#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								4892	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	4892		Missense_Mutation	SNP	HMMPfam_Oxidored_q1,HMMPfam_NADH_dehy_S2_C	p.I141T		37	c.422		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND2			T			4892	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361453	ensembl	human	known	54_36p	missense	SNP	NULL	C
DMRT3	58524	genome.wustl.edu	37	9	990675	990675	+	Silent	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr9:990675C>A	ENST00000190165.2	+	2	1127	c.1089C>A	c.(1087-1089)ccC>ccA	p.P363P		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	363					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		CCCCTTTCCCCCAGCCACCCC	0.592																																																0			9											54.0	53.0	53.0					9																	990675		2203	4300	6503	980675	SO:0001819	synonymous_variant	58524			AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.1089C>A	9.37:g.990675C>A		Somatic		Capture	Illumina GAIIx	4	980675	Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Silent	SNP	superfamily_DM_DNA_bd,HMMPfam_DM,HMMSmart_DM,PatternScan_DM_1,HMMPfam_DMA	p.P363	ENST00000190165.2	37	c.1089	CCDS6443.1	9																																																																																			-	NULL		0.592	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT3	protein_coding	OTTHUMT00000051490.1	C	NM_021240		980675	+1	no_errors	NM_021240	genbank	human	validated	54_36p	silent	SNP	0.949	A
POLN	353497	genome.wustl.edu	37	4	2077203	2077203	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr4:2077203C>A	ENST00000511885.2	-	24	2784	c.2431G>T	c.(2431-2433)Gat>Tat	p.D811Y	POLN_ENST00000382865.1_Missense_Mutation_p.D811Y			Q7Z5Q5	DPOLN_HUMAN	polymerase (DNA directed) nu	811					double-strand break repair via homologous recombination (GO:0000724)|interstrand cross-link repair (GO:0036297)|translesion synthesis (GO:0019985)	nucleus (GO:0005634)	cyclin binding (GO:0030332)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(2)|skin(4)|urinary_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			ATCTGCGGATCTTCCACTTCA	0.627								DNA polymerases (catalytic subunits)																																								0			4											85.0	70.0	75.0					4																	2077203		2203	4300	6503	2047001	SO:0001583	missense	353497			AF044578	CCDS3360.1	4p16.3	2012-05-18			ENSG00000130997	ENSG00000130997		"""DNA polymerases"""	18870	protein-coding gene	gene with protein product		610887				12794064	Standard	NM_181808		Approved		uc003ger.2	Q7Z5Q5	OTTHUMG00000090081	ENST00000511885.2:c.2431G>T	4.37:g.2077203C>A	ENSP00000435506:p.Asp811Tyr	Somatic		Capture	Illumina GAIIx	4	2047001	A2A336|B4E158|Q4TTW4|Q6ZNF4	Missense_Mutation	SNP	superfamily_Ribonuclease H-like,superfamily_DNA/RNA polymerases,HMMPfam_DNA_pol_A,HMMSmart_SM00482	p.D811Y	ENST00000511885.2	37	c.2431	CCDS3360.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.423|9.423	1.083569|1.083569	0.20309|0.20309	.|.	.|.	ENSG00000130997|ENSG00000130997	ENST00000511885;ENST00000382865;ENST00000253313|ENST00000511098	D;D|.	0.96651|.	-4.08;-4.08|.	3.07|3.07	3.07|3.07	0.35406|0.35406	DNA-directed DNA polymerase, family A, palm domain (2);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.71392|0.71392	0.3334|0.3334	M|M	0.78801|0.78801	2.425|2.425	0.39362|0.39362	D|D	0.965946|0.965946	D;B|.	0.76494|.	0.999;0.142|.	D;B|.	0.69479|.	0.964;0.216|.	T|T	0.73613|0.73613	-0.3927|-0.3927	10|5	0.87932|.	D|.	0|.	-9.9919|-9.9919	9.8885|9.8885	0.41276|0.41276	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	502;811|.	E9PE06;Q7Z5Q5|.	.;DPOLN_HUMAN|.	Y|N	811;811;502|443	ENSP00000435506:D811Y;ENSP00000372316:D811Y|.	ENSP00000253313:D502Y|.	D|K	-|-	1|3	0|2	POLN|POLN	2047001|2047001	0.878000|0.878000	0.30173|0.30173	0.684000|0.684000	0.30055|0.30055	0.293000|0.293000	0.27360|0.27360	4.876000|4.876000	0.63079|0.63079	2.034000|2.034000	0.60081|0.60081	0.561000|0.561000	0.74099|0.74099	GAT|AAG	-	superfamily_DNA/RNA polymerases,HMMPfam_DNA_pol_A,HMMSmart_SM00482		0.627	POLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLN	protein_coding	OTTHUMT00000205684.2	C	NM_181808		2047001	-1	no_errors	NM_181808	genbank	human	validated	54_36p	missense	SNP	0.426	A
SIGLEC1	6614	genome.wustl.edu	37	20	3683957	3683957	+	Missense_Mutation	SNP	G	G	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr20:3683957G>C	ENST00000344754.4	-	5	1114	c.1115C>G	c.(1114-1116)tCc>tGc	p.S372C	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.S372C	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	372	Ig-like C2-type 3.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GAGGGTATGGGAGTGGGCATC	0.582																																																0			20											171.0	127.0	142.0					20																	3683957		2203	4300	6503	3631957	SO:0001583	missense	6614			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.1115C>G	20.37:g.3683957G>C	ENSP00000341141:p.Ser372Cys	Somatic		Capture	Illumina GAIIx	4	3631957	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_C2-set_2,HMMSmart_SM00408,HMMPfam_ig,HMMPfam_I-set	p.S372C	ENST00000344754.4	37	c.1115	CCDS13060.1	20	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279928	0.23392	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.13196	2.61;2.61	5.2	0.439	0.16567	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.788553	0.10789	N	0.633972	T	0.39655	0.1086	M	0.85542	2.76	0.09310	N	1	P;P;P	0.52463	0.942;0.953;0.942	P;P;P	0.61874	0.881;0.895;0.831	T	0.43360	-0.9396	10	0.56958	D	0.05	.	16.0711	0.80936	0.0:0.6301:0.3699:0.0	.	372;372;372	Q9BZZ2-2;Q9BZZ2;Q9BZZ2-3	.;SN_HUMAN;.	C	372	ENSP00000341141:S372C;ENSP00000202578:S372C	ENSP00000202578:S372C	S	-	2	0	SIGLEC1	3631957	0.024000	0.19004	0.001000	0.08648	0.081000	0.17604	1.187000	0.32090	0.550000	0.28991	0.462000	0.41574	TCC	-	superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig		0.582	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	protein_coding	OTTHUMT00000077761.2	G	NM_023068		3631957	-1	no_errors	NM_023068	genbank	human	reviewed	54_36p	missense	SNP	0.000	C
ZZEF1	23140	genome.wustl.edu	37	17	3921023	3921023	+	Splice_Site	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr17:3921023G>T	ENST00000381638.2	-	48	7767	c.7643C>A	c.(7642-7644)tCc>tAc	p.S2548Y		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2548							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TGCAGGCCGGGACTGCAAACC	0.577																																																0			17											80.0	80.0	80.0					17																	3921023		2203	4300	6503	3867772	SO:0001630	splice_region_variant	23140			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.7642-1C>A	17.37:g.3921023G>T		Somatic		Capture	Illumina GAIIx	4	3867772	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,superfamily_Galactose-binding domain-like,HMMPfam_APC10,superfamily_Spermadhesin CUB domain,HMMSmart_SM00291,HMMPfam_ZZ,PatternScan_ZF_ZZ_1	p.S2548Y	ENST00000381638.2	37	c.7643	CCDS11043.1	17	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005632	0.74932	.	.	ENSG00000074755	ENST00000381638	T	0.24151	1.87	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.29556	0.0737	L	0.27053	0.805	0.54753	D	0.999989	D	0.59357	0.985	P	0.54460	0.753	T	0.02339	-1.1174	10	0.62326	D	0.03	-14.065	12.3029	0.54884	0.0774:0.0:0.9226:0.0	.	2548	O43149	ZZEF1_HUMAN	Y	2548	ENSP00000371051:S2548Y	ENSP00000371051:S2548Y	S	-	2	0	ZZEF1	3867772	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.690000	0.84178	2.482000	0.83794	0.650000	0.86243	TCC	-	NULL		0.577	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	protein_coding	OTTHUMT00000207480.1	G	NM_015113	Missense_Mutation	3867772	-1	no_errors	NM_015113	genbank	human	validated	54_36p	missense	SNP	1.000	T
C11orf42	160298	genome.wustl.edu	37	11	6231584	6231584	+	Missense_Mutation	SNP	G	G	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr11:6231584G>C	ENST00000316375.2	+	2	627	c.577G>C	c.(577-579)Gtt>Ctt	p.V193L	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	193										endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTCATTACCTGTTGCCTTCTC	0.572																																																0			11											77.0	85.0	82.0					11																	6231584		2201	4296	6497	6188160	SO:0001583	missense	160298			BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.577G>C	11.37:g.6231584G>C	ENSP00000321021:p.Val193Leu	Somatic		Capture	Illumina GAIIx	4	6188160		Missense_Mutation	SNP	NULL	p.V193L	ENST00000316375.2	37	c.577	CCDS7759.1	11	.	.	.	.	.	.	.	.	.	.	G	4.757	0.140732	0.09083	.	.	ENSG00000180878	ENST00000316375	T	0.52057	0.68	5.13	-2.07	0.07276	.	0.858069	0.10078	N	0.718828	T	0.28962	0.0719	N	0.14661	0.345	0.23454	N	0.997646	B	0.19817	0.039	B	0.20384	0.029	T	0.23084	-1.0198	10	0.59425	D	0.04	0.0	9.6756	0.40039	0.6689:0.0:0.3311:0.0	.	193	Q8N5U0	CK042_HUMAN	L	193	ENSP00000321021:V193L	ENSP00000321021:V193L	V	+	1	0	C11orf42	6188160	0.549000	0.26481	0.967000	0.41034	0.777000	0.43975	-0.444000	0.06854	-0.612000	0.05701	-0.225000	0.12378	GTT	-	NULL		0.572	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf42	protein_coding	OTTHUMT00000257227.2	G	NM_173525		6188160	+1	no_errors	NM_173525	genbank	human	predicted	54_36p	missense	SNP	0.932	C
SCNN1A	6337	genome.wustl.edu	37	12	6483986	6483986	+	5'UTR	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr12:6483986C>A	ENST00000228916.2	-	0	62				SCNN1A_ENST00000360168.3_Missense_Mutation_p.E47D|SCNN1A_ENST00000358945.3_5'UTR|SCNN1A_ENST00000396966.2_5'Flank|SCNN1A_ENST00000543768.1_Missense_Mutation_p.E11D|SCNN1A_ENST00000538979.1_Intron|LTBR_ENST00000539925.1_5'Flank	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	TAGGGTCCTGCTCCTCCAGCT	0.612																																																0			12											41.0	43.0	42.0					12																	6483986		2203	4300	6503	6354247	SO:0001623	5_prime_UTR_variant	6337			Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.-37G>T	12.37:g.6483986C>A		Somatic		Capture	Illumina GAIIx	4	6354247	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Missense_Mutation	SNP	HMMPfam_ASC,PatternScan_ASC	p.E47D	ENST00000228916.2	37	c.141	CCDS8543.1	12	.	.	.	.	.	.	.	.	.	.	C	8.418	0.845804	0.16963	.	.	ENSG00000111319	ENST00000360168;ENST00000543768;ENST00000536788	T;T;D	0.86097	-0.78;-0.45;-2.07	2.94	1.04	0.20106	.	3.984550	0.00582	N	0.000333	T	0.73001	0.3531	N	0.08118	0	0.09310	N	0.999998	B;B	0.26445	0.092;0.149	B;B	0.29785	0.05;0.107	T	0.64529	-0.6386	10	0.49607	T	0.09	.	4.7136	0.12884	0.0:0.6864:0.0:0.3136	.	11;47	B4E2Q5;P37088-2	.;.	D	47;11;9	ENSP00000353292:E47D;ENSP00000438739:E11D;ENSP00000443434:E9D	ENSP00000353292:E47D	E	-	3	2	SCNN1A	6354247	0.004000	0.15560	0.009000	0.14445	0.143000	0.21401	0.302000	0.19192	0.556000	0.29098	-0.254000	0.11334	GAG	-	NULL		0.612	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCNN1A	protein_coding	OTTHUMT00000399055.1	C			6354247	-1	no_errors	ENST00000360168	ensembl	human	known	54_36p	missense	SNP	0.003	A
DCHS1	8642	genome.wustl.edu	37	11	6644764	6644764	+	Missense_Mutation	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr11:6644764C>T	ENST00000299441.3	-	21	8554	c.8143G>A	c.(8143-8145)Gtg>Atg	p.V2715M	RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2715	Cadherin 26. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCTCGGCCACGCTGGTGCTG	0.577																																																0			11											55.0	47.0	49.0					11																	6644764		2201	4296	6497	6601340	SO:0001583	missense	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.8143G>A	11.37:g.6644764C>T	ENSP00000299441:p.Val2715Met	Somatic		Capture	Illumina GAIIx	4	6601340	O15098	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1	p.V2715M	ENST00000299441.3	37	c.8143	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395387	0.62066	.	.	ENSG00000166341	ENST00000299441	T	0.58358	0.34	5.26	4.33	0.51752	Cadherin (3);Cadherin-like (1);	0.000000	0.31323	N	0.007855	T	0.50377	0.1612	M	0.86268	2.805	0.19575	N	0.999963	B	0.32365	0.367	B	0.29353	0.101	T	0.56565	-0.7958	10	0.54805	T	0.06	.	4.0968	0.09995	0.0804:0.1346:0.5381:0.2468	.	2715	Q96JQ0	PCD16_HUMAN	M	2715	ENSP00000299441:V2715M	ENSP00000299441:V2715M	V	-	1	0	DCHS1	6601340	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.868000	0.27982	1.477000	0.48234	-0.120000	0.15030	GTG	-	superfamily_Cadherin,HMMPfam_Cadherin		0.577	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	protein_coding	OTTHUMT00000257258.1	C	NM_003737		6601340	-1	no_errors	NM_003737	genbank	human	reviewed	54_36p	missense	SNP	0.996	T
TP53	7157	genome.wustl.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr17:7578403C>T	ENST00000269305.4	-	5	716	c.527G>A	c.(526-528)tGc>tAc	p.C176Y	TP53_ENST00000420246.2_Missense_Mutation_p.C176Y|TP53_ENST00000455263.2_Missense_Mutation_p.C176Y|TP53_ENST00000359597.4_Missense_Mutation_p.C176Y|TP53_ENST00000413465.2_Missense_Mutation_p.C176Y|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.C176Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)	17											49.0	49.0	49.0					17																	7578403		2203	4300	6503	7519128	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>A	17.37:g.7578403C>T	ENSP00000269305:p.Cys176Tyr	Somatic		Capture	Illumina GAIIx	4	7519128	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.C176Y	ENST00000269305.4	37	c.527	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497871	0.85069	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.996;0.997;0.998;0.998;0.997;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176Y;ENSP00000352610:C176Y;ENSP00000269305:C176Y;ENSP00000398846:C176Y;ENSP00000391127:C176Y;ENSP00000391478:C176Y;ENSP00000425104:C44Y;ENSP00000423862:C83Y	ENSP00000269305:C176Y	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519128	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SNX29	92017	genome.wustl.edu	37	16	12145846	12145846	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr16:12145846C>A	ENST00000566228.1	+	8	960	c.891C>A	c.(889-891)gaC>gaA	p.D297E	SNX29_ENST00000323433.4_5'Flank|SNX29_ENST00000306030.3_5'Flank	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	297						extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						ACAACTCCGACCGCTCCTCTG	0.493																																																0			16											66.0	76.0	73.0					16																	12145846		2197	4298	6495	12053347	SO:0001583	missense	84127			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.891C>A	16.37:g.12145846C>A	ENSP00000456480:p.Asp297Glu	Somatic		Capture	Illumina GAIIx	4	12053347	B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	HMMPfam_RUN,HMMSmart_SM00593	p.D297E	ENST00000566228.1	37	c.891	CCDS10553.2	16	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474653	0.26511	.	.	ENSG00000140660	ENST00000268271	.	.	.	5.91	3.65	0.41850	.	0.125811	0.53938	D	0.000051	T	0.63343	0.2503	M	0.65975	2.015	0.80722	D	1	.	.	.	.	.	.	T	0.61108	-0.7129	7	0.30854	T	0.27	-23.4349	10.5327	0.44986	0.0:0.7865:0.0:0.2135	.	.	.	.	E	297	.	ENSP00000268271:D297E	D	+	3	2	RUNDC2A	12053347	1.000000	0.71417	1.000000	0.80357	0.474000	0.32979	1.173000	0.31920	1.520000	0.48965	0.462000	0.41574	GAC	-	NULL		0.493	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RUNDC2A	protein_coding	OTTHUMT00000422622.1	C			12053347	+1	no_errors	NM_032167	genbank	human	validated	54_36p	missense	SNP	0.996	A
FRMPD4	9758	genome.wustl.edu	37	X	12736742	12736742	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chrX:12736742C>A	ENST00000380682.1	+	16	4303	c.3797C>A	c.(3796-3798)cCt>cAt	p.P1266H		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1266					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GAGAGAGCCCCTGGGCTTCCC	0.577																																																0			X											101.0	100.0	100.0					X																	12736742		2203	4300	6503	12646663	SO:0001583	missense	9758			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3797C>A	X.37:g.12736742C>A	ENSP00000370057:p.Pro1266His	Somatic		Capture	Illumina GAIIx	4	12646663	A8K0X9|O15032	Missense_Mutation	SNP	PatternScan_WW_DOMAIN_1,PatternScan_FERM_1,PatternScan_FERM_2,superfamily_PDZ,HMMSmart_PDZ,HMMPfam_PDZ,HMMSmart_B41,superfamily_FERM_3-hlx,HMMPfam_FERM_M	p.P1266H	ENST00000380682.1	37	c.3797	CCDS35201.1	X	.	.	.	.	.	.	.	.	.	.	C	6.129	0.392112	0.11581	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.05513	3.43	5.55	4.69	0.59074	.	1.229440	0.05366	N	0.534670	T	0.06462	0.0166	N	0.08118	0	0.09310	N	1	B;B	0.25809	0.135;0.135	B;B	0.30572	0.117;0.117	T	0.49762	-0.8905	10	0.72032	D	0.01	5.4785	13.4653	0.61249	0.0:0.9227:0.0:0.0773	.	1258;1266	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	H	1266;1257;1255	ENSP00000370057:P1266H	ENSP00000304583:P1255H	P	+	2	0	FRMPD4	12646663	0.003000	0.15002	0.020000	0.16555	0.616000	0.37450	1.376000	0.34306	1.101000	0.41535	0.600000	0.82982	CCT	-	NULL		0.577	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	protein_coding	OTTHUMT00000055771.1	C	XM_045712		12646663	+1	no_errors	NM_014728	genbank	human	validated	54_36p	missense	SNP	0.043	A
GCDH	2639	genome.wustl.edu	37	19	13005143	13005143	+	Intron	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr19:13005143G>T	ENST00000222214.5	+	6	716				GCDH_ENST00000457854.1_Intron|GCDH_ENST00000422947.2_Intron|GCDH_ENST00000591470.1_Intron			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase						cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	TTGAAACAGGGTGTCTTGACC	0.488																																					GBM(123;875 1636 7726 16444 26754)											0			19																																								12866143	SO:0001627	intron_variant	729389			AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.505+676G>T	19.37:g.13005143G>T		Somatic		Capture	Illumina GAIIx	4	12866143	A8K2Z2|O14719	RNA	SNP	-	NULL	ENST00000222214.5	37	NULL	CCDS12286.1	19																																																																																			-	-		0.488	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729389	protein_coding	OTTHUMT00000451897.1	G			12866143	+1	pseudogene	XR_015945	genbank	human	model	54_36p	rna	SNP	1.000	T
