#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SPEN	23013	broad.mit.edu	37	1	16259192	16259192	+	Missense_Mutation	SNP	G	G	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr1:16259192G>A	ENST00000375759.3	+	11	6661	c.6457G>A	c.(6457-6459)Gtg>Atg	p.V2153M		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2153	Interaction with MSX2. {ECO:0000250}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.V2153M(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GAAAGAAGACGTGTCTGCCTC	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											90.0	91.0	91.0					1																	16259192		2203	4300	6503	16131779	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.6457G>A	1.37:g.16259192G>A	ENSP00000364912:p.Val2153Met	Somatic		Capture	Illumina GAIIx	Phase_I	16131779	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.304931	0.01353	.	.	ENSG00000065526	ENST00000375759	T	0.08634	3.07	5.16	-0.532	0.11890	.	.	.	.	.	T	0.07052	0.0179	N	0.22421	0.69	0.09310	N	1	D	0.59767	0.986	P	0.45276	0.475	T	0.40924	-0.9537	9	0.31617	T	0.26	0.9878	12.1169	0.53870	0.149:0.6695:0.1815:0.0	.	2153	Q96T58	MINT_HUMAN	M	2153	ENSP00000364912:V2153M	ENSP00000364912:V2153M	V	+	1	0	SPEN	16131779	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.342000	0.19926	-0.064000	0.13043	-0.359000	0.07587	GTG		0.547	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
HSPG2	3339	broad.mit.edu	37	1	22205081	22205081	+	Silent	SNP	G	G	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr1:22205081G>T	ENST00000374695.3	-	19	2626	c.2547C>A	c.(2545-2547)cgC>cgA	p.R849R		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	849	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)	p.R849R(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TCTCACAGCGGCGGCCAGTGT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	1											42.0	44.0	44.0					1																	22205081		2203	4300	6503	22077668	SO:0001819	synonymous_variant	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.2547C>A	1.37:g.22205081G>T		Somatic		Capture	Illumina GAIIx	Phase_I	22077668	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	ENST00000374695.3	37	CCDS30625.1																																																																																				0.632	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
PAFAH2	5051	broad.mit.edu	37	1	26303245	26303245	+	Missense_Mutation	SNP	C	C	T	rs200838566	byFrequency	TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr1:26303245C>T	ENST00000374282.3	-	8	865	c.686G>A	c.(685-687)cGt>cAt	p.R229H	PAFAH2_ENST00000374284.1_Missense_Mutation_p.R229H	NM_000437.3	NP_000428.2	Q99487	PAFA2_HUMAN	platelet-activating factor acetylhydrolase 2, 40kDa	229					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|phospholipid binding (GO:0005543)	p.R229H(1)		NS(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|urinary_tract(1)	9		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)		CACAGCCACACGGCTCATGTC	0.483													C|||	3	0.000599042	0.0015	0.0	5008	,	,		18775	0.0		0.0	False		,,,				2504	0.001															1	Substitution - Missense(1)	ovary(1)	1											88.0	75.0	80.0					1																	26303245		2203	4300	6503	26175832	SO:0001583	missense	5051			D87845	CCDS270.1	1p34.3	2008-09-19	2002-08-29		ENSG00000158006	ENSG00000158006			8579	protein-coding gene	gene with protein product		602344	"""platelet-activating factor acetylhydrolase 2 (40kD)"""			8955149, 9494101	Standard	NM_000437		Approved	HSD-PLA2	uc001bld.4	Q99487	OTTHUMG00000007437	ENST00000374282.3:c.686G>A	1.37:g.26303245C>T	ENSP00000363400:p.Arg229His	Somatic		Capture	Illumina GAIIx	Phase_I	26175832	D3DPK1|O15458|Q5SY02	Missense_Mutation	SNP	ENST00000374282.3	37	CCDS270.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	19.00	3.741230	0.69304	.	.	ENSG00000158006	ENST00000374282;ENST00000374284	T;T	0.56275	0.47;0.47	5.2	4.29	0.51040	.	0.222920	0.30781	N	0.008893	T	0.56804	0.2010	M	0.72479	2.2	0.09310	N	0.999999	D	0.53151	0.958	P	0.48921	0.595	T	0.53634	-0.8411	10	0.46703	T	0.11	-1.9135	9.8644	0.41134	0.0:0.8323:0.0:0.1677	.	229	Q99487	PAFA2_HUMAN	H	229	ENSP00000363400:R229H;ENSP00000363402:R229H	ENSP00000363400:R229H	R	-	2	0	PAFAH2	26175832	0.124000	0.22315	0.760000	0.31359	0.972000	0.66771	1.043000	0.30316	1.321000	0.45227	0.313000	0.20887	CGT		0.483	PAFAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019544.1	NM_000437	
FAM167B	84734	broad.mit.edu	37	1	32713083	32713083	+	Missense_Mutation	SNP	G	G	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr1:32713083G>T	ENST00000373582.3	+	1	250	c.61G>T	c.(61-63)Ggg>Tgg	p.G21W		NM_032648.2	NP_116037.2	Q9BTA0	F167B_HUMAN	family with sequence similarity 167, member B	21								p.G21W(1)		endometrium(1)|large_intestine(1)|lung(1)|ovary(2)	5						GGATGAGGAGGGGGAGAGCCT	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											53.0	65.0	61.0					1																	32713083		2077	4204	6281	32485670	SO:0001583	missense	84734			BC004269	CCDS358.2	1p35.1	2010-08-27	2008-06-11	2008-06-11	ENSG00000183615	ENSG00000183615			28133	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 90"""	C1orf90		12477932	Standard	NM_032648		Approved	MGC10820	uc001buw.3	Q9BTA0	OTTHUMG00000007462	ENST00000373582.3:c.61G>T	1.37:g.32713083G>T	ENSP00000362684:p.Gly21Trp	Somatic		Capture	Illumina GAIIx	Phase_I	32485670	Q5TDH6	Missense_Mutation	SNP	ENST00000373582.3	37	CCDS358.2	.	.	.	.	.	.	.	.	.	.	g	12.66	2.004988	0.35415	.	.	ENSG00000183615	ENST00000373582	T	0.30448	1.53	5.02	2.11	0.27256	.	0.540328	0.15603	U	0.253791	T	0.13970	0.0338	N	0.08118	0	0.23689	N	0.997106	P	0.36712	0.566	B	0.32393	0.145	T	0.11131	-1.0600	10	0.72032	D	0.01	.	8.08	0.30739	0.1464:0.1312:0.7224:0.0	.	21	Q9BTA0	F167B_HUMAN	W	21	ENSP00000362684:G21W	ENSP00000362684:G21W	G	+	1	0	FAM167B	32485670	1.000000	0.71417	0.262000	0.24481	0.875000	0.50365	4.347000	0.59373	0.254000	0.21573	-0.136000	0.14681	GGG		0.617	FAM167B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019615.2	NM_032648	
LRRC8C	84230	broad.mit.edu	37	1	90179703	90179703	+	Missense_Mutation	SNP	T	T	G	rs199876585	byFrequency	TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr1:90179703T>G	ENST00000370454.4	+	3	1829	c.1574T>G	c.(1573-1575)cTa>cGa	p.L525R	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	525					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.L525R(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		GTTGGCTCTCTAAGTCATGAT	0.458													T|||	2	0.000399361	0.0	0.0	5008	,	,		19807	0.002		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1											81.0	79.0	80.0					1																	90179703		2203	4300	6503	89952291	SO:0001583	missense	84230				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1574T>G	1.37:g.90179703T>G	ENSP00000359483:p.Leu525Arg	Somatic		Capture	Illumina GAIIx	Phase_I	89952291	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	37	CCDS725.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	T	16.90	3.250680	0.59212	.	.	ENSG00000171488	ENST00000370454	T	0.23754	1.89	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000001	T	0.25865	0.0630	L	0.29908	0.895	0.58432	D	0.999997	D	0.69078	0.997	D	0.63033	0.91	T	0.02417	-1.1162	10	0.39692	T	0.17	.	15.7125	0.77641	0.0:0.0:0.0:1.0	.	525	Q8TDW0	LRC8C_HUMAN	R	525	ENSP00000359483:L525R	ENSP00000359483:L525R	L	+	2	0	LRRC8C	89952291	0.996000	0.38824	0.999000	0.59377	0.992000	0.81027	7.997000	0.88414	2.165000	0.68154	0.528000	0.53228	CTA		0.458	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
NPL	80896	broad.mit.edu	37	1	182787734	182787734	+	Silent	SNP	G	G	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr1:182787734G>A	ENST00000367553.1	+	8	560	c.516G>A	c.(514-516)ctG>ctA	p.L172L	NPL_ENST00000367552.2_Silent_p.L172L|NPL_ENST00000258317.2_Silent_p.L172L|NPL_ENST00000463899.1_3'UTR|NPL_ENST00000367554.3_Silent_p.L153L|NPL_ENST00000367555.1_Silent_p.L172L	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)	172					carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)	p.L172L(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						TCCAAGGGCTGAAATTCAGTG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	1											99.0	97.0	98.0					1																	182787734		2203	4300	6503	181054357	SO:0001819	synonymous_variant	80896			AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.516G>A	1.37:g.182787734G>A		Somatic		Capture	Illumina GAIIx	Phase_I	181054357	B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Silent	SNP	ENST00000367553.1	37	CCDS1350.1																																																																																				0.448	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085463.1	NM_030769	
