	6497	56513471	SO:0001587	stop_gained	390181			AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.507C>A	11.37:g.56756895C>A	ENSP00000322784:p.Cys169*	Somatic		Capture	Illumina GAIIx	4	56513471	B2RNZ9	Nonsense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.C169*	ENST00000326855.2	37	c.507	CCDS31538.1	11	.	.	.	.	.	.	.	.	.	.	C	6.563	0.472163	0.12461	.	.	ENSG00000181273	ENST00000326855	.	.	.	3.85	0.396	0.16309	.	0.000000	0.44285	D	0.000472	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.4208	4.1226	0.10112	0.0:0.4367:0.1783:0.3851	.	.	.	.	X	169	.	ENSP00000322784:C169X	C	+	3	2	OR5AK2	56513471	0.003000	0.15002	0.086000	0.20670	0.013000	0.08279	-0.002000	0.12924	0.256000	0.21614	0.194000	0.17425	TGC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.423	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AK2	protein_coding	OTTHUMT00000392446.1	C	NM_001005323		56513471	+1	no_errors	NM_001005323	genbank	human	provisional	54_36p	nonsense	SNP	0.089	A
P2RX3	5024	genome.wustl.edu	37	11	57135859	57135859	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr11:57135859C>A	ENST00000263314.2	+	10	985	c.951C>A	c.(949-951)aaC>aaA	p.N317K		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	317					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)			endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						GCAAGTTCAACATCATCCCCA	0.627																																																0			11											233.0	186.0	202.0					11																	57135859		2201	4296	6497	56892435	SO:0001583	missense	5024			Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.951C>A	11.37:g.57135859C>A	ENSP00000263314:p.Asn317Lys	Somatic		Capture	Illumina GAIIx	4	56892435	Q6DK37|Q9UQB6	Missense_Mutation	SNP	HMMPfam_P2X_receptor,PatternScan_P2X_RECEPTOR	p.N317K	ENST00000263314.2	37	c.951	CCDS7953.1	11	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210922	0.79240	.	.	ENSG00000109991	ENST00000439993;ENST00000263314	T	0.04360	3.64	5.78	3.91	0.45181	.	0.193359	0.56097	D	0.000039	T	0.13114	0.0318	M	0.64567	1.98	0.47009	D	0.999281	D	0.53462	0.96	P	0.57244	0.816	T	0.00670	-1.1617	10	0.51188	T	0.08	-40.7987	10.1319	0.42685	0.0:0.8424:0.0:0.1575	.	317	P56373	P2RX3_HUMAN	K	316;317	ENSP00000263314:N317K	ENSP00000263314:N317K	N	+	3	2	P2RX3	56892435	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.592000	0.46171	0.908000	0.36671	-0.136000	0.14681	AAC	-	HMMPfam_P2X_receptor		0.627	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX3	protein_coding	OTTHUMT00000392465.1	C	NM_002559		56892435	+1	no_errors	NM_002559	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
L3HYPDH	112849	genome.wustl.edu	37	14	59950697	59950697	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr14:59950697C>A	ENST00000247194.4	-	1	451	c.338G>T	c.(337-339)cGc>cTc	p.R113L	JKAMP_ENST00000554271.1_5'Flank|JKAMP_ENST00000356057.5_5'Flank|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000556985.1_5'Flank|JKAMP_ENST00000261247.9_5'Flank|JKAMP_ENST00000425728.2_5'Flank|L3HYPDH_ENST00000487285.1_5'Flank	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)	113					metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)									L-Proline(DB00172)	CAAAGCGAAGCGGCCCAGCGC	0.701											OREG0022712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			14											11.0	11.0	11.0					14																	59950697		2135	4181	6316	59020450	SO:0001583	missense	112849			AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941	ENST00000247194.4:c.338G>T	14.37:g.59950697C>A	ENSP00000247194:p.Arg113Leu	Somatic	1042	Capture	Illumina GAIIx	4	59020450	Q96LJ5	Missense_Mutation	SNP	superfamily_Diaminopimelate epimerase-like,HMMPfam_Pro_racemase	p.R113L	ENST00000247194.4	37	c.338	CCDS9739.1	14	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744182	0.89663	.	.	ENSG00000126790	ENST00000247194	T	0.18174	2.23	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.51143	0.1657	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.57802	-0.7748	10	0.42905	T	0.14	.	18.8558	0.92251	0.0:1.0:0.0:0.0	.	113;113	B4DGY8;Q96EM0	.;PRCM_HUMAN	L	113	ENSP00000247194:R113L	ENSP00000247194:R113L	R	-	2	0	C14orf149	59020450	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	7.038000	0.76537	2.522000	0.85027	0.561000	0.74099	CGC	-	superfamily_Diaminopimelate epimerase-like,HMMPfam_Pro_racemase		0.701	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf149	protein_coding	OTTHUMT00000072254.5	C	NM_144581		59020450	-1	no_errors	NM_144581	genbank	human	provisional	54_36p	missense	SNP	1.000	A
MIR7162	102466227	genome.wustl.edu	37	15	62538696	62538696	+	RNA	SNP	G	G	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr15:62538696G>C	ENST00000570077.1	-	0	520																											ACCTCTTCCTGCTCTTGGTTC	0.542																																																0			15																																								60325988			255180																															15.37:g.62538696G>C		Somatic		Capture	Illumina GAIIx	4	60325988		RNA	SNP	-	NULL	ENST00000570077.1	37	NULL		15																																																																																			-	-		0.542	hsa-mir-7162.1-004	KNOWN	basic	processed_transcript	FLJ38723	pseudogene	OTTHUMT00000422143.1	G			60325988	-1	no_errors	XR_041381	genbank	human	model	54_36p	rna	SNP	0.942	C
AHNAK	79026	genome.wustl.edu	37	11	62297752	62297752	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr11:62297752G>T	ENST00000378024.4	-	5	4411	c.4137C>A	c.(4135-4137)caC>caA	p.H1379Q	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1379					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GCATCTTCAGGTGCCAATCTG	0.502																																																0			11											256.0	260.0	259.0					11																	62297752		2202	4299	6501	62054328	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.4137C>A	11.37:g.62297752G>T	ENSP00000367263:p.His1379Gln	Somatic		Capture	Illumina GAIIx	4	62054328	A1A586	Missense_Mutation	SNP	superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,HMMPfam_CheC	p.H1379Q	ENST00000378024.4	37	c.4137	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	g	9.185	1.024497	0.19433	.	.	ENSG00000124942	ENST00000378024	T	0.00873	5.59	4.64	4.64	0.57946	.	.	.	.	.	T	0.01592	0.0051	M	0.77313	2.365	0.22156	N	0.999329	P	0.37276	0.589	B	0.33454	0.164	T	0.44498	-0.9324	9	0.15499	T	0.54	.	10.9118	0.47114	0.0:0.0:0.6747:0.3252	.	1379	Q09666	AHNK_HUMAN	Q	1379	ENSP00000367263:H1379Q	ENSP00000367263:H1379Q	H	-	3	2	AHNAK	62054328	0.045000	0.20229	1.000000	0.80357	0.782000	0.44232	0.051000	0.14141	2.135000	0.66039	0.550000	0.68814	CAC	-	NULL		0.502	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	protein_coding	OTTHUMT00000395572.1	G	NM_024060		62054328	-1	no_errors	NM_001620	genbank	human	validated	54_36p	missense	SNP	1.000	T