SOX6	55553	genome.wustl.edu	37	11	16068144	16068144	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr11:16068144C>A	ENST00000352083.6	-	12	1616	c.1539G>T	c.(1537-1539)gaG>gaT	p.E513D	SOX6_ENST00000316399.6_Missense_Mutation_p.E513D|SOX6_ENST00000528429.1_Missense_Mutation_p.E513D|SOX6_ENST00000396356.3_Missense_Mutation_p.E513D|SOX6_ENST00000528252.1_Missense_Mutation_p.E486D|SOX6_ENST00000527619.1_Missense_Mutation_p.E489D			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	513					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						GCTGCTGTTGCTCCCGCTGGA	0.502																																																0			11											129.0	112.0	118.0					11																	16068144		2200	4294	6494	16024720	SO:0001583	missense	55553			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.1539G>T	11.37:g.16068144C>A	ENSP00000339876:p.Glu513Asp	Somatic		Capture	Illumina GAIIx	4	16024720	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	superfamily_HMG-box,HMMSmart_HMG,HMMPfam_HMG_box	p.E513D	ENST00000352083.6	37	c.1539		11	.	.	.	.	.	.	.	.	.	.	C	19.58	3.855172	0.71719	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	D;D;D;D;D;D	0.98313	-4.75;-4.86;-4.75;-4.78;-4.78;-4.86	5.81	3.96	0.45880	.	0.098161	0.64402	D	0.000002	D	0.98444	0.9482	M	0.73217	2.22	0.58432	D	0.999994	D;D;D	0.69078	0.997;0.982;0.99	D;P;D	0.72982	0.925;0.826;0.979	D	0.98001	1.0360	10	0.46703	T	0.11	.	11.462	0.50217	0.0:0.8013:0.0:0.1987	.	513;513;489	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	D	513;513;513;486;489;513	ENSP00000324948:E513D;ENSP00000339876:E513D;ENSP00000379644:E513D;ENSP00000432134:E486D;ENSP00000434455:E489D;ENSP00000433233:E513D	ENSP00000324948:E513D	E	-	3	2	SOX6	16024720	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.929000	0.28844	0.823000	0.34589	-0.198000	0.12761	GAG	-	NULL		0.502	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	SOX6	protein_coding	OTTHUMT00000386811.1	C	NM_033326		16024720	-1	no_errors	NM_033326	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CDH18	1016	genome.wustl.edu	37	5	19483433	19483433	+	Missense_Mutation	SNP	A	A	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr5:19483433A>T	ENST00000507958.1	-	14	2849	c.1859T>A	c.(1858-1860)cTt>cAt	p.L620H	CDH18_ENST00000502796.1_3'UTR|CDH18_ENST00000274170.4_Missense_Mutation_p.L620H|CDH18_ENST00000506372.1_3'UTR|CDH18_ENST00000382275.1_Missense_Mutation_p.L620H			Q13634	CAD18_HUMAN	cadherin 18, type 2	620					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AACACAGAGAAGAATAGCGAT	0.468																																																0			5											63.0	63.0	63.0					5																	19483433		2203	4300	6503	19519190	SO:0001583	missense	1016			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1859T>A	5.37:g.19483433A>T	ENSP00000425093:p.Leu620His	Somatic		Capture	Illumina GAIIx	4	19519190	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	superfamily_Cadherin,HMMSmart_CA,HMMPfam_Cadherin,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.L620H	ENST00000507958.1	37	c.1859	CCDS3889.1	5	.	.	.	.	.	.	.	.	.	.	A	24.5	4.543512	0.86022	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	T;T;T	0.62941	-0.01;-0.01;-0.01	5.54	5.54	0.83059	.	0.068403	0.64402	D	0.000013	T	0.81394	0.4813	M	0.87381	2.88	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.84354	0.0534	9	.	.	.	.	14.505	0.67746	1.0:0.0:0.0:0.0	.	620	Q13634	CAD18_HUMAN	H	620	ENSP00000371710:L620H;ENSP00000425093:L620H;ENSP00000274170:L620H	.	L	-	2	0	CDH18	19519190	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.113000	0.64589	0.533000	0.62120	CTT	-	NULL		0.468	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	protein_coding	OTTHUMT00000366747.1	A	NM_004934		19519190	-1	no_errors	NM_004934	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LOC81691	81691	genome.wustl.edu	37	16	20839845	20839845	+	Missense_Mutation	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr16:20839845C>G	ENST00000261377.6	+	11	1353	c.1144C>G	c.(1144-1146)Cat>Gat	p.H382D	ERI2_ENST00000564349.1_Intron|AC004381.6_ENST00000564274.1_Missense_Mutation_p.H382D|AC004381.6_ENST00000348433.6_Missense_Mutation_p.H382D	NM_001199053.1|NM_030941.2	NP_001185982.1|NP_112203.2																					TTTCCTTAAGCATGGCCCAAA	0.408																																																0			16											202.0	173.0	183.0					16																	20839845		2201	4300	6501	20747346	SO:0001583	missense	81691																														ENST00000261377.6:c.1144C>G	16.37:g.20839845C>G	ENSP00000261377:p.His382Asp	Somatic		Capture	Illumina GAIIx	4	20747346		Missense_Mutation	SNP	superfamily_Ribonuclease H-like,HMMSmart_SM00479,HMMPfam_Exonuc_X-T,HMMSmart_SM00360,HMMPfam_RRM_1,superfamily_RNA-binding domain RBD	p.H382D	ENST00000261377.6	37	c.1144	CCDS10591.1	16	.	.	.	.	.	.	.	.	.	.	C	12.49	1.952806	0.34471	.	.	ENSG00000005189	ENST00000348433;ENST00000261377	T;T	0.32023	1.47;1.86	5.2	-0.0108	0.13995	Exonuclease (1);	0.581880	0.17927	N	0.157304	T	0.16342	0.0393	N	0.24115	0.695	0.19575	N	0.999965	B;B	0.20261	0.043;0.004	B;B	0.20767	0.031;0.007	T	0.13980	-1.0489	10	0.45353	T	0.12	-2.7915	4.0912	0.09970	0.2035:0.4927:0.0:0.3038	.	382;382	Q96IC2-2;Q96IC2	.;REXON_HUMAN	D	382	ENSP00000261378:H382D;ENSP00000261377:H382D	ENSP00000261377:H382D	H	+	1	0	AC004381.6	20747346	0.289000	0.24334	0.861000	0.33841	0.851000	0.48451	-0.043000	0.12043	0.010000	0.14839	-0.458000	0.05436	CAT	-	superfamily_Ribonuclease H-like,HMMSmart_SM00479		0.408	AC004381.6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC81691	protein_coding	OTTHUMT00000254418.2	C			20747346	+1	no_errors	NM_030941	genbank	human	validated	54_36p	missense	SNP	0.941	G
DNAH3	55567	genome.wustl.edu	37	16	20996443	20996443	+	Missense_Mutation	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr16:20996443C>T	ENST00000261383.3	-	48	7620	c.7621G>A	c.(7621-7623)Gtt>Att	p.V2541I	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2541	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GTGACTTCAACCTTCTCTCCT	0.473																																																0			16											73.0	61.0	65.0					16																	20996443		2201	4300	6501	20903944	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7621G>A	16.37:g.20996443C>T	ENSP00000261383:p.Val2541Ile	Somatic		Capture	Illumina GAIIx	4	20903944	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,superfamily_Prefoldin,HMMPfam_Dynein_heavy	p.V2541I	ENST00000261383.3	37	c.7621	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	2.622	-0.288367	0.05605	.	.	ENSG00000158486	ENST00000261383	T	0.41065	1.01	5.13	1.56	0.23342	Dynein heavy chain, P-loop containing D4 domain (1);	0.375965	0.25887	N	0.027649	T	0.14313	0.0346	N	0.02539	-0.55	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.17501	-1.0367	10	0.07325	T	0.83	.	8.774	0.34751	0.0:0.2279:0.0:0.7721	.	2541	Q8TD57	DYH3_HUMAN	I	2541	ENSP00000261383:V2541I	ENSP00000261383:V2541I	V	-	1	0	DNAH3	20903944	1.000000	0.71417	0.967000	0.41034	0.580000	0.36256	1.446000	0.35090	-0.012000	0.14223	-0.302000	0.09304	GTT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.473	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	protein_coding	OTTHUMT00000207361.1	C	NM_017539		20903944	-1	no_errors	NM_017539	genbank	human	provisional	54_36p	missense	SNP	0.980	T
IFNA14	3448	genome.wustl.edu	37	9	21239728	21239728	+	Missense_Mutation	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr9:21239728G>T	ENST00000380222.2	-	1	250	c.207C>A	c.(205-207)aaC>aaA	p.N69K		NM_002172.2	NP_002163.2	P01570	IFN14_HUMAN	interferon, alpha 14	69					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)	11				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		TCTGGAACTGGTTGCCATCAA	0.473																																																0			9											118.0	118.0	118.0					9																	21239728		2203	4300	6503	21229728	SO:0001583	missense	3448				CCDS6501.1	9p22	2010-08-24			ENSG00000228083	ENSG00000228083		"""Interferons"""	5420	protein-coding gene	gene with protein product		147579				1385305	Standard	NM_002172		Approved	LEIF2H, IFN-alphaH	uc010mis.3	P01570	OTTHUMG00000019665	ENST00000380222.2:c.207C>A	9.37:g.21239728G>T	ENSP00000369571:p.Asn69Lys	Somatic		Capture	Illumina GAIIx	4	21229728	Q5VZ56|Q7M4S1	Missense_Mutation	SNP	HMMPfam_Interferon,superfamily_4_helix_cytokine,HMMSmart_IFabd,PatternScan_INTERFERON_A_B_D	p.N69K	ENST00000380222.2	37	c.207	CCDS6501.1	9	.	.	.	.	.	.	.	.	.	.	g	4.844	0.156946	0.09236	.	.	ENSG00000228083	ENST00000380222	T	0.03152	4.03	3.38	1.04	0.20106	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.616840	0.02788	N	0.121662	T	0.06234	0.0161	L	0.49126	1.545	0.09310	N	1	B	0.15719	0.014	B	0.28784	0.094	T	0.46148	-0.9212	10	0.28530	T	0.3	.	7.0806	0.25229	0.1139:0.5543:0.3318:0.0	.	69	P01570	IFN14_HUMAN	K	69	ENSP00000369571:N69K	ENSP00000369571:N69K	N	-	3	2	IFNA14	21229728	0.000000	0.05858	0.014000	0.15608	0.199000	0.23934	-1.285000	0.02791	0.047000	0.15862	0.398000	0.26397	AAC	-	HMMPfam_Interferon,superfamily_4_helix_cytokine,HMMSmart_IFabd		0.473	IFNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA14	protein_coding	OTTHUMT00000051894.1	G	NM_002172		21229728	-1	no_errors	NM_002172	genbank	human	validated	54_36p	missense	SNP	0.001	T
SUSD2	56241	genome.wustl.edu	37	22	24583177	24583177	+	Silent	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr22:24583177C>T	ENST00000358321.3	+	11	1911	c.1650C>T	c.(1648-1650)ttC>ttT	p.F550F		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	550	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CAGGAATGTTCCTGTCGGTGG	0.672																																																0			22											67.0	64.0	65.0					22																	24583177		2203	4300	6503	22913177	SO:0001819	synonymous_variant	56241			AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1650C>T	22.37:g.24583177C>T		Somatic		Capture	Illumina GAIIx	4	22913177	Q9H5Y6	Silent	SNP	HMMSmart_SO,HMMPfam_Somatomedin_B,superfamily_SSF90188,PatternScan_SMB_1,HMMSmart_AMOP,HMMPfam_AMOP,HMMSmart_VWD,HMMPfam_VWD,superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP	p.F550	ENST00000358321.3	37	c.1650	CCDS13824.1	22																																																																																			-	HMMSmart_VWD,HMMPfam_VWD		0.672	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD2	protein_coding	OTTHUMT00000320088.1	C	NM_019601		22913177	+1	no_errors	NM_019601	genbank	human	validated	54_36p	silent	SNP	1.000	T
EMILIN1	11117	genome.wustl.edu	37	2	27305517	27305517	+	Missense_Mutation	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:27305517C>G	ENST00000380320.4	+	4	1577	c.1078C>G	c.(1078-1080)Cgg>Ggg	p.R360G		NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	360					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAGCTGGGCCGGCGACTGGC	0.716																																																0			2											6.0	7.0	7.0					2																	27305517		2139	4174	6313	27159021	SO:0001583	missense	11117			AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.1078C>G	2.37:g.27305517C>G	ENSP00000369677:p.Arg360Gly	Somatic		Capture	Illumina GAIIx	4	27159021	A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Missense_Mutation	SNP	HMMPfam_EMI,HMMPfam_Collagen,superfamily_TNF_like,HMMPfam_C1q	p.R360G	ENST00000380320.4	37	c.1078	CCDS1733.1	2	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888167	0.33348	.	.	ENSG00000138080	ENST00000380320	T	0.63580	-0.05	5.25	4.37	0.52481	.	0.330677	0.26013	N	0.026862	T	0.44159	0.1280	N	0.24115	0.695	0.34163	D	0.668939	B	0.32203	0.36	B	0.28465	0.09	T	0.54214	-0.8327	10	0.25751	T	0.34	-17.5494	10.977	0.47472	0.3398:0.6602:0.0:0.0	.	360	Q9Y6C2	EMIL1_HUMAN	G	360	ENSP00000369677:R360G	ENSP00000369677:R360G	R	+	1	2	EMILIN1	27159021	0.009000	0.17119	0.995000	0.50966	0.912000	0.54170	0.832000	0.27490	1.209000	0.43321	0.407000	0.27541	CGG	-	NULL		0.716	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN1	protein_coding	OTTHUMT00000214185.1	C	NM_007046		27159021	+1	no_errors	NM_007046	genbank	human	validated	54_36p	missense	SNP	0.515	G
PTK2B	2185	genome.wustl.edu	37	8	27255119	27255119	+	Missense_Mutation	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr8:27255119G>T	ENST00000397501.1	+	7	826	c.18G>T	c.(16-18)gaG>gaT	p.E6D	PTK2B_ENST00000338238.4_Missense_Mutation_p.E6D|PTK2B_ENST00000517339.1_Missense_Mutation_p.E6D|PTK2B_ENST00000346049.5_Missense_Mutation_p.E6D|PTK2B_ENST00000544172.1_Missense_Mutation_p.E6D|PTK2B_ENST00000420218.2_Missense_Mutation_p.E6D	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	6					activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	GGGTGTCCGAGCCCCTGAGTC	0.597																																																0			8											116.0	102.0	107.0					8																	27255119		2203	4300	6503	27311036	SO:0001583	missense	2185			U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.18G>T	8.37:g.27255119G>T	ENSP00000380638:p.Glu6Asp	Somatic		Capture	Illumina GAIIx	4	27311036	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	HMMSmart_SM00295,superfamily_Second domain of FERM,HMMPfam_FERM_M,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,HMMPfam_Focal_AT,superfamily_FAT domain of focal adhesion kinase	p.E6D	ENST00000397501.1	37	c.18	CCDS6057.1	8	.	.	.	.	.	.	.	.	.	.	G	16.16	3.045773	0.55110	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000522338;ENST00000521164;ENST00000346049;ENST00000420218;ENST00000522517;ENST00000412793;ENST00000517339	T;T;T;T;T;T	0.75050	-0.9;-0.87;-0.9;-0.9;-0.87;-0.87	4.79	3.92	0.45320	.	0.120722	0.56097	D	0.000030	T	0.56834	0.2012	N	0.14661	0.345	0.32154	N	0.583903	B;B	0.24721	0.11;0.021	B;B	0.19946	0.027;0.014	T	0.64170	-0.6470	10	0.87932	D	0	.	10.5881	0.45294	0.0931:0.0:0.9069:0.0	.	6;6	Q14289-2;Q14289	.;FAK2_HUMAN	D	6;11;6;6;6;6;6;6;6;6;6	ENSP00000380638:E6D;ENSP00000342242:E6D;ENSP00000440926:E6D;ENSP00000332816:E6D;ENSP00000391995:E6D;ENSP00000427931:E6D	ENSP00000342242:E6D	E	+	3	2	PTK2B	27311036	1.000000	0.71417	0.996000	0.52242	0.963000	0.63663	2.036000	0.41165	1.251000	0.43983	0.655000	0.94253	GAG	-	NULL		0.597	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	protein_coding	OTTHUMT00000219916.1	G	NM_004103		27311036	+1	no_errors	NM_004103	genbank	human	reviewed	54_36p	missense	SNP	0.981	T
SNX17	9784	genome.wustl.edu	37	2	27596119	27596119	+	Missense_Mutation	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:27596119C>G	ENST00000233575.2	+	4	484	c.262C>G	c.(262-264)Caa>Gaa	p.Q88E	EIF2B4_ENST00000445933.2_5'Flank|EIF2B4_ENST00000493344.2_5'Flank|SNX17_ENST00000542478.1_5'UTR|EIF2B4_ENST00000347454.4_5'Flank|SNX17_ENST00000537606.1_Missense_Mutation_p.Q63E|SNX17_ENST00000543024.1_5'UTR	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	88	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGTAGTTCGGCAAGACCCATT	0.527																																																0			2											116.0	104.0	108.0					2																	27596119		2203	4300	6503	27449623	SO:0001583	missense	9784			D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.262C>G	2.37:g.27596119C>G	ENSP00000233575:p.Gln88Glu	Somatic		Capture	Illumina GAIIx	4	27449623	B4DQM7|Q53HN7|Q6IAS3	Missense_Mutation	SNP	HMMPfam_PX,HMMSmart_PX,superfamily_PX,HMMPfam_FERM_M	p.Q88E	ENST00000233575.2	37	c.262	CCDS1750.1	2	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448555	0.84101	.	.	ENSG00000115234	ENST00000233575;ENST00000537606	T;T	0.39787	1.06;1.06	4.95	4.95	0.65309	Phox homologous domain (5);	0.174672	0.52532	D	0.000068	T	0.56307	0.1976	L	0.45228	1.405	0.80722	D	1	P;B;D;B	0.61080	0.623;0.03;0.989;0.403	B;B;D;B	0.68765	0.102;0.038;0.96;0.253	T	0.54860	-0.8230	10	0.48119	T	0.1	-5.0488	16.8931	0.86093	0.0:1.0:0.0:0.0	.	63;76;68;88	B4DQM7;B4DTB8;B4DQ37;Q15036	.;.;.;SNX17_HUMAN	E	88;63	ENSP00000233575:Q88E;ENSP00000439208:Q63E	ENSP00000233575:Q88E	Q	+	1	0	SNX17	27449623	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	6.559000	0.73946	2.567000	0.86603	0.462000	0.41574	CAA	-	HMMPfam_PX,HMMSmart_PX,superfamily_PX		0.527	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX17	protein_coding	OTTHUMT00000215024.1	C	NM_014748		27449623	+1	no_errors	NM_014748	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SETD1A	9739	genome.wustl.edu	37	16	30991352	30991352	+	Nonsense_Mutation	SNP	C	C	G	rs375584016		TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr16:30991352C>G	ENST00000262519.8	+	14	4931	c.4245C>G	c.(4243-4245)taC>taG	p.Y1415*		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1415	Interaction with CFP1.|Pro-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						cccgcgccTACGAGCCACGCA	0.692																																																0			16											26.0	29.0	28.0					16																	30991352		2197	4299	6496	30898853	SO:0001587	stop_gained	9739			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.4245C>G	16.37:g.30991352C>G	ENSP00000262519:p.Tyr1415*	Somatic		Capture	Illumina GAIIx	4	30898853	A6NP62|Q6PIF3|Q8TAJ6	Nonsense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1,superfamily_SSF82199,HMMPfam_SET,HMMSmart_SET,HMMSmart_PostSET	p.Y1415*	ENST00000262519.8	37	c.4245	CCDS32435.1	16	.	.	.	.	.	.	.	.	.	.	C	43	10.050729	0.99325	.	.	ENSG00000099381	ENST00000262519	.	.	.	4.06	-1.81	0.07882	.	0.245941	0.33834	N	0.004520	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	9.0409	0.36316	0.0:0.4011:0.0:0.5989	.	.	.	.	X	1415	.	ENSP00000262519:Y1415X	Y	+	3	2	SETD1A	30898853	0.225000	0.23685	0.223000	0.23860	0.006000	0.05464	-0.608000	0.05641	-0.181000	0.10619	-0.253000	0.11424	TAC	-	NULL		0.692	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	protein_coding	OTTHUMT00000318244.2	C	NM_014712		30898853	+1	no_errors	NM_014712	genbank	human	provisional	54_36p	nonsense	SNP	0.988	G
