#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								8505	SO:0001628	intergenic_variant	4514																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	8505		Missense_Mutation	SNP	HMMPfam_ATP-synt_8	p.Y47H		37	c.139		MT																																																																																			-	HMMPfam_ATP-synt_8	0	0					MT-CO3			T			8505	+1	no_errors	ENST00000361851	ensembl	human	known	54_36p	missense	SNP	NULL	C
GNPTG	84572	genome.wustl.edu	37	16	1412861	1412861	+	Silent	SNP	G	G	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr16:1412861G>T	ENST00000204679.4	+	10	820	c.777G>T	c.(775-777)ctG>ctT	p.L259L	LA16c-316G12.2_ENST00000569831.1_RNA	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit	259					carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				TCAAAAGGCTGAAAGGTTTGC	0.572																																																0			16											112.0	116.0	115.0					16																	1412861		2199	4300	6499	1352862	SO:0001819	synonymous_variant	84572			BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835	ENST00000204679.4:c.777G>T	16.37:g.1412861G>T		Somatic		Capture	Illumina GAIIx	4	1352862	B2R556|Q6XYD7|Q96L13	Silent	SNP	superfamily_Mannose 6-phosphate receptor domain,HMMPfam_PRKCSH	p.L259	ENST00000204679.4	37	c.777	CCDS10436.1	16																																																																																			-	NULL		0.572	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTG	protein_coding	OTTHUMT00000109058.2	G	NM_032520		1352862	+1	no_errors	NM_032520	genbank	human	validated	54_36p	silent	SNP	0.004	T
NOP2	4839	genome.wustl.edu	37	12	6670926	6670926	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr12:6670926C>A	ENST00000322166.5	-	11	1232	c.1111G>T	c.(1111-1113)Gcc>Tcc	p.A371S	NOP2_ENST00000399466.2_Missense_Mutation_p.A367S|NOP2_ENST00000541778.1_Missense_Mutation_p.A367S|NOP2_ENST00000545200.1_Missense_Mutation_p.A367S|NOP2_ENST00000542015.1_Intron|NOP2_ENST00000382421.3_Missense_Mutation_p.A404S|NOP2_ENST00000537442.1_Missense_Mutation_p.A371S	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	371					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						ATGCTGGAGGCTCCCTGCAGC	0.597																																																0			12											41.0	45.0	44.0					12																	6670926		2030	4173	6203	6541187	SO:0001583	missense	4839				CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.1111G>T	12.37:g.6670926C>A	ENSP00000313272:p.Ala371Ser	Somatic		Capture	Illumina GAIIx	4	6541187	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	superfamily_SSF53335,HMMPfam_Nol1_Nop2_Fmu,PatternScan_NOL1_NOP2_SUN,HMMPfam_P120R	p.A367S	ENST00000322166.5	37	c.1099	CCDS58203.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.489940	0.96339	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000545200;ENST00000399466;ENST00000322166;ENST00000541778;ENST00000542944	T;T;T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77;1.77;1.77	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.52805	0.1757	M	0.86651	2.83	0.80722	D	1	P;P	0.49696	0.927;0.849	P;P	0.54706	0.759;0.674	T	0.60742	-0.7203	10	0.66056	D	0.02	-21.7863	19.2531	0.93933	0.0:1.0:0.0:0.0	.	367;367	Q05BA7;P46087-2	.;.	S	371;404;367;367;371;367;247	ENSP00000444437:A371S;ENSP00000371858:A404S;ENSP00000439422:A367S;ENSP00000382392:A367S;ENSP00000313272:A371S;ENSP00000443150:A367S;ENSP00000440754:A247S	ENSP00000313272:A371S	A	-	1	0	NOP2	6541187	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	7.788000	0.85771	2.536000	0.85505	0.561000	0.74099	GCC	-	superfamily_SSF53335,HMMPfam_Nol1_Nop2_Fmu		0.597	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP2	protein_coding	OTTHUMT00000402614.1	C	NM_006170		6541187	-1	no_errors	NM_001033714	genbank	human	validated	54_36p	missense	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577560	7577560	+	Missense_Mutation	SNP	A	A	C	rs397516437		TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr17:7577560A>C	ENST00000269305.4	-	7	910	c.721T>G	c.(721-723)Tcc>Gcc	p.S241A	TP53_ENST00000359597.4_Missense_Mutation_p.S241A|TP53_ENST00000445888.2_Missense_Mutation_p.S241A|TP53_ENST00000420246.2_Missense_Mutation_p.S241A|TP53_ENST00000455263.2_Missense_Mutation_p.S241A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.S241A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	241	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		S -> A (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|S -> C (in sporadic cancers; somatic mutation).|S -> F (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934573). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228}.|S -> P (in sporadic cancers; somatic mutation).|S -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S241fs*6(9)|p.0?(8)|p.S241T(8)|p.S241A(8)|p.?(5)|p.S241del(3)|p.N239_C242delNSSC(3)|p.S241P(3)|p.S148T(1)|p.Y236_M243delYMCNSSCM(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.S241_G245delSCMGG(1)|p.C238fs*21(1)|p.H233fs*6(1)|p.S241fs*7(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.S241fs*22(1)|p.S241fs*23(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCCATGCAGGAACTGTTACAC	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	61	Substitution - Missense(20)|Deletion - Frameshift(14)|Deletion - In frame(11)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(2)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(9)|upper_aerodigestive_tract(5)|biliary_tract(5)|large_intestine(5)|urinary_tract(5)|bone(5)|breast(5)|central_nervous_system(4)|ovary(4)|stomach(3)|lung(3)|oesophagus(2)|pancreas(2)|thyroid(1)|endometrium(1)|liver(1)|skin(1)	17	GRCh37	CD984149|CM942121	TP53	D|M							139.0	107.0	118.0					17																	7577560		2203	4300	6503	7518285	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.721T>G	17.37:g.7577560A>C	ENSP00000269305:p.Ser241Ala	Somatic		Capture	Illumina GAIIx	4	7518285	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.S241A	ENST00000269305.4	37	c.721	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	17.95	3.514682	0.64634	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99842	-7.1;-7.1;-7.1;-7.1;-7.1;-7.1;-7.1;-7.1	4.62	3.53	0.40419	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.120078	0.56097	D	0.000022	D	0.99816	0.9919	M	0.92784	3.345	0.42488	D	0.992885	D;D;D;D;D;D	0.71674	0.982;0.995;0.998;0.986;0.986;0.992	D;D;D;D;D;D	0.91635	0.999;0.993;0.997;0.999;0.999;0.995	D	0.97804	1.0246	10	0.87932	D	0	-35.4617	9.0966	0.36642	0.8362:0.0:0.0:0.1638	.	241;241;148;241;241;241	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	A	241;241;241;241;241;241;230;148;109;148	ENSP00000410739:S241A;ENSP00000352610:S241A;ENSP00000269305:S241A;ENSP00000398846:S241A;ENSP00000391127:S241A;ENSP00000391478:S241A;ENSP00000425104:S109A;ENSP00000423862:S148A	ENSP00000269305:S241A	S	-	1	0	TP53	7518285	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.179000	0.42528	0.889000	0.36185	0.379000	0.24179	TCC	-	HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		7518285	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.999	C
FASTKD3	79072	genome.wustl.edu	37	5	7867012	7867012	+	Silent	SNP	A	A	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:7867012A>C	ENST00000264669.5	-	2	1321	c.1185T>G	c.(1183-1185)acT>acG	p.T395T	FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000341013.6_5'Flank|MTRR_ENST00000440940.2_5'Flank|MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000502509.1_Intron	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	395					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGCAAACAAAAGTTTCTGCCA	0.423																																																0			5											59.0	61.0	60.0					5																	7867012		2203	4300	6503	7920012	SO:0001819	synonymous_variant	79072			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.1185T>G	5.37:g.7867012A>C		Somatic		Capture	Illumina GAIIx	4	7920012	Q9BVD3	Silent	SNP	HMMPfam_FAST_1,HMMPfam_FAST_2,HMMPfam_RAP	p.T395	ENST00000264669.5	37	c.1185	CCDS3873.1	5																																																																																			-	NULL		0.423	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD3	protein_coding	OTTHUMT00000253673.1	A	NM_024091		7920012	-1	no_errors	NM_024091	genbank	human	validated	54_36p	silent	SNP	0.624	C
USP7	7874	genome.wustl.edu	37	16	8999116	8999116	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr16:8999116G>A	ENST00000344836.4	-	14	1699	c.1501C>T	c.(1501-1503)Cac>Tac	p.H501Y	USP7_ENST00000535863.1_Missense_Mutation_p.H402Y|USP7_ENST00000381886.4_Missense_Mutation_p.H485Y	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	501	USP.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						TCGTCATCGTGACCCCCATAA	0.438											OREG0023595	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			16											263.0	198.0	220.0					16																	8999116		2197	4300	6497	8906617	SO:0001583	missense	7874			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.1501C>T	16.37:g.8999116G>A	ENSP00000343535:p.His501Tyr	Somatic	653	Capture	Illumina GAIIx	4	8906617	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	superfamily_Traf_like,HMMSmart_MATH,HMMPfam_MATH,superfamily_SSF54001,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.H501Y	ENST00000344836.4	37	c.1501	CCDS32385.1	16	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878500	0.33162	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549;ENST00000542333	T;T;T	0.05382	3.45;3.45;3.45	5.39	5.39	0.77823	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.06371	0.0164	N	0.17278	0.47	0.80722	D	1	B;B	0.18863	0.031;0.031	B;B	0.24394	0.053;0.04	T	0.45556	-0.9253	10	0.32370	T	0.25	.	19.1486	0.93479	0.0:0.0:1.0:0.0	.	501;485	Q93009;B7Z815	UBP7_HUMAN;.	Y	501;509;402;402;443	ENSP00000343535:H501Y;ENSP00000443646:H402Y;ENSP00000439272:H443Y	ENSP00000343535:H501Y	H	-	1	0	USP7	8906617	1.000000	0.71417	0.869000	0.34112	0.409000	0.31022	9.675000	0.98638	2.517000	0.84864	0.561000	0.74099	CAC	-	superfamily_SSF54001,HMMPfam_UCH		0.438	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP7	protein_coding	OTTHUMT00000434268.2	G			8906617	-1	no_errors	NM_003470	genbank	human	validated	54_36p	missense	SNP	1.000	A
EPS8	2059	genome.wustl.edu	37	12	15807146	15807146	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr12:15807146T>G	ENST00000281172.5	-	13	1619	c.1183A>C	c.(1183-1185)Aat>Cat	p.N395H	EPS8_ENST00000542903.1_Missense_Mutation_p.N135H|EPS8_ENST00000540613.1_Missense_Mutation_p.N135H|EPS8_ENST00000543612.1_Missense_Mutation_p.N395H|EPS8_ENST00000543523.1_Missense_Mutation_p.N395H	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	395	PH; second part.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		ACAGTATAATTTAAGAAATCA	0.413																																																0			12											122.0	103.0	110.0					12																	15807146		2203	4300	6503	15698413	SO:0001583	missense	2059			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.1183A>C	12.37:g.15807146T>G	ENSP00000281172:p.Asn395His	Somatic		Capture	Illumina GAIIx	4	15698413	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	HMMSmart_PTB,superfamily_SSF50729,HMMPfam_PTB,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.N395H	ENST00000281172.5	37	c.1183	CCDS31753.1	12	.	.	.	.	.	.	.	.	.	.	T	10.94	1.493627	0.26774	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903;ENST00000543223	T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98	4.82	4.82	0.62117	.	0.212364	0.48286	D	0.000195	T	0.17323	0.0416	L	0.39020	1.185	0.09310	N	0.999994	B	0.02656	0.0	B	0.04013	0.001	T	0.11372	-1.0590	10	0.46703	T	0.11	-17.9989	11.224	0.48873	0.0:0.0:0.1965:0.8035	.	395	Q12929	EPS8_HUMAN	H	395;395;395;135;135;395	ENSP00000441867:N395H;ENSP00000281172:N395H;ENSP00000442388:N395H;ENSP00000441888:N135H;ENSP00000437806:N135H	ENSP00000281172:N395H	N	-	1	0	EPS8	15698413	0.998000	0.40836	0.824000	0.32777	0.967000	0.64934	1.540000	0.36115	2.130000	0.65690	0.482000	0.46254	AAT	-	NULL		0.413	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8	protein_coding	OTTHUMT00000401093.1	T			15698413	-1	no_errors	NM_004447	genbank	human	reviewed	54_36p	missense	SNP	0.951	G
