#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CEP72	55722	genome.wustl.edu	37	5	647995	647995	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:647995T>A	ENST00000264935.5	+	11	1832	c.1742T>A	c.(1741-1743)aTc>aAc	p.I581N	CEP72_ENST00000444221.1_3'UTR	NM_018140.3	NP_060610.2	Q9P209	CEP72_HUMAN	centrosomal protein 72kDa	581					G2/M transition of mitotic cell cycle (GO:0000086)|gamma-tubulin complex localization (GO:0033566)|mitotic cell cycle (GO:0000278)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)				autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	20			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			TACGACAAGATCCAGGAGCTC	0.562																																																0			5											56.0	53.0	54.0					5																	647995		2201	4295	6496	700995	SO:0001583	missense	55722			BC000132	CCDS34126.1	5p15.33	2014-02-20			ENSG00000112877	ENSG00000112877			25547	protein-coding gene	gene with protein product						10819331	Standard	NM_018140		Approved	KIAA1519, FLJ10565	uc003jbf.3	Q9P209	OTTHUMG00000161745	ENST00000264935.5:c.1742T>A	5.37:g.647995T>A	ENSP00000264935:p.Ile581Asn	Somatic		Capture	Illumina GAIIx	4	700995	B4DR26|Q9BV03|Q9BWM3|Q9NVR4	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRR_1,HMMSmart_LRRcap	p.I581N	ENST00000264935.5	37	c.1742	CCDS34126.1	5	.	.	.	.	.	.	.	.	.	.	T	16.34	3.095680	0.56075	.	.	ENSG00000112877	ENST00000264935	T	0.12255	2.7	4.53	4.53	0.55603	.	0.438864	0.20167	N	0.097815	T	0.29458	0.0734	M	0.69823	2.125	0.80722	D	1	D	0.58970	0.984	P	0.57371	0.819	T	0.02860	-1.1101	10	0.87932	D	0	-11.499	10.5454	0.45058	0.0:0.0:0.0:1.0	.	581	Q9P209	CEP72_HUMAN	N	581	ENSP00000264935:I581N	ENSP00000264935:I581N	I	+	2	0	CEP72	700995	0.998000	0.40836	0.981000	0.43875	0.968000	0.65278	1.804000	0.38873	1.815000	0.52974	0.459000	0.35465	ATC	-	NULL		0.562	CEP72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP72	protein_coding	OTTHUMT00000365967.3	T	NM_018140		700995	+1	no_errors	NM_018140	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
WDR18	57418	genome.wustl.edu	37	19	991315	991315	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr19:991315C>G	ENST00000251289.5	+	7	918	c.895C>G	c.(895-897)Cag>Gag	p.Q299E	WDR18_ENST00000587001.2_Missense_Mutation_p.Q299E	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	299					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGGACGTGCAGAGCAAGCA	0.677																																																0			19											33.0	25.0	28.0					19																	991315		2168	4256	6424	942315	SO:0001583	missense	57418				CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.895C>G	19.37:g.991315C>G	ENSP00000251289:p.Gln299Glu	Somatic		Capture	Illumina GAIIx	4	942315	O60390|Q9BWR2	Missense_Mutation	SNP	superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.Q299E	ENST00000251289.5	37	c.895	CCDS12051.1	19	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062827	0.36373	.	.	ENSG00000065268	ENST00000251289	T	0.16743	2.32	3.9	2.82	0.32997	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.184904	0.48767	D	0.000167	T	0.14527	0.0351	L	0.55481	1.735	0.34402	D	0.695361	B	0.21905	0.062	B	0.24394	0.053	T	0.19160	-1.0314	10	0.06494	T	0.89	.	11.4284	0.50025	0.1886:0.8114:0.0:0.0	.	299	Q9BV38	WDR18_HUMAN	E	299	ENSP00000251289:Q299E	ENSP00000251289:Q299E	Q	+	1	0	WDR18	942315	1.000000	0.71417	0.269000	0.24586	0.435000	0.31806	5.696000	0.68287	0.788000	0.33755	0.591000	0.81541	CAG	-	superfamily_WD40_like		0.677	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR18	protein_coding	OTTHUMT00000458225.2	C			942315	+1	no_errors	NM_024100	genbank	human	reviewed	54_36p	missense	SNP	0.954	G
MUC6	4588	genome.wustl.edu	37	11	1017307	1017307	+	Missense_Mutation	SNP	G	G	A	rs372717767		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:1017307G>A	ENST00000421673.2	-	31	5544	c.5494C>T	c.(5494-5496)Cct>Tct	p.P1832S		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1832	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGGTGTGAGGGTGTGATGGG	0.552																																																0			11						G	SER/PRO	152,4250		0,152,2049	780.0	761.0	767.0		5494	-1.4	0.0	11		767	139,8451		0,139,4156	no	missense	MUC6	NM_005961.2	74	0,291,6205	AA,AG,GG		1.6182,3.453,2.2398	benign	1832/2440	1017307	291,12701	2201	4295	6496	1007307	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5494C>T	11.37:g.1017307G>A	ENSP00000406861:p.Pro1832Ser	Somatic		Capture	Illumina GAIIx	4	1007307	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,superfamily_Serine proterase inhibitors,HMMPfam_TIL,HMMSmart_SM00215,HMMSmart_SM00041	p.P1832S	ENST00000421673.2	37	c.5494	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	G	11.67	1.706398	0.30232	0.03453	0.016182	ENSG00000184956	ENST00000421673	T	0.20200	2.09	3.21	-1.4	0.08968	.	.	.	.	.	T	0.10035	0.0246	M	0.65975	2.015	0.09310	N	1	P	0.45078	0.85	P	0.51657	0.676	T	0.08868	-1.0701	9	0.35671	T	0.21	.	3.0139	0.06053	0.3177:0.0:0.3661:0.3162	.	1832	Q6W4X9	MUC6_HUMAN	S	1832	ENSP00000406861:P1832S	ENSP00000406861:P1832S	P	-	1	0	MUC6	1007307	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.644000	0.02002	-0.414000	0.07495	-0.643000	0.03959	CCT	-	NULL		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	protein_coding	OTTHUMT00000382120.2	G	XM_290540		1007307	-1	no_errors	NM_005961	genbank	human	validated	54_36p	missense	SNP	0.003	A
MUC6	4588	genome.wustl.edu	37	11	1017325	1017325	+	Missense_Mutation	SNP	A	A	C	rs55903826	byFrequency	TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:1017325A>C	ENST00000421673.2	-	31	5526	c.5476T>G	c.(5476-5478)Tat>Gat	p.Y1826D		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1826	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGGTTGGATAGGTAGTGGTG	0.552																																																0			11																																								1007325	SO:0001583	missense	4588			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5476T>G	11.37:g.1017325A>C	ENSP00000406861:p.Tyr1826Asp	Somatic		Capture	Illumina GAIIx	4	1007325	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	HMMPfam_VWD,HMMSmart_SM00216,superfamily_Serine proterase inhibitors,HMMSmart_SM00041,HMMSmart_SM00215,HMMPfam_C8,HMMPfam_TIL	p.Y1826D	ENST00000421673.2	37	c.5476	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	A	9.324	1.058685	0.19987	.	.	ENSG00000184956	ENST00000421673	T	0.18960	2.18	3.21	-6.41	0.01938	.	.	.	.	.	T	0.20251	0.0487	N	0.24115	0.695	0.09310	N	1	D	0.76494	0.999	D	0.79784	0.993	T	0.06075	-1.0847	9	0.34782	T	0.22	.	1.5268	0.02527	0.1433:0.2106:0.3334:0.3126	.	1826	Q6W4X9	MUC6_HUMAN	D	1826	ENSP00000406861:Y1826D	ENSP00000406861:Y1826D	Y	-	1	0	MUC6	1007325	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-4.881000	0.00174	-2.482000	0.00522	-0.736000	0.03550	TAT	-	NULL		0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	protein_coding	OTTHUMT00000382120.2	A	XM_290540		1007325	-1	no_errors	NM_005961	genbank	human	validated	54_36p	missense	SNP	0.000	C
NOP56	10528	genome.wustl.edu	37	20	2638646	2638646	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr20:2638646A>C	ENST00000329276.5	+	12	2007	c.1491A>C	c.(1489-1491)gaA>gaC	p.E497D	SNORA51_ENST00000606420.1_RNA|SNORD56_ENST00000413522.1_RNA|SNORD86_ENST00000391196.1_RNA|IDH3B_ENST00000488299.1_5'Flank|SNORD57_ENST00000448188.1_RNA|NOP56_ENST00000492135.1_3'UTR	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	497	Lys-rich.				cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						ATGGAATGGAAGACCCATCTA	0.458																																																0			20											58.0	71.0	67.0					20																	2638646		2193	4291	6484	2586646	SO:0001583	missense	10528			Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.1491A>C	20.37:g.2638646A>C	ENSP00000370589:p.Glu497Asp	Somatic		Capture	Illumina GAIIx	4	2586646	Q2M3T6|Q9NQ05	Missense_Mutation	SNP	HMMPfam_NOP5NT,HMMPfam_NOSIC,superfamily_SSF89124,HMMPfam_Nop	p.E497D	ENST00000329276.5	37	c.1491	CCDS13030.1	20	.	.	.	.	.	.	.	.	.	.	A	14.46	2.541063	0.45280	.	.	ENSG00000101361	ENST00000329276	T	0.41400	1.0	4.78	-1.6	0.08426	.	0.179498	0.51477	N	0.000098	T	0.21550	0.0519	N	0.24115	0.695	0.34850	D	0.741533	B	0.02656	0.0	B	0.04013	0.001	T	0.02581	-1.1138	10	0.45353	T	0.12	-19.0993	4.2865	0.10857	0.4915:0.0:0.3545:0.154	.	497	O00567	NOP56_HUMAN	D	497	ENSP00000370589:E497D	ENSP00000370589:E497D	E	+	3	2	NOP56	2586646	0.996000	0.38824	0.945000	0.38365	0.936000	0.57629	0.341000	0.19909	-0.302000	0.08869	0.528000	0.53228	GAA	-	NULL		0.458	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	protein_coding	OTTHUMT00000077631.2	A	NM_006392		2586646	+1	no_errors	NM_006392	genbank	human	reviewed	54_36p	missense	SNP	0.972	C
CRACR2A	84766	genome.wustl.edu	37	12	3765503	3765503	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:3765503C>G	ENST00000252322.1	-	9	1300	c.832G>C	c.(832-834)Gag>Cag	p.E278Q	EFCAB4B_ENST00000444507.1_Missense_Mutation_p.E278Q|EFCAB4B_ENST00000440314.2_Missense_Mutation_p.E278Q	NM_032680.3	NP_116069.1	Q9BSW2	EFC4B_HUMAN		278					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			GTGAGCTGCTCCAGCTCCTGC	0.542																																																0			12											160.0	129.0	139.0					12																	3765503		2203	4300	6503	3635764	SO:0001583	missense	84766																														ENST00000252322.1:c.832G>C	12.37:g.3765503C>G	ENSP00000252322:p.Glu278Gln	Somatic		Capture	Illumina GAIIx	4	3635764	B4E1X0|B9EK63	Missense_Mutation	SNP	superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1	p.E278Q	ENST00000252322.1	37	c.832	CCDS8522.1	12	.	.	.	.	.	.	.	.	.	.	c	21.9	4.219117	0.79464	.	.	ENSG00000130038	ENST00000440314;ENST00000444507;ENST00000252322	T;T;T	0.21932	1.98;2.62;2.59	4.87	4.87	0.63330	.	0.101589	0.64402	D	0.000003	T	0.43188	0.1236	M	0.67953	2.075	0.37318	D	0.909448	D;D;D	0.89917	1.0;0.989;0.993	D;P;P	0.66716	0.946;0.836;0.796	T	0.45145	-0.9281	10	0.41790	T	0.15	-20.4294	15.8626	0.79038	0.0:1.0:0.0:0.0	.	278;278;278	D7UEQ6;Q9BSW2-2;Q9BSW2	.;.;EFC4B_HUMAN	Q	278	ENSP00000409382:E278Q;ENSP00000412496:E278Q;ENSP00000252322:E278Q	ENSP00000252322:E278Q	E	-	1	0	EFCAB4B	3635764	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	5.120000	0.64685	2.385000	0.81259	0.556000	0.70494	GAG	-	NULL		0.542	EFCAB4B-005	KNOWN	basic|CCDS	protein_coding	EFCAB4B	protein_coding	OTTHUMT00000398673.1	C			3635764	-1	no_errors	NM_032680	genbank	human	validated	54_36p	missense	SNP	1.000	G
JAKMIP1	152789	genome.wustl.edu	37	4	6114562	6114562	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr4:6114562G>A	ENST00000282924.5	-	2	501	c.16C>T	c.(16-18)Cgg>Tgg	p.R6W	JAKMIP1_ENST00000409021.3_Missense_Mutation_p.R6W|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.R6W|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.R6W|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.R6W|JAKMIP1_ENST00000457227.2_Intron	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	6	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCCTTGCTCCGGCCTTTCTTC	0.627																																																0			4											99.0	76.0	84.0					4																	6114562		2203	4300	6503	6165463	SO:0001583	missense	152789			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.16C>T	4.37:g.6114562G>A	ENSP00000282924:p.Arg6Trp	Somatic		Capture	Illumina GAIIx	4	6165463	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	NULL	p.R6W	ENST00000282924.5	37	c.16	CCDS3385.1	4	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480083	0.63849	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.43294	1.32;1.0;1.31;1.31;0.95	3.94	3.94	0.45596	.	0.000000	0.64402	D	0.000015	T	0.62901	0.2466	M	0.74881	2.28	0.30399	N	0.780174	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.69654	0.938;0.958;0.965;0.938;0.958	T	0.67019	-0.5776	10	0.87932	D	0	.	15.1499	0.72689	0.0:0.0:1.0:0.0	.	6;6;6;6;6	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	W	6	ENSP00000386711:R6W;ENSP00000387042:R6W;ENSP00000282924:R6W;ENSP00000386925:R6W;ENSP00000386745:R6W	ENSP00000282924:R6W	R	-	1	2	JAKMIP1	6165463	1.000000	0.71417	0.998000	0.56505	0.642000	0.38348	6.181000	0.71988	2.041000	0.60428	0.591000	0.81541	CGG	-	NULL		0.627	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP1	protein_coding	OTTHUMT00000246816.2	G	NM_144720		6165463	-1	no_errors	NM_001099433	genbank	human	validated	54_36p	missense	SNP	1.000	A
LAMA1	284217	genome.wustl.edu	37	18	7050779	7050779	+	Silent	SNP	T	T	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr18:7050779T>G	ENST00000389658.3	-	4	595	c.502A>C	c.(502-504)Aga>Cga	p.R168R		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	168	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GGCCCTCGTCTTGGAGTTATA	0.512																																																0			18											124.0	102.0	109.0					18																	7050779		2203	4300	6503	7040779	SO:0001819	synonymous_variant	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.502A>C	18.37:g.7050779T>G		Somatic		Capture	Illumina GAIIx	4	7040779		Silent	SNP	HMMSmart_SM00136,HMMPfam_Laminin_N,superfamily_Galactose-binding domain-like,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_Concanavalin A-like lectins/glucanases,PatternScan_EGF_1,PatternScan_EGF_LAM_1,HMMSmart_SM00181,superfamily_EGF/Laminin,PatternScan_EGF_2,HMMSmart_SM00281,HMMPfam_Laminin_B,HMMPfam_Laminin_I,HMMPfam_Laminin_II,HMMSmart_SM00282,HMMPfam_Laminin_G_1,HMMPfam_Laminin_G_2	p.R168	ENST00000389658.3	37	c.502	CCDS32787.1	18																																																																																			-	HMMSmart_SM00136,HMMPfam_Laminin_N,superfamily_Galactose-binding domain-like		0.512	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	protein_coding	OTTHUMT00000257369.1	T	NM_005559		7040779	-1	no_errors	NM_005559	genbank	human	validated	54_36p	silent	SNP	0.977	G
RREB1	6239	genome.wustl.edu	37	6	7231272	7231272	+	Silent	SNP	T	T	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:7231272T>G	ENST00000349384.6	+	10	3254	c.2940T>G	c.(2938-2940)ccT>ccG	p.P980P	RREB1_ENST00000334984.6_Silent_p.P980P|RREB1_ENST00000379938.2_Silent_p.P980P|RREB1_ENST00000379933.3_Silent_p.P980P	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	980	Pro-rich.				multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTTCTCTTCCTGTAACTTTGG	0.677																																																0			6											18.0	21.0	20.0					6																	7231272		2203	4300	6503	7176271	SO:0001819	synonymous_variant	6239			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2940T>G	6.37:g.7231272T>G		Somatic		Capture	Illumina GAIIx	4	7176271	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Silent	SNP	HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF57667	p.P980	ENST00000349384.6	37	c.2940	CCDS34336.1	6																																																																																			-	NULL		0.677	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	protein_coding	OTTHUMT00000352985.1	T			7176271	+1	no_errors	NM_001003699	genbank	human	validated	54_36p	silent	SNP	0.002	G
PEX5	5830	genome.wustl.edu	37	12	7361136	7361136	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:7361136C>A	ENST00000455147.2	+	14	1845	c.1265C>A	c.(1264-1266)gCc>gAc	p.A422D	PEX5_ENST00000266563.5_Missense_Mutation_p.A385D|PEX5_ENST00000266564.3_Missense_Mutation_p.A414D|PEX5_ENST00000412720.2_Missense_Mutation_p.A443D|PEX5_ENST00000434354.2_Missense_Mutation_p.A437D|PEX5_ENST00000420616.2_Missense_Mutation_p.A422D	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5	422					cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						CAGCGACAGGCCTGTGAAACC	0.597																																																0			12											67.0	60.0	63.0					12																	7361136		2203	4300	6503	7252403	SO:0001583	missense	5830			U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.1265C>A	12.37:g.7361136C>A	ENSP00000400647:p.Ala422Asp	Somatic		Capture	Illumina GAIIx	4	7252403	A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	Missense_Mutation	SNP	superfamily_SSF48452,HMMSmart_TPR,HMMPfam_TPR_1	p.A414D	ENST00000455147.2	37	c.1241	CCDS44823.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.310944	0.95629	.	.	ENSG00000139197	ENST00000455147;ENST00000266563;ENST00000434354;ENST00000420616;ENST00000412720;ENST00000396637;ENST00000266564	D;D;D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81	5.31	5.31	0.75309	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.110548	0.64402	D	0.000008	D	0.96225	0.8769	M	0.88105	2.93	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	P;D;D;D;D	0.87578	0.872;0.997;0.987;0.994;0.998	D	0.96816	0.9600	10	0.87932	D	0	.	18.9623	0.92681	0.0:1.0:0.0:0.0	.	443;437;422;414;385	B4E0T2;B4DZ45;P50542;P50542-3;P50542-2	.;.;PEX5_HUMAN;.;.	D	422;385;437;422;443;392;414	ENSP00000400647:A422D;ENSP00000266563:A385D;ENSP00000407401:A437D;ENSP00000410159:A422D;ENSP00000391601:A443D;ENSP00000379877:A392D;ENSP00000266564:A414D	ENSP00000266563:A385D	A	+	2	0	PEX5	7252403	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.474000	0.83562	0.591000	0.81541	GCC	-	superfamily_SSF48452		0.597	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX5	protein_coding	OTTHUMT00000398611.1	C	NM_000319		7252403	+1	no_errors	NM_000319	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CLEC4A	50856	genome.wustl.edu	37	12	8278166	8278166	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:8278166A>G	ENST00000229332.5	+	2	339	c.92A>G	c.(91-93)gAg>gGg	p.E31G	CLEC4A_ENST00000352620.3_Missense_Mutation_p.E31G|CLEC4A_ENST00000360500.3_Intron|CLEC4A_ENST00000345999.3_Intron	NM_016184.3|NM_194447.2|NM_194450.2	NP_057268.1|NP_919429.2|NP_919432.1	Q9UMR7	CLC4A_HUMAN	C-type lectin domain family 4, member A	31					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(3)|large_intestine(2)|lung(4)|prostate(1)	11				Kidney(36;0.0915)		GCTTCCAAGGAGAGGACTGCC	0.408																																																0			12											139.0	119.0	126.0					12																	8278166		2203	4300	6503	8169433	SO:0001583	missense	50856			AJ133532	CCDS8590.1, CCDS8591.1, CCDS8592.1, CCDS41745.1	12p13	2005-02-09	2005-02-09	2005-02-09	ENSG00000111729	ENSG00000111729		"""C-type lectin domain containing"""	13257	protein-coding gene	gene with protein product		605306	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 6"""	CLECSF6		10438934	Standard	NM_016184		Approved	DCIR, DDB27	uc001qtz.1	Q9UMR7	OTTHUMG00000168571	ENST00000229332.5:c.92A>G	12.37:g.8278166A>G	ENSP00000229332:p.Glu31Gly	Somatic		Capture	Illumina GAIIx	4	8169433	Q17R69|Q8WXW9|Q9H2Z9|Q9NS33|Q9UI34	Missense_Mutation	SNP	superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1	p.E31G	ENST00000229332.5	37	c.92	CCDS8590.1	12	.	.	.	.	.	.	.	.	.	.	A	5.683	0.310505	0.10733	.	.	ENSG00000111729	ENST00000229332;ENST00000352620;ENST00000546339	T;T;T	0.54675	5.34;5.15;0.56	3.89	-0.161	0.13371	.	.	.	.	.	T	0.41259	0.1151	L	0.43923	1.385	0.09310	N	1	P;B	0.38827	0.649;0.002	B;B	0.39258	0.295;0.006	T	0.32824	-0.9892	9	0.72032	D	0.01	.	5.01	0.14308	0.4473:0.3726:0.0:0.1801	.	31;31	Q9UMR7-2;Q9UMR7	.;CLC4A_HUMAN	G	31;31;20	ENSP00000229332:E31G;ENSP00000247243:E31G;ENSP00000443082:E20G	ENSP00000229332:E31G	E	+	2	0	CLEC4A	8169433	0.004000	0.15560	0.000000	0.03702	0.038000	0.13279	0.450000	0.21762	-0.021000	0.14009	-0.291000	0.09656	GAG	-	NULL		0.408	CLEC4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4A	protein_coding	OTTHUMT00000400257.1	A	NM_194450		8169433	+1	no_errors	NM_016184	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
KAL1	3730	genome.wustl.edu	37	X	8503805	8503805	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:8503805A>G	ENST00000262648.3	-	12	1818	c.1669T>C	c.(1669-1671)Tca>Cca	p.S557P	KAL1_ENST00000481896.1_5'UTR	NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	557	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						ACGATGAATGAAGCAGAAAGG	0.493																																																0			X											100.0	81.0	87.0					X																	8503805		2203	4300	6503	8463805	SO:0001583	missense	3730				CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.1669T>C	X.37:g.8503805A>G	ENSP00000262648:p.Ser557Pro	Somatic		Capture	Illumina GAIIx	4	8463805	B2RPF8	Missense_Mutation	SNP	superfamily_WAP,HMMPfam_WAP,HMMSmart_WAP,PatternScan_4_DISULFIDE_CORE,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.S557P	ENST00000262648.3	37	c.1669	CCDS14130.1	X	.	.	.	.	.	.	.	.	.	.	A	10.09	1.255521	0.22965	.	.	ENSG00000011201	ENST00000262648	T	0.60299	0.2	4.3	4.3	0.51218	Fibronectin, type III (3);	0.130816	0.53938	D	0.000057	T	0.63022	0.2476	L	0.40543	1.245	0.26126	N	0.980483	D	0.62365	0.991	D	0.71656	0.974	T	0.53718	-0.8399	10	0.48119	T	0.1	-14.4357	7.7638	0.28968	0.8111:0.0:0.0:0.1889	.	557	P23352	KALM_HUMAN	P	557	ENSP00000262648:S557P	ENSP00000262648:S557P	S	-	1	0	KAL1	8463805	0.984000	0.35163	0.010000	0.14722	0.046000	0.14306	2.783000	0.47766	1.404000	0.46819	0.417000	0.27973	TCA	-	HMMSmart_FN3,HMMPfam_fn3		0.493	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAL1	protein_coding	OTTHUMT00000055692.1	A	NM_000216		8463805	-1	no_errors	NM_000216	genbank	human	reviewed	54_36p	missense	SNP	0.948	G
PMM2	5373	genome.wustl.edu	37	16	8898695	8898695	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr16:8898695A>G	ENST00000268261.4	+	3	316	c.250A>G	c.(250-252)Aga>Gga	p.R84G	PMM2_ENST00000537352.1_Intron|PMM2_ENST00000569958.1_Intron|PMM2_ENST00000566983.1_Missense_Mutation_p.R57G|PMM2_ENST00000539622.1_Intron	NM_000303.2	NP_000294.1	O15305	PMM2_HUMAN	phosphomannomutase 2	84					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)	phosphomannomutase activity (GO:0004615)			breast(3)|cervix(1)|endometrium(2)|large_intestine(1)|ovary(1)|skin(1)	9						ACTCTTGTGTAGACAGGTAGG	0.353																																					Esophageal Squamous(154;1308 1842 2827 29799 42829)											0			16											112.0	108.0	109.0					16																	8898695		2197	4300	6497	8806196	SO:0001583	missense	5373			BC008310	CCDS10536.1	16p13	2012-09-06			ENSG00000140650	ENSG00000140650	5.3.1.8		9115	protein-coding gene	gene with protein product	"""phosphomannose isomerase 1"""	601785		CDG1		9140401	Standard	NM_000303		Approved	CDGS, CDG1a, PMI, PMI1	uc002czf.4	O15305	OTTHUMG00000129697	ENST00000268261.4:c.250A>G	16.37:g.8898695A>G	ENSP00000268261:p.Arg84Gly	Somatic		Capture	Illumina GAIIx	4	8806196	A8K672|B7Z6R0|D3DUF3	Missense_Mutation	SNP	superfamily_HAD-like,HMMPfam_PMM	p.R84G	ENST00000268261.4	37	c.250	CCDS10536.1	16	.	.	.	.	.	.	.	.	.	.	A	11.90	1.776647	0.31411	.	.	ENSG00000140650	ENST00000268261	D	0.98419	-4.92	5.73	5.73	0.89815	HAD-like domain (1);	0.153262	0.64402	D	0.000018	D	0.96052	0.8714	L	0.31926	0.97	0.80722	D	1	B;B	0.24823	0.112;0.007	B;B	0.30646	0.118;0.057	D	0.94323	0.7555	10	0.31617	T	0.26	.	15.1963	0.73092	1.0:0.0:0.0:0.0	.	84;84	B7Z3M6;O15305	.;PMM2_HUMAN	G	84	ENSP00000268261:R84G	ENSP00000268261:R84G	R	+	1	2	PMM2	8806196	1.000000	0.71417	0.996000	0.52242	0.295000	0.27426	4.409000	0.59768	2.180000	0.69256	0.533000	0.62120	AGA	-	superfamily_HAD-like,HMMPfam_PMM		0.353	PMM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMM2	protein_coding	OTTHUMT00000251904.1	A	NM_000303		8806196	+1	no_errors	NM_000303	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
IL17RC	84818	genome.wustl.edu	37	3	9975017	9975017	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr3:9975017G>C	ENST00000295981.3	+	19	2334	c.2116G>C	c.(2116-2118)Gac>Cac	p.D706H	IL17RC_ENST00000403601.3_Missense_Mutation_p.D635H|RP11-1020A11.1_ENST00000602411.1_RNA|CRELD1_ENST00000397170.3_5'Flank|CRELD1_ENST00000452070.1_5'Flank|IL17RC_ENST00000413608.1_Missense_Mutation_p.D622H|CRELD1_ENST00000383811.3_5'Flank|IL17RC_ENST00000498214.1_3'UTR|IL17RC_ENST00000383812.4_Missense_Mutation_p.D620H|IL17RC_ENST00000416074.2_Missense_Mutation_p.D461H|IL17RC_ENST00000455057.1_Missense_Mutation_p.D603H|CRELD1_ENST00000326434.5_5'Flank	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	706	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GGCCTGCTTCGACAGGCTGCT	0.721																																																0			3											11.0	13.0	12.0					3																	9975017		2179	4253	6432	9950017	SO:0001583	missense	84818			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.2116G>C	3.37:g.9975017G>C	ENSP00000295981:p.Asp706His	Somatic		Capture	Illumina GAIIx	4	9950017	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	HMMPfam_SEFIR	p.D706H	ENST00000295981.3	37	c.2116	CCDS2590.1	3	.	.	.	.	.	.	.	.	.	.	G	18.48	3.634244	0.67130	.	.	ENSG00000163702	ENST00000383812;ENST00000295981;ENST00000403601;ENST00000416074;ENST00000455057;ENST00000413608	T;T;T;T;T	0.50813	1.73;1.72;1.73;0.73;1.73	5.05	5.05	0.67936	SEFIR (1);	0.355351	0.25851	N	0.027881	T	0.60805	0.2297	L	0.47716	1.5	0.32684	N	0.515064	D;P;P;D;D;P;D;D	0.76494	0.999;0.778;0.778;0.999;0.999;0.737;0.994;0.983	D;B;P;D;D;B;D;P	0.70935	0.951;0.377;0.472;0.971;0.971;0.341;0.947;0.829	T	0.70142	-0.4953	10	0.72032	D	0.01	-12.2448	13.9224	0.63940	0.0:0.0:1.0:0.0	.	461;603;605;622;461;620;706;635	F5H4Z2;E9PHG1;A8BWD5;E9PHJ6;B4E008;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;I17RC_HUMAN;.	H	620;706;635;461;603;622	ENSP00000373323:D620H;ENSP00000295981:D706H;ENSP00000384969:D635H;ENSP00000407894:D603H;ENSP00000396064:D622H	ENSP00000295981:D706H	D	+	1	0	IL17RC	9950017	0.969000	0.33509	0.989000	0.46669	0.519000	0.34347	2.533000	0.45667	2.355000	0.79922	0.555000	0.69702	GAC	-	HMMPfam_SEFIR		0.721	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL17RC	protein_coding	OTTHUMT00000250526.2	G	NM_032732		9950017	+1	no_errors	NM_153461	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
NPPB	4879	genome.wustl.edu	37	1	11918474	11918474	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:11918474G>A	ENST00000376468.3	-	2	282	c.185C>T	c.(184-186)aCa>aTa	p.T62I		NM_002521.2	NP_002512.1	P16860	ANFB_HUMAN	natriuretic peptide B	62					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|protein complex (GO:0043234)	diuretic hormone activity (GO:0008613)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)	CTCCAGGGATGTCTGCTCCAC	0.652																																																0			1											25.0	27.0	26.0					1																	11918474		2203	4299	6502	11841061	SO:0001583	missense	4879			BC025785	CCDS140.1	1p36.2	2014-01-30	2010-11-09		ENSG00000120937	ENSG00000120937		"""Endogenous ligands"""	7940	protein-coding gene	gene with protein product		600295	"""natriuretic peptide precursor B"""			2597152	Standard	NM_002521		Approved		uc001atj.3	P16860	OTTHUMG00000002389	ENST00000376468.3:c.185C>T	1.37:g.11918474G>A	ENSP00000365651:p.Thr62Ile	Somatic		Capture	Illumina GAIIx	4	11841061	B0ZBE9|Q6FGY0|Q9P2Q7	Missense_Mutation	SNP	HMMPfam_ANP,HMMSmart_NAT_PEP,PatternScan_NATRIURETIC_PEPTIDE	p.T62I	ENST00000376468.3	37	c.185	CCDS140.1	1	.	.	.	.	.	.	.	.	.	.	G	2.183	-0.387132	0.04932	.	.	ENSG00000120937	ENST00000376468	T	0.23552	1.9	4.31	-8.61	0.00885	.	.	.	.	.	T	0.10294	0.0252	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29150	-1.0021	9	0.30078	T	0.28	.	6.6387	0.22897	0.1684:0.1268:0.5799:0.1249	.	62	P16860	ANFB_HUMAN	I	62	ENSP00000365651:T62I	ENSP00000365651:T62I	T	-	2	0	NPPB	11841061	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.584000	0.05800	-1.846000	0.01175	-2.677000	0.00143	ACA	-	HMMPfam_ANP		0.652	NPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPPB	protein_coding	OTTHUMT00000006854.1	G	NM_002521		11841061	-1	no_errors	NM_002521	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
NBAS	51594	genome.wustl.edu	37	2	15557673	15557673	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:15557673T>G	ENST00000281513.5	-	24	2766	c.2741A>C	c.(2740-2742)aAa>aCa	p.K914T	NBAS_ENST00000441750.1_Intron	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	914					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TAATCTTAGTTTTTCAATGTC	0.328																																																0			2											75.0	69.0	71.0					2																	15557673		2203	4300	6503	15475124	SO:0001583	missense	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2741A>C	2.37:g.15557673T>G	ENSP00000281513:p.Lys914Thr	Somatic		Capture	Illumina GAIIx	4	15475124	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMPfam_Sec39,PatternScan_RIBOSOMAL_S14	p.K914T	ENST00000281513.5	37	c.2741	CCDS1685.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.344981|4.344981	0.82022|0.82022	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000429842|ENST00000281513	.|T	.|0.17691	.|2.26	5.72|5.72	5.72|5.72	0.89469|0.89469	.|Secretory pathway Sec39 (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.34745|0.34745	0.0908|0.0908	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	.|P	.|0.38223	.|0.623	.|P	.|0.47786	.|0.557	T|T	0.09207|0.09207	-1.0685|-1.0685	6|10	.|0.87932	.|D	.|0	.|.	15.9942|15.9942	0.80228|0.80228	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|914	.|A2RRP1	.|NBAS_HUMAN	N|T	11|914	.|ENSP00000281513:K914T	.|ENSP00000281513:K914T	K|K	-|-	3|2	2|0	NBAS|NBAS	15475124|15475124	1.000000|1.000000	0.71417|0.71417	0.959000|0.959000	0.39883|0.39883	0.889000|0.889000	0.51656|0.51656	7.579000|7.579000	0.82511|0.82511	2.193000|2.193000	0.70182|0.70182	0.477000|0.477000	0.44152|0.44152	AAA|AAA	-	HMMPfam_Sec39		0.328	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	protein_coding	OTTHUMT00000241638.1	T	NM_015909		15475124	-1	no_errors	NM_015909	genbank	human	validated	54_36p	missense	SNP	1.000	G
CTPS2	56474	genome.wustl.edu	37	X	16688749	16688749	+	Silent	SNP	T	T	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:16688749T>C	ENST00000443824.1	-	11	1886	c.1143A>G	c.(1141-1143)aaA>aaG	p.K381K	CTPS2_ENST00000359276.4_Silent_p.K381K|CTPS2_ENST00000380241.3_Silent_p.K381K	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	381	Glutamine amidotransferase type-1. {ECO:0000255|PROSITE-ProRule:PRU00605}.				'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					TCGCCTGGAGTTTTCCCAATG	0.363																																																0			X											137.0	132.0	134.0					X																	16688749		2203	4300	6503	16598670	SO:0001819	synonymous_variant	56474			AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.1143A>G	X.37:g.16688749T>C		Somatic		Capture	Illumina GAIIx	4	16598670	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_CTP_synth_N,superfamily_Class I glutamine amidotransferase-like,HMMPfam_GATase	p.K381	ENST00000443824.1	37	c.1143	CCDS14175.1	X	.	.	.	.	.	.	.	.	.	.	T	10.48	1.360682	0.24598	.	.	ENSG00000047230	ENST00000455276	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	T	0.63686	0.2532	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62789	-0.6780	4	.	.	.	-20.9984	11.7663	0.51933	0.0:0.0:0.0:1.0	.	.	.	.	S	3	.	.	N	-	2	0	CTPS2	16598670	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.035000	0.57297	1.763000	0.52060	0.486000	0.48141	AAC	-	superfamily_Class I glutamine amidotransferase-like,HMMPfam_GATase		0.363	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS2	protein_coding	OTTHUMT00000055906.1	T	NM_019857		16598670	-1	no_errors	NM_019857	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