NUP133	55746	broad.mit.edu	37	1	229631266	229631266	+	Missense_Mutation	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr1:229631266C>T	ENST00000261396.3	-	8	1113	c.1022G>A	c.(1021-1023)cGa>cAa	p.R341Q	NUP133_ENST00000537506.1_Missense_Mutation_p.R325Q	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	341					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)	p.R341Q(1)		NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GTCCAAATATCGAATGTTGAC	0.294																																																1	Substitution - Missense(1)	ovary(1)	1											156.0	146.0	149.0					1																	229631266		2202	4299	6501	227697889	SO:0001583	missense	55746				CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.1022G>A	1.37:g.229631266C>T	ENSP00000261396:p.Arg341Gln	Somatic		Capture	Illumina GAIIx	Phase_I	227697889	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	37	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	C	8.651	0.898247	0.17686	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.44881	0.91;0.91;0.91	5.6	-2.14	0.07123	WD40/YVTN repeat-like-containing domain (1);Nucleoporin, Nup133/Nup155-like, N-terminal (1);	1.484590	0.03252	N	0.181990	T	0.18593	0.0446	N	0.03115	-0.41	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.16424	-1.0403	10	0.13470	T	0.59	-1.3506	6.828	0.23895	0.0:0.196:0.1496:0.6544	.	341	Q8WUM0	NU133_HUMAN	Q	341;341;341;325	ENSP00000261396:R341Q;ENSP00000355640:R341Q;ENSP00000443496:R325Q	ENSP00000261396:R341Q	R	-	2	0	NUP133	227697889	0.049000	0.20398	0.268000	0.24571	0.865000	0.49528	0.472000	0.22116	0.004000	0.14682	-0.345000	0.07892	CGA		0.294	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
RECQL	5965	broad.mit.edu	37	12	21626516	21626516	+	Missense_Mutation	SNP	G	G	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr12:21626516G>T	ENST00000444129.2	-	12	1884	c.1416C>A	c.(1414-1416)aaC>aaA	p.N472K	RECQL_ENST00000421138.2_Missense_Mutation_p.N472K	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	472					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.N472K(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						CGCACATTTTGTTACATGCTT	0.353								Other identified genes with known or suspected DNA repair function																																								1	Substitution - Missense(1)	ovary(1)	12											127.0	104.0	112.0					12																	21626516		2202	4299	6501	21517783	SO:0001583	missense	5965			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1416C>A	12.37:g.21626516G>T	ENSP00000416739:p.Asn472Lys	Somatic		Capture	Illumina GAIIx	Phase_I	21517783	A8K6G2	Missense_Mutation	SNP	ENST00000444129.2	37	CCDS31756.1	.	.	.	.	.	.	.	.	.	.	G	16.02	3.003748	0.54254	.	.	ENSG00000004700	ENST00000444129;ENST00000421138	T;T	0.33654	1.4;1.4	6.04	4.23	0.50019	.	0.173134	0.64402	D	0.000011	T	0.24470	0.0593	L	0.37507	1.11	0.46336	D	0.998999	P	0.34757	0.467	B	0.24541	0.054	T	0.02975	-1.1087	10	0.26408	T	0.33	-19.5993	12.1619	0.54109	0.0644:0.1209:0.8147:0.0	.	472	P46063	RECQ1_HUMAN	K	472	ENSP00000416739:N472K;ENSP00000395449:N472K	ENSP00000395449:N472K	N	-	3	2	RECQL	21517783	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.968000	0.49224	0.888000	0.36160	0.563000	0.77884	AAC		0.353	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907	
MYL6	4637	broad.mit.edu	37	12	56553369	56553369	+	Splice_Site	SNP	A	A	G			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr12:56553369A>G	ENST00000550697.1	+	3	272		c.e3-1		MYL6_ENST00000548400.1_Splice_Site|MYL6_ENST00000549017.1_Splice_Site|MYL6_ENST00000548580.1_Intron|RP11-977G19.5_ENST00000553176.1_RNA|MYL6_ENST00000348108.4_Splice_Site|RP11-603J24.14_ENST00000548731.1_RNA|MYL6_ENST00000547408.1_Splice_Site|MYL6_ENST00000293422.5_Splice_Site|MYL6_ENST00000548293.1_Splice_Site|MYL6_ENST00000551589.1_Splice_Site|MYL6_ENST00000536128.1_Splice_Site|MYL6_ENST00000549566.1_Intron|MYL6_ENST00000547649.1_Splice_Site	NM_021019.4	NP_066299.2	P60660	MYL6_HUMAN	myosin, light chain 6, alkali, smooth muscle and non-muscle						ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle tissue development (GO:0007519)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|unconventional myosin complex (GO:0016461)|vesicle (GO:0031982)	actin-dependent ATPase activity (GO:0030898)|calcium ion binding (GO:0005509)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.?(1)		large_intestine(1)|lung(1)|ovary(1)|prostate(3)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(18;0.0979)			CTGAATCCTCAGAGTTCAAGG	0.512																																																1	Unknown(1)	ovary(1)	12											113.0	107.0	109.0					12																	56553369		2203	4300	6503	54839636	SO:0001630	splice_region_variant	4637			AB046613	CCDS8906.1, CCDS31834.1	12q13.13	2013-01-10	2006-09-29			ENSG00000092841		"""Myosins / Light chain"", ""EF-hand domain containing"""	7587	protein-coding gene	gene with protein product		609931	"""myosin, light polypeptide 6, alkali, smooth muscle and non-muscle"""			8188229, 2304459, 2722814	Standard	NM_021019		Approved	ESMLC, MLC3NM, MLC1SM	uc001sjx.2	P60660		ENST00000550697.1:c.32-1A>G	12.37:g.56553369A>G		Somatic		Capture	Illumina GAIIx	Phase_I	54839636	P16475|P24572|P24573|Q12790|Q561V9|Q6IAZ0|Q6IPY5	Splice_Site	SNP	ENST00000550697.1	37	CCDS8906.1	.	.	.	.	.	.	.	.	.	.	A	19.26	3.792491	0.70452	.	.	ENSG00000092841	ENST00000550697;ENST00000293422;ENST00000348108;ENST00000536128;ENST00000547649;ENST00000547408;ENST00000551589;ENST00000553056;ENST00000548400;ENST00000548293	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5576	0.61768	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYL6	54839636	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.129000	0.94430	2.106000	0.64143	0.455000	0.32223	.		0.512	MYL6-003	KNOWN	NAGNAG_splice_site|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407928.3		Intron
WIF1	11197	broad.mit.edu	37	12	65471525	65471525	+	Splice_Site	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr12:65471525C>T	ENST00000286574.4	-	3	772		c.e3+1			NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1						multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)		p.?(1)		cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		AGACCACCCACCTGATGCCTT	0.428			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	1	Unknown(1)	ovary(1)	12											103.0	85.0	91.0					12																	65471525		2203	4300	6503	63757792	SO:0001630	splice_region_variant	11197			AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.397+1G>A	12.37:g.65471525C>T		Somatic		Capture	Illumina GAIIx	Phase_I	63757792	Q6UXI1|Q8WVG4	Splice_Site	SNP	ENST00000286574.4	37	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.517856	0.85495	.	.	ENSG00000156076	ENST00000286574;ENST00000546001	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4405	0.94817	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WIF1	63757792	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.115000	0.71566	2.689000	0.91719	0.650000	0.86243	.		0.428	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2		Intron
VWA8	23078	broad.mit.edu	37	13	42407524	42407524	+	Silent	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr13:42407524C>T	ENST00000379310.3	-	13	1637	c.1569G>A	c.(1567-1569)acG>acA	p.T523T	VWA8_ENST00000281496.6_Silent_p.T523T	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	523						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.T523T(1)									ATACAGCAAGCGTGCCCGCAT	0.507																																																1	Substitution - coding silent(1)	ovary(1)	13											62.0	54.0	57.0					13																	42407524		2203	4300	6503	41305524	SO:0001819	synonymous_variant	23078			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.1569G>A	13.37:g.42407524C>T		Somatic		Capture	Illumina GAIIx	Phase_I	41305524	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	CCDS41881.1																																																																																				0.507	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
SLITRK1	114798	broad.mit.edu	37	13	84454755	84454755	+	Missense_Mutation	SNP	C	C	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr13:84454755C>A	ENST00000377084.2	-	1	1773	c.888G>T	c.(886-888)gaG>gaT	p.E296D		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	296					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.E296D(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TGGCATGATCCTCTTGCCCAT	0.552																																																1	Substitution - Missense(1)	ovary(1)	13											77.0	76.0	76.0					13																	84454755		2203	4300	6503	83352756	SO:0001583	missense	114798			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.888G>T	13.37:g.84454755C>A	ENSP00000366288:p.Glu296Asp	Somatic		Capture	Illumina GAIIx	Phase_I	83352756	Q5U5I6|Q96SF9	Missense_Mutation	SNP	ENST00000377084.2	37	CCDS9464.1	.	.	.	.	.	.	.	.	.	.	C	1.743	-0.491290	0.04322	.	.	ENSG00000178235	ENST00000377084	T	0.58210	0.35	4.85	-2.48	0.06423	.	0.209202	0.45126	N	0.000386	T	0.20210	0.0486	N	0.08118	0	0.34715	D	0.728125	B	0.06786	0.001	B	0.06405	0.002	T	0.10590	-1.0623	10	0.12766	T	0.61	-7.8753	2.5523	0.04751	0.1189:0.2653:0.119:0.4969	.	296	Q96PX8	SLIK1_HUMAN	D	296	ENSP00000366288:E296D	ENSP00000366288:E296D	E	-	3	2	SLITRK1	83352756	0.405000	0.25336	0.933000	0.37362	0.965000	0.64279	0.024000	0.13555	-0.672000	0.05266	-1.164000	0.01763	GAG		0.552	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
