#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PDPN	10630	broad.mit.edu	37	1	13937005	13937005	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:13937005T>C	ENST00000509009.1	+	3	354	c.310T>C	c.(310-312)Tcc>Ccc	p.S104P	PDPN_ENST00000513143.1_Missense_Mutation_p.S67P|PDPN_ENST00000376061.4_Missense_Mutation_p.S67P|PDPN_ENST00000376057.4_Missense_Mutation_p.S185P|PDPN_ENST00000475043.1_Missense_Mutation_p.S67P|PDPN_ENST00000487038.1_Missense_Mutation_p.S67P|PDPN_ENST00000294489.6_Missense_Mutation_p.S185P					podoplanin									p.S185P(1)		endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		CACCAGTCACTCCACGGGTAA	0.498																																																1	Substitution - Missense(1)	ovary(1)	1											87.0	83.0	84.0					1																	13937005		2203	4300	6503	13809592	SO:0001583	missense	10630			AB127958, AY194238	CCDS30602.1, CCDS41266.1, CCDS44060.1, CCDS53270.1	1p36.21	2008-02-05			ENSG00000162493	ENSG00000162493			29602	protein-coding gene	gene with protein product	"""lung type I cell membrane associated glycoprotein"""	608863				10393083, 9651190	Standard	NM_006474		Approved	T1A-2, Gp38, aggrus, GP40, PA2.26	uc001avd.3	Q86YL7	OTTHUMG00000007912	ENST00000509009.1:c.310T>C	1.37:g.13937005T>C	ENSP00000422977:p.Ser104Pro	Somatic		Capture	Illumina GAIIx	Phase_I	13809592		Missense_Mutation	SNP	ENST00000509009.1	37		.	.	.	.	.	.	.	.	.	.	T	10.45	1.353575	0.24512	.	.	ENSG00000162493	ENST00000294489;ENST00000376057;ENST00000510906;ENST00000509009;ENST00000376061;ENST00000513143;ENST00000487038;ENST00000475043	T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	4.42	-7.06	0.01568	.	0.868320	0.10210	N	0.702226	T	0.26738	0.0654	L	0.52759	1.655	0.09310	N	1	B;B;B;B	0.20550	0.012;0.012;0.046;0.046	B;B;B;B	0.21546	0.026;0.026;0.035;0.035	T	0.22941	-1.0202	10	0.35671	T	0.21	-31.976	2.3985	0.04395	0.2485:0.4097:0.127:0.2149	.	109;67;185;185	Q86YL7;E9PB68;Q86YL7-3;Q86YL7-4	PDPN_HUMAN;.;.;.	P	185;185;176;104;67;67;67;67	ENSP00000294489:S185P;ENSP00000365225:S185P;ENSP00000426302:S176P;ENSP00000422977:S104P;ENSP00000365229:S67P;ENSP00000425304:S67P;ENSP00000427537:S67P;ENSP00000426063:S67P	ENSP00000294489:S185P	S	+	1	0	PDPN	13809592	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.260000	0.02858	-1.581000	0.01642	0.533000	0.62120	TCC		0.498	PDPN-009	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367736.1	NM_006474	
CSMD2	114784	broad.mit.edu	37	1	34164526	34164526	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:34164526C>A	ENST00000373380.1	-	3	591	c.371G>T	c.(370-372)tGt>tTt	p.C124F	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.C1251F			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1211	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.C1211F(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGGGTCCTCACATTTGATGAG	0.512																																																1	Substitution - Missense(1)	ovary(1)	1											57.0	55.0	55.0					1																	34164526		2203	4300	6503	33937113	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.371G>T	1.37:g.34164526C>A	ENSP00000362478:p.Cys124Phe	Somatic		Capture	Illumina GAIIx	Phase_I	33937113	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373380.1	37		.	.	.	.	.	.	.	.	.	.	C	23.9	4.476535	0.84640	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	D;D	0.99784	-6.74;-6.74	5.76	5.76	0.90799	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.99908	0.9956	H	0.99619	4.66	0.80722	D	1	D;D;D	0.69078	0.991;0.997;0.997	D;D;D	0.73708	0.945;0.981;0.974	D	0.96272	0.9199	10	0.87932	D	0	.	19.3155	0.94211	0.0:1.0:0.0:0.0	.	124;1211;1251	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	F	1251;124	ENSP00000362479:C1251F;ENSP00000362478:C124F	ENSP00000241312:C1211F	C	-	2	0	CSMD2	33937113	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.879000	0.98667	0.650000	0.86243	TGT		0.512	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	
ZFP69B	65243	broad.mit.edu	37	1	40923075	40923075	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:40923075C>G	ENST00000411995.2	+	5	775	c.400C>G	c.(400-402)Ctg>Gtg	p.L134V	ZFP69B_ENST00000361584.3_Missense_Mutation_p.L32V|ZFP69B_ENST00000484445.1_Missense_Mutation_p.A105G	NM_023070.2	NP_075558.2	Q9UJL9	ZF69B_HUMAN	ZFP69 zinc finger protein B	134	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L32V(1)									AGAACCATGGCTGATGGAGAG	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											108.0	104.0	106.0					1																	40923075		2203	4300	6503	40695662	SO:0001583	missense	65243			BC017498	CCDS452.1, CCDS452.2	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187801	ENSG00000187801		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	28053	protein-coding gene	gene with protein product			"""zinc finger protein 643"""	ZNF643			Standard	NM_023070		Approved	ZKSCAN23B, FLJ34293, ZSCAN54B	uc001cfn.2	Q9UJL9	OTTHUMG00000007302	ENST00000411995.2:c.400C>G	1.37:g.40923075C>G	ENSP00000399664:p.Leu134Val	Somatic		Capture	Illumina GAIIx	Phase_I	40695662	Q5QPL4	Missense_Mutation	SNP	ENST00000411995.2	37	CCDS452.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.89|13.89	2.373288|2.373288	0.42105|0.42105	.|.	.|.	ENSG00000187801|ENSG00000187801	ENST00000484445|ENST00000431552;ENST00000411995;ENST00000361584	.|T;T	.|0.08008	.|3.56;3.14	3.4|3.4	-0.938|-0.938	0.10412|0.10412	.|Krueppel-associated box (2);	.|.	.|.	.|.	.|.	T|T	0.02970|0.02970	0.0088|0.0088	N|N	0.04043|0.04043	-0.29|-0.29	0.20873|0.20873	N|N	0.999832|0.999832	.|B	.|0.26195	.|0.144	.|B	.|0.18263	.|0.021	T|T	0.42258|0.42258	-0.9462|-0.9462	6|9	0.49607|0.36615	T|T	0.09|0.2	.|.	2.751|2.751	0.05281|0.05281	0.3564:0.3253:0.0:0.3183|0.3564:0.3253:0.0:0.3183	.|.	.|134	.|Q9UJL9	.|ZN643_HUMAN	G|V	105|65;134;32	.|ENSP00000399664:L134V;ENSP00000354547:L32V	ENSP00000435907:A105G|ENSP00000354547:L32V	A|L	+|+	2|1	0|2	ZNF643|ZNF643	40695662|40695662	0.006000|0.006000	0.16342|0.16342	0.446000|0.446000	0.26920|0.26920	0.549000|0.549000	0.35272|0.35272	-0.217000|-0.217000	0.09253|0.09253	-0.179000|-0.179000	0.10654|0.10654	-0.794000|-0.794000	0.03295|0.03295	GCT|CTG		0.488	ZFP69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019078.2	NM_023070	
C1orf168	199920	broad.mit.edu	37	1	57206386	57206386	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:57206386A>G	ENST00000343433.6	-	13	1767	c.1687T>C	c.(1687-1689)Tcg>Ccg	p.S563P	C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	563								p.S563P(1)		NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						TTTTCTTTCGACTTGGTTTTC	0.363																																																1	Substitution - Missense(1)	ovary(1)	1											109.0	101.0	103.0					1																	57206386		2203	4298	6501	56978974	SO:0001583	missense	199920			BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.1687T>C	1.37:g.57206386A>G	ENSP00000345972:p.Ser563Pro	Somatic		Capture	Illumina GAIIx	Phase_I	56978974	Q63HM3|Q6ZUY6	Missense_Mutation	SNP	ENST00000343433.6	37	CCDS30729.1	.	.	.	.	.	.	.	.	.	.	A	8.104	0.777312	0.16120	.	.	ENSG00000187889	ENST00000343433	T	0.35421	1.31	4.1	0.41	0.16387	.	0.866965	0.09770	N	0.758063	T	0.22003	0.0530	L	0.32530	0.975	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.28490	-1.0042	10	0.22109	T	0.4	0.2002	2.7711	0.05335	0.6012:0.0:0.2105:0.1884	.	563	Q5VWT5	CA168_HUMAN	P	563	ENSP00000345972:S563P	ENSP00000345972:S563P	S	-	1	0	C1orf168	56978974	0.998000	0.40836	0.085000	0.20634	0.953000	0.61014	0.905000	0.28504	0.046000	0.15833	0.460000	0.39030	TCG		0.363	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303	
GIPC2	54810	broad.mit.edu	37	1	78546423	78546423	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:78546423G>A	ENST00000370759.3	+	2	498	c.305G>A	c.(304-306)gGa>gAa	p.G102E	GIPC2_ENST00000476882.1_3'UTR	NM_017655.4	NP_060125.4	Q8TF65	GIPC2_HUMAN	GIPC PDZ domain containing family, member 2	102						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.G102E(1)		endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)	20						GGACAACTAGGACTAGAAGAT	0.353																																																1	Substitution - Missense(1)	ovary(1)	1											137.0	140.0	139.0					1																	78546423		2203	4300	6503	78319011	SO:0001583	missense	54810			AB073737	CCDS685.1	1p31.1	2010-05-28			ENSG00000137960	ENSG00000137960			18177	protein-coding gene	gene with protein product	"""semaphorin cytoplasmic domain associated protein 2"""					11836570	Standard	NM_017655		Approved	FLJ20075, SEMCAP-2	uc001dik.3	Q8TF65	OTTHUMG00000041145	ENST00000370759.3:c.305G>A	1.37:g.78546423G>A	ENSP00000359795:p.Gly102Glu	Somatic		Capture	Illumina GAIIx	Phase_I	78319011	Q8IYD3|Q9NXS7	Missense_Mutation	SNP	ENST00000370759.3	37	CCDS685.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.463592	0.63513	.	.	ENSG00000137960	ENST00000370759	T	0.38887	1.11	6.16	6.16	0.99307	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57528	-0.7796	10	0.51188	T	0.08	-3.009	20.8598	0.99761	0.0:0.0:1.0:0.0	.	102	Q8TF65	GIPC2_HUMAN	E	102	ENSP00000359795:G102E	ENSP00000359795:G102E	G	+	2	0	GIPC2	78319011	1.000000	0.71417	0.990000	0.47175	0.021000	0.10359	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	GGA		0.353	GIPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098629.1	NM_017655	
GTF2B	2959	broad.mit.edu	37	1	89325691	89325691	+	Nonsense_Mutation	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:89325691G>A	ENST00000370500.5	-	5	527	c.409C>T	c.(409-411)Cga>Tga	p.R137*	GTF2B_ENST00000494819.1_5'UTR	NM_001514.5	NP_001505.1	Q00403	TF2B_HUMAN	general transcription factor IIB	137					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)	core promoter binding (GO:0001047)|thyroid hormone receptor binding (GO:0046966)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R137*(1)		endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		TTATTTGTTCGATCCTTCAAA	0.343																																																1	Substitution - Nonsense(1)	ovary(1)	1											132.0	134.0	133.0					1																	89325691		2203	4300	6503	89098279	SO:0001587	stop_gained	2959			M76766	CCDS715.1	1p22-p21	2010-03-23			ENSG00000137947	ENSG00000137947		"""General transcription factors"""	4648	protein-coding gene	gene with protein product		189963				1876184, 8162052	Standard	NM_001514		Approved	TFIIB	uc001dmo.4	Q00403	OTTHUMG00000010611	ENST00000370500.5:c.409C>T	1.37:g.89325691G>A	ENSP00000359531:p.Arg137*	Somatic		Capture	Illumina GAIIx	Phase_I	89098279	A8K1A7|Q5JS30	Nonsense_Mutation	SNP	ENST00000370500.5	37	CCDS715.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297907	0.81025	.	.	ENSG00000137947	ENST00000370500;ENST00000448623;ENST00000418217	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	15.9647	19.7434	0.96241	0.0:0.0:1.0:0.0	.	.	.	.	X	137;136;132	.	ENSP00000359531:R137X	R	-	1	2	GTF2B	89098279	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.015000	0.70791	2.716000	0.92895	0.591000	0.81541	CGA		0.343	GTF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029279.1	NM_001514	
LRRC8B	23507	broad.mit.edu	37	1	90049602	90049602	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:90049602C>G	ENST00000330947.2	+	5	1753	c.1393C>G	c.(1393-1395)Ctc>Gtc	p.L465V	RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000439853.1_Missense_Mutation_p.L465V|LRRC8B_ENST00000358200.4_Missense_Mutation_p.L465V	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	465					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L465F(1)|p.L465V(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		GCTGGTCAACCTCAAGGAGCT	0.473																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	1											51.0	51.0	51.0					1																	90049602		2203	4300	6503	89822190	SO:0001583	missense	23507			AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.1393C>G	1.37:g.90049602C>G	ENSP00000332674:p.Leu465Val	Somatic		Capture	Illumina GAIIx	Phase_I	89822190	D3DT28|Q6UY21|Q8N106|Q92627	Missense_Mutation	SNP	ENST00000330947.2	37	CCDS724.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.465050	0.63513	.	.	ENSG00000197147	ENST00000330947;ENST00000358200;ENST00000439853	T;T;T	0.03212	4.01;4.01;4.01	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000004	T	0.17746	0.0426	M	0.89030	3	0.58432	D	0.999999	D	0.63880	0.993	D	0.73708	0.981	T	0.02087	-1.1216	10	0.72032	D	0.01	.	19.3297	0.94281	0.0:1.0:0.0:0.0	.	465	Q6P9F7	LRC8B_HUMAN	V	465	ENSP00000332674:L465V;ENSP00000350933:L465V;ENSP00000400704:L465V	ENSP00000332674:L465V	L	+	1	0	LRRC8B	89822190	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	7.764000	0.85297	2.625000	0.88918	0.655000	0.94253	CTC		0.473	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028008.1	NM_015350	
LRRC8D	55144	broad.mit.edu	37	1	90399924	90399924	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:90399924C>A	ENST00000337338.5	+	3	1704	c.1297C>A	c.(1297-1299)Cgt>Agt	p.R433S	LRRC8D_ENST00000394593.3_Missense_Mutation_p.R433S	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	433					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R433S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		ATATTCCAAGCGTTTTGGTGT	0.393																																																1	Substitution - Missense(1)	ovary(1)	1											75.0	74.0	74.0					1																	90399924		2203	4300	6503	90172512	SO:0001583	missense	55144			AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.1297C>A	1.37:g.90399924C>A	ENSP00000338887:p.Arg433Ser	Somatic		Capture	Illumina GAIIx	Phase_I	90172512	D3DT29|Q6UWB2|Q9NVW3	Missense_Mutation	SNP	ENST00000337338.5	37	CCDS726.1	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009005	0.54361	.	.	ENSG00000171492	ENST00000337338;ENST00000394593	T;T	0.29397	1.57;1.57	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.35828	0.0945	L	0.41027	1.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.03249	-1.1056	9	.	.	.	.	13.9423	0.64064	0.2666:0.7334:0.0:0.0	.	433	Q7L1W4	LRC8D_HUMAN	S	433	ENSP00000338887:R433S;ENSP00000378093:R433S	.	R	+	1	0	LRRC8D	90172512	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.437000	0.44828	2.698000	0.92095	0.655000	0.94253	CGT		0.393	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