JAK3	3718	genome.wustl.edu	37	19	17942152	17942152	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr19:17942152T>A	ENST00000527670.1	-	20	2892	c.2863A>T	c.(2863-2865)Atc>Ttc	p.I955F	JAK3_ENST00000534444.1_Missense_Mutation_p.I955F|JAK3_ENST00000458235.1_Missense_Mutation_p.I955F			P52333	JAK3_HUMAN	Janus kinase 3	955	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	TCCACGAGGATGTTTCGGGCG	0.652		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0			19											119.0	106.0	110.0					19																	17942152		2203	4300	6503	17803152	SO:0001583	missense	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2863A>T	19.37:g.17942152T>A	ENSP00000432511:p.Ile955Phe	Somatic		Capture	Illumina GAIIx	4	17803152	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	HMMSmart_SM00295,superfamily_SH2 domain,HMMSmart_SM00252,superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_THIOL_PROTEASE_HIS,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.I955F	ENST00000527670.1	37	c.2863	CCDS12366.1	19	.	.	.	.	.	.	.	.	.	.	T	20.9	4.070178	0.76301	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	T;T;D	0.92911	-0.61;-0.61;-3.13	3.43	3.43	0.39272	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.141330	0.46145	D	0.000318	D	0.93115	0.7808	L	0.52905	1.665	0.80722	D	1	D;D	0.89917	1.0;0.996	D;P	0.75020	0.985;0.878	D	0.92204	0.5770	10	0.87932	D	0	-28.375	5.7876	0.18343	0.0:0.128:0.0:0.872	.	955;955	P52333-2;P52333	.;JAK3_HUMAN	F	955	ENSP00000391676:I955F;ENSP00000432511:I955F;ENSP00000436421:I955F	ENSP00000391676:I955F	I	-	1	0	JAK3	17803152	1.000000	0.71417	0.948000	0.38648	0.838000	0.47535	1.786000	0.38694	1.536000	0.49237	0.379000	0.24179	ATC	-	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase_Tyr,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_TYR		0.652	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK3	protein_coding	OTTHUMT00000385549.1	T	NM_000215		17803152	-1	no_errors	NM_000215	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TVP23B	51030	genome.wustl.edu	37	17	18707465	18707465	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr17:18707465G>A	ENST00000307767.8	+	6	776	c.477G>A	c.(475-477)atG>atA	p.M159I	TVP23B_ENST00000476139.1_Missense_Mutation_p.M95I|TVP23B_ENST00000574226.1_Missense_Mutation_p.M159I|TVP23B_ENST00000581733.1_Missense_Mutation_p.M95I	NM_016078.4	NP_057162.4	Q9NYZ1	TV23B_HUMAN	trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)	159						integral component of membrane (GO:0016021)											TGGTTATCATGGGTGTGGTGC	0.453																																																0			17											141.0	132.0	135.0					17																	18707465		1958	4149	6107	18648190	SO:0001583	missense	51030			AF151906	CCDS42274.1	17p11.2	2012-11-29	2012-11-29	2012-11-29	ENSG00000171928	ENSG00000171928			20399	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B"", ""family with sequence similarity 18, member B1"""	FAM18B, FAM18B1		10810093	Standard	NM_016078		Approved	CGI-148, YDR084C	uc002gum.2	Q9NYZ1	OTTHUMG00000059052	ENST00000307767.8:c.477G>A	17.37:g.18707465G>A	ENSP00000305654:p.Met159Ile	Somatic		Capture	Illumina GAIIx	4	18648190	A8K448|Q96HK5|Q9Y3E6	Missense_Mutation	SNP	HMMPfam_DUF846	p.M159I	ENST00000307767.8	37	c.477	CCDS42274.1	17	.	.	.	.	.	.	.	.	.	.	G	0.393	-0.922640	0.02396	.	.	ENSG00000171928	ENST00000307767	T	0.36520	1.25	2.68	2.68	0.31781	.	0.039764	0.85682	D	0.000000	T	0.22437	0.0541	L	0.33293	1	0.54753	D	0.999983	B	0.10296	0.003	B	0.20767	0.031	T	0.07927	-1.0747	10	0.02654	T	1	-22.0479	11.11	0.48226	0.0:0.0:1.0:0.0	.	159	Q9NYZ1	F18B1_HUMAN	I	159	ENSP00000305654:M159I	ENSP00000305654:M159I	M	+	3	0	FAM18B1	18648190	1.000000	0.71417	1.000000	0.80357	0.211000	0.24417	6.869000	0.75521	1.504000	0.48704	0.194000	0.17425	ATG	-	HMMPfam_DUF846		0.453	TVP23B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM18B	protein_coding	OTTHUMT00000130667.2	G	NM_016078		18648190	+1	no_errors	NM_016078	genbank	human	predicted	54_36p	missense	SNP	1.000	A
RABGGTA	5875	genome.wustl.edu	37	14	24739234	24739234	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr14:24739234C>T	ENST00000399409.3	-	4	835	c.352G>A	c.(352-354)Ggc>Agc	p.G118S	RABGGTA_ENST00000559586.1_5'UTR|RABGGTA_ENST00000560777.1_5'Flank|RABGGTA_ENST00000216840.6_Missense_Mutation_p.G118S	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	118					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		GGCAGGCGGCCTAGCAGCCAG	0.622																																																0			14											36.0	43.0	40.0					14																	24739234		2010	4174	6184	23809074	SO:0001583	missense	5875				CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.352G>A	14.37:g.24739234C>T	ENSP00000382341:p.Gly118Ser	Somatic		Capture	Illumina GAIIx	4	23809074	A8K5N2|D3DS69	Missense_Mutation	SNP	superfamily_Prenyl_trans,HMMPfam_PPTA,superfamily_RabGG_trans_A,HMMPfam_RabGGT_insert,superfamily_SSF52058,HMMPfam_LRR_1	p.G118S	ENST00000399409.3	37	c.352	CCDS45088.1	14	.	.	.	.	.	.	.	.	.	.	C	5.932	0.356047	0.11239	.	.	ENSG00000100949	ENST00000216840;ENST00000399409;ENST00000543002	T;T	0.39592	1.07;1.07	5.17	-0.959	0.10343	Protein prenyltransferase (1);	0.540963	0.21612	N	0.071761	T	0.15998	0.0385	N	0.03238	-0.38	0.43953	D	0.996625	B	0.02656	0.0	B	0.04013	0.001	T	0.17592	-1.0364	10	0.13470	T	0.59	-3.9902	9.827	0.40919	0.0:0.4095:0.0:0.5905	.	118	Q92696	PGTA_HUMAN	S	118;118;81	ENSP00000216840:G118S;ENSP00000382341:G118S	ENSP00000216840:G118S	G	-	1	0	RABGGTA	23809074	0.003000	0.15002	0.885000	0.34714	0.890000	0.51754	-0.085000	0.11250	-0.548000	0.06199	0.462000	0.41574	GGC	-	superfamily_Prenyl_trans,HMMPfam_PPTA		0.622	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RABGGTA	protein_coding	OTTHUMT00000415308.5	C	NM_182836		23809074	-1	no_errors	NM_004581	genbank	human	validated	54_36p	missense	SNP	0.859	T
ZNF726	730087	genome.wustl.edu	37	19	24097633	24097633	+	5'Flank	SNP	A	A	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr19:24097633A>T	ENST00000334589.5	+	0	0				ZNF726_ENST00000525354.2_5'Flank|ZNF726_ENST00000575986.1_5'Flank|ZNF726_ENST00000322487.7_5'Flank|ZNF726_ENST00000531821.2_5'Flank|ZNF726_ENST00000594466.1_5'Flank			A6NNF4	ZN726_HUMAN	zinc finger protein 726						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAACTGTCCAATCAGGCACGC	0.567																																																0			19																																								23889473	SO:0001631	upstream_gene_variant	730087			DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681		19.37:g.24097633A>T	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	23889473	M0R0X8|Q86Y87	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.N85I	ENST00000334589.5	37	c.254		19																																																																																			-	NULL		0.567	ZNF726-003	PUTATIVE	basic|exp_conf	protein_coding	LOC730087	protein_coding	OTTHUMT00000395815.2	A	XM_001715134		23889473	+1	no_errors	XM_001726951	genbank	human	model	54_36p	missense	SNP	0.010	T
HIST1H2BB	3018	genome.wustl.edu	37	6	26043811	26043811	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr6:26043811C>G	ENST00000357905.2	-	1	74	c.75G>C	c.(73-75)aaG>aaC	p.K25N	HIST1H3C_ENST00000540144.1_5'Flank	NM_021062.2	NP_066406.1	P33778	H2B1B_HUMAN	histone cluster 1, H2bb	25					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						TCTTACCATCCTTCTTCTGCG	0.488																																																0			6											147.0	141.0	143.0					6																	26043811		2203	4300	6503	26151790	SO:0001583	missense	3018			AF531285	CCDS4575.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196226			"""Histones / Replication-dependent"""	4751	protein-coding gene	gene with protein product		602803	"""H2B histone family, member F"", ""histone 1, H2bb"""	H2BFF		8227173, 12408966	Standard	NM_021062		Approved	H2B/f	uc003nfu.3	P33778	OTTHUMG00000014421	ENST00000357905.2:c.75G>C	6.37:g.26043811C>G	ENSP00000350580:p.Lys25Asn	Somatic		Capture	Illumina GAIIx	4	26151790	Q4KN36	Missense_Mutation	SNP	superfamily_Histone-fold,HMMSmart_H2B,HMMPfam_Histone,PatternScan_HISTONE_H2B	p.K25N	ENST00000357905.2	37	c.75	CCDS4575.1	6	.	.	.	.	.	.	.	.	.	.	C	1.671	-0.508876	0.04231	.	.	ENSG00000196226	ENST00000357905	T	0.21734	1.99	5.34	-4.25	0.03766	Histone-fold (2);	0.000000	0.64402	U	0.000012	T	0.11879	0.0289	M	0.90019	3.08	0.21915	N	0.999474	P	0.37573	0.6	B	0.28011	0.085	T	0.26189	-1.0110	10	0.72032	D	0.01	.	13.6905	0.62542	0.0:0.4022:0.0:0.5978	.	25	P33778	H2B1B_HUMAN	N	25	ENSP00000350580:K25N	ENSP00000350580:K25N	K	-	3	2	HIST1H2BB	26151790	0.058000	0.20735	0.002000	0.10522	0.001000	0.01503	-0.536000	0.06135	-0.891000	0.03940	-0.345000	0.07892	AAG	-	superfamily_Histone-fold		0.488	HIST1H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BB	protein_coding	OTTHUMT00000040083.1	C	NM_021062		26151790	-1	no_errors	NM_021062	genbank	human	reviewed	54_36p	missense	SNP	0.022	G
APBA2	321	genome.wustl.edu	37	15	29346257	29346257	+	Missense_Mutation	SNP	C	C	T	rs141358568	byFrequency	TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr15:29346257C>T	ENST00000558402.1	+	5	769	c.170C>T	c.(169-171)gCg>gTg	p.A57V	APBA2_ENST00000558330.1_Missense_Mutation_p.A57V|APBA2_ENST00000558259.1_Missense_Mutation_p.A57V|APBA2_ENST00000561069.1_Missense_Mutation_p.A57V|APBA2_ENST00000411764.1_Missense_Mutation_p.A57V			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	57					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)	p.A57V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GAGAGCCCCGCGCCAGAGGAA	0.657													C|||	4	0.000798722	0.0	0.0043	5008	,	,		17859	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	large_intestine(1)	15						C	VAL/ALA,VAL/ALA	3,4403	6.2+/-15.9	0,3,2200	56.0	67.0	64.0		170,170	1.7	0.0	15	dbSNP_134	64	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense	APBA2	NM_001130414.1,NM_005503.3	64,64	0,9,6494	TT,TC,CC		0.0698,0.0681,0.0692	benign,benign	57/738,57/750	29346257	9,12997	2203	4300	6503	27133549	SO:0001583	missense	321			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.170C>T	15.37:g.29346257C>T	ENSP00000453293:p.Ala57Val	Somatic		Capture	Illumina GAIIx	4	27133549	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	superfamily_SSF50729,HMMSmart_PTB,HMMPfam_PID,superfamily_PDZ,HMMPfam_PDZ,HMMSmart_PDZ	p.A57V	ENST00000558402.1	37	c.170	CCDS10022.1	15	3	0.0013736263736263737	0	0.0	3	0.008287292817679558	0	0.0	0	0.0	C	6.412	0.444058	0.12164	6.81E-4	6.98E-4	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.40756	1.02	4.83	1.71	0.24356	.	1.249360	0.05773	N	0.607052	T	0.16557	0.0398	N	0.03115	-0.41	0.09310	N	0.999998	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.20605	-1.0270	10	0.41790	T	0.15	.	9.1865	0.37174	0.0:0.7636:0.0:0.2364	.	57;57;57	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	V	57	ENSP00000409312:A57V	ENSP00000219865:A57V	A	+	2	0	APBA2	27133549	0.000000	0.05858	0.006000	0.13384	0.337000	0.28794	-0.285000	0.08410	0.360000	0.24265	0.650000	0.86243	GCG	-	NULL		0.657	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	protein_coding	OTTHUMT00000251362.3	C	NM_005503		27133549	+1	no_errors	NM_005503	genbank	human	reviewed	54_36p	missense	SNP	0.669	T
GDPD3	79153	genome.wustl.edu	37	16	30122714	30122714	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr16:30122714G>C	ENST00000406256.3	-	7	1079	c.702C>G	c.(700-702)atC>atG	p.I234M	RP11-455F5.4_ENST00000566190.1_RNA	NM_024307.2	NP_077283.2	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain containing 3	234	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)	11						GGTACCTGTTGATGATGTTGG	0.572																																																0			16											114.0	115.0	115.0					16																	30122714		2197	4300	6497	30030215	SO:0001583	missense	79153			AK026256	CCDS10671.2	16p11.2	2008-02-05			ENSG00000102886	ENSG00000102886			28638	protein-coding gene	gene with protein product							Standard	NM_024307		Approved	MGC4171	uc002dwp.3	Q7L5L3	OTTHUMG00000132106	ENST00000406256.3:c.702C>G	16.37:g.30122714G>C	ENSP00000384363:p.Ile234Met	Somatic		Capture	Illumina GAIIx	4	30030215	Q9H652	Missense_Mutation	SNP	superfamily_PLC-like phosphodiesterases,HMMPfam_GDPD	p.I234M	ENST00000406256.3	37	c.702	CCDS10671.2	16	.	.	.	.	.	.	.	.	.	.	G	11.45	1.642182	0.29157	.	.	ENSG00000102886	ENST00000406256;ENST00000360688	T	0.28895	1.59	5.45	4.49	0.54785	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.166532	0.50627	D	0.000117	T	0.41003	0.1140	M	0.65975	2.015	0.33126	D	0.542495	P	0.48503	0.911	P	0.51516	0.672	T	0.54682	-0.8257	10	0.42905	T	0.14	.	10.5188	0.44907	0.0918:0.0:0.9082:0.0	.	234	Q7L5L3	GDPD3_HUMAN	M	234;172	ENSP00000384363:I234M	ENSP00000353909:I172M	I	-	3	3	GDPD3	30030215	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.084000	0.41625	2.523000	0.85059	0.655000	0.94253	ATC	-	superfamily_PLC-like phosphodiesterases,HMMPfam_GDPD		0.572	GDPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD3	protein_coding	OTTHUMT00000255144.1	G	NM_024307		30030215	-1	no_errors	NM_024307	genbank	human	validated	54_36p	missense	SNP	1.000	C