NUMB	8650	broad.mit.edu	37	14	73743432	73743432	+	Missense_Mutation	SNP	T	T	C			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr14:73743432T>C	ENST00000355058.3	-	13	2088	c.1810A>G	c.(1810-1812)Aca>Gca	p.T604A	NUMB_ENST00000554521.2_Missense_Mutation_p.T398A|NUMB_ENST00000356296.4_Missense_Mutation_p.T556A|NUMB_ENST00000544991.3_Missense_Mutation_p.T409A|NUMB_ENST00000557597.1_Missense_Mutation_p.T593A|NUMB_ENST00000535282.1_Missense_Mutation_p.T593A|NUMB_ENST00000555238.1_Missense_Mutation_p.T604A|NUMB_ENST00000454166.4_Missense_Mutation_p.T458A|NUMB_ENST00000359560.3_Missense_Mutation_p.T593A|NUMB_ENST00000559312.1_Missense_Mutation_p.T409A|RP4-647C14.3_ENST00000556578.1_RNA|NUMB_ENST00000556772.1_Missense_Mutation_p.T460A|NUMB_ENST00000555738.2_Missense_Mutation_p.T447A|NUMB_ENST00000555394.1_Missense_Mutation_p.T556A|NUMB_ENST00000554546.1_Missense_Mutation_p.T545A|NUMB_ENST00000560335.1_Missense_Mutation_p.T458A			P49757	NUMB_HUMAN	numb homolog (Drosophila)	604					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T604A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		GGAACCTCTGTATGCCTGTCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	14											77.0	69.0	72.0					14																	73743432		2203	4300	6503	72813185	SO:0001583	missense	8650			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.1810A>G	14.37:g.73743432T>C	ENSP00000347169:p.Thr604Ala	Somatic		Capture	Illumina GAIIx	Phase_I	72813185	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	ENST00000355058.3	37	CCDS32116.1	.	.	.	.	.	.	.	.	.	.	T	0.004	-2.332154	0.00227	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000544991;ENST00000454166;ENST00000555738;ENST00000554521;ENST00000535282	T;T;T;T;T;T;T;T;T;T;T;T;T	0.54479	0.58;0.58;1.01;1.01;1.59;1.01;1.01;0.58;0.57;0.58;0.58;0.57;1.01	4.84	-1.52	0.08637	.	0.542064	0.21742	N	0.069803	T	0.19485	0.0468	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.0;0.001;0.001;0.001;0.0	T	0.12319	-1.0552	10	0.08179	T	0.78	-0.0412	1.6058	0.02684	0.179:0.3014:0.3213:0.1984	.	302;447;458;398;409;545;556;593;604	B1P2N9;B1P2N6;B1P2N5;B1P2N8;B1P2N7;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;.;.;.;NUMB_HUMAN	A	545;556;593;604;460;604;593;556;409;458;447;398;593	ENSP00000452416:T545A;ENSP00000348644:T556A;ENSP00000451117:T593A;ENSP00000451300:T604A;ENSP00000451513:T460A;ENSP00000347169:T604A;ENSP00000352563:T593A;ENSP00000451625:T556A;ENSP00000446001:T409A;ENSP00000394025:T458A;ENSP00000452069:T447A;ENSP00000450817:T398A;ENSP00000441258:T593A	ENSP00000347169:T604A	T	-	1	0	NUMB	72813185	0.000000	0.05858	0.532000	0.27989	0.075000	0.17131	-0.194000	0.09559	-0.032000	0.13758	-0.429000	0.05907	ACA		0.522	NUMB-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414416.1		
NPRL3	8131	broad.mit.edu	37	16	150411	150411	+	Silent	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr16:150411C>T	ENST00000399953.3	-	7	1128	c.726G>A	c.(724-726)ctG>ctA	p.L242L	NPRL3_ENST00000399951.3_Silent_p.L63L|NPRL3_ENST00000405960.3_5'UTR	NM_001077350.2|NM_001243247.1|NM_001243248.1|NM_001243249.1	NP_001070818.1|NP_001230176.1|NP_001230177.1|NP_001230178.1	Q12980	NPRL3_HUMAN	nitrogen permease regulator-like 3 (S. cerevisiae)	242					aorta morphogenesis (GO:0035909)|cardiac muscle tissue development (GO:0048738)|palate development (GO:0060021)|ventricular septum development (GO:0003281)		GTPase activator activity (GO:0005096)	p.L242L(1)		endometrium(1)|large_intestine(3)|ovary(2)	6						CTGGGGGGATCAGACTGGAGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	16											37.0	44.0	42.0					16																	150411		2011	4165	6176	90411	SO:0001819	synonymous_variant	8131				CCDS73794.1, CCDS73795.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000103148	ENSG00000103148			14124	protein-coding gene	gene with protein product	"""conserved gene telomeric to alpha globin cluster"""	600928	"""chromosome 16 open reading frame 35"""	C16orf35		8575760	Standard	NM_001243247		Approved	CGTHBA, RMD11, NPR3, MARE, HS-40	uc002cfr.3	Q12980	OTTHUMG00000047792	ENST00000399953.3:c.726G>A	16.37:g.150411C>T		Somatic		Capture	Illumina GAIIx	Phase_I	90411	D3DU40|Q1W6H0|Q4TT56|Q92469	Silent	SNP	ENST00000399953.3	37																																																																																					0.627	NPRL3-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001039476	
ZSCAN32	54925	broad.mit.edu	37	16	3440120	3440120	+	Missense_Mutation	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr16:3440120C>T	ENST00000396852.4	-	5	948	c.641G>A	c.(640-642)cGt>cAt	p.R214H	ZSCAN32_ENST00000304926.3_Missense_Mutation_p.R2H|ZSCAN32_ENST00000574940.1_Missense_Mutation_p.R214H|ZSCAN32_ENST00000422427.2_Missense_Mutation_p.R2H|ZSCAN32_ENST00000396846.3_Missense_Mutation_p.R214H|ZSCAN32_ENST00000573830.1_Intron|ZSCAN32_ENST00000439568.2_Intron	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	214	KRAB.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R2H(1)									TCTGTTGTCACGCATGGCTGG	0.567																																																1	Substitution - Missense(1)	ovary(1)	16											67.0	47.0	54.0					16																	3440120		2197	4300	6497	3380121	SO:0001583	missense	54925			AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.641G>A	16.37:g.3440120C>T	ENSP00000380061:p.Arg214His	Somatic		Capture	Illumina GAIIx	Phase_I	3380121	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Missense_Mutation	SNP	ENST00000396852.4	37		.	.	.	.	.	.	.	.	.	.	C	3.452	-0.111784	0.06881	.	.	ENSG00000140987	ENST00000304926;ENST00000396852;ENST00000396846;ENST00000418960;ENST00000422427	T;T;T;T	0.19394	2.99;5.69;5.69;2.15	2.99	2.01	0.26516	.	.	.	.	.	T	0.08133	0.0203	N	0.08118	0	0.09310	N	0.999997	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.37056	-0.9722	9	0.15066	T	0.55	.	3.0021	0.06017	0.2714:0.5748:0.0:0.1538	.	2;213;2;214	B4DR24;Q9BU74;Q9NX65;Q6WMU8	.;.;ZN434_HUMAN;.	H	2;214;214;213;2	ENSP00000302502:R2H;ENSP00000380061:R214H;ENSP00000380057:R214H;ENSP00000407312:R2H	ENSP00000302502:R2H	R	-	2	0	ZNF434	3380121	0.000000	0.05858	0.263000	0.24496	0.105000	0.19272	-0.190000	0.09615	1.189000	0.43028	0.467000	0.42956	CGT		0.567	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251509.2	NM_017810	
ERCC4	2072	broad.mit.edu	37	16	14029536	14029536	+	Missense_Mutation	SNP	G	G	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr16:14029536G>A	ENST00000311895.7	+	8	1756	c.1747G>A	c.(1747-1749)Gca>Aca	p.A583T	CTD-2135D7.2_ENST00000570663.1_RNA|CTD-2135D7.2_ENST00000575137.1_RNA	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	583					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.A583T(1)		NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						TCTTTATGACGCAGAGCTAAC	0.493			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	1	Substitution - Missense(1)	ovary(1)	16											78.0	77.0	77.0					16																	14029536		2197	4300	6497	13937037	SO:0001583	missense	2072	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.1747G>A	16.37:g.14029536G>A	ENSP00000310520:p.Ala583Thr	Somatic		Capture	Illumina GAIIx	Phase_I	13937037	A5PKV6|A8K111|O00140|Q8TD83	Missense_Mutation	SNP	ENST00000311895.7	37	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617095	0.46736	.	.	ENSG00000175595	ENST00000311895;ENST00000389138	T	0.61859	0.07	5.33	4.38	0.52667	.	0.050978	0.85682	D	0.000000	T	0.56731	0.2005	M	0.71581	2.175	0.53688	D	0.999975	D	0.58268	0.982	P	0.47075	0.536	T	0.55560	-0.8122	10	0.19590	T	0.45	-16.9429	8.4473	0.32849	0.0776:0.0:0.7699:0.1525	.	583	Q92889	XPF_HUMAN	T	583;572	ENSP00000310520:A583T	ENSP00000310520:A583T	A	+	1	0	ERCC4	13937037	1.000000	0.71417	0.303000	0.25071	0.834000	0.47266	5.253000	0.65452	1.382000	0.46385	-0.229000	0.12294	GCA		0.493	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236	