SPTB	6710	genome.wustl.edu	37	14	65249227	65249227	+	Silent	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr14:65249227C>A	ENST00000389721.5	-	19	4079	c.4047G>T	c.(4045-4047)ctG>ctT	p.L1349L	SPTB_ENST00000389720.3_Silent_p.L1349L|SPTB_ENST00000389722.3_Silent_p.L1349L|SPTB_ENST00000556626.1_Silent_p.L1349L|SPTB_ENST00000542895.1_Silent_p.L1349L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1349					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TTTGGGACACCAGGGCTGTAA	0.607																																																0			14											115.0	124.0	121.0					14																	65249227		2203	4300	6503	64318980	SO:0001819	synonymous_variant	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.4047G>T	14.37:g.65249227C>A		Somatic		Capture	Illumina GAIIx	4	64318980	Q15510|Q15519	Silent	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,superfamily_Spectrin,HMMPfam_Spectrin,HMMSmart_SPEC,superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH	p.L1349	ENST00000389721.5	37	c.4047	CCDS32100.1	14																																																																																			-	HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC		0.607	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	protein_coding	OTTHUMT00000414080.1	C			64318980	-1	no_errors	NM_001024858	genbank	human	validated	54_36p	silent	SNP	0.013	A
ZWILCH	55055	genome.wustl.edu	37	15	66821190	66821190	+	Splice_Site	SNP	A	A	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr15:66821190A>G	ENST00000307897.5	+	11	1350	c.970A>G	c.(970-972)Acc>Gcc	p.T324A	ZWILCH_ENST00000446801.2_Splice_Site_p.T210A|ZWILCH_ENST00000535141.2_Splice_Site_p.T210A|ZWILCH_ENST00000565627.1_Splice_Site_p.T210A	NM_017975.3	NP_060445.3	Q9H900	ZWILC_HUMAN	zwilch kinetochore protein	324					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(1)|lung(6)|ovary(1)	18						TCTTTTTCAGACCTTGAAGCA	0.388																																																0			15											89.0	83.0	85.0					15																	66821190		2201	4299	6500	64608244	SO:0001630	splice_region_variant	55055			AK023175	CCDS10219.1, CCDS73746.1	15q22.31	2013-01-17	2012-12-13		ENSG00000174442	ENSG00000174442			25468	protein-coding gene	gene with protein product		609984	"""Zwilch, kinetochore associated, homolog (Drosophila)"""			12686595	Standard	NM_017975		Approved	FLJ10036, KNTC1AP	uc002aqb.3	Q9H900	OTTHUMG00000133194	ENST00000307897.5:c.970-1A>G	15.37:g.66821190A>G		Somatic		Capture	Illumina GAIIx	4	64608244	B3KVB8|Q6N049|Q8N404|Q96SY7|Q9NWG7	Missense_Mutation	SNP	HMMPfam_DUF2352	p.T324A	ENST00000307897.5	37	c.970	CCDS10219.1	15	.	.	.	.	.	.	.	.	.	.	A	8.861	0.947017	0.18356	.	.	ENSG00000174442	ENST00000307897;ENST00000446801;ENST00000535141	T;T;T	0.39997	1.05;1.05;1.05	5.18	-0.88	0.10610	.	0.835756	0.11042	N	0.605976	T	0.16257	0.0391	N	0.04043	-0.29	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.26950	-1.0088	9	.	.	.	-0.4378	5.1382	0.14945	0.5959:0.0:0.2788:0.1252	.	324	Q9H900	ZWILC_HUMAN	A	324;210;210	ENSP00000311429:T324A;ENSP00000402217:T210A;ENSP00000437749:T210A	.	T	+	1	0	ZWILCH	64608244	0.004000	0.15560	0.559000	0.28332	0.230000	0.25150	0.053000	0.14184	0.171000	0.19730	0.379000	0.24179	ACC	-	HMMPfam_DUF2352		0.388	ZWILCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZWILCH	protein_coding	OTTHUMT00000256904.4	A	NM_017975	Missense_Mutation	64608244	+1	no_errors	NM_017975	genbank	human	validated	54_36p	missense	SNP	0.338	G
RPE65	6121	genome.wustl.edu	37	1	68896808	68896808	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr1:68896808C>G	ENST00000262340.5	-	13	1443	c.1390G>C	c.(1390-1392)Gat>Cat	p.D464H		NM_000329.2	NP_000320.1	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein 65kDa	464					cellular response to electrical stimulus (GO:0071257)|detection of light stimulus involved in visual perception (GO:0050908)|insulin receptor signaling pathway (GO:0008286)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin gene expression (GO:0007468)|retina homeostasis (GO:0001895)|retina morphogenesis in camera-type eye (GO:0060042)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity (GO:0052885)|all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity (GO:0052884)|metal ion binding (GO:0046872)|retinal isomerase activity (GO:0004744)			central_nervous_system(1)|kidney(3)|large_intestine(12)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	35						GGGTATGAATCAGGCTCTTGC	0.378																																																0			1											92.0	89.0	90.0					1																	68896808		2203	4300	6503	68669396	SO:0001583	missense	6121			U18991	CCDS643.1	1p31	2014-05-13	2002-08-29		ENSG00000116745	ENSG00000116745	3.1.1.64		10294	protein-coding gene	gene with protein product	"""retinol isomerase"", ""all-trans-retinyl-palmitate hydrolase"", ""retinoid isomerohydrolase"", ""BCO family, member 3"""	180069	"""retinal pigment epithelium-specific protein (65kD)"""	RP20		8340400	Standard	XM_006710811		Approved	LCA2, rd12, BCO3	uc001dei.1	Q16518	OTTHUMG00000009208	ENST00000262340.5:c.1390G>C	1.37:g.68896808C>G	ENSP00000262340:p.Asp464His	Somatic		Capture	Illumina GAIIx	4	68669396	A8K1L0|Q5T9U3	Missense_Mutation	SNP	HMMPfam_RPE65	p.D464H	ENST00000262340.5	37	c.1390	CCDS643.1	1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.388399	0.25118	.	.	ENSG00000116745	ENST00000262340	D	0.94862	-3.54	5.29	3.39	0.38822	.	0.179274	0.64402	D	0.000016	D	0.84880	0.5570	L	0.42529	1.33	0.58432	D	0.999995	B	0.18166	0.026	B	0.25506	0.061	T	0.79548	-0.1758	10	0.39692	T	0.17	-1.0419	6.5744	0.22557	0.1462:0.7058:0.0:0.148	.	464	Q16518	RPE65_HUMAN	H	464	ENSP00000262340:D464H	ENSP00000262340:D464H	D	-	1	0	RPE65	68669396	0.998000	0.40836	0.755000	0.31263	0.937000	0.57800	3.756000	0.55205	0.603000	0.29913	0.555000	0.69702	GAT	-	HMMPfam_RPE65		0.378	RPE65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPE65	protein_coding	OTTHUMT00000025509.1	C	NM_000329		68669396	-1	no_errors	NM_000329	genbank	human	reviewed	54_36p	missense	SNP	0.929	G
KCNQ5	56479	genome.wustl.edu	37	6	73843315	73843315	+	Silent	SNP	C	C	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr6:73843315C>T	ENST00000370398.1	+	10	1528	c.1419C>T	c.(1417-1419)ttC>ttT	p.F473F	KCNQ5_ENST00000355194.4_Silent_p.F473F|KCNQ5-AS1_ENST00000429832.1_RNA|KCNQ5_ENST00000342056.2_Silent_p.F492F|KCNQ5_ENST00000403813.2_Silent_p.F464F|KCNQ5_ENST00000355635.3_Silent_p.F474F|KCNQ5_ENST00000402622.2_Silent_p.F483F|KCNQ5_ENST00000414165.2_Intron	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	473					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GAACCCGCTTCCGGCCCTCGC	0.527																																					GBM(142;1375 1859 14391 23261 44706)											0			6											78.0	79.0	79.0					6																	73843315		2203	4300	6503	73900036	SO:0001819	synonymous_variant	56479			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1419C>T	6.37:g.73843315C>T		Somatic		Capture	Illumina GAIIx	4	73900036	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Silent	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_KCNQ_channel	p.F473	ENST00000370398.1	37	c.1419	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	C	9.415	1.081646	0.20309	.	.	ENSG00000185760	ENST00000427928	.	.	.	5.59	4.71	0.59529	.	.	.	.	.	T	0.54919	0.1888	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51702	-0.8672	4	.	.	.	.	12.5499	0.56222	0.0:0.9231:0.0:0.0769	.	.	.	.	S	65	.	.	P	+	1	0	KCNQ5	73900036	0.996000	0.38824	1.000000	0.80357	0.970000	0.65996	0.658000	0.24979	2.797000	0.96272	0.563000	0.77884	CCG	-	HMMPfam_KCNQ_channel		0.527	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	protein_coding	OTTHUMT00000041198.3	C	NM_019842		73900036	+1	no_errors	NM_019842	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