PEX26	55670	genome.wustl.edu	37	22	18570811	18570811	+	Silent	SNP	T	T	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr22:18570811T>G	ENST00000329627.7	+	6	1094	c.888T>G	c.(886-888)tcT>tcG	p.S296S	PEX26_ENST00000428061.2_Silent_p.S247S|PEX26_ENST00000399744.3_Silent_p.S296S	NM_017929.5	NP_060399.1	Q7Z412	PEX26_HUMAN	peroxisomal biogenesis factor 26	296					protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)	integral component of peroxisomal membrane (GO:0005779)|peroxisome (GO:0005777)	ATPase binding (GO:0051117)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|kidney(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CTGCATTTTCTCGCCTCTACC	0.617																																																0			22											190.0	155.0	167.0					22																	18570811		2203	4300	6503	16950811	SO:0001819	synonymous_variant	55670			AB089678	CCDS13750.1, CCDS56221.1	22q11.21	2008-08-26	2008-08-26		ENSG00000215193	ENSG00000215193			22965	protein-coding gene	gene with protein product		608666	"""peroxisome biogenesis factor 26"""			12717447, 12851857	Standard	NM_017929		Approved	FLJ20695	uc002znp.4	Q7Z412	OTTHUMG00000149970	ENST00000329627.7:c.888T>G	22.37:g.18570811T>G		Somatic		Capture	Illumina GAIIx	4	16950811	F6UBB5|Q7Z413|Q7Z414|Q7Z415|Q7Z416|Q96B12|Q9NWQ0|Q9NXU0	Missense_Mutation	SNP	HMMPfam_Pex26	p.L295R	ENST00000329627.7	37	c.884	CCDS13750.1	22	.	.	.	.	.	.	.	.	.	.	T	8.629	0.893176	0.17613	.	.	ENSG00000215193	ENST00000399746	.	.	.	5.48	-0.356	0.12583	.	.	.	.	.	T	0.36166	0.0957	.	.	.	0.26431	N	0.975947	.	.	.	.	.	.	T	0.35724	-0.9777	5	0.56958	D	0.05	0.104	5.1701	0.15105	0.0:0.319:0.1491:0.5319	.	.	.	.	R	296	.	ENSP00000382650:L296R	L	+	2	0	PEX26	16950811	0.009000	0.17119	0.001000	0.08648	0.207000	0.24258	0.386000	0.20702	-0.175000	0.10725	0.454000	0.30748	CTC	-	HMMPfam_Pex26		0.617	PEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX26	protein_coding	OTTHUMT00000314644.3	T	NM_017929		16950811	+1	no_errors	ENST00000399746	ensembl	human	known	54_36p	missense	SNP	0.007	G
RRBP1	6238	genome.wustl.edu	37	20	17606168	17606168	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr20:17606168C>G	ENST00000377813.1	-	12	3346	c.3043G>C	c.(3043-3045)Gtg>Ctg	p.V1015L	RRBP1_ENST00000246043.4_Missense_Mutation_p.V1015L|RRBP1_ENST00000470422.1_5'Flank|RRBP1_ENST00000377807.2_Missense_Mutation_p.V582L|RRBP1_ENST00000360807.4_Missense_Mutation_p.V582L|RRBP1_ENST00000455029.2_Missense_Mutation_p.V356L			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	1015					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TTGTTCTTCACTTTCTGCTGC	0.642																																																0			20											158.0	116.0	130.0					20																	17606168		2203	4300	6503	17554168	SO:0001583	missense	6238			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.3043G>C	20.37:g.17606168C>G	ENSP00000367044:p.Val1015Leu	Somatic		Capture	Illumina GAIIx	4	17554168	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	HMMPfam_Rib_recp_KP_reg	p.V582L	ENST00000377813.1	37	c.1744		20	.	.	.	.	.	.	.	.	.	.	C	11.37	1.617836	0.28801	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14	5.15	-0.321	0.12717	.	1.348970	0.05433	N	0.546258	T	0.10121	0.0248	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.32428	-0.9907	10	0.27082	T	0.32	-1.6904	5.1744	0.15127	0.0:0.5107:0.145:0.3443	.	582	Q9P2E9-3	.	L	582;1015;582;1015;356	ENSP00000354045:V582L;ENSP00000367044:V1015L;ENSP00000367038:V582L;ENSP00000246043:V1015L;ENSP00000401206:V356L	ENSP00000246043:V1015L	V	-	1	0	RRBP1	17554168	0.000000	0.05858	0.699000	0.30290	0.959000	0.62525	-0.116000	0.10724	0.300000	0.22699	0.511000	0.50034	GTG	-	NULL		0.642	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	protein_coding	OTTHUMT00000078125.1	C	NM_001042576		17554168	-1	no_errors	NM_001042576	genbank	human	reviewed	54_36p	missense	SNP	0.007	G
MAP1S	55201	genome.wustl.edu	37	19	17838345	17838345	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr19:17838345A>T	ENST00000324096.4	+	5	2303	c.2152A>T	c.(2152-2154)Agc>Tgc	p.S718C	MAP1S_ENST00000597681.1_3'UTR|MAP1S_ENST00000544059.2_Missense_Mutation_p.S692C|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	718	Necessary for association with microtubules.|Necessary for interaction with RASSF1 isoform A and isoform C.|Necessary for the microtubule-organizing center localization.|Pro-rich.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						GGCTGGGCTGAGCCTCCCGCT	0.687																																																0			19											18.0	16.0	17.0					19																	17838345		2199	4296	6495	17699345	SO:0001583	missense	55201			BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.2152A>T	19.37:g.17838345A>T	ENSP00000325313:p.Ser718Cys	Somatic		Capture	Illumina GAIIx	4	17699345	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	NULL	p.S718C	ENST00000324096.4	37	c.2152	CCDS32954.1	19	.	.	.	.	.	.	.	.	.	.	A	15.67	2.901752	0.52227	.	.	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.19938	2.11;2.11	4.44	3.4	0.38934	.	0.000000	0.64402	D	0.000012	T	0.19327	0.0464	L	0.58101	1.795	0.31323	N	0.685789	B;B	0.18166	0.009;0.026	B;B	0.17098	0.017;0.017	T	0.14476	-1.0471	10	0.87932	D	0	-29.3196	5.1532	0.15021	0.6313:0.1878:0.0:0.1808	.	692;718	B4DH53;Q66K74	.;MAP1S_HUMAN	C	718;692	ENSP00000325313:S718C;ENSP00000439243:S692C	ENSP00000325313:S718C	S	+	1	0	MAP1S	17699345	0.000000	0.05858	0.931000	0.37212	0.540000	0.34992	0.202000	0.17295	0.533000	0.28675	0.397000	0.26171	AGC	-	NULL		0.687	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1S	protein_coding	OTTHUMT00000466027.1	A	NM_018174		17699345	+1	no_errors	NM_018174	genbank	human	validated	54_36p	missense	SNP	0.015	T
TOP3A	7156	genome.wustl.edu	37	17	18181361	18181361	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr17:18181361C>A	ENST00000321105.5	-	18	2669	c.2455G>T	c.(2455-2457)Gct>Tct	p.A819S	TOP3A_ENST00000542570.1_Missense_Mutation_p.A724S|TOP3A_ENST00000540524.1_Missense_Mutation_p.A349S	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	819	2 X 27 AA approximate repeats.				DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						AGCAGCACAGCCTCCTGGCCA	0.612																																																0			17											47.0	49.0	48.0					17																	18181361		2203	4300	6503	18122086	SO:0001583	missense	7156			U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.2455G>T	17.37:g.18181361C>A	ENSP00000321636:p.Ala819Ser	Somatic		Capture	Illumina GAIIx	4	18122086	A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	superfamily_Prokaryotic type I DNA topoisomerase,HMMSmart_SM00493,HMMPfam_Toprim,HMMSmart_SM00436,HMMPfam_Topoisom_bac,HMMSmart_SM00437,PatternScan_TOPOISOMERASE_I_PROK,superfamily_Zinc beta-ribbon,HMMPfam_zf-C4_Topoisom,HMMPfam_zf-GRF,PatternScan_AA_TRNA_LIGASE_I	p.A819S	ENST00000321105.5	37	c.2455	CCDS11194.1	17	.	.	.	.	.	.	.	.	.	.	C	17.56	3.420485	0.62622	.	.	ENSG00000177302	ENST00000321105;ENST00000540524;ENST00000542570	T;T;T	0.25579	1.79;1.79;1.79	5.55	5.55	0.83447	Zinc finger, GRF-type (1);	0.000000	0.85682	D	0.000000	T	0.47967	0.1474	M	0.64630	1.985	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.62298	0.9;0.9	T	0.29274	-1.0017	10	0.42905	T	0.14	-21.5771	19.4999	0.95090	0.0:1.0:0.0:0.0	.	724;819	B4DK80;Q13472	.;TOP3A_HUMAN	S	819;349;724	ENSP00000321636:A819S;ENSP00000446425:A349S;ENSP00000442336:A724S	ENSP00000321636:A819S	A	-	1	0	TOP3A	18122086	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.529000	0.81952	2.621000	0.88768	0.549000	0.68633	GCT	-	HMMPfam_zf-GRF		0.612	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP3A	protein_coding	OTTHUMT00000132052.2	C			18122086	-1	no_errors	NM_004618	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	9	19200506	19200506	+	IGR	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr9:19200506A>G								PLIN2 (51218 upstream) : DENND4C (29926 downstream)																							AGAGCAATACACCGCCGTTTG	0.448																																																0			9																																								19190506	SO:0001628	intergenic_variant	253482																															9.37:g.19200506A>G		Somatic		Capture	Illumina GAIIx	4	19190506		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.448					LOC253482			A			19190506	-1	pseudogene	XR_016415	genbank	human	model	54_36p	rna	SNP	1.000	G
AKR7L	246181	genome.wustl.edu	37	1	19593797	19593797	+	RNA	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:19593797G>A	ENST00000429712.1	-	0	1112				AKR7L_ENST00000420396.2_RNA			Q8NHP1	ARK74_HUMAN	aldo-keto reductase family 7-like							extracellular vesicular exosome (GO:0070062)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|ovary(1)|prostate(1)|urinary_tract(1)	6						AATGAGCTTAGATGAAGTAGT	0.512																																																0			1											72.0	76.0	75.0					1																	19593797		2203	4300	6503	19466384			246181					1p36.1-p35	2008-12-09			ENSG00000211454	ENSG00000211454			24056	protein-coding gene	gene with protein product		608478				12879023	Standard	NR_040288		Approved	AFAR3	uc021ohn.1	Q8NHP1	OTTHUMG00000002520		1.37:g.19593797G>A		Somatic		Capture	Illumina GAIIx	4	19466384	Q5U614	Silent	SNP	superfamily_Aldo/ket_red	p.I153	ENST00000429712.1	37	c.459		1																																																																																			-	superfamily_Aldo/ket_red		0.512	AKR7L-001	KNOWN	basic	polymorphic_pseudogene	AKR7L	polymorphic_pseudogene	OTTHUMT00000007163.3	G	NM_201252		19466384	-1	no_errors	NM_201252	genbank	human	reviewed	54_36p	silent	SNP	0.996	A
ZNF101	94039	genome.wustl.edu	37	19	19790530	19790530	+	Silent	SNP	T	T	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr19:19790530T>A	ENST00000592502.1	+	4	842	c.732T>A	c.(730-732)gtT>gtA	p.V244V	ZNF101_ENST00000444249.2_3'UTR|ZNF101_ENST00000415784.2_Silent_p.V124V			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	244					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						AAATTCATGTTAGAACTCACA	0.373																																																0			19											32.0	32.0	32.0					19																	19790530		2203	4300	6503	19651530	SO:0001819	synonymous_variant	94039			AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.732T>A	19.37:g.19790530T>A		Somatic		Capture	Illumina GAIIx	4	19651530	C9JU83|Q0VDG9	Silent	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_ZnF_C2H2	p.V244	ENST00000592502.1	37	c.732	CCDS32971.1	19																																																																																			-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.373	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF101	protein_coding	OTTHUMT00000460559.1	T	NM_033204		19651530	+1	no_errors	NM_033204	genbank	human	provisional	54_36p	silent	SNP	0.030	A
LAMA3	3909	genome.wustl.edu	37	18	21519187	21519187	+	Splice_Site	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr18:21519187C>G	ENST00000313654.9	+	68	9104	c.8863C>G	c.(8863-8865)Ctg>Gtg	p.L2955V	LAMA3_ENST00000399516.3_Splice_Site_p.L2899V|LAMA3_ENST00000269217.6_Splice_Site_p.L1346V|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000587184.1_Splice_Site_p.L1290V	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2955					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TCCCATGCAGCTGTTGCAGGA	0.498																																																0			18											98.0	96.0	96.0					18																	21519187		2203	4300	6503	19773185	SO:0001630	splice_region_variant	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8863-1C>G	18.37:g.21519187C>G		Somatic		Capture	Illumina GAIIx	4	19773185	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	HMMSmart_SM00136,HMMPfam_Laminin_N,superfamily_Galactose-binding domain-like,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_LAM_1,HMMSmart_SM00181,HMMSmart_SM00281,HMMPfam_Laminin_B,PatternScan_EGF_2,HMMPfam_Laminin_I,HMMPfam_Laminin_II,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,PatternScan_CHAPERONINS_CPN60	p.L2955V	ENST00000313654.9	37	c.8863	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	C	8.325	0.825289	0.16749	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.18174	2.24;2.23;3.8	5.28	4.41	0.53225	.	.	.	.	.	T	0.10680	0.0261	N	0.24115	0.695	0.37058	D	0.897938	B;B;B;B	0.28378	0.172;0.209;0.009;0.105	B;B;B;B	0.24394	0.039;0.053;0.006;0.022	T	0.22765	-1.0207	8	.	.	.	.	10.0391	0.42146	0.0:0.9065:0.0:0.0935	.	1290;1346;2899;2955	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	V	2955;2899;1346	ENSP00000324532:L2955V;ENSP00000382432:L2899V;ENSP00000269217:L1346V	.	L	+	1	2	LAMA3	19773185	0.602000	0.26916	0.855000	0.33649	0.488000	0.33401	0.591000	0.23969	1.363000	0.46019	0.561000	0.74099	CTG	-	NULL		0.498	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	protein_coding	OTTHUMT00000254824.3	C	NM_000227, NM_198129	Missense_Mutation	19773185	+1	no_errors	NM_198129	genbank	human	reviewed	54_36p	missense	SNP	0.595	G
MBOAT1	154141	genome.wustl.edu	37	6	20151460	20151460	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:20151460C>A	ENST00000324607.7	-	3	443	c.279G>T	c.(277-279)atG>atT	p.M93I	MBOAT1_ENST00000536798.1_Missense_Mutation_p.M93I|MBOAT1_ENST00000541730.1_5'UTR	NM_001080480.1	NP_001073949.1	Q6ZNC8	MBOA1_HUMAN	membrane bound O-acyltransferase domain containing 1	93					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(5)	20	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)			TTGCATAGCACATTAACACCA	0.363																																																0			6											154.0	134.0	141.0					6																	20151460		2203	4300	6503	20259439	SO:0001583	missense	154141			AK093994	CCDS34346.1	6p22.3	2013-10-11	2006-06-29	2006-06-29	ENSG00000172197	ENSG00000172197			21579	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 1"""	611732	"""O-acyltransferase (membrane bound) domain containing 1"""	OACT1		18287005	Standard	NM_001080480		Approved	MGC44669, dJ434O11.1, LPEAT1	uc003ncx.2	Q6ZNC8	OTTHUMG00000014334	ENST00000324607.7:c.279G>T	6.37:g.20151460C>A	ENSP00000324944:p.Met93Ile	Somatic		Capture	Illumina GAIIx	4	20259439	A9EDQ5|B4DL59|B4E3J4|Q86XC2|Q8N9R5	Missense_Mutation	SNP	HMMPfam_MBOAT	p.M93I	ENST00000324607.7	37	c.279	CCDS34346.1	6	.	.	.	.	.	.	.	.	.	.	C	0.504	-0.869776	0.02570	.	.	ENSG00000172197	ENST00000324607;ENST00000536798	T;T	0.18810	2.97;2.19	5.69	3.59	0.41128	.	0.396053	0.33144	N	0.005228	T	0.02083	0.0065	N	0.04508	-0.205	0.27592	N	0.949243	B	0.02656	0.0	B	0.01281	0.0	T	0.45160	-0.9280	10	0.02654	T	1	-22.7531	9.965	0.41719	0.0:0.768:0.0:0.232	.	93	Q6ZNC8	MBOA1_HUMAN	I	93	ENSP00000324944:M93I;ENSP00000439814:M93I	ENSP00000324944:M93I	M	-	3	0	MBOAT1	20259439	0.154000	0.22792	0.998000	0.56505	0.705000	0.40729	0.132000	0.15891	1.392000	0.46585	0.650000	0.86243	ATG	-	NULL		0.363	MBOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT1	protein_coding	OTTHUMT00000039980.1	C			20259439	-1	no_errors	NM_001080480	genbank	human	provisional	54_36p	missense	SNP	0.815	A
ZNF70	7621	genome.wustl.edu	37	22	24086677	24086677	+	Silent	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr22:24086677G>A	ENST00000341976.3	-	2	1111	c.651C>T	c.(649-651)atC>atT	p.I217I		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						TTCCGGTGTGGATCTTTTGGT	0.577																																																0			22											58.0	49.0	52.0					22																	24086677		2203	4300	6503	22416677	SO:0001819	synonymous_variant	7621			X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.651C>T	22.37:g.24086677G>A		Somatic		Capture	Illumina GAIIx	4	22416677		Silent	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.I217	ENST00000341976.3	37	c.651	CCDS13812.1	22																																																																																			-	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.577	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF70	protein_coding	OTTHUMT00000319881.1	G	NM_021916		22416677	-1	no_errors	NM_021916	genbank	human	provisional	54_36p	silent	SNP	0.457	A
BCL2L2	599	genome.wustl.edu	37	14	23777076	23777076	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr14:23777076G>T	ENST00000250405.5	+	3	329	c.100G>T	c.(100-102)Ggg>Tgg	p.G34W	BCL2L2-PABPN1_ENST00000553781.1_Missense_Mutation_p.G34W|BCL2L2-PABPN1_ENST00000557008.1_Missense_Mutation_p.G34W	NM_001199839.1|NM_004050.4	NP_001186768.1|NP_004041	Q92843	B2CL2_HUMAN	BCL2-like 2	34					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|Sertoli cell proliferation (GO:0060011)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|lung(4)|prostate(1)	6	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00654)		AGCTGGCCCCGGGGAGGGCCC	0.642																																																0			14											37.0	40.0	39.0					14																	23777076		2203	4298	6501	22846916	SO:0001583	missense	599			D87461	CCDS9591.1	14q11.2-q12	2014-03-07			ENSG00000129473	ENSG00000129473		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	995	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 51"""	601931				8761287	Standard	NM_001199839		Approved	KIAA0271, BCL-W, PPP1R51		Q92843	OTTHUMG00000028738	ENST00000250405.5:c.100G>T	14.37:g.23777076G>T	ENSP00000250405:p.Gly34Trp	Somatic		Capture	Illumina GAIIx	4	22846916	A8K0F4|Q2M3U0|Q5U0H4	Missense_Mutation	SNP	superfamily_Bcl-2 inhibitors of programmed cell death,HMMPfam_BH4,HMMSmart_SM00265,PatternScan_BH4_1,HMMPfam_Bcl-2,HMMSmart_SM00337,PatternScan_BH1,PatternScan_BH2	p.G34W	ENST00000250405.5	37	c.100	CCDS9591.1	14	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059882	0.55325	.	.	ENSG00000129473;ENSG00000129473;ENSG00000129473;ENSG00000129473;ENSG00000129473;ENSG00000258643;ENSG00000258643;ENSG00000258643	ENST00000553824;ENST00000250405;ENST00000557236;ENST00000557579;ENST00000554635;ENST00000553781;ENST00000556100;ENST00000557008	T;T;T;T;T;T	0.49432	0.78;1.8;1.84;2.83;0.78;2.83	5.73	5.73	0.89815	.	0.099013	0.42964	D	0.000625	T	0.63803	0.2542	L	0.48642	1.525	0.36065	D	0.841735	D;D	0.89917	1.0;0.998	D;D	0.79108	0.992;0.929	T	0.70525	-0.4848	10	0.87932	D	0	-12.8585	17.3963	0.87446	0.0:0.0:1.0:0.0	.	34;34	G3V5R7;Q92843	.;B2CL2_HUMAN	W	34	ENSP00000250405:G34W;ENSP00000451701:G34W;ENSP00000452265:G34W;ENSP00000451320:G34W;ENSP00000450916:G34W;ENSP00000452479:G34W	ENSP00000250405:G34W	G	+	1	0	RP11-124D2.2;BCL2L2	22846916	0.701000	0.27806	0.996000	0.52242	0.814000	0.46013	1.695000	0.37763	2.722000	0.93159	0.655000	0.94253	GGG	-	superfamily_Bcl-2 inhibitors of programmed cell death		0.642	BCL2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L2	protein_coding	OTTHUMT00000071763.3	G	NM_004050		22846916	+1	no_errors	NM_004050	genbank	human	reviewed	54_36p	missense	SNP	0.988	T
SRRM1	10250	genome.wustl.edu	37	1	24995972	24995972	+	Missense_Mutation	SNP	G	G	A	rs142386020		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:24995972G>A	ENST00000323848.9	+	14	2413	c.2098G>A	c.(2098-2100)Gtt>Att	p.V700I	SRRM1_ENST00000374389.4_Missense_Mutation_p.V709I|SRRM1_ENST00000447431.2_Missense_Mutation_p.V712I|snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000479034.1_3'UTR	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	700	Arg-rich.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		TCCTCCACCCGTTCGAAGAGG	0.582																																					Ovarian(68;897 1494 3282 17478)											0			1						G	ILE/VAL	0,4406		0,0,2203	54.0	50.0	51.0		2098	3.9	0.5	1	dbSNP_134	51	1,8599	1.2+/-3.3	0,1,4299	no	missense	SRRM1	NM_005839.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	700/905	24995972	1,13005	2203	4300	6503	24868559	SO:0001583	missense	10250			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.2098G>A	1.37:g.24995972G>A	ENSP00000326261:p.Val700Ile	Somatic		Capture	Illumina GAIIx	4	24868559	O60585|Q5VVN4	Missense_Mutation	SNP	superfamily_PWI domain,HMMSmart_SM00311,HMMPfam_PWI	p.V700I	ENST00000323848.9	37	c.2098	CCDS255.1	1	.	.	.	.	.	.	.	.	.	.	G	10.76	1.440783	0.25900	0.0	1.16E-4	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.31510	1.49;1.49;1.49	5.85	3.87	0.44632	.	0.429536	0.19391	N	0.115416	T	0.20373	0.0490	L	0.29908	0.895	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15407	-1.0438	10	0.20519	T	0.43	-1.1351	9.7186	0.40289	0.0945:0.2253:0.6801:0.0	.	712;700	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	I	700;712;709	ENSP00000326261:V700I;ENSP00000391430:V712I;ENSP00000363510:V709I	ENSP00000326261:V700I	V	+	1	0	SRRM1	24868559	0.002000	0.14202	0.544000	0.28141	0.912000	0.54170	1.376000	0.34306	1.412000	0.46977	0.563000	0.77884	GTT	-	NULL		0.582	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	protein_coding	OTTHUMT00000009292.2	G	NM_005839		24868559	+1	no_errors	NM_005839	genbank	human	validated	54_36p	missense	SNP	0.243	A
DSC1	1823	genome.wustl.edu	37	18	28712568	28712568	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr18:28712568A>G	ENST00000257198.5	-	14	2462	c.2201T>C	c.(2200-2202)aTt>aCt	p.I734T	DSC1_ENST00000257197.3_Missense_Mutation_p.I734T|RP11-408H20.3_ENST00000582307.1_RNA|RP11-408H20.2_ENST00000581836.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	734					homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			ATTTGATACAATTAAATTTTG	0.348																																																0			18											165.0	161.0	162.0					18																	28712568		2202	4300	6502	26966566	SO:0001583	missense	1823			AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.2201T>C	18.37:g.28712568A>G	ENSP00000257198:p.Ile734Thr	Somatic		Capture	Illumina GAIIx	4	26966566	Q9HB01	Missense_Mutation	SNP	HMMPfam_Cadherin_pro,superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1	p.I734T	ENST00000257198.5	37	c.2201	CCDS11894.1	18	.	.	.	.	.	.	.	.	.	.	A	23.1	4.378427	0.82682	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.60548	0.19;0.18	5.84	5.84	0.93424	.	0.000000	0.53938	D	0.000052	T	0.78368	0.4272	M	0.83223	2.63	0.53688	D	0.999976	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.991	T	0.81807	-0.0763	10	0.87932	D	0	.	15.8842	0.79232	1.0:0.0:0.0:0.0	.	734;734	Q08554;Q9HB00	DSC1_HUMAN;.	T	734	ENSP00000257197:I734T;ENSP00000257198:I734T	ENSP00000257197:I734T	I	-	2	0	DSC1	26966566	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.913000	0.69957	2.232000	0.73038	0.533000	0.62120	ATT	-	NULL		0.348	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC1	protein_coding	OTTHUMT00000254946.1	A	NM_004948, NM_024421		26966566	-1	no_errors	NM_024421	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
NEK10	152110	genome.wustl.edu	37	3	27161286	27161286	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr3:27161286G>T	ENST00000429845.2	-	36	3688	c.3326C>A	c.(3325-3327)tCc>tAc	p.S1109Y	NEK10_ENST00000383771.4_Missense_Mutation_p.S411Y|NEK10_ENST00000383770.3_Missense_Mutation_p.S364Y|NEK10_ENST00000295720.6_Missense_Mutation_p.S421Y			Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10	1109					positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein autophosphorylation (GO:0031954)|protein phosphorylation (GO:0006468)|regulation of cell cycle G2/M phase transition (GO:1902749)|regulation of ERK1 and ERK2 cascade (GO:0070372)	protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GTTTCCACCGGATGAACGATG	0.403																																																0			3											124.0	128.0	127.0					3																	27161286		2203	4300	6503	27136290	SO:0001583	missense	152110			AK123061, AK057247	CCDS46781.1	3p24.1	2012-11-15	2012-11-15		ENSG00000163491	ENSG00000163491			18592	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)- related kinase 10"""			15289607	Standard	NM_199347		Approved	FLJ32685	uc003cdt.2	Q6ZWH5	OTTHUMG00000130571	ENST00000429845.2:c.3326C>A	3.37:g.27161286G>T	ENSP00000395849:p.Ser1109Tyr	Somatic		Capture	Illumina GAIIx	4	27136290	A8MWG1|B9ZVR0|Q45VJ4|Q6ZR11|Q7Z671|Q86XB1|Q96MB3	Missense_Mutation	SNP	HMMSmart_SM00220,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_TYR	p.S496Y	ENST00000429845.2	37	c.1487		3	.	.	.	.	.	.	.	.	.	.	G	3.983	-0.006017	0.07773	.	.	ENSG00000163491	ENST00000295720;ENST00000383771;ENST00000383770	T;T;T	0.12361	2.69;2.75;2.94	5.94	2.05	0.26809	.	.	.	.	.	T	0.11836	0.0288	.	.	.	0.09310	N	1	P;P	0.41569	0.547;0.755	B;B	0.41088	0.26;0.347	T	0.17745	-1.0359	8	0.56958	D	0.05	.	5.3151	0.15850	0.2323:0.2898:0.4779:0.0	.	421;364	Q6ZWH5-5;Q6ZWH5-7	.;.	Y	421;411;364	ENSP00000295720:S421Y;ENSP00000373281:S411Y;ENSP00000373280:S364Y	ENSP00000295720:S421Y	S	-	2	0	NEK10	27136290	0.002000	0.14202	0.009000	0.14445	0.026000	0.11368	0.902000	0.28459	0.093000	0.17368	0.643000	0.83706	TCC	-	NULL		0.403	NEK10-016	NOVEL	basic|appris_principal	protein_coding	NEK10	protein_coding	OTTHUMT00000438156.1	G	NM_152534		27136290	-1	no_errors	ENST00000396636	ensembl	human	known	54_36p	missense	SNP	0.218	T
MYO1D	4642	genome.wustl.edu	37	17	31065331	31065331	+	Silent	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr17:31065331C>G	ENST00000318217.5	-	14	1990	c.1686G>C	c.(1684-1686)ctG>ctC	p.L562L	MYO1D_ENST00000584232.1_5'UTR|MYO1D_ENST00000579584.1_Silent_p.L562L|MYO1D_ENST00000394649.4_Silent_p.L474L	NM_015194.1	NP_056009.1	O94832	MYO1D_HUMAN	myosin ID	562	Myosin motor.				early endosome to recycling endosome transport (GO:0061502)|negative regulation of phosphatase activity (GO:0010923)	axolemma (GO:0030673)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|smooth endoplasmic reticulum (GO:0005790)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TAGCAGCAGTCAGAGGTCGCT	0.373																																																0			17											91.0	95.0	94.0					17																	31065331		2203	4300	6503	28089444	SO:0001819	synonymous_variant	4642			AB018270	CCDS32615.1	17q11-q12	2014-06-12				ENSG00000176658		"""Myosins / Myosin superfamily : Class I"""	7598	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 108"""	606539				8884266	Standard	NM_015194		Approved	KIAA0727, myr4, PPP1R108	uc002hho.1	O94832		ENST00000318217.5:c.1686G>C	17.37:g.31065331C>G		Somatic		Capture	Illumina GAIIx	4	28089444	A6H8V3|Q8NHP9	Silent	SNP	HMMSmart_SM00242,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,HMMPfam_Myosin_TH1	p.L562	ENST00000318217.5	37	c.1686	CCDS32615.1	17																																																																																			-	HMMSmart_SM00242,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Myosin_head		0.373	MYO1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1D	protein_coding	OTTHUMT00000447457.1	C			28089444	-1	no_errors	NM_015194	genbank	human	provisional	54_36p	silent	SNP	0.977	G
ZBED9	114821	genome.wustl.edu	37	6	28540482	28540482	+	Silent	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:28540482A>G	ENST00000452236.2	-	4	3801	c.3184T>C	c.(3184-3186)Tta>Cta	p.L1062L		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						ccccgtgataaccaccgtatc	0.343																																																0			6											83.0	84.0	84.0					6																	28540482		2203	4300	6503	28648461	SO:0001819	synonymous_variant	114821																														ENST00000452236.2:c.3184T>C	6.37:g.28540482A>G		Somatic		Capture	Illumina GAIIx	4	28648461		Silent	SNP	HMMPfam_SCAN,HMMSmart_SCAN,superfamily_RNaseH_fold,HMMPfam_rve,HMMPfam_hATC	p.L1062	ENST00000452236.2	37	c.3184	CCDS34355.1	6																																																																																			-	NULL		0.343	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	protein_coding	OTTHUMT00000043551.3	A			28648461	-1	no_errors	NM_052923	genbank	human	provisional	54_36p	silent	SNP	1.000	G
DMD	1756	genome.wustl.edu	37	X	31144780	31144780	+	Silent	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:31144780G>T	ENST00000357033.4	-	78	11231	c.11025C>A	c.(11023-11025)acC>acA	p.T3675T	DMD_ENST00000361471.4_Intron|DMD_ENST00000359836.1_Intron|DMD_ENST00000378723.3_Intron|DMD_ENST00000378702.4_Silent_p.T607T|DMD_ENST00000378680.2_Intron|DMD_ENST00000343523.2_Intron|DMD_ENST00000541735.1_Silent_p.T1105T|DMD_ENST00000378677.2_Silent_p.T3671T|DMD_ENST00000474231.1_Intron|DMD_ENST00000378707.3_Silent_p.T1215T	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3675					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCTTTCCAGGGGTATTTCTTC	0.383																																																0			X											96.0	81.0	87.0					X																	31144780		2202	4300	6502	31054701	SO:0001819	synonymous_variant	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.11025C>A	X.37:g.31144780G>T		Somatic		Capture	Illumina GAIIx	4	31054701	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	superfamily_Calponin-homology domain CH-domain,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_SM00033,PatternScan_ACTININ_2,HMMPfam_Spectrin,superfamily_Spectrin repeat,HMMSmart_SM00150,superfamily_t-snare proteins,superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_EF-hand,HMMPfam_efhand_1,HMMPfam_efhand_2,HMMPfam_ZZ,HMMSmart_SM00291,PatternScan_ZF_ZZ_1,superfamily_Prefoldin	p.T3675	ENST00000357033.4	37	c.11025	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	8.399	0.841569	0.16963	.	.	ENSG00000198947	ENST00000465285	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	T	0.70307	0.3209	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68723	-0.5333	4	.	.	.	.	13.5828	0.61913	0.075:0.0:0.925:0.0	.	.	.	.	T	1414	.	.	P	-	1	0	DMD	31054701	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.460000	0.66691	2.546000	0.85860	0.594000	0.82650	CCC	-	NULL		0.383	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	G	NM_004006		31054701	-1	no_errors	NM_004006	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
MCCD1	401250	genome.wustl.edu	37	6	31496835	31496835	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:31496835G>A	ENST00000376191.2	+	1	342	c.44G>A	c.(43-45)cGc>cAc	p.R15H	DDX39B_ENST00000462421.1_5'Flank	NM_001011700.2	NP_001011700.2	P59942	MCCD1_HUMAN	mitochondrial coiled-coil domain 1	15						mitochondrion (GO:0005739)				skin(1)	1						CATTTCCTTCGCCTCCTTCTG	0.622																																																0			6											173.0	128.0	144.0					6																	31496835		1511	2709	4220	31604814	SO:0001583	missense	401250				CCDS34396.1	6p21.3	2003-10-17				ENSG00000204511			20668	protein-coding gene	gene with protein product		609624				14527716	Standard	NM_001011700		Approved		uc003ntp.1	P59942		ENST00000376191.2:c.44G>A	6.37:g.31496835G>A	ENSP00000365362:p.Arg15His	Somatic		Capture	Illumina GAIIx	4	31604814	A2AB29|A2RUP7|B0UZB2|Q7RTY2	Missense_Mutation	SNP	NULL	p.R15H	ENST00000376191.2	37	c.44	CCDS34396.1	6	.	.	.	.	.	.	.	.	.	.	N	0.027	-1.363954	0.01235	.	.	ENSG00000204511	ENST00000376191	T	0.25579	1.79	3.25	-1.04	0.10068	.	1.197690	0.06338	N	0.707425	T	0.04182	0.0116	N	0.24115	0.695	0.09310	N	0.999996	B	0.06786	0.001	B	0.01281	0.0	T	0.39057	-0.9632	10	0.33940	T	0.23	.	0.8462	0.01161	0.2296:0.1814:0.4032:0.1857	.	15	P59942	MCCD1_HUMAN	H	15	ENSP00000365362:R15H	ENSP00000365362:R15H	R	+	2	0	MCCD1	31604814	0.001000	0.12720	0.079000	0.20413	0.036000	0.12997	0.081000	0.14823	-0.382000	0.07870	-0.300000	0.09419	CGC	-	NULL		0.622	MCCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCD1	protein_coding	OTTHUMT00000259099.1	G			31604814	+1	no_errors	NM_001011700	genbank	human	validated	54_36p	missense	SNP	0.098	A
EIF2S2	8894	genome.wustl.edu	37	20	32693295	32693295	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr20:32693295C>T	ENST00000374980.2	-	2	293	c.72G>A	c.(70-72)atG>atA	p.M24I		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	24					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						CCTCATCTAACATAAAAGGct	0.388																																																0			20											78.0	66.0	70.0					20																	32693295		2203	4300	6503	32156956	SO:0001583	missense	8894			M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.72G>A	20.37:g.32693295C>T	ENSP00000364119:p.Met24Ile	Somatic		Capture	Illumina GAIIx	4	32156956	Q9BVU0|Q9UJE4	Missense_Mutation	SNP	superfamily_Translation initiation factor 2 beta aIF2beta N-terminal domain,HMMPfam_eIF-5_eIF-2B,HMMSmart_SM00653,superfamily_Zinc-binding domain of translation initiation factor 2 beta	p.M24I	ENST00000374980.2	37	c.72	CCDS13231.1	20	.	.	.	.	.	.	.	.	.	.	C	17.44	3.389045	0.61956	.	.	ENSG00000125977	ENST00000374980	T	0.41400	1.0	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.52322	0.1727	M	0.68317	2.08	0.58432	D	0.999999	P;P	0.35872	0.525;0.525	B;B	0.42214	0.38;0.38	T	0.52697	-0.8541	10	0.52906	T	0.07	-37.6721	19.8041	0.96521	0.0:1.0:0.0:0.0	.	24;24	Q6IBR8;P20042	.;IF2B_HUMAN	I	24	ENSP00000364119:M24I	ENSP00000364119:M24I	M	-	3	0	EIF2S2	32156956	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.767000	0.74975	2.748000	0.94277	0.591000	0.81541	ATG	-	NULL		0.388	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S2	protein_coding	OTTHUMT00000078765.2	C	NM_003908		32156956	-1	no_errors	NM_003908	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ADAMTS12	81792	genome.wustl.edu	37	5	33637690	33637690	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:33637690A>C	ENST00000504830.1	-	12	2215	c.1880T>G	c.(1879-1881)tTt>tGt	p.F627C	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.F627C	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	627	Cys-rich.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						ACCTGGGTTAAAAATGGGAAA	0.463										HNSCC(64;0.19)																																						0			5											124.0	127.0	126.0					5																	33637690		2203	4300	6503	33673447	SO:0001583	missense	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1880T>G	5.37:g.33637690A>C	ENSP00000422554:p.Phe627Cys	Somatic		Capture	Illumina GAIIx	4	33673447	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.F627C	ENST00000504830.1	37	c.1880	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	A	14.75	2.628244	0.46944	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.59364	3.9;0.27	5.98	4.84	0.62591	.	0.303746	0.37857	N	0.001904	T	0.67906	0.2943	M	0.70595	2.14	0.80722	D	1	D;D	0.76494	0.999;0.98	D;P	0.69479	0.964;0.719	T	0.68379	-0.5424	10	0.38643	T	0.18	.	5.1174	0.14843	0.648:0.0:0.0813:0.2707	.	627;627	P58397-3;P58397	.;ATS12_HUMAN	C	627	ENSP00000422554:F627C;ENSP00000344847:F627C	ENSP00000344847:F627C	F	-	2	0	ADAMTS12	33673447	0.914000	0.31030	0.994000	0.49952	0.733000	0.41908	0.718000	0.25866	2.289000	0.77006	0.528000	0.53228	TTT	-	NULL		0.463	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	A	NM_030955		33673447	-1	no_errors	NM_030955	genbank	human	reviewed	54_36p	missense	SNP	0.989	C
