#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								2438	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	2438		RNA	SNP	-	NULL		37	NULL		MT																																																																																			-	-	0	0					ENSG00000210082			G			2438	+1	no_errors	ENST00000387347	ensembl	human	known	54_36p	rna	SNP	NULL	A
NOP56	10528	genome.wustl.edu	37	20	2634879	2634879	+	Intron	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr20:2634879C>G	ENST00000329276.5	+	4	724				SNORD86_ENST00000391196.1_RNA|SNORA51_ENST00000606420.1_RNA|SNORD56_ENST00000413522.1_RNA|SNORD57_ENST00000448188.1_RNA|SNORD110_ENST00000408189.1_RNA|MIR1292_ENST00000408135.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						ACTTGCGAATCAAATCTGTCA	0.502																																																0			20											172.0	156.0	161.0					20																	2634879		876	1991	2867	2582879	SO:0001627	intron_variant	0			Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.209-181C>G	20.37:g.2634879C>G		Somatic		Capture	Illumina GAIIx	4	2582879	Q2M3T6|Q9NQ05	RNA	SNP	-	NULL	ENST00000329276.5	37	NULL	CCDS13030.1	20																																																																																			-	-		0.502	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD110	protein_coding	OTTHUMT00000077631.2	C	NM_006392		2582879	+1	no_errors	NR_003078	genbank	human	provisional	54_36p	rna	SNP	0.000	G
SRRM2	23524	genome.wustl.edu	37	16	2813842	2813842	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr16:2813842G>T	ENST00000301740.8	+	11	3862	c.3313G>T	c.(3313-3315)Gtc>Ttc	p.V1105F		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1105	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TTCATCTCCAGTCACTGAGCT	0.473																																																0			16											83.0	84.0	84.0					16																	2813842		2198	4300	6498	2753843	SO:0001583	missense	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3313G>T	16.37:g.2813842G>T	ENSP00000301740:p.Val1105Phe	Somatic		Capture	Illumina GAIIx	4	2753843	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	HMMPfam_cwf21	p.V1105F	ENST00000301740.8	37	c.3313	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	A	1.891	-0.455409	0.04540	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	D	0.92858	-3.12	5.92	-11.8	0.00035	.	1.156660	0.06280	N	0.697170	D	0.83533	0.5275	L	0.29908	0.895	0.09310	N	1	B	0.25169	0.119	B	0.24701	0.055	T	0.72235	-0.4352	10	0.56958	D	0.05	0.0607	10.0631	0.42286	0.5859:0.066:0.2815:0.0666	.	1105	Q9UQ35	SRRM2_HUMAN	F	1105;1105;357	ENSP00000301740:V1105F	ENSP00000301740:V1105F	V	+	1	0	SRRM2	2753843	0.000000	0.05858	0.000000	0.03702	0.191000	0.23601	-3.760000	0.00373	-2.969000	0.00287	-3.325000	0.00044	GTC	-	NULL		0.473	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	protein_coding	OTTHUMT00000436411.1	G			2753843	+1	no_errors	NM_016333	genbank	human	validated	54_36p	missense	SNP	0.001	T
OR3A3	8392	genome.wustl.edu	37	17	3324139	3324139	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr17:3324139G>A	ENST00000291231.1	+	1	278	c.278G>A	c.(277-279)cGt>cAt	p.R93H		NM_012373.2	NP_036505.2	P47888	OR3A3_HUMAN	olfactory receptor, family 3, subfamily A, member 3	93					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)	9						ATGTTGGGTCGTCTCTTGTCC	0.557																																																0			17																																								3270889	SO:0001583	missense	8392			U04688	CCDS11025.1	17p13.3	2012-08-09			ENSG00000159961	ENSG00000159961		"""GPCR / Class A : Olfactory receptors"""	8284	protein-coding gene	gene with protein product				OR3A6, OR3A7, OR3A8P		8004088, 9500546	Standard	NM_012373		Approved	OR17-201, OR17-137, OR17-16	uc010vrd.2	P47888	OTTHUMG00000090649	ENST00000291231.1:c.278G>A	17.37:g.3324139G>A	ENSP00000291231:p.Arg93His	Somatic		Capture	Illumina GAIIx	4	3270889	Q2VPE4|Q6IFM6|Q9P1Q4|Q9UBE7	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.R93H	ENST00000291231.1	37	c.278	CCDS11025.1	17	.	.	.	.	.	.	.	.	.	.	G	6.873	0.530424	0.13127	.	.	ENSG00000159961	ENST00000291231	T	0.00402	7.56	2.7	-4.93	0.03066	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.00389	-1.56	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.36744	-0.9735	9	0.54805	T	0.06	.	6.4836	0.22077	0.6798:0.0:0.1817:0.1386	.	93	P47888	OR3A3_HUMAN	H	93	ENSP00000291231:R93H	ENSP00000291231:R93H	R	+	2	0	OR3A3	3270889	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.830000	0.01699	-1.210000	0.02627	-1.000000	0.02509	CGT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.557	OR3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR3A3	protein_coding	OTTHUMT00000207309.1	G			3270889	+1	no_errors	NM_012373	genbank	human	provisional	54_36p	missense	SNP	0.000	A
EPB41L3	23136	genome.wustl.edu	37	18	5415930	5415930	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr18:5415930A>G	ENST00000341928.2	-	13	2294	c.1954T>C	c.(1954-1956)Tac>Cac	p.Y652H	EPB41L3_ENST00000342933.3_Missense_Mutation_p.Y652H|EPB41L3_ENST00000540638.2_Intron|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000542146.1_Intron|EPB41L3_ENST00000400111.3_Intron|EPB41L3_ENST00000542652.2_Intron|EPB41L3_ENST00000427684.2_Intron	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	652	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GTGAGAGCGTATGGCACTGAG	0.577																																																0			18											176.0	124.0	142.0					18																	5415930		2203	4300	6503	5405930	SO:0001583	missense	23136			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1954T>C	18.37:g.5415930A>G	ENSP00000343158:p.Tyr652His	Somatic		Capture	Illumina GAIIx	4	5405930	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	HMMSmart_SM00295,superfamily_Ubiquitin-like,HMMPfam_FERM_N,PatternScan_FERM_1,superfamily_Second domain of FERM,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_PH domain-like,HMMPfam_FERM_C,HMMPfam_FA,HMMPfam_SAB,HMMPfam_4_1_CTD	p.Y652H	ENST00000341928.2	37	c.1954	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	A	14.50	2.554291	0.45487	.	.	ENSG00000082397	ENST00000341928;ENST00000342933	D;D	0.81659	-1.52;-1.52	5.52	5.52	0.82312	.	0.604873	0.16721	N	0.202246	T	0.71230	0.3315	N	0.19112	0.55	0.80722	D	1	B	0.16396	0.017	B	0.12156	0.007	T	0.67341	-0.5695	10	0.62326	D	0.03	.	15.6572	0.77150	1.0:0.0:0.0:0.0	.	652	Q9Y2J2	E41L3_HUMAN	H	652	ENSP00000343158:Y652H;ENSP00000341138:Y652H	ENSP00000343158:Y652H	Y	-	1	0	EPB41L3	5405930	1.000000	0.71417	0.980000	0.43619	0.989000	0.77384	9.339000	0.96797	2.091000	0.63221	0.460000	0.39030	TAC	-	NULL		0.577	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	protein_coding	OTTHUMT00000254424.1	A	NM_012307		5405930	-1	no_errors	NM_012307	genbank	human	provisional	54_36p	missense	SNP	0.998	G
FBXO18	84893	genome.wustl.edu	37	10	5969461	5969461	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr10:5969461T>G	ENST00000362091.4	+	19	2901	c.2786T>G	c.(2785-2787)cTc>cGc	p.L929R	FBXO18_ENST00000379999.5_Missense_Mutation_p.L980R|FBXO18_ENST00000397269.3_Missense_Mutation_p.L433R	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	929					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						AAGAAGCGTCTCATCATGACC	0.388																																																0			10											145.0	129.0	134.0					10																	5969461		2203	4300	6503	6009467	SO:0001583	missense	84893			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2786T>G	10.37:g.5969461T>G	ENSP00000355415:p.Leu929Arg	Somatic		Capture	Illumina GAIIx	4	6009467	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Missense_Mutation	SNP	superfamily_SSF81383,HMMPfam_F-box,HMMSmart_FBOX,superfamily_SSF52540	p.L980R	ENST00000362091.4	37	c.2939	CCDS7072.1	10	.	.	.	.	.	.	.	.	.	.	T	21.2	4.112234	0.77210	.	.	ENSG00000134452	ENST00000397269;ENST00000362091;ENST00000379999	D;D;D	0.91686	-2.89;-2.89;-2.89	5.46	4.33	0.51752	.	0.000000	0.85682	D	0.000000	D	0.96750	0.8939	H	0.94306	3.52	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.96432	0.9320	10	0.87932	D	0	-14.8138	10.3883	0.44154	0.0:0.0784:0.0:0.9216	.	980;929;855	Q8NFZ0-2;Q8NFZ0;Q2TAK1	.;FBX18_HUMAN;.	R	433;929;980	ENSP00000380439:L433R;ENSP00000355415:L929R;ENSP00000369335:L980R	ENSP00000355415:L929R	L	+	2	0	FBXO18	6009467	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.393000	0.73217	0.914000	0.36822	0.456000	0.33151	CTC	-	superfamily_SSF52540		0.388	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	protein_coding	OTTHUMT00000046596.1	T	NM_032807		6009467	+1	no_errors	NM_032807	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
DCHS1	8642	genome.wustl.edu	37	11	6661584	6661584	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr11:6661584T>G	ENST00000299441.3	-	2	1672	c.1261A>C	c.(1261-1263)Atc>Ctc	p.I421L		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	421	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCAGATAGATGACGCTGTCT	0.567																																																0			11											52.0	47.0	49.0					11																	6661584		2201	4296	6497	6618160	SO:0001583	missense	8642			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.1261A>C	11.37:g.6661584T>G	ENSP00000299441:p.Ile421Leu	Somatic		Capture	Illumina GAIIx	4	6618160	O15098	Missense_Mutation	SNP	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA,PatternScan_CADHERIN_1	p.I421L	ENST00000299441.3	37	c.1261	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	T	15.80	2.941580	0.53079	.	.	ENSG00000166341	ENST00000299441	T	0.14640	2.49	5.67	5.67	0.87782	Cadherin (4);Cadherin-like (1);	0.000000	0.46145	D	0.000311	T	0.22085	0.0532	N	0.21282	0.65	0.49389	D	0.999785	P	0.44478	0.836	D	0.66084	0.941	T	0.09618	-1.0666	10	0.13108	T	0.6	.	15.0866	0.72158	0.0:0.0:0.0:1.0	.	421	Q96JQ0	PCD16_HUMAN	L	421	ENSP00000299441:I421L	ENSP00000299441:I421L	I	-	1	0	DCHS1	6618160	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.150000	0.58098	2.150000	0.67090	0.519000	0.50382	ATC	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.567	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	protein_coding	OTTHUMT00000257258.1	T	NM_003737		6618160	-1	no_errors	NM_003737	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