USP54	159195	genome.wustl.edu	37	10	75277097	75277097	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr10:75277097C>G	ENST00000339859.4	-	19	3187	c.3087G>C	c.(3085-3087)aaG>aaC	p.K1029N	USP54_ENST00000497106.1_5'UTR|USP54_ENST00000408019.1_Missense_Mutation_p.K1029N|USP54_ENST00000422491.2_Missense_Mutation_p.K211N|RP11-137L10.6_ENST00000600206.1_RNA|RP11-137L10.6_ENST00000595069.1_RNA|USP54_ENST00000428547.1_Missense_Mutation_p.K879N|RP11-137L10.6_ENST00000597958.1_RNA|USP54_ENST00000394811.2_Missense_Mutation_p.K117N|RP11-137L10.6_ENST00000593790.1_RNA			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1029					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					CAGGATCCTTCTTTTCTTGGA	0.522																																					Colon(195;880 2046 8854 25025 38456)											0			10											115.0	119.0	118.0					10																	75277097		2203	4300	6503	74947103	SO:0001583	missense	159195			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.3087G>C	10.37:g.75277097C>G	ENSP00000345216:p.Lys1029Asn	Somatic		Capture	Illumina GAIIx	4	74947103	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH	p.K1029N	ENST00000339859.4	37	c.3087	CCDS7329.2	10	.	.	.	.	.	.	.	.	.	.	C	10.65	1.410672	0.25465	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000394811;ENST00000422491	T;T;T;T;T	0.34072	1.75;1.75;1.74;1.38;1.68	6.03	0.382	0.16234	.	.	.	.	.	T	0.43919	0.1269	L	0.43152	1.355	0.29263	N	0.871221	D;D	0.63046	0.992;0.986	P;P	0.62298	0.9;0.617	T	0.38200	-0.9672	9	0.72032	D	0.01	-2.0327	7.4661	0.27322	0.0:0.5568:0.1131:0.3301	.	211;1029	E7EW90;Q70EL1	.;UBP54_HUMAN	N	1029;1029;879;117;211	ENSP00000345216:K1029N;ENSP00000386080:K1029N;ENSP00000408714:K879N;ENSP00000378290:K117N;ENSP00000407368:K211N	ENSP00000345216:K1029N	K	-	3	2	USP54	74947103	0.887000	0.30362	0.614000	0.29051	0.403000	0.30841	0.549000	0.23329	0.146000	0.19002	-0.122000	0.15005	AAG	-	NULL		0.522	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP54	protein_coding	OTTHUMT00000316563.2	C	NM_152586		74947103	-1	no_errors	NM_152586	genbank	human	provisional	54_36p	missense	SNP	0.005	G
FRG2C	100288801	genome.wustl.edu	37	3	75718368	75718368	+	IGR	SNP	G	G	A	rs373780336		TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr3:75718368G>A	ENST00000308062.3	+	0	2078					NM_001124759.1	NP_001118231.1	A6NGY1	FRG2C_HUMAN	FSHD region gene 2 family, member C							nucleus (GO:0005634)				breast(2)|ovary(1)	3						GAAGGCAGGCGAAAGCGGACC	0.652																																																0			3																																								75801058	SO:0001628	intergenic_variant	0				CCDS43108.1	3p12.3	2009-11-25			ENSG00000172969	ENSG00000172969			33626	protein-coding gene	gene with protein product							Standard	NM_001124759		Approved			A6NGY1	OTTHUMG00000158963		3.37:g.75718368G>A		Somatic		Capture	Illumina GAIIx	4	75801058		RNA	SNP	-	NULL	ENST00000308062.3	37	NULL	CCDS43108.1	3																																																																																			-	-		0.652	FRG2C-001	KNOWN	NAGNAG_splice_site|not_best_in_genome_evidence|basic|appris_candidate_longest|CCDS	protein_coding	LOC440015	protein_coding	OTTHUMT00000352694.1	G	NM_001124759.1		75801058	+1	no_errors	XR_015234	genbank	human	model	54_36p	rna	SNP	0.012	A
ACSBG1	23205	genome.wustl.edu	37	15	78486862	78486862	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr15:78486862T>C	ENST00000258873.4	-	3	644	c.439A>G	c.(439-441)Aag>Gag	p.K147E	ACSBG1_ENST00000560817.1_Intron|ACSBG1_ENST00000541759.1_Intron|ACSBG1_ENST00000558828.1_5'Flank	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	147					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						AGGAAGCCCTTGGCGGCTCTG	0.617																																																0			15											55.0	61.0	59.0					15																	78486862		2196	4293	6489	76273917	SO:0001583	missense	23205			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.439A>G	15.37:g.78486862T>C	ENSP00000258873:p.Lys147Glu	Somatic		Capture	Illumina GAIIx	4	76273917	B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding,PatternScan_AMP_BINDING	p.K147E	ENST00000258873.4	37	c.439	CCDS10298.1	15	.	.	.	.	.	.	.	.	.	.	T	30	5.053522	0.93793	.	.	ENSG00000103740	ENST00000258873	T	0.40225	1.04	5.12	5.12	0.69794	AMP-dependent synthetase/ligase (1);	0.054245	0.64402	N	0.000001	T	0.68723	0.3032	M	0.89904	3.07	0.80722	D	1	D;D	0.76494	0.999;0.989	D;D	0.67382	0.951;0.945	T	0.76187	-0.3051	10	0.66056	D	0.02	-42.3277	13.7668	0.62999	0.0:0.0:0.0:1.0	.	147;147	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	E	147	ENSP00000258873:K147E	ENSP00000258873:K147E	K	-	1	0	ACSBG1	76273917	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.370000	0.66144	1.929000	0.55896	0.533000	0.62120	AAG	-	superfamily_Acetyl-CoA synthetase-like,HMMPfam_AMP-binding		0.617	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	protein_coding	OTTHUMT00000289802.2	T	NM_015162		76273917	-1	no_errors	NM_015162	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	5	76878775	76878775	+	IGR	SNP	A	A	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr5:76878775A>G								WDR41 (90354 upstream) : OTP (45762 downstream)																							GATTTGATTCATGAGATCTAT	0.403																																																0			5																																								76914531	SO:0001628	intergenic_variant	648000																															5.37:g.76878775A>G		Somatic		Capture	Illumina GAIIx	4	76914531		Missense_Mutation	SNP	HMMPfam_Ribosomal_L30_N,HMMPfam_Ribosomal_L30,superfamily_Ribosomal protein L30p/L7e,PatternScan_RIBOSOMAL_L30	p.H203R		37	c.608		5																																																																																			-	superfamily_Ribosomal protein L30p/L7e	0	0.403					LOC648000			A			76914531	+1	pseudogene	XM_001722435	genbank	human	model	54_36p	missense	SNP	1.000	G
TBCD	6904	genome.wustl.edu	37	17	80785898	80785898	+	Intron	SNP	C	C	T	rs75044636	byFrequency	TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr17:80785898C>T	ENST00000355528.4	+	13	1448				TBCD_ENST00000539345.2_Intron|TBCD_ENST00000397466.2_Intron	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D						'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			gatatgtacacgtggacacgc	0.512													C|||	600	0.119808	0.0038	0.0821	5008	,	,		26997	0.0714		0.1451	False		,,,				2504	0.3272															0			17																																								78379187	SO:0001627	intron_variant	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1318+13088C>T	17.37:g.80785898C>T		Somatic		Capture	Illumina GAIIx	4	78379187	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	NULL	p.T57M	ENST00000355528.4	37	c.170	CCDS45818.1	17																																																																																			-	NULL		0.512	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000214069	protein_coding	OTTHUMT00000439415.1	C	NM_005993		78379187	+1	no_stop_codon	ENST00000397438	ensembl	human	known	54_36p	missense	SNP	0.980	T
Unknown	0	genome.wustl.edu	37	X	79816980	79816980	+	IGR	SNP	T	T	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chrX:79816980T>A								FAM46D (116170 upstream) : BRWD3 (109372 downstream)																							CCATCTGAAATGCCAGGACTC	0.592																																																0			X																																								79703636	SO:0001628	intergenic_variant	727874																															X.37:g.79816980T>A		Somatic		Capture	Illumina GAIIx	4	79703636		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.592					LOC727874			T			79703636	+1	pseudogene	XR_042356	genbank	human	model	54_36p	rna	SNP	0.999	A