GGA2	23062	broad.mit.edu	37	16	23481341	23481341	+	Silent	SNP	G	G	T	rs200357653		TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr16:23481341G>T	ENST00000309859.4	-	15	1678	c.1596C>A	c.(1594-1596)atC>atA	p.I532I	GGA2_ENST00000567468.1_Intron	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	532	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)	p.I532I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		CTTGAAACATGATATCCCAGA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	16											87.0	80.0	83.0					16																	23481341		2197	4300	6497	23388842	SO:0001819	synonymous_variant	23062			AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.1596C>A	16.37:g.23481341G>T		Somatic		Capture	Illumina GAIIx	Phase_I	23388842	D3DWF0|O14564|Q9NYN2|Q9UPS2	Silent	SNP	ENST00000309859.4	37	CCDS10611.1																																																																																				0.537	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		
CLUH	23277	broad.mit.edu	37	17	2604478	2604478	+	Missense_Mutation	SNP	G	G	C			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr17:2604478G>C	ENST00000570628.2	-	7	972	c.867C>G	c.(865-867)atC>atG	p.I289M	CLUH_ENST00000538975.1_Missense_Mutation_p.I289M|CLUH_ENST00000435359.1_Missense_Mutation_p.I289M			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	289					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)		p.I289M(1)									AGGTCGGGCTGATCTGGTTGA	0.602																																																1	Substitution - Missense(1)	ovary(1)	17											39.0	41.0	40.0					17																	2604478		2004	4156	6160	2551228	SO:0001583	missense	23277			AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.867C>G	17.37:g.2604478G>C	ENSP00000458986:p.Ile289Met	Somatic		Capture	Illumina GAIIx	Phase_I	2551228	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	37	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667161	0.67814	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	D;D	0.82167	-1.58;-1.58	4.65	4.65	0.58169	GSKIP/TIF31 domain (1);	0.047687	0.85682	D	0.000000	D	0.86535	0.5956	M	0.85630	2.765	0.80722	D	1	B;B	0.33477	0.413;0.248	B;B	0.38106	0.265;0.206	D	0.87978	0.2741	10	0.56958	D	0.05	.	16.719	0.85405	0.0:0.0:1.0:0.0	.	289;289	O75153;C9J6D7	K0664_HUMAN;.	M	289	ENSP00000388872:I289M;ENSP00000439628:I289M	ENSP00000320468:I289M	I	-	3	3	KIAA0664	2551228	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.260000	0.95568	2.409000	0.81822	0.655000	0.94253	ATC		0.602	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	17	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	7518263	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln	Somatic		Capture	Illumina GAIIx	Phase_I	7518263	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MBTD1	54799	broad.mit.edu	37	17	49270165	49270165	+	Silent	SNP	T	T	C			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr17:49270165T>C	ENST00000586178.1	-	15	2011	c.1668A>G	c.(1666-1668)caA>caG	p.Q556Q	MBTD1_ENST00000415868.1_Silent_p.Q556Q|MBTD1_ENST00000376381.2_3'UTR	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	556					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.Q392Q(2)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			GAGGCTGTAGTTGATATCCAG	0.423																																																2	Substitution - coding silent(2)	ovary(1)|skin(1)	17											162.0	150.0	154.0					17																	49270165		2203	4300	6503	46625164	SO:0001819	synonymous_variant	54799			AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.1668A>G	17.37:g.49270165T>C		Somatic		Capture	Illumina GAIIx	Phase_I	46625164	Q6ZVU7|Q9NXU1	Silent	SNP	ENST00000586178.1	37	CCDS11581.2																																																																																				0.423	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318124.1		
TXNDC2	84203	broad.mit.edu	37	18	9887220	9887220	+	Silent	SNP	G	G	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr18:9887220G>A	ENST00000306084.6	+	2	943	c.744G>A	c.(742-744)caG>caA	p.Q248Q	TXNDC2_ENST00000357775.5_Silent_p.Q181Q|TXNDC2_ENST00000536353.2_Intron	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	248	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)	p.Q181Q(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						AAACCATCCAGCCCAAGGAGG	0.582																																																1	Substitution - coding silent(1)	ovary(1)	18											136.0	133.0	134.0					18																	9887220		2203	4300	6503	9877220	SO:0001819	synonymous_variant	84203			AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.744G>A	18.37:g.9887220G>A		Somatic		Capture	Illumina GAIIx	Phase_I	9877220	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Silent	SNP	ENST00000306084.6	37	CCDS42414.1																																																																																				0.582	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
CEP192	55125	broad.mit.edu	37	18	13059273	13059273	+	Missense_Mutation	SNP	G	G	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr18:13059273G>A	ENST00000325971.8	+	19	4255	c.2662G>A	c.(2662-2664)Gtc>Atc	p.V888I	CEP192_ENST00000430049.2_Missense_Mutation_p.V1009I|CEP192_ENST00000506447.1_Missense_Mutation_p.V1484I			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	888					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)	p.V888I(1)		NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GGCCAGCACCGTCACTCTCAC	0.458																																																1	Substitution - Missense(1)	ovary(1)	18											148.0	136.0	140.0					18																	13059273		2203	4300	6503	13049273	SO:0001583	missense	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.2662G>A	18.37:g.13059273G>A	ENSP00000317156:p.Val888Ile	Somatic		Capture	Illumina GAIIx	Phase_I	13049273	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37		.	.	.	.	.	.	.	.	.	.	G	18.33	3.601079	0.66332	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.80653	-1.4;-1.4;-1.4	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000001	D	0.89760	0.6808	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.962;0.996	D	0.90832	0.4717	10	0.87932	D	0	-15.641	18.8382	0.92171	0.0:0.0:1.0:0.0	.	1009;1484;888	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	I	1484;888;888;1009	ENSP00000427550:V1484I;ENSP00000317156:V888I;ENSP00000389190:V1009I	ENSP00000317156:V888I	V	+	1	0	CEP192	13049273	1.000000	0.71417	0.586000	0.28679	0.022000	0.10575	9.136000	0.94489	2.520000	0.84964	0.591000	0.81541	GTC		0.458	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
ZNF846	162993	broad.mit.edu	37	19	9868185	9868185	+	Missense_Mutation	SNP	T	T	C			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr19:9868185T>C	ENST00000397902.2	-	6	1981	c.1568A>G	c.(1567-1569)aAa>aGa	p.K523R	ZNF846_ENST00000586293.1_3'UTR|ZNF846_ENST00000588267.1_Intron|ZNF846_ENST00000592859.1_Intron	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	523					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K523R(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						TCTTAGATGTTTAGCAAGTGC	0.363																																																1	Substitution - Missense(1)	ovary(1)	19											151.0	158.0	156.0					19																	9868185		2030	4210	6240	9729185	SO:0001583	missense	162993			AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.1568A>G	19.37:g.9868185T>C	ENSP00000380999:p.Lys523Arg	Somatic		Capture	Illumina GAIIx	Phase_I	9729185	A8K0H1|B3KUP1	Missense_Mutation	SNP	ENST00000397902.2	37	CCDS42496.1	.	.	.	.	.	.	.	.	.	.	.	7.610	0.674522	0.14841	.	.	ENSG00000196605	ENST00000397902	T	0.07567	3.18	1.58	1.58	0.23477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04048	0.0113	N	0.11870	0.19	0.09310	N	1	B	0.22346	0.068	B	0.12837	0.008	T	0.45249	-0.9274	9	0.13853	T	0.58	.	7.2454	0.26119	0.0:0.0:0.0:1.0	.	523	Q147U1	ZN846_HUMAN	R	523	ENSP00000380999:K523R	ENSP00000380999:K523R	K	-	2	0	ZNF846	9729185	0.000000	0.05858	0.139000	0.22197	0.922000	0.55478	-0.908000	0.04063	0.998000	0.38996	0.374000	0.22700	AAA		0.363	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450253.1	NM_001077624	
ZNF14	7561	broad.mit.edu	37	19	19823594	19823594	+	Missense_Mutation	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr19:19823594C>T	ENST00000344099.3	-	4	634	c.496G>A	c.(496-498)Gtg>Atg	p.V166M		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	166					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V166M(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				TAGGGCTTCACTCCAGTGTGA	0.398																																																1	Substitution - Missense(1)	ovary(1)	19											130.0	122.0	125.0					19																	19823594		2203	4300	6503	19684594	SO:0001583	missense	7561			AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.496G>A	19.37:g.19823594C>T	ENSP00000340514:p.Val166Met	Somatic		Capture	Illumina GAIIx	Phase_I	19684594	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	ENST00000344099.3	37	CCDS12409.1	.	.	.	.	.	.	.	.	.	.	C	9.647	1.140485	0.21205	.	.	ENSG00000105708	ENST00000344099	T	0.18338	2.22	1.79	0.644	0.17776	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15262	0.0368	L	0.49455	1.56	0.20196	N	0.999927	B	0.21753	0.06	B	0.20955	0.032	T	0.26608	-1.0098	9	0.87932	D	0	.	6.2405	0.20787	0.0:0.8209:0.0:0.1791	.	166	P17017	ZNF14_HUMAN	M	166	ENSP00000340514:V166M	ENSP00000340514:V166M	V	-	1	0	ZNF14	19684594	0.504000	0.26123	0.003000	0.11579	0.021000	0.10359	2.718000	0.47236	0.072000	0.16694	0.460000	0.39030	GTG		0.398	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