FAM47A	158724	genome.wustl.edu	37	X	34148898	34148898	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chrX:34148898G>A	ENST00000346193.3	-	1	1549	c.1498C>T	c.(1498-1500)Cgg>Tgg	p.R500W		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	500			Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CTGGACGTCCGACGAGTCTTG	0.657																																																0			X																																								34058819	SO:0001583	missense	158724			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1498C>T	X.37:g.34148898G>A	ENSP00000345029:p.Arg500Trp	Somatic		Capture	Illumina GAIIx	4	34058819	A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.R500W	ENST00000346193.3	37	c.1498	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	g	11.99	1.804555	0.31869	.	.	ENSG00000185448	ENST00000346193	T	0.17213	2.29	0.546	-0.481	0.12082	.	.	.	.	.	T	0.24509	0.0594	L	0.44542	1.39	0.09310	N	1	D	0.76494	0.999	P	0.61201	0.885	T	0.12889	-1.0530	8	0.72032	D	0.01	.	.	.	.	.	500	Q5JRC9	FA47A_HUMAN	W	500	ENSP00000345029:R500W	ENSP00000345029:R500W	R	-	1	2	FAM47A	34058819	0.006000	0.16342	0.001000	0.08648	0.070000	0.16714	0.340000	0.19892	-0.325000	0.08577	0.287000	0.19450	CGG	-	NULL		0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	protein_coding	OTTHUMT00000056205.1	G	NM_203408		34058819	-1	no_errors	NM_203408	genbank	human	predicted	54_36p	missense	SNP	0.000	A
C12orf40	283461	genome.wustl.edu	37	12	40076832	40076832	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr12:40076832A>C	ENST00000324616.5	+	8	1260	c.1106A>C	c.(1105-1107)gAa>gCa	p.E369A	C12orf40_ENST00000405531.3_Missense_Mutation_p.E369A|C12orf40_ENST00000398716.1_Missense_Mutation_p.E292A	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	369										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						AGTTATCCAGAAAAATGTCAG	0.328																																																0			12											40.0	38.0	38.0					12																	40076832		1822	4062	5884	38363099	SO:0001583	missense	283461			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1106A>C	12.37:g.40076832A>C	ENSP00000317671:p.Glu369Ala	Somatic		Capture	Illumina GAIIx	4	38363099	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	NULL	p.E369A	ENST00000324616.5	37	c.1106	CCDS41770.1	12	.	.	.	.	.	.	.	.	.	.	A	12.39	1.923875	0.34002	.	.	ENSG00000180116	ENST00000405531;ENST00000398716;ENST00000324616	T;T	0.61627	0.09;0.14	5.26	1.37	0.22104	.	0.577836	0.16358	N	0.217936	T	0.45538	0.1347	L	0.36672	1.1	0.09310	N	1	P	0.46142	0.873	B	0.43225	0.412	T	0.35798	-0.9774	10	0.87932	D	0	.	6.4325	0.21805	0.6196:0.3002:0.0802:0.0	.	369	Q86WS4	CL040_HUMAN	A	369;292;369	ENSP00000383897:E369A;ENSP00000317671:E369A	ENSP00000317671:E369A	E	+	2	0	C12orf40	38363099	0.939000	0.31865	0.020000	0.16555	0.369000	0.29798	0.651000	0.24873	0.121000	0.18284	-0.326000	0.08463	GAA	-	NULL		0.328	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	protein_coding	OTTHUMT00000257664.2	A	NM_173599		38363099	+1	no_errors	NM_001031748	genbank	human	validated	54_36p	missense	SNP	0.040	C
ALDH1B1	219	genome.wustl.edu	37	9	38396587	38396587	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr9:38396587G>A	ENST00000377698.3	+	2	995	c.842G>A	c.(841-843)aGa>aAa	p.R281K		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	281					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		AACCTCAAGAGAGTCACCCTG	0.597																																																0			9											52.0	49.0	50.0					9																	38396587		2202	4300	6502	38386587	SO:0001583	missense	219			M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.842G>A	9.37:g.38396587G>A	ENSP00000366927:p.Arg281Lys	Somatic		Capture	Illumina GAIIx	4	38386587	B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	superfamily_ALDH-like,HMMPfam_Aldedh,PatternScan_ALDEHYDE_DEHYDR_GLU,PatternScan_ALDEHYDE_DEHYDR_CYS	p.R281K	ENST00000377698.3	37	c.842	CCDS6615.1	9	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267172	0.40095	.	.	ENSG00000137124	ENST00000377698	T	0.16597	2.33	5.7	5.7	0.88788	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.078188	0.47455	D	0.000223	T	0.12008	0.0292	N	0.11789	0.175	0.38181	D	0.939615	B	0.11235	0.004	B	0.20955	0.032	T	0.20140	-1.0284	10	0.24483	T	0.36	.	17.3416	0.87298	0.0:0.0:1.0:0.0	.	281	P30837	AL1B1_HUMAN	K	281	ENSP00000366927:R281K	ENSP00000366927:R281K	R	+	2	0	ALDH1B1	38386587	1.000000	0.71417	0.789000	0.31954	0.986000	0.74619	3.942000	0.56614	2.698000	0.92095	0.655000	0.94253	AGA	-	superfamily_ALDH-like,HMMPfam_Aldedh		0.597	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1B1	protein_coding	OTTHUMT00000052492.1	G			38386587	+1	no_errors	NM_000692	genbank	human	reviewed	54_36p	missense	SNP	0.992	A
PCED1B	91523	genome.wustl.edu	37	12	47628992	47628992	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr12:47628992G>C	ENST00000546455.1	+	4	877	c.146G>C	c.(145-147)aGa>aCa	p.R49T	PCED1B_ENST00000432328.1_Missense_Mutation_p.R49T|RP11-493L12.3_ENST00000547748.1_RNA			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B	49							hydrolase activity (GO:0016787)										GGGCAGCTTAGAGCAAGGGGG	0.597																																																0			12											71.0	65.0	67.0					12																	47628992		2203	4300	6503	45915259	SO:0001583	missense	91523			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.146G>C	12.37:g.47628992G>C	ENSP00000446688:p.Arg49Thr	Somatic		Capture	Illumina GAIIx	4	45915259	Q96B20	Missense_Mutation	SNP	superfamily_SGNH hydrolase	p.R49T	ENST00000546455.1	37	c.146	CCDS8752.1	12	.	.	.	.	.	.	.	.	.	.	G	8.146	0.786326	0.16189	.	.	ENSG00000179715	ENST00000546455;ENST00000432328;ENST00000549500;ENST00000549630;ENST00000551777	T;T;T;T;T	0.56275	1.01;1.01;0.56;0.57;0.47	3.79	-1.1	0.09872	Esterase, SGNH hydrolase-type (1);	0.161017	0.37483	N	0.002067	T	0.42899	0.1223	L	0.52905	1.665	0.23913	N	0.996482	B	0.33841	0.428	B	0.35899	0.213	T	0.40627	-0.9553	10	0.87932	D	0	-22.3339	7.191	0.25826	0.5146:0.0:0.4854:0.0	.	49	Q96HM7	F113B_HUMAN	T	49	ENSP00000446688:R49T;ENSP00000396040:R49T;ENSP00000449680:R49T;ENSP00000448000:R49T;ENSP00000448926:R49T	ENSP00000396040:R49T	R	+	2	0	FAM113B	45915259	0.997000	0.39634	0.962000	0.40283	0.011000	0.07611	0.493000	0.22451	-0.191000	0.10448	-0.238000	0.12139	AGA	-	NULL		0.597	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM113B	protein_coding	OTTHUMT00000405079.1	G	NM_138371		45915259	+1	no_errors	NM_138371	genbank	human	predicted	54_36p	missense	SNP	0.998	C
AGBL4	84871	genome.wustl.edu	37	1	50311647	50311647	+	Intron	SNP	C	C	T	rs181259983		TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr1:50311647C>T	ENST00000371839.1	-	2	274				AGBL4_ENST00000371836.1_Intron|AGBL4_ENST00000371838.1_Intron|AGBL4_ENST00000497451.1_Intron	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		CAAACATCAGCGAAACCACAC	0.522																																																0			1																																								50084234	SO:0001627	intron_variant	0			AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.157+5420G>A	1.37:g.50311647C>T		Somatic		Capture	Illumina GAIIx	4	50084234	B3KT26|B4DG37	Nonsense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.R330*	ENST00000371839.1	37	c.988	CCDS44137.1	1																																																																																			-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.522	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF859P	protein_coding	OTTHUMT00000021346.4	C	NM_032785		50084234	+1	no_start_codon	ENST00000401053	ensembl	human	known	54_36p	nonsense	SNP	0.124	T
RPGRIP1L	23322	genome.wustl.edu	37	16	53682975	53682975	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr16:53682975T>G	ENST00000379925.3	-	16	2255	c.2205A>C	c.(2203-2205)ttA>ttC	p.L735F	RPGRIP1L_ENST00000262135.4_Missense_Mutation_p.L735F|RPGRIP1L_ENST00000564374.1_Missense_Mutation_p.L735F|RPGRIP1L_ENST00000563746.1_Missense_Mutation_p.L735F	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like	735					camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				TGGGAACTCTTAATCGGAACC	0.393																																																0			16											121.0	113.0	116.0					16																	53682975		2198	4300	6498	52240476	SO:0001583	missense	23322				CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.2205A>C	16.37:g.53682975T>G	ENSP00000369257:p.Leu735Phe	Somatic		Capture	Illumina GAIIx	4	52240476	A0PJ88|Q9Y2K8	Missense_Mutation	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.L735F	ENST00000379925.3	37	c.2205	CCDS32447.1	16	.	.	.	.	.	.	.	.	.	.	T	20.6	4.010160	0.75046	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	D;D	0.91295	-2.82;-2.82	6.08	4.88	0.63580	.	0.000000	0.64402	D	0.000002	D	0.94483	0.8224	M	0.82823	2.61	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93235	0.6621	10	0.48119	T	0.1	-8.2322	7.9464	0.29989	0.0:0.1841:0.0:0.8159	.	735;735;735;735	B4E3M8;B7ZKJ9;Q68CZ1;Q68CZ1-2	.;.;FTM_HUMAN;.	F	735	ENSP00000369257:L735F;ENSP00000262135:L735F	ENSP00000262135:L735F	L	-	3	2	RPGRIP1L	52240476	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.793000	0.26944	0.988000	0.38734	0.482000	0.46254	TTA	-	superfamily_C2 domain (Calcium/lipid-binding domain CaLB)		0.393	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	RPGRIP1L	protein_coding	OTTHUMT00000422187.1	T	NM_015272		52240476	-1	no_errors	NM_015272	genbank	human	reviewed	54_36p	missense	SNP	0.997	G
ST18	9705	genome.wustl.edu	37	8	53071595	53071595	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr8:53071595G>A	ENST00000276480.7	-	15	2352	c.1669C>T	c.(1669-1671)Cgt>Tgt	p.R557C		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	557					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				GAGCTGGCACGGCCAGGGCTC	0.517																																																0			8											96.0	103.0	101.0					8																	53071595		2203	4300	6503	53234148	SO:0001583	missense	9705			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1669C>T	8.37:g.53071595G>A	ENSP00000276480:p.Arg557Cys	Somatic		Capture	Illumina GAIIx	4	53234148	Q17RY1	Missense_Mutation	SNP	superfamily_SSF103637,HMMPfam_zf-C2HC,HMMPfam_MYT1	p.R557C	ENST00000276480.7	37	c.1669	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820369	0.71028	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.49139	0.79;0.79	6.08	5.19	0.71726	Myelin transcription factor 1 (1);	0.212625	0.48767	D	0.000170	T	0.59115	0.2170	L	0.51422	1.61	0.44247	D	0.997096	D;D	0.76494	0.999;0.976	P;P	0.57846	0.828;0.645	T	0.58549	-0.7617	10	0.39692	T	0.17	-5.9118	17.2592	0.87065	0.0:0.1257:0.8743:0.0	.	557;557	E5RHS3;O60284	.;ST18_HUMAN	C	557	ENSP00000276480:R557C;ENSP00000428521:R557C	ENSP00000276480:R557C	R	-	1	0	ST18	53234148	1.000000	0.71417	0.959000	0.39883	0.943000	0.58893	2.917000	0.48821	1.546000	0.49388	0.655000	0.94253	CGT	-	HMMPfam_MYT1		0.517	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	protein_coding	OTTHUMT00000377867.1	G			53234148	-1	no_errors	NM_014682	genbank	human	validated	54_36p	missense	SNP	0.690	A
PCSK9	255738	genome.wustl.edu	37	1	55518362	55518362	+	Missense_Mutation	SNP	G	G	C	rs150169598		TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr1:55518362G>C	ENST00000302118.5	+	5	987	c.697G>C	c.(697-699)Gtg>Ctg	p.V233L	PCSK9_ENST00000543384.1_Missense_Mutation_p.V33L|PCSK9_ENST00000452118.2_3'UTR|PCSK9_ENST00000490692.1_3'UTR	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	233	Peptidase S8.				apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						CCTGGCAGGGGTGGTCAGCGG	0.632																																					Pancreas(137;1454 1827 5886 22361 42375)											0			1											34.0	35.0	35.0					1																	55518362		2203	4299	6502	55290950	SO:0001583	missense	255738			AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.697G>C	1.37:g.55518362G>C	ENSP00000303208:p.Val233Leu	Somatic		Capture	Illumina GAIIx	4	55290950	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Missense_Mutation	SNP	superfamily_Protease propeptides/inhibitors,HMMPfam_Inhibitor_I9,superfamily_Subtilisin-like,HMMPfam_Peptidase_S8	p.V233L	ENST00000302118.5	37	c.697	CCDS603.1	1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199013	0.58126	.	.	ENSG00000169174	ENST00000302118;ENST00000543384	D;D	0.86497	-2.13;-2.13	4.02	3.07	0.35406	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.64402	D	0.000002	T	0.79405	0.4440	N	0.12182	0.205	0.41055	D	0.985336	D	0.55800	0.973	P	0.48598	0.583	T	0.75947	-0.3138	10	0.25751	T	0.34	-13.4965	13.3053	0.60349	0.0:0.1604:0.8395:0.0	.	233	Q8NBP7	PCSK9_HUMAN	L	233;33	ENSP00000303208:V233L;ENSP00000441859:V33L	ENSP00000303208:V233L	V	+	1	0	PCSK9	55290950	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	4.318000	0.59190	0.609000	0.30018	0.563000	0.77884	GTG	-	superfamily_Subtilisin-like,HMMPfam_Peptidase_S8		0.632	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK9	protein_coding	OTTHUMT00000022280.1	G	NM_174936		55290950	+1	no_errors	NM_174936	genbank	human	reviewed	54_36p	missense	SNP	0.998	C