BIRC6	57448	genome.wustl.edu	37	2	32660642	32660642	+	Missense_Mutation	SNP	A	A	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:32660642A>C	ENST00000421745.2	+	14	3622	c.3488A>C	c.(3487-3489)gAg>gCg	p.E1163A		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1163					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ATGGATGTAGAGGAATCACAG	0.413																																					Pancreas(94;175 1509 16028 18060 45422)											0			2											63.0	63.0	63.0					2																	32660642		2184	4252	6436	32514146	SO:0001583	missense	57448			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.3488A>C	2.37:g.32660642A>C	ENSP00000393596:p.Glu1163Ala	Somatic		Capture	Illumina GAIIx	4	32514146	Q9ULD1	Missense_Mutation	SNP	superfamily_Inhibitor of apoptosis (IAP) repeat,HMMSmart_SM00238,HMMPfam_BIR,superfamily_Galactose-binding domain-like,superfamily_UBC-like,HMMSmart_SM00212,HMMPfam_UQ_con	p.E1163A	ENST00000421745.2	37	c.3488	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	A	20.2	3.942585	0.73672	.	.	ENSG00000115760	ENST00000421745	T	0.74842	-0.88	5.12	5.12	0.69794	.	0.166914	0.37906	N	0.001882	T	0.79482	0.4453	L	0.35793	1.09	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.80705	-0.1263	10	0.52906	T	0.07	.	14.9376	0.70970	1.0:0.0:0.0:0.0	.	1163	Q9NR09	BIRC6_HUMAN	A	1163	ENSP00000393596:E1163A	ENSP00000393596:E1163A	E	+	2	0	BIRC6	32514146	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.791000	0.91849	1.926000	0.55796	0.460000	0.39030	GAG	-	NULL		0.413	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	protein_coding	OTTHUMT00000318769.3	A	NM_016252		32514146	+1	no_errors	NM_016252	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
KIFC1	3833	genome.wustl.edu	37	6	33371877	33371877	+	Missense_Mutation	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr6:33371877G>A	ENST00000428849.2	+	6	1177	c.727G>A	c.(727-729)Gga>Aga	p.G243R		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	243					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						AGAACGGAGGGGACTGATGTC	0.572																																																0			6											72.0	72.0	72.0					6																	33371877		2203	4300	6503	33479855	SO:0001583	missense	3833			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.727G>A	6.37:g.33371877G>A	ENSP00000393963:p.Gly243Arg	Somatic		Capture	Illumina GAIIx	4	33479855	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_KISc,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1	p.G243R	ENST00000428849.2	37	c.727	CCDS34430.1	6	.	.	.	.	.	.	.	.	.	.	G	4.785	0.145899	0.09134	.	.	ENSG00000237649	ENST00000428849	T	0.77358	-1.09	5.17	-0.537	0.11872	.	0.857758	0.10534	N	0.663433	T	0.40322	0.1112	L	0.51422	1.61	0.09310	N	1	B;B	0.33413	0.411;0.411	B;B	0.20955	0.032;0.032	T	0.13098	-1.0522	10	0.16896	T	0.51	-1.2294	4.9401	0.13961	0.3784:0.1514:0.4702:0.0	.	235;243	B4E063;Q9BW19	.;KIFC1_HUMAN	R	243	ENSP00000393963:G243R	ENSP00000393963:G243R	G	+	1	0	KIFC1	33479855	0.002000	0.14202	0.011000	0.14972	0.025000	0.11179	0.139000	0.16036	-0.304000	0.08843	-0.300000	0.09419	GGA	-	NULL		0.572	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	protein_coding	OTTHUMT00000076417.1	G	NM_002263		33479855	+1	no_errors	NM_002263	genbank	human	validated	54_36p	missense	SNP	0.608	A
PCGF2	7703	genome.wustl.edu	37	17	36891700	36891700	+	Missense_Mutation	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr17:36891700C>G	ENST00000580830.1	-	12	1512	c.811G>C	c.(811-813)Gcc>Ccc	p.A271P	PCGF2_ENST00000579882.1_3'UTR|PCGF2_ENST00000585100.1_3'UTR|PCGF2_ENST00000581345.1_Missense_Mutation_p.A271P|PCGF2_ENST00000360797.2_Missense_Mutation_p.A271P|PCGF2_ENST00000578109.1_3'UTR			P35227	PCGF2_HUMAN	polycomb group ring finger 2	271	Pro/Ser-rich.				anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					GAGGAGGTGGCTGGCAGGGTG	0.701											OREG0024367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			17											19.0	16.0	17.0					17																	36891700		2189	4286	6475	34145226	SO:0001583	missense	7703			D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.811G>C	17.37:g.36891700C>G	ENSP00000461961:p.Ala271Pro	Somatic	866	Capture	Illumina GAIIx	4	34145226	A6NGD8	Missense_Mutation	SNP	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1	p.A271P	ENST00000580830.1	37	c.811	CCDS32638.1	17	.	.	.	.	.	.	.	.	.	.	C	17.22	3.334833	0.60853	.	.	ENSG00000056661	ENST00000360797	T	0.32023	1.47	4.92	3.96	0.45880	.	0.667250	0.13815	N	0.360821	T	0.18215	0.0437	N	0.19112	0.55	0.34365	D	0.691418	B	0.10296	0.003	B	0.08055	0.003	T	0.14924	-1.0455	10	0.35671	T	0.21	-31.5536	6.0484	0.19772	0.1866:0.7188:0.0:0.0945	.	271	P35227	PCGF2_HUMAN	P	271	ENSP00000354033:A271P	ENSP00000354033:A271P	A	-	1	0	PCGF2	34145226	0.027000	0.19231	0.996000	0.52242	0.953000	0.61014	0.563000	0.23547	1.311000	0.45024	0.561000	0.74099	GCC	-	NULL		0.701	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF2	protein_coding	OTTHUMT00000442246.2	C	NM_007144		34145226	-1	no_errors	NM_007144	genbank	human	reviewed	54_36p	missense	SNP	0.101	G
C6orf1	221491	genome.wustl.edu	37	6	34214590	34214590	+	Missense_Mutation	SNP	A	A	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr6:34214590A>C	ENST00000476320.1	-	5	863	c.181T>G	c.(181-183)Tca>Gca	p.S61A	C6orf1_ENST00000394990.4_Missense_Mutation_p.S61A|C6orf1_ENST00000468145.1_Missense_Mutation_p.S61A|C6orf1_ENST00000481533.1_Missense_Mutation_p.S61A|C6orf1_ENST00000413013.2_Missense_Mutation_p.S41A|C6orf1_ENST00000335352.3_Missense_Mutation_p.S41A	NM_001008703.1	NP_001008703.1	Q86T20	CF001_HUMAN	chromosome 6 open reading frame 1	61						extracellular region (GO:0005576)				endometrium(1)|prostate(1)	2		Ovarian(999;0.0228)		BRCA - Breast invasive adenocarcinoma(397;1.11e-10)		TCACGTCTTGACATCCAGCAG	0.647											OREG0017364	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			6											30.0	30.0	30.0					6																	34214590		2201	4299	6500	34322568	SO:0001583	missense	221491			AY062936	CCDS4790.1, CCDS75433.1	6p21.3	2011-12-12			ENSG00000186577	ENSG00000186577			1340	protein-coding gene	gene with protein product		611419				10036196	Standard	NM_178508		Approved	LBH, MGC57858	uc003ojh.3	Q86T20	OTTHUMG00000159754	ENST00000476320.1:c.181T>G	6.37:g.34214590A>C	ENSP00000417604:p.Ser61Ala	Somatic	846	Capture	Illumina GAIIx	4	34322568	A8K299	Missense_Mutation	SNP	NULL	p.S61A	ENST00000476320.1	37	c.181	CCDS4790.1	6	.	.	.	.	.	.	.	.	.	.	A	17.57	3.421728	0.62622	.	.	ENSG00000186577	ENST00000476320;ENST00000335352;ENST00000394990;ENST00000481533;ENST00000413013;ENST00000468145	T;T;T;T;T;T	0.38077	1.17;1.16;1.17;1.17;1.16;1.17	5.4	5.4	0.78164	.	0.000000	0.27941	N	0.017227	T	0.25195	0.0612	N	0.08118	0	0.25523	N	0.987341	D	0.76494	0.999	D	0.78314	0.991	T	0.27020	-1.0086	10	0.87932	D	0	-8.7704	11.8289	0.52283	1.0:0.0:0.0:0.0	.	61	Q86T20	CF001_HUMAN	A	61;41;61;61;41;61	ENSP00000417604:S61A;ENSP00000334260:S41A;ENSP00000378441:S61A;ENSP00000418062:S61A;ENSP00000387460:S41A;ENSP00000418884:S61A	ENSP00000334260:S41A	S	-	1	0	C6orf1	34322568	1.000000	0.71417	0.999000	0.59377	0.917000	0.54804	4.137000	0.58010	2.061000	0.61500	0.454000	0.30748	TCA	-	NULL		0.647	C6orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf1	protein_coding	OTTHUMT00000357175.1	A	NM_178508		34322568	-1	no_errors	NM_001008703	genbank	human	validated	54_36p	missense	SNP	0.998	C
KCNH4	23415	genome.wustl.edu	37	17	40332908	40332908	+	Missense_Mutation	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr17:40332908G>T	ENST00000264661.3	-	1	388	c.56C>A	c.(55-57)gCc>gAc	p.A19D	KCNH4_ENST00000607371.1_Missense_Mutation_p.A19D	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	19	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.A19D(1)|p.A19N(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AAAACGGGTGGCGATGGTGTC	0.657																																					NSCLC(117;707 1703 2300 21308 31858)											2	Substitution - Missense(2)	lung(2)	17											112.0	106.0	108.0					17																	40332908		2203	4300	6503	37586434	SO:0001583	missense	23415			AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.56C>A	17.37:g.40332908G>T	ENSP00000264661:p.Ala19Asp	Somatic		Capture	Illumina GAIIx	4	37586434		Missense_Mutation	SNP	PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2,HMMSmart_PAS,superfamily_SSF55785,HMMPfam_PAS,HMMSmart_PAC,superfamily_SSF81324,HMMPfam_Ion_trans,superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding	p.A19D	ENST00000264661.3	37	c.56	CCDS11420.1	17	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425415	0.83667	.	.	ENSG00000089558	ENST00000264661	D	0.98937	-5.25	3.62	3.62	0.41486	PAS (2);	.	.	.	.	D	0.99174	0.9714	M	0.90650	3.135	0.58432	D	0.999996	D	0.76494	0.999	D	0.73380	0.98	D	0.99056	1.0829	9	0.72032	D	0.01	.	15.0727	0.72049	0.0:0.0:1.0:0.0	.	19	Q9UQ05	KCNH4_HUMAN	D	19	ENSP00000264661:A19D	ENSP00000264661:A19D	A	-	2	0	KCNH4	37586434	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.055000	0.64282	1.824000	0.53156	0.462000	0.41574	GCC	-	HMMSmart_PAS		0.657	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	KCNH4	protein_coding	OTTHUMT00000449791.2	G	NM_012285		37586434	-1	no_errors	NM_012285	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MYRIP	25924	genome.wustl.edu	37	3	40231703	40231703	+	Silent	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr3:40231703C>T	ENST00000302541.6	+	10	1756	c.1414C>T	c.(1414-1416)Ctg>Ttg	p.L472L	MYRIP_ENST00000444716.1_Silent_p.L472L|MYRIP_ENST00000396217.3_Silent_p.L383L|MYRIP_ENST00000425621.1_Silent_p.L472L|MYRIP_ENST00000539167.1_Silent_p.L285L|MYRIP_ENST00000459828.1_3'UTR	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	472	Myosin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CCAGGCCAGACTGTCCTGGTT	0.622																																																0			3											65.0	70.0	68.0					3																	40231703		2203	4300	6503	40206707	SO:0001819	synonymous_variant	25924			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.1414C>T	3.37:g.40231703C>T		Somatic		Capture	Illumina GAIIx	4	40206707	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Silent	SNP	superfamily_FYVE_PHD_ZnF,HMMPfam_MOBP	p.L472	ENST00000302541.6	37	c.1414	CCDS2689.1	3																																																																																			-	NULL		0.622	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	protein_coding	OTTHUMT00000254181.2	C	NM_015460		40206707	+1	no_errors	NM_015460	genbank	human	validated	54_36p	silent	SNP	0.001	T
MATN4	8785	genome.wustl.edu	37	20	43926617	43926617	+	Missense_Mutation	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr20:43926617G>A	ENST00000372754.1	-	8	1651	c.1643C>T	c.(1642-1644)gCc>gTc	p.A548V	MATN4_ENST00000353917.5_Missense_Mutation_p.A425V|MATN4_ENST00000342716.4_Missense_Mutation_p.A507V|MATN4_ENST00000372756.1_Missense_Mutation_p.A507V|MATN4_ENST00000537548.1_Missense_Mutation_p.A507V|MATN4_ENST00000360607.6_Missense_Mutation_p.A466V|MATN4_ENST00000372751.4_Missense_Mutation_p.A358V			O95460	MATN4_HUMAN	matrilin 4	548	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				GAAGTCCGGGGCATAGGACAC	0.647																																																0			20											70.0	71.0	71.0					20																	43926617		2203	4300	6503	43360031	SO:0001583	missense	8785			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.1643C>T	20.37:g.43926617G>A	ENSP00000361840:p.Ala548Val	Somatic		Capture	Illumina GAIIx	4	43360031	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,HMMPfam_Matrilin_ccoil	p.A507V	ENST00000372754.1	37	c.1520		20	.	.	.	.	.	.	.	.	.	.	G	4.079	0.012609	0.07912	.	.	ENSG00000124159	ENST00000372753;ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132;ENST00000372751	T;T;T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	5.64	5.64	0.86602	.	0.167994	0.28688	N	0.014469	T	0.61961	0.2389	N	0.03324	-0.35	0.25457	N	0.987958	B;P;B	0.36616	0.055;0.561;0.101	B;B;B	0.41440	0.139;0.357;0.138	T	0.51608	-0.8684	10	0.11182	T	0.66	.	18.7456	0.91791	0.0:0.0:1.0:0.0	.	425;466;507	A6NNA4;O95460-4;O95460-2	.;.;.	V	358;548;507;425;466;507;507;548;358	ENSP00000361839:A358V;ENSP00000361840:A548V;ENSP00000361842:A507V;ENSP00000243983:A425V;ENSP00000353819:A466V;ENSP00000343164:A507V;ENSP00000440328:A507V;ENSP00000361837:A358V	ENSP00000255132:A548V	A	-	2	0	MATN4	43360031	1.000000	0.71417	0.998000	0.56505	0.186000	0.23388	5.518000	0.67068	2.661000	0.90470	0.644000	0.83932	GCC	-	HMMSmart_VWA,superfamily_SSF53300,HMMPfam_VWA		0.647	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	MATN4	protein_coding	OTTHUMT00000080335.1	G			43360031	-1	no_errors	NM_003833	genbank	human	reviewed	54_36p	missense	SNP	0.984	A
TSPEAR	54084	genome.wustl.edu	37	21	45950952	45950952	+	Missense_Mutation	SNP	G	G	C	rs199858107	byFrequency	TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr21:45950952G>C	ENST00000323084.4	-	4	672	c.607C>G	c.(607-609)Cgg>Ggg	p.R203G	TSPEAR_ENST00000397916.1_Missense_Mutation_p.R135G	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	203	Laminin G-like.				sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						GCTCTCCTCCGGCTGCCGACG	0.587																																																0			21											73.0	60.0	64.0					21																	45950952		2203	4300	6503	44775380	SO:0001583	missense	54084			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.607C>G	21.37:g.45950952G>C	ENSP00000321987:p.Arg203Gly	Somatic		Capture	Illumina GAIIx	4	44775380		Missense_Mutation	SNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_EPTP	p.R203G	ENST00000323084.4	37	c.607	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	G	11.65	1.702374	0.30232	.	.	ENSG00000175894	ENST00000323084;ENST00000397916;ENST00000341581	T;T	0.41065	1.01;1.01	4.44	-0.0275	0.13926	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);	0.048943	0.85682	D	0.000000	T	0.59783	0.2219	M	0.77616	2.38	0.50813	D	0.999894	D	0.89917	1.0	D	0.72982	0.979	T	0.61821	-0.6984	10	0.87932	D	0	6.601	10.8685	0.46869	0.0:0.0:0.3371:0.6629	.	203	Q8WU66	TSEAR_HUMAN	G	203;135;203	ENSP00000321987:R203G;ENSP00000381012:R135G	ENSP00000321987:R203G	R	-	1	2	TSPEAR	44775380	1.000000	0.71417	0.995000	0.50966	0.011000	0.07611	0.573000	0.23699	-0.012000	0.14223	-0.224000	0.12420	CGG	-	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases		0.587	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf29	protein_coding	OTTHUMT00000098761.1	G	NM_144991		44775380	-1	no_errors	NM_144991	genbank	human	provisional	54_36p	missense	SNP	0.996	C
HCN1	348980	genome.wustl.edu	37	5	45262305	45262305	+	Silent	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr5:45262305C>T	ENST00000303230.4	-	8	2448	c.2391G>A	c.(2389-2391)gtG>gtA	p.V797V		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	797					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TCAGAGTGGACACCTCATGGG	0.637																																																0			5											54.0	52.0	53.0					5																	45262305		2203	4300	6503	45298062	SO:0001819	synonymous_variant	348980			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2391G>A	5.37:g.45262305C>T		Somatic		Capture	Illumina GAIIx	4	45298062		Silent	SNP	PatternScan_CNMP_BINDING_2,HMMPfam_Ion_trans_N,superfamily_SSF81324,HMMPfam_Ion_trans,superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1	p.V797	ENST00000303230.4	37	c.2391	CCDS3952.1	5																																																																																			-	NULL		0.637	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	protein_coding	OTTHUMT00000253847.1	C	NM_021072		45298062	-1	no_errors	NM_021072	genbank	human	validated	54_36p	silent	SNP	0.960	T
RPL7P48	388401	genome.wustl.edu	37	17	49580520	49580520	+	IGR	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr17:49580520G>A								RP11-1018N14.5 (57357 upstream) : RN7SL699P (92346 downstream)																							TCGGCTCTGCGAAATTCCTTC	0.428																																																0			17																																								46935519	SO:0001628	intergenic_variant	388401																															17.37:g.49580520G>A		Somatic		Capture	Illumina GAIIx	4	46935519		RNA	SNP	-	NULL		37	NULL		17																																																																																			-	-	0	0.428					LOC388401			G			46935519	-1	pseudogene	XR_016879	genbank	human	model	54_36p	rna	SNP	0.987	A
CYP4Z1	199974	genome.wustl.edu	37	1	47583523	47583523	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr1:47583523C>A	ENST00000334194.3	+	12	1438	c.1435C>A	c.(1435-1437)Cac>Aac	p.H479N	CYP4Z1_ENST00000471598.1_3'UTR|CYP4A22-AS1_ENST00000444042.2_lincRNA	NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	479						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						GGCTCCAGACCACTCAAGGCC	0.463																																																0			1											80.0	70.0	73.0					1																	47583523		2203	4300	6503	47356110	SO:0001583	missense	199974			AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.1435C>A	1.37:g.47583523C>A	ENSP00000334246:p.His479Asn	Somatic		Capture	Illumina GAIIx	4	47356110	Q5VVE4	Missense_Mutation	SNP	superfamily_Cytochrome_P450,HMMPfam_p450,PatternScan_CYTOCHROME_P450	p.H479N	ENST00000334194.3	37	c.1435	CCDS545.1	1	.	.	.	.	.	.	.	.	.	.	c	11.69	1.713520	0.30413	.	.	ENSG00000186160	ENST00000334194	T	0.68479	-0.33	1.87	-2.29	0.06805	.	0.292311	0.13232	U	0.403611	T	0.39682	0.1087	N	0.05012	-0.13	0.09310	N	1	B	0.28178	0.202	B	0.33690	0.168	T	0.31971	-0.9924	10	0.35671	T	0.21	.	4.9864	0.14192	0.0:0.5683:0.1737:0.258	.	479	Q86W10	CP4Z1_HUMAN	N	479	ENSP00000334246:H479N	ENSP00000334246:H479N	H	+	1	0	CYP4Z1	47356110	0.000000	0.05858	0.003000	0.11579	0.695000	0.40330	0.223000	0.17719	-0.212000	0.10109	0.271000	0.19318	CAC	-	superfamily_Cytochrome_P450,HMMPfam_p450		0.463	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4Z1	protein_coding	OTTHUMT00000022020.1	C	NM_178134		47356110	+1	no_errors	NM_178134	genbank	human	reviewed	54_36p	missense	SNP	0.014	A