MAN2A2	4122	genome.wustl.edu	37	15	91448687	91448687	+	Silent	SNP	G	G	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr15:91448687G>A	ENST00000559717.1	+	3	798	c.339G>A	c.(337-339)ccG>ccA	p.P113P	MAN2A2_ENST00000431652.2_5'Flank|MAN2A2_ENST00000360468.3_Silent_p.P113P			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	113					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CCATCTCCCCGCAGGACTGCC	0.657																																																0			15											24.0	30.0	28.0					15																	91448687		2196	4297	6493	89249691	SO:0001819	synonymous_variant	4122			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.339G>A	15.37:g.91448687G>A		Somatic		Capture	Illumina GAIIx	4	89249691	A6NH12|A8K1E8|Q13754	Silent	SNP	superfamily_Glyco_hydro/deAcase_b/a-brl,HMMPfam_Glyco_hydro_38,superfamily_SSF88688,HMMPfam_Alpha-mann_mid,superfamily_Gal_mut_like,HMMPfam_Glyco_hydro_38C	p.P113	ENST00000559717.1	37	c.339	CCDS32332.1	15																																																																																			-	NULL		0.657	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A2	protein_coding	OTTHUMT00000418246.5	G	NM_006122		89249691	+1	no_errors	NM_006122	genbank	human	validated	54_36p	silent	SNP	0.645	A
PRC1	9055	genome.wustl.edu	37	15	91512754	91512754	+	Missense_Mutation	SNP	C	C	A	rs201777744		TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr15:91512754C>A	ENST00000361188.5	-	13	2883	c.1672G>T	c.(1672-1674)Ggt>Tgt	p.G558C	PRC1_ENST00000361919.3_Splice_Site_p.A558S|PRC1-AS1_ENST00000556200.1_RNA|PRC1_ENST00000442656.2_Splice_Site_p.A517S|PRC1-AS1_ENST00000554388.1_RNA|PRC1_ENST00000394249.3_Missense_Mutation_p.G558C					protein regulator of cytokinesis 1											endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					GGGTACCCACCACTCAGGATG	0.542																																																0			15						C	CYS/GLY,CYS/GLY,SER/ALA	0,4396		0,0,2198	121.0	100.0	107.0		1672,1672,1672	6.1	1.0	15		107	2,8594	2.2+/-6.3	0,2,4296	yes	missense,missense,missense-near-splice	PRC1	NM_003981.2,NM_199413.1,NM_199414.1	159,159,99	0,2,6494	AA,AC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	558/621,558/607,558/567	91512754	2,12990	2198	4298	6496	89313758	SO:0001583	missense	9055			AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1672G>T	15.37:g.91512754C>A	ENSP00000354679:p.Gly558Cys	Somatic		Capture	Illumina GAIIx	4	89313758		Missense_Mutation	SNP	HMMPfam_MAP65_ASE1	p.G558C	ENST00000361188.5	37	c.1672	CCDS45352.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.3|23.3	4.397491|4.397491	0.83120|0.83120	0.0|0.0	2.33E-4|2.33E-4	ENSG00000198901|ENSG00000198901	ENST00000361919;ENST00000442656|ENST00000394249;ENST00000361188;ENST00000555455	T;T|T;T	0.29142|0.31510	1.58;1.58|1.49;1.49	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.237656	.|0.42172	.|D	.|0.000759	T|T	0.38241|0.38241	0.1033|0.1033	N|N	0.08118|0.08118	0|0	0.35595|0.35595	D|D	0.807417|0.807417	B;B|D;D	0.15930|0.61080	0.001;0.015|0.989;0.983	B;B|P;D	0.23419|0.66716	0.012;0.046|0.889;0.946	T|T	0.52895|0.52895	-0.8514|-0.8514	9|10	0.20046|0.62326	T|D	0.44|0.03	.|.	20.2194|20.2194	0.98323|0.98323	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	517;558|528;558	O43663-3;F8W9B5|O43663-2;O43663	.;.|.;PRC1_HUMAN	S|C	558;517|558;558;161	ENSP00000354618:A558S;ENSP00000409549:A517S|ENSP00000377793:G558C;ENSP00000354679:G558C	ENSP00000354618:A558S|ENSP00000354679:G558C	A|G	-|-	1|1	0|0	PRC1|PRC1	89313758|89313758	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	4.952000|4.952000	0.63618|0.63618	2.879000|2.879000	0.98667|0.98667	0.650000|0.650000	0.86243|0.86243	GCG|GGT	-	HMMPfam_MAP65_ASE1		0.542	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRC1	protein_coding	OTTHUMT00000414760.1	C	NM_003981		89313758	-1	no_errors	NM_003981	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PCDH11X	27328	genome.wustl.edu	37	X	91238360	91238360	+	Intron	SNP	T	T	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chrX:91238360T>G	ENST00000373094.1	+	2	3878				PCDH11X_ENST00000298274.8_Intron|PCDH11X_ENST00000373097.1_Intron|PCDH11X_ENST00000504220.2_Intron|PCDH11X_ENST00000361655.2_Intron|PCDH11X_ENST00000373088.1_Intron|PCDH11X_ENST00000406881.1_Intron	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked						homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GTGGtctcagtattggctgag	0.438																																					NSCLC(38;925 1092 2571 38200 45895)											0			X																																								91125016	SO:0001627	intron_variant	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3033+104088T>G	X.37:g.91238360T>G		Somatic		Capture	Illumina GAIIx	4	91125016	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	RNA	SNP	-	NULL	ENST00000373094.1	37	NULL	CCDS14461.1	X																																																																																			-	-		0.438	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC100132302	protein_coding	OTTHUMT00000057436.1	T	NM_032969		91125016	-1	pseudogene	XR_038899	genbank	human	model	54_36p	rna	SNP	0.998	G
SAMD9L	219285	genome.wustl.edu	37	7	92765038	92765038	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr7:92765038C>G	ENST00000318238.4	-	5	1463	c.247G>C	c.(247-249)Gac>Cac	p.D83H	SAMD9L_ENST00000411955.1_Missense_Mutation_p.D83H|SAMD9L_ENST00000437805.1_Missense_Mutation_p.D83H	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	83					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TCATGATTGTCACTTTCAGGG	0.378																																																0			7											129.0	142.0	138.0					7																	92765038		2203	4300	6503	92602974	SO:0001583	missense	219285			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.247G>C	7.37:g.92765038C>G	ENSP00000326247:p.Asp83His	Somatic		Capture	Illumina GAIIx	4	92602974	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/Pointed domain	p.D83H	ENST00000318238.4	37	c.247	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	C	10.02	1.235932	0.22626	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805;ENST00000394472	T;T;T	0.16196	2.36;2.36;2.36	4.68	-2.72	0.05968	.	1.190630	0.06269	N	0.695303	T	0.04452	0.0122	N	0.00926	-1.1	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.08055	0.003;0.001	T	0.32929	-0.9888	10	0.33940	T	0.23	-0.2148	1.9631	0.03390	0.1694:0.2269:0.3919:0.2118	.	83;83	Q8IVG5-2;Q8IVG5	.;SAM9L_HUMAN	H	83	ENSP00000326247:D83H;ENSP00000405760:D83H;ENSP00000408796:D83H	ENSP00000326247:D83H	D	-	1	0	SAMD9L	92602974	0.000000	0.05858	0.002000	0.10522	0.132000	0.20833	-1.867000	0.01646	-0.424000	0.07382	0.460000	0.39030	GAC	-	superfamily_SAM/Pointed domain		0.378	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	protein_coding	OTTHUMT00000341730.1	C	NM_152703		92602974	-1	no_errors	NM_152703	genbank	human	validated	54_36p	missense	SNP	0.000	G