LRRC37A11P	342666	genome.wustl.edu	37	17	37187950	37187950	+	RNA	SNP	A	A	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr17:37187950A>T	ENST00000425901.2	+	0	1792					NR_033753.2				leucine rich repeat containing 37, member A11, pseudogene																		AGAAGACCCCAACTCAGCCTC	0.488																																																0			17																																								34441476			0					17q12	2013-05-14			ENSG00000214553	ENSG00000214553			43815	pseudogene	pseudogene							Standard	NR_033753		Approved		uc002hrd.1		OTTHUMG00000133184		17.37:g.37187950A>T		Somatic		Capture	Illumina GAIIx	4	34441476		Silent	SNP	NULL	p.P87	ENST00000425901.2	37	c.261		17																																																																																			-	NULL		0.488	LRRC37A11P-002	KNOWN	basic	processed_transcript	uc002hrd.1	pseudogene	OTTHUMT00000444105.1	A	NR_033753		34441476	+1	no_errors	ENST00000398572	ensembl	human	known	54_36p	silent	SNP	0.001	T
APOL5	80831	genome.wustl.edu	37	22	36116671	36116671	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr22:36116671G>A	ENST00000249044.2	+	2	112	c.112G>A	c.(112-114)Gtc>Atc	p.V38I		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	38					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						CGGAGGTGAGGTCTGGGGGAA	0.498																																																0			22											74.0	65.0	68.0					22																	36116671		2203	4300	6503	34446617	SO:0001583	missense	80831			AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.112G>A	22.37:g.36116671G>A	ENSP00000249044:p.Val38Ile	Somatic		Capture	Illumina GAIIx	4	34446617	Q5TFL9|Q9UGW5	Missense_Mutation	SNP	HMMPfam_ApoL	p.V38I	ENST00000249044.2	37	c.112	CCDS13920.1	22	.	.	.	.	.	.	.	.	.	.	G	10.46	1.357793	0.24598	.	.	ENSG00000128313	ENST00000249044	T	0.04551	3.6	1.53	1.53	0.23141	.	5.202800	0.01392	N	0.013292	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	P	0.50156	0.932	P	0.45071	0.468	T	0.32955	-0.9887	10	0.59425	D	0.04	.	6.5164	0.22250	0.0:0.0:1.0:0.0	.	38	Q9BWW9	APOL5_HUMAN	I	38	ENSP00000249044:V38I	ENSP00000249044:V38I	V	+	1	0	APOL5	34446617	0.001000	0.12720	0.005000	0.12908	0.139000	0.21198	0.586000	0.23894	1.195000	0.43115	0.511000	0.50034	GTC	-	NULL		0.498	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOL5	protein_coding	OTTHUMT00000318979.1	G	NM_030642		34446617	+1	no_errors	NM_030642	genbank	human	reviewed	54_36p	missense	SNP	0.005	A
MYH9	4627	genome.wustl.edu	37	22	36688211	36688211	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr22:36688211T>G	ENST00000216181.5	-	31	4395	c.4165A>C	c.(4165-4167)Aag>Cag	p.K1389Q		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1389					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TTCTGGAGCTTCCTCTTCACC	0.607			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																														Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0			22											104.0	93.0	97.0					22																	36688211		2203	4300	6503	35018157	SO:0001583	missense	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4165A>C	22.37:g.36688211T>G	ENSP00000216181:p.Lys1389Gln	Somatic		Capture	Illumina GAIIx	4	35018157	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	HMMPfam_Myosin_N,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,superfamily_Prefoldin,HMMPfam_Myosin_tail_1,superfamily_Regulator of G-protein signaling RGS	p.K1389Q	ENST00000216181.5	37	c.4165	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	T	18.17	3.563850	0.65651	.	.	ENSG00000100345	ENST00000216181	D	0.84223	-1.82	4.94	4.94	0.65067	Myosin tail (1);	0.221045	0.44483	D	0.000452	D	0.93510	0.7929	M	0.92169	3.28	0.80722	D	1	D	0.62365	0.991	D	0.65874	0.939	D	0.95048	0.8184	10	0.87932	D	0	.	14.8877	0.70582	0.0:0.0:0.0:1.0	.	1389	P35579	MYH9_HUMAN	Q	1389	ENSP00000216181:K1389Q	ENSP00000216181:K1389Q	K	-	1	0	MYH9	35018157	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.664000	0.54525	1.976000	0.57569	0.379000	0.24179	AAG	-	HMMPfam_Myosin_tail_1		0.607	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	protein_coding	OTTHUMT00000259110.3	T	NM_002473		35018157	-1	no_errors	NM_002473	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FAM214B	80256	genome.wustl.edu	37	9	35107716	35107716	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr9:35107716G>A	ENST00000378561.1	-	2	3611	c.556C>T	c.(556-558)Ctt>Ttt	p.L186F	FAM214B_ENST00000322813.5_Missense_Mutation_p.L186F|FAM214B_ENST00000605244.1_Missense_Mutation_p.L186F|FAM214B_ENST00000378554.2_Missense_Mutation_p.L186F|FAM214B_ENST00000378557.1_Missense_Mutation_p.L186F|FAM214B_ENST00000488109.2_Missense_Mutation_p.L186F|FAM214B_ENST00000378566.1_Intron|FAM214B_ENST00000603301.1_Missense_Mutation_p.L186F|FAM214B_ENST00000605392.1_5'Flank			Q7L5A3	F214B_HUMAN	family with sequence similarity 214, member B	186						nucleus (GO:0005634)											TCAGTGTCAAGTGTGTGCAGC	0.632																																																0			9											42.0	51.0	48.0					9																	35107716		2202	4300	6502	35097716	SO:0001583	missense	80256			AB040972	CCDS6578.1	9p13.2	2011-12-01	2011-12-01	2011-12-01	ENSG00000005238	ENSG00000005238			25666	protein-coding gene	gene with protein product			"""KIAA1539"""	KIAA1539		10819331	Standard	NM_025182		Approved	FLJ11560, bA182N22.6	uc003zwo.3	Q7L5A3	OTTHUMG00000019847	ENST00000378561.1:c.556C>T	9.37:g.35107716G>A	ENSP00000367823:p.Leu186Phe	Somatic		Capture	Illumina GAIIx	4	35097716	B1AML4|B1AML5|D3DRN5|O60377|Q9BQ60|Q9HAI9|Q9P1Y9	Missense_Mutation	SNP	NULL	p.L186F	ENST00000378561.1	37	c.556	CCDS6578.1	9	.	.	.	.	.	.	.	.	.	.	g	11.05	1.524026	0.27299	.	.	ENSG00000005238	ENST00000322813;ENST00000378561;ENST00000378557;ENST00000378554	.	.	.	4.87	1.96	0.26148	.	0.201916	0.33854	N	0.004482	T	0.46151	0.1378	L	0.55481	1.735	0.36015	D	0.838324	B	0.02656	0.0	B	0.04013	0.001	T	0.40175	-0.9577	8	.	.	.	-25.5246	7.1344	0.25521	0.1524:0.0:0.7108:0.1368	.	186	Q7L5A3	K1539_HUMAN	F	186	.	.	L	-	1	0	KIAA1539	35097716	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	1.161000	0.31773	0.236000	0.21180	-1.093000	0.02169	CTT	-	NULL		0.632	FAM214B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1539	protein_coding	OTTHUMT00000052261.1	G	NM_025182		35097716	-1	no_errors	NM_025182	genbank	human	predicted	54_36p	missense	SNP	1.000	A
PAMR1	25891	genome.wustl.edu	37	11	35454364	35454364	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:35454364T>A	ENST00000378880.2	-	11	2148	c.1703A>T	c.(1702-1704)gAc>gTc	p.D568V	PAMR1_ENST00000378878.3_Missense_Mutation_p.D457V|PAMR1_ENST00000278360.3_Missense_Mutation_p.D585V|PAMR1_ENST00000532848.1_Missense_Mutation_p.D528V	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	568	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						ACGGGCCTTGTCTAGGAGCTT	0.557																																																0			11											67.0	64.0	65.0					11																	35454364		2202	4298	6500	35410940	SO:0001583	missense	25891				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.1703A>T	11.37:g.35454364T>A	ENSP00000368158:p.Asp568Val	Somatic		Capture	Illumina GAIIx	4	35410940	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	HMMSmart_EGF,superfamily_CUB,HMMPfam_CUB,HMMSmart_CUB,superfamily_SSF57196,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP,superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin	p.D585V	ENST00000378880.2	37	c.1754	CCDS31460.1	11	.	.	.	.	.	.	.	.	.	.	T	22.0	4.227539	0.79576	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43	5.61	5.61	0.85477	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.93432	0.7905	M	0.63428	1.95	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.992	D	0.94096	0.7357	10	0.87932	D	0	.	15.8204	0.78638	0.0:0.0:0.0:1.0	.	457;568;585	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	V	585;568;457;528;545	ENSP00000278360:D585V;ENSP00000368158:D568V;ENSP00000368156:D457V;ENSP00000433868:D528V;ENSP00000432591:D545V	ENSP00000278360:D585V	D	-	2	0	PAMR1	35410940	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.102000	0.71486	2.146000	0.66826	0.459000	0.35465	GAC	-	superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin		0.557	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKFZP586H2123	protein_coding	OTTHUMT00000389177.1	T	NM_015430		35410940	-1	no_errors	NM_015430	genbank	human	validated	54_36p	missense	SNP	1.000	A
RECK	8434	genome.wustl.edu	37	9	36118898	36118898	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr9:36118898G>T	ENST00000377966.3	+	18	2964	c.2398G>T	c.(2398-2400)Gcc>Tcc	p.A800S		NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	800					blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			CAGCTCCGTCGCCGAGTGTGC	0.607																																																0			9											84.0	76.0	79.0					9																	36118898		2203	4300	6503	36108898	SO:0001583	missense	8434			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.2398G>T	9.37:g.36118898G>T	ENSP00000367202:p.Ala800Ser	Somatic		Capture	Illumina GAIIx	4	36108898	B2RNS1|Q5W0K6|Q8WX37	Missense_Mutation	SNP	superfamily_Kazal-type serine protease inhibitors,HMMPfam_Kazal_2,HMMSmart_SM00280,PatternScan_KAZAL	p.A800S	ENST00000377966.3	37	c.2398	CCDS6597.1	9	.	.	.	.	.	.	.	.	.	.	G	0.661	-0.805813	0.02819	.	.	ENSG00000122707	ENST00000377966	T	0.40476	1.03	5.43	-10.3	0.00346	.	0.811905	0.11622	N	0.545651	T	0.13329	0.0323	N	0.02539	-0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.40384	-0.9566	10	0.10377	T	0.69	0.2	15.1418	0.72615	0.7589:0.0913:0.1498:0.0	.	800;800	A8K9D8;O95980	.;RECK_HUMAN	S	800	ENSP00000367202:A800S	ENSP00000367202:A800S	A	+	1	0	RECK	36108898	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.436000	0.06922	-1.901000	0.01096	-1.655000	0.00754	GCC	-	NULL		0.607	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECK	protein_coding	OTTHUMT00000052409.1	G			36108898	+1	no_errors	NM_021111	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
LMBRD2	92255	genome.wustl.edu	37	5	36123035	36123035	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:36123035C>A	ENST00000296603.4	-	8	1313	c.851G>T	c.(850-852)gGt>gTt	p.G284V		NM_001007527.1	NP_001007528.1	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	284						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CATGTTCCTACCCATTTTTTC	0.244																																																0			5											77.0	78.0	77.0					5																	36123035		2202	4290	6492	36158792	SO:0001583	missense	92255				CCDS34145.1	5p13.2	2008-02-05			ENSG00000164187	ENSG00000164187			25287	protein-coding gene	gene with protein product							Standard	NM_001007527		Approved	DKFZp434H2226	uc003jkb.1	Q68DH5	OTTHUMG00000162150	ENST00000296603.4:c.851G>T	5.37:g.36123035C>A	ENSP00000296603:p.Gly284Val	Somatic		Capture	Illumina GAIIx	4	36158792	B3KRB6|Q9NTC7	Missense_Mutation	SNP	HMMPfam_LMBR1	p.G284V	ENST00000296603.4	37	c.851	CCDS34145.1	5	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537920	0.85917	.	.	ENSG00000164187	ENST00000296603;ENST00000546130	T	0.31510	1.49	5.39	5.39	0.77823	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.49029	0.1533	L	0.47716	1.5	0.80722	D	1	D	0.71674	0.998	D	0.66716	0.946	T	0.21724	-1.0237	10	0.32370	T	0.25	-13.582	19.5261	0.95208	0.0:1.0:0.0:0.0	.	284	Q68DH5	LMBD2_HUMAN	V	284;178	ENSP00000296603:G284V	ENSP00000296603:G284V	G	-	2	0	LMBRD2	36158792	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.463000	0.60128	2.668000	0.90789	0.650000	0.86243	GGT	-	HMMPfam_LMBR1		0.244	LMBRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBRD2	protein_coding	OTTHUMT00000367552.1	C	NM_001007527		36158792	-1	no_errors	NM_001007527	genbank	human	validated	54_36p	missense	SNP	1.000	A
MYD88	4615	genome.wustl.edu	37	3	38182744	38182744	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr3:38182744G>C	ENST00000396334.3	+	5	1081	c.897G>C	c.(895-897)tgG>tgC	p.W299C	MYD88_ENST00000495303.1_3'UTR|MYD88_ENST00000481122.1_3'UTR|MYD88_ENST00000424893.1_Missense_Mutation_p.W254C|MYD88_ENST00000417037.2_Missense_Mutation_p.W307C|MYD88_ENST00000443433.2_3'UTR	NM_002468.4	NP_002459.2	Q99836	MYD88_HUMAN	myeloid differentiation primary response 88	286					3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|establishment of endothelial intestinal barrier (GO:0090557)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)|response to molecule of fungal origin (GO:0002238)|response to peptidoglycan (GO:0032494)|response to virus (GO:0009615)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|type I interferon biosynthetic process (GO:0045351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|TIR domain binding (GO:0070976)			breast(1)|haematopoietic_and_lymphoid_tissue(226)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	237				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CTTGGTTCTGGACTCGCCTTG	0.547			Mis		ABC-DLBCL																																		Dom	yes		3	3p22	4615	myeloid differentiation primary response gene (88)		L	0			3											211.0	175.0	187.0					3																	38182744		2203	4300	6503	38157748	SO:0001583	missense	4615			U84408	CCDS2674.2, CCDS54565.1, CCDS54566.1, CCDS54567.1, CCDS54568.1	3p22	2014-09-17	2012-11-15		ENSG00000172936	ENSG00000172936			7562	protein-coding gene	gene with protein product		602170	"""myeloid differentiation primary response gene (88)"""			9013863	Standard	NM_002468		Approved		uc003chx.3	Q99836	OTTHUMG00000131083	ENST00000396334.3:c.897G>C	3.37:g.38182744G>C	ENSP00000379625:p.Trp299Cys	Somatic		Capture	Illumina GAIIx	4	38157748	B4DKH8|B4DKU4|B4DQ60|B4DQ72|J3KPU4|J3KQ87|J3KQJ6|P78397|Q53XS7	Missense_Mutation	SNP	superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death,superfamily_TIR,HMMSmart_TIR,HMMPfam_TIR	p.W286C	ENST00000396334.3	37	c.858	CCDS2674.2	3	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794371	0.90453	.	.	ENSG00000172936	ENST00000417037;ENST00000396334;ENST00000424893;ENST00000421516;ENST00000415158	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	5.52	5.52	0.82312	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.066130	0.64402	D	0.000003	T	0.52175	0.1718	M	0.90814	3.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.60561	-0.7239	10	0.87932	D	0	-19.1009	18.8132	0.92065	0.0:0.0:1.0:0.0	.	241;286;275	Q99836-2;Q99836;B4E3D6	.;MYD88_HUMAN;.	C	307;299;254;306;275	ENSP00000401399:W307C;ENSP00000379625:W299C;ENSP00000389979:W254C;ENSP00000391753:W306C	ENSP00000379625:W299C	W	+	3	0	MYD88	38157748	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.355000	0.97087	2.767000	0.95098	0.655000	0.94253	TGG	-	superfamily_TIR,HMMSmart_TIR,HMMPfam_TIR		0.547	MYD88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYD88	protein_coding	OTTHUMT00000253743.4	G	NM_002468		38157748	+1	no_errors	NM_002468	genbank	human	validated	54_36p	missense	SNP	1.000	C
UTP11L	51118	genome.wustl.edu	37	1	38488461	38488461	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:38488461C>G	ENST00000373014.4	+	7	719	c.658C>G	c.(658-660)Caa>Gaa	p.Q220E	UTP11L_ENST00000488453.1_3'UTR|UTP11L_ENST00000537711.1_3'UTR	NM_016037.3	NP_057121.2	Q9Y3A2	UTP11_HUMAN	UTP11-like, U3 small nucleolar ribonucleoprotein (yeast)	220					nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleolus (GO:0005730)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TCAGAAAATTCAAACACGCAA	0.393																																																0			1											102.0	94.0	96.0					1																	38488461		2203	4300	6503	38261048	SO:0001583	missense	51118			AF151852	CCDS429.1	1p34.3	2014-03-06	2014-03-06		ENSG00000183520	ENSG00000183520			24329	protein-coding gene	gene with protein product		609440				11860508, 10810093	Standard	NM_016037		Approved	CGI-94	uc001ccn.4	Q9Y3A2	OTTHUMG00000004435	ENST00000373014.4:c.658C>G	1.37:g.38488461C>G	ENSP00000362105:p.Gln220Glu	Somatic		Capture	Illumina GAIIx	4	38261048	A8K785|B4DJC6|D3DPT7|Q5VT93|Q9BS98|Q9NS31	Missense_Mutation	SNP	HMMPfam_Utp11	p.Q220E	ENST00000373014.4	37	c.658	CCDS429.1	1	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888983	0.33348	.	.	ENSG00000183520	ENST00000373014	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.46151	0.1378	N	0.17800	0.525	0.80722	D	1	P	0.36199	0.543	B	0.39660	0.306	T	0.37150	-0.9718	9	0.02654	T	1	-14.0712	20.8794	0.99867	0.0:1.0:0.0:0.0	.	220	Q9Y3A2	UTP11_HUMAN	E	220	.	ENSP00000362105:Q220E	Q	+	1	0	UTP11L	38261048	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.853000	0.75435	2.941000	0.99782	0.655000	0.94253	CAA	-	HMMPfam_Utp11		0.393	UTP11L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP11L	protein_coding	OTTHUMT00000012962.1	C	NM_016037		38261048	+1	no_errors	NM_016037	genbank	human	validated	54_36p	missense	SNP	1.000	G
EGFLAM	133584	genome.wustl.edu	37	5	38458444	38458444	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:38458444A>G	ENST00000354891.3	+	21	3089	c.2743A>G	c.(2743-2745)Atg>Gtg	p.M915V	EGFLAM_ENST00000397202.2_Missense_Mutation_p.M273V|CTD-2263F21.1_ENST00000510469.1_RNA|EGFLAM_ENST00000322350.5_Missense_Mutation_p.M907V|EGFLAM_ENST00000397210.3_Missense_Mutation_p.M50V|EGFLAM_ENST00000514476.1_Missense_Mutation_p.M50V|EGFLAM_ENST00000336740.6_Missense_Mutation_p.M673V|EGFLAM_ENST00000506135.1_Missense_Mutation_p.M50V	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	915	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GGCATCCATCATGGTGAATGG	0.532																																					Colon(62;485 1295 3347 17454)											0			5											172.0	152.0	159.0					5																	38458444		2203	4300	6503	38494201	SO:0001583	missense	133584			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2743A>G	5.37:g.38458444A>G	ENSP00000346964:p.Met915Val	Somatic		Capture	Illumina GAIIx	4	38494201	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3,HMMSmart_EGF,superfamily_ConA_like_lec_gl,PatternScan_EGF_1,HMMSmart_LamG,HMMPfam_Laminin_G_1,HMMPfam_EGF,PatternScan_EGF_2,HMMPfam_Laminin_G_2	p.M907V	ENST00000354891.3	37	c.2719	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	A	2.839	-0.241002	0.05906	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000397202;ENST00000339580;ENST00000397210;ENST00000506135;ENST00000508131;ENST00000514476	T;T;T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;0.05;0.05;-1.13;0.05	5.46	2.75	0.32379	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.258573	0.44902	D	0.000419	T	0.45955	0.1368	N	0.01751	-0.74	0.25090	N	0.990865	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.0	T	0.29941	-0.9995	10	0.20519	T	0.43	-2.3555	5.1684	0.15098	0.6385:0.1592:0.2023:0.0	.	673;915;907	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	V	915;907;673;273;673;50;50;50;50	ENSP00000346964:M915V;ENSP00000313084:M907V;ENSP00000337607:M673V;ENSP00000380385:M273V;ENSP00000380393:M50V;ENSP00000425579:M50V;ENSP00000427228:M50V;ENSP00000423228:M50V	ENSP00000313084:M907V	M	+	1	0	EGFLAM	38494201	0.178000	0.23122	1.000000	0.80357	0.993000	0.82548	0.864000	0.27926	0.980000	0.38523	0.533000	0.62120	ATG	-	superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2		0.532	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	protein_coding	OTTHUMT00000367323.1	A	NM_152403		38494201	+1	no_errors	NM_152403	genbank	human	validated	54_36p	missense	SNP	1.000	G
EMILIN3	90187	genome.wustl.edu	37	20	39990998	39990998	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr20:39990998G>T	ENST00000332312.3	-	4	1403	c.1211C>A	c.(1210-1212)gCa>gAa	p.A404E		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	404						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				CTCGGTGACTGCCTGCAGGGC	0.662																																																0			20											30.0	35.0	33.0					20																	39990998		2203	4300	6503	39424412	SO:0001583	missense	90187			AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.1211C>A	20.37:g.39990998G>T	ENSP00000332806:p.Ala404Glu	Somatic		Capture	Illumina GAIIx	4	39424412	Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	HMMPfam_EMI	p.A404E	ENST00000332312.3	37	c.1211	CCDS13316.1	20	.	.	.	.	.	.	.	.	.	.	G	8.341	0.828601	0.16749	.	.	ENSG00000183798	ENST00000332312	T	0.13657	2.57	5.14	1.92	0.25849	.	0.906105	0.09628	N	0.776583	T	0.10723	0.0262	L	0.54323	1.7	0.09310	N	0.999998	B	0.32245	0.361	B	0.22386	0.039	T	0.33624	-0.9861	9	.	.	.	-0.1586	2.6568	0.05015	0.1733:0.3275:0.3774:0.1218	.	404	Q9NT22	EMIL3_HUMAN	E	404	ENSP00000332806:A404E	.	A	-	2	0	EMILIN3	39424412	0.076000	0.21285	0.037000	0.18230	0.659000	0.38960	0.510000	0.22723	0.138000	0.18790	0.561000	0.74099	GCA	-	NULL		0.662	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN3	protein_coding	OTTHUMT00000106876.2	G	XM_029741		39424412	-1	no_errors	NM_052846	genbank	human	validated	54_36p	missense	SNP	0.016	T
MACF1	23499	genome.wustl.edu	37	1	39903522	39903522	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:39903522T>A	ENST00000372915.3	+	70	17846	c.17759T>A	c.(17758-17760)aTc>aAc	p.I5920N	MACF1_ENST00000564288.1_Missense_Mutation_p.I6021N|MACF1_ENST00000289893.4_Missense_Mutation_p.I4464N|MACF1_ENST00000317713.7_Missense_Mutation_p.I3962N|MACF1_ENST00000539005.1_Missense_Mutation_p.I3832N|MACF1_ENST00000361689.2_Missense_Mutation_p.I3962N|MACF1_ENST00000545844.1_Missense_Mutation_p.I3962N|MACF1_ENST00000567887.1_Missense_Mutation_p.I6058N			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5920					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CCACCACTGATCCCTGCTGAA	0.463																																																0			1											179.0	164.0	169.0					1																	39903522		2203	4300	6503	39676109	SO:0001583	missense	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.17759T>A	1.37:g.39903522T>A	ENSP00000362006:p.Ile5920Asn	Somatic		Capture	Illumina GAIIx	4	39676109	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	superfamily_SSF75399,HMMSmart_PLEC,HMMPfam_Plectin,HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC,PatternScan_GLYCOSYL_HYDROL_F5,superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1,HMMPfam_GAS2,HMMSmart_GAS2	p.I4464N	ENST00000372915.3	37	c.13391		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.1|25.1	4.603045|4.603045	0.87157|0.87157	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000372925|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	.|T;T;T;T;T;T	.|0.54279	.|0.58;0.58;0.58;0.58;0.58;0.58	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.000000	.|0.64402	.|D	.|0.000008	T|T	0.71904|0.71904	0.3395|0.3395	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.71414	.|0.973;0.97	T|T	0.76038|0.76038	-0.3105|-0.3105	5|10	.|0.87932	.|D	.|0	.|.	15.6841|15.6841	0.77396|0.77396	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|5920;3962	.|Q9UPN3;F8W8Q1	.|MACF1_HUMAN;.	E|N	2965|3962;5920;3962;3962;3832;4464	.|ENSP00000439537:I3962N;ENSP00000362006:I5920N;ENSP00000354573:I3962N;ENSP00000313438:I3962N;ENSP00000444364:I3832N;ENSP00000289893:I4464N	.|ENSP00000289893:I4464N	D|I	+|+	3|2	2|0	MACF1|MACF1	39676109|39676109	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.997000|0.997000	0.91878|0.91878	7.997000|7.997000	0.88414|0.88414	2.162000|2.162000	0.67917|0.67917	0.460000|0.460000	0.39030|0.39030	GAT|ATC	-	HMMPfam_Spectrin,HMMSmart_SPEC		0.463	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	T	NM_033044		39676109	+1	no_errors	NM_033044	genbank	human	reviewed	54_36p	missense	SNP	0.924	A
KBTBD7	84078	genome.wustl.edu	37	13	41766912	41766912	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr13:41766912C>T	ENST00000379483.3	-	1	1790	c.1482G>A	c.(1480-1482)atG>atA	p.M494I		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	494										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		CATAGCAAAGCATGCGCTTAC	0.423																																																0			13											69.0	62.0	64.0					13																	41766912		2203	4300	6503	40664912	SO:0001583	missense	84078			AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.1482G>A	13.37:g.41766912C>T	ENSP00000368797:p.Met494Ile	Somatic		Capture	Illumina GAIIx	4	40664912	B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,HMMPfam_BACK,superfamily_Galactose oxidase central domain,HMMSmart_SM00612,HMMPfam_Kelch_1	p.M494I	ENST00000379483.3	37	c.1482	CCDS9377.1	13	.	.	.	.	.	.	.	.	.	.	C	8.096	0.775532	0.16051	.	.	ENSG00000120696	ENST00000379483;ENST00000501885	T	0.64085	-0.08	5.5	4.65	0.58169	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.52338	0.1728	L	0.40543	1.245	0.47949	D	0.999555	B	0.30406	0.278	B	0.24155	0.051	T	0.54669	-0.8259	10	0.66056	D	0.02	.	13.536	0.61646	0.157:0.8429:0.0:0.0	.	494	Q8WVZ9	KBTB7_HUMAN	I	494;396	ENSP00000368797:M494I	ENSP00000368797:M494I	M	-	3	0	KBTBD7	40664912	1.000000	0.71417	1.000000	0.80357	0.040000	0.13550	6.342000	0.72982	1.298000	0.44778	0.650000	0.86243	ATG	-	superfamily_Galactose oxidase central domain		0.423	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD7	protein_coding	OTTHUMT00000044660.1	C	NM_032138		40664912	-1	no_errors	NM_032138	genbank	human	provisional	54_36p	missense	SNP	1.000	T
C6	729	genome.wustl.edu	37	5	41149448	41149448	+	Missense_Mutation	SNP	C	C	T	rs142836385	byFrequency	TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:41149448C>T	ENST00000263413.3	-	17	2782	c.2518G>A	c.(2518-2520)Ggc>Agc	p.G840S	C6_ENST00000337836.5_Missense_Mutation_p.G840S	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	840	C5b-binding domain.|Factor I module (FIM) 1.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				AACTGGCGGCCGTCTTGGCAG	0.423													C|||	13	0.00259585	0.0008	0.0029	5008	,	,		18133	0.0		0.0099	False		,,,				2504	0.0															0			5						C	SER/GLY,SER/GLY	0,4406		0,0,2203	139.0	136.0	137.0		2518,2518	5.8	0.8	5	dbSNP_134	137	28,8572	18.5+/-59.3	1,26,4273	yes	missense,missense	C6	NM_000065.2,NM_001115131.1	56,56	1,26,6476	TT,TC,CC		0.3256,0.0,0.2153	possibly-damaging,possibly-damaging	840/935,840/935	41149448	28,12978	2203	4300	6503	41185205	SO:0001583	missense	729			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.2518G>A	5.37:g.41149448C>T	ENSP00000263413:p.Gly840Ser	Somatic		Capture	Illumina GAIIx	4	41185205		Missense_Mutation	SNP	PatternScan_EGF_2,superfamily_TSP1,HMMSmart_TSP1,HMMPfam_TSP_1,superfamily_LDL_rcpt_classA_cys-rich,HMMPfam_Ldl_recept_a,HMMSmart_LDLa,PatternScan_LDLRA_1,HMMPfam_MACPF,HMMSmart_MACPF,PatternScan_MAC_PERFORIN,PatternScan_EGF_1,superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP,HMMSmart_FIMAC,HMMSmart_KAZAL,HMMPfam_Kazal_2	p.G840S	ENST00000263413.3	37	c.2518	CCDS3936.1	5	12	0.005494505494505495	0	0.0	3	0.008287292817679558	0	0.0	9	0.011873350923482849	C	5.530	0.282643	0.10458	0.0	0.003256	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.59502	0.26;0.26	5.85	5.85	0.93711	.	0.306075	0.37053	N	0.002274	T	0.24699	0.0599	N	0.14661	0.345	0.23661	N	0.997178	B	0.31837	0.342	B	0.16722	0.016	T	0.15578	-1.0432	10	0.07644	T	0.81	-20.1278	11.1365	0.48377	0.0:0.8891:0.0:0.1109	.	840	P13671	CO6_HUMAN	S	840	ENSP00000338861:G840S;ENSP00000263413:G840S	ENSP00000263413:G840S	G	-	1	0	C6	41185205	0.003000	0.15002	0.818000	0.32626	0.207000	0.24258	0.821000	0.27338	2.768000	0.95171	0.655000	0.94253	GGC	-	NULL		0.423	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	protein_coding	OTTHUMT00000211592.1	C			41185205	-1	no_errors	NM_000065	genbank	human	reviewed	54_36p	missense	SNP	0.051	T
ANK1	286	genome.wustl.edu	37	8	41577264	41577264	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr8:41577264G>T	ENST00000347528.4	-	10	1105	c.1022C>A	c.(1021-1023)cCa>cAa	p.P341Q	ANK1_ENST00000396942.1_Missense_Mutation_p.P341Q|ANK1_ENST00000396945.1_Missense_Mutation_p.P341Q|ANK1_ENST00000265709.8_Missense_Mutation_p.P374Q|ANK1_ENST00000289734.7_Missense_Mutation_p.P341Q|ANK1_ENST00000379758.2_Missense_Mutation_p.P341Q|ANK1_ENST00000352337.4_Missense_Mutation_p.P341Q	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	341	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CACGTGGAGTGGGGTCAGGTG	0.602																																																0			8											235.0	204.0	215.0					8																	41577264		2203	4300	6503	41696421	SO:0001583	missense	286			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1022C>A	8.37:g.41577264G>T	ENSP00000339620:p.Pro341Gln	Somatic		Capture	Illumina GAIIx	4	41696421	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,HMMPfam_ZU5,HMMSmart_SM00218,HMMSmart_SM00005,superfamily_DEATH domain,HMMPfam_Death	p.P341Q	ENST00000347528.4	37	c.1022	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	G	18.25	3.583475	0.65992	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	5.76	5.76	0.90799	Ankyrin repeat-containing domain (3);	0.053388	0.85682	D	0.000000	D	0.87787	0.6265	H	0.94771	3.58	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.998;0.984;1.0	D	0.90379	0.4386	10	0.87932	D	0	.	19.9766	0.97312	0.0:0.0:1.0:0.0	.	374;341;341;341;341	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	Q	341;341;341;341;341;341;374;341	ENSP00000339620:P341Q;ENSP00000289734:P341Q;ENSP00000369082:P341Q;ENSP00000380149:P341Q;ENSP00000380147:P341Q;ENSP00000309131:P341Q;ENSP00000265709:P374Q	ENSP00000265709:P374Q	P	-	2	0	ANK1	41696421	1.000000	0.71417	0.425000	0.26659	0.029000	0.11900	9.869000	0.99810	2.739000	0.93911	0.555000	0.69702	CCA	-	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank		0.602	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	protein_coding	OTTHUMT00000317297.1	G	NM_020475		41696421	-1	no_errors	NM_020476	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
COX7A2L	9167	genome.wustl.edu	37	2	42578489	42578489	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:42578489C>T	ENST00000378669.1	-	4	1044	c.215G>A	c.(214-216)gGt>gAt	p.G72D	COX7A2L_ENST00000482463.1_5'UTR|COX7A2L_ENST00000234301.2_Missense_Mutation_p.G72D			O14548	COX7R_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2 like	72					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			lung(4)	4						GACGGGCACACCATCAGCTTT	0.448																																																0			2											83.0	73.0	76.0					2																	42578489		2203	4300	6503	42431993	SO:0001583	missense	9167			AB007618	CCDS1808.1	2p21	2010-06-14			ENSG00000115944	ENSG00000115944			2289	protein-coding gene	gene with protein product		605771				9418891	Standard	NM_004718		Approved	EB1, COX7RP, COX7AR, SIG81	uc002rsk.3	O14548	OTTHUMG00000128605	ENST00000378669.1:c.215G>A	2.37:g.42578489C>T	ENSP00000367938:p.Gly72Asp	Somatic		Capture	Illumina GAIIx	4	42431993	Q9P118	Missense_Mutation	SNP	superfamily_Mitochondrial cytochrome c oxidase subunit VIIa,HMMPfam_COX7a	p.G72D	ENST00000378669.1	37	c.215	CCDS1808.1	2	.	.	.	.	.	.	.	.	.	.	C	13.78	2.338839	0.41398	.	.	ENSG00000115944	ENST00000378669;ENST00000234301	T;T	0.42131	0.98;0.98	5.39	4.52	0.55395	.	0.105419	0.64402	D	0.000003	T	0.58133	0.2101	M	0.61703	1.905	0.45056	D	0.998075	D	0.71674	0.998	D	0.69654	0.965	T	0.56056	-0.8042	10	0.33141	T	0.24	-13.9512	13.0649	0.59028	0.0:0.9208:0.0:0.0792	.	72	O14548	COX7R_HUMAN	D	72	ENSP00000367938:G72D;ENSP00000234301:G72D	ENSP00000234301:G72D	G	-	2	0	COX7A2L	42431993	1.000000	0.71417	0.890000	0.34922	0.173000	0.22820	5.619000	0.67729	1.266000	0.44231	-0.140000	0.14226	GGT	-	superfamily_Mitochondrial cytochrome c oxidase subunit VIIa,HMMPfam_COX7a		0.448	COX7A2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX7A2L	protein_coding	OTTHUMT00000250466.3	C	NM_004718		42431993	-1	no_errors	NM_004718	genbank	human	reviewed	54_36p	missense	SNP	0.981	T