CEACAM8	1088	genome.wustl.edu	37	19	43087447	43087447	+	Missense_Mutation	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr19:43087447G>T	ENST00000244336.5	-	5	1102	c.1001C>A	c.(1000-1002)gCc>gAc	p.A334D	CEACAM8_ENST00000599005.1_Missense_Mutation_p.A36D|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000594688.1_RNA	NM_001816.3	NP_001807.2	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 8	334					immune response (GO:0006955)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	16		Prostate(69;0.00899)				GCTGACAGTGGCTCTAGCTGA	0.463																																																0			19											97.0	87.0	90.0					19																	43087447		2203	4300	6503	47779287	SO:0001583	missense	1088			D90064	CCDS12610.1	19q13.2	2013-01-29			ENSG00000124469	ENSG00000124469		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1820	protein-coding gene	gene with protein product		615747		CGM6		2208113, 2306228	Standard	NM_001816		Approved	CD66b	uc002oud.2	P31997	OTTHUMG00000151124	ENST00000244336.5:c.1001C>A	19.37:g.43087447G>T	ENSP00000244336:p.Ala334Asp	Somatic		Capture	Illumina GAIIx	4	47779287	O60399|Q16574	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig	p.A334D	ENST00000244336.5	37	c.1001	CCDS12610.1	19	.	.	.	.	.	.	.	.	.	.	g	8.087	0.773587	0.16051	.	.	ENSG00000124469	ENST00000244336	T	0.19938	2.11	1.7	1.7	0.24286	.	.	.	.	.	T	0.18593	0.0446	L	0.54323	1.7	0.09310	N	1	P	0.38922	0.651	B	0.36030	0.216	T	0.14783	-1.0460	9	0.56958	D	0.05	.	6.8426	0.23971	0.0:0.0:1.0:0.0	.	334	P31997	CEAM8_HUMAN	D	334	ENSP00000244336:A334D	ENSP00000244336:A334D	A	-	2	0	CEACAM8	47779287	0.003000	0.15002	0.051000	0.19133	0.094000	0.18550	0.413000	0.21148	1.268000	0.44264	0.305000	0.20034	GCC	-	NULL		0.463	CEACAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM8	protein_coding	OTTHUMT00000321430.1	G			47779287	-1	no_errors	NM_001816	genbank	human	validated	54_36p	missense	SNP	0.001	T
PORCN	64840	genome.wustl.edu	37	X	48375613	48375613	+	Missense_Mutation	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chrX:48375613G>A	ENST00000326194.6	+	13	1259	c.1216G>A	c.(1216-1218)Gcc>Acc	p.A406T	PORCN_ENST00000367574.4_Missense_Mutation_p.A324T|PORCN_ENST00000537758.1_Missense_Mutation_p.A406T|PORCN_ENST00000355961.4_Missense_Mutation_p.A401T|PORCN_ENST00000355092.3_Missense_Mutation_p.A400T|PORCN_ENST00000361988.3_Missense_Mutation_p.A395T|PORCN_ENST00000359882.4_Missense_Mutation_p.A400T	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	406					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGGAGCTCTGGCCATCTTCCA	0.587																																																0			X											125.0	87.0	100.0					X																	48375613		2181	4237	6418	48260557	SO:0001583	missense	64840			AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.1216G>A	X.37:g.48375613G>A	ENSP00000322304:p.Ala406Thr	Somatic		Capture	Illumina GAIIx	4	48260557	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Missense_Mutation	SNP	HMMPfam_MBOAT	p.A406T	ENST00000326194.6	37	c.1216	CCDS14299.1	X	.	.	.	.	.	.	.	.	.	.	G	15.97	2.989428	0.53934	.	.	ENSG00000102312	ENST00000359882;ENST00000537758;ENST00000367574;ENST00000355961;ENST00000361988;ENST00000326194;ENST00000355092	D;D;D;D;D;D;D	0.98120	-3.72;-4.73;-3.39;-3.73;-3.72;-4.73;-3.72	5.51	5.51	0.81932	.	0.114056	0.64402	D	0.000016	D	0.95996	0.8696	L	0.60455	1.87	0.53688	D	0.999973	B;B;B;B;B	0.29835	0.087;0.003;0.014;0.258;0.087	B;B;B;B;B	0.25987	0.065;0.039;0.026;0.065;0.065	D	0.94858	0.8019	10	0.34782	T	0.22	-1.6002	15.7043	0.77565	0.0:0.0:1.0:0.0	.	400;406;324;395;401	Q9H237-3;Q9H237;B7ZAR3;Q9H237-4;Q9H237-2	.;PORCN_HUMAN;.;.;.	T	400;406;324;401;395;406;400	ENSP00000352946:A400T;ENSP00000446401:A406T;ENSP00000356546:A324T;ENSP00000348233:A401T;ENSP00000354978:A395T;ENSP00000322304:A406T;ENSP00000347207:A400T	ENSP00000322304:A406T	A	+	1	0	PORCN	48260557	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.345000	0.59360	2.305000	0.77605	0.508000	0.49915	GCC	-	NULL		0.587	PORCN-011	KNOWN	basic|CCDS	protein_coding	PORCN	protein_coding	OTTHUMT00000356990.1	G	NM_022825		48260557	+1	no_errors	NM_203475	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ACVRL1	94	genome.wustl.edu	37	12	52307369	52307369	+	Nonsense_Mutation	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr12:52307369G>T	ENST00000388922.4	+	4	623	c.340G>T	c.(340-342)Gga>Tga	p.G114*	ACVRL1_ENST00000419526.2_Intron|ACVRL1_ENST00000550683.1_Nonsense_Mutation_p.G128*	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	114					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	GGAGCAGCCGGGAACAGATGG	0.687																																																0			12											18.0	18.0	18.0					12																	52307369		2202	4300	6502	50593636	SO:0001587	stop_gained	94			L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.340G>T	12.37:g.52307369G>T	ENSP00000373574:p.Gly114*	Somatic		Capture	Illumina GAIIx	4	50593636	A6NGA8	Nonsense_Mutation	SNP	HMMPfam_Activin_recp,superfamily_SSF57302,HMMPfam_TGF_beta_GS,HMMSmart_GS,superfamily_Kinase_like,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.G114*	ENST00000388922.4	37	c.340	CCDS31804.1	12	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118624	0.56505	.	.	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683	.	.	.	5.63	-2.6	0.06190	.	3.096070	0.01189	N	0.007291	.	.	.	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	3.5289	0.07769	0.3215:0.179:0.413:0.0865	.	.	.	.	X	114;114;128	.	ENSP00000267008:G114X	G	+	1	0	ACVRL1	50593636	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.682000	0.05185	-0.951000	0.03654	-0.345000	0.07892	GGA	-	NULL		0.687	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVRL1	protein_coding	OTTHUMT00000404520.2	G			50593636	+1	no_errors	NM_000020	genbank	human	reviewed	54_36p	nonsense	SNP	0.000	T
FRMD6	122786	genome.wustl.edu	37	14	52186956	52186956	+	Missense_Mutation	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr14:52186956C>T	ENST00000344768.5	+	11	1404	c.1208C>T	c.(1207-1209)cCc>cTc	p.P403L	FRMD6_ENST00000356218.4_Missense_Mutation_p.P395L|FRMD6_ENST00000554167.1_Missense_Mutation_p.P326L|FRMD6_ENST00000553556.1_Missense_Mutation_p.P45L|FRMD6_ENST00000395718.2_Missense_Mutation_p.P395L			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	403					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GACACCAAGCCCCGGGACACG	0.617																																																0			14											69.0	64.0	66.0					14																	52186956		2203	4300	6503	51256706	SO:0001583	missense	122786			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1208C>T	14.37:g.52186956C>T	ENSP00000343899:p.Pro403Leu	Somatic		Capture	Illumina GAIIx	4	51256706	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Missense_Mutation	SNP	HMMSmart_B41,superfamily_SSF54236,HMMPfam_FERM_N,superfamily_FERM_3-hlx,HMMPfam_FERM_M,superfamily_SSF50729,HMMPfam_FERM_C	p.P395L	ENST00000344768.5	37	c.1184	CCDS58318.1	14	.	.	.	.	.	.	.	.	.	.	C	3.319	-0.139101	0.06669	.	.	ENSG00000139926	ENST00000356218;ENST00000395718;ENST00000344768;ENST00000554167;ENST00000555197;ENST00000555703;ENST00000553556	T;T;T;T	0.76839	-1.05;-1.05;-0.82;-0.63	5.98	3.86	0.44501	.	0.086755	0.50627	D	0.000107	T	0.58366	0.2117	N	0.14661	0.345	0.50467	D	0.999877	B;B;B	0.09022	0.002;0.001;0.002	B;B;B	0.08055	0.003;0.001;0.002	T	0.52472	-0.8571	10	0.25106	T	0.35	.	8.8497	0.35192	0.1246:0.7313:0.0:0.144	.	326;403;395	G3V4T7;Q96NE9;Q96NE9-2	.;FRMD6_HUMAN;.	L	395;395;403;326;133;45;45	ENSP00000348550:P395L;ENSP00000379068:P395L;ENSP00000343899:P403L;ENSP00000451977:P326L	ENSP00000343899:P403L	P	+	2	0	FRMD6	51256706	0.998000	0.40836	0.992000	0.48379	0.619000	0.37552	1.003000	0.29809	1.542000	0.49330	0.591000	0.81541	CCC	-	NULL		0.617	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	protein_coding	OTTHUMT00000276881.1	C	NM_152330		51256706	+1	no_errors	NM_001042481	genbank	human	validated	54_36p	missense	SNP	0.996	T
A1CF	29974	genome.wustl.edu	37	10	52573743	52573743	+	Silent	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr10:52573743C>A	ENST00000373993.1	-	8	1265	c.1221G>T	c.(1219-1221)ctG>ctT	p.L407L	A1CF_ENST00000493415.1_5'UTR|A1CF_ENST00000374001.2_Silent_p.L399L|A1CF_ENST00000395489.2_Silent_p.L400L|A1CF_ENST00000395495.1_Silent_p.L352L|A1CF_ENST00000373995.3_Silent_p.L407L|ASAH2B_ENST00000483649.1_Intron|A1CF_ENST00000282641.2_Silent_p.L407L|A1CF_ENST00000373997.3_Silent_p.L399L			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	407	Required for nuclear localization. {ECO:0000269|PubMed:12896982}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						ATCCTCGACCCAGGCCTGTGT	0.483																																																0			10											112.0	111.0	111.0					10																	52573743		2203	4300	6503	52243749	SO:0001819	synonymous_variant	29974			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.1221G>T	10.37:g.52573743C>A		Somatic		Capture	Illumina GAIIx	4	52243749	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Silent	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1,superfamily_dsRNA-binding domain-like	p.L407	ENST00000373993.1	37	c.1221	CCDS7242.1	10																																																																																			-	NULL		0.483	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	protein_coding	OTTHUMT00000048086.2	C	NM_014576		52243749	-1	no_errors	NM_138932	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
MCM3	4172	genome.wustl.edu	37	6	52143648	52143648	+	Splice_Site	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr6:52143648C>T	ENST00000229854.7	-	6	847	c.771G>A	c.(769-771)agG>agA	p.R257R	MCM3_ENST00000476448.1_5'UTR|MCM3_ENST00000419835.2_Splice_Site_p.R211R|MCM3_ENST00000596288.1_Splice_Site_p.R302R			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3	257					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					TCAGGACAGTCCTGGGACAAA	0.438																																																0			6											71.0	67.0	69.0					6																	52143648		2203	4300	6503	52251607	SO:0001630	splice_region_variant	4172			X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.771-1G>A	6.37:g.52143648C>T		Somatic		Capture	Illumina GAIIx	4	52251607	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Silent	SNP	superfamily_Nucleic_acid_OB,HMMSmart_MCM,HMMPfam_MCM,superfamily_SSF52540,HMMSmart_AAA,PatternScan_MCM_1	p.R257	ENST00000229854.7	37	c.771		6																																																																																			-	superfamily_Nucleic_acid_OB,HMMSmart_MCM		0.438	MCM3-006	KNOWN	basic|appris_principal	protein_coding	MCM3	protein_coding	OTTHUMT00000470784.1	C		Silent	52251607	-1	no_errors	NM_002388	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
TINAG	27283	genome.wustl.edu	37	6	54191699	54191699	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr6:54191699C>A	ENST00000259782.4	+	4	705	c.609C>A	c.(607-609)agC>agA	p.S203R	TINAG_ENST00000370869.3_Missense_Mutation_p.S199R|TINAG_ENST00000370864.3_Missense_Mutation_p.S185R	NM_014464.3	NP_055279.3	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	203					cell adhesion (GO:0007155)|immune response (GO:0006955)	basement membrane (GO:0005604)	cysteine-type endopeptidase activity (GO:0004197)|nucleotide binding (GO:0000166)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(1)	34	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)			TGCTCCTGAGCATGAATGAAA	0.383																																																0			6											136.0	120.0	126.0					6																	54191699		2203	4300	6503	54299658	SO:0001583	missense	27283			AB022277	CCDS4955.1	6p12.1	2008-05-15			ENSG00000137251	ENSG00000137251			14599	protein-coding gene	gene with protein product		606749				10652240	Standard	NM_014464		Approved		uc003pcj.2	Q9UJW2	OTTHUMG00000014893	ENST00000259782.4:c.609C>A	6.37:g.54191699C>A	ENSP00000259782:p.Ser203Arg	Somatic		Capture	Illumina GAIIx	4	54299658	Q5T467|Q9UJW1|Q9ULZ4	Missense_Mutation	SNP	HMMSmart_SM00201,PatternScan_SMB_1,superfamily_Cysteine proteinases,HMMSmart_SM00645,HMMPfam_Peptidase_C1,PatternScan_THIOL_PROTEASE_ASN	p.S203R	ENST00000259782.4	37	c.609	CCDS4955.1	6	.	.	.	.	.	.	.	.	.	.	C	11.04	1.521666	0.27211	.	.	ENSG00000137251	ENST00000370869;ENST00000339741;ENST00000259782;ENST00000370864	T;D;T	0.83837	1.95;-1.77;1.96	5.7	-0.143	0.13444	.	0.593326	0.18756	N	0.132025	T	0.55847	0.1946	L	0.42245	1.32	0.31221	N	0.697517	B	0.09022	0.002	B	0.08055	0.003	T	0.35649	-0.9780	10	0.32370	T	0.25	.	7.0951	0.25305	0.0:0.628:0.1476:0.2244	.	203	Q9UJW2	TINAG_HUMAN	R	199;153;203;185	ENSP00000359906:S199R;ENSP00000259782:S203R;ENSP00000359901:S185R	ENSP00000259782:S203R	S	+	3	2	TINAG	54299658	0.949000	0.32298	1.000000	0.80357	0.961000	0.63080	-0.231000	0.09069	0.228000	0.21019	0.643000	0.83706	AGC	-	superfamily_Cysteine proteinases		0.383	TINAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TINAG	protein_coding	OTTHUMT00000040984.1	C	NM_014464		54299658	+1	no_errors	NM_014464	genbank	human	validated	54_36p	missense	SNP	0.998	A
DHX29	54505	genome.wustl.edu	37	5	54581243	54581243	+	Splice_Site	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr5:54581243C>T	ENST00000251636.5	-	10	1382	c.1234G>A	c.(1234-1236)Gtt>Att	p.V412I	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	412						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				ATTACCCTAACCCTACAAAGA	0.358																																																0			5											63.0	55.0	58.0					5																	54581243		2203	4300	6503	54617000	SO:0001630	splice_region_variant	54505			AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.1233-1G>A	5.37:g.54581243C>T		Somatic		Capture	Illumina GAIIx	4	54617000	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_DEAD,PatternScan_DEAH_ATP_HELICASE,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_HA2,HMMPfam_DUF1605	p.V412I	ENST00000251636.5	37	c.1234	CCDS34158.1	5	.	.	.	.	.	.	.	.	.	.	C	21.7	4.193801	0.78902	.	.	ENSG00000067248	ENST00000251636	T	0.03689	3.84	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.10337	0.0253	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.39482	-0.9612	10	0.07644	T	0.81	.	19.57	0.95407	0.0:1.0:0.0:0.0	.	412	Q7Z478	DHX29_HUMAN	I	412	ENSP00000251636:V412I	ENSP00000251636:V412I	V	-	1	0	DHX29	54617000	1.000000	0.71417	0.999000	0.59377	0.624000	0.37722	7.058000	0.76676	2.726000	0.93360	0.655000	0.94253	GTT	-	NULL		0.358	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX29	protein_coding	OTTHUMT00000368532.1	C	NM_019030	Missense_Mutation	54617000	-1	no_errors	NM_019030	genbank	human	validated	54_36p	missense	SNP	1.000	T
CPLX4	339302	genome.wustl.edu	37	18	56964052	56964052	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr18:56964052C>A	ENST00000299721.3	-	3	547	c.361G>T	c.(361-363)Gat>Tat	p.D121Y	CPLX4_ENST00000587244.1_Intron	NM_181654.3	NP_857637.1	Q7Z7G2	CPLX4_HUMAN	complexin 4	121					exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter secretion (GO:0046928)	cell junction (GO:0030054)|membrane (GO:0016020)|synapse (GO:0045202)		p.D121Y(1)		autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	16		Colorectal(73;0.175)				AGAATAGAATCTTTATCTTCT	0.418																																																1	Substitution - Missense(1)	large_intestine(1)	18											122.0	111.0	115.0					18																	56964052		2203	4300	6503	55115032	SO:0001583	missense	339302			AY286502	CCDS11973.1	18q21.32	2005-08-02			ENSG00000166569	ENSG00000166569			24330	protein-coding gene	gene with protein product		609586				15911881	Standard	NM_181654		Approved	CPX-IV	uc002lhy.3	Q7Z7G2	OTTHUMG00000132756	ENST00000299721.3:c.361G>T	18.37:g.56964052C>A	ENSP00000299721:p.Asp121Tyr	Somatic		Capture	Illumina GAIIx	4	55115032	F1T0L6	Missense_Mutation	SNP	NULL	p.D121Y	ENST00000299721.3	37	c.361	CCDS11973.1	18	.	.	.	.	.	.	.	.	.	.	C	26.3	4.726137	0.89298	.	.	ENSG00000166569	ENST00000299721	.	.	.	5.66	5.66	0.87406	.	0.087184	0.85682	D	0.000000	T	0.76828	0.4042	M	0.65498	2.005	0.80722	D	1	B	0.30104	0.268	P	0.44732	0.459	T	0.76479	-0.2944	9	0.72032	D	0.01	0.2791	19.3422	0.94347	0.0:1.0:0.0:0.0	.	121	Q7Z7G2	CPLX4_HUMAN	Y	121	.	ENSP00000299721:D121Y	D	-	1	0	CPLX4	55115032	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.723000	0.68492	2.653000	0.90120	0.561000	0.74099	GAT	-	NULL		0.418	CPLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPLX4	protein_coding	OTTHUMT00000256127.1	C	NM_181654		55115032	-1	no_errors	NM_181654	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PCK1	5105	genome.wustl.edu	37	20	56138629	56138629	+	Silent	SNP	T	T	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr20:56138629T>A	ENST00000319441.4	+	6	971	c.807T>A	c.(805-807)ggT>ggA	p.G269G	PCK1_ENST00000535860.1_Silent_p.G137G|PCK1_ENST00000543666.1_Intron	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	269					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			AGATTCTGGGTATAACCAACC	0.547																																																0			20											56.0	57.0	57.0					20																	56138629		2203	4300	6503	55572035	SO:0001819	synonymous_variant	5105				CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.807T>A	20.37:g.56138629T>A		Somatic		Capture	Illumina GAIIx	4	55572035	A8K437|B4DT64|Q8TCA3|Q9UJD2	Silent	SNP	superfamily_PEP_carboxykinase_N,HMMPfam_PEPCK,superfamily_SSF53795,PatternScan_PEPCK_GTP	p.G269	ENST00000319441.4	37	c.807	CCDS13460.1	20																																																																																			-	HMMPfam_PEPCK,superfamily_SSF53795		0.547	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK1	protein_coding	OTTHUMT00000079851.2	T			55572035	+1	no_errors	NM_002591	genbank	human	reviewed	54_36p	silent	SNP	0.980	A
GPR182	11318	genome.wustl.edu	37	12	57389741	57389741	+	Missense_Mutation	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr12:57389741C>G	ENST00000300098.1	+	2	967	c.748C>G	c.(748-750)Caa>Gaa	p.Q250E	HBCBP_ENST00000600202.1_5'Flank|RP11-474N8.5_ENST00000556850.1_RNA	NM_007264.3	NP_009195.1	O15218	GP182_HUMAN	G protein-coupled receptor 182	250					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	15						GCAGCCAGGACAACCCAAGAG	0.637																																																0			12											41.0	41.0	41.0					12																	57389741		2203	4300	6503	55676008	SO:0001583	missense	11318			Y13583	CCDS8927.1	12q13.3	2012-08-21	2007-09-24	2007-09-24		ENSG00000166856		"""GPCR / Class A : Orphans"""	13708	protein-coding gene	gene with protein product		605307	"""adrenomedullin receptor"""	ADMR		9367907, 9535752	Standard	NM_007264		Approved	hrhAMR, G10D, AM-R	uc001smk.3	O15218		ENST00000300098.1:c.748C>G	12.37:g.57389741C>G	ENSP00000300098:p.Gln250Glu	Somatic		Capture	Illumina GAIIx	4	55676008		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.Q250E	ENST00000300098.1	37	c.748	CCDS8927.1	12	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.445214	0.01089	.	.	ENSG00000166856	ENST00000300098	T	0.38722	1.12	4.13	1.22	0.21188	GPCR, rhodopsin-like superfamily (1);	0.637053	0.15353	N	0.266854	T	0.20495	0.0493	L	0.31476	0.935	0.09310	N	1	B	0.14805	0.011	B	0.11329	0.006	T	0.25047	-1.0143	10	0.05959	T	0.93	.	1.7262	0.02922	0.1677:0.4932:0.1635:0.1756	.	250	O15218	GP182_HUMAN	E	250	ENSP00000300098:Q250E	ENSP00000300098:Q250E	Q	+	1	0	GPR182	55676008	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	0.670000	0.25157	0.132000	0.18615	0.561000	0.74099	CAA	-	superfamily_SSF81321,HMMPfam_7tm_1		0.637	GPR182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR182	protein_coding	OTTHUMT00000411212.1	C	NM_007264		55676008	+1	no_errors	NM_007264	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