TMED5	50999	broad.mit.edu	37	1	93645704	93645704	+	Silent	SNP	G	G	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:93645704G>C	ENST00000370282.3	-	1	581	c.96C>G	c.(94-96)ctC>ctG	p.L32L	CCDC18_ENST00000343253.7_5'UTR|CCDC18_ENST00000401026.3_5'Flank|TMED5_ENST00000370280.1_Silent_p.L32L|CCDC18_ENST00000557479.1_5'Flank|TMED5_ENST00000479918.1_Silent_p.L32L|CCDC18_ENST00000338949.4_5'Flank|CCDC18_ENST00000334652.5_5'Flank	NM_016040.4	NP_057124.3	Q9Y3A6	TMED5_HUMAN	transmembrane emp24 protein transport domain containing 5	32					Golgi ribbon formation (GO:0090161)|protein transport (GO:0015031)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.L32L(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6		all_lung(203;0.0223)|Lung NSC(277;0.071)|Melanoma(281;0.147)|Glioma(108;0.188)		all cancers(265;0.00108)|GBM - Glioblastoma multiforme(16;0.00407)|Epithelial(280;0.0797)		AGTCGCTATCGAGGGAAGGTG	0.637																																																1	Substitution - coding silent(1)	ovary(1)	1											70.0	72.0	71.0					1																	93645704		2203	4300	6503	93418292	SO:0001819	synonymous_variant	50999			BC070051	CCDS743.1, CCDS53342.1	1p22.1	2013-09-19			ENSG00000117500	ENSG00000117500			24251	protein-coding gene	gene with protein product						10810093	Standard	NM_016040		Approved	CGI-100	uc001dpn.3	Q9Y3A6	OTTHUMG00000010162	ENST00000370282.3:c.96C>G	1.37:g.93645704G>C		Somatic		Capture	Illumina GAIIx	Phase_I	93418292	B1AKT4|B2R703|D3DT38|Q96AX8	Silent	SNP	ENST00000370282.3	37	CCDS743.1																																																																																				0.637	TMED5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028076.3	NM_016040	
KIAA1324	57535	broad.mit.edu	37	1	109707161	109707161	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:109707161C>A	ENST00000369939.3	+	3	498	c.315C>A	c.(313-315)gaC>gaA	p.D105E	KIAA1324_ENST00000529753.1_Missense_Mutation_p.D105E	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	105					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)	p.D105E(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		ATATGAAGGACCAGTCATGTA	0.582																																																1	Substitution - Missense(1)	ovary(1)	1											126.0	123.0	124.0					1																	109707161		2203	4300	6503	109508684	SO:0001583	missense	57535			AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.315C>A	1.37:g.109707161C>A	ENSP00000358955:p.Asp105Glu	Somatic		Capture	Illumina GAIIx	Phase_I	109508684	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Missense_Mutation	SNP	ENST00000369939.3	37	CCDS794.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.000761	0.54254	.	.	ENSG00000116299	ENST00000531664;ENST00000534476;ENST00000526264;ENST00000369939;ENST00000457623;ENST00000529753	T;T;T;T;T;D	0.97480	0.94;1.53;0.94;1.46;1.46;-4.4	6.04	0.789	0.18607	.	0.530450	0.22284	N	0.062083	T	0.79919	0.4529	N	0.12182	0.205	0.23991	N	0.996242	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.001	T	0.74137	-0.3762	10	0.13108	T	0.6	-16.3277	4.3	0.10920	0.1448:0.3261:0.3977:0.1314	.	105;105;105;105	Q6UXG2-4;Q6UXG2-3;C9J810;Q6UXG2	.;.;.;K1324_HUMAN	E	105	ENSP00000431349:D105E;ENSP00000432164:D105E;ENSP00000435066:D105E;ENSP00000358955:D105E;ENSP00000393964:D105E;ENSP00000434595:D105E	ENSP00000358955:D105E	D	+	3	2	KIAA1324	109508684	0.343000	0.24818	0.999000	0.59377	0.918000	0.54935	-0.285000	0.08410	0.123000	0.18342	0.561000	0.74099	GAC		0.582	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032389.2	NM_020775	
MOV10	4343	broad.mit.edu	37	1	113236720	113236720	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:113236720G>T	ENST00000413052.2	+	8	1611	c.1221G>T	c.(1219-1221)caG>caT	p.Q407H	MOV10_ENST00000369644.1_Missense_Mutation_p.Q351H|RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000357443.2_Missense_Mutation_p.Q407H|MOV10_ENST00000369645.1_Missense_Mutation_p.Q407H|MOV10_ENST00000468624.1_3'UTR	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	407					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.Q407H(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		AGACACACCAGGAGGACCCCA	0.567																																																1	Substitution - Missense(1)	ovary(1)	1											136.0	129.0	132.0					1																	113236720		2203	4300	6503	113038243	SO:0001583	missense	4343			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.1221G>T	1.37:g.113236720G>T	ENSP00000399797:p.Gln407His	Somatic		Capture	Illumina GAIIx	Phase_I	113038243	Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Missense_Mutation	SNP	ENST00000413052.2	37	CCDS853.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.612510	0.28712	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000285733;ENST00000369644;ENST00000357443;ENST00000369648	D;D;D;D	0.91894	-2.93;-2.93;-2.93;-2.93	4.87	1.96	0.26148	.	0.821195	0.11586	N	0.549209	T	0.67116	0.2859	N	0.08118	0	0.22342	N	0.999187	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.0;0.003;0.001	T	0.59810	-0.7384	10	0.41790	T	0.15	-6.4361	6.4351	0.21819	0.0726:0.1313:0.6598:0.1363	.	351;407;407	Q5JR04;Q9H8T8;Q9HCE1	.;.;MOV10_HUMAN	H	407;407;407;351;407;345	ENSP00000399797:Q407H;ENSP00000358659:Q407H;ENSP00000358658:Q351H;ENSP00000350028:Q407H	ENSP00000285733:Q407H	Q	+	3	2	MOV10	113038243	0.006000	0.16342	0.938000	0.37757	0.864000	0.49448	0.829000	0.27449	0.259000	0.21709	-0.310000	0.09108	CAG		0.567	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032906.1	NM_020963	
ADAR	103	broad.mit.edu	37	1	154574369	154574369	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:154574369G>A	ENST00000368474.4	-	2	948	c.749C>T	c.(748-750)gCt>gTt	p.A250V	ADAR_ENST00000292205.5_Missense_Mutation_p.A293V|ADAR_ENST00000471068.1_5'Flank|ADAR_ENST00000368471.3_5'UTR	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	250					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A250V(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		CCAAGCCTGAGCTGAGACTGC	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											121.0	124.0	123.0					1																	154574369		2203	4300	6503	152840993	SO:0001583	missense	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.749C>T	1.37:g.154574369G>A	ENSP00000357459:p.Ala250Val	Somatic		Capture	Illumina GAIIx	Phase_I	152840993	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933122	0.34096	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000529168	T;T;T	0.12569	2.67;2.68;2.71	2.09	-4.17	0.03857	.	1.204520	0.07030	U	0.828319	T	0.01592	0.0051	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45789	-0.9237	10	0.29301	T	0.29	.	2.574	0.04801	0.5054:0.0:0.2903:0.2043	.	250;250;250	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	V	293;250;245	ENSP00000292205:A293V;ENSP00000357459:A250V;ENSP00000431794:A245V	ENSP00000292205:A293V	A	-	2	0	ADAR	152840993	0.659000	0.27411	0.140000	0.22221	0.142000	0.21351	1.720000	0.38022	-1.131000	0.02910	-0.339000	0.08088	GCT		0.517	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
THBS3	7059	broad.mit.edu	37	1	155172631	155172631	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:155172631T>C	ENST00000368378.3	-	8	949	c.929A>G	c.(928-930)aAc>aGc	p.N310S	RP11-263K19.4_ENST00000453136.1_RNA|THBS3_ENST00000541990.1_5'UTR|RP11-263K19.4_ENST00000422665.1_RNA|RP11-263K19.4_ENST00000447623.1_RNA|THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000430312.1_RNA|RP11-263K19.4_ENST00000436772.1_RNA|RP11-263K19.4_ENST00000454348.1_RNA|THBS3_ENST00000457183.2_Missense_Mutation_p.N190S|THBS3_ENST00000541576.1_5'Flank	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	310					bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.N310S(1)		breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTGGGTGCCGTTGCCCTGCAG	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											56.0	59.0	58.0					1																	155172631		2203	4300	6503	153439255	SO:0001583	missense	7059			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.929A>G	1.37:g.155172631T>C	ENSP00000357362:p.Asn310Ser	Somatic		Capture	Illumina GAIIx	Phase_I	153439255	B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	ENST00000368378.3	37	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.359853	0.82353	.	.	ENSG00000169231	ENST00000368378;ENST00000457183;ENST00000428962	T;T;T	0.34859	1.34;1.34;1.34	5.13	5.13	0.70059	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	T	0.30541	0.0768	M	0.79475	2.455	0.58432	D	0.999999	P;P;P;P	0.41313	0.745;0.745;0.745;0.745	B;B;B;B	0.39419	0.299;0.299;0.299;0.299	T	0.37549	-0.9701	10	0.87932	D	0	-32.866	13.1963	0.59740	0.0:0.0:0.0:1.0	.	190;310;310;310	B4DQ20;Q53FK6;Q2HIZ0;P49746	.;.;.;TSP3_HUMAN	S	310;190;160	ENSP00000357362:N310S;ENSP00000392207:N190S;ENSP00000404040:N160S	ENSP00000357362:N310S	N	-	2	0	THBS3	153439255	1.000000	0.71417	0.989000	0.46669	0.965000	0.64279	7.825000	0.86693	2.279000	0.76181	0.533000	0.62120	AAC		0.622	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
ASPM	259266	broad.mit.edu	37	1	197115270	197115270	+	Splice_Site	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:197115270C>A	ENST00000367409.4	-	1	554		c.e1+1		ASPM_ENST00000294732.7_Splice_Site	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)						developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.?(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						CTGAGACCTACCTGCAACACG	0.577																																																1	Unknown(1)	ovary(1)	1											83.0	82.0	83.0					1																	197115270		2203	4300	6503	195381893	SO:0001630	splice_region_variant	259266			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.297+1G>T	1.37:g.197115270C>A		Somatic		Capture	Illumina GAIIx	Phase_I	195381893	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Splice_Site	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093319	0.36952	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367406	.	.	.	4.29	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0847	0.72142	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ASPM	195381893	1.000000	0.71417	0.856000	0.33681	0.235000	0.25334	4.881000	0.63114	2.179000	0.69175	0.561000	0.74099	.		0.577	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	Intron
CDC42BPA	8476	broad.mit.edu	37	1	227222460	227222460	+	Silent	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr1:227222460C>T	ENST00000366769.3	-	25	4558	c.3267G>A	c.(3265-3267)caG>caA	p.Q1089Q	CDC42BPA_ENST00000334218.5_Silent_p.Q1089Q|CDC42BPA_ENST00000535525.1_Silent_p.Q1069Q|CDC42BPA_ENST00000366765.3_Silent_p.Q1102Q|CDC42BPA_ENST00000366766.2_Silent_p.Q1124Q|CDC42BPA_ENST00000366764.2_Silent_p.Q1061Q|CDC42BPA_ENST00000366767.3_Silent_p.Q1008Q	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)									p.Q1008Q(1)		NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CCAGTGCTCTCTGCCACCCTT	0.398																																																1	Substitution - coding silent(1)	ovary(1)	1											159.0	143.0	148.0					1																	227222460		2203	4300	6503	225289083	SO:0001819	synonymous_variant	8476			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.3267G>A	1.37:g.227222460C>T		Somatic		Capture	Illumina GAIIx	Phase_I	225289083		Silent	SNP	ENST00000366769.3	37	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	C	9.705	1.155647	0.21454	.	.	ENSG00000143776	ENST00000448940;ENST00000442054;ENST00000441725	.	.	.	5.81	-7.45	0.01374	.	.	.	.	.	T	0.73024	0.3534	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75271	-0.3376	4	.	.	.	.	21.8185	0.99961	0.0:0.8672:0.0:0.1328	.	.	.	.	K	292;418;314	.	.	E	-	1	0	CDC42BPA	225289083	0.598000	0.26882	0.882000	0.34594	0.976000	0.68499	-0.091000	0.11146	-1.027000	0.03325	-0.300000	0.09419	GAG		0.398	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
VIM	7431	broad.mit.edu	37	10	17277378	17277378	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr10:17277378G>A	ENST00000224237.5	+	6	1364	c.1219G>A	c.(1219-1221)Gag>Aag	p.E407K	RP11-124N14.3_ENST00000456355.1_RNA|VIM_ENST00000544301.1_Missense_Mutation_p.E407K			P08670	VIME_HUMAN	vimentin	407	Coil 2.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)	p.E407K(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCTGGAAGGCGAGGAGAGCAG	0.502																																																1	Substitution - Missense(1)	ovary(1)	10											81.0	76.0	78.0					10																	17277378		2203	4300	6503	17317384	SO:0001583	missense	7431			M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.1219G>A	10.37:g.17277378G>A	ENSP00000224237:p.Glu407Lys	Somatic		Capture	Illumina GAIIx	Phase_I	17317384	B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	ENST00000224237.5	37	CCDS7120.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857444	0.91433	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533	D;D	0.93366	-3.21;-3.21	5.73	5.73	0.89815	Filament (1);	0.330005	0.21462	N	0.074144	D	0.97707	0.9248	M	0.92169	3.28	0.80722	D	1	D;D;D;D	0.89917	0.99;1.0;1.0;0.99	P;D;D;P	0.97110	0.869;0.975;1.0;0.869	D	0.98080	1.0403	10	0.66056	D	0.02	.	19.9515	0.97200	0.0:0.0:1.0:0.0	.	407;394;407;407	Q53HU8;F5H288;B0YJC4;P08670	.;.;.;VIME_HUMAN	K	407;407;394	ENSP00000446007:E407K;ENSP00000224237:E407K	ENSP00000224237:E407K	E	+	1	0	VIM	17317384	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.855000	0.99526	2.693000	0.91896	0.638000	0.83543	GAG		0.502	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047015.1	NM_003380	