RP11-390F4.6	0	genome.wustl.edu	37	9	6670110	6670110	+	lincRNA	SNP	G	G	A	rs565639051		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr9:6670110G>A	ENST00000413145.1	+	0	315																											ATAGCGAGCCGCAAAGAGCAT	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		15209	0.0		0.001	False		,,,				2504	0.0															0			9																																								6660110			0																															9.37:g.6670110G>A		Somatic		Capture	Illumina GAIIx	4	6660110		RNA	SNP	-	NULL	ENST00000413145.1	37	NULL		9																																																																																			-	-		0.607	RP11-390F4.6-001	KNOWN	basic	lincRNA	LOC100132467	lincRNA	OTTHUMT00000051688.1	G			6660110	-1	pseudogene	XR_039339	genbank	human	model	54_36p	rna	SNP	0.005	A
TP53	7157	genome.wustl.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	T	rs121912656|rs397516437		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr17:7577547C>T	ENST00000269305.4	-	7	923	c.734G>A	c.(733-735)gGc>gAc	p.G245D	TP53_ENST00000455263.2_Missense_Mutation_p.G245D|TP53_ENST00000420246.2_Missense_Mutation_p.G245D|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.G245D|TP53_ENST00000359597.4_Missense_Mutation_p.G245D|TP53_ENST00000413465.2_Missense_Mutation_p.G245D	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	17	GRCh37	CM010464|CM900209	TP53	M	rs121912656						151.0	113.0	126.0					17																	7577547		2203	4300	6503	7518272	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>A	17.37:g.7577547C>T	ENSP00000269305:p.Gly245Asp	Somatic		Capture	Illumina GAIIx	4	7518272	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.G245D	ENST00000269305.4	37	c.734	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838149	0.91117	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	A	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0;1.0	D	0.96045	0.9027	9	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	D	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245D;ENSP00000352610:G245D;ENSP00000269305:G245D;ENSP00000398846:G245D;ENSP00000391127:G245D;ENSP00000391478:G245D;ENSP00000425104:G113D;ENSP00000423862:G152D	ENSP00000269305:G245D	G	-	2	0	TP53	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	-	HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7518272	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SLC2A14	144195	genome.wustl.edu	37	12	7967095	7967095	+	Silent	SNP	G	G	A	rs113299917	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr12:7967095G>A	ENST00000543909.1	-	16	2139	c.1380C>T	c.(1378-1380)acC>acT	p.T460T	SLC2A14_ENST00000542505.1_Silent_p.T101T|SLC2A14_ENST00000340749.5_Silent_p.T437T|SLC2A14_ENST00000542546.1_Silent_p.T351T|SLC2A14_ENST00000396589.2_Silent_p.T460T|SLC2A14_ENST00000535295.1_Silent_p.T351T|SLC2A14_ENST00000539924.1_Silent_p.T475T|SLC2A14_ENST00000431042.2_Silent_p.T437T			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	460					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		TGAGGAAGCCGGTGAAGATAA	0.428													G|||	122	0.024361	0.0008	0.0014	5008	,	,		-128	0.0675		0.003	False		,,,				2504	0.0501															0			12						G		2,4404	4.2+/-10.8	0,2,2201	52.0	53.0	52.0		1380	-5.7	0.0	12	dbSNP_132	52	9,8591	5.7+/-21.5	0,9,4291	no	coding-synonymous	SLC2A14	NM_153449.2		0,11,6492	AA,AG,GG		0.1047,0.0454,0.0846		460/521	7967095	11,12995	2203	4300	6503	7858362	SO:0001819	synonymous_variant	144195			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.1380C>T	12.37:g.7967095G>A		Somatic		Capture	Illumina GAIIx	4	7858362	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Silent	SNP	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr,PatternScan_SUGAR_TRANSPORT_2,PatternScan_SUGAR_TRANSPORT_1	p.T460	ENST00000543909.1	37	c.1380	CCDS8585.1	12																																																																																			-	superfamily_MFS general substrate transporter,HMMPfam_Sugar_tr		0.428	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	SLC2A14	protein_coding	OTTHUMT00000399836.2	G	NM_153449		7858362	-1	no_errors	NM_153449	genbank	human	provisional	54_36p	silent	SNP	0.011	A
NLRP10	338322	genome.wustl.edu	37	11	7981543	7981543	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr11:7981543G>T	ENST00000328600.2	-	2	1777	c.1616C>A	c.(1615-1617)cCc>cAc	p.P539H		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	539					defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGCTAAACAGGGAGAAATTCT	0.418																																																0			11											65.0	64.0	64.0					11																	7981543		2201	4296	6497	7938119	SO:0001583	missense	338322			AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1616C>A	11.37:g.7981543G>T	ENSP00000327763:p.Pro539His	Somatic		Capture	Illumina GAIIx	4	7938119	Q2M3C4|Q6JGT0	Missense_Mutation	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,superfamily_SSF52540,HMMPfam_NACHT	p.P539H	ENST00000328600.2	37	c.1616	CCDS7784.1	11	.	.	.	.	.	.	.	.	.	.	G	13.38	2.218715	0.39201	.	.	ENSG00000182261	ENST00000328600	D	0.89050	-2.46	4.58	3.65	0.41850	.	0.000000	0.35124	N	0.003424	D	0.83510	0.5270	L	0.29908	0.895	0.09310	N	1	P	0.51147	0.942	P	0.46389	0.515	T	0.76825	-0.2816	10	0.56958	D	0.05	.	9.2168	0.37353	0.1088:0.0:0.8912:0.0	.	539	Q86W26	NAL10_HUMAN	H	539	ENSP00000327763:P539H	ENSP00000327763:P539H	P	-	2	0	NLRP10	7938119	0.650000	0.27331	0.016000	0.15963	0.237000	0.25408	3.005000	0.49521	2.283000	0.76528	0.563000	0.77884	CCC	-	NULL		0.418	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP10	protein_coding	OTTHUMT00000385705.1	G	NM_176821		7938119	-1	no_errors	NM_176821	genbank	human	reviewed	54_36p	missense	SNP	0.143	T
PLCB1	23236	genome.wustl.edu	37	20	8689385	8689385	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr20:8689385G>C	ENST00000338037.6	+	12	1263	c.1236G>C	c.(1234-1236)gaG>gaC	p.E412D	PLCB1_ENST00000378637.2_Missense_Mutation_p.E412D|PLCB1_ENST00000378641.3_Missense_Mutation_p.E412D	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	412	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TTTCGTTTGAGAACCATGTGG	0.353																																																0			20											134.0	111.0	118.0					20																	8689385		2203	4300	6503	8637385	SO:0001583	missense	23236			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1236G>C	20.37:g.8689385G>C	ENSP00000338185:p.Glu412Asp	Somatic		Capture	Illumina GAIIx	4	8637385	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	superfamily_EF-hand,HMMPfam_efhand_like,HMMSmart_SM00148,HMMPfam_PI-PLC-X,superfamily_PLC-like phosphodiesterases,HMMPfam_PI-PLC-Y,HMMSmart_SM00149,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,HMMPfam_PLC-beta_C	p.E412D	ENST00000338037.6	37	c.1236	CCDS13102.1	20	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889375	0.72524	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.62788	-0.0;-0.0;-0.0	5.2	0.376	0.16193	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.099612	0.64402	D	0.000002	T	0.80874	0.4707	H	0.95611	3.695	0.46458	D	0.999057	D;P	0.69078	0.997;0.68	D;B	0.74348	0.983;0.325	T	0.79860	-0.1625	10	0.87932	D	0	.	7.4769	0.27382	0.6761:0.0:0.3239:0.0	.	412;412	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	D	412;412;412;332;332	ENSP00000367908:E412D;ENSP00000338185:E412D;ENSP00000367904:E412D	ENSP00000338185:E412D	E	+	3	2	PLCB1	8637385	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.499000	0.45372	0.222000	0.20900	0.655000	0.94253	GAG	-	HMMSmart_SM00148,HMMPfam_PI-PLC-X,superfamily_PLC-like phosphodiesterases		0.353	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCB1	protein_coding	OTTHUMT00000077938.3	G			8637385	+1	no_errors	NM_015192	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ZNF121	7675	genome.wustl.edu	37	19	9677386	9677386	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:9677386C>G	ENST00000586602.1	-	6	819	c.403G>C	c.(403-405)Gtt>Ctt	p.V135L	ZNF121_ENST00000320451.6_Missense_Mutation_p.V135L			P58317	ZN121_HUMAN	zinc finger protein 121	135					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						TGCATTTTAACAGACACAGCA	0.378																																																0			19											84.0	75.0	78.0					19																	9677386		2203	4300	6503	9538386	SO:0001583	missense	7675			M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.403G>C	19.37:g.9677386C>G	ENSP00000468643:p.Val135Leu	Somatic		Capture	Illumina GAIIx	4	9538386		Missense_Mutation	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.V135L	ENST00000586602.1	37	c.403		19	.	.	.	.	.	.	.	.	.	.	C	4.873	0.162286	0.09287	.	.	ENSG00000197961	ENST00000538300;ENST00000320451	T	0.15017	2.46	1.3	-1.26	0.09376	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08980	0.0222	N	0.16307	0.4	0.09310	N	1	B	0.18310	0.027	B	0.24006	0.05	T	0.35001	-0.9806	9	0.62326	D	0.03	.	2.5684	0.04789	0.0:0.3354:0.2706:0.394	.	135	P58317	ZN121_HUMAN	L	135	ENSP00000326967:V135L	ENSP00000326967:V135L	V	-	1	0	ZNF121	9538386	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.794000	0.04584	-0.299000	0.08909	-0.479000	0.04858	GTT	-	superfamily_SSF57667		0.378	ZNF121-003	KNOWN	basic|appris_principal	protein_coding	ZNF121	protein_coding	OTTHUMT00000449910.1	C	NM_001008727		9538386	-1	no_errors	NM_001008727	genbank	human	validated	54_36p	missense	SNP	0.000	G