RNF220	55182	genome.wustl.edu	37	1	44878386	44878386	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:44878386A>T	ENST00000355387.2	+	2	1067	c.617A>T	c.(616-618)aAt>aTt	p.N206I	RNF220_ENST00000372247.2_Missense_Mutation_p.N206I|RNF220_ENST00000361799.2_Missense_Mutation_p.N206I			Q5VTB9	RN220_HUMAN	ring finger protein 220	206					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						GAGGATCGGAATGACAGATGT	0.522																																																0			1											93.0	84.0	87.0					1																	44878386		2203	4300	6503	44650973	SO:0001583	missense	55182			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.617A>T	1.37:g.44878386A>T	ENSP00000347548:p.Asn206Ile	Somatic		Capture	Illumina GAIIx	4	44650973	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Missense_Mutation	SNP	superfamily_RING/U-box	p.N206I	ENST00000355387.2	37	c.617	CCDS510.1	1	.	.	.	.	.	.	.	.	.	.	A	8.658	0.899967	0.17686	.	.	ENSG00000187147	ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247	.	.	.	5.69	4.57	0.56435	.	0.176186	0.49916	D	0.000122	T	0.30166	0.0756	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.05971	-1.0853	9	0.31617	T	0.26	.	9.2865	0.37760	0.8432:0.0:0.1568:0.0	.	206	Q5VTB9	RN220_HUMAN	I	206	.	ENSP00000347548:N206I	N	+	2	0	RNF220	44650973	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.552000	0.60747	0.990000	0.38787	0.533000	0.62120	AAT	-	NULL		0.522	RNF220-001	KNOWN	basic|CCDS	protein_coding	RNF220	protein_coding	OTTHUMT00000020683.4	A	NM_018150		44650973	+1	no_errors	NM_018150	genbank	human	validated	54_36p	missense	SNP	1.000	T
EFCAB14	9813	genome.wustl.edu	37	1	47144202	47144202	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:47144202C>A	ENST00000371933.3	-	11	2395	c.1419G>T	c.(1417-1419)ttG>ttT	p.L473F	EFCAB14_ENST00000544071.1_Intron|EFCAB14-AS1_ENST00000418985.1_RNA|EFCAB14-AS1_ENST00000442839.1_RNA	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	473	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)										CAAATGCTCTCAAGCTCTCTG	0.478																																																0			1											110.0	107.0	108.0					1																	47144202		2203	4300	6503	46916789	SO:0001583	missense	9813			AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.1419G>T	1.37:g.47144202C>A	ENSP00000361001:p.Leu473Phe	Somatic		Capture	Illumina GAIIx	4	46916789	D3DQ23|Q5SXB8	Missense_Mutation	SNP	PatternScan_EF_HAND_1	p.L473F	ENST00000371933.3	37	c.1419	CCDS30706.1	1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654796	0.47467	.	.	ENSG00000159658	ENST00000371933	T	0.02280	4.36	5.14	1.02	0.19986	EF-hand-like domain (1);	0.229376	0.36066	N	0.002812	T	0.03695	0.0105	L	0.31926	0.97	0.23845	N	0.99668	D;B	0.69078	0.997;0.004	D;B	0.65987	0.94;0.011	T	0.43147	-0.9409	10	0.28530	T	0.3	-22.0368	1.588	0.02648	0.3522:0.3607:0.1245:0.1625	.	265;473	B7Z3D1;O75071	.;K0494_HUMAN	F	473	ENSP00000361001:L473F	ENSP00000361001:L473F	L	-	3	2	KIAA0494	46916789	0.468000	0.25839	0.019000	0.16419	0.865000	0.49528	0.177000	0.16801	0.037000	0.15575	0.591000	0.81541	TTG	-	NULL		0.478	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0494	protein_coding	OTTHUMT00000021931.1	C	NM_014774		46916789	-1	no_errors	NM_014774	genbank	human	validated	54_36p	missense	SNP	0.031	A
UBA1	7317	genome.wustl.edu	37	X	47074275	47074275	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:47074275G>A	ENST00000335972.6	+	26	3307	c.3124G>A	c.(3124-3126)Gac>Aac	p.D1042N	UBA1_ENST00000377351.4_Missense_Mutation_p.D1042N|UBA1_ENST00000377269.3_Missense_Mutation_p.D490N	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	1042					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GTGCTGTAACGACGAGAGCGG	0.627																																																0			X											127.0	93.0	104.0					X																	47074275		2203	4300	6503	46959219	SO:0001583	missense	7317			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.3124G>A	X.37:g.47074275G>A	ENSP00000338413:p.Asp1042Asn	Somatic		Capture	Illumina GAIIx	4	46959219	Q5JRR8|Q96E13	Missense_Mutation	SNP	superfamily_MoeB,HMMPfam_ThiF,PatternScan_UBIQUITIN_ACTIVAT_1,HMMPfam_UBA_e1_thiolCys,PatternScan_UBIQUITIN_ACTIVAT_2,HMMPfam_UBACT,HMMPfam_UBA_e1_C	p.D1042N	ENST00000335972.6	37	c.3124	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022624	0.75275	.	.	ENSG00000130985	ENST00000377351;ENST00000335972;ENST00000377269	T;T;T	0.51071	0.72;0.72;1.3	5.24	4.37	0.52481	Ubiquitin-activating enzyme e1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.49779	0.1577	M	0.77616	2.38	0.80722	D	1	B;B	0.29909	0.115;0.261	B;B	0.32724	0.103;0.151	T	0.51092	-0.8749	10	0.51188	T	0.08	-16.6479	10.3796	0.44104	0.0962:0.0:0.9038:0.0	.	490;1042	Q5JRR6;P22314	.;UBA1_HUMAN	N	1042;1042;490	ENSP00000366568:D1042N;ENSP00000338413:D1042N;ENSP00000366481:D490N	ENSP00000338413:D1042N	D	+	1	0	UBA1	46959219	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.009000	0.93606	1.112000	0.41740	0.529000	0.55759	GAC	-	HMMPfam_UBA_e1_C		0.627	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	protein_coding	OTTHUMT00000056389.1	G	NM_003334		46959219	+1	no_errors	NM_003334	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ARHGEF1	9138	genome.wustl.edu	37	19	42409343	42409343	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr19:42409343A>C	ENST00000354532.3	+	24	2414	c.2266A>C	c.(2266-2268)Act>Cct	p.T756P	ARHGEF1_ENST00000347545.4_Missense_Mutation_p.T723P|ARHGEF1_ENST00000378152.4_Missense_Mutation_p.T738P|ARHGEF1_ENST00000337665.4_Missense_Mutation_p.T771P|ARHGEF1_ENST00000599846.1_Missense_Mutation_p.T812P	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	756	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		TGCTCTCATCACTGAGACTGC	0.667																																																0			19											61.0	59.0	60.0					19																	42409343		2203	4300	6503	47101183	SO:0001583	missense	9138			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.2266A>C	19.37:g.42409343A>C	ENSP00000346532:p.Thr756Pro	Somatic		Capture	Illumina GAIIx	4	47101183	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	HMMPfam_RGS-like,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,superfamily_SSF50729,HMMSmart_PH	p.T771P	ENST00000354532.3	37	c.2311	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	A	18.66	3.672694	0.67928	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000337665;ENST00000378152	T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08	3.93	3.93	0.45458	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.072667	0.52532	D	0.000074	T	0.68540	0.3012	L	0.50333	1.59	0.45490	D	0.998456	D;D;D;P	0.64830	0.969;0.982;0.994;0.707	P;P;P;B	0.62560	0.596;0.788;0.904;0.33	T	0.66630	-0.5875	10	0.34782	T	0.22	-11.205	11.0518	0.47894	1.0:0.0:0.0:0.0	.	738;771;723;756	Q6NX52;Q92888-3;Q92888-2;Q92888	.;.;.;ARHG1_HUMAN	P	756;723;771;738	ENSP00000346532:T756P;ENSP00000344429:T723P;ENSP00000337261:T771P;ENSP00000367394:T738P	ENSP00000337261:T771P	T	+	1	0	ARHGEF1	47101183	0.999000	0.42202	0.997000	0.53966	0.991000	0.79684	4.462000	0.60121	1.560000	0.49568	0.454000	0.30748	ACT	-	superfamily_SSF50729,HMMSmart_PH		0.667	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	protein_coding	OTTHUMT00000463360.1	A	NM_199002		47101183	+1	no_errors	NM_199002	genbank	human	reviewed	54_36p	missense	SNP	0.980	C
STIL	6491	genome.wustl.edu	37	1	47717183	47717183	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:47717183C>G	ENST00000360380.3	-	18	3852	c.3489G>C	c.(3487-3489)caG>caC	p.Q1163H	STIL_ENST00000337817.5_Missense_Mutation_p.Q1163H|STIL_ENST00000243182.6_Missense_Mutation_p.Q1163H|STIL_ENST00000396221.2_Missense_Mutation_p.Q1146H|STIL_ENST00000371877.3_Missense_Mutation_p.Q1164H	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	1163					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				GACCACCAAGCTGTTCAGGTA	0.408																																																0			1											134.0	134.0	134.0					1																	47717183		2203	4300	6503	47489770	SO:0001583	missense	6491			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.3489G>C	1.37:g.47717183C>G	ENSP00000353544:p.Gln1163His	Somatic		Capture	Illumina GAIIx	4	47489770	Q5T0C5|Q68CN9	Missense_Mutation	SNP	NULL	p.Q1164H	ENST00000360380.3	37	c.3492	CCDS548.1	1	.	.	.	.	.	.	.	.	.	.	C	11.26	1.585141	0.28268	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182	T;T;T;T;T	0.19669	2.14;2.14;2.14;2.13;2.14	5.81	0.108	0.14548	.	0.475348	0.22667	N	0.057101	T	0.23370	0.0565	L	0.34521	1.04	0.09310	N	1	D;D;D	0.89917	0.998;0.998;1.0	D;D;D	0.69479	0.951;0.951;0.964	T	0.08806	-1.0704	10	0.40728	T	0.16	-3.9196	1.5248	0.02523	0.14:0.3259:0.143:0.3911	.	1146;1164;1163	E9PSF2;Q15468-2;Q15468	.;.;STIL_HUMAN	H	1163;1163;1164;1146;1163	ENSP00000353544:Q1163H;ENSP00000337367:Q1163H;ENSP00000360944:Q1164H;ENSP00000379523:Q1146H;ENSP00000243182:Q1163H	ENSP00000243182:Q1163H	Q	-	3	2	STIL	47489770	0.000000	0.05858	0.012000	0.15200	0.518000	0.34316	-0.172000	0.09868	0.083000	0.17047	-0.384000	0.06662	CAG	-	NULL		0.408	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STIL	protein_coding	OTTHUMT00000021649.2	C	NM_003035		47489770	-1	no_errors	NM_001048166	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
PSG3	5671	genome.wustl.edu	37	19	43233443	43233443	+	Missense_Mutation	SNP	T	T	G	rs146535064		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr19:43233443T>G	ENST00000327495.5	-	5	1259	c.1075A>C	c.(1075-1077)Aac>Cac	p.N359H	PSG3_ENST00000595140.1_Missense_Mutation_p.N359H	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	359	Ig-like C2-type 3.			Missing (in Ref. 9). {ECO:0000305}.	defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				GCTGGTGGGTTAGAGTCCGCG	0.453																																																0			19											161.0	171.0	168.0					19																	43233443		2203	4300	6503	47925283	SO:0001583	missense	5671				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.1075A>C	19.37:g.43233443T>G	ENSP00000332215:p.Asn359His	Somatic		Capture	Illumina GAIIx	4	47925283	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig,HMMSmart_IGc2	p.N359H	ENST00000327495.5	37	c.1075	CCDS12611.1	19	.	.	.	.	.	.	.	.	.	.	N	10.81	1.456492	0.26161	.	.	ENSG00000221826	ENST00000327495	T	0.13420	2.59	1.33	1.33	0.21861	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.23014	0.0556	M	0.64404	1.975	0.09310	N	1	P;P	0.46952	0.521;0.887	P;P	0.55391	0.615;0.775	T	0.08126	-1.0737	9	0.49607	T	0.09	.	4.7238	0.12931	0.0:0.0:0.0:1.0	.	359;359	P11464-2;Q16557	.;PSG3_HUMAN	H	359	ENSP00000332215:N359H	ENSP00000332215:N359H	N	-	1	0	PSG3	47925283	0.268000	0.24133	0.068000	0.19968	0.025000	0.11179	0.131000	0.15870	0.578000	0.29487	0.323000	0.21402	AAC	-	superfamily_SSF48726,HMMSmart_IGc2,HMMPfam_ig		0.453	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	protein_coding	OTTHUMT00000321423.2	T	NM_021016		47925283	-1	no_errors	NM_021016	genbank	human	validated	54_36p	missense	SNP	0.375	G
OR4A47	403253	genome.wustl.edu	37	11	48511008	48511008	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:48511008T>C	ENST00000446524.1	+	1	740	c.664T>C	c.(664-666)Tct>Cct	p.S222P		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						CATCTTGCACTCTTTAAAGAA	0.443																																																0			11											110.0	105.0	107.0					11																	48511008		2201	4298	6499	48467584	SO:0001583	missense	403253			BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.664T>C	11.37:g.48511008T>C	ENSP00000412752:p.Ser222Pro	Somatic		Capture	Illumina GAIIx	4	48467584		Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.S222P	ENST00000446524.1	37	c.664	CCDS31490.1	11	.	.	.	.	.	.	.	.	.	.	N	12.64	1.998358	0.35226	.	.	ENSG00000237388	ENST00000446524	T	0.00169	8.63	4.59	4.59	0.56863	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000053	T	0.00845	0.0028	H	0.95884	3.735	0.09310	N	1	D	0.71674	0.998	D	0.70487	0.969	T	0.14811	-1.0459	10	0.87932	D	0	.	11.9052	0.52708	0.0:0.0:0.0:1.0	.	222	Q6IF82	O4A47_HUMAN	P	222	ENSP00000412752:S222P	ENSP00000412752:S222P	S	+	1	0	OR4A47	48467584	0.000000	0.05858	0.170000	0.22879	0.246000	0.25737	-0.164000	0.09983	1.692000	0.51112	0.172000	0.16884	TCT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.443	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A47	protein_coding	OTTHUMT00000390559.1	T	NM_001005512		48467584	+1	no_errors	NM_001005512	genbank	human	validated	54_36p	missense	SNP	0.054	C
SLC5A9	200010	genome.wustl.edu	37	1	48703467	48703467	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:48703467C>T	ENST00000438567.2	+	11	1461	c.1409C>T	c.(1408-1410)cCc>cTc	p.P470L	SLC5A9_ENST00000236495.5_Missense_Mutation_p.P495L|SLC5A9_ENST00000533824.1_Missense_Mutation_p.P491L	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9	470					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						CTGGCCCCACCCATCACCGCT	0.572																																																0			1											132.0	107.0	116.0					1																	48703467		2203	4300	6503	48476054	SO:0001583	missense	200010			BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.1409C>T	1.37:g.48703467C>T	ENSP00000401730:p.Pro470Leu	Somatic		Capture	Illumina GAIIx	4	48476054	B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	Missense_Mutation	SNP	HMMPfam_SSF,PatternScan_NA_SOLUT_SYMP_1	p.P488L	ENST00000438567.2	37	c.1463	CCDS30709.2	1	.	.	.	.	.	.	.	.	.	.	c	29.4	5.006707	0.93287	.	.	ENSG00000117834	ENST00000533824;ENST00000438567;ENST00000236495	D;D;D	0.88896	-2.44;-2.44;-2.44	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.96800	0.8955	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98208	1.0471	10	0.87932	D	0	.	17.5459	0.87861	0.0:1.0:0.0:0.0	.	491;470;495	E9PJ08;Q2M3M2;E9PAK4	.;SC5A9_HUMAN;.	L	491;470;495	ENSP00000431900:P491L;ENSP00000401730:P470L;ENSP00000236495:P495L	ENSP00000236495:P495L	P	+	2	0	SLC5A9	48476054	1.000000	0.71417	0.935000	0.37517	0.948000	0.59901	7.651000	0.83577	2.624000	0.88883	0.651000	0.88453	CCC	-	HMMPfam_SSF		0.572	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A9	protein_coding	OTTHUMT00000022061.3	C	XM_117174		48476054	+1	no_errors	NM_001011547	genbank	human	validated	54_36p	missense	SNP	1.000	T
COL7A1	1294	genome.wustl.edu	37	3	48604107	48604107	+	Missense_Mutation	SNP	C	C	T	rs141883531		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr3:48604107C>T	ENST00000328333.8	-	111	8397	c.8290G>A	c.(8290-8292)Gag>Aag	p.E2764K	UCN2_ENST00000273610.3_5'Flank|COL7A1_ENST00000470076.1_5'Flank|COL7A1_ENST00000454817.1_Missense_Mutation_p.E2732K	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2764	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCCCCTCTCTCGCCAGGAGCT	0.632																																																0			3						C	LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	116.0	127.0	124.0		8290	5.1	1.0	3	dbSNP_134	124	0,8600		0,0,4300	no	missense	COL7A1	NM_000094.3	56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	2764/2945	48604107	2,13004	2203	4300	6503	48579111	SO:0001583	missense	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.8290G>A	3.37:g.48604107C>T	ENSP00000332371:p.Glu2764Lys	Somatic		Capture	Illumina GAIIx	4	48579111	Q14054|Q16507	Missense_Mutation	SNP	superfamily_vWA-like,HMMSmart_SM00327,HMMPfam_VWA,HMMSmart_SM00060,HMMPfam_fn3,superfamily_Fibronectin type III,HMMPfam_Collagen,superfamily_BPTI-like,HMMPfam_Kunitz_BPTI,PatternScan_BPTI_KUNITZ_1	p.E2764K	ENST00000328333.8	37	c.8290	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	C	14.13	2.444282	0.43429	4.54E-4	0.0	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.94138	-3.36;-3.36	5.12	5.12	0.69794	.	0.000000	0.44688	D	0.000437	D	0.92548	0.7633	L	0.42008	1.315	0.42338	D	0.992325	D	0.59767	0.986	P	0.54815	0.761	D	0.89958	0.4084	10	0.10377	T	0.69	.	15.2884	0.73849	0.0:1.0:0.0:0.0	.	2764	Q02388	CO7A1_HUMAN	K	2764;2732	ENSP00000332371:E2764K;ENSP00000412569:E2732K	ENSP00000332371:E2764K	E	-	1	0	COL7A1	48579111	1.000000	0.71417	0.980000	0.43619	0.396000	0.30629	4.816000	0.62642	2.404000	0.81709	0.467000	0.42956	GAG	-	HMMPfam_Collagen		0.632	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	protein_coding	OTTHUMT00000257519.1	C	NM_000094		48579111	-1	no_errors	NM_000094	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
RHAG	6005	genome.wustl.edu	37	6	49583450	49583450	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:49583450G>T	ENST00000371175.4	-	4	553	c.527C>A	c.(526-528)gCc>gAc	p.A176D	RHAG_ENST00000229810.7_Missense_Mutation_p.A176D	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	176					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					GGCCCCAAAGGCATGGATCGT	0.468																																					Ovarian(176;476 2003 7720 43408 44749)											0			6											117.0	110.0	113.0					6																	49583450		2203	4300	6503	49691409	SO:0001583	missense	6005				CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.527C>A	6.37:g.49583450G>T	ENSP00000360217:p.Ala176Asp	Somatic		Capture	Illumina GAIIx	4	49691409	B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Missense_Mutation	SNP	HMMPfam_Ammonium_transp,superfamily_RH_like_transpt	p.A176D	ENST00000371175.4	37	c.527	CCDS4927.1	6	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778013	0.90195	.	.	ENSG00000112077	ENST00000371175;ENST00000229810;ENST00000418071;ENST00000539403	T;T	0.25250	1.81;1.81	5.76	5.76	0.90799	Ammonium transporter AmtB-like (3);	0.091506	0.85682	D	0.000000	T	0.52322	0.1727	M	0.91196	3.185	0.80722	D	1	D;P;P	0.52996	0.957;0.87;0.87	P;P;P	0.60345	0.873;0.824;0.824	T	0.62440	-0.6854	10	0.87932	D	0	-8.7584	18.9695	0.92709	0.0:0.0:1.0:0.0	.	176;176;176	O43515;Q9UHG9;Q02094	.;.;RHAG_HUMAN	D	176	ENSP00000360217:A176D;ENSP00000229810:A176D	ENSP00000229810:A176D	A	-	2	0	RHAG	49691409	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	9.410000	0.97335	2.726000	0.93360	0.655000	0.94253	GCC	-	HMMPfam_Ammonium_transp,superfamily_RH_like_transpt		0.468	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHAG	protein_coding	OTTHUMT00000043806.1	G			49691409	-1	no_errors	NM_000324	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
HOXC11	3227	genome.wustl.edu	37	12	54367695	54367695	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:54367695G>C	ENST00000546378.1	+	1	786	c.670G>C	c.(670-672)Gga>Cga	p.G224R	HOTAIR_ENST00000455246.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.G224R|HOTAIR_ENST00000424518.1_RNA			O43248	HXC11_HUMAN	homeobox C11	224					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						GCCGGCCAAAGGAGCCGCCCC	0.716			T	NUP98	AML																																		Dom	yes		12	12q13.3	3227	homeo box C11		L	0			12											2.0	2.0	2.0					12																	54367695		1532	2822	4354	52653962	SO:0001583	missense	3227				CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.670G>C	12.37:g.54367695G>C	ENSP00000446680:p.Gly224Arg	Somatic		Capture	Illumina GAIIx	4	52653962	A8K7D1|Q96DH2	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.G224R	ENST00000546378.1	37	c.670	CCDS8867.1	12	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028689	0.35797	.	.	ENSG00000123388	ENST00000546378;ENST00000243082	D;T	0.95724	-3.79;1.86	4.22	4.22	0.49857	Homeodomain-related (1);Homeodomain-like (1);	0.143200	0.64402	D	0.000013	D	0.86715	0.5999	N	0.08118	0	0.37139	D	0.901614	B	0.34103	0.437	B	0.31495	0.131	D	0.86827	0.2008	10	0.66056	D	0.02	.	6.1702	0.20412	0.1015:0.1919:0.7066:0.0	.	224	O43248	HXC11_HUMAN	R	224	ENSP00000446680:G224R;ENSP00000243082:G224R	ENSP00000243082:G224R	G	+	1	0	HOXC11	52653962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.970000	0.29383	2.343000	0.79666	0.561000	0.74099	GGA	-	superfamily_Homeodomain-like		0.716	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC11	protein_coding	OTTHUMT00000358869.2	G			52653962	+1	no_errors	NM_014212	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
GPR84	53831	genome.wustl.edu	37	12	54756634	54756634	+	Silent	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:54756634G>T	ENST00000551809.1	-	1	1637	c.1002C>A	c.(1000-1002)ccC>ccA	p.P334P	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA|GPR84_ENST00000267015.3_Silent_p.P334P			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	334						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						GCAGCAAGAAGGGGATGTAGC	0.532																																																0			12											136.0	135.0	135.0					12																	54756634		2203	4300	6503	53042901	SO:0001819	synonymous_variant	53831			AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.1002C>A	12.37:g.54756634G>T		Somatic		Capture	Illumina GAIIx	4	53042901	B6V9G7	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.P334	ENST00000551809.1	37	c.1002	CCDS8878.1	12																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.532	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPR84	protein_coding	OTTHUMT00000406156.1	G			53042901	-1	no_errors	NM_020370	genbank	human	provisional	54_36p	silent	SNP	0.990	T
ITIH6	347365	genome.wustl.edu	37	X	54784956	54784956	+	Silent	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:54784956G>A	ENST00000218436.6	-	8	1580	c.1551C>T	c.(1549-1551)ggC>ggT	p.G517G		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	517					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										CCAGGTGGATGCCCAGTTCCT	0.627																																																0			X											26.0	24.0	25.0					X																	54784956		2202	4299	6501	54801681	SO:0001819	synonymous_variant	347365			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1551C>T	X.37:g.54784956G>A		Somatic		Capture	Illumina GAIIx	4	54801681	A6NN03	Silent	SNP	HMMSmart_VIT,HMMPfam_VIT,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,HMMPfam_ITI_HC_C	p.G517	ENST00000218436.6	37	c.1551	CCDS14361.1	X																																																																																			-	NULL		0.627	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH5L	protein_coding	OTTHUMT00000056814.2	G	NM_198510		54801681	-1	no_errors	NM_198510	genbank	human	provisional	54_36p	silent	SNP	0.474	A
HCRTR2	3062	genome.wustl.edu	37	6	55039484	55039484	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:55039484C>G	ENST00000370862.3	+	1	435	c.99C>G	c.(97-99)gaC>gaG	p.D33E		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	33					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			ACCCCACCGACTATGACGACG	0.537																																																0			6											148.0	132.0	137.0					6																	55039484		2203	4300	6503	55147443	SO:0001583	missense	3062			AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.99C>G	6.37:g.55039484C>G	ENSP00000359899:p.Asp33Glu	Somatic		Capture	Illumina GAIIx	4	55147443	Q5VTM0	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1,HMMPfam_Orexin_rec2	p.D33E	ENST00000370862.3	37	c.99	CCDS4956.1	6	.	.	.	.	.	.	.	.	.	.	C	12.72	2.024040	0.35701	.	.	ENSG00000137252	ENST00000370862	T	0.37915	1.17	4.99	4.99	0.66335	.	0.283281	0.34314	N	0.004074	T	0.11707	0.0285	L	0.38838	1.175	0.34545	D	0.710741	B	0.02656	0.0	B	0.04013	0.001	T	0.07520	-1.0768	10	0.11485	T	0.65	.	10.2166	0.43173	0.0:0.8469:0.0:0.1531	.	33	O43614	OX2R_HUMAN	E	33	ENSP00000359899:D33E	ENSP00000359899:D33E	D	+	3	2	HCRTR2	55147443	0.104000	0.21937	1.000000	0.80357	0.991000	0.79684	0.575000	0.23729	2.599000	0.87857	0.563000	0.77884	GAC	-	superfamily_SSF81321		0.537	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR2	protein_coding	OTTHUMT00000043392.1	C			55147443	+1	no_errors	NM_001526	genbank	human	reviewed	54_36p	missense	SNP	0.773	G
ANKRD55	79722	genome.wustl.edu	37	5	55439720	55439720	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:55439720G>C	ENST00000341048.4	-	7	671	c.520C>G	c.(520-522)Cag>Gag	p.Q174E	ANKRD55_ENST00000513241.2_Missense_Mutation_p.Q145E|ANKRD55_ENST00000504958.2_Intron|ANKRD55_ENST00000505970.2_5'UTR|RNA5SP184_ENST00000411071.1_RNA	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	174										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				TGTTGAGGCTGGTTGTGGAAA	0.532																																																0			5											250.0	248.0	248.0					5																	55439720		2203	4300	6503	55475477	SO:0001583	missense	79722			AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.520C>G	5.37:g.55439720G>C	ENSP00000342295:p.Gln174Glu	Somatic		Capture	Illumina GAIIx	4	55475477	B3KVT8|Q3KP45|Q9HAD3	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank	p.Q174E	ENST00000341048.4	37	c.520	CCDS34161.1	5	.	.	.	.	.	.	.	.	.	.	G	16.17	3.046990	0.55110	.	.	ENSG00000164512	ENST00000507283;ENST00000341048;ENST00000513241	D;D	0.83250	-1.7;-1.7	5.5	4.58	0.56647	.	0.371296	0.25500	N	0.030260	T	0.74604	0.3738	N	0.25485	0.75	0.21355	N	0.999715	B	0.16802	0.019	B	0.22152	0.038	T	0.66618	-0.5878	10	0.51188	T	0.08	.	13.985	0.64328	0.0:0.0:0.7626:0.2374	.	174	B3KVT8	.	E	174;174;145	ENSP00000342295:Q174E;ENSP00000423507:Q145E	ENSP00000342295:Q174E	Q	-	1	0	ANKRD55	55475477	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.195000	0.51013	2.578000	0.87016	0.650000	0.86243	CAG	-	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank		0.532	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD55	protein_coding	OTTHUMT00000368510.4	G	NM_024669		55475477	-1	no_errors	NM_024669	genbank	human	validated	54_36p	missense	SNP	1.000	C
LRP1	4035	genome.wustl.edu	37	12	57600504	57600504	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:57600504C>T	ENST00000243077.3	+	76	12305	c.11839C>T	c.(11839-11841)Cgg>Tgg	p.R3947W		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3947					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ACAGATTGACCGGGGTGTCAC	0.602																																																0			12											66.0	54.0	58.0					12																	57600504		2203	4300	6503	55886771	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.11839C>T	12.37:g.57600504C>T	ENSP00000243077:p.Arg3947Trp	Somatic		Capture	Illumina GAIIx	4	55886771	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b,PatternScan_EGF_1	p.R3947W	ENST00000243077.3	37	c.11839	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	17.09	3.301494	0.60195	.	.	ENSG00000123384	ENST00000243077	D	0.91180	-2.8	5.38	2.14	0.27477	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.488750	0.18177	N	0.149263	T	0.80747	0.4682	N	0.24115	0.695	0.80722	D	1	P	0.41929	0.765	B	0.33799	0.17	T	0.78727	-0.2091	10	0.66056	D	0.02	.	9.7761	0.40621	0.1262:0.3645:0.5093:0.0	.	3947	Q07954	LRP1_HUMAN	W	3947	ENSP00000243077:R3947W	ENSP00000243077:R3947W	R	+	1	2	LRP1	55886771	0.741000	0.28217	0.997000	0.53966	0.998000	0.95712	0.290000	0.18975	0.707000	0.31934	0.655000	0.94253	CGG	-	superfamily_YWTD domain,HMMPfam_Ldl_recept_b		0.602	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	C	NM_002332		55886771	+1	no_errors	NM_002332	genbank	human	validated	54_36p	missense	SNP	0.782	T
GLI1	2735	genome.wustl.edu	37	12	57861946	57861946	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:57861946G>C	ENST00000228682.2	+	10	1338	c.1247G>C	c.(1246-1248)aGg>aCg	p.R416T	GLI1_ENST00000546141.1_Missense_Mutation_p.R375T|GLI1_ENST00000543426.1_Missense_Mutation_p.R288T	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	416					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			GAGCCCAAGAGGGAGCGGGAA	0.622																																					Pancreas(157;841 1936 10503 41495 50368)											0			12											52.0	50.0	50.0					12																	57861946		2203	4300	6503	56148213	SO:0001583	missense	2735				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1247G>C	12.37:g.57861946G>C	ENSP00000228682:p.Arg416Thr	Somatic		Capture	Illumina GAIIx	4	56148213	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.R416T	ENST00000228682.2	37	c.1247	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	G	13.56	2.273795	0.40194	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T	0.13307	2.73;2.6;2.68;2.68	4.95	4.95	0.65309	.	0.112768	0.38436	N	0.001693	T	0.08313	0.0207	N	0.22421	0.69	0.28703	N	0.903953	B	0.16166	0.016	B	0.21546	0.035	T	0.23726	-1.0180	10	0.17369	T	0.5	.	6.8062	0.23779	0.0898:0.0:0.7332:0.177	.	416	P08151	GLI1_HUMAN	T	288;416;375;375;288	ENSP00000437607:R288T;ENSP00000228682:R416T;ENSP00000441006:R375T;ENSP00000434408:R375T	ENSP00000228682:R416T	R	+	2	0	GLI1	56148213	0.997000	0.39634	1.000000	0.80357	0.974000	0.67602	0.900000	0.28431	2.449000	0.82847	0.655000	0.94253	AGG	-	NULL		0.622	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	protein_coding	OTTHUMT00000394197.1	G	NM_005269		56148213	+1	no_errors	NM_005269	genbank	human	reviewed	54_36p	missense	SNP	0.849	C
KIFC3	3801	genome.wustl.edu	37	16	57800814	57800814	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr16:57800814C>G	ENST00000379655.4	-	10	1559	c.1302G>C	c.(1300-1302)aaG>aaC	p.K434N	KIFC3_ENST00000541240.1_Missense_Mutation_p.K456N|KIFC3_ENST00000421376.2_Missense_Mutation_p.K295N|KIFC3_ENST00000543930.1_Missense_Mutation_p.K295N|KIFC3_ENST00000445690.2_Missense_Mutation_p.K434N|KIFC3_ENST00000562903.1_Missense_Mutation_p.K295N|KIFC3_ENST00000465878.2_Missense_Mutation_p.K295N|KIFC3_ENST00000539578.1_Missense_Mutation_p.K376N|KIFC3_ENST00000540079.2_Missense_Mutation_p.K332N	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	434					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				CATTGTGGCACTTCTTACGCA	0.642																																																0			16											79.0	65.0	70.0					16																	57800814		2198	4300	6498	56358315	SO:0001583	missense	3801			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.1302G>C	16.37:g.57800814C>G	ENSP00000368976:p.Lys434Asn	Somatic		Capture	Illumina GAIIx	4	56358315	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00129,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1	p.K434N	ENST00000379655.4	37	c.1302	CCDS10789.2	16	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852564	0.71719	.	.	ENSG00000140859	ENST00000379655;ENST00000445690;ENST00000421376;ENST00000541240;ENST00000540079;ENST00000543930;ENST00000539578	T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.35	2.29	0.28610	.	0.045033	0.85682	D	0.000000	T	0.57242	0.2040	M	0.84433	2.695	0.50632	D	0.999882	D;D;P;P;P;P;P	0.55800	0.97;0.973;0.855;0.549;0.849;0.855;0.93	P;P;P;P;B;P;P	0.53861	0.548;0.736;0.548;0.481;0.288;0.548;0.581	T	0.61491	-0.7052	10	0.87932	D	0	.	10.3793	0.44101	0.0:0.7819:0.0:0.2181	.	456;376;295;332;139;434;295	B7Z484;F5H4I9;B7Z896;F5H3M2;B7Z3I6;Q9BVG8;A8K6S2	.;.;.;.;.;KIFC3_HUMAN;.	N	434;434;295;456;332;295;376	ENSP00000368976:K434N;ENSP00000401696:K434N;ENSP00000396399:K295N;ENSP00000442008:K456N;ENSP00000438805:K332N;ENSP00000444012:K295N;ENSP00000444884:K376N	ENSP00000368976:K434N	K	-	3	2	KIFC3	56358315	0.843000	0.29541	1.000000	0.80357	0.988000	0.76386	-0.037000	0.12164	0.238000	0.21222	-0.216000	0.12614	AAG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.642	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIFC3	protein_coding	OTTHUMT00000257329.2	C	NM_005550		56358315	-1	no_errors	NM_005550	genbank	human	validated	54_36p	missense	SNP	1.000	G