GRID1	2894	broad.mit.edu	37	10	87675942	87675942	+	Splice_Site	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr10:87675942C>T	ENST00000327946.7	-	5	866		c.e5+1			NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1						ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.?(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						AGAGCCCTTACCTCATTCACA	0.507										Multiple Myeloma(13;0.14)																																						1	Unknown(1)	ovary(1)	10											85.0	78.0	80.0					10																	87675942		2203	4300	6503	87665922	SO:0001630	splice_region_variant	2894			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.780+1G>A	10.37:g.87675942C>T		Somatic		Capture	Illumina GAIIx	Phase_I	87665922	B3KXD5|B7Z7L0|Q8IXT3	Splice_Site	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.714907	0.68844	.	.	ENSG00000182771	ENST00000327946	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6027	0.68453	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GRID1	87665922	1.000000	0.71417	1.000000	0.80357	0.656000	0.38851	5.801000	0.69115	2.504000	0.84457	0.561000	0.74099	.		0.507	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	Intron
VWA2	340706	broad.mit.edu	37	10	116048756	116048756	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr10:116048756C>A	ENST00000392982.3	+	12	1880	c.1630C>A	c.(1630-1632)Ccc>Acc	p.P544T	VWA2_ENST00000603594.1_Missense_Mutation_p.P544T			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	544	VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)	p.P544T(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		CTCAGTAGGGCCCGAGAATTT	0.582																																																1	Substitution - Missense(1)	ovary(1)	10											78.0	76.0	76.0					10																	116048756		2203	4300	6503	116038746	SO:0001583	missense	340706			AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.1630C>A	10.37:g.116048756C>A	ENSP00000376708:p.Pro544Thr	Somatic		Capture	Illumina GAIIx	Phase_I	116038746	A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Missense_Mutation	SNP	ENST00000392982.3	37		.	.	.	.	.	.	.	.	.	.	C	4.345	0.063511	0.08388	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	D	0.83506	-1.73	5.43	1.2	0.21068	von Willebrand factor, type A (3);	0.554095	0.18133	N	0.150677	T	0.73697	0.3620	L	0.48218	1.51	0.09310	N	1	B;B;B	0.32717	0.38;0.381;0.169	B;B;B	0.38842	0.283;0.198;0.086	T	0.57585	-0.7786	10	0.14252	T	0.57	.	4.1233	0.10116	0.2393:0.4384:0.2475:0.0748	.	240;544;544	Q5GFL6-3;Q5GFL6;Q5GFL6-2	.;VWA2_HUMAN;.	T	544	ENSP00000376708:P544T	ENSP00000298715:P544T	P	+	1	0	VWA2	116038746	0.000000	0.05858	0.118000	0.21660	0.033000	0.12548	0.727000	0.25999	0.253000	0.21552	-0.175000	0.13238	CCC		0.582	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050456.3	NM_198496	
TRIM5	85363	broad.mit.edu	37	11	5701286	5701286	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr11:5701286G>A	ENST00000380034.3	-	2	378	c.122C>T	c.(121-123)gCa>gTa	p.A41V	TRIM5_ENST00000396853.4_Missense_Mutation_p.A41V|TRIM5_ENST00000380027.1_Missense_Mutation_p.A41V|TRIM5_ENST00000396847.3_Missense_Mutation_p.A41V|TRIM5_ENST00000305836.5_Missense_Mutation_p.A41V|TRIM5_ENST00000396855.3_Missense_Mutation_p.A41V|TRIM5_ENST00000483835.1_5'Flank	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5	41					activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A41V(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		CTTGTGGTTTGCAGTGAGGCA	0.557																																																1	Substitution - Missense(1)	ovary(1)	11											123.0	108.0	113.0					11																	5701286		2201	4297	6498	5657862	SO:0001583	missense	85363			AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.122C>T	11.37:g.5701286G>A	ENSP00000369373:p.Ala41Val	Somatic		Capture	Illumina GAIIx	Phase_I	5657862	A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Missense_Mutation	SNP	ENST00000380034.3	37	CCDS31393.1	.	.	.	.	.	.	.	.	.	.	G	5.262	0.233739	0.09969	.	.	ENSG00000132256	ENST00000396855;ENST00000305836;ENST00000380034;ENST00000380027;ENST00000396847;ENST00000396853;ENST00000412903;ENST00000419850	D;D;D;D;D;D;D;D	0.93019	-1.85;-3.15;-3.15;-1.85;-3.15;-1.85;-3.15;-3.15	4.07	-0.281	0.12882	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	1.461070	0.04165	N	0.323797	D	0.88923	0.6569	N	0.17248	0.465	0.09310	N	1	B;B;P	0.45396	0.079;0.079;0.857	B;B;P	0.48982	0.051;0.056;0.597	T	0.80710	-0.1261	10	0.33141	T	0.24	.	4.2282	0.10590	0.0974:0.4756:0.2793:0.1478	.	41;41;41	Q9C035-3;Q9C035-4;Q9C035	.;.;TRIM5_HUMAN	V	41	ENSP00000380064:A41V;ENSP00000307031:A41V;ENSP00000369373:A41V;ENSP00000369366:A41V;ENSP00000380058:A41V;ENSP00000380062:A41V;ENSP00000388031:A41V;ENSP00000388150:A41V	ENSP00000307031:A41V	A	-	2	0	TRIM5	5657862	0.000000	0.05858	0.001000	0.08648	0.037000	0.13140	-1.170000	0.03118	-0.026000	0.13895	-0.188000	0.12872	GCA		0.557	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143360.3	NM_033034	
NELL1	4745	broad.mit.edu	37	11	20968915	20968915	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr11:20968915C>A	ENST00000357134.5	+	11	1257	c.1105C>A	c.(1105-1107)Cct>Act	p.P369T	NELL1_ENST00000325319.5_Missense_Mutation_p.P312T|NELL1_ENST00000298925.5_Missense_Mutation_p.P397T|NELL1_ENST00000532434.1_Missense_Mutation_p.P369T	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	369					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)	p.P369T(1)		NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						AGAAATGTGTCCTCCTTTGAA	0.418																																																1	Substitution - Missense(1)	ovary(1)	11											129.0	127.0	128.0					11																	20968915		2203	4300	6503	20925491	SO:0001583	missense	4745			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1105C>A	11.37:g.20968915C>A	ENSP00000349654:p.Pro369Thr	Somatic		Capture	Illumina GAIIx	Phase_I	20925491	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	ENST00000357134.5	37	CCDS7855.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604409	0.66445	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45	6.17	5.26	0.73747	von Willebrand factor, type C (1);	0.122875	0.56097	D	0.000039	T	0.81550	0.4846	M	0.81497	2.545	0.46774	D	0.999192	P;D;D;D	0.76494	0.562;0.999;0.986;0.993	B;D;P;D	0.78314	0.346;0.991;0.885;0.966	T	0.82884	-0.0236	10	0.48119	T	0.1	-8.5939	13.7699	0.63018	0.0:0.9296:0.0:0.0704	.	312;397;369;369	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	T	397;369;312;369	ENSP00000298925:P397T;ENSP00000349654:P369T;ENSP00000317837:P312T;ENSP00000437170:P369T	ENSP00000298925:P397T	P	+	1	0	NELL1	20925491	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	3.863000	0.56016	1.616000	0.50265	0.655000	0.94253	CCT		0.418	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	
OR5M11	219487	broad.mit.edu	37	11	56310387	56310387	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr11:56310387G>T	ENST00000528616.2	-	1	370	c.347C>A	c.(346-348)gCa>gAa	p.A116E		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						ATAGGCCATTGCTGCCAGCAT	0.458																																																0			11											68.0	70.0	69.0					11																	56310387		2187	4294	6481	56066963	SO:0001583	missense	219487			AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.347C>A	11.37:g.56310387G>T	ENSP00000432417:p.Ala116Glu	Somatic		Capture	Illumina GAIIx	Phase_I	56066963	B2RNL5|B2RNL7	Missense_Mutation	SNP	ENST00000528616.2	37	CCDS53629.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067947	0.55539	.	.	ENSG00000255223	ENST00000528616	T	0.03124	4.04	5.1	4.19	0.49359	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.17874	0.0429	H	0.96142	3.775	0.09310	N	1	P	0.49358	0.923	P	0.52267	0.694	T	0.23762	-1.0179	9	0.66056	D	0.02	.	6.7536	0.23501	0.26:0.0:0.74:0.0	.	116	Q96RB7	OR5MB_HUMAN	E	116	ENSP00000432417:A116E	ENSP00000432417:A116E	A	-	2	0	OR5M11	56066963	0.000000	0.05858	0.990000	0.47175	0.815000	0.46073	0.134000	0.15932	1.416000	0.47057	0.632000	0.83419	GCA		0.458	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	NM_001005245	
AHNAK	79026	broad.mit.edu	37	11	62288364	62288364	+	Missense_Mutation	SNP	T	T	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr11:62288364T>G	ENST00000378024.4	-	5	13799	c.13525A>C	c.(13525-13527)Atg>Ctg	p.M4509L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4509					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.M4509L(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ACATCAGGCATCTTAAACTTG	0.418																																																1	Substitution - Missense(1)	ovary(1)	11											76.0	73.0	74.0					11																	62288364		2202	4299	6501	62044940	SO:0001583	missense	79026			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.13525A>C	11.37:g.62288364T>G	ENSP00000367263:p.Met4509Leu	Somatic		Capture	Illumina GAIIx	Phase_I	62044940	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.471236	0.26423	.	.	ENSG00000124942	ENST00000378024	T	0.01422	4.91	5.12	1.32	0.21799	.	0.542781	0.15183	U	0.275992	T	0.02807	0.0084	M	0.82823	2.61	0.26968	N	0.965654	B	0.19331	0.035	B	0.23275	0.045	T	0.32534	-0.9903	10	0.22706	T	0.39	.	9.9376	0.41561	0.0:0.2143:0.0:0.7857	.	4509	Q09666	AHNK_HUMAN	L	4509	ENSP00000367263:M4509L	ENSP00000367263:M4509L	M	-	1	0	AHNAK	62044940	0.386000	0.25180	0.990000	0.47175	0.968000	0.65278	0.575000	0.23729	0.322000	0.23283	0.523000	0.50628	ATG		0.418	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
UBE4A	9354	broad.mit.edu	37	11	118253371	118253371	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr11:118253371C>G	ENST00000431736.2	+	13	2170	c.2098C>G	c.(2098-2100)Cag>Gag	p.Q700E	UBE4A_ENST00000545354.1_Missense_Mutation_p.Q165E|UBE4A_ENST00000252108.3_Missense_Mutation_p.Q693E					ubiquitination factor E4A									p.Q700E(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CCACCTGGATCAGACCCCAAA	0.493																																																1	Substitution - Missense(1)	ovary(1)	11											219.0	200.0	207.0					11																	118253371		2200	4296	6496	117758581	SO:0001583	missense	9354			D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.2098C>G	11.37:g.118253371C>G	ENSP00000387362:p.Gln700Glu	Somatic		Capture	Illumina GAIIx	Phase_I	117758581		Missense_Mutation	SNP	ENST00000431736.2	37	CCDS8396.1	.	.	.	.	.	.	.	.	.	.	C	6.688	0.495642	0.12762	.	.	ENSG00000110344	ENST00000252108;ENST00000431736;ENST00000545354	T;T;T	0.66280	-0.2;-0.2;1.04	5.68	4.77	0.60923	Ubiquitin conjugation factor E4, core (1);	0.216882	0.49305	D	0.000157	T	0.30727	0.0774	N	0.01576	-0.805	0.41534	D	0.988479	B;B	0.16396	0.017;0.014	B;B	0.15870	0.014;0.004	T	0.37103	-0.9720	10	0.02654	T	1	-1.952	14.1914	0.65641	0.0:0.9286:0.0:0.0714	.	693;700	Q14139;Q14139-2	UBE4A_HUMAN;.	E	693;700;165	ENSP00000252108:Q693E;ENSP00000387362:Q700E;ENSP00000438918:Q165E	ENSP00000252108:Q693E	Q	+	1	0	UBE4A	117758581	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	3.186000	0.50942	1.405000	0.46838	0.591000	0.81541	CAG		0.493	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
OR10S1	219873	broad.mit.edu	37	11	123848124	123848124	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr11:123848124G>A	ENST00000531945.1	-	1	364	c.275C>T	c.(274-276)cCc>cTc	p.P92L		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P92L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CATGACCTTGGGCACTGTCAC	0.552																																																1	Substitution - Missense(1)	ovary(1)	11											87.0	68.0	75.0					11																	123848124		2202	4299	6501	123353334	SO:0001583	missense	219873			BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.275C>T	11.37:g.123848124G>A	ENSP00000431914:p.Pro92Leu	Somatic		Capture	Illumina GAIIx	Phase_I	123353334	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	37	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636124	0.87760	.	.	ENSG00000196248	ENST00000531945	T	0.01854	4.6	4.84	4.84	0.62591	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	U	0.000861	T	0.22898	0.0553	H	0.97516	4.02	0.53688	D	0.999978	D	0.89917	1.0	D	0.69307	0.963	T	0.43475	-0.9389	10	0.72032	D	0.01	-27.1585	17.8867	0.88856	0.0:0.0:1.0:0.0	.	92	Q8NGN2	O10S1_HUMAN	L	92	ENSP00000431914:P92L	ENSP00000431914:P92L	P	-	2	0	OR10S1	123353334	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.021000	0.93673	2.544000	0.85801	0.638000	0.83543	CCC		0.552	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474	
PRICKLE1	144165	broad.mit.edu	37	12	42853970	42853970	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr12:42853970T>C	ENST00000455697.1	-	8	2422	c.2137A>G	c.(2137-2139)Ata>Gta	p.I713V	RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.I713V|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.I713V|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.I713V|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.I713V	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	713					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.I713V(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		TTATTCTGTATAAATTTCTCA	0.483																																																1	Substitution - Missense(1)	ovary(1)	12											74.0	77.0	76.0					12																	42853970		2203	4300	6503	41140237	SO:0001583	missense	144165			AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.2137A>G	12.37:g.42853970T>C	ENSP00000401060:p.Ile713Val	Somatic		Capture	Illumina GAIIx	Phase_I	41140237	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	T	10.15	1.270933	0.23221	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	5.58	-0.0644	0.13772	.	0.604659	0.17647	N	0.166840	T	0.68879	0.3049	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50524	-0.8818	10	0.12103	T	0.63	-12.4202	11.882	0.52581	0.1046:0.0:0.5807:0.3147	.	713	Q96MT3	PRIC1_HUMAN	V	713	ENSP00000401060:I713V;ENSP00000398947:I713V;ENSP00000448359:I713V;ENSP00000345064:I713V;ENSP00000449819:I713V	ENSP00000345064:I713V	I	-	1	0	PRICKLE1	41140237	0.002000	0.14202	0.054000	0.19295	0.996000	0.88848	0.208000	0.17415	0.107000	0.17824	0.533000	0.62120	ATA		0.483	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