SCO1	6341	genome.wustl.edu	37	17	10596253	10596253	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr17:10596253G>C	ENST00000255390.5	-	3	450	c.390C>G	c.(388-390)caC>caG	p.H130Q	SCO1_ENST00000577427.1_Missense_Mutation_p.H130Q|SCO1_ENST00000582053.1_5'UTR	NM_004589.2	NP_004580.1	O75880	SCO1_HUMAN	SCO1 cytochrome c oxidase assembly protein	130	Important for dimerization.				cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|generation of precursor metabolites and energy (GO:0006091)|respiratory chain complex IV assembly (GO:0008535)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)	copper ion binding (GO:0005507)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	10						GCTTGCCGATGTGTCGCTGCC	0.423																																					Melanoma(128;591 1731 19711 31891 44645)											0			17											69.0	61.0	64.0					17																	10596253		2203	4300	6503	10536978	SO:0001583	missense	6341			AF026852	CCDS11158.1	17p13.1	2012-10-15	2012-10-15		ENSG00000133028	ENSG00000133028		"""Mitochondrial respiratory chain complex assembly factors"""	10603	protein-coding gene	gene with protein product		603644	"""SCO (cytochrome oxidase deficient, yeast) homolog 1"", ""SCO cytochrome oxidase deficient homolog 1 (yeast)"""	SCOD1		9878253	Standard	NM_004589		Approved		uc002gmr.4	O75880	OTTHUMG00000130364	ENST00000255390.5:c.390C>G	17.37:g.10596253G>C	ENSP00000255390:p.His130Gln	Somatic		Capture	Illumina GAIIx	4	10536978	B2RDM0	Missense_Mutation	SNP	superfamily_Thiordxn-like_fd,HMMPfam_SCO1-SenC	p.H130Q	ENST00000255390.5	37	c.390	CCDS11158.1	17	.	.	.	.	.	.	.	.	.	.	G	0.050	-1.253493	0.01457	.	.	ENSG00000133028	ENST00000255390;ENST00000396047	D	0.93712	-3.27	6.17	2.99	0.34606	Thioredoxin-like fold (1);	0.373274	0.33290	N	0.005063	T	0.76485	0.3994	N	0.00980	-1.08	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.0;0.001	T	0.65772	-0.6087	10	0.16420	T	0.52	-1.0262	7.5189	0.27616	0.1187:0.1028:0.6737:0.1048	.	130;130	A8MY34;O75880	.;SCO1_HUMAN	Q	130	ENSP00000255390:H130Q	ENSP00000255390:H130Q	H	-	3	2	SCO1	10536978	0.956000	0.32656	0.352000	0.25734	0.002000	0.02628	1.785000	0.38684	0.497000	0.27926	-0.795000	0.03280	CAC	-	superfamily_Thiordxn-like_fd		0.423	SCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCO1	protein_coding	OTTHUMT00000252729.2	G	NM_004589		10536978	-1	no_errors	NM_004589	genbank	human	reviewed	54_36p	missense	SNP	0.005	C
ZNF491	126069	genome.wustl.edu	37	19	11917874	11917874	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:11917874C>G	ENST00000323169.5	+	3	1437	c.1106C>G	c.(1105-1107)tCc>tGc	p.S369C	ZNF491_ENST00000492230.1_Intron	NM_152356.3	NP_689569.2	Q8N8L2	ZN491_HUMAN	zinc finger protein 491	369					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(14)|lung(6)|ovary(2)|skin(1)	26						TGTGTCAGCTCCTTTCATAGA	0.393																																																0			19											56.0	58.0	57.0					19																	11917874		2203	4300	6503	11778874	SO:0001583	missense	126069			AK092110	CCDS12267.1	19p13.2	2013-01-08			ENSG00000177599	ENSG00000177599		"""Zinc fingers, C2H2-type"""	23706	protein-coding gene	gene with protein product							Standard	XM_005259730		Approved	FLJ34791	uc002mso.1	Q8N8L2	OTTHUMG00000156529	ENST00000323169.5:c.1106C>G	19.37:g.11917874C>G	ENSP00000313443:p.Ser369Cys	Somatic		Capture	Illumina GAIIx	4	11778874	Q3MJ35|Q8NAT8	Missense_Mutation	SNP	superfamily_SSF57667,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.S369C	ENST00000323169.5	37	c.1106	CCDS12267.1	19	.	.	.	.	.	.	.	.	.	.	c	6.810	0.518497	0.13005	.	.	ENSG00000177599	ENST00000323169;ENST00000455048	T	0.16597	2.33	0.981	-1.96	0.07525	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12475	0.0303	L	0.49126	1.545	0.09310	N	1	B	0.18863	0.031	B	0.15870	0.014	T	0.36744	-0.9735	9	0.62326	D	0.03	.	1.1661	0.01816	0.2007:0.2531:0.3786:0.1676	.	369	Q8N8L2	ZN491_HUMAN	C	369;341	ENSP00000313443:S369C	ENSP00000313443:S369C	S	+	2	0	ZNF491	11778874	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.544000	0.00436	-0.576000	0.05974	0.505000	0.49811	TCC	-	superfamily_SSF57667,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1		0.393	ZNF491-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF491	protein_coding	OTTHUMT00000344518.1	C	NM_152356		11778874	+1	no_errors	NM_152356	genbank	human	validated	54_36p	missense	SNP	0.000	G
ZNF799	90576	genome.wustl.edu	37	19	12501999	12501999	+	Missense_Mutation	SNP	G	G	A	rs183068429		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:12501999G>A	ENST00000430385.3	-	4	1413	c.1213C>T	c.(1213-1215)Ccc>Tcc	p.P405S	ZNF799_ENST00000419318.1_Missense_Mutation_p.P373S|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						AATACACTGGGATAAACAAAG	0.418																																																0			19											143.0	142.0	142.0					19																	12501999		2203	4300	6503	12362999	SO:0001583	missense	90576			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1213C>T	19.37:g.12501999G>A	ENSP00000411084:p.Pro405Ser	Somatic		Capture	Illumina GAIIx	4	12362999		Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,HMMSmart_SM00355,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.P405S	ENST00000430385.3	37	c.1213	CCDS45989.1	19	.	.	.	.	.	.	.	.	.	.	G	0.133	-1.111207	0.01813	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.06933	3.24;3.24	1.31	0.231	0.15377	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03564	0.0102	N	0.01522	-0.82	0.09310	N	1	P	0.49358	0.923	P	0.54590	0.756	T	0.17715	-1.0360	9	0.02654	T	1	.	1.9548	0.03374	0.2185:0.0:0.4643:0.3172	.	405	Q96GE5	ZN799_HUMAN	S	373;405	ENSP00000415278:P373S;ENSP00000411084:P405S	ENSP00000415278:P373S	P	-	1	0	ZNF799	12362999	0.000000	0.05858	0.000000	0.03702	0.148000	0.21650	-0.650000	0.05378	0.117000	0.18138	0.430000	0.28490	CCC	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.418	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF799	protein_coding	OTTHUMT00000344099.2	G	NM_001080821		12362999	-1	no_errors	NM_001080821	genbank	human	validated	54_36p	missense	SNP	0.000	A
EGFL6	25975	genome.wustl.edu	37	X	13635855	13635855	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:13635855C>G	ENST00000361306.1	+	8	1042	c.785C>G	c.(784-786)cCt>cGt	p.P262R	EGFL6_ENST00000380602.3_Missense_Mutation_p.P262R	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	262					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						TTAGCTATCCCTGAAAATTCT	0.348																																																0			X											108.0	112.0	110.0					X																	13635855		2203	4300	6503	13545776	SO:0001583	missense	25975			AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.785C>G	X.37:g.13635855C>G	ENSP00000355126:p.Pro262Arg	Somatic		Capture	Illumina GAIIx	4	13545776	B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Missense_Mutation	SNP	superfamily_Growth factor receptor domain,HMMSmart_SM00181,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,superfamily_EGF/Laminin,HMMSmart_SM00137,HMMPfam_MAM	p.P262R	ENST00000361306.1	37	c.785	CCDS14155.1	X	.	.	.	.	.	.	.	.	.	.	C	12.85	2.060897	0.36373	.	.	ENSG00000198759	ENST00000361306;ENST00000380602	D;D	0.87966	-2.32;-2.32	5.74	5.74	0.90152	.	0.369038	0.30185	N	0.010216	D	0.84224	0.5425	N	0.08118	0	0.45194	D	0.998208	D;D	0.76494	0.999;0.995	D;P	0.70016	0.967;0.854	D	0.84838	0.0806	10	0.52906	T	0.07	.	8.2199	0.31534	0.1573:0.7635:0.0:0.0792	.	262;262	Q8IUX8-2;Q8IUX8	.;EGFL6_HUMAN	R	262	ENSP00000355126:P262R;ENSP00000369976:P262R	ENSP00000355126:P262R	P	+	2	0	EGFL6	13545776	1.000000	0.71417	1.000000	0.80357	0.239000	0.25481	2.887000	0.48586	2.433000	0.82419	0.589000	0.80489	CCT	-	NULL		0.348	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EGFL6	protein_coding	OTTHUMT00000055800.1	C	NM_015507		13545776	+1	no_errors	NM_015507	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MACROD2	140733	genome.wustl.edu	37	20	15948271	15948271	+	Silent	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr20:15948271C>G	ENST00000310348.4	+	13	981	c.981C>G	c.(979-981)ccC>ccG	p.P327P	MACROD2_ENST00000217246.4_Silent_p.P327P|MACROD2_ENST00000378058.3_Silent_p.P92P|MACROD2_ENST00000402914.1_Silent_p.P92P			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	327	Glu-rich.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)	p.P92P(1)|p.P327P(1)		breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				AAGATCATCCCGATGGTAGGT	0.348																																																2	Substitution - coding silent(2)	kidney(2)	20											122.0	123.0	122.0					20																	15948271		2203	4300	6503	15896271	SO:0001819	synonymous_variant	140733			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.981C>G	20.37:g.15948271C>G		Somatic		Capture	Illumina GAIIx	4	15896271	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Silent	SNP	superfamily_SSF52949,HMMSmart_A1pp,HMMPfam_Macro	p.P327	ENST00000310348.4	37	c.981	CCDS13120.2	20																																																																																			-	NULL		0.348	MACROD2-201	KNOWN	basic|CCDS	protein_coding	MACROD2	protein_coding		C	NM_080676		15896271	+1	no_errors	NM_080676	genbank	human	validated	54_36p	silent	SNP	0.000	G