OS9	10956	genome.wustl.edu	37	12	58114203	58114203	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:58114203A>C	ENST00000315970.7	+	14	1821	c.1780A>C	c.(1780-1782)Aaa>Caa	p.K594Q	OS9_ENST00000389142.5_Missense_Mutation_p.K524Q|OS9_ENST00000257966.8_Missense_Mutation_p.K540Q|OS9_ENST00000435406.2_Missense_Mutation_p.K487Q|OS9_ENST00000413095.2_Missense_Mutation_p.K333Q|OS9_ENST00000552285.1_Missense_Mutation_p.K539Q|OS9_ENST00000389146.6_Missense_Mutation_p.K579Q|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000551035.1_Missense_Mutation_p.K507Q|OS9_ENST00000439210.2_Missense_Mutation_p.K465Q	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	594					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			AATTGAGATCAAAATTGTCCG	0.552																																																0			12											89.0	86.0	87.0					12																	58114203		2203	4300	6503	56400470	SO:0001583	missense	10956			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.1780A>C	12.37:g.58114203A>C	ENSP00000318165:p.Lys594Gln	Somatic		Capture	Illumina GAIIx	4	56400470	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	HMMPfam_PRKCSH,superfamily_Mannose 6-phosphate receptor domain	p.K594Q	ENST00000315970.7	37	c.1780	CCDS31843.1	12	.	.	.	.	.	.	.	.	.	.	A	23.8	4.454142	0.84209	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000439210;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000389142	T;T;T;T;T;T;T;T;T	0.56444	0.65;1.13;0.74;1.09;0.46;0.69;0.68;0.59;0.76	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.61337	0.2339	L	0.32530	0.975	0.24281	N	0.995204	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;0.998;0.996;0.999;0.967;1.0;0.999	D;D;D;P;D;P;D;D	0.91635	0.994;0.997;0.991;0.857;0.994;0.65;0.999;0.991	T	0.55817	-0.8081	10	0.44086	T	0.13	.	13.1995	0.59758	1.0:0.0:0.0:0.0	.	465;507;333;540;524;539;579;594	E7EW91;F8VUH2;B4E321;G3XA88;E9PEY5;Q9BW99;A6NLB2;Q13438	.;.;.;.;.;.;.;OS9_HUMAN	Q	539;594;465;579;333;507;540;487;524	ENSP00000450010:K539Q;ENSP00000318165:K594Q;ENSP00000407360:K465Q;ENSP00000373798:K579Q;ENSP00000413112:K333Q;ENSP00000447866:K507Q;ENSP00000257966:K540Q;ENSP00000389632:K487Q;ENSP00000373794:K524Q	ENSP00000257966:K540Q	K	+	1	0	OS9	56400470	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.072000	0.64389	2.107000	0.64212	0.533000	0.62120	AAA	-	NULL		0.552	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	protein_coding	OTTHUMT00000408344.1	A	NM_006812		56400470	+1	no_errors	NM_006812	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
SSRP1	6749	genome.wustl.edu	37	11	57095779	57095779	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:57095779G>A	ENST00000278412.2	-	13	1869	c.1603C>T	c.(1603-1605)Cct>Tct	p.P535S	snoU13_ENST00000459327.1_RNA|RP11-872D17.4_ENST00000534162.1_RNA	NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	535					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						ACCTCCACAGGCTTCTTGCGG	0.577																																					Colon(89;1000 1340 6884 23013 41819)											0			11											148.0	142.0	144.0					11																	57095779		2201	4296	6497	56852355	SO:0001583	missense	6749			M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.1603C>T	11.37:g.57095779G>A	ENSP00000278412:p.Pro535Ser	Somatic		Capture	Illumina GAIIx	4	56852355	Q5BJG8	Missense_Mutation	SNP	HMMPfam_SSrecog,superfamily_HMG-box,HMMSmart_HMG,HMMPfam_HMG_box	p.P535S	ENST00000278412.2	37	c.1603	CCDS7952.1	11	.	.	.	.	.	.	.	.	.	.	G	6.465	0.453929	0.12283	.	.	ENSG00000149136	ENST00000278412	D	0.93426	-3.22	4.8	2.84	0.33178	.	0.634087	0.15143	N	0.278180	D	0.82756	0.5106	N	0.12182	0.205	0.33766	D	0.622456	B	0.22003	0.063	B	0.15052	0.012	T	0.75323	-0.3358	10	0.12766	T	0.61	.	6.9012	0.24283	0.0917:0.0:0.735:0.1733	.	535	Q08945	SSRP1_HUMAN	S	535	ENSP00000278412:P535S	ENSP00000278412:P535S	P	-	1	0	SSRP1	56852355	1.000000	0.71417	0.956000	0.39512	0.488000	0.33401	3.626000	0.54245	0.556000	0.29098	0.561000	0.74099	CCT	-	NULL		0.577	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSRP1	protein_coding	OTTHUMT00000392460.1	G	NM_003146		56852355	-1	no_errors	NM_003146	genbank	human	reviewed	54_36p	missense	SNP	0.987	A
B3GAT3	26229	genome.wustl.edu	37	11	62388127	62388127	+	Nonsense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:62388127G>T	ENST00000265471.5	-	2	326	c.99C>A	c.(97-99)tgC>tgA	p.C33*	B3GAT3_ENST00000534026.1_Nonsense_Mutation_p.C33*|B3GAT3_ENST00000531383.1_Nonsense_Mutation_p.C33*	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	33					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						GGGGAGGAAGGCAGTCACATG	0.617																																																0			11											22.0	25.0	24.0					11																	62388127		2202	4299	6501	62144703	SO:0001587	stop_gained	26229			AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.99C>A	11.37:g.62388127G>T	ENSP00000265471:p.Cys33*	Somatic		Capture	Illumina GAIIx	4	62144703	B7ZAB3|Q96I06|Q9UEP0	Nonsense_Mutation	SNP	superfamily_SSF53448,HMMPfam_Glyco_transf_43	p.C33*	ENST00000265471.5	37	c.99	CCDS8025.1	11	.	.	.	.	.	.	.	.	.	.	G	28.3	4.907571	0.92107	.	.	ENSG00000149541	ENST00000265471;ENST00000531383;ENST00000534026;ENST00000534715	.	.	.	5.53	3.67	0.42095	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	7.5335	0.27697	0.1881:0.0:0.8119:0.0	.	.	.	.	X	33;33;33;56	.	ENSP00000265471:C33X	C	-	3	2	B3GAT3	62144703	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.447000	0.44917	1.343000	0.45638	0.655000	0.94253	TGC	-	NULL		0.617	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GAT3	protein_coding	OTTHUMT00000395588.1	G	NM_012200		62144703	-1	no_errors	NM_012200	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
NPBWR2	2832	genome.wustl.edu	37	20	62737497	62737497	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr20:62737497C>T	ENST00000369768.1	-	1	1027	c.688G>A	c.(688-690)Gtg>Atg	p.V230M		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	230					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					GTGTAGAGCACACAGATGGTG	0.662																																																0			20											57.0	49.0	52.0					20																	62737497		2202	4295	6497	62207941	SO:0001583	missense	2832			U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.688G>A	20.37:g.62737497C>T	ENSP00000358783:p.Val230Met	Somatic		Capture	Illumina GAIIx	4	62207941	Q6NWQ6|Q9H4K3	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V230M	ENST00000369768.1	37	c.688	CCDS13557.1	20	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747701	0.49257	.	.	ENSG00000125522	ENST00000369768	T	0.41758	0.99	3.9	0.0349	0.14185	GPCR, rhodopsin-like superfamily (1);	0.253757	0.31020	U	0.008413	T	0.45418	0.1341	M	0.70108	2.13	0.26012	N	0.981978	D	0.55800	0.973	P	0.53006	0.715	T	0.37478	-0.9704	10	0.72032	D	0.01	.	3.6748	0.08287	0.0:0.4064:0.2048:0.3888	.	230	P48146	NPBW2_HUMAN	M	230	ENSP00000358783:V230M	ENSP00000358783:V230M	V	-	1	0	NPBWR2	62207941	1.000000	0.71417	0.000000	0.03702	0.574000	0.36063	2.366000	0.44204	0.122000	0.18314	0.491000	0.48974	GTG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.662	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPBWR2	protein_coding	OTTHUMT00000080300.1	C	NM_005286		62207941	-1	no_errors	NM_005286	genbank	human	reviewed	54_36p	missense	SNP	0.999	T
MTMR8	55613	genome.wustl.edu	37	X	63551599	63551599	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:63551599G>T	ENST00000374852.3	-	11	1257	c.1190C>A	c.(1189-1191)cCt>cAt	p.P397H	MTMR8_ENST00000453546.1_Intron|MTMR8_ENST00000478487.1_5'UTR	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	397	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						GGTGAAGATAGGGGACACTTC	0.428																																																1	Whole gene deletion(1)	ovary(1)	X											52.0	46.0	48.0					X																	63551599		2203	4300	6503	63468324	SO:0001583	missense	55613			AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1190C>A	X.37:g.63551599G>T	ENSP00000363985:p.Pro397His	Somatic		Capture	Illumina GAIIx	4	63468324	Q5JT99|Q9NXP6	Missense_Mutation	SNP	superfamily_PH domain-like,superfamily_(Phosphotyrosine protein) phosphatases II,HMMPfam_Myotub-related,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.P397H	ENST00000374852.3	37	c.1190	CCDS14379.1	X	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127349	0.56721	.	.	ENSG00000102043	ENST00000374852;ENST00000247400	D	0.97906	-4.6	3.42	2.54	0.30619	Myotubularin phosphatase domain (1);	0.000000	0.51477	U	0.000087	D	0.99158	0.9709	H	0.99074	4.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98023	1.0372	10	0.87932	D	0	.	9.0002	0.36077	0.1178:0.0:0.8822:0.0	.	397	Q96EF0	MTMR8_HUMAN	H	397;283	ENSP00000363985:P397H	ENSP00000247400:P283H	P	-	2	0	MTMR8	63468324	1.000000	0.71417	0.044000	0.18714	0.804000	0.45430	6.289000	0.72696	0.616000	0.30141	0.600000	0.82982	CCT	-	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00404		0.428	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR8	protein_coding	OTTHUMT00000056949.2	G	NM_017677		63468324	-1	no_errors	NM_017677	genbank	human	provisional	54_36p	missense	SNP	1.000	T
SERTAD2	9792	genome.wustl.edu	37	2	64863627	64863627	+	Nonsense_Mutation	SNP	C	C	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:64863627C>A	ENST00000313349.3	-	2	676	c.379G>T	c.(379-381)Gag>Tag	p.E127*	SERTAD2_ENST00000476805.2_5'Flank	NM_014755.2	NP_055570.1	Q14140	SRTD2_HUMAN	SERTA domain containing 2	127					negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|skin(1)	12						AGGCAGGCCTCCAGGGGCGTA	0.692																																																0			2											39.0	43.0	42.0					2																	64863627		2203	4300	6503	64717131	SO:0001587	stop_gained	9792			D50917	CCDS33210.1	2p15	2007-05-01			ENSG00000179833	ENSG00000179833			30784	protein-coding gene	gene with protein product	"""transcriptional regulator interacting with the PHS-bromodomain 2"""					8590280, 11331592	Standard	NM_014755		Approved	TRIP-Br2, KIAA0127, Sei-2	uc002sde.2	Q14140	OTTHUMG00000152678	ENST00000313349.3:c.379G>T	2.37:g.64863627C>A	ENSP00000326933:p.Glu127*	Somatic		Capture	Illumina GAIIx	4	64717131	Q53TS2	Nonsense_Mutation	SNP	HMMPfam_SERTA	p.E127*	ENST00000313349.3	37	c.379	CCDS33210.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.481806	0.96307	.	.	ENSG00000179833	ENST00000313349	.	.	.	5.59	5.59	0.84812	.	0.153973	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-5.6176	19.587	0.95493	0.0:1.0:0.0:0.0	.	.	.	.	X	127	.	ENSP00000326933:E127X	E	-	1	0	SERTAD2	64717131	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.389000	0.79806	2.638000	0.89438	0.655000	0.94253	GAG	-	NULL		0.692	SERTAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD2	protein_coding	OTTHUMT00000327322.2	C	NM_014755		64717131	-1	no_errors	NM_014755	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
GUSB	2990	genome.wustl.edu	37	7	65432891	65432891	+	Missense_Mutation	SNP	G	G	A	rs143495981		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr7:65432891G>A	ENST00000304895.4	-	10	1610	c.1480C>T	c.(1480-1482)Ccg>Tcg	p.P494S	GUSB_ENST00000345660.6_Missense_Mutation_p.P443S|GUSB_ENST00000421103.1_Missense_Mutation_p.P348S	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	494					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						TCCACATACGGAGCCTAGGAC	0.547																																																0			7											48.0	46.0	47.0					7																	65432891		2203	4300	6503	65070326	SO:0001583	missense	2990			M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.1480C>T	7.37:g.65432891G>A	ENSP00000302728:p.Pro494Ser	Somatic		Capture	Illumina GAIIx	4	65070326	B4E1F6|E9PCV0|Q549U0|Q96CL9	Missense_Mutation	SNP	superfamily_Galactose-binding domain-like,HMMPfam_Glyco_hydro_2_N,HMMPfam_Glyco_hydro_2,superfamily_beta-Galactosidase/glucuronidase domain,HMMPfam_Glyco_hydro_2_C,superfamily_(Trans)glycosidases,PatternScan_GLYCOSYL_HYDROL_F2_1,PatternScan_GLYCOSYL_HYDROL_F2_2	p.P494S	ENST00000304895.4	37	c.1480	CCDS5530.1	7	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018034	0.54576	.	.	ENSG00000169919	ENST00000304895;ENST00000421103;ENST00000345660	D;D;D	0.95069	-3.6;-3.6;-3.6	5.45	5.45	0.79879	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 2, TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.90321	0.6972	L	0.31157	0.91	0.80722	D	1	B;B	0.30439	0.279;0.059	B;B	0.29176	0.099;0.068	D	0.87659	0.2533	10	0.18710	T	0.47	.	18.2566	0.90021	0.0:0.0:1.0:0.0	.	348;494	E9PCV0;P08236	.;BGLR_HUMAN	S	494;348;443	ENSP00000302728:P494S;ENSP00000391390:P348S;ENSP00000340734:P443S	ENSP00000302728:P494S	P	-	1	0	GUSB	65070326	1.000000	0.71417	0.132000	0.22025	0.306000	0.27790	7.891000	0.87319	2.550000	0.86006	0.542000	0.68232	CCG	-	HMMPfam_Glyco_hydro_2_C,superfamily_(Trans)glycosidases		0.547	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUSB	protein_coding	OTTHUMT00000251637.3	G	NM_000181		65070326	-1	no_errors	NM_000181	genbank	human	validated	54_36p	missense	SNP	0.999	A
ASL	435	genome.wustl.edu	37	7	65546870	65546870	+	Silent	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr7:65546870C>T	ENST00000304874.9	+	3	195	c.93C>T	c.(91-93)gaC>gaT	p.D31D	ASL_ENST00000395332.3_Silent_p.D31D|ASL_ENST00000395331.3_Silent_p.D31D|ASL_ENST00000380839.4_Silent_p.D31D	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	31			D -> N (in ARGINSA). {ECO:0000269|PubMed:17326097}.		arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	TTGCCTACGACCGGCACCTTT	0.597																																																0			7											68.0	55.0	59.0					7																	65546870		2203	4300	6503	65184305	SO:0001819	synonymous_variant	435				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.93C>T	7.37:g.65546870C>T		Somatic		Capture	Illumina GAIIx	4	65184305	E7EMI0|E9PE48|Q6LDS5|Q96HS2	Silent	SNP	HMMPfam_Lyase_1,superfamily_L-Aspartase-like,PatternScan_FUMARATE_LYASES	p.D31	ENST00000304874.9	37	c.93	CCDS5531.1	7																																																																																			-	HMMPfam_Lyase_1,superfamily_L-Aspartase-like		0.597	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASL	protein_coding	OTTHUMT00000251695.2	C	NM_000048		65184305	+1	no_errors	NM_000048	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
HEPH	9843	genome.wustl.edu	37	X	65392395	65392395	+	Silent	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:65392395C>G	ENST00000343002.2	+	2	1030	c.366C>G	c.(364-366)ccC>ccG	p.P122P	HEPH_ENST00000374727.3_Silent_p.P125P|HEPH_ENST00000519389.1_Silent_p.P176P|HEPH_ENST00000419594.1_Silent_p.P125P|HEPH_ENST00000336279.5_5'UTR|HEPH_ENST00000441993.2_Silent_p.P125P			Q9BQS7	HEPH_HUMAN	hephaestin	122	Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CCACTCGTCCCTATACCATCC	0.507																																																0			X											98.0	90.0	93.0					X																	65392395		2203	4300	6503	65309120	SO:0001819	synonymous_variant	9843			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.366C>G	X.37:g.65392395C>G		Somatic		Capture	Illumina GAIIx	4	65309120	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Silent	SNP	superfamily_Cupredoxins,HMMPfam_Cu-oxidase,PatternScan_MULTICOPPER_OXIDASE1,HMMPfam_Cu-oxidase_3,HMMPfam_Cu-oxidase_2,PatternScan_MULTICOPPER_OXIDASE2	p.P122	ENST00000343002.2	37	c.366		X																																																																																			-	superfamily_Cupredoxins		0.507	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	protein_coding	OTTHUMT00000056995.1	C	NM_138737		65309120	+1	no_errors	NM_138737	genbank	human	provisional	54_36p	silent	SNP	0.787	G
BRMS1	25855	genome.wustl.edu	37	11	66108277	66108277	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:66108277T>G	ENST00000359957.3	-	6	663	c.503A>C	c.(502-504)gAg>gCg	p.E168A	BRMS1_ENST00000425825.2_Missense_Mutation_p.E168A|RP11-867G23.12_ENST00000526655.1_RNA	NM_015399.3	NP_056214.1	Q9HCU9	BRMS1_HUMAN	breast cancer metastasis suppressor 1	168					apoptotic process (GO:0006915)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of anoikis (GO:2000210)|positive regulation of protein deacetylation (GO:0090312)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)			large_intestine(1)|liver(1)|lung(1)|prostate(1)|skin(1)	5						GCGGTCCTCCTCCAGCCTCTG	0.657																																					GBM(7;55 307 2662 20856 28942)											0			11											29.0	26.0	27.0					11																	66108277		2200	4295	6495	65864853	SO:0001583	missense	25855			AF147350	CCDS8135.1, CCDS44654.1	11q13-q13.2	2008-02-05				ENSG00000174744			17262	protein-coding gene	gene with protein product		606259				10850410	Standard	XM_005273883		Approved	DKFZP564A063	uc001oho.1	Q9HCU9		ENST00000359957.3:c.503A>C	11.37:g.66108277T>G	ENSP00000353042:p.Glu168Ala	Somatic		Capture	Illumina GAIIx	4	65864853	Q6IAI2	Missense_Mutation	SNP	HMMPfam_Sds3	p.E168A	ENST00000359957.3	37	c.503	CCDS8135.1	11	.	.	.	.	.	.	.	.	.	.	T	20.7	4.029411	0.75504	.	.	ENSG00000174744	ENST00000425825;ENST00000359957;ENST00000530756	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.76385	0.3980	M	0.83774	2.66	0.58432	D	0.999999	B;P	0.43662	0.177;0.814	P;P	0.55713	0.632;0.782	T	0.79933	-0.1594	9	0.72032	D	0.01	-29.7741	12.3708	0.55254	0.0:0.0:0.0:1.0	.	168;168	Q9HCU9;G5E9I4	BRMS1_HUMAN;.	A	168	.	ENSP00000353042:E168A	E	-	2	0	BRMS1	65864853	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.962000	0.56766	1.820000	0.53075	0.374000	0.22700	GAG	-	HMMPfam_Sds3		0.657	BRMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRMS1	protein_coding	OTTHUMT00000392958.2	T	NM_015399		65864853	-1	no_errors	NM_001024957	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
AR	367	genome.wustl.edu	37	X	66943649	66943649	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:66943649G>T	ENST00000374690.3	+	8	3253	c.2729G>T	c.(2728-2730)gGg>gTg	p.G910V	AR_ENST00000396043.2_Missense_Mutation_p.G378V|AR_ENST00000396044.3_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	909	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.		K -> R (in prostate cancer). {ECO:0000269|PubMed:9438000}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	ATCCTTTCTGGGAAAGTCAAG	0.483									Androgen Insensitivity Syndrome																																							0			X											186.0	154.0	165.0					X																	66943649		2203	4300	6503	66860374	SO:0001583	missense	367	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2729G>T	X.37:g.66943649G>T	ENSP00000363822:p.Gly910Val	Somatic		Capture	Illumina GAIIx	4	66860374	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	HMMPfam_Androgen_recep,HMMSmart_SM00399,HMMPfam_zf-C4,superfamily_Glucocorticoid receptor-like (DNA-binding domain),PatternScan_NUCLEAR_REC_DBD_1,superfamily_Nuclear receptor ligand-binding domain,HMMSmart_SM00430,HMMPfam_Hormone_recep	p.G910V	ENST00000374690.3	37	c.2729	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370733	0.82573	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396043	D;D	0.99803	-6.82;-6.82	5.18	5.18	0.71444	Nuclear hormone receptor, ligand-binding (1);	0.000000	0.85682	D	0.000000	D	0.99764	0.9904	M	0.87038	2.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97081	0.9784	10	0.87932	D	0	.	14.9089	0.70740	0.0:0.0:1.0:0.0	.	378;909	F1D8N5;P10275	.;ANDR_HUMAN	V	728;910;378	ENSP00000363822:G910V;ENSP00000379358:G378V	ENSP00000363822:G910V	G	+	2	0	AR	66860374	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.401000	0.81631	0.594000	0.82650	GGG	-	superfamily_Nuclear receptor ligand-binding domain		0.483	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	protein_coding	OTTHUMT00000057007.1	G	NM_000044		66860374	+1	no_errors	NM_000044	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
C11orf72	100505621	genome.wustl.edu	37	11	67372182	67372182	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:67372182G>C	ENST00000333139.3	-	3	599	c.359C>G	c.(358-360)tCt>tGt	p.S120C	RP11-655M14.12_ENST00000533876.1_RNA|NDUFV1_ENST00000415352.2_5'Flank|NDUFV1_ENST00000532303.1_5'Flank|NDUFV1_ENST00000322776.6_5'Flank|NDUFV1_ENST00000529927.1_5'Flank|C11orf72_ENST00000446232.1_Missense_Mutation_p.S120C			Q8NBR9	CK072_HUMAN	chromosome 11 open reading frame 72	120										central_nervous_system(1)|lung(2)|stomach(1)	4						tttcaggtgagagatgacagg	0.502																																																0			11											90.0	79.0	82.0					11																	67372182		2200	4295	6495	67128758	SO:0001583	missense	283135			AK075315		11q13.2	2011-05-24			ENSG00000184224	ENSG00000184224			26915	protein-coding gene	gene with protein product							Standard			Approved	FLJ90834	uc001omi.1	Q8NBR9	OTTHUMG00000156309	ENST00000333139.3:c.359C>G	11.37:g.67372182G>C	ENSP00000328640:p.Ser120Cys	Somatic		Capture	Illumina GAIIx	4	67128758		Missense_Mutation	SNP	NULL	p.S120C	ENST00000333139.3	37	c.359		11	.	.	.	.	.	.	.	.	.	.	g	10.98	1.505615	0.26949	.	.	ENSG00000184224	ENST00000333139;ENST00000446232	T;T	0.55052	0.54;0.54	2.84	-1.51	0.08664	.	.	.	.	.	T	0.34803	0.0910	.	.	.	.	.	.	B	0.21606	0.058	B	0.14023	0.01	T	0.30031	-0.9992	7	0.87932	D	0	.	3.5602	0.07880	0.4044:0.315:0.2807:0.0	.	120	Q8NBR9	CK072_HUMAN	C	120	ENSP00000328640:S120C;ENSP00000416700:S120C	ENSP00000328640:S120C	S	-	2	0	C11orf72	67128758	0.003000	0.15002	0.027000	0.17364	0.326000	0.28443	-0.062000	0.11674	-0.287000	0.09064	-0.494000	0.04653	TCT	-	NULL		0.502	C11orf72-001	KNOWN	basic|appris_principal	protein_coding	C11orf72	protein_coding	OTTHUMT00000343852.2	G	NM_173578		67128758	-1	no_errors	ENST00000333139	ensembl	human	known	54_36p	missense	SNP	0.003	C
YIPF6	286451	genome.wustl.edu	37	X	67731781	67731781	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:67731781G>C	ENST00000462683.1	+	2	892	c.148G>C	c.(148-150)Gac>Cac	p.D50H	YIPF6_ENST00000470730.1_3'UTR|YIPF6_ENST00000374622.2_Intron	NM_173834.3	NP_776195.2	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	50					intestinal epithelial cell development (GO:0060576)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	7						CCGGGAGTTTGACAGCTCCAC	0.418																																																0			X											156.0	134.0	141.0					X																	67731781		2203	4300	6503	67648506	SO:0001583	missense	286451			BC012469	CCDS14389.1, CCDS56604.1	Xq13.1	2008-02-05			ENSG00000181704	ENSG00000181704		"""Yip1 domain family"""	28304	protein-coding gene	gene with protein product						12477932	Standard	NM_173834		Approved	MGC21416, FinGER6	uc004dwz.3	Q96EC8	OTTHUMG00000021745	ENST00000462683.1:c.148G>C	X.37:g.67731781G>C	ENSP00000417573:p.Asp50His	Somatic		Capture	Illumina GAIIx	4	67648506	B4E1U7|G5E997|Q5JP08	Missense_Mutation	SNP	HMMPfam_Yip1	p.D50H	ENST00000462683.1	37	c.148	CCDS14389.1	X	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248023	0.59103	.	.	ENSG00000181704	ENST00000462683	T	0.45276	0.9	5.66	5.66	0.87406	.	0.048179	0.85682	D	0.000000	T	0.43942	0.1270	M	0.61703	1.905	0.80722	D	1	B	0.21147	0.052	B	0.18561	0.022	T	0.32640	-0.9899	10	0.49607	T	0.09	-1.2895	16.1014	0.81175	0.0:0.0:1.0:0.0	.	50	Q96EC8	YIPF6_HUMAN	H	50	ENSP00000417573:D50H	ENSP00000417573:D50H	D	+	1	0	YIPF6	67648506	1.000000	0.71417	0.996000	0.52242	0.921000	0.55340	7.499000	0.81566	2.404000	0.81709	0.525000	0.51046	GAC	-	NULL		0.418	YIPF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF6	protein_coding	OTTHUMT00000057016.1	G	NM_173834		67648506	+1	no_errors	NM_173834	genbank	human	provisional	54_36p	missense	SNP	1.000	C
THAP10	56906	genome.wustl.edu	37	15	71184262	71184262	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr15:71184262G>T	ENST00000249861.4	-	1	862	c.350C>A	c.(349-351)gCa>gAa	p.A117E	LRRC49_ENST00000443425.2_5'Flank|LRRC49_ENST00000260382.5_5'Flank|LRRC49_ENST00000544974.2_Intron|LRRC49_ENST00000560369.1_5'Flank	NM_020147.3	NP_064532.1	Q9P2Z0	THA10_HUMAN	THAP domain containing 10	117							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						ATGCCTGGCTGCCTGGAGCTC	0.682																																																0			15											34.0	35.0	35.0					15																	71184262		2199	4297	6496	68971316	SO:0001583	missense	56906			AL360202	CCDS10237.1	15q22.32	2013-01-25			ENSG00000129028	ENSG00000129028		"""THAP (C2CH-type zinc finger) domain containing"""	23193	protein-coding gene	gene with protein product		612538				12575992	Standard	NM_020147		Approved		uc002asv.3	Q9P2Z0	OTTHUMG00000133388	ENST00000249861.4:c.350C>A	15.37:g.71184262G>T	ENSP00000249861:p.Ala117Glu	Somatic		Capture	Illumina GAIIx	4	68971316	B2R8R0	Missense_Mutation	SNP	HMMPfam_THAP,HMMSmart_SM00692	p.A117E	ENST00000249861.4	37	c.350	CCDS10237.1	15	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140330	0.37825	.	.	ENSG00000129028	ENST00000249861	.	.	.	2.47	1.53	0.23141	.	.	.	.	.	T	0.12050	0.0293	N	0.08118	0	0.09310	N	1	P	0.38827	0.649	B	0.38655	0.278	T	0.14643	-1.0465	8	0.06494	T	0.89	.	4.9959	0.14240	0.1804:0.0:0.8196:0.0	.	117	Q9P2Z0	THA10_HUMAN	E	117	.	ENSP00000249861:A117E	A	-	2	0	THAP10	68971316	0.007000	0.16637	0.020000	0.16555	0.541000	0.35023	0.481000	0.22260	0.360000	0.24265	0.561000	0.74099	GCA	-	NULL		0.682	THAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP10	protein_coding	OTTHUMT00000257242.2	G	NM_020147		68971316	-1	no_errors	NM_020147	genbank	human	provisional	54_36p	missense	SNP	0.010	T
TSHZ1	10194	genome.wustl.edu	37	18	72998153	72998153	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr18:72998153A>G	ENST00000580243.1	+	2	1139	c.791A>G	c.(790-792)cAc>cGc	p.H264R	TSHZ1_ENST00000322038.5_Missense_Mutation_p.H219R			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	264					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		CTGACGGTGCACATGAACGAG	0.592																																																0			18											94.0	73.0	80.0					18																	72998153		2203	4300	6503	71127141	SO:0001583	missense	10194			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.791A>G	18.37:g.72998153A>G	ENSP00000464391:p.His264Arg	Somatic		Capture	Illumina GAIIx	4	71127141	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMSmart_SM00389,HMMPfam_Homeobox	p.H219R	ENST00000580243.1	37	c.656		18	.	.	.	.	.	.	.	.	.	.	A	12.40	1.928079	0.34002	.	.	ENSG00000179981	ENST00000322038	T	0.45276	0.9	5.28	5.28	0.74379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67496	-0.5656	10	0.87932	D	0	-34.188	15.2238	0.73333	1.0:0.0:0.0:0.0	.	264	Q6ZSZ6	TSH1_HUMAN	R	219	ENSP00000323584:H219R	ENSP00000323584:H219R	H	+	2	0	TSHZ1	71127141	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.957000	0.93082	2.454000	0.82982	0.561000	0.74099	CAC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.592	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	protein_coding	OTTHUMT00000444913.1	A	NM_005786		71127141	+1	no_errors	NM_005786	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ZNF638	27332	genome.wustl.edu	37	2	71592676	71592676	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:71592676C>T	ENST00000409544.1	+	6	2465	c.1835C>T	c.(1834-1836)aCt>aTt	p.T612I	ZNF638_ENST00000377802.2_Missense_Mutation_p.T612I|ZNF638_ENST00000355812.3_Missense_Mutation_p.T612I|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000264447.4_Missense_Mutation_p.T612I	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	612					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						AAGCCTAAAACTAGCAGTGGA	0.388																																																0			2											99.0	94.0	96.0					2																	71592676		2203	4300	6503	71446184	SO:0001583	missense	27332			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.1835C>T	2.37:g.71592676C>T	ENSP00000386433:p.Thr612Ile	Somatic		Capture	Illumina GAIIx	4	71446184	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	HMMSmart_SM00451,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.T612I	ENST00000409544.1	37	c.1835	CCDS1917.1	2	.	.	.	.	.	.	.	.	.	.	C	9.338	1.062304	0.19987	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000394137;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544	T;T;T;T;T;T	0.72394	-0.06;-0.65;0.52;-0.05;1.52;1.52	5.69	0.732	0.18283	.	0.784413	0.12240	N	0.486639	T	0.47395	0.1443	L	0.27053	0.805	0.09310	N	1	B;B;B;B;B;B	0.09022	0.0;0.002;0.001;0.001;0.0;0.0	B;B;B;B;B;B	0.14578	0.001;0.011;0.003;0.002;0.001;0.003	T	0.18429	-1.0337	10	0.18276	T	0.48	7.0E-4	0.2639	0.00222	0.2049:0.292:0.2004:0.3027	.	612;718;612;612;612;612	A8K583;F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;.;ZN638_HUMAN;.	I	612;718;191;612;612;612;612	ENSP00000386669:T612I;ENSP00000438189:T718I;ENSP00000348066:T612I;ENSP00000367033:T612I;ENSP00000264447:T612I;ENSP00000386433:T612I	ENSP00000264447:T612I	T	+	2	0	ZNF638	71446184	0.001000	0.12720	0.365000	0.25901	0.945000	0.59286	-0.452000	0.06787	0.552000	0.29026	0.563000	0.77884	ACT	-	NULL		0.388	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	protein_coding	OTTHUMT00000327431.1	C	NM_014497		71446184	+1	no_errors	NM_001014972	genbank	human	reviewed	54_36p	missense	SNP	0.159	T
PGM2L1	283209	genome.wustl.edu	37	11	74053598	74053598	+	Nonsense_Mutation	SNP	T	T	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:74053598T>A	ENST00000298198.4	-	12	1851	c.1540A>T	c.(1540-1542)Aaa>Taa	p.K514*		NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	514					glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					GGATATTCTTTTGGAGAATCA	0.338																																																0			11											78.0	87.0	84.0					11																	74053598		2200	4293	6493	73731246	SO:0001587	stop_gained	283209			AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.1540A>T	11.37:g.74053598T>A	ENSP00000298198:p.Lys514*	Somatic		Capture	Illumina GAIIx	4	73731246	Q96MQ7|Q9UIK3	Nonsense_Mutation	SNP	superfamily_Phosphoglucomutase first 3 domains,HMMPfam_PGM_PMM_I,HMMPfam_PGM_PMM_II,superfamily_Phosphoglucomutase C-terminal domain	p.K514*	ENST00000298198.4	37	c.1540	CCDS8231.1	11	.	.	.	.	.	.	.	.	.	.	T	40	8.088041	0.98648	.	.	ENSG00000165434	ENST00000298198	.	.	.	5.8	5.8	0.92144	.	0.296096	0.36893	N	0.002346	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.9902	14.1023	0.65065	0.0:0.0:0.0:1.0	.	.	.	.	X	514	.	ENSP00000298198:K514X	K	-	1	0	PGM2L1	73731246	0.988000	0.35896	1.000000	0.80357	0.990000	0.78478	1.231000	0.32624	2.203000	0.70933	0.460000	0.39030	AAA	-	superfamily_Phosphoglucomutase C-terminal domain		0.338	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM2L1	protein_coding	OTTHUMT00000398324.1	T	NM_173582		73731246	-1	no_errors	NM_173582	genbank	human	validated	54_36p	nonsense	SNP	0.998	A
CTRB1	1504	genome.wustl.edu	37	16	75258620	75258620	+	Silent	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr16:75258620C>T	ENST00000361017.4	+	7	656	c.648C>T	c.(646-648)ccC>ccT	p.P216P	RP11-331F4.4_ENST00000489723.1_RNA	NM_001906.4	NP_001897.4	P17538	CTRB1_HUMAN	chymotrypsinogen B1	216	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|lung(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.166)	Aprotinin(DB06692)	CTGGCGGCCCCCTGGTCTGCC	0.657																																																0			16											47.0	47.0	47.0					16																	75258620		2198	4300	6498	73816121	SO:0001819	synonymous_variant	1504				CCDS32490.1	16q23.1	2008-02-05			ENSG00000168925	ENSG00000168925	3.4.21.1		2521	protein-coding gene	gene with protein product		118890		CTRB		2917002, 8186414	Standard	NM_001906		Approved		uc002fds.3	P17538	OTTHUMG00000159272	ENST00000361017.4:c.648C>T	16.37:g.75258620C>T		Somatic		Capture	Illumina GAIIx	4	73816121		Silent	SNP	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	p.P216	ENST00000361017.4	37	c.648	CCDS32490.1	16																																																																																			-	superfamily_Trypsin-like serine proteases,HMMSmart_SM00020,HMMPfam_Trypsin,PatternScan_TRYPSIN_SER		0.657	CTRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTRB1	protein_coding	OTTHUMT00000354300.2	C	NM_001906		73816121	+1	no_errors	NM_001906	genbank	human	validated	54_36p	silent	SNP	0.998	T