CALCOCO1	57658	broad.mit.edu	37	12	54118947	54118947	+	Missense_Mutation	SNP	T	T	C	rs535194693		TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr12:54118947T>C	ENST00000550804.1	-	2	140	c.80A>G	c.(79-81)aAc>aGc	p.N27S	CALCOCO1_ENST00000547885.1_5'UTR|CALCOCO1_ENST00000262059.4_Missense_Mutation_p.N27S|CALCOCO1_ENST00000430117.2_Missense_Mutation_p.N27S|CALCOCO1_ENST00000548263.1_Missense_Mutation_p.N27S			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	27	N-terminal AD (CTNNB1 binding site). {ECO:0000250}.|p300 KIX-binding. {ECO:0000250}.				intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.N27S(1)		NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						CACCTTGGTGTTGGGGATGTA	0.542																																																1	Substitution - Missense(1)	ovary(1)	12											205.0	159.0	174.0					12																	54118947		2203	4300	6503	52405214	SO:0001583	missense	57658			AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.80A>G	12.37:g.54118947T>C	ENSP00000449960:p.Asn27Ser	Somatic		Capture	Illumina GAIIx	Phase_I	52405214	B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Missense_Mutation	SNP	ENST00000550804.1	37	CCDS8864.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.150445	0.78001	.	.	ENSG00000012822	ENST00000430117;ENST00000262059;ENST00000413257;ENST00000548263;ENST00000550804;ENST00000549935;ENST00000551900;ENST00000546619;ENST00000547949;ENST00000553154;ENST00000549784;ENST00000549173;ENST00000548177;ENST00000552623;ENST00000549349;ENST00000549688;ENST00000547885;ENST00000548431	T;T;T;T;T;T;T;T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78;2.78;2.78;2.78;2.78;2.78;2.78;2.78	4.86	4.86	0.63082	.	0.000000	0.49305	D	0.000158	T	0.17238	0.0414	L	0.38175	1.15	0.35200	D	0.774219	D;P;P;P;P	0.56746	0.977;0.568;0.943;0.512;0.954	P;B;P;B;P	0.54759	0.76;0.237;0.496;0.152;0.63	T	0.11518	-1.0584	10	0.41790	T	0.15	-23.7115	13.8751	0.63648	0.0:0.0:0.0:1.0	.	27;27;27;27;27	B4DG60;E9PAU0;Q9P1Z2-3;Q9P1Z2-2;Q9P1Z2	.;.;.;.;CACO1_HUMAN	S	27	ENSP00000397189:N27S;ENSP00000262059:N27S;ENSP00000447647:N27S;ENSP00000449960:N27S;ENSP00000450083:N27S;ENSP00000448621:N27S;ENSP00000447117:N27S;ENSP00000449058:N27S;ENSP00000446820:N27S;ENSP00000448026:N27S;ENSP00000450012:N27S;ENSP00000449796:N27S	ENSP00000262059:N27S	N	-	2	0	CALCOCO1	52405214	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.578000	0.53892	2.188000	0.69820	0.533000	0.62120	AAC		0.542	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898	
MDM1	56890	broad.mit.edu	37	12	68696565	68696565	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr12:68696565C>A	ENST00000303145.7	-	12	1893	c.1807G>T	c.(1807-1809)Gac>Tac	p.D603Y	MDM1_ENST00000540418.1_Missense_Mutation_p.D323Y|MDM1_ENST00000411698.2_Missense_Mutation_p.D568Y	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	603					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)		p.D603Y(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		TGGATATTGTCTTCAGAATCT	0.428																																																1	Substitution - Missense(1)	ovary(1)	12											122.0	124.0	123.0					12																	68696565		2203	4300	6503	66982832	SO:0001583	missense	56890			AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.1807G>T	12.37:g.68696565C>A	ENSP00000302537:p.Asp603Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	66982832	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Missense_Mutation	SNP	ENST00000303145.7	37	CCDS8983.1	.	.	.	.	.	.	.	.	.	.	C	8.519	0.868372	0.17250	.	.	ENSG00000111554	ENST00000540418;ENST00000303145;ENST00000539972;ENST00000411698	T;T;T	0.23147	1.92;2.24;2.24	4.13	-4.37	0.03633	.	2.029970	0.02376	N	0.078319	T	0.18130	0.0435	N	0.22421	0.69	0.09310	N	0.999998	B;B	0.31790	0.34;0.34	B;B	0.34242	0.178;0.178	T	0.19353	-1.0308	9	.	.	.	7.3776	9.6833	0.40082	0.0:0.5021:0.3499:0.148	.	568;603	E7EPQ3;Q8TC05	.;MDM1_HUMAN	Y	323;603;30;568	ENSP00000443815:D323Y;ENSP00000302537:D603Y;ENSP00000391006:D568Y	.	D	-	1	0	MDM1	66982832	0.012000	0.17670	0.004000	0.12327	0.556000	0.35491	-0.189000	0.09629	-0.766000	0.04639	0.555000	0.69702	GAC		0.428	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402402.1	NM_020128	
TPH2	121278	broad.mit.edu	37	12	72335393	72335393	+	Silent	SNP	C	C	T	rs74510566		TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr12:72335393C>T	ENST00000333850.3	+	2	276	c.135C>T	c.(133-135)gaC>gaT	p.D45D	TPH2_ENST00000546576.1_3'UTR	NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	45					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)	p.D45D(2)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	GCAAAAATGACGACAAAGGCA	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		6803	0.0		0.001	False		,,,				2504	0.0															2	Substitution - coding silent(2)	ovary(1)|lung(1)	12											82.0	76.0	78.0					12																	72335393		2203	4300	6503	70621660	SO:0001819	synonymous_variant	121278			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.135C>T	12.37:g.72335393C>T		Somatic		Capture	Illumina GAIIx	Phase_I	70621660	A6NGA4|Q14CB0	Silent	SNP	ENST00000333850.3	37	CCDS31859.1																																																																																				0.393	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
RPH3A	22895	broad.mit.edu	37	12	113303276	113303276	+	Silent	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr12:113303276C>T	ENST00000389385.4	+	6	785	c.288C>T	c.(286-288)aaC>aaT	p.N96N	RPH3A_ENST00000551052.1_Silent_p.N92N|RPH3A_ENST00000543106.2_Silent_p.N96N|RPH3A_ENST00000420983.2_Silent_p.N96N|RPH3A_ENST00000415485.3_Silent_p.N96N|RPH3A_ENST00000548866.1_Silent_p.N47N|RPH3A_ENST00000447659.2_Silent_p.N47N	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	96	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)	p.N92N(1)		breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		ATGGGGTGAACCGCTGCATAC	0.527																																																1	Substitution - coding silent(1)	ovary(1)	12											203.0	176.0	185.0					12																	113303276		2203	4300	6503	111787659	SO:0001819	synonymous_variant	22895			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.288C>T	12.37:g.113303276C>T		Somatic		Capture	Illumina GAIIx	Phase_I	111787659	B7Z3C3|Q96AE0	Silent	SNP	ENST00000389385.4	37	CCDS44979.1																																																																																				0.527	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
GCN1L1	10985	broad.mit.edu	37	12	120586117	120586117	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr12:120586117C>A	ENST00000300648.6	-	37	4592	c.4580G>T	c.(4579-4581)tGt>tTt	p.C1527F		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1527					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)	p.C1527F(1)		NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTTAGGAGCACAGTACGCCAT	0.552																																																1	Substitution - Missense(1)	ovary(1)	12											83.0	90.0	88.0					12																	120586117		2139	4243	6382	119070500	SO:0001583	missense	10985			U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.4580G>T	12.37:g.120586117C>A	ENSP00000300648:p.Cys1527Phe	Somatic		Capture	Illumina GAIIx	Phase_I	119070500	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432185	0.62844	.	.	ENSG00000089154	ENST00000300648	T	0.64803	-0.12	5.19	5.19	0.71726	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83968	0.5369	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87360	0.2343	10	0.62326	D	0.03	.	18.7095	0.91651	0.0:1.0:0.0:0.0	.	1527	Q92616	GCN1L_HUMAN	F	1527	ENSP00000300648:C1527F	ENSP00000300648:C1527F	C	-	2	0	GCN1L1	119070500	1.000000	0.71417	1.000000	0.80357	0.223000	0.24884	7.583000	0.82559	2.435000	0.82474	0.313000	0.20887	TGT		0.552	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
DZIP1	22873	broad.mit.edu	37	13	96242592	96242592	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr13:96242592C>T	ENST00000376829.2	-	17	2635	c.1784G>A	c.(1783-1785)cGa>cAa	p.R595Q	DZIP1_ENST00000347108.3_Missense_Mutation_p.R595Q|DZIP1_ENST00000361396.2_Missense_Mutation_p.R576Q|DZIP1_ENST00000361156.3_Missense_Mutation_p.R576Q	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	595					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.R576Q(2)|p.R595Q(1)		endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			AAGGAATTCTCGAATTTGATG	0.368																																																3	Substitution - Missense(3)	large_intestine(2)|ovary(1)	13											200.0	179.0	186.0					13																	96242592		2203	4300	6503	95040593	SO:0001583	missense	22873			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.1784G>A	13.37:g.96242592C>T	ENSP00000366025:p.Arg595Gln	Somatic		Capture	Illumina GAIIx	Phase_I	95040593	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	ENST00000376829.2	37	CCDS9478.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613807	0.87359	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.19532	2.14;2.19;2.19;2.14	5.66	5.66	0.87406	.	0.152609	0.45361	D	0.000372	T	0.47600	0.1454	M	0.74258	2.255	0.36969	D	0.893749	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.941	T	0.55496	-0.8132	10	0.72032	D	0.01	-11.5579	16.6566	0.85230	0.0:1.0:0.0:0.0	.	576;595	Q86YF9-2;Q86YF9	.;DZIP1_HUMAN	Q	595;576;576;595	ENSP00000257312:R595Q;ENSP00000355018:R576Q;ENSP00000355175:R576Q;ENSP00000366025:R595Q	ENSP00000257312:R595Q	R	-	2	0	DZIP1	95040593	0.999000	0.42202	0.989000	0.46669	0.891000	0.51852	4.413000	0.59795	2.665000	0.90641	0.561000	0.74099	CGA		0.368	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045496.3	NM_014934	
MIPOL1	145282	broad.mit.edu	37	14	37777574	37777574	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr14:37777574C>A	ENST00000327441.7	+	10	1144	c.678C>A	c.(676-678)aaC>aaA	p.N226K	MIPOL1_ENST00000537471.1_Missense_Mutation_p.N226K|MIPOL1_ENST00000556451.1_Missense_Mutation_p.N195K|MIPOL1_ENST00000536774.1_Missense_Mutation_p.N45K|MIPOL1_ENST00000396294.2_Missense_Mutation_p.N226K|MIPOL1_ENST00000545536.1_Missense_Mutation_p.N195K|MIPOL1_ENST00000539062.2_Missense_Mutation_p.N195K	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	226						nucleus (GO:0005634)		p.N226K(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		AATTACTGAACAGAATAAACA	0.308																																																1	Substitution - Missense(1)	ovary(1)	14											106.0	112.0	110.0					14																	37777574		2203	4299	6502	36847325	SO:0001583	missense	145282			AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.678C>A	14.37:g.37777574C>A	ENSP00000333539:p.Asn226Lys	Somatic		Capture	Illumina GAIIx	Phase_I	36847325	D3DSA4|Q7Z3J0|Q8IV14	Missense_Mutation	SNP	ENST00000327441.7	37	CCDS9664.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214782	0.58452	.	.	ENSG00000151338	ENST00000327441;ENST00000536774;ENST00000539062;ENST00000556451;ENST00000396294;ENST00000537471;ENST00000545536	T;T;T;T;T;T	0.46063	0.88;0.89;0.88;0.88;0.88;0.88	5.65	5.65	0.86999	.	0.337880	0.34291	N	0.004092	T	0.47078	0.1426	M	0.71581	2.175	0.46061	D	0.998846	P;P	0.47545	0.897;0.897	P;B	0.44946	0.465;0.402	T	0.47548	-0.9109	10	0.06494	T	0.89	-9.2844	19.7072	0.96079	0.0:1.0:0.0:0.0	.	226;195	Q8TD10;Q49AL5	MIPO1_HUMAN;.	K	226;45;195;195;226;226;195	ENSP00000333539:N226K;ENSP00000438319:N195K;ENSP00000450479:N195K;ENSP00000379589:N226K;ENSP00000444254:N226K;ENSP00000442529:N195K	ENSP00000333539:N226K	N	+	3	2	MIPOL1	36847325	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.689000	0.68234	2.662000	0.90505	0.591000	0.81541	AAC		0.308	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276734.1	NM_138731	
SLC35F4	341880	broad.mit.edu	37	14	58048029	58048029	+	Missense_Mutation	SNP	A	A	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr14:58048029A>T	ENST00000339762.6	-	4	817	c.818T>A	c.(817-819)cTg>cAg	p.L273Q	RP11-409I10.2_ENST00000555600.1_RNA|SLC35F4_ENST00000554729.1_Missense_Mutation_p.L114Q|SLC35F4_ENST00000556826.1_Missense_Mutation_p.L237Q			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	273	EamA.				transport (GO:0006810)	integral component of membrane (GO:0016021)		p.L273Q(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CGTGGCCGTCAGCTTCTTTAA	0.428																																																1	Substitution - Missense(1)	ovary(1)	14											58.0	55.0	56.0					14																	58048029		1935	4134	6069	57117782	SO:0001583	missense	341880					14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.818T>A	14.37:g.58048029A>T	ENSP00000342518:p.Leu273Gln	Somatic		Capture	Illumina GAIIx	Phase_I	57117782	A6NDQ3	Missense_Mutation	SNP	ENST00000339762.6	37		.	.	.	.	.	.	.	.	.	.	A	20.9	4.063446	0.76187	.	.	ENSG00000151812	ENST00000556826;ENST00000339762;ENST00000554729	T;T;T	0.37752	1.18;1.18;1.18	6.08	6.08	0.98989	Drug/metabolite transporter (1);	0.000000	0.85682	D	0.000000	T	0.54581	0.1867	L	0.47190	1.495	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.52859	-0.8519	10	0.52906	T	0.07	-8.0836	16.6512	0.85203	1.0:0.0:0.0:0.0	.	273	A4IF30	S35F4_HUMAN	Q	237;273;114	ENSP00000452086:L237Q;ENSP00000342518:L273Q;ENSP00000451990:L114Q	ENSP00000342518:L273Q	L	-	2	0	SLC35F4	57117782	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.265000	0.95647	2.333000	0.79357	0.482000	0.46254	CTG		0.428	SLC35F4-201	KNOWN	basic	protein_coding	protein_coding		XM_292260	