MAP3K15	389840	genome.wustl.edu	37	X	19410174	19410174	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:19410174A>T	ENST00000338883.4	-	18	2376	c.2377T>A	c.(2377-2379)Ttt>Att	p.F793I	MAP3K15_ENST00000359173.3_Missense_Mutation_p.F228I|MAP3K15_ENST00000469203.2_Missense_Mutation_p.F625I|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	793	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			F -> L (in Ref. 1; BAD18622). {ECO:0000305}.			ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GAGGTTCCAAAATCGGAGATT	0.488																																																0			X											79.0	75.0	77.0					X																	19410174		2203	4300	6503	19320095	SO:0001583	missense	389840			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2377T>A	X.37:g.19410174A>T	ENSP00000345629:p.Phe793Ile	Somatic		Capture	Illumina GAIIx	4	19320095	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	HMMSmart_S_TKc,HMMPfam_Pkinase,superfamily_Kinase_like,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,superfamily_SAM_homology	p.F268I	ENST00000338883.4	37	c.802		X	.	.	.	.	.	.	.	.	.	.	A	20.6	4.013712	0.75161	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.63580	-0.05;-0.05;-0.05	5.09	5.09	0.68999	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88797	0.6534	H	0.99789	4.78	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.984;0.999	D	0.93567	0.6900	10	0.87932	D	0	.	14.176	0.65542	1.0:0.0:0.0:0.0	.	268;793	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	I	793;228;625	ENSP00000345629:F793I;ENSP00000352093:F228I;ENSP00000428356:F625I	ENSP00000345629:F793I	F	-	1	0	MAP3K15	19320095	1.000000	0.71417	0.997000	0.53966	0.356000	0.29392	8.910000	0.92685	1.794000	0.52575	0.417000	0.27973	TTT	-	HMMSmart_S_TKc,HMMPfam_Pkinase,superfamily_Kinase_like		0.488	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	protein_coding		A	NM_001001671		19320095	-1	no_errors	NM_001001671	genbank	human	validated	54_36p	missense	SNP	1.000	T
IGLV10-54	28772	genome.wustl.edu	37	22	22569547	22569547	+	RNA	SNP	A	A	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr22:22569547A>C	ENST00000390287.2	+	0	252									immunoglobulin lambda variable 10-54																		GGGATCTCAGAGAGATTCTCT	0.552																																																0			22											52.0	56.0	55.0					22																	22569547		2014	4171	6185	20899547			0			Z73676		22q11.2	2012-02-08			ENSG00000211642	ENSG00000211642		"""Immunoglobulins / IGL locus"""	5884	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000150993		22.37:g.22569547A>C		Somatic		Capture	Illumina GAIIx	4	20899547		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00406	p.E80A	ENST00000390287.2	37	c.239		22																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00406		0.552	IGLV10-54-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV10-54	IG_V_gene	OTTHUMT00000320858.1	A	NG_000002		20899547	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390287	ensembl	human	known	54_36p	missense	SNP	0.001	C
KRT18P40	390904	genome.wustl.edu	37	19	21144323	21144323	+	IGR	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:21144323G>C								ZNF85 (10820 upstream) : CTD-2542C24.8 (10744 downstream)																							CACAAATACTGTGGACAATGC	0.463																																																0			19																																								20936163	SO:0001628	intergenic_variant	390904																															19.37:g.21144323G>C		Somatic		Capture	Illumina GAIIx	4	20936163		RNA	SNP	-	NULL		37	NULL		19																																																																																			-	-	0	0.463					KRT18P40			G			20936163	+1	pseudogene	XR_017288	genbank	human	model	54_36p	rna	SNP	0.704	C
EIF4G3	8672	genome.wustl.edu	37	1	21220078	21220078	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:21220078G>A	ENST00000264211.8	-	12	2211	c.2017C>T	c.(2017-2019)Cga>Tga	p.R673*	EIF4G3_ENST00000537738.1_Nonsense_Mutation_p.R126*|EIF4G3_ENST00000400422.1_Nonsense_Mutation_p.R673*|EIF4G3_ENST00000544689.1_Nonsense_Mutation_p.R216*|EIF4G3_ENST00000374933.3_5'UTR|EIF4G3_ENST00000536266.1_Nonsense_Mutation_p.R277*|EIF4G3_ENST00000374935.3_Nonsense_Mutation_p.R393*|EIF4G3_ENST00000374937.3_Nonsense_Mutation_p.R679*|EIF4G3_ENST00000602326.1_Nonsense_Mutation_p.R679*	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	673					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		TCTGGTCCTCGAGGCAAAATT	0.458																																																0			1											107.0	100.0	102.0					1																	21220078		2203	4300	6503	21092665	SO:0001587	stop_gained	8672			AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.2017C>T	1.37:g.21220078G>A	ENSP00000264211:p.Arg673*	Somatic		Capture	Illumina GAIIx	4	21092665	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Nonsense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_MIF4G,HMMSmart_SM00543,HMMPfam_MA3,HMMSmart_SM00544,superfamily_PH domain-like,HMMSmart_SM00515,HMMPfam_W2	p.R673*	ENST00000264211.8	37	c.2017	CCDS214.1	1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006352	0.93287	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266;ENST00000374933;ENST00000544689	.	.	.	5.78	4.85	0.62838	.	0.233665	0.37483	N	0.002079	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-8.7231	14.4534	0.67401	0.0:0.0:0.7145:0.2855	.	.	.	.	X	673;869;673;393;126;679;277;216;216	.	ENSP00000264211:R673X	R	-	1	2	EIF4G3	21092665	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.538000	0.60650	1.413000	0.46997	-0.274000	0.10170	CGA	-	NULL		0.458	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	protein_coding	OTTHUMT00000007467.3	G	NM_003760		21092665	-1	no_errors	NM_003760	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
USP48	84196	genome.wustl.edu	37	1	22084161	22084161	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:22084161T>C	ENST00000308271.9	-	2	898	c.250A>G	c.(250-252)Aaa>Gaa	p.K84E	USP48_ENST00000529637.1_Missense_Mutation_p.K84E|USP48_ENST00000421625.2_Missense_Mutation_p.K84E|USP48_ENST00000400301.1_Missense_Mutation_p.K84E	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	84					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		TTTACCTTTTTTCTCCTCTCA	0.338																																																0			1											107.0	99.0	102.0					1																	22084161		2202	4299	6501	21956748	SO:0001583	missense	84196			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.250A>G	1.37:g.22084161T>C	ENSP00000309262:p.Lys84Glu	Somatic		Capture	Illumina GAIIx	4	21956748	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_2,superfamily_Ubiquitin-like	p.K84E	ENST00000308271.9	37	c.250	CCDS30623.1	1	.	.	.	.	.	.	.	.	.	.	T	12.13	1.844402	0.32606	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000529637;ENST00000421625	T;T;T;T	0.05786	3.39;3.4;3.4;3.56	5.71	5.71	0.89125	.	0.191336	0.56097	D	0.000032	T	0.08358	0.0208	L	0.43152	1.355	0.45946	D	0.998778	B;B;B;B;B;B	0.18741	0.005;0.01;0.002;0.004;0.006;0.03	B;B;B;B;B;B	0.14023	0.005;0.005;0.003;0.006;0.01;0.007	T	0.09400	-1.0676	10	0.51188	T	0.08	.	15.1695	0.72858	0.0:0.0:0.0:1.0	.	84;84;84;84;84;84	B7ZKS7;B7ZKS3;Q86UV5-7;Q86UV5-3;Q86UV5-2;Q86UV5	.;.;.;.;.;UBP48_HUMAN	E	84	ENSP00000383157:K84E;ENSP00000309262:K84E;ENSP00000431949:K84E;ENSP00000406256:K84E	ENSP00000309262:K84E	K	-	1	0	USP48	21956748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.681000	0.68175	2.172000	0.68678	0.533000	0.62120	AAA	-	superfamily_Cysteine proteinases		0.338	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP48	protein_coding	OTTHUMT00000021372.1	T	NM_032236		21956748	-1	no_errors	NM_032236	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CNR2	1269	genome.wustl.edu	37	1	24201883	24201883	+	Silent	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:24201883G>A	ENST00000374472.4	-	2	386	c.225C>T	c.(223-225)agC>agT	p.S75S	CNR2_ENST00000536471.1_Silent_p.S75S	NM_001841.2	NP_001832.1	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	75					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of action potential (GO:0045759)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|response to amphetamine (GO:0001975)|response to lipopolysaccharide (GO:0032496)|sensory perception of pain (GO:0019233)	dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(9)|pancreas(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(2)	26		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Dronabinol(DB00470)|Nabilone(DB00486)	CCCCAGCCAAGCTGCCAATGA	0.547																																																0			1											64.0	74.0	71.0					1																	24201883		2203	4300	6503	24074470	SO:0001819	synonymous_variant	1269			X74328	CCDS245.1	1p	2012-08-08			ENSG00000188822	ENSG00000188822		"""GPCR / Class A : Cannabinoid receptors"""	2160	protein-coding gene	gene with protein product		605051					Standard	NM_001841		Approved	CB2	uc001bif.3	P34972	OTTHUMG00000013892	ENST00000374472.4:c.225C>T	1.37:g.24201883G>A		Somatic		Capture	Illumina GAIIx	4	24074470	C6ES44|Q4VBK8|Q5JRH7|Q6B0G7|Q6NSY0	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S75	ENST00000374472.4	37	c.225	CCDS245.1	1																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.547	CNR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR2	protein_coding	OTTHUMT00000038949.1	G	NM_001841		24074470	-1	no_errors	NM_001841	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