MSH4	4438	genome.wustl.edu	37	1	76365303	76365303	+	Splice_Site	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:76365303G>C	ENST00000263187.3	+	19	2635	c.2531G>C	c.(2530-2532)gGa>gCa	p.G844A		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	844					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.G844E(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						ATAATTCTAGGATTAAAAGCT	0.313								Mismatch excision repair (MMR)																																								1	Substitution - Missense(1)	skin(1)	1											79.0	84.0	82.0					1																	76365303		2203	4298	6501	76137891	SO:0001630	splice_region_variant	4438			U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2531-1G>C	1.37:g.76365303G>C		Somatic		Capture	Illumina GAIIx	4	76137891	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	superfamily_DNA_mismatch_repair_MutS_connt,HMMPfam_MutS_II,HMMPfam_MutS_III,superfamily_DNA_repair_MutS_domIII,HMMSmart_MUTSd,HMMPfam_MutS_IV,HMMPfam_MutS_V,superfamily_SSF52540,HMMSmart_MUTSac,PatternScan_DNA_MISMATCH_REPAIR_2	p.G844A	ENST00000263187.3	37	c.2531	CCDS670.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994733	0.74703	.	.	ENSG00000057468	ENST00000263187	D	0.95171	-3.63	5.61	5.61	0.85477	DNA mismatch repair protein MutS, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96166	0.8750	M	0.64260	1.97	0.58432	D	0.999991	D	0.76494	0.999	D	0.79784	0.993	D	0.95302	0.8404	9	.	.	.	.	17.8182	0.88642	0.0:0.0:1.0:0.0	.	844	O15457	MSH4_HUMAN	A	844	ENSP00000263187:G844A	.	G	+	2	0	MSH4	76137891	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	7.777000	0.85628	2.643000	0.89663	0.467000	0.42956	GGA	-	HMMPfam_MutS_V,superfamily_SSF52540,HMMSmart_MUTSac		0.313	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH4	protein_coding	OTTHUMT00000026983.1	G	NM_002440	Missense_Mutation	76137891	+1	no_errors	NM_002440	genbank	human	validated	54_36p	missense	SNP	1.000	C
CAPN5	726	genome.wustl.edu	37	11	76829351	76829351	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:76829351G>A	ENST00000278559.3	+	8	1309	c.1120G>A	c.(1120-1122)Ggt>Agt	p.G374S	CAPN5_ENST00000456580.2_Missense_Mutation_p.G414S|CAPN5_ENST00000529629.1_Missense_Mutation_p.G374S|CAPN5_ENST00000531028.1_Intron	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	374	Domain III.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						ACAGAACCGCGGTGGCGGCTG	0.647																																																0			11											60.0	56.0	57.0					11																	76829351		2200	4292	6492	76506999	SO:0001583	missense	726				CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.1120G>A	11.37:g.76829351G>A	ENSP00000278559:p.Gly374Ser	Somatic		Capture	Illumina GAIIx	4	76506999	O00263	Missense_Mutation	SNP	PatternScan_THIOL_PROTEASE_HIS,PatternScan_THIOL_PROTEASE_ASN,superfamily_SSF54001,HMMSmart_CysPc,HMMPfam_Peptidase_C2,PatternScan_THIOL_PROTEASE_CYS,HMMPfam_Calpain_III,HMMSmart_calpain_III,superfamily_Peptidase_C2,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.G374S	ENST00000278559.3	37	c.1120	CCDS8248.1	11	.	.	.	.	.	.	.	.	.	.	G	3.618	-0.078077	0.07184	.	.	ENSG00000149260	ENST00000278559;ENST00000360841;ENST00000529629;ENST00000456580;ENST00000544318	T;T;T	0.39787	1.06;1.06;1.06	5.21	4.08	0.47627	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.376195	0.32655	N	0.005803	T	0.07638	0.0192	N	0.00067	-2.295	0.19300	N	0.999978	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.09377	0.003;0.001;0.004;0.001	T	0.31475	-0.9942	10	0.08381	T	0.77	.	6.8673	0.24100	0.7913:0.0:0.0756:0.1331	.	412;414;414;374	Q59GM2;E7EV01;Q6ZRM8;O15484	.;.;.;CAN5_HUMAN	S	374;414;374;414;414	ENSP00000278559:G374S;ENSP00000432332:G374S;ENSP00000409996:G414S	ENSP00000278559:G374S	G	+	1	0	CAPN5	76506999	0.611000	0.26992	0.991000	0.47740	0.826000	0.46750	0.887000	0.28254	0.816000	0.34421	-0.415000	0.06103	GGT	-	HMMPfam_Calpain_III,HMMSmart_calpain_III,superfamily_Peptidase_C2		0.647	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN5	protein_coding	OTTHUMT00000382564.2	G	NM_004055		76506999	+1	no_errors	NM_004055	genbank	human	reviewed	54_36p	missense	SNP	0.995	A
WDFY3	23001	genome.wustl.edu	37	4	85696070	85696070	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr4:85696070G>C	ENST00000295888.4	-	29	5064	c.4657C>G	c.(4657-4659)Ctt>Gtt	p.L1553V	WDFY3_ENST00000322366.6_Missense_Mutation_p.L1553V	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1553					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		ATATCTCGAAGAGTCAGGAGC	0.393																																																0			4											128.0	135.0	133.0					4																	85696070		2203	4300	6503	85915094	SO:0001583	missense	23001			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.4657C>G	4.37:g.85696070G>C	ENSP00000295888:p.Leu1553Val	Somatic		Capture	Illumina GAIIx	4	85915094	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	superfamily_ARM repeat,superfamily_Concanavalin A-like lectins/glucanases,superfamily_Cyclin-like,superfamily_PH domain-like,superfamily_BEACH domain,HMMPfam_Beach,superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1,HMMSmart_SM00064,HMMPfam_FYVE,superfamily_FYVE/PHD zinc finger	p.L1553V	ENST00000295888.4	37	c.4657	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894366	0.52121	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.61158	0.13;0.13	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.57770	0.2076	L	0.58583	1.82	0.80722	D	1	P	0.44044	0.825	B	0.39419	0.299	T	0.63739	-0.6569	10	0.56958	D	0.05	.	19.4007	0.94629	0.0:0.0:1.0:0.0	.	1553	Q8IZQ1	WDFY3_HUMAN	V	1553	ENSP00000318466:L1553V;ENSP00000295888:L1553V	ENSP00000295888:L1553V	L	-	1	0	WDFY3	85915094	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.672000	0.74477	2.650000	0.89964	0.655000	0.94253	CTT	-	NULL		0.393	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	protein_coding	OTTHUMT00000252811.2	G	NM_014991		85915094	-1	no_errors	NM_014991	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ABCB4	5244	genome.wustl.edu	37	7	87076386	87076386	+	Silent	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr7:87076386G>C	ENST00000265723.4	-	9	1080	c.969C>G	c.(967-969)gtC>gtG	p.V323V	ABCB4_ENST00000359206.3_Silent_p.V323V|ABCB4_ENST00000545634.1_Silent_p.V323V|ABCB4_ENST00000358400.3_Silent_p.V323V|ABCB4_ENST00000453593.1_Silent_p.V323V	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	323	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	CTTTTGATATGACTAGAGTGG	0.333																																																0			7											119.0	110.0	113.0					7																	87076386		2203	4300	6503	86914322	SO:0001819	synonymous_variant	5244			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.969C>G	7.37:g.87076386G>C		Somatic		Capture	Illumina GAIIx	4	86914322	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Silent	SNP	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.V323	ENST00000265723.4	37	c.969	CCDS5606.1	7																																																																																			-	superfamily_Multidrug resistance ABC transporter MsbA N-terminal domain,HMMPfam_ABC_membrane		0.333	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	protein_coding	OTTHUMT00000336083.1	G	NM_000443		86914322	-1	no_errors	NM_018849	genbank	human	reviewed	54_36p	silent	SNP	0.986	C
ABCG2	9429	genome.wustl.edu	37	4	89042873	89042873	+	Silent	SNP	G	G	T	rs141546179		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr4:89042873G>T	ENST00000237612.3	-	6	1148	c.603C>A	c.(601-603)atC>atA	p.I201I	ABCG2_ENST00000515655.1_Silent_p.I201I	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	201	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	AAGGATCAGTGATAAGCTCCA	0.408																																																0			4											147.0	139.0	142.0					4																	89042873		2203	4300	6503	89261897	SO:0001819	synonymous_variant	9429			AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.603C>A	4.37:g.89042873G>T		Somatic		Capture	Illumina GAIIx	4	89261897	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,HMMPfam_ABC2_membrane	p.I201	ENST00000237612.3	37	c.603	CCDS3628.1	4																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran		0.408	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG2	protein_coding	OTTHUMT00000253051.1	G	NM_004827		89261897	-1	no_errors	NM_004827	genbank	human	reviewed	54_36p	silent	SNP	0.998	T
HERC3	8916	genome.wustl.edu	37	4	89577085	89577085	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr4:89577085C>G	ENST00000402738.1	+	9	1207	c.968C>G	c.(967-969)gCa>gGa	p.A323G	HERC3_ENST00000407637.1_Missense_Mutation_p.A323G|HERC3_ENST00000264345.3_Missense_Mutation_p.A323G|HERC3_ENST00000543130.1_5'Flank	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	323					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GGTTGTGGAGCAAGAGGTCAA	0.463																																																0			4											207.0	188.0	194.0					4																	89577085		2203	4300	6503	89796108	SO:0001583	missense	8916			D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.968C>G	4.37:g.89577085C>G	ENSP00000385684:p.Ala323Gly	Somatic		Capture	Illumina GAIIx	4	89796108	A8K1S5|Q8IXX3	Missense_Mutation	SNP	superfamily_RCC1/BLIP-II,PatternScan_RCC1_2,HMMPfam_RCC1,superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT	p.A323G	ENST00000402738.1	37	c.968	CCDS34028.1	4	.	.	.	.	.	.	.	.	.	.	C	2.399	-0.338070	0.05278	.	.	ENSG00000138641	ENST00000402738;ENST00000407637;ENST00000264345	D;D;D	0.84730	-1.89;-1.89;-1.89	4.66	3.82	0.43975	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.301028	0.37437	N	0.002085	T	0.49949	0.1587	N	0.00358	-1.6	0.80722	D	1	B;B	0.23650	0.0;0.089	B;B	0.22386	0.001;0.039	T	0.57636	-0.7777	10	0.02654	T	1	.	7.0043	0.24828	0.3094:0.611:0.0:0.0795	.	323;323	Q15034;Q8IXX3	HERC3_HUMAN;.	G	323	ENSP00000385684:A323G;ENSP00000384005:A323G;ENSP00000264345:A323G	ENSP00000264345:A323G	A	+	2	0	HERC3	89796108	0.758000	0.28405	0.997000	0.53966	0.999000	0.98932	1.174000	0.31932	1.186000	0.42985	0.655000	0.94253	GCA	-	superfamily_RCC1/BLIP-II		0.463	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC3	protein_coding	OTTHUMT00000318081.2	C	NM_014606		89796108	+1	no_errors	NM_014606	genbank	human	provisional	54_36p	missense	SNP	0.955	G
GABRR2	2570	genome.wustl.edu	37	6	89967689	89967689	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:89967689C>G	ENST00000402938.3	-	9	1231	c.1098G>C	c.(1096-1098)atG>atC	p.M366I	GABRR2_ENST00000602399.1_Missense_Mutation_p.M391I	NM_002043.3	NP_002034.3	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 2	366					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(10)|prostate(2)|urinary_tract(1)	21		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	GCATTCCACACATGCACGGGA	0.532																																																0			6											58.0	54.0	55.0					6																	89967689		2203	4300	6503	90024408	SO:0001583	missense	2570				CCDS5020.2, CCDS5020.3	6q15	2012-06-22	2012-02-03		ENSG00000111886	ENSG00000111886		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4091	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 2"""	137162	"""gamma-aminobutyric acid (GABA) receptor, rho 2"""			1315307	Standard	NM_002043		Approved		uc003pnb.3	P28476	OTTHUMG00000015198	ENST00000402938.3:c.1098G>C	6.37:g.89967689C>G	ENSP00000386029:p.Met366Ile	Somatic		Capture	Illumina GAIIx	4	90024408	A2BDE4|Q9H153	Missense_Mutation	SNP	superfamily_Nicotinic receptor ligand binding domain-like,HMMPfam_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL,superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_memb	p.M391I	ENST00000402938.3	37	c.1173	CCDS5020.3	6	.	.	.	.	.	.	.	.	.	.	C	3.345	-0.133751	0.06711	.	.	ENSG00000111886	ENST00000402938	.	.	.	5.82	5.82	0.92795	Neurotransmitter-gated ion-channel transmembrane domain (2);	1.016230	0.07816	N	0.959048	T	0.13415	0.0325	N	0.17800	0.525	0.28503	N	0.913905	B	0.02656	0.0	B	0.09377	0.004	T	0.12604	-1.0541	8	.	.	.	.	9.7825	0.40656	0.0:0.8114:0.0:0.1886	.	391	P28476	GBRR2_HUMAN	I	391	.	.	M	-	3	0	GABRR2	90024408	0.000000	0.05858	0.985000	0.45067	0.099000	0.18886	-0.843000	0.04350	2.766000	0.95052	0.650000	0.86243	ATG	-	superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_memb		0.532	GABRR2-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	GABRR2	protein_coding	OTTHUMT00000041482.3	C			90024408	-1	no_errors	NM_002043	genbank	human	reviewed	54_36p	missense	SNP	0.981	G
NR2F1	7025	genome.wustl.edu	37	5	92929390	92929390	+	Silent	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:92929390C>T	ENST00000327111.3	+	3	2801	c.1114C>T	c.(1114-1116)Ctg>Ttg	p.L372L	NR2F1_ENST00000506162.1_3'UTR	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	372					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		CAAACTGCTGCTGCGACTGCC	0.607																																																0			5											94.0	94.0	94.0					5																	92929390		2203	4300	6503	92955146	SO:0001819	synonymous_variant	7025			BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.1114C>T	5.37:g.92929390C>T		Somatic		Capture	Illumina GAIIx	4	92955146		Silent	SNP	HMMSmart_ZnF_C4,HMMPfam_zf-C4,superfamily_SSF57716,PatternScan_NUCLEAR_REC_DBD_1,superfamily_Str_ncl_receptor,HMMPfam_zf-C4_C,HMMSmart_HOLI,HMMPfam_Hormone_recep	p.L372	ENST00000327111.3	37	c.1114	CCDS4068.1	5																																																																																			-	superfamily_Str_ncl_receptor,HMMSmart_HOLI,HMMPfam_Hormone_recep		0.607	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2F1	protein_coding	OTTHUMT00000239293.2	C	NM_005654		92955146	+1	no_errors	NM_005654	genbank	human	provisional	54_36p	silent	SNP	1.000	T
ABCA4	24	genome.wustl.edu	37	1	94528847	94528847	+	Silent	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:94528847G>A	ENST00000370225.3	-	12	1667	c.1581C>T	c.(1579-1581)agC>agT	p.S527S	ABCA4_ENST00000535735.1_Silent_p.S527S	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	527					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CATCATTGTAGCTTTCAAACT	0.488																																																0			1											109.0	103.0	105.0					1																	94528847		2203	4300	6503	94301435	SO:0001819	synonymous_variant	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1581C>T	1.37:g.94528847G>A		Somatic		Capture	Illumina GAIIx	4	94301435	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.S527	ENST00000370225.3	37	c.1581	CCDS747.1	1																																																																																			-	NULL		0.488	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	G	NM_000350		94301435	-1	no_errors	NM_000350	genbank	human	reviewed	54_36p	silent	SNP	0.255	A
ANKRD20A8P	729171	genome.wustl.edu	37	2	95519316	95519316	+	RNA	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:95519316G>C	ENST00000432432.2	-	0	397					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		CTTTGTCACAGATATCAATCT	0.383																																																0			2																																								94883043			0					2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95519316G>C		Somatic		Capture	Illumina GAIIx	4	94883043	A6NC18	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248	p.I96M	ENST00000432432.2	37	c.288		2																																																																																			-	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank		0.383	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	ENSG00000187984	pseudogene	OTTHUMT00000451404.1	G			94883043	-1	no_start_codon:no_stop_codon	ENST00000338192	ensembl	human	known	54_36p	missense	SNP	0.714	C
RHOBTB3	22836	genome.wustl.edu	37	5	95067664	95067664	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:95067664T>C	ENST00000379982.3	+	2	612	c.104T>C	c.(103-105)gTc>gCc	p.V35A	RHOBTB3_ENST00000506817.1_Missense_Mutation_p.V35A|CTD-2154I11.2_ENST00000512486.1_RNA|CTD-2154I11.2_ENST00000513235.1_RNA|RHOBTB3_ENST00000515852.1_3'UTR	NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	35	Rho-like.				ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		AGCCCTCTGGTCTCCGGGGAC	0.632																																																0			5											50.0	48.0	49.0					5																	95067664		2203	4300	6503	95093420	SO:0001583	missense	22836			AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.104T>C	5.37:g.95067664T>C	ENSP00000369318:p.Val35Ala	Somatic		Capture	Illumina GAIIx	4	95093420	A0PJA4|A8K1W9|Q8IW06	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_BTB,superfamily_BTB/POZ_fold,HMMPfam_BTB	p.V35A	ENST00000379982.3	37	c.104	CCDS4077.1	5	.	.	.	.	.	.	.	.	.	.	T	18.06	3.539167	0.65085	.	.	ENSG00000164292	ENST00000506959;ENST00000506817;ENST00000379982	T;T;T	0.69926	1.04;0.92;-0.44	4.86	3.67	0.42095	.	0.169666	0.37623	N	0.002011	T	0.58424	0.2121	N	0.19112	0.55	0.80722	D	1	B;D	0.64830	0.018;0.994	B;P	0.51833	0.011;0.681	T	0.60622	-0.7227	10	0.72032	D	0.01	-0.4263	8.9223	0.35619	0.1664:0.0:0.0:0.8335	.	35;35	O94955;D6RG10	RHBT3_HUMAN;.	A	41;35;35	ENSP00000423688:V41A;ENSP00000426479:V35A;ENSP00000369318:V35A	ENSP00000369318:V35A	V	+	2	0	RHOBTB3	95093420	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	4.597000	0.61062	0.773000	0.33404	0.455000	0.32223	GTC	-	NULL		0.632	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB3	protein_coding	OTTHUMT00000241658.1	T	NM_014899		95093420	+1	no_errors	NM_014899	genbank	human	validated	54_36p	missense	SNP	0.992	C
LMTK2	22853	genome.wustl.edu	37	7	97766717	97766717	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr7:97766717G>A	ENST00000297293.5	+	2	487	c.194G>A	c.(193-195)tGt>tAt	p.C65Y	LMTK2_ENST00000493372.1_3'UTR	NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	65					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					ATTGCAAACTGTGTATCCTGC	0.398																																																0			7											90.0	88.0	89.0					7																	97766717		2203	4300	6503	97604653	SO:0001583	missense	22853			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.194G>A	7.37:g.97766717G>A	ENSP00000297293:p.Cys65Tyr	Somatic		Capture	Illumina GAIIx	4	97604653	A4D272|Q75MG7|Q9UPS3	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.C65Y	ENST00000297293.5	37	c.194	CCDS5654.1	7	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418252	0.83449	.	.	ENSG00000164715	ENST00000297293	T	0.81078	-1.45	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.88400	0.6426	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89750	0.3939	10	0.87932	D	0	.	17.1665	0.86818	0.0:0.0:1.0:0.0	.	65	Q8IWU2	LMTK2_HUMAN	Y	65	ENSP00000297293:C65Y	ENSP00000297293:C65Y	C	+	2	0	LMTK2	97604653	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.795000	0.91872	2.275000	0.75901	0.591000	0.81541	TGT	-	NULL		0.398	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	protein_coding	OTTHUMT00000334560.1	G	NM_014916		97604653	+1	no_errors	NM_014916	genbank	human	validated	54_36p	missense	SNP	1.000	A
ALDH1A3	220	genome.wustl.edu	37	15	101420211	101420211	+	Splice_Site	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr15:101420211G>C	ENST00000329841.5	+	1	631	c.99G>C	c.(97-99)aaG>aaC	p.K33N	RP11-66B24.8_ENST00000558568.1_lincRNA|ALDH1A3_ENST00000557963.1_Missense_Mutation_p.K33N|ALDH1A3_ENST00000346623.6_Splice_Site_p.K33N|ALDH1A3_ENST00000560555.1_3'UTR	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	33					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	AGTTCACCAAGGTGAGGCGGG	0.771																																																0			15											6.0	10.0	9.0					15																	101420211		1486	2737	4223	99237734	SO:0001630	splice_region_variant	220			U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.99+1G>C	15.37:g.101420211G>C		Somatic		Capture	Illumina GAIIx	4	99237734	Q6NT64	Missense_Mutation	SNP	superfamily_Aldehyde_DH/Histidinol_DH,HMMPfam_Aldedh,PatternScan_ALDEHYDE_DEHYDR_GLU,PatternScan_ALDEHYDE_DEHYDR_CYS	p.K33N	ENST00000329841.5	37	c.99	CCDS10389.1	15	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698733	0.88830	.	.	ENSG00000184254	ENST00000329841;ENST00000415812;ENST00000346623	T;T	0.16597	2.33;2.38	3.65	3.65	0.41850	Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.107471	0.64402	D	0.000007	T	0.25975	0.0633	N	0.19112	0.55	0.34143	D	0.666618	D;B;B	0.58620	0.983;0.23;0.23	D;B;B	0.72982	0.979;0.063;0.063	T	0.40403	-0.9565	10	0.62326	D	0.03	.	14.0922	0.64998	0.0:0.0:1.0:0.0	.	44;33;33	Q7Z3A2;B2R5T2;P47895	.;.;AL1A3_HUMAN	N	33;33;44	ENSP00000332256:K33N;ENSP00000343294:K44N	ENSP00000332256:K33N	K	+	3	2	ALDH1A3	99237734	1.000000	0.71417	0.998000	0.56505	0.953000	0.61014	4.568000	0.60857	1.860000	0.53959	0.561000	0.74099	AAG	-	superfamily_Aldehyde_DH/Histidinol_DH		0.771	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A3	protein_coding	OTTHUMT00000313620.2	G		Missense_Mutation	99237734	+1	no_errors	NM_000693	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
C7orf43	55262	genome.wustl.edu	37	7	99753465	99753465	+	Intron	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr7:99753465G>C	ENST00000316937.3	-	9	1426				C7orf43_ENST00000498638.1_5'Flank|MIR4658_ENST00000584344.1_RNA|C7orf43_ENST00000394035.2_5'UTR|C7orf43_ENST00000419841.1_Intron|C7orf43_ENST00000457641.1_Intron	NM_018275.3	NP_060745.3	Q8WVR3	CG043_HUMAN	chromosome 7 open reading frame 43											breast(1)|endometrium(3)|large_intestine(3)|lung(2)|prostate(1)	10	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCAGAAACAGGGACCAGCAAA	0.587																																																0			7											37.0	35.0	36.0					7																	99753465		2203	4300	6503	99591401	SO:0001627	intron_variant	55262				CCDS5687.1	7q22.1	2011-11-25			ENSG00000146826	ENSG00000146826			25604	protein-coding gene	gene with protein product						12477932	Standard	NM_018275		Approved	FLJ10925	uc003utr.3	Q8WVR3	OTTHUMG00000154862	ENST00000316937.3:c.1241-17C>G	7.37:g.99753465G>C		Somatic		Capture	Illumina GAIIx	4	99591401	A4D2A9|D6W5U4|Q9BQJ1|Q9BUB6|Q9NV47	Silent	SNP	NULL	p.S34	ENST00000316937.3	37	c.102	CCDS5687.1	7																																																																																			-	NULL		0.587	C7orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf43	protein_coding	OTTHUMT00000337395.2	G	NM_018275		99591401	-1	no_errors	ENST00000275726	ensembl	human	known	54_36p	silent	SNP	0.000	C
MUC12	10071	genome.wustl.edu	37	7	100642532	100642532	+	Silent	SNP	G	G	A	rs146028281	byFrequency	TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr7:100642532G>A	ENST00000379442.3	+	5	9117	c.9117G>A	c.(9115-9117)gcG>gcA	p.A3039A	MUC12_ENST00000536621.1_Silent_p.A2896A			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3039	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACACAACAGCGTTCCCTGACA	0.567																																																0			7											92.0	204.0	173.0					7																	100642532		411	1074	1485	100429252	SO:0001819	synonymous_variant	10071			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.9117G>A	7.37:g.100642532G>A		Somatic		Capture	Illumina GAIIx	4	100429252	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	NULL	p.A700	ENST00000379442.3	37	c.2100		7																																																																																			-	NULL		0.567	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	protein_coding	OTTHUMT00000347234.1	G	XM_379904		100429252	+1	no_start_codon:no_stop_codon	ENST00000379442	ensembl	human	known	54_36p	silent	SNP	0.000	A
COL15A1	1306	genome.wustl.edu	37	9	101798461	101798461	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr9:101798461G>A	ENST00000375001.3	+	20	2722	c.2299G>A	c.(2299-2301)Gga>Aga	p.G767R		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	767	Triple-helical region 3 (COL3).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				GGGTCTCAAAGGAGAGAAAGG	0.493																																																0			9											68.0	88.0	81.0					9																	101798461		2203	4300	6503	100838282	SO:0001583	missense	1306			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2299G>A	9.37:g.101798461G>A	ENSP00000364140:p.Gly767Arg	Somatic		Capture	Illumina GAIIx	4	100838282	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	superfamily_ConA_like_lec_gl,HMMSmart_TSPN,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_Collagen,superfamily_C-type_lectin_fold,HMMPfam_Endostatin	p.G767R	ENST00000375001.3	37	c.2299	CCDS35081.1	9	.	.	.	.	.	.	.	.	.	.	G	15.86	2.956874	0.53293	.	.	ENSG00000204291	ENST00000375001	D	0.91577	-2.87	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.96396	0.8824	M	0.93507	3.425	0.45541	D	0.998499	D	0.89917	1.0	D	0.91635	0.999	D	0.97115	0.9807	10	0.87932	D	0	-13.2268	14.6855	0.69047	0.0:0.0:1.0:0.0	.	767	P39059	COFA1_HUMAN	R	767	ENSP00000364140:G767R	ENSP00000364140:G767R	G	+	1	0	COL15A1	100838282	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	4.850000	0.62889	2.589000	0.87451	0.655000	0.94253	GGA	-	NULL		0.493	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL15A1	protein_coding	OTTHUMT00000053386.3	G	NM_001855		100838282	+1	no_errors	NM_001855	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TRPC6	7225	genome.wustl.edu	37	11	101362391	101362391	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:101362391C>G	ENST00000344327.3	-	3	1448	c.1024G>C	c.(1024-1026)Gtc>Ctc	p.V342L	TRPC6_ENST00000348423.4_Intron|TRPC6_ENST00000532133.1_Missense_Mutation_p.V342L|TRPC6_ENST00000360497.4_Missense_Mutation_p.V342L	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	342					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		ATGGCCTCGACTTCTTCAGTG	0.413																																					Colon(166;1315 1927 11094 12848 34731)											0			11											119.0	115.0	116.0					11																	101362391		2203	4299	6502	100867601	SO:0001583	missense	7225			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1024G>C	11.37:g.101362391C>G	ENSP00000340913:p.Val342Leu	Somatic		Capture	Illumina GAIIx	4	100867601	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,HMMPfam_TRP_2,HMMPfam_Ion_trans	p.V342L	ENST00000344327.3	37	c.1024	CCDS8311.1	11	.	.	.	.	.	.	.	.	.	.	C	7.458	0.644148	0.14451	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000360497	T;T;T	0.63417	-0.04;-0.04;-0.04	6.14	5.23	0.72850	.	0.051641	0.85682	D	0.000000	T	0.48732	0.1516	L	0.28776	0.89	0.58432	D	0.999999	P;B	0.36249	0.545;0.214	B;B	0.36289	0.221;0.11	T	0.47873	-0.9083	10	0.06236	T	0.91	0.0341	17.2076	0.86922	0.1272:0.8728:0.0:0.0	.	342;342	Q9Y210-3;Q9Y210	.;TRPC6_HUMAN	L	342	ENSP00000340913:V342L;ENSP00000435574:V342L;ENSP00000353687:V342L	ENSP00000340913:V342L	V	-	1	0	TRPC6	100867601	1.000000	0.71417	0.991000	0.47740	0.066000	0.16364	6.011000	0.70760	1.635000	0.50512	-0.133000	0.14855	GTC	-	NULL		0.413	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	protein_coding	OTTHUMT00000394770.1	C	NM_004621		100867601	-1	no_errors	NM_004621	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
NOLC1	9221	genome.wustl.edu	37	10	103912207	103912207	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr10:103912207C>A	ENST00000605788.1	+	1	275	c.40C>A	c.(40-42)Ctg>Atg	p.L14M	NOLC1_ENST00000488254.2_Missense_Mutation_p.L14M|NOLC1_ENST00000603742.1_5'UTR|NOLC1_ENST00000405356.1_Missense_Mutation_p.L14M	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	14	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		TCCCAGCGACCTGTATCCCCT	0.622																																																0			10											84.0	81.0	82.0					10																	103912207		2203	4300	6503	103902197	SO:0001583	missense	9221			Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.40C>A	10.37:g.103912207C>A	ENSP00000474710:p.Leu14Met	Somatic		Capture	Illumina GAIIx	4	103902197	Q15030|Q5VV70|Q9BUV3	Missense_Mutation	SNP	HMMPfam_SRP40_C	p.L14M	ENST00000605788.1	37	c.40	CCDS7530.1	10	.	.	.	.	.	.	.	.	.	.	C	15.05	2.716912	0.48622	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	T	0.57436	0.4	5.4	3.42	0.39159	LisH dimerisation motif (2);	0.000000	0.51477	D	0.000092	T	0.69415	0.3108	M	0.78801	2.425	0.33952	D	0.644564	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.79047	-0.1963	10	0.87932	D	0	-8.2066	9.7061	0.40216	0.0:0.82:0.0:0.18	.	14;14;14	Q14978-3;Q14978-2;Q14978	.;.;NOLC1_HUMAN	M	14	ENSP00000385410:L14M	ENSP00000359024:L14M	L	+	1	2	NOLC1	103902197	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	1.772000	0.38552	1.522000	0.49001	-0.258000	0.10820	CTG	-	NULL		0.622	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NOLC1	protein_coding	OTTHUMT00000050012.2	C	NM_004741		103902197	+1	no_errors	NM_004741	genbank	human	validated	54_36p	missense	SNP	1.000	A
ACAT1	38	genome.wustl.edu	37	11	108013301	108013301	+	Intron	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:108013301C>T	ENST00000265838.4	+	9	1031					NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1						adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	aggtggctcacacctgtaatc	0.537																																																0			11											41.0	32.0	35.0					11																	108013301		2201	4298	6499	107518511	SO:0001627	intron_variant	38			D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	ENST00000265838.4:c.940+24C>T	11.37:g.108013301C>T		Somatic		Capture	Illumina GAIIx	4	107518511	B2R6H1|G3XAB4|Q96FG8	Missense_Mutation	SNP	superfamily_Thiolase-like,HMMPfam_Thiolase_N	p.H287Y	ENST00000265838.4	37	c.859	CCDS8339.1	11																																																																																			-	NULL		0.537	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT1	protein_coding	OTTHUMT00000389474.1	C	NM_000019		107518511	+1	no_errors	ENST00000375674	ensembl	human	known	54_36p	missense	SNP	0.358	T
SSH1	54434	genome.wustl.edu	37	12	109182204	109182204	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:109182204G>A	ENST00000326495.5	-	15	2803	c.2710C>T	c.(2710-2712)Cgc>Tgc	p.R904C	SSH1_ENST00000360239.3_Missense_Mutation_p.R592C	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	904	Interaction with YWHAG.				actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGGTCCAGGCGGTAGAAGAAA	0.582																																																0			12											31.0	34.0	33.0					12																	109182204		2186	4275	6461	107706333	SO:0001583	missense	54434			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.2710C>T	12.37:g.109182204G>A	ENSP00000315713:p.Arg904Cys	Somatic		Capture	Illumina GAIIx	4	107706333	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	superfamily_DEK C-terminal domain,HMMPfam_DEK_C,superfamily_(Phosphotyrosine protein) phosphatases II,HMMPfam_DSPc,HMMSmart_SM00195,PatternScan_TYR_PHOSPHATASE_1	p.R904C	ENST00000326495.5	37	c.2710	CCDS9121.1	12	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787542	0.49997	.	.	ENSG00000084112	ENST00000360239;ENST00000326495	T;T	0.16073	2.51;2.37	5.31	5.31	0.75309	.	0.541571	0.19508	N	0.112563	T	0.38719	0.1051	M	0.64997	1.995	0.42647	D	0.993434	D;D	0.89917	1.0;1.0	D;D	0.87578	0.959;0.998	T	0.02581	-1.1138	10	0.44086	T	0.13	-33.657	13.8986	0.63787	0.0:0.0:0.7255:0.2745	.	904;592	Q8WYL5;Q8WYL5-4	SSH1_HUMAN;.	C	592;904	ENSP00000353374:R592C;ENSP00000315713:R904C	ENSP00000315713:R904C	R	-	1	0	SSH1	107706333	1.000000	0.71417	0.994000	0.49952	0.505000	0.33919	2.755000	0.47540	2.674000	0.91012	0.650000	0.86243	CGC	-	NULL		0.582	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSH1	protein_coding	OTTHUMT00000403724.1	G	NM_018984		107706333	-1	no_errors	NM_018984	genbank	human	provisional	54_36p	missense	SNP	0.047	A