RYR3	6263	broad.mit.edu	37	15	34032066	34032066	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr15:34032066C>T	ENST00000389232.4	+	51	7760	c.7690C>T	c.(7690-7692)Cct>Tct	p.P2564S	RYR3_ENST00000415757.3_Missense_Mutation_p.P2564S	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2564	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.P2564S(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AATGGCCCTGCCTTGTCTCAG	0.468																																																1	Substitution - Missense(1)	ovary(1)	15											81.0	74.0	76.0					15																	34032066		1914	4104	6018	31819358	SO:0001583	missense	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7690C>T	15.37:g.34032066C>T	ENSP00000373884:p.Pro2564Ser	Somatic		Capture	Illumina GAIIx	Phase_I	31819358	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.923174	0.52653	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.97731	-4.51;-4.51	5.4	5.4	0.78164	.	0.135038	0.50627	D	0.000113	D	0.97424	0.9157	M	0.74389	2.26	0.58432	D	0.999996	P;B	0.45531	0.86;0.382	P;B	0.44561	0.453;0.146	D	0.97750	1.0214	10	0.54805	T	0.06	.	19.3716	0.94490	0.0:1.0:0.0:0.0	.	2564;2564	Q15413-2;Q15413	.;RYR3_HUMAN	S	2564	ENSP00000373884:P2564S;ENSP00000399610:P2564S	ENSP00000354735:P2564S	P	+	1	0	RYR3	31819358	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.596000	0.54024	2.805000	0.96524	0.655000	0.94253	CCT		0.468	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
NXN	64359	broad.mit.edu	37	17	704246	704246	+	Silent	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr17:704246G>A	ENST00000336868.3	-	8	1342	c.1251C>T	c.(1249-1251)atC>atT	p.I417I	NXN_ENST00000537628.2_Silent_p.I168I|NXN_ENST00000538650.1_Silent_p.I108I|NXN_ENST00000575801.1_Silent_p.I309I	NM_022463.4	NP_071908.2	Q6DKJ4	NXN_HUMAN	nucleoredoxin	417					cardiovascular system development (GO:0072358)|cell differentiation (GO:0030154)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-disulfide reductase activity (GO:0047134)|thioredoxin-disulfide reductase activity (GO:0004791)	p.I417I(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		AGGCCTCCACGATGGCGGGGG	0.567																																																1	Substitution - coding silent(1)	ovary(1)	17											64.0	60.0	62.0					17																	704246		2203	4300	6503	650996	SO:0001819	synonymous_variant	64359				CCDS10998.1, CCDS56013.1	17p13	2007-08-10			ENSG00000167693	ENSG00000167693			18008	protein-coding gene	gene with protein product		612895					Standard	NM_022463		Approved	FLJ12614, NRX	uc002fsa.3	Q6DKJ4	OTTHUMG00000090307	ENST00000336868.3:c.1251C>T	17.37:g.704246G>A		Somatic		Capture	Illumina GAIIx	Phase_I	650996	B4DXQ0|D3DTH2|Q3SWW6|Q6P3U6|Q7L4C6|Q9H9Q1	Silent	SNP	ENST00000336868.3	37	CCDS10998.1																																																																																				0.567	NXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206669.1		
TP53	7157	broad.mit.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	17	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	7517846	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys	Somatic		Capture	Illumina GAIIx	Phase_I	7517846	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MYH13	8735	broad.mit.edu	37	17	10250012	10250012	+	Silent	SNP	C	C	T	rs191213361		TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr17:10250012C>T	ENST00000418404.3	-	12	1411	c.1248G>A	c.(1246-1248)ggG>ggA	p.G416G	MYH13_ENST00000252172.4_Silent_p.G416G			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	416	Myosin motor.				cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.G416G(1)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GGACATTTTGCCCTTTAGTGA	0.448																																																1	Substitution - coding silent(1)	ovary(1)	17											118.0	110.0	113.0					17																	10250012		1974	4176	6150	10190737	SO:0001819	synonymous_variant	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.1248G>A	17.37:g.10250012C>T		Somatic		Capture	Illumina GAIIx	Phase_I	10190737	O95252|Q9P0U8	Silent	SNP	ENST00000418404.3	37	CCDS45613.1																																																																																				0.448	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
TRIM16	10626	broad.mit.edu	37	17	15535915	15535915	+	Nonsense_Mutation	SNP	G	G	T	rs145384017	byFrequency	TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr17:15535915G>T	ENST00000578237.1	-	9	1778	c.923C>A	c.(922-924)tCg>tAg	p.S308*	RP11-385D13.1_ENST00000455584.2_Nonsense_Mutation_p.S308*|TRIM16_ENST00000416464.2_Nonsense_Mutation_p.S178*|TRIM16_ENST00000579219.1_Intron|TRIM16_ENST00000577886.1_Nonsense_Mutation_p.S92*|TRIM16_ENST00000336708.7_Nonsense_Mutation_p.S308*			O95361	TRI16_HUMAN	tripartite motif containing 16	308					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)	p.S308*(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		GCGGATGCCCGAGAGTTTATC	0.448																																																1	Substitution - Nonsense(1)	ovary(1)	17											121.0	107.0	112.0					17																	15535915		2203	4300	6503	15476640	SO:0001587	stop_gained	10626			AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.923C>A	17.37:g.15535915G>T	ENSP00000463188:p.Ser308*	Somatic		Capture	Illumina GAIIx	Phase_I	15476640	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Nonsense_Mutation	SNP	ENST00000578237.1	37	CCDS11171.1	.	.	.	.	.	.	.	.	.	.	g	20.9	4.069036	0.76301	.	.	ENSG00000221926	ENST00000336708;ENST00000416464	.	.	.	4.8	3.84	0.44239	.	0.664334	0.14661	N	0.305963	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4291	0.50029	0.0895:0.0:0.9105:0.0	.	.	.	.	X	308;178	.	ENSP00000338989:S308X	S	-	2	0	TRIM16	15476640	0.998000	0.40836	0.897000	0.35233	0.320000	0.28249	3.153000	0.50685	1.156000	0.42514	-0.234000	0.12200	TCG		0.448	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130700.2	NM_006470	
KRT13	3860	broad.mit.edu	37	17	39658838	39658838	+	Silent	SNP	C	C	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr17:39658838C>G	ENST00000246635.3	-	6	1078	c.1032G>C	c.(1030-1032)ggG>ggC	p.G344G	AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Silent_p.G344G|KRT13_ENST00000587118.1_5'Flank|KRT13_ENST00000336861.3_Silent_p.G344G	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	344	Coil 2.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.G344G(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				TGTTCTCCAGCCCCGCTTTCT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	17											75.0	69.0	71.0					17																	39658838		2203	4300	6503	36912364	SO:0001819	synonymous_variant	3860				CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.1032G>C	17.37:g.39658838C>G		Somatic		Capture	Illumina GAIIx	Phase_I	36912364	Q53G54|Q6AZK5|Q8N240	Silent	SNP	ENST00000246635.3	37	CCDS11396.1																																																																																				0.632	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
ABCA8	10351	broad.mit.edu	37	17	66871410	66871410	+	Missense_Mutation	SNP	C	C	T	rs200226002		TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr17:66871410C>T	ENST00000269080.2	-	35	4639	c.4502G>A	c.(4501-4503)cGg>cAg	p.R1501Q	ABCA8_ENST00000430352.2_Missense_Mutation_p.R1541Q|ABCA8_ENST00000586539.1_Missense_Mutation_p.R1541Q	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1501					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.R1501Q(1)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CCTTTCCTGCCGAGCAGCCTG	0.453																																																1	Substitution - Missense(1)	ovary(1)	17											80.0	74.0	76.0					17																	66871410		2203	4300	6503	64383005	SO:0001583	missense	10351			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.4502G>A	17.37:g.66871410C>T	ENSP00000269080:p.Arg1501Gln	Somatic		Capture	Illumina GAIIx	Phase_I	64383005	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343486	0.61073	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.82255	-1.59;-1.59	5.37	3.24	0.37175	.	0.146272	0.30723	N	0.009016	T	0.68072	0.2961	L	0.37697	1.125	0.35033	D	0.759018	P;B;P	0.43885	0.527;0.301;0.82	B;B;B	0.28232	0.06;0.078;0.087	T	0.75328	-0.3356	10	0.39692	T	0.17	.	10.1386	0.42721	0.0:0.7881:0.1367:0.0751	.	1541;1541;1501	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	Q	1501;1541	ENSP00000269080:R1501Q;ENSP00000402814:R1541Q	ENSP00000269080:R1501Q	R	-	2	0	ABCA8	64383005	0.112000	0.22096	1.000000	0.80357	0.910000	0.53928	1.729000	0.38115	1.408000	0.46895	0.655000	0.94253	CGG		0.453	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
COL5A3	50509	broad.mit.edu	37	19	10106274	10106274	+	Missense_Mutation	SNP	C	C	T	rs573860973		TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr19:10106274C>T	ENST00000264828.3	-	16	1638	c.1553G>A	c.(1552-1554)gGa>gAa	p.G518E	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	518	Collagen-like 2.|Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.G518E(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TCCATGAGGTCCCTGCAGGCC	0.498																																																1	Substitution - Missense(1)	ovary(1)	19											57.0	52.0	54.0					19																	10106274		2203	4300	6503	9967274	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1553G>A	19.37:g.10106274C>T	ENSP00000264828:p.Gly518Glu	Somatic		Capture	Illumina GAIIx	Phase_I	9967274	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.509998	0.85282	.	.	ENSG00000080573	ENST00000264828	D	0.99619	-6.28	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000001	D	0.99840	0.9927	H	0.99626	4.665	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.96539	0.9399	10	0.87932	D	0	.	14.2733	0.66164	0.0:1.0:0.0:0.0	.	518	P25940	CO5A3_HUMAN	E	518	ENSP00000264828:G518E	ENSP00000264828:G518E	G	-	2	0	COL5A3	9967274	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.758000	0.68776	2.519000	0.84933	0.655000	0.94253	GGA		0.498	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
SLC1A6	6511	broad.mit.edu	37	19	15083684	15083684	+	Silent	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr19:15083684G>A	ENST00000221742.3	-	1	46	c.39C>T	c.(37-39)agC>agT	p.S13S	SLC1A6_ENST00000600144.1_Silent_p.S13S|SLC1A6_ENST00000598504.1_Silent_p.S13S|SLC1A6_ENST00000430939.2_Missense_Mutation_p.R18W|SLC1A6_ENST00000544886.2_Silent_p.S13S	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	13					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.S13S(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						GCCGCTGGCCGCTCTCCCGCA	0.682																																																1	Substitution - coding silent(1)	ovary(1)	19											6.0	8.0	7.0					19																	15083684		2081	4102	6183	14944684	SO:0001819	synonymous_variant	6511				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.39C>T	19.37:g.15083684G>A		Somatic		Capture	Illumina GAIIx	Phase_I	14944684	Q8N753	Silent	SNP	ENST00000221742.3	37	CCDS12321.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594868	0.28445	.	.	ENSG00000105143	ENST00000430939	T	0.75260	-0.92	4.25	-0.783	0.10958	.	.	.	.	.	T	0.62048	0.2396	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.54430	-0.8295	8	0.87932	D	0	-26.7728	7.0701	0.25173	0.484:0.0:0.516:0.0	.	18	E7EV13	.	W	18	ENSP00000409386:R18W	ENSP00000409386:R18W	R	-	1	2	SLC1A6	14944684	0.902000	0.30710	0.999000	0.59377	0.967000	0.64934	0.089000	0.15002	-0.044000	0.13491	0.313000	0.20887	CGG		0.682	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071	
FBXO27	126433	broad.mit.edu	37	19	39517637	39517637	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr19:39517637G>T	ENST00000292853.4	-	5	700	c.581C>A	c.(580-582)gCc>gAc	p.A194D	FBXO27_ENST00000600828.1_Missense_Mutation_p.A193D|FBXO27_ENST00000509137.2_Missense_Mutation_p.A194D	NM_178820.3	NP_849142.1	Q8NI29	FBX27_HUMAN	F-box protein 27	194	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)	p.A194D(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|urinary_tract(2)	17	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GTCGTGTCGGGCTCCCCACCT	0.567																																																1	Substitution - Missense(1)	ovary(1)	19											90.0	91.0	91.0					19																	39517637		2203	4300	6503	44209477	SO:0001583	missense	126433			AF436061	CCDS12527.1	19q13.2	2008-02-05	2004-06-15			ENSG00000161243		"""F-boxes /  ""other"""""	18753	protein-coding gene	gene with protein product		609099	"""F-box only protein 27"""			126433	Standard	NM_178820		Approved	Fbg5, Fbx27	uc002okh.3	Q8NI29		ENST00000292853.4:c.581C>A	19.37:g.39517637G>T	ENSP00000292853:p.Ala194Asp	Somatic		Capture	Illumina GAIIx	Phase_I	44209477	Q96C87	Missense_Mutation	SNP	ENST00000292853.4	37	CCDS12527.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482354	0.44147	.	.	ENSG00000161243	ENST00000292853;ENST00000509137	T;T	0.28666	1.6;1.6	3.97	2.92	0.33932	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.413589	0.19534	N	0.111967	T	0.22704	0.0548	L	0.49126	1.545	0.31909	N	0.614941	B	0.31256	0.316	B	0.28991	0.097	T	0.19386	-1.0307	10	0.11182	T	0.66	-12.083	8.6777	0.34189	0.0:0.0:0.7506:0.2494	.	194	Q8NI29	FBX27_HUMAN	D	194	ENSP00000292853:A194D;ENSP00000437662:A194D	ENSP00000292853:A194D	A	-	2	0	FBXO27	44209477	0.084000	0.21492	0.852000	0.33557	0.063000	0.16089	1.094000	0.30951	0.976000	0.38417	0.491000	0.48974	GCC		0.567	FBXO27-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463281.1		