KCNN4	3783	broad.mit.edu	37	19	44284855	44284855	+	Splice_Site	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr19:44284855C>T	ENST00000262888.3	-	1	554	c.159G>A	c.(157-159)tcG>tcA	p.S53S		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	53					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)	p.S53S(1)		biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	CCCCACTCACCGAGCACCCCC	0.657																																																1	Substitution - coding silent(1)	ovary(1)	19											115.0	104.0	107.0					19																	44284855		2203	4300	6503	48976695	SO:0001630	splice_region_variant	3783			AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.159+1G>A	19.37:g.44284855C>T		Somatic		Capture	Illumina GAIIx	Phase_I	48976695	Q53XR4	Silent	SNP	ENST00000262888.3	37	CCDS12630.1																																																																																				0.657	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463598.1	NM_002250	Silent
ZC3H4	23211	broad.mit.edu	37	19	47570525	47570525	+	Silent	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr19:47570525C>T	ENST00000253048.5	-	15	3037	c.3000G>A	c.(2998-3000)gcG>gcA	p.A1000A	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1000							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A1000A(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		ATTGCAGGGCCGCGGGCACGG	0.736																																																1	Substitution - coding silent(1)	ovary(1)	19											28.0	33.0	31.0					19																	47570525		1941	4100	6041	52262365	SO:0001819	synonymous_variant	23211			AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.3000G>A	19.37:g.47570525C>T		Somatic		Capture	Illumina GAIIx	Phase_I	52262365	Q9Y420	Silent	SNP	ENST00000253048.5	37	CCDS42582.1																																																																																				0.736	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466667.1		
NLRP11	204801	broad.mit.edu	37	19	56307617	56307617	+	Splice_Site	SNP	C	C	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr19:56307617C>A	ENST00000589093.1	-	6	2265		c.e6-1		NLRP11_ENST00000443188.1_Splice_Site|NLRP11_ENST00000592953.1_Splice_Site|NLRP11_ENST00000360133.3_Splice_Site|NLRP11_ENST00000589824.2_Splice_Site			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11								ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.?(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TTTCATCAAGCTGTAAGAGGA	0.428																																																1	Unknown(1)	ovary(1)	19											72.0	70.0	71.0					19																	56307617		2203	4300	6503	60999429	SO:0001630	splice_region_variant	204801			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.2172-1G>T	19.37:g.56307617C>A		Somatic		Capture	Illumina GAIIx	Phase_I	60999429	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Splice_Site	SNP	ENST00000589093.1	37	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	C	7.178	0.588922	0.13812	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	.	.	.	2.38	2.38	0.29361	.	.	.	.	.	.	.	.	.	.	.	0.35478	D	0.797927	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.356	0.32331	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NLRP11	60999429	0.016000	0.18221	0.022000	0.16811	0.014000	0.08584	1.022000	0.30052	1.634000	0.50500	0.655000	0.94253	.		0.428	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	Intron
PTPN4	5775	broad.mit.edu	37	2	120723097	120723097	+	Missense_Mutation	SNP	C	C	G			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr2:120723097C>G	ENST00000263708.2	+	25	3205	c.2434C>G	c.(2434-2436)Cag>Gag	p.Q812E	PTPN4_ENST00000544261.1_Missense_Mutation_p.Q445E	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	812	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)	p.Q812E(1)		endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	TCCACTCACTCAGATCCAGTA	0.388																																																1	Substitution - Missense(1)	ovary(1)	2											127.0	109.0	115.0					2																	120723097		2203	4300	6503	120439567	SO:0001583	missense	5775				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.2434C>G	2.37:g.120723097C>G	ENSP00000263708:p.Gln812Glu	Somatic		Capture	Illumina GAIIx	Phase_I	120439567	B2RBV8|Q9UDA7	Missense_Mutation	SNP	ENST00000263708.2	37	CCDS2129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.1|27.1	4.804393|4.804393	0.90623|0.90623	.|.	.|.	ENSG00000088179|ENSG00000088179	ENST00000263708;ENST00000544261|ENST00000441089	T;T|.	0.15952|.	2.38;2.38|.	5.72|5.72	5.72|5.72	0.89469|0.89469	Protein-tyrosine phosphatase, receptor/non-receptor type (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.88138|.	0.6356|.	H|H	0.95816|0.95816	3.725|3.725	0.80722|0.80722	D|D	1|1	D|.	0.63880|.	0.993|.	D|.	0.75484|.	0.986|.	D|.	0.90958|.	0.4810|.	10|.	0.87932|.	D|.	0|.	.|.	19.8965|19.8965	0.96963|0.96963	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	812|.	P29074|.	PTN4_HUMAN|.	E|X	812;445|95	ENSP00000263708:Q812E;ENSP00000445841:Q445E|.	ENSP00000263708:Q812E|.	Q|S	+|+	1|2	0|0	PTPN4|PTPN4	120439567|120439567	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	7.625000|7.625000	0.83145|0.83145	2.717000|2.717000	0.92951|0.92951	0.655000|0.655000	0.94253|0.94253	CAG|TCA		0.388	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254233.2		
AGPS	8540	broad.mit.edu	37	2	178301755	178301755	+	Silent	SNP	C	C	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr2:178301755C>A	ENST00000264167.4	+	5	756	c.610C>A	c.(610-612)Cga>Aga	p.R204R	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	204	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)	p.R204R(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			AATGTTTGAGCGAATTCCTGA	0.303																																																1	Substitution - coding silent(1)	ovary(1)	2											126.0	133.0	130.0					2																	178301755		2203	4300	6503	178010001	SO:0001819	synonymous_variant	8540			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.610C>A	2.37:g.178301755C>A		Somatic		Capture	Illumina GAIIx	Phase_I	178010001	A5D8U9|Q2TU35	Silent	SNP	ENST00000264167.4	37	CCDS2275.1																																																																																				0.303	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255730.2		
CST7	8530	broad.mit.edu	37	20	24937932	24937932	+	Missense_Mutation	SNP	C	C	A	rs369955079		TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr20:24937932C>A	ENST00000480798.1	+	2	356	c.80C>A	c.(79-81)tCc>tAc	p.S27Y	CST7_ENST00000376835.2_Missense_Mutation_p.S49Y	NM_003650.3	NP_003641.3	O76096	CYTF_HUMAN	cystatin F (leukocystatin)	27					immune response (GO:0006955)|negative regulation of endopeptidase activity (GO:0010951)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)	p.S49Y(1)		large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	5						GATACTTGTTCCCAGGACCTT	0.478																																																1	Substitution - Missense(1)	ovary(1)	20											273.0	271.0	271.0					20																	24937932		2203	4300	6503	24885932	SO:0001583	missense	8530			AF036342	CCDS13165.1, CCDS13165.2	20p11.21	2008-04-15			ENSG00000077984	ENSG00000077984			2479	protein-coding gene	gene with protein product		603253				9733783, 9632704	Standard	NM_003650		Approved		uc002wtx.2	O76096	OTTHUMG00000032108	ENST00000480798.1:c.80C>A	20.37:g.24937932C>A	ENSP00000420384:p.Ser27Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	24885932	Q6FH95|Q7Z4J8|Q9UED4	Missense_Mutation	SNP	ENST00000480798.1	37	CCDS13165.2	.	.	.	.	.	.	.	.	.	.	c	9.694	1.152711	0.21371	.	.	ENSG00000077984	ENST00000480798;ENST00000376835	T;T	0.09255	3.03;3.0	4.28	0.887	0.19200	.	0.225382	0.39341	N	0.001398	T	0.05593	0.0147	L	0.34521	1.04	0.09310	N	1	P	0.48350	0.909	B	0.36845	0.234	T	0.35919	-0.9769	10	0.59425	D	0.04	-24.3586	2.3246	0.04220	0.2277:0.4141:0.0:0.3581	.	27	O76096	CYTF_HUMAN	Y	27;49	ENSP00000420384:S27Y;ENSP00000366031:S49Y	ENSP00000366031:S49Y	S	+	2	0	CST7	24885932	0.000000	0.05858	0.083000	0.20561	0.086000	0.17979	0.025000	0.13577	0.397000	0.25310	0.506000	0.49869	TCC		0.478	CST7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078381.2	NM_003650	