CACNG3	10368	genome.wustl.edu	37	16	24373065	24373065	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr16:24373065G>C	ENST00000005284.3	+	4	2031	c.829G>C	c.(829-831)Ggg>Cgg	p.G277R		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	277					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		GATCACCATGGGGACCCTCCT	0.542																																																0			16											105.0	112.0	110.0					16																	24373065		2197	4300	6497	24280566	SO:0001583	missense	10368			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.829G>C	16.37:g.24373065G>C	ENSP00000005284:p.Gly277Arg	Somatic		Capture	Illumina GAIIx	4	24280566		Missense_Mutation	SNP	HMMPfam_PMP22_Claudin	p.G277R	ENST00000005284.3	37	c.829	CCDS10620.1	16	.	.	.	.	.	.	.	.	.	.	g	18.55	3.649152	0.67358	.	.	ENSG00000006116	ENST00000005284	T	0.55760	0.5	4.93	4.93	0.64822	.	0.299246	0.35739	N	0.003017	T	0.53286	0.1787	L	0.51422	1.61	0.54753	D	0.999982	P	0.48503	0.911	P	0.45037	0.467	T	0.54214	-0.8327	10	0.36615	T	0.2	-15.4374	17.8078	0.88607	0.0:0.0:1.0:0.0	.	277	O60359	CCG3_HUMAN	R	277	ENSP00000005284:G277R	ENSP00000005284:G277R	G	+	1	0	CACNG3	24280566	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.369000	0.73109	2.266000	0.75297	0.645000	0.84053	GGG	-	NULL		0.542	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG3	protein_coding	OTTHUMT00000254548.1	G	NM_006539		24280566	+1	no_errors	NM_006539	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DSG3	1830	genome.wustl.edu	37	18	29046618	29046618	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr18:29046618G>A	ENST00000257189.4	+	11	1620	c.1537G>A	c.(1537-1539)Gct>Act	p.A513T		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	513					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GGTTGTCTCCGCTAGAACACT	0.448																																																0			18											136.0	122.0	127.0					18																	29046618		2203	4300	6503	27300616	SO:0001583	missense	1830			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.1537G>A	18.37:g.29046618G>A	ENSP00000257189:p.Ala513Thr	Somatic		Capture	Illumina GAIIx	4	27300616	A8K2V2	Missense_Mutation	SNP	HMMPfam_Cadherin,HMMSmart_CA,superfamily_Cadherin,PatternScan_CADHERIN_1	p.A513T	ENST00000257189.4	37	c.1537	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980488	0.53827	.	.	ENSG00000134757	ENST00000257189	T	0.63417	-0.04	5.73	3.01	0.34805	.	0.638909	0.13488	N	0.384184	T	0.72374	0.3452	L	0.60455	1.87	0.09310	N	1	D	0.76494	0.999	D	0.65010	0.931	T	0.61143	-0.7122	10	0.59425	D	0.04	.	10.6779	0.45797	0.2073:0.0:0.7927:0.0	.	513	P32926	DSG3_HUMAN	T	513	ENSP00000257189:A513T	ENSP00000257189:A513T	A	+	1	0	DSG3	27300616	0.168000	0.22989	0.000000	0.03702	0.001000	0.01503	2.179000	0.42528	0.377000	0.24735	-0.196000	0.12772	GCT	-	superfamily_Cadherin		0.448	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	protein_coding	OTTHUMT00000254949.1	G	NM_001944		27300616	+1	no_errors	NM_001944	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
DSG3	1830	genome.wustl.edu	37	18	29052246	29052246	+	Splice_Site	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr18:29052246G>C	ENST00000257189.4	+	13	1980		c.e13-1			NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3						apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTTTTCACTAGTGGCCCCCCT	0.398																																																0			18											88.0	93.0	91.0					18																	29052246		2203	4300	6503	27306244	SO:0001630	splice_region_variant	1830			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.1898-1G>C	18.37:g.29052246G>C		Somatic		Capture	Illumina GAIIx	4	27306244	A8K2V2	Splice_Site	SNP	-	e13-1	ENST00000257189.4	37	c.1898-1	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810555	0.50421	.	.	ENSG00000134757	ENST00000257189	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9134	0.97033	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DSG3	27306244	1.000000	0.71417	0.993000	0.49108	0.466000	0.32739	6.411000	0.73298	2.708000	0.92522	0.467000	0.42956	.	-	-		0.398	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	protein_coding	OTTHUMT00000254949.1	G	NM_001944	Intron	27306244	+1	no_errors	NM_001944	genbank	human	reviewed	54_36p	splice_site	SNP	0.998	C
NUGGC	389643	genome.wustl.edu	37	8	27898593	27898593	+	Missense_Mutation	SNP	C	C	T	rs200817436		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr8:27898593C>T	ENST00000413272.2	-	13	1728	c.1586G>A	c.(1585-1587)cGc>cAc	p.R529H	NUGGC_ENST00000341513.6_Missense_Mutation_p.R529H	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	529					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										GAGGATGCAGCGGTAAGAAGT	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		18945	0.001		0.0	False		,,,				2504	0.0															0			8						C	HIS/ARG	2,4120		0,2,2059	50.0	51.0	51.0		1586	5.5	1.0	8		51	3,8427		0,3,4212	yes	missense	C8orf80	NM_001010906.1	29	0,5,6271	TT,TC,CC		0.0356,0.0485,0.0398	probably-damaging	529/797	27898593	5,12547	2061	4215	6276	27954512	SO:0001583	missense	389643			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1586G>A	8.37:g.27898593C>T	ENSP00000408697:p.Arg529His	Somatic		Capture	Illumina GAIIx	4	27954512	Q6ZP73	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R529H	ENST00000413272.2	37	c.1586	CCDS47833.1	8	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771839	0.69992	4.85E-4	3.56E-4	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.32515	1.45;1.45	5.53	5.53	0.82687	.	0.338199	0.26939	N	0.021735	T	0.38188	0.1031	L	0.29908	0.895	0.40960	D	0.984618	D	0.76494	0.999	P	0.59487	0.858	T	0.05435	-1.0885	10	0.27082	T	0.32	-12.0884	14.9723	0.71243	0.0:1.0:0.0:0.0	.	529	Q68CJ6	SLIP_HUMAN	H	529	ENSP00000408697:R529H;ENSP00000345031:R529H	ENSP00000345031:R529H	R	-	2	0	C8orf80	27954512	0.621000	0.27077	0.996000	0.52242	0.298000	0.27526	1.025000	0.30090	2.584000	0.87258	0.650000	0.86243	CGC	-	NULL		0.567	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C8orf80	protein_coding	OTTHUMT00000342494.1	C	NM_001010906		27954512	-1	no_errors	NM_001010906	genbank	human	predicted	54_36p	missense	SNP	0.775	T
OR5V1	81696	genome.wustl.edu	37	6	29323149	29323149	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr6:29323149G>A	ENST00000377154.1	-	4	1123	c.824C>T	c.(823-825)tCa>tTa	p.S275L	OR5V1_ENST00000543825.1_Missense_Mutation_p.S275L			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GTACAACACTGAAACCAACCT	0.423																																					Ovarian(32;43 883 21137 32120 42650)											0			6											130.0	127.0	128.0					6																	29323149		2203	4300	6503	29431128	SO:0001583	missense	81696				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.824C>T	6.37:g.29323149G>A	ENSP00000366359:p.Ser275Leu	Somatic		Capture	Illumina GAIIx	4	29431128	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S275L	ENST00000377154.1	37	c.824	CCDS4657.1	6	.	.	.	.	.	.	.	.	.	.	G	16.27	3.077203	0.55753	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.00265	8.39;8.39	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.000000	0.28067	N	0.016726	T	0.00412	0.0013	H	0.95294	3.65	0.09310	N	1	P	0.52577	0.954	P	0.56514	0.8	T	0.16778	-1.0391	10	0.87932	D	0	-40.713	17.3782	0.87398	0.0:0.0:1.0:0.0	.	275	Q9UGF6	OR5V1_HUMAN	L	275	ENSP00000366359:S275L;ENSP00000443309:S275L	ENSP00000366356:S275L	S	-	2	0	OR5V1	29431128	0.003000	0.15002	0.098000	0.21074	0.622000	0.37654	1.466000	0.35310	2.499000	0.84300	0.543000	0.68304	TCA	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.423	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5V1	protein_coding	OTTHUMT00000076398.3	G			29431128	-1	no_errors	NM_030876	genbank	human	validated	54_36p	missense	SNP	0.001	A
OR11A1	26531	genome.wustl.edu	37	6	29395342	29395342	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr6:29395342T>C	ENST00000377149.1	-	5	549	c.77A>G	c.(76-78)cAt>cGt	p.H26R	OR11A1_ENST00000377147.2_Missense_Mutation_p.H26R|OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377148.1_Missense_Mutation_p.H26R			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						AAACAAGAAATGCAGTTCAGG	0.408																																																0			6											74.0	73.0	74.0					6																	29395342		1510	2708	4218	29503321	SO:0001583	missense	26531				CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.77A>G	6.37:g.29395342T>C	ENSP00000366354:p.His26Arg	Somatic		Capture	Illumina GAIIx	4	29503321	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.H26R	ENST00000377149.1	37	c.77	CCDS34363.1	6	.	.	.	.	.	.	.	.	.	.	T	8.894	0.954619	0.18431	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.00419	7.48;7.48;7.48	3.77	2.59	0.31030	.	0.244558	0.20747	U	0.086435	T	0.00039	0.0001	N	0.02539	-0.55	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.31641	-0.9936	10	0.49607	T	0.09	-4.4099	8.0438	0.30536	0.0:0.1012:0.0:0.8988	.	26	Q9GZK7	O11A1_HUMAN	R	26	ENSP00000366353:H26R;ENSP00000366354:H26R;ENSP00000366352:H26R	ENSP00000366352:H26R	H	-	2	0	OR11A1	29503321	0.612000	0.27000	0.002000	0.10522	0.096000	0.18686	1.470000	0.35354	0.509000	0.28195	0.333000	0.21579	CAT	-	superfamily_Family A G protein-coupled receptor-like		0.408	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR11A1	protein_coding	OTTHUMT00000193778.1	T			29503321	-1	no_errors	NM_013937	genbank	human	provisional	54_36p	missense	SNP	0.939	C