NLRP4	147945	broad.mit.edu	37	19	56370584	56370584	+	Missense_Mutation	SNP	G	G	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr19:56370584G>T	ENST00000301295.6	+	3	2247	c.1825G>T	c.(1825-1827)Gtc>Ttc	p.V609F	NLRP4_ENST00000587891.1_Missense_Mutation_p.V534F|NLRP4_ENST00000346986.5_Missense_Mutation_p.V609F	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	609					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.V609F(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CGTTCAAAATGTCTTTAAGAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	19											67.0	63.0	64.0					19																	56370584		2203	4299	6502	61062396	SO:0001583	missense	147945			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1825G>T	19.37:g.56370584G>T	ENSP00000301295:p.Val609Phe	Somatic		Capture	Illumina GAIIx	Phase_I	61062396	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.696032	0.48202	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.52754	0.65;0.65	3.47	-3.15	0.05233	.	.	.	.	.	T	0.53158	0.1779	L	0.52905	1.665	0.09310	N	1	D;D;D	0.69078	0.991;0.997;0.99	D;D;P	0.67548	0.952;0.937;0.854	T	0.46789	-0.9166	9	0.51188	T	0.08	.	4.5558	0.12136	0.2574:0.3111:0.4315:0.0	.	609;534;609	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	F	609	ENSP00000301295:V609F;ENSP00000344787:V609F	ENSP00000301295:V609F	V	+	1	0	NLRP4	61062396	0.013000	0.17824	0.001000	0.08648	0.003000	0.03518	0.593000	0.23999	-0.467000	0.06932	0.591000	0.81541	GTC		0.408	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
NLRP4	147945	broad.mit.edu	37	19	56373461	56373461	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr19:56373461C>T	ENST00000301295.6	+	5	2544	c.2122C>T	c.(2122-2124)Cgt>Tgt	p.R708C	NLRP4_ENST00000587891.1_Missense_Mutation_p.R633C|NLRP4_ENST00000346986.5_Missense_Mutation_p.R708C	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	708			R -> H (in dbSNP:rs12462372).		inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)	p.R708C(1)		breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GAAACTCTCTCGTGATGACAT	0.468																																																1	Substitution - Missense(1)	ovary(1)	19											142.0	127.0	132.0					19																	56373461		2203	4300	6503	61065273	SO:0001583	missense	147945			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2122C>T	19.37:g.56373461C>T	ENSP00000301295:p.Arg708Cys	Somatic		Capture	Illumina GAIIx	Phase_I	61065273	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	37	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.691663	0.30052	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.53857	0.6;0.6	3.26	-1.55	0.08558	.	.	.	.	.	T	0.51143	0.1657	N	0.24115	0.695	0.09310	N	1	B;D;D	0.89917	0.129;1.0;1.0	B;D;D	0.70016	0.059;0.967;0.927	T	0.44112	-0.9349	9	0.48119	T	0.1	.	6.4783	0.22049	0.0:0.5232:0.0:0.4768	.	708;633;708	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	C	708	ENSP00000301295:R708C;ENSP00000344787:R708C	ENSP00000301295:R708C	R	+	1	0	NLRP4	61065273	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.147000	0.10234	-0.184000	0.10567	0.563000	0.77884	CGT		0.468	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
NPAS2	4862	broad.mit.edu	37	2	101580581	101580581	+	Silent	SNP	A	A	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Sequenom;Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr2:101580581A>G	ENST00000335681.5	+	8	945	c.660A>G	c.(658-660)ctA>ctG	p.L220L	NPAS2_ENST00000486017.1_3'UTR|NPAS2_ENST00000542504.1_Silent_p.L285L	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	220					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.L220L(1)		cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGGTGCCACTAGGAAAGGAGG	0.512																																																1	Substitution - coding silent(1)	ovary(1)	2											126.0	116.0	120.0					2																	101580581		2203	4300	6503	100947013	SO:0001819	synonymous_variant	4862			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.660A>G	2.37:g.101580581A>G		Somatic		Capture	Illumina GAIIx	Phase_I	100947013	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Silent	SNP	ENST00000335681.5	37	CCDS2048.1																																																																																				0.512	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3		
CACNB4	785	broad.mit.edu	37	2	152728962	152728962	+	Silent	SNP	A	A	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr2:152728962A>T	ENST00000539935.1	-	6	634	c.567T>A	c.(565-567)tcT>tcA	p.S189S	CACNB4_ENST00000397327.2_Silent_p.S142S|CACNB4_ENST00000534999.1_Silent_p.S155S|CACNB4_ENST00000360283.6_Silent_p.S155S|CACNB4_ENST00000201943.5_Silent_p.S189S|CACNB4_ENST00000427385.1_Silent_p.S171S	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit	189					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.S189S(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGAATGTCCCAGATACCATTT	0.363																																																1	Substitution - coding silent(1)	ovary(1)	2											118.0	117.0	118.0					2																	152728962		1829	4086	5915	152437208	SO:0001819	synonymous_variant	785			AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.567T>A	2.37:g.152728962A>T		Somatic		Capture	Illumina GAIIx	Phase_I	152437208	A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Silent	SNP	ENST00000539935.1	37	CCDS46426.1																																																																																				0.363	CACNB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338385.4	NM_000726.3	
TTN	7273	broad.mit.edu	37	2	179612115	179612115	+	Intron	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr2:179612115G>A	ENST00000591111.1	-	46	10585				TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000360870.5_Silent_p.D5004D|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.D5004D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAAATATAAGTCAGGGGACT	0.368																																																1	Substitution - coding silent(1)	ovary(1)	2											60.0	66.0	64.0					2																	179612115		2201	4297	6498	179320360	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-5467C>T	2.37:g.179612115G>A		Somatic		Capture	Illumina GAIIx	Phase_I	179320360	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF280B	140883	broad.mit.edu	37	22	22843712	22843712	+	Silent	SNP	T	T	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr22:22843712T>C	ENST00000406426.1	-	4	754	c.12A>G	c.(10-12)tcA>tcG	p.S4S	ZNF280B_ENST00000360412.2_Silent_p.S4S			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S4S(1)		autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CTTCCTCACATGATTGTTCCA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	22											101.0	92.0	95.0					22																	22843712		2203	4300	6503	21173712	SO:0001819	synonymous_variant	140883			AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.12A>G	22.37:g.22843712T>C		Somatic		Capture	Illumina GAIIx	Phase_I	21173712		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																				0.398	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
CPNE9	151835	broad.mit.edu	37	3	9760228	9760228	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr3:9760228C>T	ENST00000383832.3	+	17	1373	c.1183C>T	c.(1183-1185)Cgc>Tgc	p.R395C	CPNE9_ENST00000383831.3_Missense_Mutation_p.R395C	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX	395	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R395C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					CCAGAGCCTGCGCACAGTGCA	0.567																																																1	Substitution - Missense(1)	ovary(1)	3											108.0	108.0	108.0					3																	9760228		2007	4178	6185	9735228	SO:0001583	missense	151835				CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.1183C>T	3.37:g.9760228C>T	ENSP00000373343:p.Arg395Cys	Somatic		Capture	Illumina GAIIx	Phase_I	9735228	A1L430|A6NDX6|A8MSP8	Missense_Mutation	SNP	ENST00000383832.3	37	CCDS2574.2	.	.	.	.	.	.	.	.	.	.	C	21.9	4.210425	0.79240	.	.	ENSG00000144550	ENST00000383832;ENST00000383831	T;T	0.24350	1.86;1.86	5.44	5.44	0.79542	von Willebrand factor, type A (2);Copine (1);	0.000000	0.85682	D	0.000000	T	0.52533	0.1740	M	0.81179	2.53	0.80722	D	1	D	0.71674	0.998	P	0.62382	0.901	T	0.54282	-0.8317	9	.	.	.	.	18.8695	0.92308	0.0:1.0:0.0:0.0	.	395	Q8IYJ1	CPNE9_HUMAN	C	395	ENSP00000373343:R395C;ENSP00000373342:R395C	.	R	+	1	0	CPNE9	9735228	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.589000	0.36644	2.533000	0.85409	0.579000	0.79373	CGC		0.567	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250205.4	NM_001033755	
HDAC11	79885	broad.mit.edu	37	3	13538271	13538271	+	Silent	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr3:13538271C>T	ENST00000295757.3	+	4	471	c.288C>T	c.(286-288)ccC>ccT	p.P96P	HDAC11_ENST00000404040.1_Intron|HDAC11_ENST00000433119.1_Silent_p.P68P|HDAC11_ENST00000405025.1_Intron|HDAC11_ENST00000446613.2_Intron|HDAC11_ENST00000522202.1_Intron|HDAC11_ENST00000402271.1_Intron|HDAC11_ENST00000437379.2_Silent_p.P68P|HDAC11_ENST00000404548.1_Intron|HDAC11_ENST00000402259.1_Intron	NM_024827.3	NP_079103.2	Q96DB2	HDA11_HUMAN	histone deacetylase 11	96	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|oligodendrocyte development (GO:0014003)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)	p.P96P(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(4)|prostate(3)	13						CAGAAATCCCCCCCGTTATCT	0.587											OREG0015411	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	3											94.0	91.0	92.0					3																	13538271		2203	4300	6503	13513271	SO:0001819	synonymous_variant	79885			AK025426	CCDS2615.1, CCDS46760.1	3p25.1	2008-07-18			ENSG00000163517	ENSG00000163517	3.5.1.98		19086	protein-coding gene	gene with protein product		607226				11948178	Standard	NM_001136041		Approved		uc003bxy.3	Q96DB2	OTTHUMG00000129800	ENST00000295757.3:c.288C>T	3.37:g.13538271C>T		Somatic	688	Capture	Illumina GAIIx	Phase_I	13513271	B4DDK1|Q9H6I7|Q9H6X3|Q9NTC9	Silent	SNP	ENST00000295757.3	37	CCDS2615.1																																																																																				0.587	HDAC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252028.5	NM_024827	
MST1R	4486	broad.mit.edu	37	3	49932680	49932680	+	Missense_Mutation	SNP	G	G	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr3:49932680G>C	ENST00000296474.3	-	14	3218	c.3191C>G	c.(3190-3192)tCt>tGt	p.S1064C	MST1R_ENST00000344206.4_Missense_Mutation_p.S1015C	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	1064					cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)	p.S1064C(1)		cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CAAGAGCGCAGAGTCCAGGTC	0.577																																																1	Substitution - Missense(1)	ovary(1)	3											187.0	185.0	186.0					3																	49932680		2203	4300	6503	49907684	SO:0001583	missense	4486			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.3191C>G	3.37:g.49932680G>C	ENSP00000296474:p.Ser1064Cys	Somatic		Capture	Illumina GAIIx	Phase_I	49907684	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	ENST00000296474.3	37	CCDS2807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.526373|4.526373	0.85600|0.85600	.|.	.|.	ENSG00000164078|ENSG00000164078	ENST00000440292|ENST00000296474;ENST00000344206	.|T;T	.|0.08546	.|3.08;3.08	5.84|5.84	4.02|4.02	0.46733|0.46733	.|Protein kinase-like domain (1);	.|0.416320	.|0.30658	.|N	.|0.009147	T|T	0.11281|0.11281	0.0275|0.0275	L|L	0.60455|0.60455	1.87|1.87	0.09310|0.09310	N|N	1|1	.|P	.|0.52692	.|0.955	.|B	.|0.42319	.|0.383	T|T	0.08310|0.08310	-1.0728|-1.0728	5|10	.|0.87932	.|D	.|0	-0.5334|-0.5334	12.1313|12.1313	0.53944|0.53944	0.0:0.1301:0.7344:0.1355|0.0:0.1301:0.7344:0.1355	.|.	.|1064	.|Q04912	.|RON_HUMAN	V|C	85|1064;1015	.|ENSP00000296474:S1064C;ENSP00000341325:S1015C	.|ENSP00000296474:S1064C	L|S	-|-	1|2	2|0	MST1R|MST1R	49907684|49907684	0.944000|0.944000	0.32072|0.32072	0.001000|0.001000	0.08648|0.08648	0.622000|0.622000	0.37654|0.37654	5.448000|5.448000	0.66612|0.66612	0.793000|0.793000	0.33875|0.33875	0.561000|0.561000	0.74099|0.74099	CTG|TCT		0.577	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1		
NRROS	375387	broad.mit.edu	37	3	196387726	196387726	+	Silent	SNP	G	G	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr3:196387726G>C	ENST00000328557.4	+	3	1415	c.1212G>C	c.(1210-1212)ctG>ctC	p.L404L		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	404					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L404L(1)									TGGGCAGCCTGCGCTTGTTCA	0.642																																																1	Substitution - coding silent(1)	ovary(1)	3											54.0	59.0	57.0					3																	196387726		2203	4300	6503	197872123	SO:0001819	synonymous_variant	375387			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1212G>C	3.37:g.196387726G>C		Somatic		Capture	Illumina GAIIx	Phase_I	197872123		Silent	SNP	ENST00000328557.4	37	CCDS3319.1																																																																																				0.642	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
APBB2	323	broad.mit.edu	37	4	40829237	40829237	+	Splice_Site	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr4:40829237C>T	ENST00000295974.8	-	14	2271		c.e14-1		APBB2_ENST00000543538.1_Splice_Site|Y_RNA_ENST00000384466.1_RNA|APBB2_ENST00000504305.1_Splice_Site|RP11-632F7.3_ENST00000513127.1_RNA|APBB2_ENST00000506352.1_Splice_Site|APBB2_ENST00000508593.1_Splice_Site|APBB2_ENST00000502841.1_Splice_Site|APBB2_ENST00000513140.1_Splice_Site	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2						axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)	p.?(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						CAGCCATAATCTAAGGGGGAA	0.502																																					Ovarian(3;20 75 16686 49997)											1	Unknown(1)	ovary(1)	4											121.0	120.0	120.0					4																	40829237		1964	4148	6112	40523994	SO:0001630	splice_region_variant	323			U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.1642-1G>A	4.37:g.40829237C>T		Somatic		Capture	Illumina GAIIx	Phase_I	40523994	B4DSL4|E9PG87|Q8IUI6	Splice_Site	SNP	ENST00000295974.8	37	CCDS54761.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046215	0.75846	.	.	ENSG00000163697	ENST00000295974;ENST00000316212;ENST00000513140;ENST00000513611;ENST00000508593;ENST00000506352;ENST00000512510;ENST00000513493	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2562	0.98421	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	APBB2	40523994	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	7.487000	0.81328	2.797000	0.96272	0.563000	0.77884	.		0.502	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360523.3	NM_173075	Intron