TCF12	6938	genome.wustl.edu	37	15	57554348	57554348	+	Silent	SNP	T	T	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr15:57554348T>C	ENST00000267811.5	+	16	1756	c.1452T>C	c.(1450-1452)tcT>tcC	p.S484S	TCF12_ENST00000452095.2_Silent_p.S504S|TCF12_ENST00000559710.1_Silent_p.S118S|TCF12_ENST00000537840.1_Silent_p.S248S|TCF12_ENST00000557843.1_Silent_p.S484S|TCF12_ENST00000543579.1_Silent_p.S338S|TCF12_ENST00000559703.1_Silent_p.S142S|TCF12_ENST00000438423.2_Silent_p.S508S|TCF12_ENST00000333725.5_Silent_p.S508S|TCF12_ENST00000343827.3_Silent_p.S314S	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	484					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		CAGTCCTGTCTAGTACAGTCA	0.353			T	TEC	extraskeletal myxoid chondrosarcoma																																		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0			15											88.0	84.0	85.0					15																	57554348		2192	4292	6484	55341640	SO:0001819	synonymous_variant	6938			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.1452T>C	15.37:g.57554348T>C		Somatic		Capture	Illumina GAIIx	4	55341640	Q7Z3D9|Q86TC1|Q86VM2	Silent	SNP	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH	p.S508	ENST00000267811.5	37	c.1524	CCDS10159.1	15																																																																																			-	NULL		0.353	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	protein_coding	OTTHUMT00000255069.3	T	NM_003205		55341640	+1	no_errors	NM_207036	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
ZNF613	79898	genome.wustl.edu	37	19	52448913	52448913	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr19:52448913G>A	ENST00000293471.6	+	6	2456	c.1777G>A	c.(1777-1779)Gag>Aag	p.E593K	ZNF613_ENST00000391794.4_Missense_Mutation_p.E557K|ZNF613_ENST00000601794.1_Intron	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	593					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		GTTCCAAGCAGAGAGCAAAGT	0.443																																																0			19											74.0	65.0	68.0					19																	52448913		2203	4300	6503	57140725	SO:0001583	missense	79898			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1777G>A	19.37:g.52448913G>A	ENSP00000293471:p.Glu593Lys	Somatic		Capture	Illumina GAIIx	4	57140725	Q96SS9	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.E593K	ENST00000293471.6	37	c.1777	CCDS33089.1	19	.	.	.	.	.	.	.	.	.	.	G	9.545	1.114423	0.20795	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	T;T	0.05580	3.51;3.42	2.9	-1.77	0.07982	.	.	.	.	.	T	0.02119	0.0066	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45396	-0.9264	9	0.02654	T	1	.	2.6838	0.05102	0.3807:0.0:0.4091:0.2102	.	593	Q6PF04	ZN613_HUMAN	K	593;557;267	ENSP00000293471:E593K;ENSP00000375671:E557K	ENSP00000293471:E593K	E	+	1	0	ZNF613	57140725	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.283000	0.08433	-0.269000	0.09298	-0.140000	0.14226	GAG	-	NULL		0.443	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	protein_coding	OTTHUMT00000461104.2	G	NM_024840		57140725	+1	no_errors	NM_001031721	genbank	human	provisional	54_36p	missense	SNP	0.000	A
PPP2R5E	5529	genome.wustl.edu	37	14	63920527	63920527	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr14:63920527G>T	ENST00000337537.3	-	3	836	c.234C>A	c.(232-234)gaC>gaA	p.D78E	PPP2R5E_ENST00000422769.2_Missense_Mutation_p.D2E|PPP2R5E_ENST00000553266.1_Intron|PPP2R5E_ENST00000555899.1_Missense_Mutation_p.D78E	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform	78					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		CAGATAGCGTGTCCATGAAGT	0.408																																																0			14											120.0	112.0	114.0					14																	63920527		2203	4300	6503	62990280	SO:0001583	missense	5529			L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.234C>A	14.37:g.63920527G>T	ENSP00000337641:p.Asp78Glu	Somatic		Capture	Illumina GAIIx	4	62990280	A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	Missense_Mutation	SNP	HMMPfam_B56,superfamily_ARM repeat	p.D78E	ENST00000337537.3	37	c.234	CCDS9758.1	14	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224604	0.79576	.	.	ENSG00000154001	ENST00000337537;ENST00000555899;ENST00000422769	.	.	.	6.03	6.03	0.97812	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72423	0.3458	M	0.73753	2.245	0.80722	D	1	P;P;P	0.46327	0.719;0.876;0.857	B;B;P	0.52454	0.268;0.371;0.699	T	0.73241	-0.4045	9	0.51188	T	0.08	-9.2927	13.7229	0.62740	0.0699:0.0:0.9301:0.0	.	78;78;78	B7ZKK9;B7Z5X1;Q16537	.;.;2A5E_HUMAN	E	78;78;2	.	ENSP00000337641:D78E	D	-	3	2	PPP2R5E	62990280	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.813000	0.69201	2.854000	0.98071	0.655000	0.94253	GAC	-	HMMPfam_B56,superfamily_ARM repeat		0.408	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP2R5E	protein_coding	OTTHUMT00000276973.1	G	NM_006246		62990280	-1	no_errors	NM_006246	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
GLCE	26035	genome.wustl.edu	37	15	69561365	69561365	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr15:69561365A>C	ENST00000261858.2	+	5	1864	c.1636A>C	c.(1636-1638)Aaa>Caa	p.K546Q	GLCE_ENST00000559420.2_Missense_Mutation_p.K482Q	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	546					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						GGAATCTCTTAAAGCCATGCT	0.468																																																0			15											158.0	139.0	145.0					15																	69561365		2200	4298	6498	67348419	SO:0001583	missense	26035			AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.1636A>C	15.37:g.69561365A>C	ENSP00000261858:p.Lys546Gln	Somatic		Capture	Illumina GAIIx	4	67348419	Q6GUQ2	Missense_Mutation	SNP	HMMPfam_C5-epim_C	p.K546Q	ENST00000261858.2	37	c.1636	CCDS32277.1	15	.	.	.	.	.	.	.	.	.	.	A	17.72	3.459295	0.63401	.	.	ENSG00000138604	ENST00000261858	T	0.51574	0.7	4.99	4.99	0.66335	.	0.047152	0.85682	D	0.000000	T	0.64627	0.2615	M	0.86268	2.805	0.50171	D	0.999858	D	0.58268	0.982	P	0.57620	0.824	T	0.69591	-0.5104	10	0.56958	D	0.05	-23.6458	10.0438	0.42175	0.8308:0.1692:0.0:0.0	.	546	O94923	GLCE_HUMAN	Q	546	ENSP00000261858:K546Q	ENSP00000261858:K546Q	K	+	1	0	GLCE	67348419	1.000000	0.71417	0.831000	0.32960	0.941000	0.58515	5.760000	0.68793	2.007000	0.58848	0.455000	0.32223	AAA	-	HMMPfam_C5-epim_C		0.468	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCE	protein_coding		A	NM_015554		67348419	+1	no_errors	NM_015554	genbank	human	validated	54_36p	missense	SNP	0.987	C
RAD17	5884	genome.wustl.edu	37	5	68682044	68682044	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:68682044A>T	ENST00000509734.1	+	9	1447	c.769A>T	c.(769-771)Ata>Tta	p.I257L	RAD17_ENST00000361732.2_Missense_Mutation_p.I246L|RAD17_ENST00000354312.3_Missense_Mutation_p.I246L|RAD17_ENST00000305138.4_Missense_Mutation_p.I246L|RAD17_ENST00000521422.1_Missense_Mutation_p.I81L|RAD17_ENST00000354868.5_Missense_Mutation_p.I246L|RAD17_ENST00000358030.2_Missense_Mutation_p.I81L|RAD17_ENST00000504177.1_Intron|RAD17_ENST00000380774.3_Missense_Mutation_p.I257L|RAD17_ENST00000282891.6_Missense_Mutation_p.I160L|RAD17_ENST00000345306.6_Missense_Mutation_p.I246L			O75943	RAD17_HUMAN	RAD17 homolog (S. pombe)	257					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|regulation of phosphorylation (GO:0042325)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)						Lung NSC(167;5.19e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;9.36e-57)|Epithelial(20;1.21e-52)|all cancers(19;3.34e-48)|Lung(70;0.0183)		TCTTATATTTATAATCTCGGA	0.313								Other conserved DNA damage response genes																																								0			5											81.0	89.0	86.0					5																	68682044		2201	4295	6496	68717800	SO:0001583	missense	5884			AF085736	CCDS4003.1, CCDS4004.1, CCDS4005.1, CCDS47226.1	5q13	2010-09-24	2001-11-28		ENSG00000152942	ENSG00000152942			9807	protein-coding gene	gene with protein product		603139	"""RAD1 (S. pombe) homolog"""			9869296, 9660800	Standard	NM_133343		Approved	Rad24, RAD17Sp, CCYC	uc003jwo.3	O75943	OTTHUMG00000099357	ENST00000509734.1:c.769A>T	5.37:g.68682044A>T	ENSP00000426191:p.Ile257Leu	Somatic		Capture	Illumina GAIIx	4	68717800	A8K8X2|D3DWA5|O75714|Q7Z3S4|Q9UNK7|Q9UNR7|Q9UNR8|Q9UPF5	Missense_Mutation	SNP	HMMPfam_Rad17,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.I257L	ENST00000509734.1	37	c.769	CCDS4003.1	5	.	.	.	.	.	.	.	.	.	.	A	18.45	3.626418	0.66901	.	.	ENSG00000152942	ENST00000361732;ENST00000509734;ENST00000354868;ENST00000521422;ENST00000354312;ENST00000345306;ENST00000305138;ENST00000282891;ENST00000358030;ENST00000380774	T;T;T;T;T;T;T;T;T;T	0.25414	1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8;1.8	5.15	2.77	0.32553	ATPase, AAA+ type, core (1);	0.152584	0.64402	D	0.000017	T	0.43144	0.1234	M	0.89163	3.01	0.47698	D	0.999495	P;D;D	0.53745	0.947;0.962;0.962	P;P;P	0.50378	0.566;0.639;0.508	T	0.42275	-0.9461	10	0.48119	T	0.1	-22.0547	10.7938	0.46449	0.8518:0.0:0.1482:0.0	.	257;160;246	O75943;O75943-4;O75943-2	RAD17_HUMAN;.;.	L	246;257;246;81;246;246;246;160;81;257	ENSP00000355226:I246L;ENSP00000426191:I257L;ENSP00000346938:I246L;ENSP00000427743:I81L;ENSP00000346271:I246L;ENSP00000311227:I246L;ENSP00000303134:I246L;ENSP00000282891:I160L;ENSP00000350725:I81L;ENSP00000370151:I257L	ENSP00000282891:I160L	I	+	1	0	RAD17	68717800	1.000000	0.71417	0.996000	0.52242	0.933000	0.57130	4.610000	0.61155	0.066000	0.16515	-1.463000	0.01021	ATA	-	HMMPfam_Rad17,superfamily_P-loop containing nucleoside triphosphate hydrolases		0.313	RAD17-008	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RAD17	protein_coding	OTTHUMT00000369171.1	A	NM_133344		68717800	+1	no_errors	NM_133339	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
FOLR3	2352	genome.wustl.edu	37	11	71850823	71850823	+	Missense_Mutation	SNP	A	A	G	rs369675505		TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr11:71850823A>G	ENST00000445078.2	+	5	877	c.806A>G	c.(805-807)tAt>tGt	p.Y269C	FOLR3_ENST00000456237.1_Missense_Mutation_p.Y271C|FOLR3_ENST00000442948.2_Missense_Mutation_p.Y228C			P41439	FOLR3_HUMAN	folate receptor 3 (gamma)	227					folic acid transport (GO:0015884)	extracellular region (GO:0005576)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	folic acid binding (GO:0005542)			large_intestine(3)|lung(8)|prostate(2)	13					Folic Acid(DB00158)	GCCAAGTTCTATGCTGCGGCC	0.542													a|||	1	0.000199681	0.0008	0.0	5008	,	,		16339	0.0		0.0	False		,,,				2504	0.0															0			11						A	CYS/TYR	4,4396		0,4,2196	37.0	39.0	39.0		684	1.8	0.6	11		39	0,8586		0,0,4293	no	missense	FOLR3	NM_000804.2	194	0,4,6489	GG,GA,AA		0.0,0.0909,0.0308	probably-damaging	229/246	71850823	4,12982	2200	4293	6493	71528471	SO:0001583	missense	2352			U08471	CCDS73344.1	11q13.4	2012-11-14			ENSG00000110203	ENSG00000110203			3795	protein-coding gene	gene with protein product		602469				8110752	Standard	NM_000804		Approved	FR-G	uc001orx.1	P41439	OTTHUMG00000167870	ENST00000445078.2:c.806A>G	11.37:g.71850823A>G	ENSP00000390338:p.Tyr269Cys	Somatic		Capture	Illumina GAIIx	4	71528471	J3KQ90|Q05C14	Missense_Mutation	SNP	HMMPfam_Folate_rec	p.Y228C	ENST00000445078.2	37	c.683		11	.	.	.	.	.	.	.	.	.	.	N	11.86	1.764022	0.31228	9.09E-4	0.0	ENSG00000110203	ENST00000445078;ENST00000456237;ENST00000442948	T;T;T	0.79033	-1.03;-1.03;-1.23	2.94	1.79	0.24919	.	0.000000	0.56097	U	0.000023	D	0.84415	0.5467	.	.	.	0.51767	D	0.99993	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.81118	-0.1078	8	.	.	.	.	6.179	0.20459	0.8662:0.0:0.1338:0.0	.	271;227	E9PGT2;P41439	.;FOLR3_HUMAN	C	269;271;228	ENSP00000390338:Y269C;ENSP00000399235:Y271C;ENSP00000411161:Y228C	.	Y	+	2	0	FOLR3	71528471	1.000000	0.71417	0.573000	0.28510	0.178000	0.23041	6.012000	0.70767	0.345000	0.23873	0.383000	0.25322	TAT	-	NULL		0.542	FOLR3-001	NOVEL	upstream_ATG|basic	protein_coding	FOLR3	protein_coding	OTTHUMT00000396739.1	A	NM_000804		71528471	+1	no_errors	ENST00000325101	ensembl	human	known	54_36p	missense	SNP	0.899	G