CELSR2	1952	genome.wustl.edu	37	1	109804474	109804474	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:109804474A>C	ENST00000271332.3	+	5	4403	c.4342A>C	c.(4342-4344)Agt>Cgt	p.S1448R		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1448	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CGGAGGAGTCAGTGATGGCCA	0.587																																					NSCLC(158;1285 2011 34800 34852 42084)											0			1											94.0	70.0	78.0					1																	109804474		2202	4299	6501	109605997	SO:0001583	missense	1952			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.4342A>C	1.37:g.109804474A>C	ENSP00000271332:p.Ser1448Arg	Somatic		Capture	Illumina GAIIx	4	109605997	Q5T2Y7|Q92566	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F2_1,PatternScan_G_PROTEIN_RECEP_F2_2,superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_EGF_CA,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,PatternScan_ASX_HYDROXYL,HMMSmart_TNFR,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,PatternScan_EGF_LAM_1,HMMSmart_HormR,HMMPfam_HRM,HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2	p.S1448R	ENST00000271332.3	37	c.4342	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.872463	0.91587	.	.	ENSG00000143126	ENST00000271332	T	0.80566	-1.39	5.01	5.01	0.66863	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.89136	0.6629	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91263	0.5038	9	0.87932	D	0	.	14.8929	0.70623	1.0:0.0:0.0:0.0	.	1448	Q9HCU4	CELR2_HUMAN	R	1448	ENSP00000271332:S1448R	ENSP00000271332:S1448R	S	+	1	0	CELSR2	109605997	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	8.703000	0.91344	2.100000	0.63781	0.379000	0.24179	AGT	-	superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2		0.587	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	protein_coding	OTTHUMT00000033200.1	A	NM_001408		109605997	+1	no_errors	NM_001408	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FIG4	9896	genome.wustl.edu	37	6	110059646	110059646	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:110059646T>G	ENST00000230124.3	+	7	889	c.765T>G	c.(763-765)tgT>tgG	p.C255W	FIG4_ENST00000368941.1_Intron|FIG4_ENST00000441478.2_Intron	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	255	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		ATGGGTTCTGTGGGCAGTCAA	0.313																																																0			6											137.0	137.0	137.0					6																	110059646		2203	4298	6501	110166339	SO:0001583	missense	9896			D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.765T>G	6.37:g.110059646T>G	ENSP00000230124:p.Cys255Trp	Somatic		Capture	Illumina GAIIx	4	110166339	Q53H49|Q5TCS6	Missense_Mutation	SNP	HMMPfam_Syja_N	p.C255W	ENST00000230124.3	37	c.765	CCDS5078.1	6	.	.	.	.	.	.	.	.	.	.	T	18.56	3.650772	0.67472	.	.	ENSG00000112367	ENST00000230124;ENST00000454215	T;T	0.58210	0.35;0.35	5.89	2.29	0.28610	Synaptojanin, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.49729	0.1574	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.53809	-0.8386	10	0.87932	D	0	-12.5192	8.2859	0.31928	0.0:0.2403:0.0:0.7597	.	255	Q92562	FIG4_HUMAN	W	255;234	ENSP00000230124:C255W;ENSP00000412156:C234W	ENSP00000230124:C255W	C	+	3	2	FIG4	110166339	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.248000	0.51430	0.487000	0.27698	0.533000	0.62120	TGT	-	HMMPfam_Syja_N		0.313	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIG4	protein_coding	OTTHUMT00000041768.1	T	NM_014845		110166339	+1	no_errors	NM_014845	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MORC1	27136	genome.wustl.edu	37	3	108818261	108818261	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr3:108818261T>A	ENST00000483760.1	-	6	410	c.367A>T	c.(367-369)Acg>Tcg	p.T123S	MORC1-AS1_ENST00000480826.1_RNA|MORC1_ENST00000232603.5_Missense_Mutation_p.T123S					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						CAGGTCATCGTTTCTTCCTTC	0.338																																																0			3											125.0	124.0	124.0					3																	108818261		2201	4299	6500	110300951	SO:0001583	missense	27136			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.367A>T	3.37:g.108818261T>A	ENSP00000417282:p.Thr123Ser	Somatic		Capture	Illumina GAIIx	4	110300951		Missense_Mutation	SNP	superfamily_ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase,HMMPfam_HATPase_c,HMMPfam_zf-CW	p.T123S	ENST00000483760.1	37	c.367		3	.	.	.	.	.	.	.	.	.	.	T	16.48	3.134397	0.56828	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	D;D	0.94650	-3.48;-3.48	4.78	4.78	0.61160	ATPase-like, ATP-binding domain (3);	0.000000	0.50627	D	0.000108	D	0.93772	0.8009	L	0.28556	0.865	0.25679	N	0.985815	D;B	0.76494	0.999;0.41	D;P	0.72625	0.978;0.672	D	0.86674	0.1912	10	0.37606	T	0.19	-13.7836	8.0015	0.30299	0.1816:0.0:0.0:0.8184	.	123;123	E7ERX1;Q86VD1	.;MORC1_HUMAN	S	123	ENSP00000232603:T123S;ENSP00000417282:T123S	ENSP00000232603:T123S	T	-	1	0	MORC1	110300951	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	3.933000	0.56545	2.135000	0.66039	0.454000	0.30748	ACG	-	superfamily_ATPase domain of HSP90 chaperone/DNA topoisomerase II/histidine kinase		0.338	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	protein_coding	OTTHUMT00000353844.1	T			110300951	-1	no_errors	NM_014429	genbank	human	reviewed	54_36p	missense	SNP	0.996	A
SMC3	9126	genome.wustl.edu	37	10	112343293	112343293	+	Missense_Mutation	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr10:112343293A>G	ENST00000361804.4	+	11	1082	c.956A>G	c.(955-957)aAt>aGt	p.N319S		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	319					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CTAGCAGGCAATAGTGAACAA	0.398																																																0			10											75.0	73.0	74.0					10																	112343293		2203	4300	6503	112333283	SO:0001583	missense	9126			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.956A>G	10.37:g.112343293A>G	ENSP00000354720:p.Asn319Ser	Somatic		Capture	Illumina GAIIx	4	112333283	A8K156|O60464|Q5T482	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_SMC_N,superfamily_BAG domain,superfamily_Smc hinge domain,HMMPfam_SMC_hinge,PatternScan_ABC_TRANSPORTER_1	p.N319S	ENST00000361804.4	37	c.956	CCDS31285.1	10	.	.	.	.	.	.	.	.	.	.	A	12.47	1.948403	0.34377	.	.	ENSG00000108055	ENST00000361804	T	0.75589	-0.95	5.68	5.68	0.88126	RecF/RecN/SMC (1);	0.089351	0.85682	D	0.000000	T	0.52208	0.1720	N	0.04132	-0.27	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.52779	-0.8530	10	0.09084	T	0.74	.	16.2322	0.82352	1.0:0.0:0.0:0.0	.	319	Q9UQE7	SMC3_HUMAN	S	319	ENSP00000354720:N319S	ENSP00000354720:N319S	N	+	2	0	SMC3	112333283	1.000000	0.71417	0.998000	0.56505	0.337000	0.28794	8.777000	0.91781	2.288000	0.76882	0.528000	0.53228	AAT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_SMC_N,superfamily_BAG domain		0.398	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SMC3	protein_coding	OTTHUMT00000050337.1	A	NM_005445		112333283	+1	no_errors	NM_005445	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CSDE1	7812	genome.wustl.edu	37	1	115282494	115282494	+	Silent	SNP	G	G	A	rs143932215		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:115282494G>A	ENST00000358528.4	-	3	444	c.18C>T	c.(16-18)aaC>aaT	p.N6N	CSDE1_ENST00000261443.5_Silent_p.N6N|CSDE1_ENST00000534699.1_Silent_p.N6N|CSDE1_ENST00000438362.2_Silent_p.N52N|CSDE1_ENST00000339438.6_Silent_p.N6N|CSDE1_ENST00000530886.1_Intron|CSDE1_ENST00000369530.1_Silent_p.N52N	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	6					male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTGGAGAAGGTTTGGATCAA	0.348																																																0			1											249.0	256.0	254.0					1																	115282494		2203	4300	6503	115084017	SO:0001819	synonymous_variant	7812				CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.18C>T	1.37:g.115282494G>A		Somatic		Capture	Illumina GAIIx	4	115084017	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Silent	SNP	superfamily_Nucleic acid-binding proteins,HMMPfam_CSD,HMMSmart_SM00357,PatternScan_COLD_SHOCK,PatternScan_PEROXIDASE_2	p.N6	ENST00000358528.4	37	c.18	CCDS30812.1	1																																																																																			-	NULL		0.348	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CSDE1	protein_coding	OTTHUMT00000033397.1	G	NM_007158		115084017	-1	no_errors	NM_001007553	genbank	human	validated	54_36p	silent	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	11	117009014	117009014	+	IGR	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:117009014G>C								AP000936.4 (30128 upstream) : PAFAH1B2 (5968 downstream)																							ATGTGAACCAGAGGAATGTGG	0.532																																																0			11																																								116514224	SO:0001628	intergenic_variant	653303																															11.37:g.117009014G>C		Somatic		Capture	Illumina GAIIx	4	116514224		Missense_Mutation	SNP	superfamily_Galactose-binding domain-like,HMMPfam_P_proprotein	p.Q180H		37	c.540		11																																																																																			-	NULL	0	0.532					LOC653303			G			116514224	+1	no_start_codon:pseudogene	XM_938842	genbank	human	model	54_36p	missense	SNP	0.995	C
TNC	3371	genome.wustl.edu	37	9	117808917	117808917	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr9:117808917G>T	ENST00000350763.4	-	17	5308	c.4897C>A	c.(4897-4899)Cca>Aca	p.P1633T	TNC_ENST00000341037.4_Missense_Mutation_p.P1451T|TNC_ENST00000340094.3_Missense_Mutation_p.P1269T|TNC_ENST00000423613.2_Intron|TNC_ENST00000346706.3_Missense_Mutation_p.P1087T|TNC_ENST00000481475.1_5'Flank|TNC_ENST00000542877.1_Missense_Mutation_p.P1270T|TNC_ENST00000535648.1_Missense_Mutation_p.P1178T|TNC_ENST00000537320.1_Intron|TNC_ENST00000345230.3_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1633	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						AAACCGTCTGGGGTGGCATCT	0.478																																																0			9											49.0	56.0	53.0					9																	117808917		2203	4300	6503	116848738	SO:0001583	missense	3371				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.4897C>A	9.37:g.117808917G>T	ENSP00000265131:p.Pro1633Thr	Somatic		Capture	Illumina GAIIx	4	116848738	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_EGF,HMMPfam_EGF_2,HMMPfam_EGF,HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like,HMMSmart_FBG,HMMPfam_Fibrinogen_C,superfamily_Fibrinogen_a/b/g_C	p.P1633T	ENST00000350763.4	37	c.4897	CCDS6811.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.43|10.43	1.347018|1.347018	0.24426|0.24426	.|.	.|.	ENSG00000041982|ENSG00000041982	ENST00000544972|ENST00000340094;ENST00000535648;ENST00000346706;ENST00000350763;ENST00000341037;ENST00000542877	.|T;T;T;T;T;T	.|0.56941	.|0.43;0.43;0.43;0.43;0.43;0.43	5.94|5.94	5.04|5.04	0.67666|0.67666	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.207906|0.207906	0.41097|0.41097	D|D	0.000941|0.000941	T|T	0.51109|0.51109	0.1655|0.1655	M|M	0.69358|0.69358	2.11|2.11	0.80722|0.80722	D|D	1|1	.|B	.|0.33583	.|0.418	.|B	.|0.36092	.|0.217	T|T	0.50136|0.50136	-0.8863|-0.8863	6|10	.|0.34782	.|T	.|0.22	.|.	10.5549|10.5549	0.45112|0.45112	0.0688:0.1342:0.7971:0.0|0.0688:0.1342:0.7971:0.0	.|.	.|1633	.|P24821	.|TENA_HUMAN	H|T	195|1269;1178;1087;1633;1451;1270	.|ENSP00000344400:P1269T;ENSP00000438152:P1178T;ENSP00000344555:P1087T;ENSP00000265131:P1633T;ENSP00000339553:P1451T;ENSP00000442242:P1270T	.|ENSP00000344400:P1269T	P|P	-|-	2|1	0|0	TNC|TNC	116848738|116848738	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.893000|0.893000	0.52053|0.52053	3.659000|3.659000	0.54489|0.54489	1.495000|1.495000	0.48549|0.48549	0.655000|0.655000	0.94253|0.94253	CCC|CCA	-	HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like		0.478	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	protein_coding	OTTHUMT00000055418.2	G	NM_002160		116848738	-1	no_errors	NM_002160	genbank	human	validated	54_36p	missense	SNP	1.000	T
LSAMP	4045	genome.wustl.edu	37	3	115561369	115561369	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr3:115561369A>T	ENST00000490035.2	-	5	1205	c.706T>A	c.(706-708)Tca>Aca	p.S236T	LSAMP_ENST00000539563.1_Missense_Mutation_p.S233T|LSAMP_ENST00000498645.1_5'UTR	NM_002338.3	NP_002329.2	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	236	Ig-like C2-type 3.				cell adhesion (GO:0007155)|locomotory exploration behavior (GO:0035641)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(4)|lung(14)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		CATTTGAGTGAAGCTTGTCGT	0.532																																																0			3											223.0	179.0	194.0					3																	115561369		2203	4300	6503	117044059	SO:0001583	missense	4045			U41901	CCDS2982.1	3q13.2-q21	2013-01-11			ENSG00000185565	ENSG00000185565		"""Immunoglobulin superfamily / I-set domain containing"""	6705	protein-coding gene	gene with protein product	"""IgLON family member 3"""	603241				9615236	Standard	NM_002338		Approved	LAMP, IGLON3	uc003ebs.3	Q13449	OTTHUMG00000159308	ENST00000490035.2:c.706T>A	3.37:g.115561369A>T	ENSP00000419000:p.Ser236Thr	Somatic		Capture	Illumina GAIIx	4	117044059	Q8IV49	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,HMMPfam_ig,HMMPfam_I-set,HMMSmart_IGc2	p.S236T	ENST00000490035.2	37	c.706	CCDS2982.1	3	.	.	.	.	.	.	.	.	.	.	A	11.54	1.668890	0.29604	.	.	ENSG00000185565	ENST00000333617;ENST00000490035;ENST00000539563	T;T;T	0.66815	-0.23;-0.23;-0.23	5.7	5.7	0.88788	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.412504	0.27126	N	0.020812	T	0.35653	0.0939	N	0.01134	-0.995	0.27555	N	0.950377	B;B	0.06786	0.001;0.0	B;B	0.15052	0.004;0.012	T	0.22277	-1.0221	10	0.24483	T	0.36	-4.9794	11.1137	0.48247	0.8622:0.0:0.0:0.1378	.	236;236	B2RCU8;Q13449	.;LSAMP_HUMAN	T	220;236;233	ENSP00000328455:S220T;ENSP00000419000:S236T;ENSP00000443429:S233T	ENSP00000328455:S220T	S	-	1	0	LSAMP	117044059	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	1.773000	0.38563	2.185000	0.69588	0.528000	0.53228	TCA	-	superfamily_SSF48726,HMMSmart_IGc2,HMMPfam_ig		0.532	LSAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSAMP	protein_coding	OTTHUMT00000354495.4	A	NM_002338		117044059	-1	no_errors	NM_002338	genbank	human	reviewed	54_36p	missense	SNP	0.688	T
SCN2B	6327	genome.wustl.edu	37	11	118047102	118047102	+	Silent	SNP	C	C	A	rs376823705		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr11:118047102C>A	ENST00000278947.5	-	1	286	c.45G>T	c.(43-45)acG>acT	p.T15T		NM_004588.4	NP_004579.1	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta subunit	15				T -> N (in Ref. 1; AAC26013). {ECO:0000305}.	cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|nervous system development (GO:0007399)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	voltage-gated sodium channel complex (GO:0001518)	sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)	7	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)	Valproic Acid(DB00313)|Zonisamide(DB00909)	GACTGAGCCCCGTGAGGCTGA	0.557																																																0			11											124.0	117.0	119.0					11																	118047102		2200	4296	6496	117552312	SO:0001819	synonymous_variant	6327			AY358945	CCDS8390.1	11q23.3	2013-09-19	2012-02-28		ENSG00000149575	ENSG00000149575		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10589	protein-coding gene	gene with protein product		601327	"""sodium channel, voltage-gated, type II, beta polypeptide"", ""sodium channel, voltage-gated, type II, beta"""			10198179	Standard	NM_004588		Approved		uc001psf.2	O60939	OTTHUMG00000048248	ENST00000278947.5:c.45G>T	11.37:g.118047102C>A		Somatic		Capture	Illumina GAIIx	4	117552312	O75302|Q9UNN3	Silent	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409	p.T15	ENST00000278947.5	37	c.45	CCDS8390.1	11																																																																																			-	NULL		0.557	SCN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN2B	protein_coding	OTTHUMT00000109748.2	C	NM_004588		117552312	-1	no_errors	NM_004588	genbank	human	validated	54_36p	silent	SNP	1.000	A
CCDC60	160777	genome.wustl.edu	37	12	119961528	119961528	+	Nonsense_Mutation	SNP	C	C	G	rs376933242		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr12:119961528C>G	ENST00000327554.2	+	11	1599	c.1134C>G	c.(1132-1134)taC>taG	p.Y378*	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	378										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		ACATCCACTACAAGAGTGGGG	0.527																																																0			12											112.0	90.0	98.0					12																	119961528		2203	4300	6503	118445911	SO:0001587	stop_gained	160777			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1134C>G	12.37:g.119961528C>G	ENSP00000333374:p.Tyr378*	Somatic		Capture	Illumina GAIIx	4	118445911		Nonsense_Mutation	SNP	NULL	p.Y378*	ENST00000327554.2	37	c.1134	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.446674	0.97572	.	.	ENSG00000183273	ENST00000327554	.	.	.	4.16	2.26	0.28386	.	1.577390	0.03778	N	0.260838	.	.	.	.	.	.	0.20307	N	0.999913	.	.	.	.	.	.	.	.	.	.	.	.	.	1.1982	5.8788	0.18844	0.0:0.7431:0.0:0.2569	.	.	.	.	X	378	.	.	Y	+	3	2	CCDC60	118445911	0.511000	0.26179	0.016000	0.15963	0.012000	0.07955	0.610000	0.24253	0.375000	0.24679	0.655000	0.94253	TAC	-	NULL		0.527	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	protein_coding	OTTHUMT00000401680.1	C	NM_178499		118445911	+1	no_errors	NM_178499	genbank	human	validated	54_36p	nonsense	SNP	0.112	G
RHOXF2	84528	genome.wustl.edu	37	X	119293027	119293027	+	Silent	SNP	G	G	A	rs374278020		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:119293027G>A	ENST00000371388.3	+	2	376	c.186G>A	c.(184-186)tcG>tcA	p.S62S		NM_032498.1	NP_115887.1	Q9BQY4	RHXF2_HUMAN	Rhox homeobox family, member 2	62					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(2)	8						AGTTAAAGTCGGCAGGAGCCC	0.567																																																0			X						G		0,2535		0,0,0,1094,347	4.0	5.0	5.0		186	-4.3	0.0	X		5	6,4927		0,4,2,1872,1179	no	coding-synonymous	RHOXF2	NM_032498.1		0,4,2,2966,1526	AA,AG,A,GG,G		0.1216,0.0,0.0803		62/289	119293027	6,7462	1441	3057	4498	119177055	SO:0001819	synonymous_variant	84528				CCDS14594.1	Xq24	2012-12-20			ENSG00000131721	ENSG00000131721		"""Homeoboxes / PRD class"""	30011	protein-coding gene	gene with protein product	"""cancer/testis antigen 107"""	300447				12490318	Standard	NM_032498		Approved	THG1, PEPP-2, PEPP2, CT107		Q9BQY4	OTTHUMG00000022296	ENST00000371388.3:c.186G>A	X.37:g.119293027G>A		Somatic		Capture	Illumina GAIIx	4	119177055	Q9BR00	Silent	SNP	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.S62	ENST00000371388.3	37	c.186	CCDS14594.1	X																																																																																			-	NULL		0.567	RHOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOXF2	protein_coding	OTTHUMT00000411977.1	G	NM_032498		119177055	+1	no_errors	NM_032498	genbank	human	provisional	54_36p	silent	SNP	0.000	A
PTPN4	5775	genome.wustl.edu	37	2	120723115	120723115	+	Missense_Mutation	SNP	T	T	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:120723115T>C	ENST00000263708.2	+	25	3223	c.2452T>C	c.(2452-2454)Tgg>Cgg	p.W818R	PTPN4_ENST00000544261.1_Missense_Mutation_p.W451R	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	818	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	GTACATAGCCTGGCCTGACCA	0.413																																																0			2											147.0	126.0	133.0					2																	120723115		2203	4300	6503	120439585	SO:0001583	missense	5775				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.2452T>C	2.37:g.120723115T>C	ENSP00000263708:p.Trp818Arg	Somatic		Capture	Illumina GAIIx	4	120439585	B2RBV8|Q9UDA7	Missense_Mutation	SNP	HMMSmart_B41,superfamily_SSF54236,HMMPfam_FERM_N,PatternScan_FERM_1,superfamily_FERM_3-hlx,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_SSF50729,HMMPfam_FERM_C,HMMPfam_FA,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ,superfamily_SSF52799,HMMSmart_PTPc,HMMPfam_Y_phosphatase,PatternScan_TYR_PHOSPHATASE_1	p.W818R	ENST00000263708.2	37	c.2452	CCDS2129.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.3|24.3	4.513879|4.513879	0.85389|0.85389	.|.	.|.	ENSG00000088179|ENSG00000088179	ENST00000441089|ENST00000263708;ENST00000544261	.|D;D	.|0.96491	.|-4.03;-4.03	5.72|5.72	5.72|5.72	0.89469|0.89469	.|Protein-tyrosine phosphatase, receptor/non-receptor type (4);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99205|0.99205	0.9724|0.9724	H|H	0.99887|0.99887	4.895|4.895	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.98427|0.98427	1.0580|1.0580	5|10	.|0.87932	.|D	.|0	.|.	16.0205|16.0205	0.80486|0.80486	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|818	.|P29074	.|PTN4_HUMAN	P|R	101|818;451	.|ENSP00000263708:W818R;ENSP00000445841:W451R	.|ENSP00000263708:W818R	L|W	+|+	2|1	0|0	PTPN4|PTPN4	120439585|120439585	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.842000|7.842000	0.86851|0.86851	2.194000|2.194000	0.70268|0.70268	0.533000|0.533000	0.62120|0.62120	CTG|TGG	-	superfamily_SSF52799,HMMSmart_PTPc,HMMPfam_Y_phosphatase		0.413	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	protein_coding	OTTHUMT00000254233.2	T			120439585	+1	no_errors	NM_002830	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
FABP7	2173	genome.wustl.edu	37	6	123102305	123102305	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:123102305T>A	ENST00000368444.3	+	3	634	c.314T>A	c.(313-315)tTt>tAt	p.F105Y	FABP7_ENST00000356535.4_Missense_Mutation_p.F105Y	NM_001446.3	NP_001437.1	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain	105					cell proliferation in forebrain (GO:0021846)|epithelial cell proliferation (GO:0050673)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|prepulse inhibition (GO:0060134)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|Dihomo-gamma-linolenic acid(DB00154)|Icosapent(DB00159)	GAAACAAATTTTGTAAGAGAA	0.388																																																0			6											135.0	134.0	134.0					6																	123102305		2203	4300	6503	123144004	SO:0001583	missense	2173			D88648	CCDS5127.1	6q22-q23	2013-03-01			ENSG00000164434	ENSG00000164434		"""Fatty acid binding protein family"""	3562	protein-coding gene	gene with protein product	"""brain lipid binding protein"""	602965				9375786	Standard	NM_001446		Approved	B-FABP, BLBP	uc003pzf.3	O15540	OTTHUMG00000015489	ENST00000368444.3:c.314T>A	6.37:g.123102305T>A	ENSP00000357429:p.Phe105Tyr	Somatic		Capture	Illumina GAIIx	4	123144004	B2R4L1|O14951|Q6IAU7|Q9H047	Missense_Mutation	SNP	superfamily_Lipocalins,HMMPfam_Lipocalin,PatternScan_FABP	p.F105Y	ENST00000368444.3	37	c.314	CCDS5127.1	6	.	.	.	.	.	.	.	.	.	.	T	19.88	3.909867	0.72983	.	.	ENSG00000164434	ENST00000368444;ENST00000356535	T;T	0.41400	1.0;3.15	5.18	4.0	0.46444	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.194498	0.56097	D	0.000028	T	0.26810	0.0656	N	0.20807	0.61	0.47441	D	0.999428	B;P	0.41643	0.061;0.758	B;P	0.51170	0.167;0.661	T	0.15009	-1.0452	10	0.62326	D	0.03	.	12.1389	0.53986	0.0:0.0:0.1487:0.8513	.	105;105	O15540;Q9H047	FABP7_HUMAN;.	Y	105	ENSP00000357429:F105Y;ENSP00000348931:F105Y	ENSP00000348931:F105Y	F	+	2	0	FABP7	123144004	1.000000	0.71417	0.915000	0.36163	0.908000	0.53690	5.119000	0.64679	0.894000	0.36317	0.254000	0.18369	TTT	-	superfamily_Lipocalins,HMMPfam_Lipocalin		0.388	FABP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP7	protein_coding	OTTHUMT00000042037.1	T	NM_001446		123144004	+1	no_errors	NM_001446	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
AK1	203	genome.wustl.edu	37	9	130630642	130630642	+	Silent	SNP	T	T	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr9:130630642T>C	ENST00000373176.1	-	6	626	c.474A>G	c.(472-474)gaA>gaG	p.E158E	AK1_ENST00000223836.10_Silent_p.E174E|AK1_ENST00000373156.1_Silent_p.E158E|MIR4672_ENST00000583126.1_RNA|RP11-203J24.9_ENST00000476274.2_RNA	NM_000476.2	NP_000467.1			adenylate kinase 1											endometrium(1)|prostate(1)	2						CGATGACAGGTTCTGTGGCCT	0.602																																																0			9											92.0	67.0	75.0					9																	130630642		2203	4300	6503	129670463	SO:0001819	synonymous_variant	203			J04809	CCDS6881.1	9q34.1	2008-02-05			ENSG00000106992	ENSG00000106992	2.7.4.3	"""Adenylate kinases"""	361	protein-coding gene	gene with protein product		103000					Standard	NM_000476		Approved		uc004bsm.4	P00568	OTTHUMG00000020722	ENST00000373176.1:c.474A>G	9.37:g.130630642T>C		Somatic		Capture	Illumina GAIIx	4	129670463		Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_ADK,PatternScan_ADENYLATE_KINASE	p.E158	ENST00000373176.1	37	c.474	CCDS6881.1	9	.	.	.	.	.	.	.	.	.	.	T	11.81	1.749325	0.30955	.	.	ENSG00000106992	ENST00000413016	.	.	.	5.35	-4.83	0.03161	.	.	.	.	.	T	0.69187	0.3083	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68565	-0.5375	4	.	.	.	-30.394	19.8836	0.96906	0.0:0.8915:0.0:0.1085	.	.	.	.	S	99	.	.	N	-	2	0	AK1	129670463	0.853000	0.29707	0.081000	0.20488	0.867000	0.49689	-0.017000	0.12590	-1.432000	0.01979	-0.379000	0.06801	AAC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_ADK		0.602	AK1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AK1	protein_coding	OTTHUMT00000054307.1	T			129670463	-1	no_errors	NM_000476	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
ENPP3	5169	genome.wustl.edu	37	6	132047311	132047311	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr6:132047311A>T	ENST00000414305.1	+	21	2252	c.1924A>T	c.(1924-1926)Atg>Ttg	p.M642L	ENPP3_ENST00000357639.3_Missense_Mutation_p.M642L|ENPP3_ENST00000358229.5_Missense_Mutation_p.M642L			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	642	Nuclease.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		GAGGATGCCCATGTGGAGTTC	0.448																																																0			6											170.0	161.0	164.0					6																	132047311		2203	4300	6503	132089004	SO:0001583	missense	5169			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1924A>T	6.37:g.132047311A>T	ENSP00000406261:p.Met642Leu	Somatic		Capture	Illumina GAIIx	4	132089004	Q5JTL3	Missense_Mutation	SNP	HMMSmart_SO,HMMPfam_Somatomedin_B,superfamily_SSF90188,PatternScan_SMB_1,superfamily_Alkaline_phosphatase_core,HMMPfam_Phosphodiest,superfamily_SSF54060,HMMSmart_NUC	p.M642L	ENST00000414305.1	37	c.1924	CCDS5148.1	6	.	.	.	.	.	.	.	.	.	.	A	7.422	0.636914	0.14386	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000358229	T;T;T	0.69175	-0.17;-0.17;-0.38	5.4	-10.8	0.00216	DNA/RNA non-specific endonuclease (1);Extracellular Endonuclease, subunit A (2);	0.805047	0.11427	N	0.565171	T	0.08133	0.0203	N	0.00395	-1.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36432	-0.9748	10	0.02654	T	1	-2.0641	15.7384	0.77866	0.1139:0.7552:0.0625:0.0685	.	642	O14638	ENPP3_HUMAN	L	642	ENSP00000406261:M642L;ENSP00000350265:M642L;ENSP00000350964:M642L	ENSP00000350265:M642L	M	+	1	0	ENPP3	132089004	0.006000	0.16342	0.611000	0.29010	0.988000	0.76386	-0.291000	0.08343	-2.034000	0.00924	0.533000	0.62120	ATG	-	superfamily_SSF54060,HMMSmart_NUC		0.448	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	protein_coding	OTTHUMT00000043627.2	A			132089004	+1	no_errors	NM_005021	genbank	human	reviewed	54_36p	missense	SNP	0.979	T
TG	7038	genome.wustl.edu	37	8	133899410	133899410	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr8:133899410T>G	ENST00000220616.4	+	9	1833	c.1793T>G	c.(1792-1794)gTg>gGg	p.V598G	TG_ENST00000377869.1_Missense_Mutation_p.V598G	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	598					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TTAGGTGATGTGATGGAAACG	0.478																																																0			8											139.0	128.0	132.0					8																	133899410		2203	4300	6503	133968592	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1793T>G	8.37:g.133899410T>G	ENSP00000220616:p.Val598Gly	Somatic		Capture	Illumina GAIIx	4	133968592	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	superfamily_Thyroglobulin type-1 domain,HMMPfam_Thyroglobulin_1,PatternScan_THYROGLOBULIN_1_1,HMMSmart_SM00211,superfamily_TNF receptor-like,HMMPfam_GCC2_GCC3,HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases,PatternScan_CARBOXYLESTERASE_B_2	p.V598G	ENST00000220616.4	37	c.1793	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	T	9.895	1.205255	0.22205	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.66995	-0.24;-0.23	5.03	2.63	0.31362	.	0.103647	0.42420	D	0.000710	T	0.78892	0.4355	M	0.86420	2.815	0.18873	N	0.999983	D	0.71674	0.998	D	0.69824	0.966	T	0.67461	-0.5665	10	0.49607	T	0.09	.	4.9263	0.13894	0.0:0.1593:0.158:0.6826	.	598	P01266	THYG_HUMAN	G	598	ENSP00000367100:V598G;ENSP00000220616:V598G	ENSP00000220616:V598G	V	+	2	0	TG	133968592	0.998000	0.40836	0.154000	0.22540	0.104000	0.19210	1.772000	0.38552	0.383000	0.24910	0.533000	0.62120	GTG	-	NULL		0.478	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	protein_coding	OTTHUMT00000379606.1	T	NM_003235		133968592	+1	no_errors	NM_003235	genbank	human	validated	54_36p	missense	SNP	0.740	G
RAB3GAP1	22930	genome.wustl.edu	37	2	135908055	135908055	+	Silent	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:135908055C>T	ENST00000264158.8	+	18	2083	c.2040C>T	c.(2038-2040)ctC>ctT	p.L680L	ZRANB3_ENST00000412849.1_Intron|RAB3GAP1_ENST00000442034.1_Silent_p.L680L|RAB3GAP1_ENST00000487003.1_3'UTR|RAB3GAP1_ENST00000539493.1_Silent_p.L636L	NM_012233.2	NP_036365.1	Q15042	RB3GP_HUMAN	RAB3 GTPase activating protein subunit 1 (catalytic)	680					brain development (GO:0007420)|camera-type eye development (GO:0043010)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|face morphogenesis (GO:0060325)|hypothalamus development (GO:0021854)|lipid particle organization (GO:0034389)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of calcium ion-dependent exocytosis of neurotransmitter (GO:1903233)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of GTPase activity (GO:0043087)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cytoplasm (GO:0005737)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32				BRCA - Breast invasive adenocarcinoma(221;0.117)		CCTGTCTGCTCTCAGATATGG	0.473																																																0			2											71.0	69.0	70.0					2																	135908055		2203	4300	6503	135624525	SO:0001819	synonymous_variant	22930			D31886	CCDS33294.1, CCDS54402.1	2q21.3	2013-07-09			ENSG00000115839	ENSG00000115839			17063	protein-coding gene	gene with protein product		602536				9030515, 15696165	Standard	NM_012233		Approved	RAB3GAP, KIAA0066, RAB3GAP130, WARBM1	uc010fnf.3	Q15042	OTTHUMG00000154889	ENST00000264158.8:c.2040C>T	2.37:g.135908055C>T		Somatic		Capture	Illumina GAIIx	4	135624525	A6H8Z3|C9J837|Q659F5|Q8TBB4	Silent	SNP	NULL	p.L680	ENST00000264158.8	37	c.2040	CCDS33294.1	2																																																																																			-	NULL		0.473	RAB3GAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP1	protein_coding	OTTHUMT00000337514.2	C	NM_012233		135624525	+1	no_errors	NM_012233	genbank	human	validated	54_36p	silent	SNP	1.000	T
MATR3	9782	genome.wustl.edu	37	5	138643751	138643751	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:138643751G>A	ENST00000394805.3	+	2	982	c.647G>A	c.(646-648)aGa>aAa	p.R216K	MATR3_ENST00000502499.1_Intron|MATR3_ENST00000504203.1_Intron|MATR3_ENST00000509990.1_Missense_Mutation_p.R216K|MATR3_ENST00000361059.2_Missense_Mutation_p.R216K|MATR3_ENST00000502929.1_Missense_Mutation_p.R216K|MATR3_ENST00000503811.1_Intron|MATR3_ENST00000510056.1_Missense_Mutation_p.R216K|MATR3_ENST00000394800.2_Missense_Mutation_p.R216K	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3	216					cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TATTATGACAGAATGGATTAT	0.383																																																0			5											113.0	107.0	109.0					5																	138643751		2203	4300	6503	138671650	SO:0001583	missense	9782			M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.647G>A	5.37:g.138643751G>A	ENSP00000378284:p.Arg216Lys	Somatic		Capture	Illumina GAIIx	4	138671650	B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Missense_Mutation	SNP	HMMSmart_ZnF_U1,HMMSmart_ZnF_C2H2,HMMSmart_RRM,superfamily_SSF54928	p.R216K	ENST00000394805.3	37	c.647	CCDS4210.1	5	.	.	.	.	.	.	.	.	.	.	G	10.71	1.425642	0.25639	.	.	ENSG00000015479	ENST00000509990;ENST00000361059;ENST00000502929;ENST00000394800;ENST00000394805;ENST00000504045;ENST00000510056	T;T;T;T;T;T;T	0.78003	-0.74;-0.74;-0.77;-0.77;-0.74;-1.14;-0.74	5.53	5.53	0.82687	.	0.138543	0.64402	D	0.000004	T	0.69797	0.3151	N	0.14661	0.345	0.43959	D	0.99663	B;B;B	0.31435	0.227;0.323;0.227	B;B;B	0.41332	0.205;0.354;0.159	T	0.63659	-0.6587	10	0.11485	T	0.65	-12.7568	19.8241	0.96610	0.0:0.0:1.0:0.0	.	216;216;216	D6REM6;A8MXP9;P43243	.;.;MATR3_HUMAN	K	216	ENSP00000423533:R216K;ENSP00000354346:R216K;ENSP00000422319:R216K;ENSP00000378279:R216K;ENSP00000378284:R216K;ENSP00000423290:R216K;ENSP00000426743:R216K	ENSP00000354346:R216K	R	+	2	0	MATR3	138671650	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.377000	0.90141	2.758000	0.94735	0.655000	0.94253	AGA	-	NULL		0.383	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MATR3	protein_coding	OTTHUMT00000251324.2	G	NM_018834		138671650	+1	no_errors	NM_018834	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PCDHAC2	56134	genome.wustl.edu	37	5	140346360	140346360	+	Missense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:140346360G>T	ENST00000289269.5	+	1	541	c.9G>T	c.(7-9)caG>caT	p.Q3H	PCDHA12_ENST00000398631.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	3					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTATGGAGCAGGCGGGCACCA	0.746																																					Melanoma(190;638 2083 3390 11909 52360)											0			5											4.0	4.0	4.0					5																	140346360		1711	3496	5207	140326544	SO:0001583	missense	56134			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.9G>T	5.37:g.140346360G>T	ENSP00000289269:p.Gln3His	Somatic		Capture	Illumina GAIIx	4	140326544	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	HMMSmart_SM00112,superfamily_Cadherin-like,HMMPfam_Cadherin_2,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.Q3H	ENST00000289269.5	37	c.9	CCDS4242.1	5	.	.	.	.	.	.	.	.	.	.	G	13.10	2.137640	0.37728	.	.	ENSG00000243232	ENST00000289269	T	0.47528	0.84	4.62	3.67	0.42095	.	0.532887	0.14137	N	0.338997	T	0.26268	0.0641	N	0.08118	0	0.23314	N	0.99793	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.07328	-1.0778	10	0.54805	T	0.06	.	7.7974	0.29156	0.0909:0.0:0.7354:0.1736	.	3;3	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	H	3	ENSP00000289269:Q3H	ENSP00000289269:Q3H	Q	+	3	2	PCDHAC2	140326544	0.042000	0.20092	1.000000	0.80357	0.964000	0.63967	0.152000	0.16302	2.400000	0.81607	0.561000	0.74099	CAG	-	NULL		0.746	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	protein_coding	OTTHUMT00000251802.2	G	NM_018899		140326544	+1	no_errors	NM_018899	genbank	human	reviewed	54_36p	missense	SNP	0.991	T