ASXL1	171023	broad.mit.edu	37	20	30956917	30956917	+	Silent	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr20:30956917C>T	ENST00000375687.4	+	4	667	c.243C>T	c.(241-243)ttC>ttT	p.F81F	ASXL1_ENST00000542461.1_Silent_p.F80F|ASXL1_ENST00000470145.1_3'UTR|ASXL1_ENST00000306058.5_Silent_p.F76F|ASXL1_ENST00000375689.1_Silent_p.F77F	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	81					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.F81F(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						TCAGCCTTTTCACGCTCAAGG	0.458			"""F, N, Mis"""		"""MDS, CMML"""																																		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	1	Substitution - coding silent(1)	ovary(1)	20											151.0	132.0	138.0					20																	30956917		2203	4300	6503	30420578	SO:0001819	synonymous_variant	171023			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.243C>T	20.37:g.30956917C>T		Somatic		Capture	Illumina GAIIx	Phase_I	30420578	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	C	9.253	1.041339	0.19669	.	.	ENSG00000171456	ENST00000497249	.	.	.	5.22	2.16	0.27623	.	.	.	.	.	T	0.55673	0.1935	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49322	-0.8952	4	.	.	.	-15.5376	7.8061	0.29202	0.0:0.7173:0.0:0.2827	.	.	.	.	Y	70	.	.	H	+	1	0	ASXL1	30420578	0.982000	0.34865	1.000000	0.80357	0.997000	0.91878	0.135000	0.15952	0.744000	0.32741	0.643000	0.83706	CAC		0.458	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
SS18L1	26039	broad.mit.edu	37	20	60749624	60749624	+	Missense_Mutation	SNP	G	G	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr20:60749624G>A	ENST00000331758.3	+	10	1114	c.1088G>A	c.(1087-1089)gGc>gAc	p.G363D	SS18L1_ENST00000370848.4_Missense_Mutation_p.G366D|SS18L1_ENST00000421564.1_Missense_Mutation_p.G363D	NM_198935.1	NP_945173.1	O75177	CREST_HUMAN	synovial sarcoma translocation gene on chromosome 18-like 1	363	Gln-rich.|Necessary for nuclear localization. {ECO:0000250}.				chromatin modification (GO:0016568)|dendrite development (GO:0016358)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of dendrite development (GO:0050773)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|kinetochore (GO:0000776)|nuclear body (GO:0016604)|nucleus (GO:0005634)		p.G363D(1)	SS18L1/SSX1(2)	ovary(2)|skin(1)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			CAAGGCCAAGGCCAGCAGTAC	0.622			T	SSX1	synovial sarcoma																																		Dom	yes		20	20q13.3	26039	synovial sarcoma translocation gene on chromosome 18-like 1		M	1	Substitution - Missense(1)	ovary(1)	20											81.0	87.0	85.0					20																	60749624		2203	4300	6503	60183019	SO:0001583	missense	26039			AB014593	CCDS13491.1	20q13.3	2008-07-28			ENSG00000184402	ENSG00000184402			15592	protein-coding gene	gene with protein product		606472					Standard	XM_005260389		Approved	KIAA0693	uc002ycb.3	O75177	OTTHUMG00000032902	ENST00000331758.3:c.1088G>A	20.37:g.60749624G>A	ENSP00000333012:p.Gly363Asp	Somatic		Capture	Illumina GAIIx	Phase_I	60183019	A6NNE3|A8K620|B3KWR8|E1P5H7|Q5JXJ3|Q6MZV9|Q6NTH3|Q6XYD9|Q8NE69|Q9BR55|Q9H4K6	Missense_Mutation	SNP	ENST00000331758.3	37	CCDS13491.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161584	0.78226	.	.	ENSG00000184402	ENST00000421564;ENST00000331758;ENST00000370848	T;T;T	0.40476	1.03;1.03;1.03	5.02	5.02	0.67125	.	0.115090	0.64402	D	0.000016	T	0.56046	0.1959	L	0.58101	1.795	0.50632	D	0.999888	D;P	0.61697	0.99;0.954	P;B	0.54856	0.762;0.43	T	0.60845	-0.7182	10	0.87932	D	0	-20.1927	18.6966	0.91603	0.0:0.0:1.0:0.0	.	363;363	B4DSR7;O75177	.;CREST_HUMAN	D	363;363;366	ENSP00000393999:G363D;ENSP00000333012:G363D;ENSP00000359885:G366D	ENSP00000333012:G363D	G	+	2	0	SS18L1	60183019	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.358000	0.97109	2.503000	0.84419	0.491000	0.48974	GGC		0.622	SS18L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080004.2		
LTN1	26046	broad.mit.edu	37	21	30324516	30324516	+	Missense_Mutation	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr21:30324516C>T	ENST00000361371.5	-	18	3389	c.3310G>A	c.(3310-3312)Gat>Aat	p.D1104N	LTN1_ENST00000389194.2_Missense_Mutation_p.D1150N			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	1104					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.D1104N(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TTTACTTCATCAGATGAAATG	0.333																																																1	Substitution - Missense(1)	ovary(1)	21											68.0	71.0	70.0					21																	30324516		2202	4300	6502	29246387	SO:0001583	missense	26046			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.3310G>A	21.37:g.30324516C>T	ENSP00000354977:p.Asp1104Asn	Somatic		Capture	Illumina GAIIx	Phase_I	29246387	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	ENST00000361371.5	37		.	.	.	.	.	.	.	.	.	.	C	10.93	1.488769	0.26686	.	.	ENSG00000198862	ENST00000389194;ENST00000361371	T;T	0.17854	2.25;2.26	4.97	4.97	0.65823	.	0.548799	0.19249	N	0.118963	T	0.10380	0.0254	N	0.24115	0.695	0.25871	N	0.983705	B	0.17667	0.023	B	0.15870	0.014	T	0.23084	-1.0198	10	0.16896	T	0.51	.	8.5013	0.33159	0.2414:0.6137:0.1449:0.0	.	1104	O94822	LTN1_HUMAN	N	1150;1104	ENSP00000373846:D1150N;ENSP00000354977:D1104N	ENSP00000354977:D1104N	D	-	1	0	LTN1	29246387	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.318000	0.33643	2.729000	0.93468	0.561000	0.74099	GAT		0.333	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
NCAPH2	29781	broad.mit.edu	37	22	50960778	50960778	+	Nonsense_Mutation	SNP	G	G	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr22:50960778G>T	ENST00000420993.2	+	15	1362	c.1240G>T	c.(1240-1242)Gag>Tag	p.E414*	NCAPH2_ENST00000520297.1_3'UTR|NCAPH2_ENST00000299821.11_Nonsense_Mutation_p.E414*|NCAPH2_ENST00000395701.3_Nonsense_Mutation_p.E414*|CTA-384D8.36_ENST00000608319.1_RNA	NM_001185011.1|NM_152299.3	NP_001171940.1|NP_689512.2	Q6IBW4	CNDH2_HUMAN	non-SMC condensin II complex, subunit H2	414					chromosome condensation (GO:0030261)|mitotic cell cycle (GO:0000278)	chromosome (GO:0005694)|membrane (GO:0016020)|nucleoplasm (GO:0005654)		p.E414*(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|lung(10)|ovary(1)|prostate(2)|skin(3)|stomach(1)	24		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		ACAGGTGGCTGAGCAGTGGCT	0.657																																																1	Substitution - Nonsense(1)	ovary(1)	22											59.0	63.0	62.0					22																	50960778		2203	4300	6503	49307644	SO:0001587	stop_gained	29781			BC001937	CCDS14094.2, CCDS43038.1, CCDS54546.1	22q13.33	2008-02-04			ENSG00000025770	ENSG00000025770			25071	protein-coding gene	gene with protein product	"""kleisin beta"", ""CAP-H2 subunit of the condensin II complex"""	611230				10493829	Standard	NM_014551		Approved	384D8-2, hCAP-H2, CAP-H2	uc003blx.4	Q6IBW4	OTTHUMG00000150205	ENST00000420993.2:c.1240G>T	22.37:g.50960778G>T	ENSP00000410088:p.Glu414*	Somatic		Capture	Illumina GAIIx	Phase_I	49307644	B7WPH1|O43788|Q13391|Q96C14|Q96GJ0|Q9BQ71|Q9BUT3|Q9BVD1	Nonsense_Mutation	SNP	ENST00000420993.2	37	CCDS14094.2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.094683	0.76870	.	.	ENSG00000025770	ENST00000420993;ENST00000395701;ENST00000299821	.	.	.	5.1	-0.853	0.10709	.	2.754930	0.01518	N	0.018235	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	0.039	4.7686	0.13144	0.3271:0.276:0.3969:0.0	.	.	.	.	X	414	.	ENSP00000299821:E414X	E	+	1	0	NCAPH2	49307644	0.095000	0.21747	0.000000	0.03702	0.041000	0.13682	0.124000	0.15728	-0.315000	0.08703	-0.469000	0.05056	GAG		0.657	NCAPH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317012.1	NM_152299	