LINC00521	256369	genome.wustl.edu	37	14	94467521	94467521	+	RNA	SNP	T	T	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr14:94467521T>A	ENST00000444118.1	+	0	599					NR_024182.1		Q8NCU1	CN048_HUMAN	long intergenic non-protein coding RNA 521																		CCGGAGGAGGTGCTGGTGGAG	0.667																																																0			14											52.0	43.0	46.0					14																	94467521		2203	4300	6503	93537274			256369			BI463117		14q32.12	2012-10-12	2011-11-29	2011-11-29	ENSG00000175699	ENSG00000175699		"""Long non-coding RNAs"""	19860	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 48"""	C14orf48			Standard	NR_024182		Approved		uc001ycg.1	Q8NCU1	OTTHUMG00000156974		14.37:g.94467521T>A		Somatic		Capture	Illumina GAIIx	4	93537274	Q8N7S1	Missense_Mutation	SNP	NULL	p.V70E	ENST00000444118.1	37	c.209		14																																																																																			-	NULL		0.667	LINC00521-003	KNOWN	basic	processed_transcript	C14orf48	processed_transcript	OTTHUMT00000346916.1	T			93537274	+1	no_errors	ENST00000359253	ensembl	human	known	54_36p	missense	SNP	0.000	A
HPS1	3257	genome.wustl.edu	37	10	100189400	100189400	+	Splice_Site	SNP	C	C	T	rs532348840		TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr10:100189400C>T	ENST00000325103.6	-	10	1101		c.e10-1		HPS1_ENST00000338546.5_Splice_Site|MIR4685_ENST00000578185.1_RNA|HPS1_ENST00000467246.1_Splice_Site|HPS1_ENST00000361490.4_Splice_Site	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1						blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		TGTCTGTCTCCTGGAATGGAG	0.602									Hermansky-Pudlak syndrome																																							0			10											71.0	76.0	74.0					10																	100189400		2203	4300	6503	100179390	SO:0001630	splice_region_variant	3257	Familial Cancer Database	HPS, HPS1-8	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.868-1G>A	10.37:g.100189400C>T		Somatic		Capture	Illumina GAIIx	4	100179390	A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Splice_Site	SNP	-	e8-1	ENST00000325103.6	37	c.868-1	CCDS7475.1	10	.	.	.	.	.	.	.	.	.	.	C	16.95	3.264151	0.59431	.	.	ENSG00000107521	ENST00000325103;ENST00000361490;ENST00000407891;ENST00000359632;ENST00000338546;ENST00000414009	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1217	0.89573	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HPS1	100179390	1.000000	0.71417	0.998000	0.56505	0.695000	0.40330	3.848000	0.55903	2.366000	0.80165	0.561000	0.74099	.	-	-		0.602	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS1	protein_coding	OTTHUMT00000049776.1	C	NM_000195, NM_182637, NM_182638, NM_182639	Intron	100179390	-1	no_errors	NM_000195	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	T
MUC17	140453	genome.wustl.edu	37	7	100684246	100684246	+	Silent	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr7:100684246C>A	ENST00000306151.4	+	3	9613	c.9549C>A	c.(9547-9549)acC>acA	p.T3183T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3183	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGGATAGCACCCTTTCAGCAA	0.483																																																0			7											297.0	298.0	297.0					7																	100684246		2203	4300	6503	100470966	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9549C>A	7.37:g.100684246C>A		Somatic		Capture	Illumina GAIIx	4	100470966	O14761|Q685J2|Q8TDH7	Silent	SNP	superfamily_EGF/Laminin,PatternScan_EGF_1,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.T3183	ENST00000306151.4	37	c.9549	CCDS34711.1	7																																																																																			-	NULL		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	C	NM_001040105		100470966	+1	no_errors	NM_001040105	genbank	human	provisional	54_36p	silent	SNP	0.002	A
STAB2	55576	genome.wustl.edu	37	12	104031811	104031811	+	Nonsense_Mutation	SNP	C	C	T	rs149696858	byFrequency	TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr12:104031811C>T	ENST00000388887.2	+	8	931	c.727C>T	c.(727-729)Cga>Tga	p.R243*		NM_017564.9	NP_060034.9			stabilin 2									p.R243*(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TCCATGTTTACGAAAAATCTG	0.488													C|||	3	0.000599042	0.0	0.0	5008	,	,		20844	0.002		0.001	False		,,,				2504	0.0															1	Substitution - Nonsense(1)	prostate(1)	12						C	stop/ARG	0,4406		0,0,2203	221.0	181.0	195.0		727	1.1	0.0	12	dbSNP_134	195	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	STAB2	NM_017564.9		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		243/2552	104031811	1,13005	2203	4300	6503	102555941	SO:0001587	stop_gained	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.727C>T	12.37:g.104031811C>T	ENSP00000373539:p.Arg243*	Somatic		Capture	Illumina GAIIx	4	102555941		Nonsense_Mutation	SNP	HMMSmart_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_alliinase,superfamily_SSF57196,HMMPfam_EGF,superfamily_BIgH3_FAS1,HMMPfam_Fasciclin,HMMSmart_FAS1,HMMPfam_Laminin_EGF,PatternScan_EGF_LAM_1,superfamily_Grow_fac_recept,HMMPfam_EGF_2,HMMSmart_LINK,HMMPfam_Xlink,superfamily_C-type_lectin_fold,PatternScan_LINK_1	p.R243*	ENST00000388887.2	37	c.727	CCDS31888.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	29.0	4.971627	0.92919	0.0	1.16E-4	ENSG00000136011	ENST00000388887	.	.	.	5.38	1.12	0.20585	.	0.594828	0.17469	N	0.173146	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	9.7534	0.40490	0.4093:0.3763:0.2144:0.0	.	.	.	.	X	243	.	ENSP00000373539:R243X	R	+	1	2	STAB2	102555941	0.004000	0.15560	0.000000	0.03702	0.224000	0.24922	0.414000	0.21164	0.201000	0.20466	-0.175000	0.13238	CGA	-	superfamily_SSF57196,HMMSmart_EGF		0.488	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	protein_coding	OTTHUMT00000407089.1	C			102555941	+1	no_errors	NM_017564	genbank	human	reviewed	54_36p	nonsense	SNP	0.005	T
BANK1	55024	genome.wustl.edu	37	4	102783720	102783720	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr4:102783720T>C	ENST00000322953.4	+	4	936	c.662T>C	c.(661-663)gTa>gCa	p.V221A	BANK1_ENST00000428908.1_Missense_Mutation_p.V88A|BANK1_ENST00000444316.2_Missense_Mutation_p.V191A|BANK1_ENST00000504592.1_Missense_Mutation_p.V206A|BANK1_ENST00000508653.1_Missense_Mutation_p.V88A	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	221	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		AGAGATGAAGTAATTGGTGAT	0.348																																																0			4											71.0	73.0	73.0					4																	102783720		2203	4298	6501	103002743	SO:0001583	missense	55024			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.662T>C	4.37:g.102783720T>C	ENSP00000320509:p.Val221Ala	Somatic		Capture	Illumina GAIIx	4	103002743	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	superfamily_Ankyrin repeat	p.V221A	ENST00000322953.4	37	c.662	CCDS34038.1	4	.	.	.	.	.	.	.	.	.	.	T	15.72	2.917984	0.52546	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.19394	2.85;2.84;2.15;2.15;2.85	4.84	4.84	0.62591	DBB domain (1);	0.483471	0.18355	N	0.143752	T	0.20333	0.0489	L	0.38175	1.15	0.25690	N	0.985698	P;P;P	0.50156	0.932;0.571;0.571	B;B;B	0.43445	0.42;0.21;0.21	T	0.08868	-1.0701	10	0.72032	D	0.01	.	12.4739	0.55801	0.0:0.0:0.0:1.0	.	88;221;206	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	A	206;221;88;88;191	ENSP00000421443:V206A;ENSP00000320509:V221A;ENSP00000412748:V88A;ENSP00000422314:V88A;ENSP00000388817:V191A	ENSP00000320509:V221A	V	+	2	0	BANK1	103002743	1.000000	0.71417	0.987000	0.45799	0.953000	0.61014	5.015000	0.64035	1.925000	0.55765	0.477000	0.44152	GTA	-	NULL		0.348	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BANK1	protein_coding	OTTHUMT00000363161.1	T	NM_017935		103002743	+1	no_errors	NM_017935	genbank	human	validated	54_36p	missense	SNP	0.597	C