PSAP	5660	genome.wustl.edu	37	10	73578475	73578475	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr10:73578475C>T	ENST00000394936.3	-	13	1585	c.1438G>A	c.(1438-1440)Gga>Aga	p.G480R	PSAP_ENST00000394934.1_Missense_Mutation_p.G482R			P07602	SAP_HUMAN	prosaposin	480	Saposin B-type 4. {ECO:0000255|PROSITE- ProRule:PRU00415}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						GGGCAGGCTCCAATTTTCTAT	0.493																																																0			10											75.0	84.0	81.0					10																	73578475		2203	4300	6503	73248481	SO:0001583	missense	5660			BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.1438G>A	10.37:g.73578475C>T	ENSP00000378394:p.Gly480Arg	Somatic		Capture	Illumina GAIIx	4	73248481	P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	HMMPfam_SapA,HMMSmart_SAPA,superfamily_Saposin_like,HMMPfam_SapB_1,HMMSmart_SapB,HMMPfam_SapB_2	p.G483R	ENST00000394936.3	37	c.1447	CCDS7311.1	10	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293437	0.60086	.	.	ENSG00000197746	ENST00000394936;ENST00000373120;ENST00000357471;ENST00000394934;ENST00000394929;ENST00000404083;ENST00000394940	T;T	0.80909	-1.43;-1.43	5.35	3.48	0.39840	Saposin-like (2);Saposin-like type B, 2 (1);Saposin B (2);	0.057469	0.64402	N	0.000001	T	0.80270	0.4592	L	0.52126	1.63	0.54753	D	0.999984	P	0.50272	0.933	P	0.55508	0.777	T	0.77259	-0.2654	10	0.38643	T	0.18	-11.206	5.7401	0.18089	0.1386:0.6427:0.0:0.2187	.	480	P07602	SAP_HUMAN	R	480;480;483;482;196;486;406	ENSP00000378394:G480R;ENSP00000378392:G482R	ENSP00000350063:G483R	G	-	1	0	PSAP	73248481	0.908000	0.30866	1.000000	0.80357	0.738000	0.42128	1.736000	0.38187	1.259000	0.44117	0.561000	0.74099	GGA	-	superfamily_Saposin_like,HMMSmart_SapB,HMMPfam_SapB_2		0.493	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSAP	protein_coding	OTTHUMT00000048553.1	C	NM_002778		73248481	-1	no_errors	NM_001042465	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SLAIN1	122060	genome.wustl.edu	37	13	78335170	78335170	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr13:78335170G>T	ENST00000466548.1	+	7	1582	c.1556G>T	c.(1555-1557)aGt>aTt	p.S519I	SLAIN1_ENST00000488699.1_Missense_Mutation_p.S377I|SLAIN1_ENST00000351546.3_Missense_Mutation_p.S256I|SLAIN1_ENST00000314070.5_Missense_Mutation_p.S142I|SLAIN1_ENST00000418532.1_Missense_Mutation_p.S300I|SLAIN1_ENST00000358679.3_Missense_Mutation_p.S256I|SLAIN1_ENST00000267219.8_Missense_Mutation_p.S300I	NM_001242868.1	NP_001229797.1	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1	519										breast(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		ATGGGTCGCAGTGCACTCCCA	0.468																																																0			13											91.0	83.0	85.0					13																	78335170		2203	4300	6503	77233171	SO:0001583	missense	122060			AK054608	CCDS9460.1, CCDS31995.1, CCDS31995.2, CCDS55901.1, CCDS73588.1, CCDS73589.1	13q22.3	2006-09-12	2006-09-12	2006-09-12	ENSG00000139737	ENSG00000139737			26387	protein-coding gene	gene with protein product		610491	"""chromosome 13 open reading frame 32"""	C13orf32		16546155	Standard	NM_001040153		Approved	FLJ30046	uc001vkk.3	Q8ND83	OTTHUMG00000017110	ENST00000466548.1:c.1556G>T	13.37:g.78335170G>T	ENSP00000419730:p.Ser519Ile	Somatic		Capture	Illumina GAIIx	4	77233171	A8K0Z9|B7Z209|Q5T6P4|Q5T6P7|Q8ND10|Q96NV0	Missense_Mutation	SNP	NULL	p.S300I	ENST00000466548.1	37	c.899		13	.	.	.	.	.	.	.	.	.	.	G	33	5.276657	0.95459	.	.	ENSG00000139737	ENST00000466548;ENST00000389459;ENST00000418532;ENST00000488699;ENST00000267219;ENST00000351546;ENST00000314070;ENST00000358679	.	.	.	5.9	5.9	0.94986	.	0.160375	0.64402	D	0.000001	D	0.83982	0.5372	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.997	D;D;D;D	0.91635	0.998;0.952;0.999;0.994	D	0.84847	0.0811	9	0.87932	D	0	-15.4493	20.2822	0.98520	0.0:0.0:1.0:0.0	.	255;377;142;519	B7Z326;B7Z209;Q8ND10;Q8ND83	.;.;.;SLAI1_HUMAN	I	519;519;300;377;300;256;142;256	.	ENSP00000267219:S300I	S	+	2	0	SLAIN1	77233171	1.000000	0.71417	0.987000	0.45799	0.987000	0.75469	8.492000	0.90471	2.806000	0.96561	0.655000	0.94253	AGT	-	NULL		0.468	SLAIN1-009	KNOWN	not_organism_supported|basic	protein_coding	SLAIN1	protein_coding	OTTHUMT00000355018.1	G	NM_144595		77233171	+1	no_errors	NM_001040153	genbank	human	validated	54_36p	missense	SNP	0.997	T
PHIP	55023	genome.wustl.edu	37	6	79650905	79650905	+	Silent	SNP	C	C	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr6:79650905C>T	ENST00000275034.4	-	40	5138	c.4971G>A	c.(4969-4971)aaG>aaA	p.K1657K	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1657					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TACCCCTTTTCTTGTGTATAA	0.398																																																0			6											202.0	199.0	200.0					6																	79650905		2203	4300	6503	79707624	SO:0001819	synonymous_variant	55023			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.4971G>A	6.37:g.79650905C>T		Somatic		Capture	Illumina GAIIx	4	79707624	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	superfamily_Bromodomain,HMMSmart_BROMO,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.R382K	ENST00000275034.4	37	c.1145	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	C	6.590	0.477264	0.12521	.	.	ENSG00000146247	ENST00000355098	.	.	.	5.87	5.0	0.66597	.	.	.	.	.	T	0.60470	0.2271	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62115	-0.6922	4	.	.	.	-17.4414	13.9475	0.64094	0.0:0.9277:0.0:0.0723	.	.	.	.	K	382	.	.	R	-	2	0	PHIP	79707624	0.999000	0.42202	1.000000	0.80357	0.806000	0.45545	0.480000	0.22244	1.498000	0.48600	0.650000	0.86243	AGA	-	NULL		0.398	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	protein_coding	OTTHUMT00000041297.2	C			79707624	-1	no_errors	ENST00000355098	ensembl	human	known	54_36p	missense	SNP	1.000	T
VDAC1	7416	genome.wustl.edu	37	X	80185569	80185569	+	IGR	SNP	C	C	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chrX:80185569C>T								RNU6-493P (29206 upstream) : RNU6-995P (6363 downstream)																							CAGAGTTTGGCGGCTCCATTT	0.478																																																0			X																																								80072225	SO:0001628	intergenic_variant	0																															X.37:g.80185569C>T		Somatic		Capture	Illumina GAIIx	4	80072225		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.478					LOC642585			C			80072225	+1	pseudogene	XR_038848	genbank	human	model	54_36p	rna	SNP	0.839	T
NBPF22P	285622	genome.wustl.edu	37	5	85592306	85592306	+	RNA	SNP	C	C	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:85592306C>T	ENST00000590707.1	+	0	1580					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		ATTCCATCCCCCTCCAATTGT	0.453																																																0			5																																								85628062			285622			BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85592306C>T		Somatic		Capture	Illumina GAIIx	4	85628062		RNA	SNP	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			-	-		0.453	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	pseudogene	OTTHUMT00000453100.1	C	XM_208333		85628062	+1	pseudogene	NR_003719	genbank	human	validated	54_36p	rna	SNP	0.022	T
TMEM55A	55529	genome.wustl.edu	37	8	92008043	92008043	+	Silent	SNP	G	G	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr8:92008043G>T	ENST00000285419.3	-	7	950	c.636C>A	c.(634-636)ggC>ggA	p.G212G		NM_018710.2	NP_061180.1	Q8N4L2	TM55A_HUMAN	transmembrane protein 55A	212						endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	13			BRCA - Breast invasive adenocarcinoma(11;0.033)			AATCTGGGGTGCCAACCTAAA	0.358																																																0			8											54.0	54.0	54.0					8																	92008043		2203	4300	6503	92077219	SO:0001819	synonymous_variant	55529			BC033892	CCDS6252.1	8q21.3	2005-08-09			ENSG00000155099	ENSG00000155099			25452	protein-coding gene	gene with protein product		609864				12477932	Standard	NM_018710		Approved	DKFZp762O076	uc003yes.3	Q8N4L2	OTTHUMG00000164019	ENST00000285419.3:c.636C>A	8.37:g.92008043G>T		Somatic		Capture	Illumina GAIIx	4	92077219	B2R9H4|Q68CU2	Silent	SNP	HMMPfam_Tmemb_55A	p.G212	ENST00000285419.3	37	c.636	CCDS6252.1	8																																																																																			-	HMMPfam_Tmemb_55A		0.358	TMEM55A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM55A	protein_coding	OTTHUMT00000376778.1	G	NM_018710		92077219	-1	no_errors	NM_018710	genbank	human	validated	54_36p	silent	SNP	0.999	T
BRDTP1	643486	genome.wustl.edu	37	X	95592559	95592559	+	IGR	SNP	T	T	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chrX:95592559T>C								RN7SL379P (313915 upstream) : RN7SKP194 (72871 downstream)																							TCTGAGCTTTTACTTCCTTTT	0.408																																																0			X																																								95479215	SO:0001628	intergenic_variant	643486																															X.37:g.95592559T>C		Somatic		Capture	Illumina GAIIx	4	95479215		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.408					LOC643486			T			95479215	-1	pseudogene	NR_003539	genbank	human	provisional	54_36p	rna	SNP	0.646	C
FBXO24	26261	genome.wustl.edu	37	7	100190595	100190595	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr7:100190595G>A	ENST00000241071.6	+	5	1070	c.748G>A	c.(748-750)Gtg>Atg	p.V250M	PCOLCE-AS1_ENST00000544873.1_RNA|PCOLCE-AS1_ENST00000442166.2_RNA|FBXO24_ENST00000465843.1_Missense_Mutation_p.V236M|FBXO24_ENST00000468962.1_Missense_Mutation_p.V238M|FBXO24_ENST00000427939.2_Missense_Mutation_p.V288M|FBXO24_ENST00000360609.2_Missense_Mutation_p.V236M	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24	250					protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CAAGCAGATCGTGCTGGTTGG	0.552																																																0			7											89.0	72.0	78.0					7																	100190595		2203	4300	6503	100028531	SO:0001583	missense	26261			AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.748G>A	7.37:g.100190595G>A	ENSP00000241071:p.Val250Met	Somatic		Capture	Illumina GAIIx	4	100028531	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	superfamily_F-box domain,HMMPfam_F-box,HMMSmart_SM00256,superfamily_RCC1/BLIP-II	p.V250M	ENST00000241071.6	37	c.748	CCDS5698.1	7	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461853	0.63513	.	.	ENSG00000106336	ENST00000241071;ENST00000360609;ENST00000465843;ENST00000468962;ENST00000427939	T;T;T;T;T	0.46819	2.45;0.86;0.86;2.45;2.44	5.73	4.84	0.62591	.	0.317364	0.25948	N	0.027261	T	0.41766	0.1173	N	0.08118	0	0.31674	N	0.643956	D;D;D;D	0.65815	0.968;0.982;0.982;0.995	P;P;P;P	0.54706	0.475;0.475;0.475;0.759	T	0.55655	-0.8107	10	0.72032	D	0.01	-7.9544	13.752	0.62912	0.0:0.0:0.845:0.155	.	238;288;250;236	B4DY42;B4DX91;O75426;O75426-2	.;.;FBX24_HUMAN;.	M	250;236;236;238;288	ENSP00000241071:V250M;ENSP00000353821:V236M;ENSP00000419602:V236M;ENSP00000420239:V238M;ENSP00000416558:V288M	ENSP00000241071:V250M	V	+	1	0	FBXO24	100028531	0.309000	0.24518	0.992000	0.48379	0.487000	0.33371	1.029000	0.30140	1.407000	0.46875	0.551000	0.68910	GTG	-	superfamily_RCC1/BLIP-II		0.552	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO24	protein_coding	OTTHUMT00000356104.1	G			100028531	+1	no_errors	NM_033506	genbank	human	reviewed	54_36p	missense	SNP	0.998	A
TFR2	7036	genome.wustl.edu	37	7	100225100	100225100	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr7:100225100G>T	ENST00000462107.1	-	17	2069	c.1782C>A	c.(1780-1782)taC>taA	p.Y594*	TFR2_ENST00000544242.1_Nonsense_Mutation_p.Y135*|TFR2_ENST00000431692.1_3'UTR|TFR2_ENST00000223051.3_Nonsense_Mutation_p.Y594*			Q9UP52	TFR2_HUMAN	transferrin receptor 2	594					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	GCAGGAATGGGTAGGCCTGGT	0.667																																																0			7											55.0	45.0	49.0					7																	100225100		2203	4300	6503	100063036	SO:0001587	stop_gained	7036			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.1782C>A	7.37:g.100225100G>T	ENSP00000420525:p.Tyr594*	Somatic		Capture	Illumina GAIIx	4	100063036	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Nonsense_Mutation	SNP	superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA,superfamily_Zn-dependent exopeptidases,HMMPfam_Peptidase_M28,superfamily_Transferrin receptor ectodomain C-terminal domain,HMMPfam_TFR_dimer	p.Y594*	ENST00000462107.1	37	c.1782	CCDS34707.1	7	.	.	.	.	.	.	.	.	.	.	G	40	8.507780	0.98841	.	.	ENSG00000106327	ENST00000223051;ENST00000462107;ENST00000544242	.	.	.	5.42	3.54	0.40534	.	0.203246	0.44483	D	0.000452	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.1815	7.2076	0.25915	0.2223:0.0:0.7777:0.0	.	.	.	.	X	594;594;135	.	ENSP00000223051:Y594X	Y	-	3	2	TFR2	100063036	1.000000	0.71417	0.995000	0.50966	0.566000	0.35808	0.871000	0.28023	0.623000	0.30267	0.456000	0.33151	TAC	-	superfamily_Zn-dependent exopeptidases,HMMPfam_Peptidase_M28		0.667	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	protein_coding	OTTHUMT00000356392.3	G	NM_003227		100063036	-1	no_errors	NM_003227	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
DYNC2H1	79659	genome.wustl.edu	37	11	103026072	103026072	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr11:103026072A>C	ENST00000375735.2	+	25	3730	c.3586A>C	c.(3586-3588)Atc>Ctc	p.I1196L	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.I1196L|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1196	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CGTAATTCCTATCTTGAAATA	0.338																																																0			11											77.0	71.0	73.0					11																	103026072		1815	4070	5885	102531282	SO:0001583	missense	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3586A>C	11.37:g.103026072A>C	ENSP00000364887:p.Ile1196Leu	Somatic		Capture	Illumina GAIIx	4	102531282	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.I1196L	ENST00000375735.2	37	c.3586	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	A	9.968	1.224636	0.22457	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.57752	0.38;0.38	5.63	-2.78	0.05859	Dynein heavy chain, domain-2 (1);	0.567300	0.15162	N	0.277138	T	0.16085	0.0387	N	0.00746	-1.225	0.33817	D	0.62851	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.45934	-0.9227	10	0.02654	T	1	.	11.9727	0.53071	0.1969:0.1305:0.6726:0.0	.	1196;1196	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	L	1196	ENSP00000364887:I1196L;ENSP00000381167:I1196L	ENSP00000364887:I1196L	I	+	1	0	DYNC2H1	102531282	0.996000	0.38824	0.931000	0.37212	0.972000	0.66771	0.440000	0.21592	-0.675000	0.05246	0.454000	0.30748	ATC	-	HMMPfam_DHC_N2		0.338	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	protein_coding	OTTHUMT00000387196.1	A	XM_370652		102531282	+1	no_errors	NM_001080463	genbank	human	provisional	54_36p	missense	SNP	0.997	C