TMEM194A	23306	genome.wustl.edu	37	12	57472511	57472511	+	Silent	SNP	T	T	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr12:57472511T>C	ENST00000300128.4	-	1	41	c.18A>G	c.(16-18)aaA>aaG	p.K6K	TMEM194A_ENST00000553654.1_Intron|TMEM194A_ENST00000379391.3_Silent_p.K6K	NM_001130963.1	NP_001124435.1	O14524	T194A_HUMAN	transmembrane protein 194A	6						integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(3)|lung(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						AGACCGCCACTTTCATTCCTC	0.642																																																0			12											52.0	61.0	58.0					12																	57472511		2194	4286	6480	55758778	SO:0001819	synonymous_variant	23306			AB006624	CCDS31841.1, CCDS44927.1	12q13.3	2008-06-10	2008-06-10	2008-06-10		ENSG00000166881			29001	protein-coding gene	gene with protein product			"""transmembrane protein 194"""	TMEM194			Standard	NM_015257		Approved	KIAA0286	uc001smy.3	O14524		ENST00000300128.4:c.18A>G	12.37:g.57472511T>C		Somatic		Capture	Illumina GAIIx	4	55758778	Q17R72|Q68DH0|Q6IQ25	Silent	SNP	HMMPfam_DUF2215	p.K6	ENST00000300128.4	37	c.18	CCDS44927.1	12																																																																																			-	NULL		0.642	TMEM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM194A	protein_coding	OTTHUMT00000411272.1	T	NM_015257		55758778	-1	no_errors	NM_015257	genbank	human	validated	54_36p	silent	SNP	1.000	C
GPR97	222487	genome.wustl.edu	37	16	57712216	57712216	+	Silent	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr16:57712216G>T	ENST00000333493.4	+	4	641	c.480G>T	c.(478-480)ggG>ggT	p.G160G	GPR97_ENST00000450388.3_Silent_p.G40G|GPR97_ENST00000327655.6_5'UTR|RP11-405F3.4_ENST00000563062.1_RNA	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	160					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTGGTCCAGGGACTCTCTTCA	0.587																																																0			16											104.0	93.0	97.0					16																	57712216		2198	4300	6498	56269717	SO:0001819	synonymous_variant	222487			AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.480G>T	16.37:g.57712216G>T		Somatic		Capture	Illumina GAIIx	4	56269717	Q6ZMF4|Q86SL9|Q8IZF1	Silent	SNP	PatternScan_G_PROTEIN_RECEP_F2_1,PatternScan_G_PROTEIN_RECEP_F2_2,HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2	p.G160	ENST00000333493.4	37	c.480	CCDS10786.1	16																																																																																			-	NULL		0.587	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR97	protein_coding	OTTHUMT00000257333.2	G	NM_170776		56269717	+1	no_errors	NM_170776	genbank	human	provisional	54_36p	silent	SNP	0.071	T
GPBP1	65056	genome.wustl.edu	37	5	56542978	56542978	+	Missense_Mutation	SNP	G	G	T	rs77944588		TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr5:56542978G>T	ENST00000506184.2	+	8	1845	c.740G>T	c.(739-741)gGc>gTc	p.G247V	GPBP1_ENST00000538707.1_Missense_Mutation_p.G254V|GPBP1_ENST00000424459.3_Missense_Mutation_p.G267V|GPBP1_ENST00000454432.2_Missense_Mutation_p.G267V|GPBP1_ENST00000511209.1_Missense_Mutation_p.G254V|GPBP1_ENST00000514387.2_Missense_Mutation_p.G76V|GPBP1_ENST00000264779.6_Missense_Mutation_p.G254V			Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1	247					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	19		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		TTTGGCGTTGGCAACTTTAAT	0.343																																																0			5						G	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	0,4406		0,0,2203	82.0	79.0	80.0		761,761,227,740	4.8	1.0	5	dbSNP_131	80	3,8597	3.0+/-9.4	1,1,4298	yes	missense,missense,missense,missense	GPBP1	NM_001127235.2,NM_001127236.2,NM_001203246.1,NM_022913.3	109,109,109,109	1,1,6501	TT,TG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging	254/466,254/481,76/303,247/474	56542978	3,13003	2203	4300	6503	56578735	SO:0001583	missense	65056				CCDS34162.1, CCDS47211.1, CCDS47212.1, CCDS47212.2, CCDS56368.1	5q11.2	2008-02-05				ENSG00000062194			29520	protein-coding gene	gene with protein product		608412				12842993	Standard	NM_022913		Approved	DKFZp761C169, vasculin	uc003jrk.4	Q86WP2		ENST00000506184.2:c.740G>T	5.37:g.56542978G>T	ENSP00000421202:p.Gly247Val	Somatic		Capture	Illumina GAIIx	4	56578735	A6NKW3|Q6NSH6|Q9H0D4|Q9H785|Q9NSN4	Missense_Mutation	SNP	NULL	p.G247V	ENST00000506184.2	37	c.740	CCDS34162.1	5	.	.	.	.	.	.	.	.	.	.	G	19.33	3.807618	0.70797	0.0	3.49E-4	ENSG00000062194	ENST00000424459;ENST00000514387;ENST00000506184;ENST00000454432;ENST00000511209;ENST00000264779;ENST00000538707	T;T;T;T;T;T;T	0.48522	1.82;0.81;1.83;1.82;1.86;1.83;1.83	5.68	4.8	0.61643	.	0.096519	0.64402	D	0.000001	T	0.57125	0.2032	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.959;1.0	D;D;P;D	0.97110	1.0;0.999;0.74;0.999	T	0.59685	-0.7408	10	0.52906	T	0.07	-8.7279	14.8792	0.70519	0.0:0.143:0.857:0.0	.	267;254;254;247	D4PHA4;Q86WP2-2;Q86WP2-3;Q86WP2	.;.;.;GPBP1_HUMAN	V	267;76;247;267;254;254;254	ENSP00000401596:G267V;ENSP00000421709:G76V;ENSP00000421202:G247V;ENSP00000403522:G267V;ENSP00000422337:G254V;ENSP00000264779:G254V;ENSP00000440090:G254V	ENSP00000264779:G254V	G	+	2	0	GPBP1	56578735	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.040000	0.70980	1.375000	0.46248	0.655000	0.94253	GGC	-	NULL		0.343	GPBP1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPBP1	protein_coding	OTTHUMT00000374496.1	G	NM_022913		56578735	+1	no_errors	NM_022913	genbank	human	validated	54_36p	missense	SNP	1.000	T
GLYATL2	219970	genome.wustl.edu	37	11	58660675	58660675	+	Intron	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr11:58660675G>T	ENST00000533636.1	-	1	60				GLYATL1P2_ENST00000529451.1_RNA			Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2							endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	AGGGGGCCCTGGTCTCATGGA	0.507																																																0			11																																								58417251	SO:0001627	intron_variant	0			AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000533636.1:c.506+10953C>A	11.37:g.58660675G>T		Somatic		Capture	Illumina GAIIx	4	58417251	A5LGC7|Q86WC3|Q96AT2	RNA	SNP	-	NULL	ENST00000533636.1	37	NULL		11																																																																																			-	-		0.507	GLYATL2-002	KNOWN	basic	processed_transcript	LOC100129933	protein_coding	OTTHUMT00000394601.1	G	NM_145016		58417251	+1	pseudogene	XR_037279	genbank	human	model	54_36p	rna	SNP	0.000	T
BIRC8	112401	genome.wustl.edu	37	19	53793285	53793285	+	Missense_Mutation	SNP	G	G	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr19:53793285G>C	ENST00000426466.1	-	1	1590	c.343C>G	c.(343-345)Cta>Gta	p.L115V		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	115					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		GCTTCTTGTAGCATAGGATTA	0.383																																																0			19											213.0	205.0	207.0					19																	53793285		2203	4300	6503	58485097	SO:0001583	missense	112401			AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.343C>G	19.37:g.53793285G>C	ENSP00000412957:p.Leu115Val	Somatic		Capture	Illumina GAIIx	4	58485097	Q6IPY1|Q96RW5	Missense_Mutation	SNP	superfamily_Inhibitor of apoptosis (IAP) repeat,HMMSmart_SM00238,PatternScan_BIR_REPEAT_1,HMMPfam_BIR,HMMSmart_SM00184	p.L115V	ENST00000426466.1	37	c.343	CCDS12863.1	19	.	.	.	.	.	.	.	.	.	.	G	0.001	-2.875897	0.00062	.	.	ENSG00000163098	ENST00000426466	T	0.28069	1.63	0.502	-1.0	0.10196	.	.	.	.	.	T	0.06371	0.0164	N	0.00742	-1.23	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34601	-0.9822	8	0.02654	T	1	-3.7799	.	.	.	.	115	Q96P09	BIRC8_HUMAN	V	115	ENSP00000412957:L115V	ENSP00000412957:L115V	L	-	1	2	BIRC8	58485097	1.000000	0.71417	0.025000	0.17156	0.055000	0.15305	1.457000	0.35212	-0.396000	0.07703	0.420000	0.28162	CTA	-	superfamily_Inhibitor of apoptosis (IAP) repeat		0.383	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC8	protein_coding	OTTHUMT00000464357.1	G	NM_033341		58485097	-1	no_errors	NM_033341	genbank	human	validated	54_36p	missense	SNP	0.512	C
AXIN2	8313	genome.wustl.edu	37	17	63554461	63554461	+	Missense_Mutation	SNP	T	T	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr17:63554461T>A	ENST00000375702.5	-	1	386	c.278A>T	c.(277-279)tAc>tTc	p.Y93F	CTD-2535L24.2_ENST00000577662.1_3'UTR|AXIN2_ENST00000307078.5_Missense_Mutation_p.Y93F			Q9Y2T1	AXIN2_HUMAN	axin 2	93	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						TCGGAACAGGTAAGCACCGTC	0.547									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																							0			17											147.0	141.0	143.0					17																	63554461		2203	4300	6503	60984923	SO:0001583	missense	8313	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.278A>T	17.37:g.63554461T>A	ENSP00000364854:p.Tyr93Phe	Somatic		Capture	Illumina GAIIx	4	60984923	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	superfamily_Regulator of G-protein signaling RGS,HMMPfam_RGS,HMMSmart_SM00315,HMMPfam_Axin_b-cat_bind,HMMPfam_DIX,HMMSmart_SM00021	p.Y93F	ENST00000375702.5	37	c.278		17	.	.	.	.	.	.	.	.	.	.	T	10.66	1.413203	0.25465	.	.	ENSG00000168646	ENST00000307078;ENST00000544103;ENST00000375702	T;T;T	0.01902	4.57;4.57;4.57	4.91	4.91	0.64330	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.186758	0.47852	D	0.000219	T	0.02047	0.0064	N	0.14661	0.345	0.36745	D	0.882427	P;B;P	0.37594	0.601;0.102;0.601	B;B;B	0.36719	0.231;0.139;0.231	T	0.65150	-0.6238	10	0.39692	T	0.17	-13.2863	14.2325	0.65903	0.0:0.0:0.0:1.0	.	93;93;93	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	F	93	ENSP00000302625:Y93F;ENSP00000441151:Y93F;ENSP00000364854:Y93F	ENSP00000302625:Y93F	Y	-	2	0	AXIN2	60984923	1.000000	0.71417	0.998000	0.56505	0.958000	0.62258	4.054000	0.57434	1.836000	0.53414	0.454000	0.30748	TAC	-	superfamily_Regulator of G-protein signaling RGS,HMMPfam_RGS,HMMSmart_SM00315		0.547	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	AXIN2	protein_coding	OTTHUMT00000445901.1	T	NM_004655		60984923	-1	no_errors	NM_004655	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
MACROD1	28992	genome.wustl.edu	37	11	63885420	63885420	+	Intron	SNP	G	G	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr11:63885420G>C	ENST00000255681.6	-	3	584				RP11-21A7A.3_ENST00000543817.1_RNA|FLRT1_ENST00000246841.3_Missense_Mutation_p.V561L	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						CGGCGGGGCAGTGGCTCTGGT	0.672																																																0			11											43.0	41.0	42.0					11																	63885420		2199	4297	6496	63641996	SO:0001627	intron_variant	23769			AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+33290C>G	11.37:g.63885420G>C		Somatic		Capture	Illumina GAIIx	4	63641996	Q9UH96	Missense_Mutation	SNP	superfamily_L domain-like,HMMPfam_LRRNT,HMMSmart_SM00013,HMMSmart_SM00369,HMMPfam_LRR_1,HMMSmart_SM00364,HMMSmart_SM00082,HMMPfam_fn3	p.V561L	ENST00000255681.6	37	c.1681	CCDS8056.1	11	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518404	0.27211	.	.	ENSG00000126500	ENST00000246841	T	0.60920	0.15	5.17	4.24	0.50183	.	0.216731	0.39341	N	0.001400	T	0.53916	0.1826	M	0.63843	1.955	0.32843	D	0.505664	B	0.28512	0.214	B	0.25759	0.063	T	0.66701	-0.5857	10	0.52906	T	0.07	-19.8083	13.7041	0.62627	0.0812:0.0:0.9187:0.0	.	533	Q9NZU1	FLRT1_HUMAN	L	561	ENSP00000246841:V561L	ENSP00000246841:V561L	V	+	1	0	FLRT1	63641996	1.000000	0.71417	0.946000	0.38457	0.522000	0.34438	5.356000	0.66052	2.584000	0.87258	0.655000	0.94253	GTG	-	NULL		0.672	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT1	protein_coding	OTTHUMT00000396570.1	G	NM_014067		63641996	+1	no_errors	NM_013280	genbank	human	reviewed	54_36p	missense	SNP	0.951	C
WDPCP	51057	genome.wustl.edu	37	2	63849974	63849974	+	IGR	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:63849974C>A								MDH1 (15643 upstream) : RPS4XP5 (19614 downstream)																							ATCGTCCTGGCCGAAGTGGGC	0.687																																																0			2																																								63703478	SO:0001628	intergenic_variant	0																															2.37:g.63849974C>A		Somatic		Capture	Illumina GAIIx	4	63703478		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.687					LOC388955			C			63703478	-1	pseudogene	NR_003131	genbank	human	provisional	54_36p	rna	SNP	0.072	A
COG8	84342	genome.wustl.edu	37	16	69366758	69366758	+	Missense_Mutation	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr16:69366758G>A	ENST00000306875.4	-	4	1555	c.1441C>T	c.(1441-1443)Cgc>Tgc	p.R481C	COG8_ENST00000562081.1_Missense_Mutation_p.R481C|PDF_ENST00000288022.1_5'Flank|RP11-343C2.12_ENST00000562949.1_Intron	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	481					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						TCTTCAGCGCGATGGAAGGCC	0.507																																																0			16											79.0	77.0	78.0					16																	69366758		2198	4300	6498	67924259	SO:0001583	missense	84342			AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.1441C>T	16.37:g.69366758G>A	ENSP00000305459:p.Arg481Cys	Somatic		Capture	Illumina GAIIx	4	67924259	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	HMMPfam_Dor1	p.R481C	ENST00000306875.4	37	c.1441	CCDS10876.1	16	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869364	0.72065	.	.	ENSG00000213380	ENST00000306875	T	0.52057	0.68	5.91	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.68007	0.2954	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	P;P	0.61722	0.893;0.893	T	0.71932	-0.4443	10	0.59425	D	0.04	-0.0021	15.5447	0.76090	0.0:0.0:0.8613:0.1387	.	508;481	B4DYU2;Q96MW5	.;COG8_HUMAN	C	481	ENSP00000305459:R481C	ENSP00000305459:R481C	R	-	1	0	COG8	67924259	1.000000	0.71417	0.994000	0.49952	0.312000	0.27988	6.296000	0.72751	2.802000	0.96397	0.655000	0.94253	CGC	-	NULL		0.507	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG8	protein_coding	OTTHUMT00000268948.2	G	NM_032382		67924259	-1	no_errors	NM_032382	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CBWD6	644019	genome.wustl.edu	37	9	69205457	69205457	+	Splice_Site	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr9:69205457C>G	ENST00000377457.5	-	14	1186	c.1081G>C	c.(1081-1083)Ggc>Cgc	p.G361R	CBWD6_ENST00000468061.1_5'UTR|CBWD6_ENST00000377449.1_Splice_Site_p.G325R|CBWD6_ENST00000382399.4_Splice_Site_p.G341R	NM_001085457.1	NP_001078926.1	Q4V339	CBWD6_HUMAN	COBW domain containing 6	361	CobW C-terminal.						ATP binding (GO:0005524)			lung(4)	4						TGAGACTTACCAATGAGGACC	0.413																																																0			9											13.0	13.0	13.0					9																	69205457		2096	4109	6205	68495277	SO:0001630	splice_region_variant	644019				CCDS43827.1	9q13	2006-06-30			ENSG00000204790	ENSG00000204790			31978	protein-coding gene	gene with protein product							Standard	NM_001085457		Approved	OTTHUMG00000066820	uc004afj.4	Q4V339	OTTHUMG00000066820	ENST00000377457.5:c.1081+1G>C	9.37:g.69205457C>G		Somatic		Capture	Illumina GAIIx	4	68495277		Missense_Mutation	SNP	superfamily_SSF52540,HMMPfam_cobW,HMMPfam_CobW_C,superfamily_Cbl_biosynth_CobW-like_C	p.G361R	ENST00000377457.5	37	c.1081	CCDS43827.1	9	.	.	.	.	.	.	.	.	.	.	.	12.77	2.037314	0.35989	.	.	ENSG00000204790	ENST00000377457;ENST00000377450;ENST00000377449;ENST00000382399	T;T;T	0.39229	1.09;1.09;1.09	2.63	2.63	0.31362	Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal (4);	0.052698	0.85682	D	0.000000	T	0.68751	0.3035	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75587	-0.3266	10	0.87932	D	0	-29.2164	10.7134	0.45997	0.0:1.0:0.0:0.0	.	361	Q4V339	CBWD6_HUMAN	R	361;313;325;341	ENSP00000366677:G361R;ENSP00000366668:G325R;ENSP00000371836:G341R	ENSP00000366668:G325R	G	-	1	0	CBWD6	68495277	1.000000	0.71417	0.514000	0.27761	0.166000	0.22503	6.265000	0.72534	1.309000	0.44985	0.175000	0.17021	GGC	-	HMMPfam_CobW_C,superfamily_Cbl_biosynth_CobW-like_C		0.413	CBWD6-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	CBWD6	protein_coding	OTTHUMT00000143172.2	C	XM_928822	Missense_Mutation	68495277	-1	no_errors	NM_001085457	genbank	human	provisional	54_36p	missense	SNP	1.000	G
PTPRR	5801	genome.wustl.edu	37	12	71078030	71078030	+	Missense_Mutation	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr12:71078030C>G	ENST00000283228.2	-	10	1826	c.1374G>C	c.(1372-1374)aaG>aaC	p.K458N	PTPRR_ENST00000378778.1_Missense_Mutation_p.K252N|PTPRR_ENST00000440835.2_Missense_Mutation_p.K213N|PTPRR_ENST00000342084.4_Missense_Mutation_p.K346N|PTPRR_ENST00000549308.1_Missense_Mutation_p.K213N	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	458	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		AGGCTTTCTCCTTGCCACTGT	0.443																																																0			12											97.0	86.0	90.0					12																	71078030		2203	4300	6503	69364297	SO:0001583	missense	5801			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.1374G>C	12.37:g.71078030C>G	ENSP00000283228:p.Lys458Asn	Somatic		Capture	Illumina GAIIx	4	69364297	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.K458N	ENST00000283228.2	37	c.1374	CCDS8998.1	12	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111484	0.37242	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308	D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73	5.71	0.263	0.15602	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.250149	0.26995	N	0.021448	T	0.70605	0.3243	L	0.31526	0.94	0.30576	N	0.763023	B;B;B;B	0.29646	0.253;0.056;0.126;0.02	B;B;B;B	0.23150	0.036;0.013;0.044;0.022	T	0.64647	-0.6358	10	0.72032	D	0.01	-3.2129	11.3387	0.49520	0.0:0.5585:0.0:0.4415	.	307;346;252;458	B7Z998;F5GXR7;Q15256-4;Q15256	.;.;.;PTPRR_HUMAN	N	213;458;252;346;213	ENSP00000391750:K213N;ENSP00000283228:K458N;ENSP00000368054:K252N;ENSP00000339605:K346N;ENSP00000446943:K213N	ENSP00000283228:K458N	K	-	3	2	PTPRR	69364297	0.994000	0.37717	0.887000	0.34795	0.985000	0.73830	0.647000	0.24812	-0.263000	0.09378	-0.253000	0.11424	AAG	-	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase		0.443	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRR	protein_coding	OTTHUMT00000404485.1	C	NM_002849		69364297	-1	no_errors	NM_002849	genbank	human	reviewed	54_36p	missense	SNP	0.990	G