PHOX2B	8929	broad.mit.edu	37	4	41749461	41749461	+	Missense_Mutation	SNP	C	C	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr4:41749461C>G	ENST00000226382.2	-	2	693	c.334G>C	c.(334-336)Gag>Cag	p.E112Q	RP11-227F19.2_ENST00000510602.1_lincRNA|RP11-227F19.1_ENST00000508038.1_RNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	112					autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)	p.E112Q(1)		autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						CTTTCCAGCTCTTTGAGCTGG	0.592			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																													yes	Rec	yes	familial neuroblastoma	4	4p12	8929	paired-like homeobox 2b	yes	O	1	Substitution - Missense(1)	ovary(1)	4											68.0	73.0	71.0					4																	41749461		2203	4300	6503	41444218	SO:0001583	missense	8929	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.334G>C	4.37:g.41749461C>G	ENSP00000226382:p.Glu112Gln	Somatic		Capture	Illumina GAIIx	Phase_I	41444218	Q6PJD9	Missense_Mutation	SNP	ENST00000226382.2	37	CCDS3463.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.37|17.37	3.373075|3.373075	0.61624|0.61624	.|.	.|.	ENSG00000109132|ENSG00000109132	ENST00000226382|ENST00000510424	D|D	0.96619|0.96232	-4.07|-3.95	5.4|5.4	5.4|5.4	0.78164|0.78164	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.96772|0.96772	0.8946|0.8946	L|L	0.52266|0.52266	1.64|1.64	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.96048|0.96048	0.9029|0.9029	10|7	0.66056|0.42905	D|T	0.02|0.14	.|.	19.366|19.366	0.94461|0.94461	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	112|.	Q99453|.	PHX2B_HUMAN|.	Q|N	112|51	ENSP00000226382:E112Q|ENSP00000426733:K51N	ENSP00000226382:E112Q|ENSP00000426733:K51N	E|K	-|-	1|3	0|2	PHOX2B|PHOX2B	41444218|41444218	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.807000|0.807000	0.45602|0.45602	7.599000|7.599000	0.82757|0.82757	2.797000|2.797000	0.96272|0.96272	0.655000|0.655000	0.94253|0.94253	GAG|AAG		0.592	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216832.2		
ELF2	1998	broad.mit.edu	37	4	139980194	139980194	+	Silent	SNP	T	T	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr4:139980194T>C	ENST00000394235.2	-	10	2191	c.1689A>G	c.(1687-1689)tcA>tcG	p.S563S	ELF2_ENST00000379550.1_Silent_p.S575S|ELF2_ENST00000379549.2_Silent_p.S486S|ELF2_ENST00000515489.1_Intron|ELF2_ENST00000265495.4_Silent_p.S563S|ELF2_ENST00000358635.3_Silent_p.S515S|ELF2_ENST00000510408.1_Silent_p.S503S	NM_001276458.1	NP_001263387.1			E74-like factor 2 (ets domain transcription factor)									p.S563S(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	19	all_hematologic(180;0.162)					GGGCAATAGCTGAAGGCGCAC	0.433																																																1	Substitution - coding silent(1)	ovary(1)	4											132.0	132.0	132.0					4																	139980194		2203	4300	6503	140199644	SO:0001819	synonymous_variant	1998			AF256222	CCDS3744.1, CCDS3745.1, CCDS64062.1, CCDS64063.1	4q28	2008-02-05			ENSG00000109381	ENSG00000109381			3317	protein-coding gene	gene with protein product						8756667	Standard	NM_201999		Approved	EU32, NERF, NERF-2, NERF-1A, NERF-1B	uc003ihm.2	Q15723	OTTHUMG00000133383	ENST00000394235.2:c.1689A>G	4.37:g.139980194T>C		Somatic		Capture	Illumina GAIIx	Phase_I	140199644		Silent	SNP	ENST00000394235.2	37	CCDS3744.1																																																																																				0.433	ELF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257233.2	NM_006874	
ASIC5	51802	broad.mit.edu	37	4	156784635	156784635	+	Missense_Mutation	SNP	C	C	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr4:156784635C>A	ENST00000537611.2	-	2	358	c.312G>T	c.(310-312)atG>atT	p.M104I	TDO2_ENST00000506181.1_Intron	NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	104					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)	p.M104I(1)									CTGGGAACTCCATCTTTTCCA	0.363																																																1	Substitution - Missense(1)	ovary(1)	4											74.0	65.0	68.0					4																	156784635		2203	4300	6503	157004085	SO:0001583	missense	51802			AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.312G>T	4.37:g.156784635C>A	ENSP00000442477:p.Met104Ile	Somatic		Capture	Illumina GAIIx	Phase_I	157004085		Missense_Mutation	SNP	ENST00000537611.2	37	CCDS3793.1	.	.	.	.	.	.	.	.	.	.	C	3.244	-0.154782	0.06544	.	.	ENSG00000256394	ENST00000537611	T	0.62498	0.02	4.34	-5.59	0.02505	.	0.278282	0.29073	N	0.013221	T	0.17789	0.0427	N	0.00894	-1.105	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.32375	-0.9909	10	0.05833	T	0.94	-15.9997	4.3161	0.10993	0.3461:0.1053:0.4521:0.0965	.	104	Q9NY37	ACCN5_HUMAN	I	104	ENSP00000442477:M104I	ENSP00000264432:M104I	M	-	3	0	ACCN5	157004085	0.217000	0.23597	0.979000	0.43373	0.998000	0.95712	-0.868000	0.04236	-0.759000	0.04684	0.650000	0.86243	ATG		0.363	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1		
NR3C1	2908	broad.mit.edu	37	5	142661473	142661473	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr5:142661473A>G	ENST00000343796.2	-	9	3308	c.2315T>C	c.(2314-2316)cTt>cCt	p.L772P	NR3C1_ENST00000415690.2_Intron|NR3C1_ENST00000231509.3_Missense_Mutation_p.L773P|NR3C1_ENST00000394466.2_Missense_Mutation_p.L773P|NR3C1_ENST00000394464.2_Missense_Mutation_p.L772P|NR3C1_ENST00000424646.2_Missense_Mutation_p.L746P|NR3C1_ENST00000416954.2_Missense_Mutation_p.L375P|NR3C1_ENST00000503201.1_Missense_Mutation_p.L772P|NR3C1_ENST00000504572.1_Missense_Mutation_p.L773P	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	772	Interaction with CLOCK.|Steroid-binding.				adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)	p.L773P(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	ATGAAACAGAAGTTTTTTGAT	0.318																																																1	Substitution - Missense(1)	ovary(1)	5											87.0	90.0	89.0					5																	142661473		2202	4300	6502	142641666	SO:0001583	missense	2908			X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.2315T>C	5.37:g.142661473A>G	ENSP00000343205:p.Leu772Pro	Somatic		Capture	Illumina GAIIx	Phase_I	142641666	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	ENST00000343796.2	37	CCDS4278.1	.	.	.	.	.	.	.	.	.	.	A	18.30	3.593056	0.66219	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000361001;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000416954;ENST00000503201	D;D;D;D;D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78;-3.78	5.93	5.93	0.95920	Nuclear hormone receptor, ligand-binding (1);	0.000000	0.85682	D	0.000000	D	0.97300	0.9117	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97948	1.0330	10	0.87932	D	0	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	772;773	P04150;E5KQF6	GCR_HUMAN;.	P	772;772;588;746;773;773;773;375;772	ENSP00000377977:L772P;ENSP00000343205:L772P;ENSP00000405282:L746P;ENSP00000422518:L773P;ENSP00000377979:L773P;ENSP00000231509:L773P;ENSP00000404218:L375P;ENSP00000427672:L772P	ENSP00000231509:L773P	L	-	2	0	NR3C1	142641666	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.281000	0.76405	0.533000	0.62120	CTT		0.318	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000370829.1		
CARD11	84433	broad.mit.edu	37	7	2962385	2962385	+	Missense_Mutation	SNP	A	A	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr7:2962385A>C	ENST00000396946.4	-	17	2555	c.2152T>G	c.(2152-2154)Tgc>Ggc	p.C718G		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	718	PDZ.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.C711G(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCTCGGATGCAGCCTTCTAGC	0.602			Mis		DLBCL																																		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	1	Substitution - Missense(1)	ovary(1)	7											107.0	73.0	84.0					7																	2962385		2203	4300	6503	2928911	SO:0001583	missense	84433			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2152T>G	7.37:g.2962385A>C	ENSP00000380150:p.Cys718Gly	Somatic		Capture	Illumina GAIIx	Phase_I	2928911	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	A	8.397	0.841125	0.16891	.	.	ENSG00000198286	ENST00000396946;ENST00000355508	T;T	0.30448	1.53;2.51	5.14	5.14	0.70334	PDZ/DHR/GLGF (2);	0.162006	0.56097	D	0.000025	T	0.14743	0.0356	N	0.08118	0	0.42015	D	0.990951	B	0.19200	0.034	B	0.18561	0.022	T	0.11397	-1.0589	10	0.10377	T	0.69	-20.4557	11.3402	0.49529	0.8643:0.0:0.0:0.1357	.	718	Q9BXL7	CAR11_HUMAN	G	718;189	ENSP00000380150:C718G;ENSP00000347695:C189G	ENSP00000347695:C189G	C	-	1	0	CARD11	2928911	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	5.404000	0.66344	1.941000	0.56285	0.454000	0.30748	TGC		0.602	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
NPC1L1	29881	broad.mit.edu	37	7	44575901	44575901	+	Missense_Mutation	SNP	A	A	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr7:44575901A>G	ENST00000289547.4	-	4	1863	c.1808T>C	c.(1807-1809)tTc>tCc	p.F603S	NPC1L1_ENST00000423141.1_Missense_Mutation_p.F603S|NPC1L1_ENST00000546276.1_Missense_Mutation_p.F603S|NPC1L1_ENST00000381160.3_Missense_Mutation_p.F603S	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	603					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)	p.F603S(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CCGACGCTGGAAGGCTCGCAT	0.622																																																1	Substitution - Missense(1)	ovary(1)	7											80.0	78.0	79.0					7																	44575901		2203	4300	6503	44542426	SO:0001583	missense	29881				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1808T>C	7.37:g.44575901A>G	ENSP00000289547:p.Phe603Ser	Somatic		Capture	Illumina GAIIx	Phase_I	44542426	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	37	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	a	12.02	1.813487	0.32053	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276;ENST00000423141	D;D;D;D	0.93247	-3.14;-3.15;-3.19;-1.88	4.11	4.11	0.48088	.	0.068268	0.64402	D	0.000012	D	0.92665	0.7669	L	0.51422	1.61	0.36997	D	0.895086	B;D;B;P	0.57571	0.109;0.98;0.43;0.944	B;P;B;P	0.53649	0.03;0.731;0.162;0.544	D	0.92761	0.6224	10	0.42905	T	0.14	-22.3803	9.4878	0.38940	1.0:0.0:0.0:0.0	.	603;603;603;603	B7ZLE6;Q9UHC9-3;Q17RV5;D3DVK9	.;.;.;.	S	603	ENSP00000289547:F603S;ENSP00000370552:F603S;ENSP00000438033:F603S;ENSP00000404670:F603S	ENSP00000289547:F603S	F	-	2	0	NPC1L1	44542426	1.000000	0.71417	0.902000	0.35471	0.354000	0.29330	4.948000	0.63590	1.478000	0.48253	0.248000	0.18094	TTC		0.622	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
ADCY1	107	broad.mit.edu	37	7	45750217	45750217	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr7:45750217G>A	ENST00000297323.7	+	19	3045	c.3023G>A	c.(3022-3024)cGg>cAg	p.R1008Q		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	1008					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.R1008Q(2)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GTGGCCAGTCGGATGGATAGC	0.562																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	7											70.0	62.0	65.0					7																	45750217		2203	4300	6503	45716742	SO:0001583	missense	107			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.3023G>A	7.37:g.45750217G>A	ENSP00000297323:p.Arg1008Gln	Somatic		Capture	Illumina GAIIx	Phase_I	45716742	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040832	0.93685	.	.	ENSG00000164742	ENST00000297323;ENST00000545300	T	0.55588	0.51	4.75	3.87	0.44632	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.77260	0.4104	M	0.93939	3.475	0.49687	D	0.999818	D	0.89917	1.0	D	0.97110	1.0	T	0.82178	-0.0586	10	0.87932	D	0	.	11.086	0.48086	0.091:0.0:0.909:0.0	.	1008	Q08828	ADCY1_HUMAN	Q	1008	ENSP00000297323:R1008Q	ENSP00000297323:R1008Q	R	+	2	0	ADCY1	45716742	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	9.044000	0.93805	1.362000	0.46000	0.561000	0.74099	CGG		0.562	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
PARP12	64761	broad.mit.edu	37	7	139727147	139727147	+	Silent	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr7:139727147G>A	ENST00000263549.3	-	10	2430	c.1557C>T	c.(1555-1557)cgC>cgT	p.R519R		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	519	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.R519R(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					AAGGCAGCGTGCGGTTAAAGA	0.502																																																1	Substitution - coding silent(1)	ovary(1)	7											110.0	103.0	106.0					7																	139727147		2203	4300	6503	139373616	SO:0001819	synonymous_variant	64761			AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.1557C>T	7.37:g.139727147G>A		Somatic		Capture	Illumina GAIIx	Phase_I	139373616	Q9H610|Q9NP36|Q9NTI3	Silent	SNP	ENST00000263549.3	37	CCDS5857.1																																																																																				0.502	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348413.1	NM_022750	
OR2A5	393046	broad.mit.edu	37	7	143748085	143748085	+	Silent	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr7:143748085G>A	ENST00000408906.2	+	1	625	c.591G>A	c.(589-591)gtG>gtA	p.V197V		NM_012365.1	NP_036497.1	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A, member 5	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V197V(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(23)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	38	Melanoma(164;0.0783)					TCAACCAGGTGGTCATCTTTG	0.572																																																1	Substitution - coding silent(1)	ovary(1)	7											150.0	153.0	152.0					7																	143748085		2004	4177	6181	143379018	SO:0001819	synonymous_variant	393046			U86278	CCDS43668.1	7q35	2013-09-20	2003-11-24		ENSG00000221836	ENSG00000221836		"""GPCR / Class A : Olfactory receptors"""	8232	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 5"""	OR2A8, OR2A26		9500546	Standard	NM_012365		Approved	OR7-138, OR7-141	uc011ktw.2	Q96R48	OTTHUMG00000158006	ENST00000408906.2:c.591G>A	7.37:g.143748085G>A		Somatic		Capture	Illumina GAIIx	Phase_I	143379018	B9EGX2|O43885|O43888	Silent	SNP	ENST00000408906.2	37	CCDS43668.1																																																																																				0.572	OR2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349986.1		