CENPE	1062	genome.wustl.edu	37	4	104104014	104104014	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr4:104104014G>A	ENST00000265148.3	-	11	957	c.868C>T	c.(868-870)Cga>Tga	p.R290*	CENPE_ENST00000509120.1_5'Flank|CENPE_ENST00000380026.3_Nonsense_Mutation_p.R290*	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	290	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGGAGAATTCGTGTTAACTTG	0.353																																																0			4											109.0	112.0	111.0					4																	104104014		2202	4300	6502	104323463	SO:0001587	stop_gained	1062			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.868C>T	4.37:g.104104014G>A	ENSP00000265148:p.Arg290*	Somatic		Capture	Illumina GAIIx	4	104323463	A6NKY9|A8K2U7|Q4LE75	Nonsense_Mutation	SNP	HMMSmart_SM00129,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,PatternScan_AA_TRNA_LIGASE_I	p.R290*	ENST00000265148.3	37	c.868	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.839534	0.97009	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	.	.	.	5.05	3.24	0.37175	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0889	0.30788	0.0732:0.0:0.6548:0.2719	.	.	.	.	X	290	.	ENSP00000265148:R290X	R	-	1	2	CENPE	104323463	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	2.515000	0.45512	1.337000	0.45525	-0.157000	0.13467	CGA	-	HMMSmart_SM00129,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Kinesin		0.353	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	protein_coding		G			104323463	-1	no_errors	NM_001813	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
LAMTOR5	10542	genome.wustl.edu	37	1	110950337	110950337	+	5'Flank	SNP	C	C	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr1:110950337C>G	ENST00000602318.1	-	0	0				LAMTOR5_ENST00000602858.1_5'Flank|LAMTOR5-AS1_ENST00000598454.1_RNA|LAMTOR5-AS1_ENST00000609709.1_RNA|LAMTOR5-AS1_ENST00000609244.1_RNA|LAMTOR5-AS1_ENST00000608067.1_RNA|LAMTOR5-AS1_ENST00000610148.1_RNA|LAMTOR5_ENST00000483260.1_5'Flank|LAMTOR5-AS1_ENST00000609512.1_RNA|LAMTOR5-AS1_ENST00000608253.1_RNA|LAMTOR5_ENST00000256644.4_Missense_Mutation_p.R51P|LAMTOR5_ENST00000474861.2_5'Flank|LAMTOR5-AS1_ENST00000590826.1_RNA|LAMTOR5-AS1_ENST00000608499.1_RNA|LAMTOR5-AS1_ENST00000587691.1_RNA|LAMTOR5-AS1_ENST00000590413.1_RNA|LAMTOR5-AS1_ENST00000457535.1_RNA|LAMTOR5-AS1_ENST00000608602.1_RNA|LAMTOR5-AS1_ENST00000608486.1_RNA			O43504	LTOR5_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 5						cellular response to amino acid stimulus (GO:0071230)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)|response to virus (GO:0009615)|viral genome replication (GO:0019079)	cytosol (GO:0005829)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)											GGGCGTGGACCGTAACGGCGC	0.612																																																0			1											88.0	74.0	79.0					1																	110950337		2203	4300	6503	110751860	SO:0001631	upstream_gene_variant	10542			AF029890	CCDS824.1	1p12	2012-09-24	2012-09-24	2012-09-24	ENSG00000134248	ENSG00000134248			17955	protein-coding gene	gene with protein product	"""HBx-interacting protein"", ""hepatitis B virus x-interacting protein (9.6kD)"""	608521	"""hepatitis B virus x interacting protein"""	HBXIP		9499022, 22980980	Standard	NM_006402		Approved	XIP, MGC71071	uc001dzr.3	O43504	OTTHUMG00000011568		1.37:g.110950337C>G	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	110751860	Q6IBD8	Missense_Mutation	SNP	NULL	p.R51P	ENST00000602318.1	37	c.152		1	.	.	.	.	.	.	.	.	.	.	C	8.918	0.960480	0.18583	.	.	ENSG00000134248	ENST00000256644	.	.	.	4.14	-8.28	0.01013	.	0.813726	0.09881	N	0.743674	T	0.04679	0.0127	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.19095	-1.0316	5	.	.	.	4.0526	1.154	0.01792	0.2078:0.151:0.3479:0.2933	.	.	.	.	P	51	.	.	R	-	2	0	HBXIP	110751860	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.503000	0.00449	-2.164000	0.00782	-0.972000	0.02603	CGG	-	NULL		0.612	LAMTOR5-007	NOVEL	basic|appris_principal	protein_coding	HBXIP	protein_coding	OTTHUMT00000467909.1	C	NM_006402		110751860	-1	no_errors	NM_006402	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
ABHD10	55347	genome.wustl.edu	37	3	111705845	111705845	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr3:111705845G>T	ENST00000273359.3	+	4	550	c.523G>T	c.(523-525)Gta>Tta	p.V175L	ABHD10_ENST00000494817.1_Missense_Mutation_p.V175L|ABHD10_ENST00000534857.1_Missense_Mutation_p.V18L	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	175					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						TCTTATTGGTGTAGCTACAGC	0.403																																																0			3											134.0	127.0	129.0					3																	111705845		2203	4300	6503	113188535	SO:0001583	missense	55347			AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.523G>T	3.37:g.111705845G>T	ENSP00000273359:p.Val175Leu	Somatic		Capture	Illumina GAIIx	4	113188535	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Missense_Mutation	SNP	superfamily_SSF53474,HMMPfam_Abhydrolase_1	p.V175L	ENST00000273359.3	37	c.523	CCDS2963.1	3	.	.	.	.	.	.	.	.	.	.	G	17.25	3.340643	0.60963	.	.	ENSG00000144827	ENST00000534857;ENST00000273359;ENST00000494817	T;T;T	0.67523	1.02;-0.27;-0.27	5.78	-0.91	0.10511	.	0.226724	0.42682	D	0.000665	T	0.45216	0.1331	N	0.05510	-0.035	0.21915	N	0.999479	P	0.34977	0.478	B	0.41236	0.351	T	0.45804	-0.9236	10	0.22109	T	0.4	-13.8237	11.2156	0.48825	0.5543:0.0:0.4457:0.0	.	175	Q9NUJ1	ABHDA_HUMAN	L	18;175;175	ENSP00000442932:V18L;ENSP00000273359:V175L;ENSP00000418973:V175L	ENSP00000273359:V175L	V	+	1	0	ABHD10	113188535	0.173000	0.23056	0.151000	0.22473	0.926000	0.56050	0.129000	0.15830	-0.145000	0.11294	0.591000	0.81541	GTA	-	superfamily_SSF53474,HMMPfam_Abhydrolase_1		0.403	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD10	protein_coding	OTTHUMT00000354326.1	G	NM_018394		113188535	+1	no_errors	NM_018394	genbank	human	validated	54_36p	missense	SNP	0.905	T
CCDC80	151887	genome.wustl.edu	37	3	112357087	112357087	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr3:112357087T>A	ENST00000206423.3	-	2	2619	c.1666A>T	c.(1666-1668)Aat>Tat	p.N556Y	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.N556Y	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	556	Lys-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						gcgttctcattcttcatcttt	0.393																																																0			3											125.0	106.0	112.0					3																	112357087		2203	4300	6503	113839777	SO:0001583	missense	151887			AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1666A>T	3.37:g.112357087T>A	ENSP00000206423:p.Asn556Tyr	Somatic		Capture	Illumina GAIIx	4	113839777	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	NULL	p.N556Y	ENST00000206423.3	37	c.1666	CCDS2968.1	3	.	.	.	.	.	.	.	.	.	.	T	14.47	2.545478	0.45280	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594	T;T	0.47528	0.84;0.84	5.78	3.37	0.38596	.	0.874370	0.10429	N	0.675697	T	0.33702	0.0872	N	0.19112	0.55	0.34025	D	0.653156	P;P;P	0.42620	0.785;0.679;0.679	B;B;B	0.41723	0.351;0.365;0.191	T	0.43294	-0.9400	10	0.62326	D	0.03	-5.7874	6.5188	0.22262	0.0:0.0819:0.1588:0.7593	.	567;556;556	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	Y	556;556;184	ENSP00000206423:N556Y;ENSP00000411814:N556Y	ENSP00000206423:N556Y	N	-	1	0	CCDC80	113839777	0.995000	0.38212	0.987000	0.45799	0.893000	0.52053	0.854000	0.27791	0.973000	0.38340	0.454000	0.30748	AAT	-	NULL		0.393	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	protein_coding	OTTHUMT00000354219.1	T	NM_199511		113839777	-1	no_errors	NM_199511	genbank	human	validated	54_36p	missense	SNP	0.970	A
KIAA1407	57577	genome.wustl.edu	37	3	113697706	113697706	+	Splice_Site	SNP	T	T	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr3:113697706T>G	ENST00000295878.3	-	15	2605	c.2459A>C	c.(2458-2460)cAg>cCg	p.Q820P	KIAA1407_ENST00000545063.1_3'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	820										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						TGTCCTTACCTGTAGCCAGCT	0.403																																																0			3											197.0	193.0	194.0					3																	113697706		2203	4300	6503	115180396	SO:0001630	splice_region_variant	57577			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2460+1A>C	3.37:g.113697706T>G		Somatic		Capture	Illumina GAIIx	4	115180396	B4DYL1|Q9P2E0	Missense_Mutation	SNP	NULL	p.Q820P	ENST00000295878.3	37	c.2459	CCDS2977.1	3	.	.	.	.	.	.	.	.	.	.	T	13.51	2.257845	0.39896	.	.	ENSG00000163617	ENST00000295878	T	0.34472	1.36	4.71	2.29	0.28610	.	0.364091	0.31134	N	0.008195	T	0.38904	0.1058	M	0.65975	2.015	0.80722	D	1	D	0.54207	0.965	P	0.47981	0.563	T	0.20042	-1.0287	10	0.66056	D	0.02	.	6.6058	0.22724	0.0:0.2131:0.0:0.7869	.	820	Q8NCU4	K1407_HUMAN	P	820	ENSP00000295878:Q820P	ENSP00000295878:Q820P	Q	-	2	0	KIAA1407	115180396	0.987000	0.35691	0.910000	0.35882	0.448000	0.32197	1.477000	0.35431	0.382000	0.24878	0.454000	0.30748	CAG	-	NULL		0.403	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	protein_coding	OTTHUMT00000354724.2	T	NM_020817	Missense_Mutation	115180396	-1	no_errors	NM_020817	genbank	human	predicted	54_36p	missense	SNP	0.998	G
MEGF10	84466	genome.wustl.edu	37	5	126771109	126771109	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:126771109A>G	ENST00000274473.6	+	17	2299	c.2032A>G	c.(2032-2034)Aac>Gac	p.N678D	MEGF10_ENST00000503335.2_Missense_Mutation_p.N678D	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	678	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		CTGCACCAACAACGGAACCTG	0.443																																																0			5											113.0	94.0	101.0					5																	126771109		2203	4300	6503	126799008	SO:0001583	missense	84466			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.2032A>G	5.37:g.126771109A>G	ENSP00000274473:p.Asn678Asp	Somatic		Capture	Illumina GAIIx	4	126799008	Q68DE5|Q8WUL3	Missense_Mutation	SNP	HMMPfam_EMI,superfamily_EGF/Laminin,HMMSmart_SM00181,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00180,HMMPfam_Laminin_EGF,HMMPfam_EGF_2,superfamily_Plant inhibitors of proteinases and amylases	p.N678D	ENST00000274473.6	37	c.2032	CCDS4142.1	5	.	.	.	.	.	.	.	.	.	.	A	33	5.225751	0.95173	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	D;D	0.94497	-3.44;-3.44	6.04	6.04	0.98038	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.95931	0.8675	L	0.45352	1.415	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.96217	0.9157	10	0.59425	D	0.04	-21.7724	16.5885	0.84745	1.0:0.0:0.0:0.0	.	678	Q96KG7	MEG10_HUMAN	D	678	ENSP00000423354:N678D;ENSP00000274473:N678D	ENSP00000274473:N678D	N	+	1	0	MEGF10	126799008	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.253000	0.95501	2.317000	0.78254	0.460000	0.39030	AAC	-	superfamily_Plant inhibitors of proteinases and amylases,HMMSmart_SM00181,superfamily_EGF/Laminin		0.443	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	protein_coding	OTTHUMT00000250973.2	A	NM_032446		126799008	+1	no_errors	NM_032446	genbank	human	validated	54_36p	missense	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	7	128298158	128298158	+	IGR	SNP	C	C	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr7:128298158C>T								RP11-274B21.1 (28646 upstream) : RP11-274B21.10 (8938 downstream)																							ACCGCTTGCTCAGCATCTGGC	0.617																																																0			7																																								128085394	SO:0001628	intergenic_variant	0																															7.37:g.128298158C>T		Somatic		Capture	Illumina GAIIx	4	128085394		Silent	SNP	NULL	p.L144		37	c.432		7																																																																																			-	NULL	0	0.617					LOC100130600			C			128085394	-1	no_errors	XM_001726460	genbank	human	model	54_36p	silent	SNP	0.997	T
TMCC1	23023	genome.wustl.edu	37	3	129370483	129370483	+	Missense_Mutation	SNP	C	C	G	rs201969186		TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr3:129370483C>G	ENST00000393238.3	-	6	2143	c.1803G>C	c.(1801-1803)ttG>ttC	p.L601F	TMCC1_ENST00000432054.2_Missense_Mutation_p.L277F|TMCC1_ENST00000426664.2_Missense_Mutation_p.L487F|TMCC1_ENST00000329333.5_Missense_Mutation_p.L422F	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	601						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						AGACAAAGACCAAAAGGACTG	0.517																																																0			3											161.0	142.0	149.0					3																	129370483		2203	4300	6503	130853173	SO:0001583	missense	23023			AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1803G>C	3.37:g.129370483C>G	ENSP00000376930:p.Leu601Phe	Somatic		Capture	Illumina GAIIx	4	130853173	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	HMMPfam_Tmemb_cc2	p.L601F	ENST00000393238.3	37	c.1803	CCDS33855.1	3	.	.	.	.	.	.	.	.	.	.	C	12.13	1.844432	0.32606	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56	5.26	4.32	0.51571	.	0.000000	0.85682	D	0.000000	D	0.83335	0.5232	M	0.89904	3.07	0.58432	D	0.999995	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.996	T	0.83324	-0.0016	10	0.87932	D	0	-9.674	3.9734	0.09464	0.2553:0.5263:0.1301:0.0883	.	422;601	B4DE04;O94876	.;TMCC1_HUMAN	F	277;601;487;422	ENSP00000404711:L277F;ENSP00000376930:L601F;ENSP00000389892:L487F;ENSP00000327349:L422F	ENSP00000327349:L422F	L	-	3	2	TMCC1	130853173	0.991000	0.36638	0.989000	0.46669	0.581000	0.36288	0.316000	0.19469	1.311000	0.45024	0.650000	0.86243	TTG	-	HMMPfam_Tmemb_cc2		0.517	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCC1	protein_coding	OTTHUMT00000356418.2	C	NM_015008		130853173	-1	no_errors	NM_001017395	genbank	human	validated	54_36p	missense	SNP	0.990	G