PCDHB14	56122	genome.wustl.edu	37	5	140604913	140604913	+	Silent	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr5:140604913C>T	ENST00000239449.4	+	1	1836	c.1836C>T	c.(1834-1836)ccC>ccT	p.P612P	PCDHB14_ENST00000515856.2_Silent_p.P459P	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	612	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCACGGAGCCCGGGCTGTTCG	0.711																																					Ovarian(141;50 1831 27899 33809 37648)											0			5											5.0	6.0	6.0					5																	140604913		1402	2956	4358	140585097	SO:0001819	synonymous_variant	56122			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1836C>T	5.37:g.140604913C>T		Somatic		Capture	Illumina GAIIx	4	140585097	B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,PatternScan_CADHERIN_1,HMMPfam_Cadherin,HMMSmart_CA	p.P612	ENST00000239449.4	37	c.1836	CCDS4256.1	5																																																																																			-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.711	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	protein_coding	OTTHUMT00000251814.2	C	NM_018934		140585097	+1	no_errors	NM_018934	genbank	human	reviewed	54_36p	silent	SNP	0.814	T
MIR892A	100126342	genome.wustl.edu	37	X	145075858	145075858	+	RNA	SNP	T	T	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chrX:145075858T>A	ENST00000401124.1	-	0	75				MIR888_ENST00000401186.1_RNA|hsa-mir-892c_ENST00000516410.1_RNA|MIR890_ENST00000401256.1_RNA|MIR892B_ENST00000401279.1_RNA	NR_030584.1				microRNA 892a																		CCTTTCCAAGTAGGGCACTTC	0.488																																																0			X											136.0	108.0	117.0					X																	145075858		1568	3582	5150	144883550			0					Xq27.3	2011-09-12		2008-12-18	ENSG00000215943	ENSG00000215943		"""ncRNAs / Micro RNAs"""	33639	non-coding RNA	RNA, micro				MIRN892A			Standard	NR_030584		Approved	hsa-mir-892a	uc022cfq.1				X.37:g.145075858T>A		Somatic		Capture	Illumina GAIIx	4	144883550		RNA	SNP	-	NULL	ENST00000401124.1	37	NULL		X																																																																																			-	-		0.488	MIR892A-201	KNOWN	basic	miRNA	MIRN890	miRNA		T	NR_030584		144883550	-1	no_errors	ENST00000401256	ensembl	human	known	54_36p	rna	SNP	0.001	A
SHE	126669	genome.wustl.edu	37	1	154458531	154458531	+	Missense_Mutation	SNP	G	G	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:154458531G>C	ENST00000304760.2	-	5	1275	c.1189C>G	c.(1189-1191)Cat>Gat	p.H397D		NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	397	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.							p.H397Y(1)		breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			ATGGCACCATGATACCAGCTG	0.493																																																1	Substitution - Missense(1)	pancreas(1)	1											83.0	74.0	77.0					1																	154458531		2203	4300	6503	152725155	SO:0001583	missense	126669			AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.1189C>G	1.37:g.154458531G>C	ENSP00000307369:p.His397Asp	Somatic		Capture	Illumina GAIIx	4	152725155	Q8TEQ5	Missense_Mutation	SNP	superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2	p.H397D	ENST00000304760.2	37	c.1189	CCDS30877.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.732811|4.732811	0.89482|0.89482	.|.	.|.	ENSG00000169291|ENSG00000169291	ENST00000304760|ENST00000555188	T|.	0.69435|.	-0.4|.	5.41|5.41	5.41|5.41	0.78517|0.78517	SH2 motif (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.86736|.	0.6004|.	H|H	0.96239|0.96239	3.79|3.79	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	D|.	0.90052|.	0.4150|.	9|.	.|.	.|.	.|.	-32.6451|-32.6451	17.9533|17.9533	0.89061|0.89061	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	397|.	Q5VZ18|.	SHE_HUMAN|.	D|X	397|94	ENSP00000307369:H397D|.	.|.	H|S	-|-	1|2	0|0	SHE|SHE	152725155|152725155	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	8.944000|8.944000	0.92980|0.92980	2.826000|2.826000	0.97356|0.97356	0.561000|0.561000	0.74099|0.74099	CAT|TCA	-	superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2		0.493	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHE	protein_coding	OTTHUMT00000087910.2	G	NM_001010846		152725155	-1	no_errors	NM_001010846	genbank	human	provisional	54_36p	missense	SNP	1.000	C
SHOX2	6474	genome.wustl.edu	37	3	157820636	157820636	+	Missense_Mutation	SNP	C	C	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr3:157820636C>G	ENST00000425436.3	-	2	411	c.386G>C	c.(385-387)gGg>gCg	p.G129A	SHOX2_ENST00000554685.1_5'UTR|SHOX2_ENST00000389589.4_Missense_Mutation_p.G153A|SHOX2_ENST00000441443.2_5'UTR|SHOX2_ENST00000483851.2_Missense_Mutation_p.G129A|SHOX2_ENST00000490689.2_5'UTR	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	129					cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GTCCTCCATCCCTTTCGCATC	0.572																																																0			3											163.0	135.0	145.0					3																	157820636		2203	4300	6503	159303330	SO:0001583	missense	6474			AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.386G>C	3.37:g.157820636C>G	ENSP00000398704:p.Gly129Ala	Somatic		Capture	Illumina GAIIx	4	159303330	O60465|O60467|O60903	Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1,HMMPfam_OAR	p.G129A	ENST00000425436.3	37	c.386	CCDS43164.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.86|10.86	1.468871|1.468871	0.26335|0.26335	.|.	.|.	ENSG00000168779;ENSG00000168779;ENSG00000258518|ENSG00000168779	ENST00000425436;ENST00000389589;ENST00000483851|ENST00000555977	T;D;D|.	0.94000|.	1.53;-3.33;-3.33|.	5.47|5.47	4.51|4.51	0.55191|0.55191	Homeodomain-related (1);|.	0.286505|.	0.28983|.	N|.	0.013517|.	T|T	0.37100|0.37100	0.0991|0.0991	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B;B;B|.	0.17038|.	0.02;0.019;0.002|.	B;B;B|.	0.21360|.	0.013;0.034;0.004|.	T|T	0.19192|0.19192	-1.0313|-1.0313	10|5	0.12430|.	T|.	0.62|.	.|.	13.2587|13.2587	0.60093|0.60093	0.1447:0.7514:0.104:0.0|0.1447:0.7514:0.104:0.0	.|.	129;153;129|.	O60902-2;O60902-3;O60902|.	.;.;SHOX2_HUMAN|.	A|S	153;129;129|32	ENSP00000398704:G153A;ENSP00000374240:G129A;ENSP00000419362:G129A|.	ENSP00000374240:G129A|.	G|R	-|-	2|3	0|2	SHOX2;AC112502.1|SHOX2	159303330|159303330	0.991000|0.991000	0.36638|0.36638	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.108000|1.108000	0.31123|0.31123	2.567000|2.567000	0.86603|0.86603	0.643000|0.643000	0.83706|0.83706	GGG|AGG	-	NULL		0.572	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHOX2	protein_coding	OTTHUMT00000352057.2	C			159303330	-1	no_errors	NM_006884	genbank	human	validated	54_36p	missense	SNP	1.000	G
SCN3A	6328	genome.wustl.edu	37	2	165947357	165947357	+	Missense_Mutation	SNP	A	A	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:165947357A>T	ENST00000360093.3	-	28	5797	c.5306T>A	c.(5305-5307)gTc>gAc	p.V1769D	SCN3A_ENST00000283254.7_Missense_Mutation_p.V1769D|SCN3A_ENST00000540861.1_Missense_Mutation_p.V252D|SCN3A_ENST00000465043.1_5'Flank|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Missense_Mutation_p.V1720D	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1769					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCCAGGATGACCGCGATGTA	0.448																																																0			2											119.0	118.0	118.0					2																	165947357		2203	4298	6501	165655603	SO:0001583	missense	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5306T>A	2.37:g.165947357A>T	ENSP00000353206:p.Val1769Asp	Somatic		Capture	Illumina GAIIx	4	165655603	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,HMMSmart_IQ,HMMPfam_IQ	p.V1769D	ENST00000360093.3	37	c.5306		2	.	.	.	.	.	.	.	.	.	.	A	18.13	3.554643	0.65425	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.99121	-5.45;-5.45;-5.45;-5.45	6.13	6.13	0.99165	.	0.000000	0.64402	D	0.000017	D	0.99603	0.9856	H	0.97983	4.12	0.80722	D	1	D;D;D	0.89917	0.996;0.993;1.0	D;D;D	0.80764	0.919;0.962;0.994	D	0.97695	1.0181	10	0.87932	D	0	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	1720;1720;1769	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	D	1769;1769;1720;252	ENSP00000353206:V1769D;ENSP00000283254:V1769D;ENSP00000386726:V1720D;ENSP00000439920:V252D	ENSP00000283254:V1769D	V	-	2	0	SCN3A	165655603	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.336000	0.96533	2.367000	0.80283	0.529000	0.55759	GTC	-	superfamily_SSF81324,HMMPfam_Ion_trans		0.448	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	protein_coding		A	NM_006922		165655603	-1	no_errors	NM_006922	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZBTB37	84614	genome.wustl.edu	37	1	173842707	173842707	+	Intron	SNP	A	A	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:173842707A>G	ENST00000367701.5	+	3	1214				ZBTB37_ENST00000367702.1_Silent_p.V342V|ZBTB37_ENST00000432989.1_Silent_p.V342V|ZBTB37_ENST00000367704.1_Intron|ZBTB37_ENST00000427304.1_Intron			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						GCTCCCAGGTATGGAGTTGTG	0.458																																																0			1											91.0	89.0	89.0					1																	173842707		2203	4300	6503	172109330	SO:0001627	intron_variant	84614			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.1023+3A>G	1.37:g.173842707A>G		Somatic		Capture	Illumina GAIIx	4	172109330	Q5TC80|Q96M87|Q9BQ88	Silent	SNP	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB	p.V342	ENST00000367701.5	37	c.1026	CCDS44278.1	1																																																																																			-	NULL		0.458	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB37	protein_coding	OTTHUMT00000090729.2	A	NM_032522		172109330	+1	no_errors	NM_032522	genbank	human	provisional	54_36p	silent	SNP	1.000	G
SLC25A12	8604	genome.wustl.edu	37	2	172648092	172648092	+	Missense_Mutation	SNP	T	T	G			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:172648092T>G	ENST00000422440.2	-	15	1491	c.1454A>C	c.(1453-1455)aAa>aCa	p.K485T	SLC25A12_ENST00000392592.4_Missense_Mutation_p.K378T	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	485					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	GAAACACGCTTTGGCACCCTG	0.453																																																0			2											94.0	89.0	91.0					2																	172648092		2203	4300	6503	172356338	SO:0001583	missense	8604			Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1454A>C	2.37:g.172648092T>G	ENSP00000388658:p.Lys485Thr	Somatic		Capture	Illumina GAIIx	4	172356338	B3KR64|Q96AM8	Missense_Mutation	SNP	superfamily_SSF47473,HMMSmart_EFh,PatternScan_EF_HAND_1,superfamily_Mitoch_carrier,HMMPfam_Mito_carr	p.K485T	ENST00000422440.2	37	c.1454	CCDS33327.1	2	.	.	.	.	.	.	.	.	.	.	T	17.30	3.354766	0.61293	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	T;T	0.77750	-1.12;-1.12	6.07	6.07	0.98685	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.57110	0.2031	N	0.00135	-2.02	0.58432	D	0.999999	D;P	0.59767	0.986;0.902	P;P	0.58130	0.833;0.793	T	0.72330	-0.4326	10	0.14656	T	0.56	-16.621	16.6407	0.85098	0.0:0.0:0.0:1.0	.	378;485	B3KR64;O75746	.;CMC1_HUMAN	T	485;378	ENSP00000388658:K485T;ENSP00000376371:K378T	ENSP00000376371:K378T	K	-	2	0	SLC25A12	172356338	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.005000	0.88553	2.326000	0.78906	0.533000	0.62120	AAA	-	superfamily_Mitoch_carrier,HMMPfam_Mito_carr		0.453	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A12	protein_coding	OTTHUMT00000259010.2	T	NM_003705		172356338	-1	no_errors	NM_003705	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
RNASEL	6041	genome.wustl.edu	37	1	182545452	182545452	+	Missense_Mutation	SNP	C	C	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:182545452C>A	ENST00000367559.3	-	6	2231	c.1978G>T	c.(1978-1980)Ggt>Tgt	p.G660C	RNASEL_ENST00000444138.1_Missense_Mutation_p.G660C	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	660	KEN. {ECO:0000255|PROSITE- ProRule:PRU00725}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						AGCAGATCACCCACAGTGTTC	0.274																																																0			1											71.0	73.0	72.0					1																	182545452		2203	4295	6498	180812075	SO:0001583	missense	6041			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1978G>T	1.37:g.182545452C>A	ENSP00000356530:p.Gly660Cys	Somatic		Capture	Illumina GAIIx	4	180812075	Q5W0L2|Q6AI46	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00220,HMMPfam_Ribonuc_2-5A,HMMSmart_SM00580	p.G660C	ENST00000367559.3	37	c.1978	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.996242	0.35226	.	.	ENSG00000135828	ENST00000367559;ENST00000444138	T;T	0.31769	1.48;1.48	5.4	2.29	0.28610	PUG domain (1);KEN domain, ribonuclease activator (2);	0.541770	0.17188	N	0.183612	T	0.48114	0.1482	M	0.73962	2.25	0.58432	D	0.999995	D	0.89917	1.0	D	0.74348	0.983	T	0.43845	-0.9366	10	0.66056	D	0.02	-16.7114	4.5787	0.12248	0.0:0.6125:0.1825:0.205	.	660	Q05823	RN5A_HUMAN	C	660	ENSP00000356530:G660C;ENSP00000411147:G660C	ENSP00000356530:G660C	G	-	1	0	RNASEL	180812075	0.005000	0.15991	0.918000	0.36340	0.170000	0.22686	0.948000	0.29096	0.660000	0.30964	0.591000	0.81541	GGT	-	HMMPfam_Ribonuc_2-5A,HMMSmart_SM00580		0.274	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	protein_coding	OTTHUMT00000085189.1	C	NM_021133		180812075	-1	no_errors	NM_021133	genbank	human	reviewed	54_36p	missense	SNP	0.733	A
PIGR	5284	genome.wustl.edu	37	1	207112590	207112590	+	Missense_Mutation	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:207112590G>A	ENST00000356495.4	-	3	445	c.262C>T	c.(262-264)Ccg>Tcg	p.P88S		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	88	Ig-like V-type 1.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCGTTCTCCGGGAAGTTGGTG	0.592																																																0			1											106.0	81.0	90.0					1																	207112590		2203	4300	6503	205179213	SO:0001583	missense	5284				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.262C>T	1.37:g.207112590G>A	ENSP00000348888:p.Pro88Ser	Somatic		Capture	Illumina GAIIx	4	205179213	Q68D81|Q8IZY7	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG	p.P88S	ENST00000356495.4	37	c.262	CCDS1474.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114650	0.77210	.	.	ENSG00000162896	ENST00000356495	T	0.66638	-0.22	5.67	5.67	0.87782	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.162902	0.44483	D	0.000460	T	0.81597	0.4856	M	0.73753	2.245	0.47698	D	0.99949	D	0.76494	0.999	D	0.76071	0.987	T	0.81158	-0.1060	10	0.49607	T	0.09	-22.2557	17.2861	0.87142	0.0:0.0:1.0:0.0	.	88	P01833	PIGR_HUMAN	S	88	ENSP00000348888:P88S	ENSP00000348888:P88S	P	-	1	0	PIGR	205179213	1.000000	0.71417	0.997000	0.53966	0.768000	0.43524	5.833000	0.69349	2.837000	0.97791	0.655000	0.94253	CCG	-	HMMPfam_V-set,superfamily_SSF48726,HMMSmart_IG		0.592	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGR	protein_coding	OTTHUMT00000088975.1	G	NM_002644		205179213	-1	no_errors	NM_002644	genbank	human	provisional	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	2	210045386	210045386	+	IGR	SNP	T	T	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:210045386T>C								RNA5SP117 (259998 upstream) : MAP2 (243395 downstream)																							ATTACACCTGTGTCGACATTG	0.433																																																0			2																																								209753631	SO:0001628	intergenic_variant	402116																															2.37:g.210045386T>C		Somatic		Capture	Illumina GAIIx	4	209753631		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.433					LOC402116			T			209753631	+1	pseudogene	XR_017081	genbank	human	model	54_36p	rna	SNP	1.000	C
MAP2	4133	genome.wustl.edu	37	2	210569343	210569343	+	Intron	SNP	A	A	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:210569343A>T	ENST00000360351.4	+	11	5090				MAP2_ENST00000475600.1_Intron|MAP2_ENST00000447185.1_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Splice_Site_p.K229M|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2						axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCAGGGAACAAGGTAAGGCGG	0.408																																					Pancreas(27;423 979 28787 29963)											0			2											111.0	114.0	113.0					2																	210569343		2203	4299	6502	210277588	SO:0001627	intron_variant	4133				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4585-961A>T	2.37:g.210569343A>T		Somatic		Capture	Illumina GAIIx	4	210277588	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	HMMPfam_RII_binding_1,HMMPfam_Tubulin-binding,PatternScan_TAU_MAP	p.K229M	ENST00000360351.4	37	c.686	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	A	21.8	4.195650	0.78902	.	.	ENSG00000078018	ENST00000199940;ENST00000452717	T;T	0.49720	1.83;0.77	5.03	5.03	0.67393	.	.	.	.	.	T	0.44074	0.1276	N	0.22421	0.69	0.80722	D	1	D	0.67145	0.996	P	0.51453	0.67	T	0.42015	-0.9476	9	0.48119	T	0.1	.	13.3006	0.60324	1.0:0.0:0.0:0.0	.	229	Q8IUX2	.	M	229;171	ENSP00000199940:K229M;ENSP00000388824:K171M	ENSP00000199940:K229M	K	+	2	0	MAP2	210277588	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.259000	0.58828	1.889000	0.54706	0.482000	0.46254	AAG	-	NULL		0.408	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	protein_coding	OTTHUMT00000256521.2	A	NM_001039538		210277588	+1	no_errors	NM_001039538	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	215813953	215813953	+	Missense_Mutation	SNP	C	C	T	rs554061688		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:215813953C>T	ENST00000307340.3	-	68	15301	c.14915G>A	c.(14914-14916)cGc>cAc	p.R4972H	USH2A_ENST00000366943.2_Missense_Mutation_p.R4972H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4972					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCTGTACACGCGTCGCCCTCC	0.547										HNSCC(13;0.011)			C|||	1	0.000199681	0.0	0.0014	5008	,	,		17108	0.0		0.0	False		,,,				2504	0.0															0			1											133.0	101.0	112.0					1																	215813953		2203	4300	6503	213880576	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.14915G>A	1.37:g.215813953C>T	ENSP00000305941:p.Arg4972His	Somatic		Capture	Illumina GAIIx	4	213880576	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00560,HMMSmart_SM00136,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_LAM_1,PatternScan_EGF_1,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMSmart_SM00282,HMMPfam_Laminin_G_2	p.R4972H	ENST00000307340.3	37	c.14915	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479488	0.63849	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.13538	2.59;2.58	5.6	4.67	0.58626	Fibronectin, type III (1);	0.000000	0.40064	U	0.001190	T	0.35740	0.0942	M	0.73598	2.24	0.51767	D	0.999933	D	0.89917	1.0	D	0.63957	0.92	T	0.17410	-1.0370	10	0.52906	T	0.07	.	15.6432	0.77025	0.1384:0.8616:0.0:0.0	.	4972	O75445	USH2A_HUMAN	H	4972	ENSP00000305941:R4972H;ENSP00000355910:R4972H	ENSP00000305941:R4972H	R	-	2	0	USH2A	213880576	0.998000	0.40836	0.021000	0.16686	0.015000	0.08874	3.767000	0.55288	1.322000	0.45245	0.591000	0.81541	CGC	-	NULL		0.547	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	C	NM_007123		213880576	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	missense	SNP	0.988	T
CHPF	79586	genome.wustl.edu	37	2	220405693	220405693	+	Missense_Mutation	SNP	G	G	A	rs377574209		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:220405693G>A	ENST00000243776.6	-	3	1291	c.1043C>T	c.(1042-1044)aCg>aTg	p.T348M	CHPF_ENST00000535926.1_Missense_Mutation_p.T186M|TMEM198_ENST00000344458.2_5'Flank	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	348					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CTCCTGGTACGTGCGTTCCAG	0.572																																																0			2											93.0	75.0	81.0					2																	220405693		2203	4300	6503	220113937	SO:0001583	missense	79586			BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1043C>T	2.37:g.220405693G>A	ENSP00000243776:p.Thr348Met	Somatic		Capture	Illumina GAIIx	4	220113937	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	HMMPfam_CHGN	p.T348M	ENST00000243776.6	37	c.1043	CCDS2443.1	2	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744031	0.89663	.	.	ENSG00000123989	ENST00000243776;ENST00000535926	T;T	0.15256	2.44;2.44	4.63	4.63	0.57726	.	0.063187	0.64402	D	0.000007	T	0.42291	0.1196	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.31251	-0.9950	10	0.54805	T	0.06	-14.4533	18.0706	0.89405	0.0:0.0:1.0:0.0	.	348	Q8IZ52	CHSS2_HUMAN	M	348;186	ENSP00000243776:T348M;ENSP00000445571:T186M	ENSP00000243776:T348M	T	-	2	0	CHPF	220113937	1.000000	0.71417	0.985000	0.45067	0.980000	0.70556	7.781000	0.85668	2.575000	0.86900	0.655000	0.94253	ACG	-	HMMPfam_CHGN		0.572	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF	protein_coding	OTTHUMT00000130268.1	G	NM_024536		220113937	-1	no_errors	NM_024536	genbank	human	validated	54_36p	missense	SNP	0.988	A
DISP1	84976	genome.wustl.edu	37	1	223178376	223178376	+	Missense_Mutation	SNP	A	A	C			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:223178376A>C	ENST00000284476.6	+	8	3801	c.3637A>C	c.(3637-3639)Acc>Ccc	p.T1213P		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	1213					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		TTATGAAGAGACCCACATCTG	0.468																																																0			1											57.0	61.0	60.0					1																	223178376		2203	4300	6503	221244999	SO:0001583	missense	84976			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.3637A>C	1.37:g.223178376A>C	ENSP00000284476:p.Thr1213Pro	Somatic		Capture	Illumina GAIIx	4	221244999	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	HMMPfam_Patched,superfamily_SSF82866	p.T1213P	ENST00000284476.6	37	c.3637	CCDS1536.1	1	.	.	.	.	.	.	.	.	.	.	A	12.02	1.812821	0.32053	.	.	ENSG00000154309	ENST00000284476	D	0.92048	-2.96	5.75	1.95	0.26073	.	0.547984	0.20632	N	0.088567	D	0.84920	0.5579	N	0.20986	0.625	0.26262	N	0.978559	B	0.10296	0.003	B	0.09377	0.004	T	0.71686	-0.4518	10	0.37606	T	0.19	-10.4021	12.3481	0.55132	0.5699:0.4301:0.0:0.0	.	1213	Q96F81	DISP1_HUMAN	P	1213	ENSP00000284476:T1213P	ENSP00000284476:T1213P	T	+	1	0	DISP1	221244999	0.812000	0.29077	0.942000	0.38095	0.956000	0.61745	1.202000	0.32271	0.070000	0.16634	0.459000	0.35465	ACC	-	NULL		0.468	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DISP1	protein_coding	OTTHUMT00000092512.1	A	NM_032890		221244999	+1	no_errors	NM_032890	genbank	human	reviewed	54_36p	missense	SNP	0.994	C
PARP1	142	genome.wustl.edu	37	1	226551735	226551735	+	Missense_Mutation	SNP	C	C	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:226551735C>T	ENST00000366794.5	-	20	2838	c.2695G>A	c.(2695-2697)Gac>Aac	p.D899N	PARP1_ENST00000490921.1_5'UTR	NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	899	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GAGACCATGTCAGCGAAATAG	0.473								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																								0			1											133.0	121.0	125.0					1																	226551735		2203	4300	6503	224618358	SO:0001583	missense	142			BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.2695G>A	1.37:g.226551735C>T	ENSP00000355759:p.Asp899Asn	Somatic		Capture	Illumina GAIIx	4	224618358	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	superfamily_Glucocorticoid receptor-like (DNA-binding domain),HMMPfam_zf-PARP,PatternScan_PARP_ZN_FINGER_1,HMMPfam_PADR1,superfamily_BRCT domain,HMMPfam_BRCT,HMMSmart_SM00292,HMMPfam_WGR,HMMSmart_SM00773,HMMPfam_PARP_reg,superfamily_Domain of poly(ADP-ribose) polymerase,HMMPfam_PARP,superfamily_ADP-ribosylation	p.D899N	ENST00000366794.5	37	c.2695	CCDS1554.1	1	.	.	.	.	.	.	.	.	.	.	C	37	5.984091	0.97173	.	.	ENSG00000143799	ENST00000366794	T	0.15372	2.43	6.17	6.17	0.99709	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.50854	0.1640	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50792	-0.8786	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	899	P09874	PARP1_HUMAN	N	899	ENSP00000355759:D899N	ENSP00000355759:D899N	D	-	1	0	PARP1	224618358	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.794000	0.85869	2.941000	0.99782	0.655000	0.94253	GAC	-	HMMPfam_PARP,superfamily_ADP-ribosylation		0.473	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP1	protein_coding	OTTHUMT00000091519.1	C	NM_001618		224618358	-1	no_errors	NM_001618	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PSMD1	5707	genome.wustl.edu	37	2	231926010	231926010	+	Nonsense_Mutation	SNP	G	G	T			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr2:231926010G>T	ENST00000308696.6	+	2	208	c.46G>T	c.(46-48)Gaa>Taa	p.E16*	PSMD1_ENST00000373635.4_Nonsense_Mutation_p.E16*|PSMD1_ENST00000409643.1_Nonsense_Mutation_p.E16*	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	16					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GGATGAAGATGAACCACAGCT	0.328																																																0			2											130.0	126.0	127.0					2																	231926010		2203	4300	6503	231634254	SO:0001587	stop_gained	5707			D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.46G>T	2.37:g.231926010G>T	ENSP00000309474:p.Glu16*	Somatic		Capture	Illumina GAIIx	4	231634254	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Nonsense_Mutation	SNP	HMMPfam_PC_rep,superfamily_ARM repeat	p.E16*	ENST00000308696.6	37	c.46	CCDS2482.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.610142	0.97705	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000440838;ENST00000409643	.	.	.	5.87	5.87	0.94306	.	0.044468	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	1.7842	20.2191	0.98319	0.0:0.0:1.0:0.0	.	.	.	.	X	16	.	ENSP00000309474:E16X	E	+	1	0	PSMD1	231634254	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.985000	0.93487	2.780000	0.95670	0.655000	0.94253	GAA	-	NULL		0.328	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD1	protein_coding	OTTHUMT00000256958.2	G			231634254	+1	no_errors	NM_002807	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
NLRP3	114548	genome.wustl.edu	37	1	247587804	247587804	+	Silent	SNP	G	G	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:247587804G>A	ENST00000336119.3	+	3	1805	c.1059G>A	c.(1057-1059)gtG>gtA	p.V353V	NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391828.3_Silent_p.V353V|NLRP3_ENST00000348069.2_Silent_p.V353V|NLRP3_ENST00000391827.2_Silent_p.V353V|NLRP3_ENST00000366497.2_Silent_p.V353V|NLRP3_ENST00000366496.2_Silent_p.V353V	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	353	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CGAGACCTGTGGCCCTGGAGA	0.557																																																0			1											58.0	61.0	60.0					1																	247587804		2203	4300	6503	245654427	SO:0001819	synonymous_variant	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1059G>A	1.37:g.247587804G>A		Somatic		Capture	Illumina GAIIx	4	245654427	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Silent	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,HMMPfam_NACHT,superfamily_SSF52047,HMMSmart_LRR_RI,HMMPfam_LRR_1	p.V353	ENST00000336119.3	37	c.1059	CCDS1632.1	1																																																																																			-	HMMPfam_NACHT		0.557	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	protein_coding	OTTHUMT00000097740.1	G	NM_004895		245654427	+1	no_errors	NM_001079821	genbank	human	reviewed	54_36p	silent	SNP	0.031	A
OR13G1	441933	genome.wustl.edu	37	1	247835658	247835658	+	Missense_Mutation	SNP	T	T	A			TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:247835658T>A	ENST00000359688.2	-	1	707	c.686A>T	c.(685-687)gAa>gTa	p.E229V	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CCTCTTGCCTTCTACTGTGCG	0.458																																																0			1											137.0	118.0	125.0					1																	247835658		2203	4300	6503	245902281	SO:0001583	missense	441933			AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.686A>T	1.37:g.247835658T>A	ENSP00000352717:p.Glu229Val	Somatic		Capture	Illumina GAIIx	4	245902281	B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.E229V	ENST00000359688.2	37	c.686	CCDS31094.1	1	.	.	.	.	.	.	.	.	.	.	T	11.04	1.522580	0.27211	.	.	ENSG00000197437	ENST00000359688	T	0.00220	8.52	4.2	-3.21	0.05140	GPCR, rhodopsin-like superfamily (1);	0.686063	0.12591	N	0.455550	T	0.00384	0.0012	M	0.80422	2.495	0.09310	N	1	P	0.36874	0.572	P	0.50754	0.649	T	0.07539	-1.0767	10	0.66056	D	0.02	-2.4299	10.1562	0.42825	0.0:0.0846:0.6563:0.259	.	229	Q8NGZ3	O13G1_HUMAN	V	229	ENSP00000352717:E229V	ENSP00000352717:E229V	E	-	2	0	OR13G1	245902281	0.000000	0.05858	0.000000	0.03702	0.156000	0.22039	0.263000	0.18478	-0.720000	0.04935	0.460000	0.39030	GAA	-	superfamily_SSF81321,HMMPfam_7tm_1		0.458	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	protein_coding	OTTHUMT00000096869.1	T	NM_001005487		245902281	-1	no_errors	NM_001005487	genbank	human	provisional	54_36p	missense	SNP	0.000	A
OR2T12	127064	genome.wustl.edu	37	1	248458830	248458830	+	Missense_Mutation	SNP	G	G	C	rs145359340		TCGA-36-2547-01A-01D-1526-09	TCGA-36-2547-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	02c1e018-543e-49fe-a55c-57846df082ac	55963811-0c02-4069-8d15-694e0405b70b	g.chr1:248458830G>C	ENST00000317996.1	-	1	50	c.51C>G	c.(49-51)aaC>aaG	p.N17K		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			CTCTGGTGTGGTTAAAGAGTC	0.463																																																0			1											86.0	86.0	86.0					1																	248458830		2203	4300	6503	246525453	SO:0001583	missense	127064			BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.51C>G	1.37:g.248458830G>C	ENSP00000324583:p.Asn17Lys	Somatic		Capture	Illumina GAIIx	4	246525453		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.N17K	ENST00000317996.1	37	c.51	CCDS31110.1	1	.	.	.	.	.	.	.	.	.	.	G	4.108	0.018189	0.07959	.	.	ENSG00000177201	ENST00000317996	T	0.00321	8.11	1.56	0.571	0.17352	.	1.231280	0.06234	N	0.689141	T	0.00241	0.0007	M	0.64567	1.98	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.41752	-0.9491	10	0.29301	T	0.29	.	2.9476	0.05850	0.3039:0.0:0.4845:0.2116	.	17	Q8NG77	O2T12_HUMAN	K	17	ENSP00000324583:N17K	ENSP00000324583:N17K	N	-	3	2	OR2T12	246525453	0.000000	0.05858	0.001000	0.08648	0.112000	0.19704	-2.527000	0.00946	-0.217000	0.10033	0.184000	0.17185	AAC	-	superfamily_SSF81321		0.463	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T12	protein_coding	OTTHUMT00000097353.1	G	NM_001004692		246525453	-1	no_errors	NM_001004692	genbank	human	provisional	54_36p	missense	SNP	0.001	C