ADAMTS12	81792	genome.wustl.edu	37	5	33576900	33576900	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr5:33576900G>C	ENST00000504830.1	-	19	3566	c.3231C>G	c.(3229-3231)agC>agG	p.S1077R	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.S992R|ADAMTS12_ENST00000504582.1_5'Flank	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1077	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GATAGCGAGAGCTCAGCTCAG	0.517										HNSCC(64;0.19)																																						0			5											126.0	120.0	122.0					5																	33576900		2203	4300	6503	33612657	SO:0001583	missense	81792			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3231C>G	5.37:g.33576900G>C	ENSP00000422554:p.Ser1077Arg	Somatic		Capture	Illumina GAIIx	4	33612657	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.S1077R	ENST00000504830.1	37	c.3231	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	g	3.738	-0.054127	0.07362	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.50277	0.75;0.75	5.17	2.47	0.30058	.	1.196350	0.05876	N	0.625494	T	0.35335	0.0928	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.30973	0.302;0.201	B;B	0.35413	0.202;0.063	T	0.38757	-0.9646	10	0.42905	T	0.14	.	8.6429	0.33987	0.233:0.0:0.767:0.0	.	992;1077	P58397-3;P58397	.;ATS12_HUMAN	R	1077;992	ENSP00000422554:S1077R;ENSP00000344847:S992R	ENSP00000344847:S992R	S	-	3	2	ADAMTS12	33612657	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	0.196000	0.17176	0.363000	0.24346	-0.142000	0.14014	AGC	-	NULL		0.517	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	G	NM_030955		33612657	-1	no_errors	NM_030955	genbank	human	reviewed	54_36p	missense	SNP	0.001	C
CTNNBL1	56259	genome.wustl.edu	37	20	36431298	36431298	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr20:36431298T>A	ENST00000361383.6	+	11	1178	c.1061T>A	c.(1060-1062)cTg>cAg	p.L354Q	CTNNBL1_ENST00000473857.1_3'UTR|CTNNBL1_ENST00000373469.1_Missense_Mutation_p.L102Q|CTNNBL1_ENST00000373473.1_Missense_Mutation_p.L167Q|CTNNBL1_ENST00000405275.2_Missense_Mutation_p.L327Q	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	354					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				AGCAGTGCCCTGAAAGTGCTG	0.433																																					Ovarian(184;582 2038 3273 4106 42608)											0			20											125.0	119.0	121.0					20																	36431298		2203	4300	6503	35864712	SO:0001583	missense	56259			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1061T>A	20.37:g.36431298T>A	ENSP00000355050:p.Leu354Gln	Somatic		Capture	Illumina GAIIx	4	35864712	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	HMMPfam_DUF1716,superfamily_ARM repeat	p.L354Q	ENST00000361383.6	37	c.1061	CCDS13298.1	20	.	.	.	.	.	.	.	.	.	.	T	24.0	4.486333	0.84854	.	.	ENSG00000132792	ENST00000361383;ENST00000405275;ENST00000373473;ENST00000373469	T;T;T;T	0.59224	0.28;0.28;0.43;0.43	5.52	5.52	0.82312	Armadillo-type fold (1);	0.151946	0.46442	D	0.000286	T	0.78972	0.4368	M	0.89163	3.01	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.68765	0.954;0.96	D	0.83552	0.0102	10	0.87932	D	0	-15.0604	14.8219	0.70080	0.0:0.0:0.0:1.0	.	354;167	Q8WYA6;Q8WYA6-2	CTBL1_HUMAN;.	Q	354;327;167;102	ENSP00000355050:L354Q;ENSP00000384355:L327Q;ENSP00000362572:L167Q;ENSP00000362568:L102Q	ENSP00000355050:L354Q	L	+	2	0	CTNNBL1	35864712	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.948000	0.87774	2.096000	0.63516	0.379000	0.24179	CTG	-	superfamily_ARM repeat		0.433	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CTNNBL1	protein_coding	OTTHUMT00000079125.1	T	NM_030877		35864712	+1	no_errors	NM_030877	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
KRT27	342574	genome.wustl.edu	37	17	38933846	38933846	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr17:38933846A>G	ENST00000301656.3	-	6	1151	c.1111T>C	c.(1111-1113)Tat>Cat	p.Y371H	KRT27_ENST00000540723.1_5'UTR	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				AGCTGCTCATACTCGAGCTTC	0.547																																																0			17											150.0	149.0	149.0					17																	38933846		2203	4300	6503	36187372	SO:0001583	missense	342574			AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.1111T>C	17.37:g.38933846A>G	ENSP00000301656:p.Tyr371His	Somatic		Capture	Illumina GAIIx	4	36187372		Missense_Mutation	SNP	HMMPfam_Filament	p.Y371H	ENST00000301656.3	37	c.1111	CCDS11375.1	17	.	.	.	.	.	.	.	.	.	.	A	16.80	3.222925	0.58668	.	.	ENSG00000171446	ENST00000301656	D	0.96774	-4.12	5.56	3.36	0.38483	Filament (1);	0.000000	0.64402	D	0.000018	D	0.96122	0.8736	M	0.77406	2.37	0.44852	D	0.997867	P	0.40180	0.705	P	0.46975	0.533	D	0.94002	0.7276	10	0.51188	T	0.08	.	9.3049	0.37870	0.8538:0.0:0.1462:0.0	.	371	Q7Z3Y8	K1C27_HUMAN	H	371	ENSP00000301656:Y371H	ENSP00000301656:Y371H	Y	-	1	0	KRT27	36187372	1.000000	0.71417	0.989000	0.46669	0.722000	0.41435	5.891000	0.69782	0.487000	0.27698	-0.256000	0.11100	TAT	-	HMMPfam_Filament		0.547	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT27	protein_coding	OTTHUMT00000257216.1	A	NM_181537		36187372	-1	no_errors	NM_181537	genbank	human	validated	54_36p	missense	SNP	1.000	G
FAM47C	442444	genome.wustl.edu	37	X	37027236	37027236	+	Silent	SNP	C	C	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:37027236C>A	ENST00000358047.3	+	1	805	c.753C>A	c.(751-753)ccC>ccA	p.P251P		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	251										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CAGAGCCTCCCAAGACTCAGG	0.622																																																0			X											55.0	52.0	53.0					X																	37027236		2202	4300	6502	36937157	SO:0001819	synonymous_variant	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.753C>A	X.37:g.37027236C>A		Somatic		Capture	Illumina GAIIx	4	36937157	Q6ZU46	Silent	SNP	NULL	p.P251	ENST00000358047.3	37	c.753	CCDS35227.1	X																																																																																			-	NULL		0.622	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	protein_coding	OTTHUMT00000060508.1	C	NM_001013736		36937157	+1	no_errors	NM_001013736	genbank	human	provisional	54_36p	silent	SNP	0.002	A
USP9X	8239	genome.wustl.edu	37	X	40990733	40990733	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:40990733T>G	ENST00000324545.8	+	4	899	c.266T>G	c.(265-267)tTg>tGg	p.L89W	USP9X_ENST00000378308.2_Missense_Mutation_p.L89W	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	89					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GTTCCAGTTTTGCCGAAAGGG	0.348																																					Ovarian(172;1807 2695 35459 49286)											0			X											149.0	140.0	143.0					X																	40990733		2203	4300	6503	40875677	SO:0001583	missense	8239			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.266T>G	X.37:g.40990733T>G	ENSP00000316357:p.Leu89Trp	Somatic		Capture	Illumina GAIIx	4	40875677	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	superfamily_Cysteine proteinases,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.L89W	ENST00000324545.8	37	c.266	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	T	24.0	4.482363	0.84747	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.03663	3.86;3.85	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.17195	0.0413	M	0.78637	2.42	0.80722	D	1	D;D	0.76494	0.999;0.999	D;P	0.68039	0.955;0.904	T	0.00326	-1.1815	10	0.66056	D	0.02	.	14.1419	0.65325	0.0:0.0:0.0:1.0	.	89;89	Q93008-1;Q93008	.;USP9X_HUMAN	W	89	ENSP00000367558:L89W;ENSP00000316357:L89W	ENSP00000316357:L89W	L	+	2	0	USP9X	40875677	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.669000	0.83911	1.786000	0.52430	0.486000	0.48141	TTG	-	NULL		0.348	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	protein_coding	OTTHUMT00000056250.4	T	NM_004652		40875677	+1	no_errors	NM_001039590	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HIVEP3	59269	genome.wustl.edu	37	1	42047792	42047792	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:42047792G>C	ENST00000372583.1	-	4	3562	c.2677C>G	c.(2677-2679)Ctt>Gtt	p.L893V	HIVEP3_ENST00000429157.2_Missense_Mutation_p.L893V|HIVEP3_ENST00000372584.1_Missense_Mutation_p.L893V|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000247584.5_Missense_Mutation_p.L893V	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	893	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				AGCTGGGCAAGTGTCTGGCTG	0.602																																																0			1											58.0	66.0	63.0					1																	42047792		2203	4300	6503	41820379	SO:0001583	missense	59269			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2677C>G	1.37:g.42047792G>C	ENSP00000361664:p.Leu893Val	Somatic		Capture	Illumina GAIIx	4	41820379	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	PatternScan_AIPM_HOMOCIT_SYNTH_1,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,superfamily_C2H2 and C2HC zinc fingers	p.L893V	ENST00000372583.1	37	c.2677	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780161	0.70222	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	4.95	4.95	0.65309	.	0.000000	0.44688	D	0.000435	T	0.76630	0.4014	M	0.76727	2.345	0.48087	D	0.999588	D;D	0.71674	0.998;0.997	D;D	0.83275	0.996;0.991	T	0.79678	-0.1703	10	0.87932	D	0	5.5	17.9567	0.89072	0.0:0.0:1.0:0.0	.	893;893	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	V	893	ENSP00000361665:L893V;ENSP00000361664:L893V;ENSP00000247584:L893V;ENSP00000410828:L893V	ENSP00000247584:L893V	L	-	1	0	HIVEP3	41820379	1.000000	0.71417	0.537000	0.28052	0.982000	0.71751	7.024000	0.76443	2.562000	0.86427	0.462000	0.41574	CTT	-	NULL		0.602	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	protein_coding	OTTHUMT00000016978.1	G	NM_024503		41820379	-1	no_errors	NM_024503	genbank	human	validated	54_36p	missense	SNP	0.994	C