FRMPD1	22844	broad.mit.edu	37	9	37745741	37745741	+	Missense_Mutation	SNP	G	G	T	rs62640014	byFrequency	TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr9:37745741G>T	ENST00000539465.1	+	16	4305	c.3712G>T	c.(3712-3714)Gat>Tat	p.D1238Y	FRMPD1_ENST00000377765.3_Missense_Mutation_p.D1238Y|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1238						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.D1238Y(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		GACAGGGCAAGATATAGCCCC	0.522													G|||	23	0.00459265	0.0174	0.0	5008	,	,		18746	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9						G	TYR/ASP	38,4368	42.3+/-75.8	0,38,2165	82.0	82.0	82.0		3712	1.1	0.0	9	dbSNP_129	82	1,8599	1.2+/-3.3	0,1,4299	yes	missense	FRMPD1	NM_014907.2	160	0,39,6464	TT,TG,GG		0.0116,0.8625,0.2999	probably-damaging	1238/1579	37745741	39,12967	2203	4300	6503	37735741	SO:0001583	missense	22844			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3712G>T	9.37:g.37745741G>T	ENSP00000444411:p.Asp1238Tyr	Somatic		Capture	Illumina GAIIx	Phase_I	37735741	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	15.86	2.958334	0.53400	0.008625	1.16E-4	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.10005	2.92;2.92	5.29	1.08	0.20341	.	0.978445	0.08425	N	0.947715	T	0.08268	0.0206	L	0.27053	0.805	0.09310	N	1	D	0.56968	0.978	P	0.52267	0.694	T	0.28490	-1.0042	10	0.62326	D	0.03	-1.2993	4.6247	0.12472	0.2747:0.1612:0.564:0.0	rs62640014	1238	Q5SYB0	FRPD1_HUMAN	Y	1238	ENSP00000366995:D1238Y;ENSP00000444411:D1238Y	ENSP00000366995:D1238Y	D	+	1	0	FRMPD1	37735741	0.091000	0.21658	0.001000	0.08648	0.113000	0.19764	1.983000	0.40648	0.641000	0.30601	0.556000	0.70494	GAT		0.522	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
SPATA31A7	26165	broad.mit.edu	37	9	65507538	65507538	+	Missense_Mutation	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr9:65507538C>T	ENST00000355045.2	-	3	305	c.277G>A	c.(277-279)Gag>Aag	p.E93K	SPATA31A7_ENST00000491812.2_5'UTR	NM_015667.2	NP_056482.2	Q8IWB4	S31A7_HUMAN	SPATA31 subfamily A, member 7	93					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.E93K(1)									TCCGAAGTCTCCTCCAGGCCT	0.622																																																1	Substitution - Missense(1)	ovary(1)	9											23.0	26.0	25.0					9																	65507538		980	2421	3401	65247358	SO:0001583	missense	26165				CCDS75838.1	9q12	2014-04-11	2012-10-12	2012-10-12	ENSG00000234734	ENSG00000276040			32007	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A7"""	FAM75A7		20850414	Standard	NM_015667		Approved	OTTHUMG00000013196		Q8IWB4	OTTHUMG00000188536	ENST00000355045.2:c.277G>A	9.37:g.65507538C>T	ENSP00000347153:p.Glu93Lys	Somatic		Capture	Illumina GAIIx	Phase_I	65247358	Q5TZK4|Q9Y4Q5	Missense_Mutation	SNP	ENST00000355045.2	37	CCDS43825.1	.	.	.	.	.	.	.	.	.	.	C	2.412	-0.335090	0.05278	.	.	ENSG00000234734	ENST00000355045	T	0.10573	2.86	1.58	-0.805	0.10879	.	1.309130	0.05490	N	0.556445	T	0.09555	0.0235	L	0.56199	1.76	0.09310	N	1	P	0.39883	0.693	B	0.37888	0.26	T	0.30534	-0.9975	10	0.20046	T	0.44	.	2.2196	0.03969	0.2973:0.5016:0.0:0.2011	.	93	Q8IWB4	F75A7_HUMAN	K	93	ENSP00000347153:E93K	ENSP00000347153:E93K	E	-	1	0	FAM75A7	65247358	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.001000	0.13038	-0.180000	0.10637	-1.608000	0.00805	GAG		0.622	SPATA31A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036952.1	NM_015667	
OMD	4958	broad.mit.edu	37	9	95179820	95179820	+	Missense_Mutation	SNP	T	T	C			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr9:95179820T>C	ENST00000375550.4	-	2	296	c.21A>G	c.(19-21)atA>atG	p.I7M	CENPP_ENST00000375587.3_Intron	NM_005014.2	NP_005005.1	Q99983	OMD_HUMAN	osteomodulin	7					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)		p.I7M(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|skin(2)	16						AAATAACATATATTGGACTTA	0.328			T	USP6	aneurysmal bone cysts																																		Dom	yes		9	9q22.31	4958	osteomodulin		M	1	Substitution - Missense(1)	ovary(1)	9											29.0	29.0	29.0					9																	95179820		2203	4300	6503	94219641	SO:0001583	missense	4958			AB000114	CCDS6696.1	9q22.31	2008-02-05			ENSG00000127083	ENSG00000127083		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8134	protein-coding gene	gene with protein product	"""osteoadherin proteoglycan"""						Standard	NM_005014		Approved	osteoadherin, SLRR2C	uc004asd.4	Q99983	OTTHUMG00000020225	ENST00000375550.4:c.21A>G	9.37:g.95179820T>C	ENSP00000364700:p.Ile7Met	Somatic		Capture	Illumina GAIIx	Phase_I	94219641	Q5TBF4	Missense_Mutation	SNP	ENST00000375550.4	37	CCDS6696.1	.	.	.	.	.	.	.	.	.	.	t	3.329	-0.137180	0.06711	.	.	ENSG00000127083	ENST00000375550	T	0.38887	1.11	5.41	3.06	0.35304	.	0.796204	0.11022	N	0.608280	T	0.23451	0.0567	N	0.19112	0.55	0.30115	N	0.806223	P	0.37864	0.61	B	0.28139	0.086	T	0.08472	-1.0720	10	0.23302	T	0.38	-2.1897	9.8938	0.41306	0.0:0.1392:0.0:0.8608	.	7	Q99983	OMD_HUMAN	M	7	ENSP00000364700:I7M	ENSP00000364700:I7M	I	-	3	3	OMD	94219641	0.846000	0.29590	0.044000	0.18714	0.015000	0.08874	0.393000	0.20817	0.445000	0.26639	0.477000	0.44152	ATA		0.328	OMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053090.1	NM_005014	
HSPA5	3309	broad.mit.edu	37	9	127998913	127998913	+	Silent	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chr9:127998913G>A	ENST00000324460.6	-	8	2126	c.1923C>T	c.(1921-1923)ccC>ccT	p.P641P		NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	641					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)	p.P641P(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CACCAGTTGGGGGAGGGCCTG	0.413										Prostate(1;0.17)																																						1	Substitution - coding silent(1)	ovary(1)	9											94.0	86.0	89.0					9																	127998913		2203	4300	6503	127038734	SO:0001819	synonymous_variant	3309				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1923C>T	9.37:g.127998913G>A		Somatic		Capture	Illumina GAIIx	Phase_I	127038734	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Silent	SNP	ENST00000324460.6	37	CCDS6863.1																																																																																				0.413	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054062.1		
GPKOW	27238	broad.mit.edu	37	X	48979003	48979003	+	Silent	SNP	C	C	T			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chrX:48979003C>T	ENST00000156109.5	-	2	378	c.300G>A	c.(298-300)gtG>gtA	p.V100V		NM_015698.4	NP_056513.2	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs	100						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)	p.V100V(1)		breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)	21						CCTGGGACACCACCCCATCCG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	X											35.0	33.0	34.0					X																	48979003		2203	4300	6503	48865947	SO:0001819	synonymous_variant	27238			U66359	CCDS35251.1	Xp11.23	2013-01-28			ENSG00000068394	ENSG00000068394		"""G patch domain containing"""	30677	protein-coding gene	gene with protein product	"""G patch domain containing 5"""					21880142, 22365833	Standard	NM_015698		Approved	T54, GPATC5, GPATCH5, Spp2	uc004dmr.3	Q92917	OTTHUMG00000021511	ENST00000156109.5:c.300G>A	X.37:g.48979003C>T		Somatic		Capture	Illumina GAIIx	Phase_I	48865947	Q59EK5|Q9BQA8	Silent	SNP	ENST00000156109.5	37	CCDS35251.1																																																																																				0.587	GPKOW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056535.2	NM_015698	
CACNA1F	778	broad.mit.edu	37	X	49083071	49083071	+	Splice_Site	SNP	C	C	G			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chrX:49083071C>G	ENST00000376265.2	-	10	1464		c.e10+1		CACNA1F_ENST00000376251.1_Splice_Site|CACNA1F_ENST00000323022.5_Splice_Site	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit						axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.?(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGACCCCCACCATGGCTGCT	0.627																																																1	Unknown(1)	ovary(1)	X											17.0	15.0	16.0					X																	49083071		2190	4272	6462	48970015	SO:0001630	splice_region_variant	778			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.1402+1G>C	X.37:g.49083071C>G		Somatic		Capture	Illumina GAIIx	Phase_I	48970015	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Splice_Site	SNP	ENST00000376265.2	37	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	c	19.66	3.868736	0.72065	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3349	0.60512	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CACNA1F	48970015	0.997000	0.39634	0.985000	0.45067	0.958000	0.62258	3.010000	0.49559	2.212000	0.71576	0.431000	0.28591	.		0.627	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	Intron
IQSEC2	23096	broad.mit.edu	37	X	53280309	53280309	+	Silent	SNP	C	C	T	rs200629644		TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chrX:53280309C>T	ENST00000375368.5	-	4	1619	c.1419G>A	c.(1417-1419)ccG>ccA	p.P473P	IQSEC2_ENST00000396435.3_Silent_p.P483P|IQSEC2_ENST00000375365.2_Silent_p.P278P			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	473					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.P480P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						TGGGCCCTGACGGGTGGCAGT	0.557													c|||	1	0.000264901	0.0	0.0	3775	,	,		13137	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	X											49.0	52.0	51.0					X																	53280309		2203	4299	6502	53297034	SO:0001819	synonymous_variant	23096			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1419G>A	X.37:g.53280309C>T		Somatic		Capture	Illumina GAIIx	Phase_I	53297034	B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	ENST00000375368.5	37																																																																																					0.557	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
CAPN6	827	broad.mit.edu	37	X	110491921	110491921	+	Missense_Mutation	SNP	G	G	A			TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chrX:110491921G>A	ENST00000324068.1	-	10	1527	c.1360C>T	c.(1360-1362)Cgc>Tgc	p.R454C	CAPN6_ENST00000541758.1_Missense_Mutation_p.R199C	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	454	Domain III.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)	p.R454C(1)		cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						AACACTGTGCGGGTGTCAATA	0.502																																																1	Substitution - Missense(1)	ovary(1)	X											115.0	97.0	103.0					X																	110491921		2203	4300	6503	110378577	SO:0001583	missense	827			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1360C>T	X.37:g.110491921G>A	ENSP00000317214:p.Arg454Cys	Somatic		Capture	Illumina GAIIx	Phase_I	110378577	D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	ENST00000324068.1	37	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985244	0.74474	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	D;D	0.90563	-2.69;-2.69	5.8	5.8	0.92144	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.000000	0.85682	D	0.000000	D	0.95544	0.8552	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95890	0.8906	10	0.87932	D	0	.	17.6415	0.88138	0.0:0.0:1.0:0.0	.	454	Q9Y6Q1	CAN6_HUMAN	C	454;199	ENSP00000317214:R454C;ENSP00000441736:R199C	ENSP00000317214:R454C	R	-	1	0	CAPN6	110378577	1.000000	0.71417	0.547000	0.28179	0.402000	0.30811	7.230000	0.78097	2.438000	0.82558	0.600000	0.82982	CGC		0.502	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1		
GABRE	2564	broad.mit.edu	37	X	151138672	151138672	+	Missense_Mutation	SNP	G	G	A	rs374540437		TCGA-59-2348-01A-01W-0799-08	TCGA-59-2348-11A-01W-0800-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	WXS	Capture			Illumina GAIIx	2d57e0c5-8058-42eb-b0f3-90d566114133	e05353fe-5619-4227-a7a0-9ed9dbe8190e	g.chrX:151138672G>A	ENST00000370328.3	-	2	312	c.259C>T	c.(259-261)Cgc>Tgc	p.R87C	GABRE_ENST00000393914.3_5'UTR|GABRE_ENST00000370325.1_Missense_Mutation_p.R87C	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	87					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.R87C(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATGCCAGGGCGCAGTTTGTGG	0.532																																																1	Substitution - Missense(1)	ovary(1)	X							CYS/ARG	0,3835		0,0,1632,571	151.0	135.0	140.0		259	4.3	1.0	X		140	1,6727		0,1,2427,1872	no	missense	GABRE	NM_004961.3	180	0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095	probably-damaging	87/507	151138672	1,10562	2203	4300	6503	150889328	SO:0001583	missense	2564			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.259C>T	X.37:g.151138672G>A	ENSP00000359353:p.Arg87Cys	Somatic		Capture	Illumina GAIIx	Phase_I	150889328	E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	ENST00000370328.3	37	CCDS14703.1	.	.	.	.	.	.	.	.	.	.	g	18.41	3.618311	0.66787	0.0	1.49E-4	ENSG00000102287	ENST00000370328;ENST00000370325	D;D	0.83506	-1.73;-1.73	5.27	4.28	0.50868	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.46145	D	0.000305	D	0.91270	0.7248	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.91873	0.5509	10	0.87932	D	0	.	8.7019	0.34332	0.0:0.0:0.7107:0.2893	.	87	P78334	GBRE_HUMAN	C	87	ENSP00000359353:R87C;ENSP00000359350:R87C	ENSP00000359350:R87C	R	-	1	0	GABRE	150889328	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	0.717000	0.25851	2.340000	0.79590	0.597000	0.82753	CGC		0.532	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060903.1	NM_004961, NM_021990, NM_021984	