EXPH5	23086	genome.wustl.edu	37	11	108383766	108383766	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr11:108383766G>C	ENST00000265843.4	-	6	2578	c.2468C>G	c.(2467-2469)cCc>cGc	p.P823R	EXPH5_ENST00000443411.1_Missense_Mutation_p.P635R|EXPH5_ENST00000525344.1_Missense_Mutation_p.P816R|EXPH5_ENST00000428840.1_Missense_Mutation_p.P747R|EXPH5_ENST00000524840.1_5'Flank	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	823					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GTCTGTCCTGGGGAAAGATGG	0.383																																																0			11											126.0	131.0	129.0					11																	108383766		2201	4298	6499	107888976	SO:0001583	missense	23086				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.2468C>G	11.37:g.108383766G>C	ENSP00000265843:p.Pro823Arg	Somatic		Capture	Illumina GAIIx	4	107888976	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	NULL	p.P823R	ENST00000265843.4	37	c.2468	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886313	0.51908	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.19669	2.68;2.57;2.44;2.68;2.37;2.13	5.74	1.54	0.23209	.	0.394740	0.24759	N	0.035840	T	0.36138	0.0956	M	0.66939	2.045	0.09310	N	1	D	0.89917	1.0	D	0.71870	0.975	T	0.11616	-1.0580	10	0.87932	D	0	-0.3098	5.0401	0.14454	0.2429:0.0:0.6143:0.1428	.	823	Q8NEV8	EXPH5_HUMAN	R	823;747;635;816;747;635	ENSP00000265843:P823R;ENSP00000391966:P747R;ENSP00000411390:P635R;ENSP00000432546:P816R;ENSP00000432683:P747R;ENSP00000446434:P635R	ENSP00000265843:P823R	P	-	2	0	EXPH5	107888976	0.008000	0.16893	0.077000	0.20336	0.894000	0.52154	0.193000	0.17116	0.092000	0.17331	0.563000	0.77884	CCC	-	NULL		0.383	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	protein_coding	OTTHUMT00000390279.1	G	NM_015065		107888976	-1	no_errors	NM_015065	genbank	human	validated	54_36p	missense	SNP	0.033	C
CHI3L2	1117	genome.wustl.edu	37	1	111773364	111773364	+	Splice_Site	SNP	G	G	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr1:111773364G>T	ENST00000445067.2	+	5	842	c.71G>T	c.(70-72)gGa>gTa	p.G24V	CHI3L2_ENST00000369748.4_Splice_Site_p.G24V|CHI3L2_ENST00000466741.1_5'UTR|CHI3L2_ENST00000369744.2_Splice_Site_p.G14V|CHI3L2_ENST00000524472.1_5'UTR			Q15782	CH3L2_HUMAN	chitinase 3-like 2	24					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)	extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(1)	19		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		TCTACTCCAGGATCTGCCTAC	0.488																																																0			1											72.0	67.0	69.0					1																	111773364		2203	4300	6503	111574887	SO:0001630	splice_region_variant	1117			U49835	CCDS30802.1, CCDS30803.1, CCDS41367.1	1p13.3	2008-02-05			ENSG00000064886	ENSG00000064886			1933	protein-coding gene	gene with protein product		601526				8702629	Standard	NM_001025197		Approved	YKL-39, YKL39	uc001eam.3	Q15782	OTTHUMG00000012174	ENST00000445067.2:c.71-1G>T	1.37:g.111773364G>T		Somatic		Capture	Illumina GAIIx	4	111574887	A6NNY3|B4DPR7|Q15749|Q15783|Q5VUV7|Q96F97	Missense_Mutation	SNP	PatternScan_CHITINASE_18,HMMPfam_Glyco_hydro_18,HMMSmart_Glyco_18,superfamily_Glyco_hydro_cat,superfamily_SSF54556	p.G24V	ENST00000445067.2	37	c.71	CCDS30802.1	1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.037740	0.54896	.	.	ENSG00000064886	ENST00000445067;ENST00000528451;ENST00000486561;ENST00000369744;ENST00000369748;ENST00000474304	T;T;T;T;T	0.14640	3.35;2.51;2.49;3.3;3.35	4.09	3.15	0.36227	.	0.186473	0.25909	N	0.027502	T	0.05456	0.0144	L	0.58969	1.84	0.80722	D	1	P;P	0.39480	0.675;0.553	B;B	0.31442	0.13;0.091	T	0.25606	-1.0127	9	.	.	.	.	11.3698	0.49694	0.0:0.1851:0.8149:0.0	.	14;24	A6NNY3;Q15782	.;CH3L2_HUMAN	V	24;24;24;14;24;24	ENSP00000437082:G24V;ENSP00000436077:G24V;ENSP00000431968:G24V;ENSP00000358759:G14V;ENSP00000358763:G24V	.	G	+	2	0	CHI3L2	111574887	0.881000	0.30235	0.546000	0.28166	0.794000	0.44872	1.085000	0.30840	0.858000	0.35431	0.655000	0.94253	GGA	-	NULL		0.488	CHI3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHI3L2	protein_coding	OTTHUMT00000033669.4	G	NM_004000	Missense_Mutation	111574887	+1	no_errors	NM_004000	genbank	human	validated	54_36p	missense	SNP	0.997	T
TCERG1	10915	genome.wustl.edu	37	5	145872522	145872522	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr5:145872522C>T	ENST00000296702.5	+	15	2190	c.2152C>T	c.(2152-2154)Cgc>Tgc	p.R718C	TCERG1_ENST00000394421.2_Missense_Mutation_p.R697C	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	718					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGAGGAAGAACGCAGGGAAAA	0.313																																																0			5											63.0	66.0	65.0					5																	145872522		2203	4295	6498	145852715	SO:0001583	missense	10915			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.2152C>T	5.37:g.145872522C>T	ENSP00000296702:p.Arg718Cys	Somatic		Capture	Illumina GAIIx	4	145852715	Q2NKN2|Q59EA1	Missense_Mutation	SNP	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_FF domain,HMMSmart_SM00441,HMMPfam_FF	p.R718C	ENST00000296702.5	37	c.2152	CCDS4282.1	5	.	.	.	.	.	.	.	.	.	.	C	24.2	4.510518	0.85389	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.33654	1.4;1.4	5.51	5.51	0.81932	FF domain (2);	0.000000	0.85682	D	0.000000	T	0.67590	0.2909	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.983	T	0.72673	-0.4222	10	0.87932	D	0	-5.8594	19.7945	0.96474	0.0:1.0:0.0:0.0	.	697;718	O14776-2;O14776	.;TCRG1_HUMAN	C	718;697	ENSP00000296702:R718C;ENSP00000377943:R697C	ENSP00000296702:R718C	R	+	1	0	TCERG1	145852715	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.061000	0.71148	2.746000	0.94184	0.591000	0.81541	CGC	-	superfamily_FF domain		0.313	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	protein_coding	OTTHUMT00000251886.1	C	NM_001040006		145852715	+1	no_errors	NM_006706	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PPARGC1B	133522	genome.wustl.edu	37	5	149212411	149212411	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr5:149212411C>A	ENST00000309241.5	+	5	807	c.775C>A	c.(775-777)Cca>Aca	p.P259T	PPARGC1B_ENST00000403750.1_Missense_Mutation_p.P195T|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.P259T|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.P220T	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	259					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GAGCCCCCAGCCAGCTCCAGC	0.682																																																0			5											30.0	39.0	36.0					5																	149212411		2202	4298	6500	149192604	SO:0001583	missense	133522			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.775C>A	5.37:g.149212411C>A	ENSP00000312649:p.Pro259Thr	Somatic		Capture	Illumina GAIIx	4	149192604	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.P259T	ENST00000309241.5	37	c.775	CCDS4298.1	5	.	.	.	.	.	.	.	.	.	.	C	9.564	1.119270	0.20877	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	T;T;T;T	0.08370	3.11;3.1;3.1;3.11	5.23	3.45	0.39498	.	0.749694	0.12778	N	0.439931	T	0.06962	0.0177	L	0.44542	1.39	0.22982	N	0.998479	B;P;B;B;B	0.34724	0.328;0.465;0.328;0.22;0.169	B;B;B;B;B	0.28011	0.085;0.085;0.085;0.039;0.079	T	0.33137	-0.9880	10	0.36615	T	0.2	-1.3903	6.4035	0.21652	0.1155:0.5084:0.3053:0.0709	.	238;238;220;259;259	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.;.;.;PRGC2_HUMAN;.	T	220;259;259;195	ENSP00000353638:P220T;ENSP00000377855:P259T;ENSP00000312649:P259T;ENSP00000384403:P195T	ENSP00000312649:P259T	P	+	1	0	PPARGC1B	149192604	0.036000	0.19791	0.316000	0.25252	0.967000	0.64934	0.408000	0.21065	0.773000	0.33404	0.655000	0.94253	CCA	-	NULL		0.682	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	protein_coding	OTTHUMT00000252334.1	C	NM_133263		149192604	+1	no_errors	NM_133263	genbank	human	provisional	54_36p	missense	SNP	0.110	A