KAT6A	7994	genome.wustl.edu	37	8	41791477	41791477	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr8:41791477C>G	ENST00000396930.3	-	18	4804	c.4261G>C	c.(4261-4263)Gat>Cat	p.D1421H	KAT6A_ENST00000265713.2_Missense_Mutation_p.D1421H|KAT6A_ENST00000406337.1_Missense_Mutation_p.D1421H	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1421					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GTTTCCAGATCCAGCTCACTA	0.502																																																0			8											101.0	97.0	98.0					8																	41791477		2203	4300	6503	41910634	SO:0001583	missense	7994			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.4261G>C	8.37:g.41791477C>G	ENSP00000380136:p.Asp1421His	Somatic		Capture	Illumina GAIIx	4	41910634	Q76L81	Missense_Mutation	SNP	HMMSmart_H15,superfamily_SSF46785,HMMSmart_PHD,HMMPfam_PHD,HMMSmart_RING,PatternScan_ZF_PHD_1,superfamily_FYVE_PHD_ZnF,superfamily_Acyl_CoA_acyltransferase,HMMPfam_MOZ_SAS	p.D1421H	ENST00000396930.3	37	c.4261	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065341	0.55432	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.75154	-0.91;-0.91;-0.91	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.82006	0.4943	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82458	-0.0447	10	0.66056	D	0.02	-24.8883	20.4043	0.99006	0.0:1.0:0.0:0.0	.	1421	Q92794	KAT6A_HUMAN	H	1421	ENSP00000265713:D1421H;ENSP00000385888:D1421H;ENSP00000380136:D1421H	ENSP00000265713:D1421H	D	-	1	0	KAT6A	41910634	1.000000	0.71417	0.994000	0.49952	0.615000	0.37417	7.294000	0.78760	2.823000	0.97156	0.650000	0.86243	GAT	-	NULL		0.502	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYST3	protein_coding	OTTHUMT00000318163.1	C	NM_006766		41910634	-1	no_errors	NM_001099412	genbank	human	validated	54_36p	missense	SNP	1.000	G
SZT2	23334	genome.wustl.edu	37	1	43888237	43888237	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:43888237C>G	ENST00000562955.1	+	13	1856	c.1856C>G	c.(1855-1857)tCt>tGt	p.S619C	SZT2_ENST00000372442.1_5'Flank	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	619					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						TCCCTGACCTCTCTGCTGCGG	0.592																																																0			1											90.0	85.0	87.0					1																	43888237		876	1991	2867	43660824	SO:0001583	missense	149469			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.1856C>G	1.37:g.43888237C>G	ENSP00000457168:p.Ser619Cys	Somatic		Capture	Illumina GAIIx	4	43660824	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	NULL	p.S619C	ENST00000562955.1	37	c.1856	CCDS30694.2	1																																																																																			-	NULL		0.592	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf84	protein_coding	OTTHUMT00000019517.3	C	NM_015284		43660824	+1	no_errors	ENST00000406439	ensembl	human	known	54_36p	missense	SNP	1.000	G
ACTN4	81	genome.wustl.edu	37	19	39200930	39200930	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:39200930C>A	ENST00000252699.2	+	8	843	c.767C>A	c.(766-768)gCc>gAc	p.A256D	ACTN4_ENST00000390009.3_Intron|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	256	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GACGAGAAGGCCATAATGACC	0.617																																					Colon(168;199 1940 10254 46213 46384)											0			19											199.0	174.0	183.0					19																	39200930		2203	4300	6503	43892770	SO:0001583	missense	81			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.767C>A	19.37:g.39200930C>A	ENSP00000252699:p.Ala256Asp	Somatic		Capture	Illumina GAIIx	4	43892770	A4K467|D6PXK4|O76048	Missense_Mutation	SNP	superfamily_Calponin-homology,HMMPfam_CH,PatternScan_ACTININ_1,HMMSmart_CH,PatternScan_ACTININ_2,superfamily_Spectrin,HMMPfam_Spectrin,HMMSmart_SPEC,superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1,HMMPfam_efhand_Ca_insen	p.A256D	ENST00000252699.2	37	c.767	CCDS12518.1	19	.	.	.	.	.	.	.	.	.	.	C	33	5.281768	0.95489	.	.	ENSG00000130402	ENST00000252699;ENST00000445727	D	0.95554	-3.74	5.76	5.76	0.90799	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97529	0.9191	M	0.72479	2.2	0.80722	D	1	D;B	0.59767	0.986;0.441	D;D	0.85130	0.997;0.932	D	0.97942	1.0326	10	0.87932	D	0	.	18.7502	0.91810	0.0:1.0:0.0:0.0	.	256;256	E7EV83;O43707	.;ACTN4_HUMAN	D	256	ENSP00000252699:A256D	ENSP00000252699:A256D	A	+	2	0	ACTN4	43892770	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.719000	0.93026	0.555000	0.69702	GCC	-	superfamily_Calponin-homology,HMMPfam_CH,HMMSmart_CH		0.617	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	protein_coding	OTTHUMT00000268091.1	C			43892770	+1	no_errors	NM_004924	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ITGA3	3675	genome.wustl.edu	37	17	48153693	48153693	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr17:48153693A>C	ENST00000320031.8	+	13	2008	c.1678A>C	c.(1678-1680)Aac>Cac	p.N560H	ITGA3_ENST00000544892.1_3'UTR|ITGA3_ENST00000007722.7_Missense_Mutation_p.N560H	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	560					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						TCCCCAGGACAACCTCCGTGA	0.642																																																0			17											107.0	101.0	103.0					17																	48153693		2203	4300	6503	45508692	SO:0001583	missense	3675			M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.1678A>C	17.37:g.48153693A>C	ENSP00000315190:p.Asn560His	Somatic		Capture	Illumina GAIIx	4	45508692	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains	p.N560H	ENST00000320031.8	37	c.1678	CCDS11558.1	17	.	.	.	.	.	.	.	.	.	.	A	20.4	3.982535	0.74474	.	.	ENSG00000005884	ENST00000007722;ENST00000538917;ENST00000320031	T;T	0.52754	0.65;0.65	5.3	5.3	0.74995	Integrin alpha-2 (1);	0.104529	0.64402	D	0.000004	T	0.65344	0.2682	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.69479	0.964;0.949	T	0.68914	-0.5283	10	0.59425	D	0.04	.	7.7695	0.28999	0.9093:0.0:0.0907:0.0	.	560;560	P26006-1;P26006	.;ITA3_HUMAN	H	560;546;560	ENSP00000007722:N560H;ENSP00000315190:N560H	ENSP00000007722:N560H	N	+	1	0	ITGA3	45508692	0.990000	0.36364	1.000000	0.80357	0.955000	0.61496	2.334000	0.43920	2.225000	0.72522	0.533000	0.62120	AAC	-	HMMPfam_Integrin_alpha2,superfamily_Integrin domains		0.642	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA3	protein_coding	OTTHUMT00000366298.1	A	NM_005501		45508692	+1	no_errors	NM_005501	genbank	human	reviewed	54_36p	missense	SNP	0.999	C
MYO5B	4645	genome.wustl.edu	37	18	47566582	47566582	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr18:47566582G>A	ENST00000285039.7	-	3	540	c.241C>T	c.(241-243)Cat>Tat	p.H81Y		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	81	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GCAGGCTCATGAAGATAGCTA	0.478																																																0			18											270.0	259.0	263.0					18																	47566582		1916	4137	6053	45820580	SO:0001583	missense	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.241C>T	18.37:g.47566582G>A	ENSP00000285039:p.His81Tyr	Somatic		Capture	Illumina GAIIx	4	45820580	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head,HMMSmart_SM00015,HMMPfam_IQ,HMMPfam_DIL	p.H81Y	ENST00000285039.7	37	c.241	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645605	0.67358	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.95518	-3.73	5.95	5.07	0.68467	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.98554	0.9517	H	0.96970	3.915	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.969	D	0.99593	1.0976	10	0.87932	D	0	.	15.8934	0.79318	0.0:0.1359:0.8641:0.0	.	80;81	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	Y	81;80	ENSP00000285039:H81Y	ENSP00000285039:H81Y	H	-	1	0	MYO5B	45820580	1.000000	0.71417	0.555000	0.28281	0.596000	0.36781	9.813000	0.99286	1.502000	0.48669	-0.302000	0.09304	CAT	-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00242,HMMPfam_Myosin_head		0.478	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	protein_coding	OTTHUMT00000448515.2	G			45820580	-1	no_errors	NM_001080467	genbank	human	provisional	54_36p	missense	SNP	1.000	A
CXXC1	30827	genome.wustl.edu	37	18	47810142	47810142	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr18:47810142C>A	ENST00000285106.6	-	11	2171	c.1457G>T	c.(1456-1458)tGt>tTt	p.C486F	CXXC1_ENST00000412036.2_Missense_Mutation_p.C490F|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000339998.6_5'Flank|MBD1_ENST00000424334.2_5'Flank|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000590208.1_5'Flank|MBD1_ENST00000585672.1_5'Flank|MBD1_ENST00000591416.1_5'Flank|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000269471.5_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000585595.1_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.C486F|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000269468.5_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	486					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						ACAGGAAACACAGAAGATCTG	0.567																																																0			18											143.0	121.0	128.0					18																	47810142		2203	4300	6503	46064140	SO:0001583	missense	30827			BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1457G>T	18.37:g.47810142C>A	ENSP00000285106:p.Cys486Phe	Somatic		Capture	Illumina GAIIx	4	46064140	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1,HMMPfam_zf-CXXC	p.C490F	ENST00000285106.6	37	c.1469	CCDS11945.1	18	.	.	.	.	.	.	.	.	.	.	C	20.7	4.034072	0.75504	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.73363	-0.72;-0.74	4.65	4.65	0.58169	CpG binding protein, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85435	0.5696	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.87474	0.2416	10	0.87932	D	0	-16.0297	15.3793	0.74641	0.0:1.0:0.0:0.0	.	490;486;353	Q9P0U4-2;Q9P0U4;Q59EC8	.;CXXC1_HUMAN;.	F	486;490	ENSP00000285106:C486F;ENSP00000390475:C490F	ENSP00000285106:C486F	C	-	2	0	CXXC1	46064140	1.000000	0.71417	0.976000	0.42696	0.993000	0.82548	7.120000	0.77153	2.290000	0.77057	0.467000	0.42956	TGT	-	NULL		0.567	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXXC1	protein_coding	OTTHUMT00000255927.2	C	NM_014593		46064140	-1	no_errors	NM_001101654	genbank	human	validated	54_36p	missense	SNP	1.000	A