PLXNA4	91584	genome.wustl.edu	37	7	131865462	131865462	+	Silent	SNP	C	C	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr7:131865462C>T	ENST00000359827.3	-	19	4484	c.3522G>A	c.(3520-3522)ggG>ggA	p.G1174G	PLXNA4_ENST00000321063.4_Silent_p.G1174G			Q9HCM2	PLXA4_HUMAN	plexin A4	1174	IPT/TIG 4.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TCACGTTGCCCCCAGCCACAG	0.597																																																0			7											53.0	56.0	55.0					7																	131865462		2084	4223	6307	131516002	SO:0001819	synonymous_variant	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.3522G>A	7.37:g.131865462C>T		Somatic		Capture	Illumina GAIIx	4	131516002	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP	p.G1174	ENST00000359827.3	37	c.3522	CCDS43646.1	7																																																																																			-	HMMSmart_SM00429,HMMPfam_TIG,superfamily_E set domains		0.597	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	protein_coding	OTTHUMT00000338422.2	C	NM_181775		131516002	-1	no_errors	NM_020911	genbank	human	validated	54_36p	silent	SNP	1.000	T
ANKHD1	54882	genome.wustl.edu	37	5	139909047	139909047	+	Silent	SNP	C	C	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:139909047C>T	ENST00000360839.2	+	29	6670	c.6516C>T	c.(6514-6516)ggC>ggT	p.G2172G	ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.G2172G|SNORD45_ENST00000363181.1_RNA|ANKHD1_ENST00000297183.6_Silent_p.G2172G|ANKHD1_ENST00000544120.1_Silent_p.G555G	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	2172						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCTCAAGGCCCACCAGCTG	0.443																																																0			5											134.0	136.0	135.0					5																	139909047		2203	4300	6503	139889231	SO:0001819	synonymous_variant	404734			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.6516C>T	5.37:g.139909047C>T		Somatic		Capture	Illumina GAIIx	4	139889231	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank,superfamily_SSF54791,HMMSmart_KH,HMMPfam_KH_1	p.G2172	ENST00000360839.2	37	c.6516	CCDS4225.1	5	.	.	.	.	.	.	.	.	.	.	C	3.377	-0.127113	0.06795	.	.	ENSG00000131503	ENST00000435794;ENST00000432301	.	.	.	5.35	0.583	0.17417	.	.	.	.	.	T	0.55689	0.1936	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48636	-0.9018	4	.	.	.	.	9.0133	0.36155	0.0:0.4943:0.0:0.5057	.	.	.	.	S	663;623	.	.	P	+	1	0	ANKHD1	139889231	0.967000	0.33354	1.000000	0.80357	0.978000	0.69477	0.077000	0.14738	0.202000	0.20498	0.591000	0.81541	CCC	-	NULL		0.443	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1-EIF4EBP3	protein_coding	OTTHUMT00000251672.1	C	NM_017747		139889231	+1	no_errors	NM_020690	genbank	human	reviewed	54_36p	silent	SNP	0.513	T
PCDHB7	56129	genome.wustl.edu	37	5	140553110	140553110	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:140553110G>T	ENST00000231137.3	+	1	868	c.694G>T	c.(694-696)Gtt>Ttt	p.V232F		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	232	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGCATTCTGGTTCTAGACGT	0.552																																																0			5											59.0	62.0	61.0					5																	140553110		2203	4300	6503	140533294	SO:0001583	missense	56129			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.694G>T	5.37:g.140553110G>T	ENSP00000231137:p.Val232Phe	Somatic		Capture	Illumina GAIIx	4	140533294	A1L3Y8	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin-like,PatternScan_CADHERIN_1,HMMPfam_Cadherin,HMMSmart_SM00112	p.V232F	ENST00000231137.3	37	c.694	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	G	13.09	2.134353	0.37630	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.68331	-0.32	4.61	4.61	0.57282	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.88738	0.6518	H	0.99726	4.73	0.46376	D	0.999012	D	0.67145	0.996	D	0.76071	0.987	D	0.91317	0.5079	9	0.87932	D	0	.	9.72	0.40297	0.1383:0.0:0.8617:0.0	.	232	Q9Y5E2	PCDB7_HUMAN	F	232;15	ENSP00000231137:V232F	ENSP00000231137:V232F	V	+	1	0	PCDHB7	140533294	1.000000	0.71417	0.040000	0.18447	0.009000	0.06853	4.166000	0.58203	2.248000	0.74166	0.655000	0.94253	GTT	-	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1		0.552	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	protein_coding	OTTHUMT00000251803.2	G	NM_018940		140533294	+1	no_errors	NM_018940	genbank	human	reviewed	54_36p	missense	SNP	0.725	T
PCDHGA3	56112	genome.wustl.edu	37	5	140723892	140723892	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:140723892C>G	ENST00000253812.6	+	1	292	c.292C>G	c.(292-294)Cag>Gag	p.Q98E	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	98	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCTGCGCTCAGATCCCGCT	0.453																																																0			5											39.0	45.0	43.0					5																	140723892		2119	4277	6396	140704076	SO:0001583	missense	56112			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.292C>G	5.37:g.140723892C>G	ENSP00000253812:p.Gln98Glu	Somatic		Capture	Illumina GAIIx	4	140704076	Q9Y5D4	Missense_Mutation	SNP	HMMSmart_SM00112,HMMPfam_Cadherin_2,superfamily_Cadherin-like,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.Q98E	ENST00000253812.6	37	c.292	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	0.009	-1.819582	0.00595	.	.	ENSG00000254245	ENST00000253812	T	0.27256	1.68	5.65	2.69	0.31865	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.601698	0.12405	U	0.471823	T	0.40247	0.1109	M	0.76002	2.32	0.09310	N	1	B;B	0.28400	0.021;0.21	B;P	0.46208	0.034;0.507	T	0.46359	-0.9197	10	0.18710	T	0.47	.	9.5666	0.39402	0.3467:0.424:0.2293:0.0	.	98;98	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	E	98	ENSP00000253812:Q98E	ENSP00000253812:Q98E	Q	+	1	0	PCDHGA3	140704076	0.000000	0.05858	0.009000	0.14445	0.165000	0.22458	-0.598000	0.05706	0.830000	0.34757	-0.176000	0.13171	CAG	-	HMMSmart_SM00112,HMMPfam_Cadherin_2,superfamily_Cadherin-like		0.453	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	protein_coding	OTTHUMT00000377017.1	C	NM_018916		140704076	+1	no_errors	NM_018916	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
PCDH1	5097	genome.wustl.edu	37	5	141243231	141243231	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:141243231C>G	ENST00000394536.3	-	3	2804	c.2665G>C	c.(2665-2667)Ggt>Cgt	p.G889R	PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000536585.1_Missense_Mutation_p.G867R|PCDH1_ENST00000456271.1_Missense_Mutation_p.G877R|PCDH1_ENST00000287008.3_Missense_Mutation_p.G889R|PCDH1_ENST00000511044.1_5'UTR	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	889					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TCCTTCTTACCAGCCTGGTAA	0.592																																					Ovarian(132;1609 1739 4190 14731 45037)											0			5											153.0	154.0	154.0					5																	141243231		2203	4300	6503	141223415	SO:0001583	missense	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.2665G>C	5.37:g.141243231C>G	ENSP00000378043:p.Gly889Arg	Somatic		Capture	Illumina GAIIx	4	141223415	Q8IUP2	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin_2,PatternScan_CADHERIN_1,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_GREAB_2,HMMPfam_Protocadherin	p.G889R	ENST00000394536.3	37	c.2665	CCDS43375.1	5	.	.	.	.	.	.	.	.	.	.	c	17.18	3.322680	0.60634	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2	4.75	4.75	0.60458	Protocadherin (1);	0.000000	0.52532	D	0.000068	T	0.60392	0.2265	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65076	-0.6256	10	0.87932	D	0	.	15.2735	0.73723	0.0:1.0:0.0:0.0	.	889;889	Q08174;Q08174-2	PCDH1_HUMAN;.	R	889;889;877;900;867	ENSP00000287008:G889R;ENSP00000378043:G889R;ENSP00000403497:G877R;ENSP00000350122:G900R;ENSP00000438825:G867R	ENSP00000287008:G889R	G	-	1	0	PCDH1	141223415	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.896000	0.69822	2.460000	0.83146	0.457000	0.33378	GGT	-	HMMPfam_Protocadherin		0.592	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	protein_coding	OTTHUMT00000251862.1	C	NM_032420		141223415	-1	no_errors	NM_032420	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PPARGC1B	133522	genome.wustl.edu	37	5	149216560	149216560	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:149216560C>A	ENST00000309241.5	+	8	2574	c.2542C>A	c.(2542-2544)Ctc>Atc	p.L848I	PPARGC1B_ENST00000360453.4_Missense_Mutation_p.L809I|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.L784I|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.L848I	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	848					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CAACCGGCAGCTCTGTTCCCG	0.617																																																0			5											77.0	81.0	79.0					5																	149216560		2203	4300	6503	149196753	SO:0001583	missense	133522			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2542C>A	5.37:g.149216560C>A	ENSP00000312649:p.Leu848Ile	Somatic		Capture	Illumina GAIIx	4	149196753	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.L848I	ENST00000309241.5	37	c.2542	CCDS4298.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.54|14.54	2.567240|2.567240	0.45694|0.45694	.|.	.|.	ENSG00000155846|ENSG00000155846	ENST00000434684|ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	.|T;T;T;T	.|0.36520	.|1.25;1.25;1.25;1.25	5.8|5.8	4.94|4.94	0.65067|0.65067	.|.	.|0.336631	.|0.24523	.|N	.|0.037798	T|T	0.32734|0.32734	0.0839|0.0839	L|L	0.39397|0.39397	1.21|1.21	0.24752|0.24752	N|N	0.992975|0.992975	.|P;P;D;P;P	.|0.53462	.|0.893;0.867;0.96;0.828;0.893	.|B;B;P;B;B	.|0.48425	.|0.438;0.359;0.577;0.254;0.438	T|T	0.12116|0.12116	-1.0560|-1.0560	5|10	.|0.23302	.|T	.|0.38	-13.1212|-13.1212	7.8494|7.8494	0.29446|0.29446	0.0:0.7827:0.0:0.2173|0.0:0.7827:0.0:0.2173	.|.	.|827;827;809;848;848	.|Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.|.;.;.;PRGC2_HUMAN;.	D|I	534|809;848;848;784	.|ENSP00000353638:L809I;ENSP00000377855:L848I;ENSP00000312649:L848I;ENSP00000384403:L784I	.|ENSP00000312649:L848I	A|L	+|+	2|1	0|0	PPARGC1B|PPARGC1B	149196753|149196753	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.693000|0.693000	0.40251|0.40251	1.574000|1.574000	0.36482|0.36482	1.460000|1.460000	0.47911|0.47911	0.462000|0.462000	0.41574|0.41574	GCT|CTC	-	NULL		0.617	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	protein_coding	OTTHUMT00000252334.1	C	NM_133263		149196753	+1	no_errors	NM_133263	genbank	human	provisional	54_36p	missense	SNP	0.932	A
FAT2	2196	genome.wustl.edu	37	5	150924642	150924642	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:150924642G>A	ENST00000261800.5	-	9	6058	c.6046C>T	c.(6046-6048)Cag>Tag	p.Q2016*		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2016	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCTGCTGACTGGACCATATGA	0.507																																																0			5											105.0	105.0	105.0					5																	150924642		2203	4300	6503	150904835	SO:0001587	stop_gained	2196			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.6046C>T	5.37:g.150924642G>A	ENSP00000261800:p.Gln2016*	Somatic		Capture	Illumina GAIIx	4	150904835	O75091|Q9NSR7	Nonsense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,superfamily_EGF/Laminin,HMMSmart_SM00179,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2	p.Q2016*	ENST00000261800.5	37	c.6046	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	G	44	10.989277	0.99499	.	.	ENSG00000086570	ENST00000261800	.	.	.	5.18	-2.09	0.07232	.	0.608291	0.15436	N	0.262452	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	13.8765	0.63655	0.0:0.0815:0.7366:0.1819	.	.	.	.	X	2016	.	ENSP00000261800:Q2016X	Q	-	1	0	FAT2	150904835	0.956000	0.32656	0.013000	0.15412	0.987000	0.75469	1.860000	0.39428	-0.294000	0.08973	0.561000	0.74099	CAG	-	superfamily_Cadherin-like,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00112,HMMPfam_Cadherin		0.507	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	G	NM_001447		150904835	-1	no_errors	NM_001447	genbank	human	reviewed	54_36p	nonsense	SNP	0.002	A