FASTK	10922	genome.wustl.edu	37	7	150774420	150774420	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr7:150774420G>C	ENST00000297532.6	-	7	1345	c.1268C>G	c.(1267-1269)aCt>aGt	p.T423S	RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000482571.1_Missense_Mutation_p.T396S|FASTK_ENST00000540185.1_3'UTR|FASTK_ENST00000353841.2_Missense_Mutation_p.T282S|FASTK_ENST00000489884.1_5'UTR	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	423					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		TGGAGGCACAGTCAGGTCCTG	0.647																																																0			7											47.0	53.0	51.0					7																	150774420		2203	4300	6503	150405353	SO:0001583	missense	10922				CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.1268C>G	7.37:g.150774420G>C	ENSP00000297532:p.Thr423Ser	Somatic		Capture	Illumina GAIIx	4	150405353	A8K867|F8VTW9|Q59EM8|Q8IVA0	Missense_Mutation	SNP	HMMPfam_FAST_1,HMMPfam_FAST_2,HMMPfam_RAP	p.T423S	ENST00000297532.6	37	c.1268	CCDS5918.1	7	.	.	.	.	.	.	.	.	.	.	G	18.00	3.524760	0.64747	.	.	ENSG00000164896	ENST00000483105;ENST00000297530;ENST00000353841;ENST00000297532;ENST00000482571	T;T;T	0.44482	0.92;0.92;0.92	4.29	4.29	0.51040	FAST kinase-like protein, subdomain 2 (1);	0.164390	0.41500	D	0.000861	T	0.36524	0.0970	N	0.08118	0	0.80722	D	1	D;P;P	0.63880	0.993;0.789;0.789	P;P;P	0.56042	0.79;0.504;0.608	T	0.21965	-1.0230	10	0.33141	T	0.24	-17.702	15.0725	0.72049	0.0:0.0:1.0:0.0	.	396;282;423	F8VTW9;Q8IVA0;Q14296	.;.;FASTK_HUMAN	S	423;423;282;423;396	ENSP00000324817:T282S;ENSP00000297532:T423S;ENSP00000418516:T396S	ENSP00000297530:T423S	T	-	2	0	FASTK	150405353	0.999000	0.42202	0.984000	0.44739	0.977000	0.68977	3.666000	0.54540	2.676000	0.91093	0.655000	0.94253	ACT	-	HMMPfam_FAST_2		0.647	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTK	protein_coding	OTTHUMT00000351832.2	G	NM_006712		150405353	-1	no_errors	NM_006712	genbank	human	reviewed	54_36p	missense	SNP	0.939	C
KPRP	448834	genome.wustl.edu	37	1	152733791	152733791	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr1:152733791G>A	ENST00000606109.1	+	1	1755	c.1727G>A	c.(1726-1728)aGt>aAt	p.S576N	KPRP_ENST00000368773.1_Missense_Mutation_p.S576N			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	576						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAAGCAAAGAGTGCTTATTTT	0.488																																																0			1											46.0	46.0	46.0					1																	152733791		2203	4300	6503	151000415	SO:0001583	missense	448834			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1727G>A	1.37:g.152733791G>A	ENSP00000475216:p.Ser576Asn	Somatic		Capture	Illumina GAIIx	4	151000415		Missense_Mutation	SNP	NULL	p.S576N	ENST00000606109.1	37	c.1727	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	G	14.32	2.498802	0.44455	.	.	ENSG00000203786	ENST00000368773	T	0.14144	2.53	4.48	3.57	0.40892	.	0.738656	0.11760	N	0.532149	T	0.03608	0.0103	N	0.22421	0.69	0.09310	N	1	P	0.35982	0.531	B	0.35971	0.215	T	0.36311	-0.9753	10	0.52906	T	0.07	-0.6458	8.2289	0.31587	0.1089:0.0:0.8911:0.0	.	576	Q5T749	KPRP_HUMAN	N	576	ENSP00000357762:S576N	ENSP00000357762:S576N	S	+	2	0	KPRP	151000415	0.164000	0.22935	0.116000	0.21606	0.029000	0.11900	2.113000	0.41902	1.245000	0.43885	0.313000	0.20887	AGT	-	NULL		0.488	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	protein_coding	OTTHUMT00000034522.2	G	NM_001025231		151000415	+1	no_errors	NM_001025231	genbank	human	provisional	54_36p	missense	SNP	0.421	A
KMT2C	58508	genome.wustl.edu	37	7	151848574	151848574	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr7:151848574C>G	ENST00000262189.6	-	50	12837	c.12619G>C	c.(12619-12621)Gga>Cga	p.G4207R	KMT2C_ENST00000355193.2_Missense_Mutation_p.G4264R|KMT2C_ENST00000485241.1_5'Flank	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4207					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ACACCACTTCCAAGAATAACC	0.443																																																0			7											106.0	89.0	95.0					7																	151848574		2203	4300	6503	151479507	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12619G>C	7.37:g.151848574C>G	ENSP00000262189:p.Gly4207Arg	Somatic		Capture	Illumina GAIIx	4	151479507	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	PatternScan_HMGI_Y,HMMPfam_AT_hook,HMMSmart_SM00249,superfamily_FYVE/PHD zinc finger,HMMPfam_PHD,HMMSmart_SM00184,PatternScan_ZF_PHD_1,PatternScan_ATPASE_ALPHA_BETA,HMMSmart_SM00398,HMMPfam_HMG_box,HMMPfam_FYRN,HMMSmart_SM00541,HMMPfam_FYRC,HMMSmart_SM00542,superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00508	p.G4207R	ENST00000262189.6	37	c.12619	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.04|18.04	3.535075|3.535075	0.64972|0.64972	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	D;D;D|.	0.88896|.	-1.84;-1.79;-2.44|.	5.25|5.25	4.36|4.36	0.52297|0.52297	.|.	0.000000|.	0.44097|.	U|.	0.000489|.	T|T	0.73265|0.73265	0.3565|0.3565	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D;P;P|.	0.89917|.	1.0;0.736;0.736|.	D;B;B|.	0.91635|.	0.999;0.275;0.275|.	T|T	0.73751|0.73751	-0.3884|-0.3884	10|5	0.54805|.	T|.	0.06|.	.|.	15.8846|15.8846	0.79238|0.79238	0.0:0.8642:0.1358:0.0|0.0:0.8642:0.1358:0.0	.|.	4207;3325;4264|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	R|S	4207;4264;824|1767	ENSP00000262189:G4207R;ENSP00000347325:G4264R;ENSP00000410411:G824R|.	ENSP00000262189:G4207R|.	G|W	-|-	1|2	0|0	MLL3|MLL3	151479507|151479507	1.000000|1.000000	0.71417|0.71417	0.785000|0.785000	0.31869|0.31869	0.996000|0.996000	0.88848|0.88848	7.294000|7.294000	0.78760|0.78760	1.187000|1.187000	0.43000|0.43000	0.650000|0.650000	0.86243|0.86243	GGA|TGG	-	NULL		0.443	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	protein_coding	OTTHUMT00000318887.3	C			151479507	-1	no_errors	NM_170606	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PLCH1	23007	genome.wustl.edu	37	3	155267709	155267709	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr3:155267709A>T	ENST00000340059.7	-	9	1192	c.1193T>A	c.(1192-1194)aTc>aAc	p.I398N	PLCH1_ENST00000334686.6_Missense_Mutation_p.I380N|PLCH1_ENST00000494598.1_Missense_Mutation_p.I398N|PLCH1_ENST00000460012.1_Missense_Mutation_p.I380N|PLCH1_ENST00000414191.1_Missense_Mutation_p.I380N|PLCH1_ENST00000447496.2_Missense_Mutation_p.I398N	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	398	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTGCTGCTGGATACTGCAGTG	0.473																																																0			3											99.0	92.0	95.0					3																	155267709		2203	4300	6503	156750403	SO:0001583	missense	23007			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.1193T>A	3.37:g.155267709A>T	ENSP00000345988:p.Ile398Asn	Somatic		Capture	Illumina GAIIx	4	156750403	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1,superfamily_SSF47473,HMMPfam_efhand_like,HMMSmart_PLCXc,HMMPfam_PI-PLC-X,superfamily_PLC-like_Pdiesterase_TIM-brl,HMMPfam_PI-PLC-Y,HMMSmart_PLCYc,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.I380N	ENST00000340059.7	37	c.1139	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	A	27.8	4.865882	0.91511	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6	5.68	5.68	0.88126	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.391760	0.29799	N	0.011173	T	0.69006	0.3063	M	0.68317	2.08	0.53688	D	0.999976	P;D;P	0.56746	0.93;0.977;0.93	P;P;P	0.62089	0.837;0.898;0.771	T	0.71731	-0.4504	10	0.62326	D	0.03	.	