ZMAT3	64393	broad.mit.edu	37	3	178785321	178785321	+	Missense_Mutation	SNP	G	G	C			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr3:178785321G>C	ENST00000311417.2	-	2	961	c.220C>G	c.(220-222)Ctc>Gtc	p.L74V	ZMAT3_ENST00000432729.1_Missense_Mutation_p.L74V	NM_022470.3	NP_071915.1			zinc finger, matrin-type 3									p.L74V(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(1)|skin(1)	14	all_cancers(143;3.31e-18)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;6.74e-27)|GBM - Glioblastoma multiforme(14;0.00448)|BRCA - Breast invasive adenocarcinoma(182;0.0527)			ACATTGCAGAGTTTGCAGTAC	0.517																																																1	Substitution - Missense(1)	ovary(1)	3											163.0	158.0	160.0					3																	178785321		2203	4300	6503	180268015	SO:0001583	missense	64393			AK122768	CCDS3224.1, CCDS46962.1	3q26.32	2012-10-05	2010-09-15		ENSG00000172667	ENSG00000172667		"""Zinc fingers, matrin-type"""	29983	protein-coding gene	gene with protein product		606452				9400996, 11689294	Standard	NM_022470		Approved	WIG1, MGC10613, FLJ12296, WIG-1, PAG608	uc003fjg.3	Q9HA38	OTTHUMG00000157290	ENST00000311417.2:c.220C>G	3.37:g.178785321G>C	ENSP00000311221:p.Leu74Val	Somatic		Capture	Illumina GAIIx	Phase_I	180268015		Missense_Mutation	SNP	ENST00000311417.2	37	CCDS3224.1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231015	0.58777	.	.	ENSG00000172667	ENST00000311417;ENST00000432729;ENST00000414084	T;T;T	0.24151	1.87;1.87;1.87	5.86	5.86	0.93980	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);	0.000000	0.85682	D	0.000000	T	0.40694	0.1127	L	0.37800	1.135	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.87578	0.996;0.998	T	0.04005	-1.0985	10	0.08179	T	0.78	-13.2241	20.1931	0.98233	0.0:0.0:1.0:0.0	.	74;74	Q9HA38-2;Q9HA38	.;ZMAT3_HUMAN	V	74	ENSP00000311221:L74V;ENSP00000396506:L74V;ENSP00000398920:L74V	ENSP00000311221:L74V	L	-	1	0	ZMAT3	180268015	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.529000	0.81952	2.771000	0.95319	0.563000	0.77884	CTC		0.517	ZMAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348336.2	NM_152240	
NPFFR2	10886	broad.mit.edu	37	4	72994447	72994447	+	Missense_Mutation	SNP	A	A	G			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr4:72994447A>G	ENST00000308744.6	+	2	543	c.445A>G	c.(445-447)Atc>Gtc	p.I149V	NPFFR2_ENST00000395999.1_Missense_Mutation_p.I50V|NPFFR2_ENST00000358749.3_Missense_Mutation_p.I47V|NPFFR2_ENST00000344413.5_Intron	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	149					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)	p.I149V(1)		NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			AGTGGCAGCAATCTTCATTAT	0.378																																																1	Substitution - Missense(1)	ovary(1)	4											211.0	184.0	193.0					4																	72994447		2203	4300	6503	73213311	SO:0001583	missense	10886			AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.445A>G	4.37:g.72994447A>G	ENSP00000307822:p.Ile149Val	Somatic		Capture	Illumina GAIIx	Phase_I	73213311	Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	A	2.101	-0.406060	0.04832	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.36878	1.23;1.23;1.23	5.9	-8.38	0.00973	.	0.783752	0.11492	N	0.558592	T	0.17109	0.0411	N	0.05306	-0.075	0.19575	N	0.999968	B;B	0.09022	0.001;0.002	B;B	0.09377	0.003;0.004	T	0.29336	-1.0015	10	0.13470	T	0.59	.	22.188	0.99968	0.2312:0.0:0.7688:0.0	.	50;149	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	V	149;50;47	ENSP00000307822:I149V;ENSP00000379321:I50V;ENSP00000351599:I47V	ENSP00000307822:I149V	I	+	1	0	NPFFR2	73213311	0.000000	0.05858	0.002000	0.10522	0.821000	0.46438	-0.985000	0.03751	-1.524000	0.01764	0.528000	0.53228	ATC		0.378	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885	
CDH10	1008	broad.mit.edu	37	5	24488157	24488157	+	Missense_Mutation	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr5:24488157C>T	ENST00000264463.4	-	12	2489	c.1982G>A	c.(1981-1983)gGt>gAt	p.G661D	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	661					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G661D(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		CTCTCCACCACCCTCATCGTT	0.463										HNSCC(23;0.051)																																						1	Substitution - Missense(1)	ovary(1)	5											64.0	66.0	65.0					5																	24488157		2203	4300	6503	24523914	SO:0001583	missense	1008			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1982G>A	5.37:g.24488157C>T	ENSP00000264463:p.Gly661Asp	Somatic		Capture	Illumina GAIIx	Phase_I	24523914	Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.815241	0.70912	.	.	ENSG00000040731	ENST00000264463	D	0.86030	-2.06	5.46	5.46	0.80206	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.95497	0.8537	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96987	0.9719	10	0.87932	D	0	.	18.2978	0.90153	0.0:1.0:0.0:0.0	.	661	Q9Y6N8	CAD10_HUMAN	D	661	ENSP00000264463:G661D	ENSP00000264463:G661D	G	-	2	0	CDH10	24523914	1.000000	0.71417	0.799000	0.32177	0.592000	0.36648	7.657000	0.83745	2.580000	0.87095	0.655000	0.94253	GGT		0.463	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
ACTBL2	345651	broad.mit.edu	37	5	56777932	56777932	+	Missense_Mutation	SNP	G	G	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr5:56777932G>T	ENST00000423391.1	-	1	704	c.603C>A	c.(601-603)ttC>ttA	p.F201L	CTD-2023N9.1_ENST00000506106.1_RNA|AC025470.1_ENST00000584598.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	201						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.F201L(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		CAGTGGTGGTGAAGTTATAGC	0.542																																																1	Substitution - Missense(1)	ovary(1)	5											102.0	83.0	89.0					5																	56777932		2203	4300	6503	56813689	SO:0001583	missense	345651				CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.603C>A	5.37:g.56777932G>T	ENSP00000416706:p.Phe201Leu	Somatic		Capture	Illumina GAIIx	Phase_I	56813689	B2RPJ1|Q562R2|Q562S9|Q562X8	Missense_Mutation	SNP	ENST00000423391.1	37	CCDS34163.1	.	.	.	.	.	.	.	.	.	.	G	7.605	0.673527	0.14776	.	.	ENSG00000169067	ENST00000423391	D	0.94497	-3.44	4.91	3.13	0.36017	.	0.000000	0.64402	D	0.000002	D	0.95198	0.8443	L	0.54908	1.71	0.38240	D	0.941283	B	0.25206	0.12	P	0.46758	0.526	D	0.93445	0.6797	10	0.87932	D	0	.	12.6888	0.56962	0.1333:0.0:0.8667:0.0	.	201	Q562R1	ACTBL_HUMAN	L	201	ENSP00000416706:F201L	ENSP00000416706:F201L	F	-	3	2	ACTBL2	56813689	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	4.736000	0.62059	0.284000	0.22305	-1.731000	0.00696	TTC		0.542	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368579.1	NM_001017992	
ACTBL2	345651	broad.mit.edu	37	5	56778051	56778051	+	Missense_Mutation	SNP	G	G	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr5:56778051G>T	ENST00000423391.1	-	1	585	c.484C>A	c.(484-486)Cac>Aac	p.H162N	CTD-2023N9.1_ENST00000506106.1_RNA|AC025470.1_ENST00000584598.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	162				H -> L (in Ref. 4; AAX82259). {ECO:0000305}.		cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.H162N(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		GGCACGATGTGAGTGACCCCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	5											103.0	88.0	93.0					5																	56778051		2203	4300	6503	56813808	SO:0001583	missense	345651				CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.484C>A	5.37:g.56778051G>T	ENSP00000416706:p.His162Asn	Somatic		Capture	Illumina GAIIx	Phase_I	56813808	B2RPJ1|Q562R2|Q562S9|Q562X8	Missense_Mutation	SNP	ENST00000423391.1	37	CCDS34163.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860579	0.51482	.	.	ENSG00000169067	ENST00000423391	T	0.08984	3.03	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000002	T	0.42877	0.1222	H	0.96970	3.915	0.53688	D	0.99997	B	0.23735	0.09	P	0.50570	0.644	T	0.53514	-0.8428	10	0.87932	D	0	.	15.3116	0.74039	0.0:0.0:1.0:0.0	.	162	Q562R1	ACTBL_HUMAN	N	162	ENSP00000416706:H162N	ENSP00000416706:H162N	H	-	1	0	ACTBL2	56813808	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.794000	0.85869	2.452000	0.82932	0.655000	0.94253	CAC		0.552	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368579.1	NM_001017992	
CLVS2	134829	broad.mit.edu	37	6	123319036	123319036	+	Silent	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr6:123319036C>T	ENST00000275162.5	+	2	1449	c.114C>T	c.(112-114)gtC>gtT	p.V38V	CLVS2_ENST00000368438.1_Intron	NM_001010852.3	NP_001010852.2	Q5SYC1	CLVS2_HUMAN	clavesin 2	38					lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)	p.V38V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	40						GGGATATGGTCATCACCAGGC	0.567																																																1	Substitution - coding silent(1)	ovary(1)	6											172.0	140.0	151.0					6																	123319036		2203	4300	6503	123360735	SO:0001819	synonymous_variant	134829			AK095527	CCDS34525.1	6q22.31	2009-10-14	2009-10-14	2009-10-14	ENSG00000146352	ENSG00000146352			23046	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 212"", ""chromosome 6 open reading frame 213"", ""retinaldehyde binding protein 1-like 2"""	C6orf212, C6orf213, RLBP1L2		19651769	Standard	NM_001010852		Approved	bA160A10.4	uc003pzi.1	Q5SYC1	OTTHUMG00000015495	ENST00000275162.5:c.114C>T	6.37:g.123319036C>T		Somatic		Capture	Illumina GAIIx	Phase_I	123360735	B3KTG5|B4DHL0|C8UZT4|Q5SYC0	Silent	SNP	ENST00000275162.5	37	CCDS34525.1																																																																																				0.567	CLVS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042042.2	NM_001010852	