GPR160	26996	genome.wustl.edu	37	3	169802395	169802395	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr3:169802395G>C	ENST00000355897.5	+	4	1243	c.635G>C	c.(634-636)aGg>aCg	p.R212T		NM_014373.2	NP_055188.1	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)	8	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			CAGGCTATCAGGATAACTTCC	0.333																																																0			3											93.0	92.0	92.0					3																	169802395		2203	4300	6503	171285089	SO:0001583	missense	26996			AB083583	CCDS3211.1	3q26.2-q27	2012-08-21			ENSG00000173890	ENSG00000173890		"""GPCR / Class A : Orphans"""	23693	protein-coding gene	gene with protein product						12044878	Standard	NM_014373		Approved	GPCR150, GPCR1	uc003fgi.3	Q9UJ42	OTTHUMG00000158776	ENST00000355897.5:c.635G>C	3.37:g.169802395G>C	ENSP00000348161:p.Arg212Thr	Somatic		Capture	Illumina GAIIx	4	171285089	D3DNQ2	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1	p.R212T	ENST00000355897.5	37	c.635	CCDS3211.1	3	.	.	.	.	.	.	.	.	.	.	G	4.677	0.125954	0.08931	.	.	ENSG00000173890	ENST00000355897	.	.	.	5.7	2.94	0.34122	GPCR, rhodopsin-like superfamily (1);	0.249646	0.35436	N	0.003215	T	0.35451	0.0932	L	0.59436	1.845	0.09310	N	1	B	0.26195	0.144	B	0.27608	0.081	T	0.28038	-1.0056	9	0.45353	T	0.12	.	6.0186	0.19616	0.2741:0.1248:0.6011:0.0	.	212	Q9UJ42	GP160_HUMAN	T	212	.	ENSP00000348161:R212T	R	+	2	0	GPR160	171285089	0.581000	0.26741	0.427000	0.26684	0.012000	0.07955	1.589000	0.36644	0.769000	0.33313	-0.137000	0.14449	AGG	-	NULL		0.333	GPR160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR160	protein_coding	OTTHUMT00000352167.1	G	NM_014373		171285089	+1	no_errors	NM_014373	genbank	human	validated	54_36p	missense	SNP	0.002	C
ZBTB37	84614	genome.wustl.edu	37	1	173839515	173839515	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr1:173839515C>A	ENST00000367701.5	+	2	343	c.152C>A	c.(151-153)gCt>gAt	p.A51D	GAS5_ENST00000364084.1_RNA|ZBTB37_ENST00000427304.1_Missense_Mutation_p.A51D|ZBTB37_ENST00000367702.1_Missense_Mutation_p.A51D|ZBTB37_ENST00000367704.1_Missense_Mutation_p.A51D|ZBTB37_ENST00000432989.1_Missense_Mutation_p.A51D			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	51	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						GTGGTGCTGGCTGCCAGCTCC	0.498																																																0			1											116.0	114.0	114.0					1																	173839515		2203	4300	6503	172106138	SO:0001583	missense	84614			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.152C>A	1.37:g.173839515C>A	ENSP00000356674:p.Ala51Asp	Somatic		Capture	Illumina GAIIx	4	172106138	Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB	p.A51D	ENST00000367701.5	37	c.152	CCDS44278.1	1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.754022	0.89843	.	.	ENSG00000185278	ENST00000367704;ENST00000427304;ENST00000432989;ENST00000367702;ENST00000367701	T;T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77;-0.77	5.6	5.6	0.85130	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.92374	0.7580	H	0.99156	4.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.95217	0.8330	10	0.87932	D	0	.	19.6287	0.95691	0.0:1.0:0.0:0.0	.	51;51	Q5TC79;Q5TC79-2	ZBT37_HUMAN;.	D	51	ENSP00000356677:A51D;ENSP00000415293:A51D;ENSP00000409408:A51D;ENSP00000356675:A51D;ENSP00000356674:A51D	ENSP00000356674:A51D	A	+	2	0	ZBTB37	172106138	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.652000	0.90054	0.563000	0.77884	GCT	-	superfamily_BTB/POZ_fold,HMMPfam_BTB,HMMSmart_BTB		0.498	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB37	protein_coding	OTTHUMT00000090729.2	C	NM_032522		172106138	+1	no_errors	NM_032522	genbank	human	provisional	54_36p	missense	SNP	1.000	A
NSD1	64324	genome.wustl.edu	37	5	176693015	176693015	+	Intron	SNP	G	G	A			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr5:176693015G>A	ENST00000439151.2	+	15	5191				NSD1_ENST00000347982.4_Intron|NSD1_ENST00000354179.4_Intron|NSD1_ENST00000361032.4_Intron	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CATCTTTGATGCAAGATATAT	0.512			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																													Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0			5																																								176625621	SO:0001627	intron_variant	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5147-1548G>A	5.37:g.176693015G>A		Somatic		Capture	Illumina GAIIx	4	176625621	Q96PD8|Q96RN7	RNA	SNP	-	NULL	ENST00000439151.2	37	NULL	CCDS4412.1	5																																																																																			-	-		0.512	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128760	protein_coding	OTTHUMT00000253412.2	G	NM_172349		176625621	-1	pseudogene	XR_038526	genbank	human	model	54_36p	rna	SNP	0.998	A
HMCN1	83872	genome.wustl.edu	37	1	186007072	186007072	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr1:186007072C>G	ENST00000271588.4	+	37	5985	c.5756C>G	c.(5755-5757)cCt>cGt	p.P1919R	HMCN1_ENST00000367492.2_Missense_Mutation_p.P1919R	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1919	Ig-like C2-type 17.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTAGAACCACCTAGTCTGGAA	0.388																																																0			1											112.0	106.0	108.0					1																	186007072		2203	4300	6503	184273695	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5756C>G	1.37:g.186007072C>G	ENSP00000271588:p.Pro1919Arg	Somatic		Capture	Illumina GAIIx	4	184273695	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	superfamily_vWA-like,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,HMMPfam_I-set,HMMSmart_SM00406,PatternScan_CECROPIN,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00682,HMMPfam_G2F,superfamily_GFP-like,PatternScan_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,HMMPfam_EGF_CA,PatternScan_EGF_2	p.P1919R	ENST00000271588.4	37	c.5756	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062789	0.55432	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.80909	-1.43;-1.43	5.52	5.52	0.82312	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93609	0.7959	H	0.96662	3.86	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.95239	0.8349	10	0.66056	D	0.02	.	19.037	0.92983	0.0:1.0:0.0:0.0	.	1919	Q96RW7	HMCN1_HUMAN	R	1919	ENSP00000271588:P1919R;ENSP00000356462:P1919R	ENSP00000271588:P1919R	P	+	2	0	HMCN1	184273695	1.000000	0.71417	0.958000	0.39756	0.015000	0.08874	5.321000	0.65846	2.597000	0.87782	0.555000	0.69702	CCT	-	superfamily_Immunoglobulin		0.388	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	C	NM_031935		184273695	+1	no_errors	NM_031935	genbank	human	reviewed	54_36p	missense	SNP	0.993	G
MYL12BP2	391722	genome.wustl.edu	37	4	185220364	185220364	+	IGR	SNP	G	G	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr4:185220364G>T								RN7SL28P (19980 upstream) : RP11-290F5.2 (41544 downstream)																							GTCAATAGGTGCTTCTGTGTA	0.423																																																0			4																																								185457358	SO:0001628	intergenic_variant	391722																															4.37:g.185220364G>T		Somatic		Capture	Illumina GAIIx	4	185457358		Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1	p.A351E		37	c.1052		4																																																																																			-	superfamily_EF-hand	0	0.423					LOC391722			G			185457358	-1	no_errors	XM_373042	genbank	human	model	54_36p	missense	SNP	1.000	T
ICOS	29851	genome.wustl.edu	37	2	204822583	204822583	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr2:204822583C>G	ENST00000316386.6	+	4	630	c.563C>G	c.(562-564)aCa>aGa	p.T188R	ICOS_ENST00000435193.1_Intron	NM_012092.3	NP_036224.1	Q9Y6W8	ICOS_HUMAN	inducible T-cell co-stimulator	188					immune response (GO:0006955)|single organismal cell-cell adhesion (GO:0016337)|T cell costimulation (GO:0031295)|T cell tolerance induction (GO:0002517)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6						GCAGTGAACACAGCCAAAAAA	0.403																																																0			2											93.0	90.0	91.0					2																	204822583		2203	4300	6503	204530828	SO:0001583	missense	29851			AB023135	CCDS2363.1	2q33	2014-09-17			ENSG00000163600	ENSG00000163600		"""CD molecules"""	5351	protein-coding gene	gene with protein product	"""activation-inducible lymphocyte immunomediatory molecule"""	604558				9930702, 10617205	Standard	NM_012092		Approved	AILIM, CD278	uc002vam.3	Q9Y6W8	OTTHUMG00000132880	ENST00000316386.6:c.563C>G	2.37:g.204822583C>G	ENSP00000319476:p.Thr188Arg	Somatic		Capture	Illumina GAIIx	4	204530828	Q8N6W8	Missense_Mutation	SNP	NULL	p.T188R	ENST00000316386.6	37	c.563	CCDS2363.1	2	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580304	0.65992	.	.	ENSG00000163600	ENST00000316386	.	.	.	5.73	5.73	0.89815	.	0.179356	0.38837	N	0.001556	T	0.74030	0.3663	M	0.68317	2.08	0.80722	D	1	D;D	0.55385	0.971;0.971	P;P	0.58454	0.839;0.839	T	0.74740	-0.3563	9	0.52906	T	0.07	-12.7433	15.3846	0.74687	0.0:1.0:0.0:0.0	.	188;188	Q53QY6;Q9Y6W8	.;ICOS_HUMAN	R	188	.	ENSP00000319476:T188R	T	+	2	0	ICOS	204530828	0.992000	0.36948	0.738000	0.30950	0.677000	0.39632	3.940000	0.56599	2.711000	0.92665	0.467000	0.42956	ACA	-	NULL		0.403	ICOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICOS	protein_coding	OTTHUMT00000256369.1	C	NM_012092		204530828	+1	no_errors	NM_012092	genbank	human	reviewed	54_36p	missense	SNP	0.291	G
ABCA12	26154	genome.wustl.edu	37	2	215865725	215865725	+	Silent	SNP	A	A	T			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr2:215865725A>T	ENST00000272895.7	-	22	3102	c.2883T>A	c.(2881-2883)ccT>ccA	p.P961P	ABCA12_ENST00000389661.4_Silent_p.P643P	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	961					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTCTGTTAGAAGGAAGCTTAA	0.403																																					Ovarian(66;664 1488 5121 34295)											0			2											56.0	59.0	58.0					2																	215865725		2202	4300	6502	215573970	SO:0001819	synonymous_variant	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2883T>A	2.37:g.215865725A>T		Somatic		Capture	Illumina GAIIx	4	215573970	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.P961	ENST00000272895.7	37	c.2883	CCDS33372.1	2																																																																																			-	NULL		0.403	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	protein_coding	OTTHUMT00000337111.1	A	NM_173076		215573970	-1	no_errors	NM_173076	genbank	human	reviewed	54_36p	silent	SNP	0.880	T
SP100	6672	genome.wustl.edu	37	2	231314307	231314307	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1725-01A-01W-0639-09	TCGA-61-1725-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	4f67fac4-4d43-4676-aabd-4d8aa4b9ccd0	e2a327aa-4c95-42d5-b446-ea9a04476ed0	g.chr2:231314307G>C	ENST00000264052.5	+	7	973	c.618G>C	c.(616-618)gaG>gaC	p.E206D	SP100_ENST00000409341.1_Missense_Mutation_p.E206D|SP100_ENST00000409824.1_Missense_Mutation_p.E181D|SP100_ENST00000409112.1_Missense_Mutation_p.E206D|SP100_ENST00000409897.1_Missense_Mutation_p.E171D|SP100_ENST00000340126.4_Missense_Mutation_p.E206D|SP100_ENST00000341950.4_Missense_Mutation_p.E206D|SP100_ENST00000427101.2_Missense_Mutation_p.E181D	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	206					cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GACTCTCAGAGCACCCCTGTG	0.438																																																0			2											90.0	80.0	83.0					2																	231314307		2203	4300	6503	231022551	SO:0001583	missense	6672			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.618G>C	2.37:g.231314307G>C	ENSP00000264052:p.Glu206Asp	Somatic		Capture	Illumina GAIIx	4	231022551	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	HMMPfam_Sp100,superfamily_SAND domain-like,HMMPfam_SAND,HMMSmart_SM00258,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_Bromodomain,HMMSmart_SM00297,HMMPfam_Bromodomain	p.E206D	ENST00000264052.5	37	c.618	CCDS2477.1	2	.	.	.	.	.	.	.	.	.	.	G	3.958	-0.010818	0.07727	.	.	ENSG00000067066	ENST00000264052;ENST00000427101;ENST00000409824;ENST00000409341;ENST00000409112;ENST00000340126;ENST00000341950;ENST00000409897	T;T;T;T;D;T;T;T	0.81739	2.1;2.0;2.0;1.98;-1.53;0.03;1.97;1.99	3.86	-1.85	0.07784	.	1.204810	0.06443	N	0.726278	T	0.57577	0.2063	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B;B;B;B	0.21225	0.041;0.014;0.024;0.023;0.053;0.014;0.024;0.023	B;B;B;B;B;B;B;B	0.23419	0.046;0.008;0.021;0.019;0.021;0.008;0.021;0.019	T	0.40270	-0.9572	10	0.13853	T	0.58	.	0.8673	0.01206	0.2281:0.3225:0.2689:0.1805	.	181;206;171;206;206;206;181;206	F8WFE2;B4E2B9;B8ZZD8;P23497-4;P23497;E7EUA7;E9PHV6;P23497-2	.;.;.;.;SP100_HUMAN;.;.;.	D	206;181;181;206;206;206;206;171	ENSP00000264052:E206D;ENSP00000399389:E181D;ENSP00000387311:E181D;ENSP00000386404:E206D;ENSP00000386427:E206D;ENSP00000343023:E206D;ENSP00000342729:E206D;ENSP00000386998:E171D	ENSP00000264052:E206D	E	+	3	2	SP100	231022551	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	-0.130000	0.10498	-0.364000	0.08088	0.655000	0.94253	GAG	-	NULL		0.438	SP100-001	KNOWN	basic|CCDS	protein_coding	SP100	protein_coding	OTTHUMT00000256914.2	G	NM_003113		231022551	+1	no_errors	NM_001080391	genbank	human	validated	54_36p	missense	SNP	0.000	C