HYDIN	54768	genome.wustl.edu	37	16	71096071	71096071	+	Splice_Site	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr16:71096071C>T	ENST00000393567.2	-	17	2527		c.e17+1		HYDIN_ENST00000321489.5_Splice_Site|HYDIN_ENST00000448089.2_Splice_Site|HYDIN_ENST00000538248.1_Splice_Site|HYDIN_ENST00000541601.1_Splice_Site|HYDIN_ENST00000448691.1_Splice_Site	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein						cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGGACTCTCACCAAAGGGGGG	0.483																																																0			16											6.0	6.0	6.0					16																	71096071		2145	4231	6376	69653572	SO:0001630	splice_region_variant	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2376+1G>A	16.37:g.71096071C>T		Somatic		Capture	Illumina GAIIx	4	69653572	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Splice_Site	SNP	-	e16+1	ENST00000393567.2	37	c.2376+1	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846415	0.51164	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8303	0.85942	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HYDIN	69653572	1.000000	0.71417	0.995000	0.50966	0.553000	0.35397	6.176000	0.71955	2.254000	0.74563	0.609000	0.83330	.	-	-		0.483	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	C		Intron	69653572	-1	no_errors	NM_032821	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
ZMYM3	9203	genome.wustl.edu	37	X	70472829	70472829	+	Missense_Mutation	SNP	G	G	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chrX:70472829G>C	ENST00000353904.2	-	2	464	c.277C>G	c.(277-279)Ccg>Gcg	p.P93A	ZMYM3_ENST00000373978.1_Missense_Mutation_p.P93A|ZMYM3_ENST00000373981.1_Missense_Mutation_p.P93A|ZMYM3_ENST00000373988.1_Missense_Mutation_p.P93A|ZMYM3_ENST00000314425.5_Missense_Mutation_p.P93A|ZMYM3_ENST00000373984.3_Missense_Mutation_p.P93A|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373982.1_Missense_Mutation_p.P93A|ZMYM3_ENST00000373998.1_Missense_Mutation_p.P93A	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	93					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TCCACCTCCGGGGGAGAGGGG	0.642																																																0			X											18.0	19.0	18.0					X																	70472829		2202	4291	6493	70389554	SO:0001583	missense	9203			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.277C>G	X.37:g.70472829G>C	ENSP00000343909:p.Pro93Ala	Somatic		Capture	Illumina GAIIx	4	70389554	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	HMMPfam_zf-FCS,HMMSmart_SM00746	p.P93A	ENST00000353904.2	37	c.277	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	g	12.93	2.085397	0.36758	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981;ENST00000373978	T;T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41;1.41	4.76	4.76	0.60689	.	0.116164	0.38605	N	0.001629	T	0.19525	0.0469	N	0.14661	0.345	0.34532	D	0.709277	B;B;B	0.32918	0.39;0.073;0.043	B;B;B	0.28991	0.097;0.025;0.011	T	0.30937	-0.9961	10	0.48119	T	0.1	-6.1679	15.2052	0.73173	0.0:0.0:1.0:0.0	.	93;93;93	Q96E26;Q14202-2;Q14202	.;.;ZMYM3_HUMAN	A	93	ENSP00000322845:P93A;ENSP00000363110:P93A;ENSP00000343909:P93A;ENSP00000363096:P93A;ENSP00000363100:P93A;ENSP00000363094:P93A;ENSP00000363093:P93A;ENSP00000363090:P93A	ENSP00000322845:P93A	P	-	1	0	ZMYM3	70389554	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	3.905000	0.56333	2.204000	0.70986	0.287000	0.19450	CCG	-	NULL		0.642	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	protein_coding	OTTHUMT00000057154.1	G	NM_201599		70389554	-1	no_errors	NM_005096	genbank	human	validated	54_36p	missense	SNP	1.000	C
ERCC6L	54821	genome.wustl.edu	37	X	71427733	71427733	+	Missense_Mutation	SNP	G	G	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chrX:71427733G>C	ENST00000334463.3	-	2	1019	c.884C>G	c.(883-885)aCt>aGt	p.T295S	ERCC6L_ENST00000373657.1_Missense_Mutation_p.T172S|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	295					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					TCTTGCTCTAGTAATAGGATT	0.363																																																0			X											63.0	64.0	63.0					X																	71427733		2203	4298	6501	71344458	SO:0001583	missense	54821			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.884C>G	X.37:g.71427733G>C	ENSP00000334675:p.Thr295Ser	Somatic		Capture	Illumina GAIIx	4	71344458	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_SNF2_N,HMMSmart_HELICc,HMMPfam_Helicase_C	p.T295S	ENST00000334463.3	37	c.884	CCDS35329.1	X	.	.	.	.	.	.	.	.	.	.	G	11.32	1.602751	0.28534	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	D;D	0.93307	-3.2;-3.2	5.97	1.58	0.23477	SNF2-related (1);	.	.	.	.	D	0.89698	0.6790	L	0.28608	0.87	0.32264	N	0.569719	P	0.45428	0.858	P	0.49387	0.609	D	0.85714	0.1321	9	0.25106	T	0.35	-1.5363	8.4656	0.32953	0.4203:0.0:0.5797:0.0	.	295	Q2NKX8	ERC6L_HUMAN	S	172;295	ENSP00000362761:T172S;ENSP00000334675:T295S	ENSP00000334675:T295S	T	-	2	0	ERCC6L	71344458	1.000000	0.71417	0.976000	0.42696	0.951000	0.60555	4.773000	0.62331	0.121000	0.18284	0.600000	0.82982	ACT	-	HMMPfam_SNF2_N		0.363	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6L	protein_coding	OTTHUMT00000057174.2	G	NM_017669		71344458	-1	no_errors	NM_017669	genbank	human	validated	54_36p	missense	SNP	1.000	C
DCTN1	1639	genome.wustl.edu	37	2	74595991	74595991	+	Missense_Mutation	SNP	A	A	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:74595991A>G	ENST00000361874.3	-	16	2035	c.1718T>C	c.(1717-1719)tTg>tCg	p.L573S	DCTN1_ENST00000409567.3_Missense_Mutation_p.L553S|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409868.1_Missense_Mutation_p.L556S|DCTN1_ENST00000409240.1_Missense_Mutation_p.L536S|DCTN1_ENST00000407639.2_Missense_Mutation_p.L439S|DCTN1_ENST00000409438.1_Missense_Mutation_p.L439S|DCTN1_ENST00000394003.3_Missense_Mutation_p.L566S	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	573					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CATCTGCCTCAATTCCATCTC	0.557																																																0			2											94.0	84.0	87.0					2																	74595991		2203	4300	6503	74449499	SO:0001583	missense	1639				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.1718T>C	2.37:g.74595991A>G	ENSP00000354791:p.Leu573Ser	Somatic		Capture	Illumina GAIIx	4	74449499	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1,superfamily_Spectrin repeat	p.L573S	ENST00000361874.3	37	c.1718	CCDS1939.1	2	.	.	.	.	.	.	.	.	.	.	A	23.0	4.362359	0.82353	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	D;D;D;D;D;D;D	0.91996	-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95	5.65	5.65	0.86999	.	0.000000	0.34628	N	0.003820	D	0.96122	0.8736	M	0.84326	2.69	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;0.999	D;D;D;D;D;D	0.91635	0.998;0.999;0.996;0.998;0.994;0.994	D	0.96587	0.9435	10	0.87932	D	0	-3.3737	14.9931	0.71406	1.0:0.0:0.0:0.0	.	553;536;573;566;439;439	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	S	573;566;556;439;439;536;556;553	ENSP00000354791:L573S;ENSP00000377571:L566S;ENSP00000384844:L439S;ENSP00000387270:L439S;ENSP00000386406:L536S;ENSP00000387327:L556S;ENSP00000386843:L553S	ENSP00000354791:L573S	L	-	2	0	DCTN1	74449499	1.000000	0.71417	0.938000	0.37757	0.995000	0.86356	8.850000	0.92190	2.371000	0.80710	0.533000	0.62120	TTG	-	NULL		0.557	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	protein_coding	OTTHUMT00000252227.3	A	NM_004082		74449499	-1	no_errors	NM_004082	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
ARHGAP24	83478	genome.wustl.edu	37	4	86915767	86915767	+	Silent	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr4:86915767G>A	ENST00000395184.1	+	9	1426	c.960G>A	c.(958-960)gtG>gtA	p.V320V	ARHGAP24_ENST00000264343.4_Silent_p.V227V|ARHGAP24_ENST00000395183.2_Silent_p.V225V	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	320	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)			breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		TGATGTCAGTGATGATTAGCA	0.393																																																0			4											172.0	169.0	170.0					4																	86915767		2203	4300	6503	87134791	SO:0001819	synonymous_variant	83478			AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.960G>A	4.37:g.86915767G>A		Somatic		Capture	Illumina GAIIx	4	87134791	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Silent	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.V320	ENST00000395184.1	37	c.960	CCDS34025.1	4																																																																																			-	superfamily_GTPase activation domain GAP,HMMSmart_SM00324		0.393	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP24	protein_coding	OTTHUMT00000252815.2	G	NM_031305		87134791	+1	no_errors	NM_001025616	genbank	human	validated	54_36p	silent	SNP	0.984	A
GAS8	2622	genome.wustl.edu	37	16	90109666	90109666	+	Silent	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr16:90109666C>T	ENST00000268699.4	+	11	1472	c.1350C>T	c.(1348-1350)gaC>gaT	p.D450D	GAS8_ENST00000536122.1_Silent_p.D425D|URAHP_ENST00000517889.1_RNA	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8	450					cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		TCCCTCTGGACAACGTGGGCT	0.657																																																0			16											84.0	75.0	78.0					16																	90109666		2198	4300	6498	88637167	SO:0001819	synonymous_variant	2622			AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.1350C>T	16.37:g.90109666C>T		Somatic		Capture	Illumina GAIIx	4	88637167	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Silent	SNP	NULL	p.D450	ENST00000268699.4	37	c.1350	CCDS10992.1	16																																																																																			-	NULL		0.657	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS8	protein_coding	OTTHUMT00000272877.2	C			88637167	+1	no_errors	NM_001481	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
FAM13A	10144	genome.wustl.edu	37	4	89709064	89709064	+	Nonsense_Mutation	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr4:89709064G>A	ENST00000264344.5	-	10	1318	c.1111C>T	c.(1111-1113)Cga>Tga	p.R371*	FAM13A_ENST00000513837.1_Nonsense_Mutation_p.R17*|FAM13A_ENST00000502459.1_5'UTR|FAM13A_ENST00000508369.1_Nonsense_Mutation_p.R45*|FAM13A_ENST00000395002.2_Nonsense_Mutation_p.R45*|FAM13A_ENST00000503556.1_Nonsense_Mutation_p.R31*|FAM13A_ENST00000511976.1_Intron	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	371					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						ACAGCTGATCGGATGGTTCTT	0.403																																																0			4											80.0	82.0	82.0					4																	89709064		2203	4300	6503	89928087	SO:0001587	stop_gained	10144			AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.1111C>T	4.37:g.89709064G>A	ENSP00000264344:p.Arg371*	Somatic		Capture	Illumina GAIIx	4	89928087	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Nonsense_Mutation	SNP	superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP	p.R371*	ENST00000264344.5	37	c.1111	CCDS34029.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.607430	0.97701	.	.	ENSG00000138640	ENST00000395002;ENST00000264344;ENST00000503556;ENST00000508369;ENST00000513837	.	.	.	5.0	4.13	0.48395	.	0.062167	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.5527	0.56236	0.0:0.0:0.5621:0.4379	.	.	.	.	X	45;371;31;45;17	.	ENSP00000264344:R371X	R	-	1	2	FAM13A	89928087	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.138000	0.42140	1.410000	0.46936	0.655000	0.94253	CGA	-	NULL		0.403	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13A	protein_coding	OTTHUMT00000363371.1	G			89928087	-1	no_errors	NM_014883	genbank	human	validated	54_36p	nonsense	SNP	0.987	A
LRRC69	100130742	genome.wustl.edu	37	8	92170308	92170308	+	Intron	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr8:92170308C>A	ENST00000448384.2	+	5	651				LRRC69_ENST00000343709.3_Intron	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69											endometrium(1)	1						CAATACATGCCCATGGGGTAC	0.413																																																0			8																																								92239484	SO:0001627	intron_variant	0			AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.651+22341C>A	8.37:g.92170308C>A		Somatic		Capture	Illumina GAIIx	4	92239484		RNA	SNP	-	NULL	ENST00000448384.2	37	NULL		8																																																																																			-	-		0.413	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	LOC100132553	protein_coding	OTTHUMT00000415207.1	C	NM_001129890		92239484	+1	pseudogene	XR_038881	genbank	human	model	54_36p	rna	SNP	0.988	A
KIAA1429	25962	genome.wustl.edu	37	8	95539310	95539310	+	Missense_Mutation	SNP	G	G	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr8:95539310G>C	ENST00000297591.5	-	8	1237	c.1162C>G	c.(1162-1164)Ctc>Gtc	p.L388V	KIAA1429_ENST00000421249.2_Missense_Mutation_p.L388V|KIAA1429_ENST00000437199.1_Missense_Mutation_p.L388V	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	388					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			AAATCTAAGAGTTCTGTTAAC	0.333																																																0			8											140.0	145.0	143.0					8																	95539310		2203	4300	6503	95608486	SO:0001583	missense	25962			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.1162C>G	8.37:g.95539310G>C	ENSP00000297591:p.Leu388Val	Somatic		Capture	Illumina GAIIx	4	95608486	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	NULL	p.L388V	ENST00000297591.5	37	c.1162	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	G	13.41	2.228803	0.39399	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.47177	0.87;0.86;0.85	5.74	2.89	0.33648	.	0.000000	0.64402	D	0.000002	T	0.58337	0.2115	L	0.57536	1.79	0.52099	D	0.999946	D;D	0.67145	0.996;0.996	D;D	0.75484	0.986;0.986	T	0.51537	-0.8693	10	0.30854	T	0.27	-6.542	8.0583	0.30619	0.3276:0.0:0.6724:0.0	.	388;388	Q69YN4-4;Q69YN4	.;VIR_HUMAN	V	388	ENSP00000297591:L388V;ENSP00000395600:L388V;ENSP00000398390:L388V	ENSP00000297591:L388V	L	-	1	0	KIAA1429	95608486	1.000000	0.71417	0.946000	0.38457	0.822000	0.46500	3.962000	0.56766	0.300000	0.22699	0.591000	0.81541	CTC	-	NULL		0.333	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	protein_coding	OTTHUMT00000378720.2	G	NM_015496		95608486	-1	no_errors	NM_015496	genbank	human	validated	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	7	97601621	97601621	+	IGR	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr7:97601621C>A								MIR5692C2 (7828 upstream) : OCM2 (12374 downstream)																							AGAAAGCAGCCACCTGCTAGA	0.736																																																0			7																																								97439557	SO:0001628	intergenic_variant	389538																															7.37:g.97601621C>A		Somatic		Capture	Illumina GAIIx	4	97439557		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.736					MGC72080			C			97439557	-1	pseudogene	NR_002822	genbank	human	provisional	54_36p	rna	SNP	0.001	A
PCCA	5095	genome.wustl.edu	37	13	100915018	100915018	+	Missense_Mutation	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr13:100915018C>G	ENST00000376285.1	+	10	790	c.752C>G	c.(751-753)tCt>tGt	p.S251C	PCCA_ENST00000376279.3_Missense_Mutation_p.S251C|PCCA_ENST00000376286.4_Missense_Mutation_p.S225C	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	251	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	GAAGCTGCTTCTAGTTTTGGC	0.398																																																0			13											122.0	139.0	133.0					13																	100915018		2203	4300	6503	99713019	SO:0001583	missense	5095			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.752C>G	13.37:g.100915018C>G	ENSP00000365462:p.Ser251Cys	Somatic		Capture	Illumina GAIIx	4	99713019	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	HMMPfam_CPSase_L_chain,superfamily_PreATP-grasp-like,HMMPfam_CPSase_L_D2,superfamily_SSF56059,PatternScan_CPSASE_1,PatternScan_CPSASE_2,superfamily_Rudmnt_hyb_motif,HMMPfam_Biotin_carb_C,superfamily_Hybrid_motif,HMMPfam_Biotin_lipoyl,PatternScan_BIOTIN	p.S251C	ENST00000376285.1	37	c.752	CCDS9496.2	13	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375874	0.82682	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.97455	-4.39;-4.39;-4.39	5.12	5.12	0.69794	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.99089	0.9687	H	0.97465	4.01	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.73380	0.98;0.967;0.98	D	0.99218	1.0878	10	0.87932	D	0	.	18.5495	0.91058	0.0:1.0:0.0:0.0	.	251;225;251	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	C	225;251;251	ENSP00000365463:S225C;ENSP00000365456:S251C;ENSP00000365462:S251C	ENSP00000365456:S251C	S	+	2	0	PCCA	99713019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.175000	0.77632	2.358000	0.79984	0.655000	0.94253	TCT	-	HMMPfam_CPSase_L_D2,superfamily_SSF56059		0.398	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	protein_coding	OTTHUMT00000045627.2	C			99713019	+1	no_errors	NM_000282	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