HIVEP2	3097	broad.mit.edu	37	6	143095727	143095727	+	Missense_Mutation	SNP	A	A	G			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr6:143095727A>G	ENST00000367604.1	-	4	788	c.149T>C	c.(148-150)aTa>aCa	p.I50T	HIVEP2_ENST00000012134.2_Missense_Mutation_p.I50T|HIVEP2_ENST00000367603.2_Missense_Mutation_p.I50T			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	50					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I50T(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CTCAGGCTCTATTTGTGGTTG	0.478																																					Esophageal Squamous(107;843 1510 13293 16805 42198)											1	Substitution - Missense(1)	ovary(1)	6											214.0	218.0	217.0					6																	143095727		2068	4217	6285	143137420	SO:0001583	missense	3097			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.149T>C	6.37:g.143095727A>G	ENSP00000356576:p.Ile50Thr	Somatic		Capture	Illumina GAIIx	Phase_I	143137420	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	A	3.593	-0.083115	0.07141	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02395	4.31;4.31;4.31	5.86	3.49	0.39957	.	0.365544	0.31061	N	0.008335	T	0.01387	0.0045	L	0.57536	1.79	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43621	-0.9380	10	0.54805	T	0.06	-3.1552	10.066	0.42303	0.8642:0.0:0.1358:0.0	.	50	P31629	ZEP2_HUMAN	T	50	ENSP00000356576:I50T;ENSP00000356575:I50T;ENSP00000012134:I50T	ENSP00000012134:I50T	I	-	2	0	HIVEP2	143137420	0.875000	0.30112	0.004000	0.12327	0.378000	0.30076	2.149000	0.42244	0.485000	0.27652	0.528000	0.53228	ATA		0.478	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
LAMB4	22798	broad.mit.edu	37	7	107752378	107752378	+	Missense_Mutation	SNP	C	C	T			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr7:107752378C>T	ENST00000388781.3	-	4	289	c.206G>A	c.(205-207)tGc>tAc	p.C69Y	LAMB4_ENST00000414450.2_Missense_Mutation_p.C69Y|LAMB4_ENST00000205386.4_Missense_Mutation_p.C69Y|LAMB4_ENST00000388780.3_Missense_Mutation_p.C69Y|LAMB4_ENST00000418464.1_Missense_Mutation_p.C69Y	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	69	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)		p.C69Y(1)		NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						ACAGATGAAGCATTTTTGTTC	0.343																																																1	Substitution - Missense(1)	ovary(1)	7											148.0	142.0	144.0					7																	107752378		2203	4300	6503	107539614	SO:0001583	missense	22798			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.206G>A	7.37:g.107752378C>T	ENSP00000373433:p.Cys69Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	107539614	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	37	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914104	0.72983	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09	5.28	4.4	0.53042	Laminin, N-terminal (3);	0.000000	0.64402	D	0.000012	D	0.94545	0.8243	M	0.92833	3.35	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	D	0.95702	0.8750	10	0.87932	D	0	.	14.1354	0.65284	0.0:0.9282:0.0:0.0718	.	69	A4D0S4	LAMB4_HUMAN	Y	69	ENSP00000205386:C69Y;ENSP00000373433:C69Y;ENSP00000373432:C69Y;ENSP00000402353:C69Y;ENSP00000402265:C69Y	ENSP00000205386:C69Y	C	-	2	0	LAMB4	107539614	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.442000	0.59988	1.601000	0.50113	0.655000	0.94253	TGC		0.343	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
IQUB	154865	broad.mit.edu	37	7	123101473	123101473	+	Nonsense_Mutation	SNP	G	G	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr7:123101473G>A	ENST00000466202.1	-	11	2521	c.1945C>T	c.(1945-1947)Caa>Taa	p.Q649*	IQUB_ENST00000324698.6_Nonsense_Mutation_p.Q649*|RP11-332K15.1_ENST00000419832.1_RNA	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	649					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)		p.Q649*(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						TAGAGCTGTTGAAGTAAACAT	0.388																																																1	Substitution - Nonsense(1)	ovary(1)	7											102.0	103.0	102.0					7																	123101473		2203	4299	6502	122888709	SO:0001587	stop_gained	154865			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.1945C>T	7.37:g.123101473G>A	ENSP00000417769:p.Gln649*	Somatic		Capture	Illumina GAIIx	Phase_I	122888709	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Nonsense_Mutation	SNP	ENST00000466202.1	37	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	G	38	6.701363	0.97772	.	.	ENSG00000164675	ENST00000466202;ENST00000324698	.	.	.	5.94	2.63	0.31362	.	0.536767	0.21170	N	0.078995	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	4.8354	0.13462	0.0778:0.1118:0.2437:0.5667	.	.	.	.	X	649	.	ENSP00000324882:Q649X	Q	-	1	0	IQUB	122888709	0.299000	0.24426	0.701000	0.30321	0.953000	0.61014	2.307000	0.43682	0.680000	0.31366	0.643000	0.83706	CAA		0.388	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827	
EQTN	54586	broad.mit.edu	37	9	27286331	27286331	+	Missense_Mutation	SNP	T	T	A			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chr9:27286331T>A	ENST00000380032.3	-	7	594	c.511A>T	c.(511-513)Aat>Tat	p.N171Y	EQTN_ENST00000537675.1_Missense_Mutation_p.N142Y	NM_020641.2	NP_065692.2	Q9NQ60	EQTN_HUMAN	equatorin, sperm acrosome associated	171					acrosomal vesicle exocytosis (GO:0060478)|endocytosis (GO:0006897)|fusion of sperm to egg plasma membrane (GO:0007342)	early endosome (GO:0005769)|inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|outer acrosomal membrane (GO:0002081)|plasma membrane (GO:0005886)		p.N171Y(1)									TCTGGCTGATTTTCTCCCTGT	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											143.0	131.0	135.0					9																	27286331		2203	4300	6503	27276331	SO:0001583	missense	54586			AJ278482	CCDS35001.1, CCDS55300.1	9p21	2012-09-20	2012-09-20	2012-09-20	ENSG00000120160	ENSG00000120160			1359	protein-coding gene	gene with protein product	"""Acr formation associated factor"", ""Acrosome formation associated factor"", ""sperm acrosome associated 8"""		"""chromosome 9 open reading frame 11"", ""equatorin"""	C9orf11			Standard	NM_020641		Approved	AFAF, SPACA8, equatorin	uc003zql.3	Q9NQ60	OTTHUMG00000021033	ENST00000380032.3:c.511A>T	9.37:g.27286331T>A	ENSP00000369371:p.Asn171Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	27276331	B2RPB3|B7ZMK1|Q5TCU1|Q96L22	Missense_Mutation	SNP	ENST00000380032.3	37	CCDS35001.1	.	.	.	.	.	.	.	.	.	.	.	15.12	2.738707	0.49045	.	.	ENSG00000120160	ENST00000537675;ENST00000380032	T;T	0.32023	1.47;1.47	4.68	-9.37	0.00626	.	1.194930	0.06424	N	0.722887	T	0.16514	0.0397	L	0.38175	1.15	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.13407	0.009;0.009	T	0.34850	-0.9812	10	0.66056	D	0.02	.	1.2866	0.02052	0.2282:0.3313:0.2525:0.188	.	142;171	B7ZMK1;Q9NQ60	.;AFAF_HUMAN	Y	142;171	ENSP00000441630:N142Y;ENSP00000369371:N171Y	ENSP00000369371:N171Y	N	-	1	0	C9orf11	27276331	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.374000	0.07484	-1.543000	0.01723	0.455000	0.32223	AAT		0.433	EQTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055499.1	NM_020641	
PGK1	5230	broad.mit.edu	37	X	77369244	77369244	+	Missense_Mutation	SNP	T	T	G			TCGA-57-1993-01A-01W-0699-08	TCGA-57-1993-11A-01W-0700-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2fca611b-92c7-4213-85e7-87d8cbd1f5a5	1f2450f1-fa26-4d9d-8947-7fc7c337ea44	g.chrX:77369244T>G	ENST00000373316.4	+	3	287	c.120T>G	c.(118-120)atT>atG	p.I40M	PGK1_ENST00000537456.1_Missense_Mutation_p.I12M|PGK1_ENST00000442431.1_Missense_Mutation_p.I40M	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	40					carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)	p.I40M(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	GTTGCAGGATTAAGGCTGCTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	X											72.0	60.0	64.0					X																	77369244		2203	4300	6503	77255900	SO:0001583	missense	5230			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.120T>G	X.37:g.77369244T>G	ENSP00000362413:p.Ile40Met	Somatic		Capture	Illumina GAIIx	Phase_I	77255900	A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	Missense_Mutation	SNP	ENST00000373316.4	37	CCDS14438.1	.	.	.	.	.	.	.	.	.	.	t	16.71	3.197723	0.58126	.	.	ENSG00000102144	ENST00000373316;ENST00000442431;ENST00000537456	D;D;D	0.94966	-3.57;-3.57;-3.57	4.91	1.15	0.20763	Phosphoglycerate kinase, N-terminal (1);	0.148828	0.64402	D	0.000017	D	0.96741	0.8936	H	0.95365	3.66	0.37715	D	0.924705	P	0.45396	0.857	P	0.54060	0.741	D	0.95643	0.8700	10	0.87932	D	0	-27.897	7.7866	0.29095	0.0:0.5461:0.0:0.4539	.	40	P00558	PGK1_HUMAN	M	40;40;12	ENSP00000362413:I40M;ENSP00000405452:I40M;ENSP00000444708:I12M	ENSP00000362413:I40M	I	+	3	3	PGK1	77255900	1.000000	0.71417	0.995000	0.50966	0.978000	0.69477	0.994000	0.29693	-0.027000	0.13873	-0.291000	0.09656	ATT		0.458	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057310.1		