15.9286	0.79644	1.0:0.0:0.0:0.0	.	380;398;398	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	N	398;380;398;398;380;380	ENSP00000419100:I398N;ENSP00000417502:I380N;ENSP00000402759:I398N;ENSP00000345988:I398N;ENSP00000335469:I380N;ENSP00000412977:I380N	ENSP00000335469:I380N	I	-	2	0	PLCH1	156750403	1.000000	0.71417	0.885000	0.34714	0.952000	0.60782	8.827000	0.92041	2.151000	0.67156	0.533000	0.62120	ATC	-	HMMSmart_PLCXc,HMMPfam_PI-PLC-X,superfamily_PLC-like_Pdiesterase_TIM-brl		0.473	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	protein_coding	OTTHUMT00000351125.1	A	NM_014996		156750403	-1	no_errors	NM_014996	genbank	human	validated	54_36p	missense	SNP	1.000	T
FAM120B	84498	genome.wustl.edu	37	6	170626612	170626612	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr6:170626612C>A	ENST00000476287.1	+	2	242	c.134C>A	c.(133-135)gCc>gAc	p.A45D	FAM120B_ENST00000252510.9_Intron|FAM120B_ENST00000537664.1_Missense_Mutation_p.A68D|FAM120B_ENST00000540480.1_Missense_Mutation_p.A57D	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	45					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.A45V(1)		endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		GTGGTTGATGCCATGTGTTGT	0.433																																																1	Substitution - Missense(1)	endometrium(1)	6											192.0	178.0	183.0					6																	170626612		2203	4300	6503	170468537	SO:0001583	missense	84498			AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.134C>A	6.37:g.170626612C>A	ENSP00000417970:p.Ala45Asp	Somatic		Capture	Illumina GAIIx	4	170468537	B4DL34|Q86V68|Q96JI9	Missense_Mutation	SNP	superfamily_PIN domain-like,PatternScan_FGGY_KINASES_1	p.A45D	ENST00000476287.1	37	c.134	CCDS5314.1	6	.	.	.	.	.	.	.	.	.	.	C	23.8	4.461897	0.84425	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287	T;T;T	0.57107	0.42;0.42;0.42	5.98	5.98	0.97165	.	0.054789	0.64402	D	0.000001	T	0.67933	0.2946	M	0.62723	1.935	0.80722	D	1	D;P	0.89917	1.0;0.824	D;P	0.79108	0.992;0.573	T	0.68337	-0.5435	10	0.87932	D	0	-28.806	20.4434	0.99119	0.0:1.0:0.0:0.0	.	45;45	Q96EK7;F2Z2E1	F120B_HUMAN;.	D	57;68;45	ENSP00000444125:A57D;ENSP00000440125:A68D;ENSP00000417970:A45D	ENSP00000436640:A45D	A	+	2	0	FAM120B	170468537	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.222000	0.58580	2.838000	0.97847	0.655000	0.94253	GCC	-	superfamily_PIN domain-like		0.433	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM120B	protein_coding	OTTHUMT00000043259.2	C	NM_032448		170468537	+1	no_errors	NM_032448	genbank	human	provisional	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	2	177065873	177065873	+	IGR	SNP	A	A	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr2:177065873A>C								HOXD1 (10185 upstream) : MTX2 (68273 downstream)																							CAACATTTACACCGGCTGCTT	0.542																																																0			2																																								176774119	SO:0001628	intergenic_variant	0																															2.37:g.177065873A>C		Somatic		Capture	Illumina GAIIx	4	176774119		Silent	SNP	HMMPfam_Ribosomal_60s	p.G36		37	c.108		2																																																																																			-	HMMPfam_Ribosomal_60s	0	0.542					RPLP1P4			A			176774119	-1	no_errors	ENST00000405359	ensembl	human	known	54_36p	silent	SNP	0.025	C
CXCR2P1	3580	genome.wustl.edu	37	2	218925694	218925694	+	RNA	SNP	A	A	C			TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr2:218925694A>C	ENST00000439871.1	-	0	686					NR_002712.1				chemokine (C-X-C motif) receptor 2 pseudogene 1																		TGCGTGTGGCATGGACAATGG	0.527																																																0			2																																								218633939			3580			M98335		2q35	2012-05-02	2010-04-14	2010-04-14	ENSG00000229754	ENSG00000229754			6028	pseudogene	pseudogene			"""interleukin 8 receptor, beta pseudogene"", ""chemokine (C-X-C motif) receptor 2 pseudogene"""	IL8RBP, CXCR2P		1427896, 1303245	Standard	NR_002712		Approved		uc002vgx.3		OTTHUMG00000155244		2.37:g.218925694A>C		Somatic		Capture	Illumina GAIIx	4	218633939		RNA	SNP	-	NULL	ENST00000439871.1	37	NULL		2																																																																																			-	-		0.527	CXCR2P1-002	KNOWN	basic	processed_transcript	IL8RBP	pseudogene	OTTHUMT00000338985.1	A	NR_002712		218633939	-1	pseudogene	NR_002712	genbank	human	provisional	54_36p	rna	SNP	0.606	C
MARC1	64757	genome.wustl.edu	37	1	220971268	220971268	+	Missense_Mutation	SNP	C	C	T	rs145144301		TCGA-36-2544-01A-01D-1526-09	TCGA-36-2544-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	43b4cb62-2673-4a89-b008-6f4543187739	7496067e-a6ab-4574-bab3-664e9237011b	g.chr1:220971268C>T	ENST00000366910.5	+	4	851	c.665C>T	c.(664-666)gCg>gTg	p.A222V	MARC1_ENST00000496110.1_3'UTR	NM_022746.3	NP_073583.3	Q5VT66	MARC1_HUMAN	mitochondrial amidoxime reducing component 1	222	MOSC. {ECO:0000255|PROSITE- ProRule:PRU00670}.				detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										GCGTCGCTGGCGGATCTCAAC	0.438																																																0			1						C	VAL/ALA	0,4406		0,0,2203	127.0	123.0	124.0		665	-0.8	0.0	1	dbSNP_134	124	1,8599	1.2+/-3.3	0,1,4299	no	missense	MOSC1	NM_022746.3	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	222/338	220971268	1,13005	2203	4300	6503	219037891	SO:0001583	missense	64757			AK026043	CCDS1526.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000186205	ENSG00000186205			26189	protein-coding gene	gene with protein product		614126	"""MOCO sulphurase C-terminal domain containing 1"""	MOSC1		11886751	Standard	NM_022746		Approved	FLJ22390	uc001hms.3	Q5VT66	OTTHUMG00000037353	ENST00000366910.5:c.665C>T	1.37:g.220971268C>T	ENSP00000355877:p.Ala222Val	Somatic		Capture	Illumina GAIIx	4	219037891	A8K447|B2D078|Q5VVS9|Q5VVT0|Q5VVT1|Q8N9P5|Q96FN8|Q9H6C7	Missense_Mutation	SNP	superfamily_PK beta-barrel domain-like,HMMPfam_MOSC_N,HMMPfam_MOSC	p.A222V	ENST00000366910.5	37	c.665	CCDS1526.1	1	.	.	.	.	.	.	.	.	.	.	C	3.303	-0.142556	0.06669	0.0	1.16E-4	ENSG00000186205	ENST00000366910;ENST00000443880	T;T	0.24350	1.86;1.86	4.82	-0.787	0.10943	Pyruvate kinase-like, insert domain (1);Molybdenum cofactor sulfurase, C-terminal (2);	0.572559	0.16223	N	0.223949	T	0.19287	0.0463	M	0.64997	1.995	0.09310	N	0.999998	B;B	0.17667	0.023;0.021	B;B	0.15484	0.013;0.013	T	0.21861	-1.0233	10	0.29301	T	0.29	-6.7738	2.7662	0.05321	0.4944:0.2545:0.1025:0.1487	.	222;222	Q5VT66-2;Q5VT66	.;MOSC1_HUMAN	V	222;35	ENSP00000355877:A222V;ENSP00000409634:A35V	ENSP00000355877:A222V	A	+	2	0	MOSC1	219037891	0.315000	0.24571	0.002000	0.10522	0.069000	0.16628	0.746000	0.26275	-0.365000	0.08076	-0.300000	0.09419	GCG	-	superfamily_PK beta-barrel domain-like,HMMPfam_MOSC		0.438	MARC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOSC1	protein_coding	OTTHUMT00000090904.1	C	NM_022746		219037891	+1	no_errors	NM_022746	genbank	human	validated	54_36p	missense	SNP	0.355	T