KMT2E	55904	genome.wustl.edu	37	7	104747842	104747842	+	Missense_Mutation	SNP	G	G	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr7:104747842G>C	ENST00000311117.3	+	22	3483	c.2938G>C	c.(2938-2940)Ggg>Cgg	p.G980R	KMT2E_ENST00000257745.4_Missense_Mutation_p.G980R|CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334914.7_Missense_Mutation_p.G35R|KMT2E_ENST00000334877.4_Missense_Mutation_p.G980R	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	980					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										GTTAACATTGGGGCCTTTTAG	0.338																																																0			7											66.0	72.0	70.0					7																	104747842		2203	4300	6503	104535078	SO:0001583	missense	55904			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2938G>C	7.37:g.104747842G>C	ENSP00000312379:p.Gly980Arg	Somatic		Capture	Illumina GAIIx	4	104535078	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,HMMPfam_SET,HMMSmart_SM00317,superfamily_SET domain	p.G980R	ENST00000311117.3	37	c.2938	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	G	21.3	4.128246	0.77549	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	D;D;D;T	0.91686	-2.89;-2.53;-2.89;0.77	6.03	6.03	0.97812	.	0.283230	0.34555	N	0.003872	D	0.88005	0.6321	N	0.19112	0.55	0.32515	N	0.537013	D	0.56035	0.974	P	0.51135	0.66	D	0.88353	0.2982	10	0.45353	T	0.12	.	7.9333	0.29914	0.185:0.0:0.815:0.0	.	980	Q8IZD2	MLL5_HUMAN	R	980;980;980;900;980;35	ENSP00000312379:G980R;ENSP00000335599:G980R;ENSP00000257745:G980R;ENSP00000333986:G35R	ENSP00000257745:G980R	G	+	1	0	MLL5	104535078	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.216000	0.65246	2.854000	0.98071	0.655000	0.94253	GGG	-	NULL		0.338	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL5	protein_coding	OTTHUMT00000348697.1	G			104535078	+1	no_errors	NM_018682	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
RTN4IP1	84816	genome.wustl.edu	37	6	107019950	107019950	+	Missense_Mutation	SNP	G	G	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr6:107019950G>C	ENST00000369063.3	-	9	1577	c.1112C>G	c.(1111-1113)cCt>cGt	p.P371R	RTN4IP1_ENST00000539449.1_3'UTR|RTN4IP1_ENST00000498091.1_5'UTR	NM_032730.4	NP_116119.2	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1	371						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(2)|lung(6)|urinary_tract(1)	13	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)		TTTAGAAAAAGGAAAGGTTTG	0.378																																																0			6											109.0	112.0	111.0					6																	107019950		2203	4300	6503	107126643	SO:0001583	missense	84816			AF336861	CCDS5056.1	6q21	2008-02-05			ENSG00000130347	ENSG00000130347			18647	protein-coding gene	gene with protein product		610502					Standard	NM_032730		Approved	NIMP	uc003prj.3	Q8WWV3	OTTHUMG00000015304	ENST00000369063.3:c.1112C>G	6.37:g.107019950G>C	ENSP00000358059:p.Pro371Arg	Somatic		Capture	Illumina GAIIx	4	107126643	Q8N9B3|Q8WZ66|Q9BRA4	Missense_Mutation	SNP	superfamily_GroES-like,HMMPfam_ADH_N,superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_ADH_zinc_N,PatternScan_QOR_ZETA_CRYSTAL	p.P371R	ENST00000369063.3	37	c.1112	CCDS5056.1	6	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183991	0.78677	.	.	ENSG00000130347	ENST00000369063	T	0.26810	1.71	6.02	5.1	0.69264	.	0.412595	0.29799	N	0.011169	T	0.41719	0.1171	M	0.86573	2.825	0.80722	D	1	D	0.60160	0.987	P	0.55303	0.773	T	0.45308	-0.9270	10	0.62326	D	0.03	-18.3881	15.1506	0.72696	0.0:0.1402:0.8598:0.0	.	371	Q8WWV3	RT4I1_HUMAN	R	371	ENSP00000358059:P371R	ENSP00000358059:P371R	P	-	2	0	RTN4IP1	107126643	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.133000	0.57983	2.857000	0.98124	0.650000	0.86243	CCT	-	NULL		0.378	RTN4IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTN4IP1	protein_coding	OTTHUMT00000041673.1	G			107126643	-1	no_errors	NM_032730	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
FOXO3	2309	genome.wustl.edu	37	6	108882613	108882613	+	Missense_Mutation	SNP	G	G	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr6:108882613G>T	ENST00000343882.6	+	2	506	c.202G>T	c.(202-204)Gac>Tac	p.D68Y	FOXO3_ENST00000406360.1_Missense_Mutation_p.D68Y	NM_201559.2	NP_963853.1	O43524	FOXO3_HUMAN	forkhead box O3	68					antral ovarian follicle growth (GO:0001547)|cellular response to oxidative stress (GO:0034599)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|initiation of primordial ovarian follicle growth (GO:0001544)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|ovulation from ovarian follicle (GO:0001542)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		AGACGACGAGGACGGCGGGGG	0.741																																																0			6											2.0	3.0	3.0					6																	108882613		1428	3057	4485	108989306	SO:0001583	missense	2309			AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689		"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A		9479491	Standard	NM_001455		Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.202G>T	6.37:g.108882613G>T	ENSP00000339527:p.Asp68Tyr	Somatic		Capture	Illumina GAIIx	4	108989306	B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	Missense_Mutation	SNP	PatternScan_FORK_HEAD_1,HMMPfam_Fork_head,superfamily_SSF46785,HMMSmart_FH,PatternScan_FORK_HEAD_2	p.D68Y	ENST00000343882.6	37	c.202	CCDS5068.1	6	.	.	.	.	.	.	.	.	.	.	G	13.28	2.191359	0.38707	.	.	ENSG00000118689	ENST00000343882;ENST00000406360	D;D	0.91124	-2.79;-2.79	3.31	3.31	0.37934	.	.	.	.	.	T	0.74344	0.3704	L	0.29908	0.895	0.80722	D	1	B	0.33583	0.418	B	0.23574	0.047	T	0.78288	-0.2262	9	0.59425	D	0.04	-1.9191	9.322	0.37971	0.0:0.0:0.7854:0.2146	.	68	O43524	FOXO3_HUMAN	Y	68	ENSP00000339527:D68Y;ENSP00000385824:D68Y	ENSP00000339527:D68Y	D	+	1	0	FOXO3	108989306	0.948000	0.32251	0.999000	0.59377	0.897000	0.52465	3.888000	0.56204	1.849000	0.53698	0.462000	0.41574	GAC	-	NULL		0.741	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXO3	protein_coding	OTTHUMT00000041722.2	G			108989306	+1	no_errors	NM_001455	genbank	human	reviewed	54_36p	missense	SNP	0.995	T
UBASH3B	84959	genome.wustl.edu	37	11	122671983	122671983	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr11:122671983C>A	ENST00000284273.5	+	11	1913	c.1538C>A	c.(1537-1539)gCa>gAa	p.A513E		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	513	Protein tyrosine phosphatase. {ECO:0000250}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		ACATTACCTGCATGGATACCT	0.473																																																0			11											176.0	167.0	170.0					11																	122671983		2202	4299	6501	122177193	SO:0001583	missense	84959			AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.1538C>A	11.37:g.122671983C>A	ENSP00000284273:p.Ala513Glu	Somatic		Capture	Illumina GAIIx	4	122177193	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	superfamily_UBA_like,HMMPfam_UBA,HMMSmart_UBA,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_SSF53254,HMMPfam_PGAM	p.A513E	ENST00000284273.5	37	c.1538	CCDS31694.1	11	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356909	0.24598	.	.	ENSG00000154127	ENST00000284273	T	0.30448	1.53	5.47	5.47	0.80525	Histidine phosphatase superfamily, clade-1 (1);	0.212782	0.48286	D	0.000199	T	0.18425	0.0442	N	0.10707	0.03	0.58432	D	0.99999	P	0.41041	0.736	B	0.42062	0.374	T	0.04268	-1.0964	10	0.02654	T	1	-8.8139	18.9206	0.92523	0.0:1.0:0.0:0.0	.	513	Q8TF42	UBS3B_HUMAN	E	513	ENSP00000284273:A513E	ENSP00000284273:A513E	A	+	2	0	UBASH3B	122177193	0.981000	0.34729	0.660000	0.29694	0.773000	0.43773	4.665000	0.61547	2.544000	0.85801	0.655000	0.94253	GCA	-	superfamily_SSF53254,HMMPfam_PGAM		0.473	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBASH3B	protein_coding	OTTHUMT00000387499.1	C	NM_032873		122177193	+1	no_errors	NM_032873	genbank	human	validated	54_36p	missense	SNP	1.000	A
C11orf63	79864	genome.wustl.edu	37	11	122831691	122831691	+	IGR	SNP	T	T	C			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr11:122831691T>C	ENST00000531316.1	+	0	2782							Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63						axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		ACATGATAAATTGGGTGCAGA	0.428																																																0			11																																								122336901	SO:0001628	intergenic_variant	0			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027		11.37:g.122831691T>C		Somatic		Capture	Illumina GAIIx	4	122336901	A8K6G0|Q96GB5|Q9H5D6	RNA	SNP	-	NULL	ENST00000531316.1	37	NULL	CCDS8438.1	11																																																																																			-	-		0.428	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128516	protein_coding	OTTHUMT00000387511.1	T	NM_024806		122336901	+1	pseudogene	XR_039709	genbank	human	model	54_36p	rna	SNP	1.000	C
OR8A1	390275	genome.wustl.edu	37	11	124440870	124440870	+	Missense_Mutation	SNP	T	T	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr11:124440870T>A	ENST00000284287.3	+	1	978	c.906T>A	c.(904-906)aaT>aaA	p.N302K		NM_001005194.1	NP_001005194.1	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A, member 1	302					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			haematopoietic_and_lymphoid_tissue(1)|lung(16)|ovary(2)|prostate(1)|skin(2)	22		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		CCATGTTGAATCCCCTAATCT	0.448																																																0			11											74.0	67.0	70.0					11																	124440870		2201	4299	6500	123946080	SO:0001583	missense	390275			BK004495	CCDS31712.1	11q24.2	2012-08-09			ENSG00000196119	ENSG00000196119		"""GPCR / Class A : Olfactory receptors"""	8469	protein-coding gene	gene with protein product							Standard	NM_001005194		Approved	OST025	uc010san.2	Q8NGG7	OTTHUMG00000165923	ENST00000284287.3:c.906T>A	11.37:g.124440870T>A	ENSP00000284287:p.Asn302Lys	Somatic		Capture	Illumina GAIIx	4	123946080	Q6IEW7|Q96RC6	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.N302K	ENST00000284287.3	37	c.906	CCDS31712.1	11	.	.	.	.	.	.	.	.	.	.	T	13.14	2.146987	0.37923	.	.	ENSG00000196119	ENST00000284287	T	0.59364	0.27	5.03	2.96	0.34315	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000109	T	0.80210	0.4581	H	0.96748	3.875	0.43050	D	0.994656	D	0.67145	0.996	D	0.72982	0.979	T	0.79785	-0.1657	10	0.87932	D	0	.	6.4866	0.22093	0.0:0.5353:0.0:0.4647	.	302	Q8NGG7	OR8A1_HUMAN	K	302	ENSP00000284287:N302K	ENSP00000284287:N302K	N	+	3	2	OR8A1	123946080	0.989000	0.36119	0.999000	0.59377	0.206000	0.24218	0.314000	0.19432	0.549000	0.28973	-0.417000	0.06048	AAT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.448	OR8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8A1	protein_coding	OTTHUMT00000387062.1	T	NM_001005194		123946080	+1	no_errors	NM_001005194	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ALDH1L1	10840	genome.wustl.edu	37	3	125877469	125877469	+	Silent	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr3:125877469C>T	ENST00000393434.2	-	3	490	c.141G>A	c.(139-141)gaG>gaA	p.E47E	ALDH1L1_ENST00000452905.2_Silent_p.E47E|ALDH1L1_ENST00000455064.2_Intron|ALDH1L1_ENST00000393431.2_Silent_p.E47E|ALDH1L1_ENST00000413612.1_5'Flank|ALDH1L1_ENST00000273450.3_Silent_p.E57E|U1_ENST00000606575.1_RNA|ALDH1L1_ENST00000472186.1_Silent_p.E47E	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	47	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CTCCATCCTTCTCAGCTTCCA	0.577																																																0			3											89.0	86.0	87.0					3																	125877469		2203	4300	6503	127360159	SO:0001819	synonymous_variant	10840			AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.141G>A	3.37:g.125877469C>T		Somatic		Capture	Illumina GAIIx	4	127360159	B4DG36|E9PBX3|Q68CS1	Silent	SNP	PatternScan_PHOSPHOPANTETHEINE,HMMPfam_Formyl_trans_N,superfamily_formyl_transf,PatternScan_GART,superfamily_FMT_C_like,HMMPfam_Formyl_trans_C,superfamily_ACP_like,superfamily_Aldehyde_DH/Histidinol_DH,HMMPfam_Aldedh,PatternScan_ALDEHYDE_DEHYDR_GLU,PatternScan_ALDEHYDE_DEHYDR_CYS	p.E47	ENST00000393434.2	37	c.141	CCDS3034.1	3																																																																																			-	HMMPfam_Formyl_trans_N,superfamily_formyl_transf		0.577	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	protein_coding	OTTHUMT00000354391.1	C	NM_012190		127360159	-1	no_errors	NM_012190	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
FAM84B	157638	genome.wustl.edu	37	8	127569045	127569045	+	Missense_Mutation	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr8:127569045C>G	ENST00000304916.3	-	2	1045	c.590G>C	c.(589-591)aGc>aCc	p.S197T	FAM84B_ENST00000517458.1_5'Flank|RP11-89K10.1_ENST00000519880.1_RNA|RP11-89K10.1_ENST00000517773.1_RNA|RP11-103H7.5_ENST00000524320.1_RNA|RP11-89K10.1_ENST00000520512.1_RNA	NM_174911.4	NP_777571.1	Q96KN1	FA84B_HUMAN	family with sequence similarity 84, member B	197						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)		STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)			GTTGCGCCAGCTCAGCTCGCG	0.682																																																0			8											11.0	10.0	10.0					8																	127569045		2167	4231	6398	127638227	SO:0001583	missense	157638			AJ417849	CCDS6358.1	8q24.13	2006-02-09				ENSG00000168672			24166	protein-coding gene	gene with protein product	"""breast cancer membrane-associated protein 101"", ""neurological/sensory 2"""	609483				12477722	Standard	NM_174911		Approved	BCMP101, NSE2	uc003yrz.2	Q96KN1		ENST00000304916.3:c.590G>C	8.37:g.127569045C>G	ENSP00000302578:p.Ser197Thr	Somatic		Capture	Illumina GAIIx	4	127638227		Missense_Mutation	SNP	NULL	p.S197T	ENST00000304916.3	37	c.590	CCDS6358.1	8	.	.	.	.	.	.	.	.	.	.	C	9.364	1.068869	0.20147	.	.	ENSG00000168672	ENST00000304916	T	0.03035	4.07	4.86	4.86	0.63082	NC (1);	0.228407	0.49916	D	0.000138	T	0.08846	0.0219	M	0.63428	1.95	0.43137	D	0.994888	D	0.53619	0.961	P	0.53224	0.721	T	0.33727	-0.9857	10	0.20519	T	0.43	-27.8525	10.654	0.45665	0.0:0.9119:0.0:0.0881	.	197	Q96KN1	FA84B_HUMAN	T	197	ENSP00000302578:S197T	ENSP00000302578:S197T	S	-	2	0	FAM84B	127638227	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	4.078000	0.57606	2.240000	0.73641	0.460000	0.39030	AGC	-	NULL		0.682	FAM84B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM84B	protein_coding	OTTHUMT00000381487.1	C	NM_174911		127638227	-1	no_errors	NM_174911	genbank	human	provisional	54_36p	missense	SNP	1.000	G
MCM6	4175	genome.wustl.edu	37	2	136616941	136616941	+	Missense_Mutation	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:136616941G>A	ENST00000264156.2	-	9	1352	c.1292C>T	c.(1291-1293)gCa>gTa	p.A431V	MCM6_ENST00000492091.1_Intron	NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	431	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		CACAACAGCTGCTGTTAAGCC	0.443																																					Ovarian(196;141 2104 8848 24991 25939)											0			2											99.0	89.0	92.0					2																	136616941		2203	4300	6503	136333411	SO:0001583	missense	4175				CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.1292C>T	2.37:g.136616941G>A	ENSP00000264156:p.Ala431Val	Somatic		Capture	Illumina GAIIx	4	136333411	B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	superfamily_Nucleic acid-binding proteins,HMMSmart_SM00350,HMMPfam_MCM,superfamily_P-loop containing nucleoside triphosphate hydrolases,PatternScan_MCM_1	p.A431V	ENST00000264156.2	37	c.1292	CCDS2179.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.846156	0.97016	.	.	ENSG00000076003	ENST00000264156	T	0.11930	2.73	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.41511	0.1162	M	0.79614	2.46	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	T	0.14924	-1.0455	10	0.66056	D	0.02	-15.4807	20.2265	0.98340	0.0:0.0:1.0:0.0	.	431	Q14566	MCM6_HUMAN	V	431	ENSP00000264156:A431V	ENSP00000264156:A431V	A	-	2	0	MCM6	136333411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.381000	0.97205	2.769000	0.95229	0.655000	0.94253	GCA	-	HMMSmart_SM00350,HMMPfam_MCM,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.443	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM6	protein_coding	OTTHUMT00000254658.1	G	NM_005915		136333411	-1	no_errors	NM_005915	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DGKI	9162	genome.wustl.edu	37	7	137128829	137128829	+	Missense_Mutation	SNP	C	C	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr7:137128829C>T	ENST00000288490.5	-	29	2779	c.2779G>A	c.(2779-2781)Gat>Aat	p.D927N	DGKI_ENST00000424189.2_Missense_Mutation_p.D940N|DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000446122.1_Missense_Mutation_p.D909N|DGKI_ENST00000453654.2_Missense_Mutation_p.D596N	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	927					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TTACCATGATCTTCTGAAGAG	0.294																																																0			7											59.0	57.0	58.0					7																	137128829		2200	4300	6500	136779369	SO:0001583	missense	9162			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2779G>A	7.37:g.137128829C>T	ENSP00000288490:p.Asp927Asn	Somatic		Capture	Illumina GAIIx	4	136779369	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	PatternScan_ZF_DAG_PE_1,HMMSmart_C1,HMMPfam_C1_1,HMMPfam_DAGK_cat,HMMSmart_DAGKc,HMMPfam_DAGK_acc,HMMSmart_DAGKa,superfamily_ANK,HMMPfam_Ank,HMMSmart_ANK	p.D927N	ENST00000288490.5	37	c.2779	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633285	0.47049	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.32515	1.45;1.45;1.45	5.47	5.47	0.80525	Ankyrin repeat-containing domain (1);	0.495896	0.20439	N	0.092306	T	0.18551	0.0445	N	0.08118	0	0.41833	D	0.990083	B;B	0.19331	0.008;0.035	B;B	0.17433	0.007;0.018	T	0.06826	-1.0805	10	0.37606	T	0.19	.	14.8392	0.70212	0.0:1.0:0.0:0.0	.	596;927	E9PFX6;O75912	.;DGKI_HUMAN	N	596;844;930;927;909	ENSP00000392161:D596N;ENSP00000288490:D927N;ENSP00000399131:D909N	ENSP00000288490:D927N	D	-	1	0	DGKI	136779369	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.868000	0.56055	2.569000	0.86673	0.650000	0.86243	GAT	-	superfamily_ANK		0.294	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	protein_coding	OTTHUMT00000341286.3	C	NM_004717		136779369	-1	no_errors	NM_004717	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LYSMD1	388695	genome.wustl.edu	37	1	151134352	151134352	+	Silent	SNP	A	A	T			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr1:151134352A>T	ENST00000368908.5	-	2	1065	c.405T>A	c.(403-405)ggT>ggA	p.G135G	LYSMD1_ENST00000440902.2_Silent_p.G87G	NM_212551.4	NP_997716.1	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain containing 1	135										endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGAGGACTTCACCATTGGCAC	0.507																																																0			1											222.0	187.0	199.0					1																	151134352		2203	4300	6503	149400976	SO:0001819	synonymous_variant	388695			BX647911	CCDS986.1, CCDS44218.1	1q21.2	2008-02-05			ENSG00000163155	ENSG00000163155			32070	protein-coding gene	gene with protein product						12477932	Standard	NM_212551		Approved	SB145, MGC35223, RP11-68I18.5	uc001ewy.3	Q96S90	OTTHUMG00000012260	ENST00000368908.5:c.405T>A	1.37:g.151134352A>T		Somatic		Capture	Illumina GAIIx	4	149400976	B4DQA1|Q69YX9	Silent	SNP	superfamily_SSF54106,HMMSmart_LysM,HMMPfam_LysM	p.G135	ENST00000368908.5	37	c.405	CCDS986.1	1																																																																																			-	NULL		0.507	LYSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYSMD1	protein_coding	OTTHUMT00000034070.3	A	NM_212551		149400976	-1	no_errors	NM_212551	genbank	human	validated	54_36p	silent	SNP	0.000	T
NOS3	4846	genome.wustl.edu	37	7	150692311	150692311	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr7:150692311C>A	ENST00000484524.1	+	2	179	c.179C>A	c.(178-180)aCc>aAc	p.T60N	NOS3_ENST00000297494.3_Missense_Mutation_p.T60N|NOS3_ENST00000467517.1_Missense_Mutation_p.T60N|NOS3_ENST00000461406.1_5'UTR	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCCCGCTAACCCAGCCCCCA	0.637																																																0			7											29.0	32.0	31.0					7																	150692311		2199	4293	6492	150323244	SO:0001583	missense	4846				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.179C>A	7.37:g.150692311C>A	ENSP00000420215:p.Thr60Asn	Somatic		Capture	Illumina GAIIx	4	150323244	Q495E5	Missense_Mutation	SNP	superfamily_Nitric oxide (NO) synthase oxygenase domain,HMMPfam_NO_synthase,PatternScan_NOS,superfamily_Flavoproteins,HMMPfam_Flavodoxin_1,superfamily_Riboflavin synthase domain-like,HMMPfam_FAD_binding_1,superfamily_Ferredoxin reductase-like C-terminal NADP-linked domain,HMMPfam_NAD_binding_1	p.T60N	ENST00000484524.1	37	c.179	CCDS55182.1	7	.	.	.	.	.	.	.	.	.	.	c	5.411	0.260986	0.10239	.	.	ENSG00000164867	ENST00000297494;ENST00000484524;ENST00000467517	T;T;T	0.14022	4.72;2.95;2.54	4.2	3.3	0.37823	.	0.458001	0.18295	N	0.145605	T	0.05686	0.0149	N	0.08118	0	0.30805	N	0.739455	B;B;B;B	0.27498	0.023;0.079;0.18;0.023	B;B;B;B	0.21546	0.014;0.035;0.035;0.014	T	0.21245	-1.0251	10	0.10902	T	0.67	-20.7492	9.3099	0.37898	0.0:0.8922:0.0:0.1078	.	60;60;60;60	A0S0A6;E9PFR2;A0S0A8;P29474	.;.;.;NOS3_HUMAN	N	60	ENSP00000297494:T60N;ENSP00000420215:T60N;ENSP00000420551:T60N	ENSP00000297494:T60N	T	+	2	0	NOS3	150323244	0.432000	0.25554	0.046000	0.18839	0.403000	0.30841	1.341000	0.33907	2.035000	0.60131	0.651000	0.88453	ACC	-	NULL		0.637	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS3	protein_coding	OTTHUMT00000351550.1	C	NM_000603		150323244	+1	no_errors	NM_000603	genbank	human	validated	54_36p	missense	SNP	0.079	A
KPRP	448834	genome.wustl.edu	37	1	152732155	152732155	+	Missense_Mutation	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr1:152732155G>A	ENST00000606109.1	+	1	119	c.91G>A	c.(91-93)Gcc>Acc	p.A31T	KPRP_ENST00000368773.1_Missense_Mutation_p.A31T			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	31	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCCCCCTTTGCCCAGAGCCA	0.582																																																0			1											123.0	121.0	122.0					1																	152732155		2203	4300	6503	150998779	SO:0001583	missense	448834			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.91G>A	1.37:g.152732155G>A	ENSP00000475216:p.Ala31Thr	Somatic		Capture	Illumina GAIIx	4	150998779		Missense_Mutation	SNP	NULL	p.A31T	ENST00000606109.1	37	c.91	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376988	0.24857	.	.	ENSG00000203786	ENST00000368773	T	0.16324	2.35	5.26	-0.34	0.12643	.	0.434159	0.19818	N	0.105396	T	0.05640	0.0148	M	0.62723	1.935	0.09310	N	1	B	0.26602	0.154	B	0.23716	0.048	T	0.26326	-1.0106	10	0.72032	D	0.01	-5.4376	4.3371	0.11092	0.2846:0.3177:0.3977:0.0	.	31	Q5T749	KPRP_HUMAN	T	31	ENSP00000357762:A31T	ENSP00000357762:A31T	A	+	1	0	KPRP	150998779	0.002000	0.14202	0.076000	0.20297	0.179000	0.23085	0.444000	0.21661	0.122000	0.18314	0.655000	0.94253	GCC	-	NULL		0.582	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	protein_coding	OTTHUMT00000034522.2	G	NM_001025231		150998779	+1	no_errors	NM_001025231	genbank	human	provisional	54_36p	missense	SNP	0.013	A
SLAMF6	114836	genome.wustl.edu	37	1	160460936	160460936	+	Missense_Mutation	SNP	A	A	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr1:160460936A>G	ENST00000368057.3	-	3	685	c.625T>C	c.(625-627)Tct>Cct	p.S209P	SLAMF6_ENST00000368055.1_Missense_Mutation_p.S98P|SLAMF6_ENST00000368059.3_Missense_Mutation_p.S209P			Q96DU3	SLAF6_HUMAN	SLAM family member 6	209	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			TTCTGGGCAGAGACAGAGAAG	0.502																																																0			1											87.0	88.0	87.0					1																	160460936		2203	4300	6503	158727560	SO:0001583	missense	114836			AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.625T>C	1.37:g.160460936A>G	ENSP00000357036:p.Ser209Pro	Somatic		Capture	Illumina GAIIx	4	158727560	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409	p.S209P	ENST00000368057.3	37	c.625	CCDS53394.1	1	.	.	.	.	.	.	.	.	.	.	A	12.17	1.857155	0.32791	.	.	ENSG00000162739	ENST00000368059;ENST00000368057;ENST00000368055	T;T;T	0.40225	1.04;1.04;1.04	4.05	2.89	0.33648	Immunoglobulin-like (1);	0.644986	0.15581	N	0.254940	T	0.45013	0.1321	M	0.77406	2.37	0.09310	N	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.999;0.999	T	0.21895	-1.0232	10	0.34782	T	0.22	-3.998	6.7393	0.23426	0.7909:0.0:0.0:0.2091	.	98;98;160;209;209;209	B7Z6A7;Q5TAS6;B4E1U5;Q96DU3-2;Q96DU3;B2R8X8	.;.;.;.;SLAF6_HUMAN;.	P	209;209;98	ENSP00000357038:S209P;ENSP00000357036:S209P;ENSP00000357034:S98P	ENSP00000357034:S98P	S	-	1	0	SLAMF6	158727560	0.001000	0.12720	0.202000	0.23494	0.339000	0.28857	0.038000	0.13862	0.694000	0.31654	0.533000	0.62120	TCT	-	superfamily_Immunoglobulin		0.502	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLAMF6	protein_coding	OTTHUMT00000059010.1	A	NM_052931		158727560	-1	no_errors	NM_052931	genbank	human	reviewed	54_36p	missense	SNP	0.011	G
RGSL1	353299	genome.wustl.edu	37	1	182443379	182443379	+	Missense_Mutation	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr1:182443379C>A	ENST00000294854.8	+	6	1153	c.1133C>A	c.(1132-1134)gCc>gAc	p.A378D	RGSL1_ENST00000542961.1_Missense_Mutation_p.A413D	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	378					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						TGTGCTGATGCCTGTGCAGGG	0.493																																					Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)											0			1											152.0	126.0	134.0					1																	182443379		692	1591	2283	180710002	SO:0001583	missense	0			AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.1133C>A	1.37:g.182443379C>A	ENSP00000457748:p.Ala378Asp	Somatic		Capture	Illumina GAIIx	4	180710002	A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	NULL	p.A413D	ENST00000294854.8	37	c.1238	CCDS58049.1	1																																																																																			-	NULL		0.493	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	uc001gpg.2	protein_coding	OTTHUMT00000320710.3	C	NM_181572		180710002	+1	no_errors	ENST00000367561	ensembl	human	known	54_36p	missense	SNP	0.002	A
LAMC1	3915	genome.wustl.edu	37	1	183109570	183109570	+	Missense_Mutation	SNP	A	A	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr1:183109570A>G	ENST00000258341.4	+	27	4762	c.4505A>G	c.(4504-4506)aAt>aGt	p.N1502S	RP11-181K3.4_ENST00000457852.3_RNA	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1502	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GCCGAGATCAATGCCAGAAAA	0.418																																																0			1											75.0	75.0	75.0					1																	183109570		2203	4300	6503	181376193	SO:0001583	missense	3915			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.4505A>G	1.37:g.183109570A>G	ENSP00000258341:p.Asn1502Ser	Somatic		Capture	Illumina GAIIx	4	181376193	Q5VYE7	Missense_Mutation	SNP	HMMSmart_LamNT,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_SSF57196,PatternScan_EGF_1,PatternScan_EGF_LAM_1,superfamily_Grow_fac_recept,HMMSmart_LamB,HMMPfam_Laminin_B,PatternScan_EGF_2	p.N1502S	ENST00000258341.4	37	c.4505	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.451312	0.43531	.	.	ENSG00000135862	ENST00000258341	T	0.77229	-1.08	5.31	4.19	0.49359	.	0.200515	0.50627	D	0.000104	T	0.60483	0.2272	N	0.17082	0.46	0.53688	D	0.999978	B	0.09022	0.002	B	0.08055	0.003	T	0.57165	-0.7858	10	0.35671	T	0.21	.	9.2185	0.37362	0.9181:0.0:0.0819:0.0	.	1502	P11047	LAMC1_HUMAN	S	1502	ENSP00000258341:N1502S	ENSP00000258341:N1502S	N	+	2	0	LAMC1	181376193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.508000	0.67006	2.010000	0.58986	0.533000	0.62120	AAT	-	NULL		0.418	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	protein_coding	OTTHUMT00000085954.2	A	NM_002293		181376193	+1	no_errors	NM_002293	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
COL3A1	1281	genome.wustl.edu	37	2	189866316	189866316	+	Splice_Site	SNP	G	G	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:189866316G>A	ENST00000304636.3	+	34	2561		c.e34+1		COL3A1_ENST00000317840.5_Splice_Site	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1						aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	TGGTAGCCCTGTAAGTGTTAA	0.478																																																0			2											97.0	102.0	100.0					2																	189866316		2203	4300	6503	189574561	SO:0001630	splice_region_variant	1281			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2391+1G>A	2.37:g.189866316G>A		Somatic		Capture	Illumina GAIIx	4	189574561	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Splice_Site	SNP	-	e34+1	ENST00000304636.3	37	c.2391+1	CCDS2297.1	2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.947890	0.92593	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2744	0.94026	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL3A1	189574561	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.813000	0.99286	2.637000	0.89404	0.557000	0.71058	.	-	-		0.478	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	protein_coding	OTTHUMT00000255899.3	G	NM_000090	Intron	189574561	+1	no_errors	NM_000090	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
CLK1	1195	genome.wustl.edu	37	2	201724423	201724423	+	Silent	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:201724423C>G	ENST00000321356.4	-	5	663	c.528G>C	c.(526-528)gtG>gtC	p.V176V	CLK1_ENST00000409769.2_5'Flank|CLK1_ENST00000434813.2_Silent_p.V218V|CLK1_ENST00000492793.1_5'Flank	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CGATGCACTCCACAACTTTTC	0.358																																																0			2											95.0	91.0	92.0					2																	201724423		2203	4300	6503	201432668	SO:0001819	synonymous_variant	1195			L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.528G>C	2.37:g.201724423C>G		Somatic		Capture	Illumina GAIIx	4	201432668	B4DFW7|Q0P694|Q8N5V8	Silent	SNP	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.V176	ENST00000321356.4	37	c.528	CCDS2331.1	2																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP		0.358	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLK1	protein_coding	OTTHUMT00000256192.2	C			201432668	-1	no_errors	NM_004071	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
ORC2	4999	genome.wustl.edu	37	2	201790656	201790656	+	Splice_Site	SNP	C	C	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:201790656C>A	ENST00000234296.2	-	13	1300		c.e13-1		RN7SL694P_ENST00000584245.1_RNA	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2						DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						AATTCAGGACCTATATCATGA	0.308																																																0			2											119.0	113.0	115.0					2																	201790656		2203	4299	6502	201498901	SO:0001630	splice_region_variant	4999				CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1051-1G>T	2.37:g.201790656C>A		Somatic		Capture	Illumina GAIIx	4	201498901	Q13204|Q53TX5	Splice_Site	SNP	-	e11-1	ENST00000234296.2	37	c.1051-1	CCDS2334.1	2	.	.	.	.	.	.	.	.	.	.	C	18.00	3.525918	0.64860	.	.	ENSG00000115942	ENST00000234296	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9106	0.92483	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ORC2	201498901	1.000000	0.71417	0.773000	0.31616	0.652000	0.38707	7.093000	0.76937	2.480000	0.83734	0.585000	0.79938	.	-	-		0.308	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC2L	protein_coding	OTTHUMT00000256191.2	C	NM_006190	Intron	201498901	-1	no_errors	NM_006190	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
KCNH1	3756	genome.wustl.edu	37	1	211256199	211256199	+	Missense_Mutation	SNP	T	T	A			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr1:211256199T>A	ENST00000271751.4	-	5	508	c.481A>T	c.(481-483)Agc>Tgc	p.S161C	KCNH1_ENST00000367007.4_Missense_Mutation_p.S161C			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	161					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		ACACCCCTGCTGCTTGTCAGT	0.557																																																0			1											96.0	78.0	84.0					1																	211256199		2203	4300	6503	209322822	SO:0001583	missense	3756			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.481A>T	1.37:g.211256199T>A	ENSP00000271751:p.Ser161Cys	Somatic		Capture	Illumina GAIIx	4	209322822	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	superfamily_PYP-like sensor domain (PAS domain),HMMSmart_SM00086,superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding	p.S161C	ENST00000271751.4	37	c.481	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.632540	0.87660	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.99113	-5.4;-5.44	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.98924	0.9635	M	0.67625	2.065	0.80722	D	1	D;D	0.71674	0.996;0.998	P;D	0.63033	0.88;0.91	D	0.99686	1.1000	10	0.87932	D	0	.	14.4148	0.67142	0.0:0.0:0.0:1.0	.	161;161	Q14CL3;O95259	.;KCNH1_HUMAN	C	161	ENSP00000271751:S161C;ENSP00000355974:S161C	ENSP00000271751:S161C	S	-	1	0	KCNH1	209322822	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.592000	0.82676	2.061000	0.61500	0.533000	0.62120	AGC	-	NULL		0.557	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	protein_coding	OTTHUMT00000088332.1	T	NM_002238		209322822	-1	no_errors	NM_172362	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
B3GALNT2	148789	genome.wustl.edu	37	1	235613591	235613591	+	Missense_Mutation	SNP	G	G	A	rs373773440		TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr1:235613591G>A	ENST00000366600.3	-	12	1661	c.1433C>T	c.(1432-1434)cCg>cTg	p.P478L		NM_152490.2	NP_689703.1	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2	478					protein glycosylation (GO:0006486)|protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|acetylglucosaminyltransferase activity (GO:0008375)|galactosyltransferase activity (GO:0008378)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			CAGTTCCCACGGAGAATACTG	0.483																																																0			1						G	LEU/PRO	0,4406		0,0,2203	111.0	101.0	104.0		1433	5.4	0.1	1		104	1,8599	1.2+/-3.3	0,1,4299	no	missense	B3GALNT2	NM_152490.2	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	478/501	235613591	1,13005	2203	4300	6503	233680214	SO:0001583	missense	148789			BC029564	CCDS1606.1, CCDS60453.1	1q42.3	2013-02-19	2006-06-14		ENSG00000162885	ENSG00000162885		"""Beta 3-glycosyltransferases"""	28596	protein-coding gene	gene with protein product		610194	"""UDP-GalNAc:betaGlcNAc beta-1,3-galactosaminyltransferase, polypeptide 2"""			14724282	Standard	NM_001277155		Approved	MGC39558	uc001hxc.3	Q8NCR0	OTTHUMG00000040468	ENST00000366600.3:c.1433C>T	1.37:g.235613591G>A	ENSP00000355559:p.Pro478Leu	Somatic		Capture	Illumina GAIIx	4	233680214	Q59GR3|Q5TCI3|Q96AL7	Missense_Mutation	SNP	HMMPfam_Galactosyl_T	p.P478L	ENST00000366600.3	37	c.1433	CCDS1606.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.286367	0.95517	0.0	1.16E-4	ENSG00000162885	ENST00000366600	T	0.66460	-0.21	5.41	5.41	0.78517	.	0.104954	0.64402	D	0.000003	T	0.73760	0.3628	M	0.62723	1.935	0.80722	D	1	D	0.63880	0.993	P	0.50405	0.64	T	0.76016	-0.3113	10	0.56958	D	0.05	-10.6192	19.5534	0.95331	0.0:0.0:1.0:0.0	.	478	Q8NCR0	B3GL2_HUMAN	L	478	ENSP00000355559:P478L	ENSP00000355559:P478L	P	-	2	0	B3GALNT2	233680214	1.000000	0.71417	0.051000	0.19133	0.692000	0.40212	7.184000	0.77705	2.697000	0.92050	0.563000	0.77884	CCG	-	NULL		0.483	B3GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALNT2	protein_coding	OTTHUMT00000097376.1	G	NM_152490		233680214	-1	no_errors	NM_152490	genbank	human	provisional	54_36p	missense	SNP	0.962	A
AQP12B	653437	genome.wustl.edu	37	2	241622248	241622248	+	Missense_Mutation	SNP	C	C	G			TCGA-42-2589-01A-01D-1526-09	TCGA-42-2589-10A-01D-1526-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	b6d00ccc-315f-466f-af5b-0b2de560281d	7fd91650-78df-4d3f-b9a4-62e921b476a9	g.chr2:241622248C>G	ENST00000407834.3	-	1	69	c.7G>C	c.(7-9)Ggt>Cgt	p.G3R		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	3						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		ACGTTAAGACCTGCCATCGGC	0.657																																																0			2											65.0	74.0	71.0					2																	241622248		2173	4275	6448	241270921	SO:0001583	missense	285192			BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.7G>C	2.37:g.241622248C>G	ENSP00000384894:p.Gly3Arg	Somatic		Capture	Illumina GAIIx	4	241270921	A4QPB9	Missense_Mutation	SNP	superfamily_MIP	p.G3R	ENST00000407834.3	37	c.7	CCDS46560.1	2	.	.	.	.	.	.	.	.	.	.	.	2.566	-0.300666	0.05495	.	.	ENSG00000185176	ENST00000407834	T	0.54675	0.56	3.19	-2.41	0.06562	.	0.300406	0.36519	N	0.002551	T	0.54598	0.1868	L	0.50333	1.59	0.09310	N	1	D	0.71674	0.998	D	0.69824	0.966	T	0.47636	-0.9102	9	.	.	.	0.2964	4.1005	0.10012	0.1616:0.3869:0.0:0.4515	.	3	A6NM10-2	.	R	3	ENSP00000384894:G3R	.	G	-	1	0	AQP12B	241270921	0.240000	0.23847	0.028000	0.17463	0.246000	0.25737	1.284000	0.33249	-0.468000	0.06922	-0.361000	0.07541	GGT	-	NULL		0.657	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP12B	protein_coding	OTTHUMT00000325625.1	C			241270921	-1	no_errors	NM_001102467	genbank	human	validated	54_36p	missense	SNP	0.561	G