PRKAR2A	5576	genome.wustl.edu	37	3	48828036	48828036	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr3:48828036G>A	ENST00000265563.8	-	4	625	c.376C>T	c.(376-378)Cag>Tag	p.Q126*	PRKAR2A_ENST00000296446.8_Nonsense_Mutation_p.Q126*|PRKAR2A_ENST00000454963.1_Nonsense_Mutation_p.Q126*	NM_004157.2	NP_004148.1	P13861	KAP2_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, alpha	126	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)		SLC26A6/PRKAR2A(2)	breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)		CTGCATCTCTGTTCATCAGTT	0.294																																																0			3											90.0	99.0	96.0					3																	48828036		2202	4299	6501	48803040	SO:0001587	stop_gained	5576				CCDS2778.1	3p21.3-p21.2	2009-07-10			ENSG00000114302	ENSG00000114302	2.7.11.1		9391	protein-coding gene	gene with protein product		176910		PRKAR2		9676433	Standard	NM_004157		Approved		uc003cux.1	P13861	OTTHUMG00000133540	ENST00000265563.8:c.376C>T	3.37:g.48828036G>A	ENSP00000265563:p.Gln126*	Somatic		Capture	Illumina GAIIx	4	48803040	Q16823|Q9BUB1	Nonsense_Mutation	SNP	superfamily_cAMP-dep_prot_kin_reg_I/II_a/b,HMMPfam_RIIa,HMMSmart_RIIa,superfamily_cNMP_binding,HMMSmart_cNMP,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2	p.Q126*	ENST00000265563.8	37	c.376	CCDS2778.1	3	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857571	0.91433	.	.	ENSG00000114302	ENST00000265563;ENST00000454963;ENST00000296446;ENST00000419216	.	.	.	5.21	5.21	0.72293	.	0.602718	0.17708	N	0.164685	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-4.3824	18.5461	0.91047	0.0:0.0:1.0:0.0	.	.	.	.	X	126;126;126;114	.	ENSP00000265563:Q126X	Q	-	1	0	PRKAR2A	48803040	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.134000	0.94467	2.716000	0.92895	0.557000	0.71058	CAG	-	superfamily_cNMP_binding		0.294	PRKAR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAR2A	protein_coding	OTTHUMT00000257518.1	G			48803040	-1	no_errors	NM_004157	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
FSHR	2492	genome.wustl.edu	37	2	49244700	49244700	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr2:49244700C>G	ENST00000406846.2	-	4	421	c.302G>C	c.(301-303)aGa>aCa	p.R101T	FSHR_ENST00000304421.4_Missense_Mutation_p.R101T|FSHR_ENST00000346173.3_Missense_Mutation_p.R101T	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	101					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CTTTTCAATTCTACTGTAAAA	0.383									Gonadal Dysgenesis, 46 XX																																							0			2											136.0	131.0	133.0					2																	49244700		2203	4300	6503	49098204	SO:0001583	missense	2492	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.302G>C	2.37:g.49244700C>G	ENSP00000384708:p.Arg101Thr	Somatic		Capture	Illumina GAIIx	4	49098204	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	superfamily_L domain-like,HMMPfam_LRRNT,HMMSmart_SM00013,HMMPfam_LRR_1,superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R101T	ENST00000406846.2	37	c.302	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	C	9.280	1.047854	0.19827	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24	5.17	5.17	0.71159	.	0.285464	0.34906	N	0.003600	T	0.80259	0.4590	N	0.26130	0.795	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.97110	0.996;1.0;1.0	T	0.78041	-0.2359	9	.	.	.	.	14.056	0.64769	0.0:1.0:0.0:0.0	.	101;101;101	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	T	101	ENSP00000384708:R101T;ENSP00000333908:R101T;ENSP00000306780:R101T;ENSP00000415504:R101T	.	R	-	2	0	FSHR	49098204	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	4.241000	0.58707	2.673000	0.90976	0.655000	0.94253	AGA	-	superfamily_L domain-like		0.383	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	protein_coding	OTTHUMT00000251367.2	C			49098204	-1	no_errors	NM_000145	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
DGKK	139189	genome.wustl.edu	37	X	50144109	50144109	+	RNA	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:50144109G>C	ENST00000376025.2	-	0	1396							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					ACATTCCTTGGAAAACCGTCT	0.458																																																0			X											73.0	61.0	65.0					X																	50144109		1932	4132	6064	50160849			139189			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50144109G>C		Somatic		Capture	Illumina GAIIx	4	50160849	B2RP91	Missense_Mutation	SNP	superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,HMMPfam_DAGK_cat,HMMSmart_SM00046,HMMPfam_DAGK_acc,HMMSmart_SM00045	p.S446C	ENST00000376025.2	37	c.1337		X																																																																																			-	superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1		0.458	DGKK-001	KNOWN	basic	processed_transcript	DGKK	processed_transcript	OTTHUMT00000368187.1	G	NM_001013742		50160849	-1	no_errors	ENST00000376025	ensembl	human	known	54_36p	missense	SNP	0.992	C
FLJ26850	400710	genome.wustl.edu	37	19	50563152	50563152	+	RNA	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:50563152C>T	ENST00000527209.1	+	0	606					NR_027257.1																						AGGGCTTCTCCCCGGTGTGGC	0.572																																																0			19																																								55254964			0																															19.37:g.50563152C>T		Somatic		Capture	Illumina GAIIx	4	55254964		Silent	SNP	superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.G129	ENST00000527209.1	37	c.387		19																																																																																			-	superfamily_SSF57667		0.572	CTD-2126E3.1-001	KNOWN	basic	sense_overlapping	ENSG00000213861	sense_overlapping	OTTHUMT00000384643.1	C			55254964	-1	no_start_codon	ENST00000396607	ensembl	human	known	54_36p	silent	SNP	0.957	T
OR8H3	390152	genome.wustl.edu	37	11	55890455	55890455	+	Missense_Mutation	SNP	G	G	A	rs377459055	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr11:55890455G>A	ENST00000313472.3	+	1	607	c.607G>A	c.(607-609)Gct>Act	p.A203T		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					ATTCATTATCGCTGGTTCCAC	0.408																																																0			11						G	THR/ALA	0,4402		0,0,2201	221.0	199.0	206.0		607	2.7	0.0	11		206	1,8591	1.2+/-3.3	0,1,4295	no	missense	OR8H3	NM_001005201.1	58	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign	203/313	55890455	1,12993	2201	4296	6497	55647031	SO:0001583	missense	390152			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.607G>A	11.37:g.55890455G>A	ENSP00000323928:p.Ala203Thr	Somatic		Capture	Illumina GAIIx	4	55647031	Q6IFB7	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A203T	ENST00000313472.3	37	c.607	CCDS31519.1	11	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041086	0.55003	0.0	1.16E-4	ENSG00000181761	ENST00000313472	T	0.37752	1.18	3.62	2.69	0.31865	GPCR, rhodopsin-like superfamily (1);	0.123056	0.37577	N	0.002030	T	0.42381	0.1200	L	0.41824	1.3	0.22142	N	0.999334	P	0.52842	0.956	P	0.56434	0.798	T	0.25082	-1.0142	10	0.66056	D	0.02	.	11.3602	0.49638	0.0928:0.0:0.9072:0.0	.	203	Q8N146	OR8H3_HUMAN	T	203	ENSP00000323928:A203T	ENSP00000323928:A203T	A	+	1	0	OR8H3	55647031	0.000000	0.05858	0.038000	0.18304	0.398000	0.30690	0.283000	0.18846	0.627000	0.30340	0.173000	0.16961	GCT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.408	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	protein_coding	OTTHUMT00000391541.1	G	NM_001005201		55647031	+1	no_errors	NM_001005201	genbank	human	provisional	54_36p	missense	SNP	0.185	A
RP1	6101	genome.wustl.edu	37	8	55538015	55538015	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr8:55538015C>G	ENST00000220676.1	+	4	1721	c.1573C>G	c.(1573-1575)Caa>Gaa	p.Q525E		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	525					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TAACAATGATCAAATGGAGGA	0.343																																					Colon(91;1014 1389 7634 14542 40420)											0			8											68.0	66.0	66.0					8																	55538015		2203	4300	6503	55700568	SO:0001583	missense	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.1573C>G	8.37:g.55538015C>G	ENSP00000220676:p.Gln525Glu	Somatic		Capture	Illumina GAIIx	4	55700568		Missense_Mutation	SNP	superfamily_SSF89837,HMMSmart_DCX,HMMPfam_DCX	p.Q525E	ENST00000220676.1	37	c.1573	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	0.021	-1.427895	0.01117	.	.	ENSG00000104237	ENST00000220676	T	0.28666	1.6	5.62	2.75	0.32379	.	0.620823	0.15233	N	0.273340	T	0.17109	0.0411	L	0.35414	1.06	0.09310	N	1	B	0.22276	0.067	B	0.12837	0.008	T	0.30650	-0.9971	10	0.12103	T	0.63	.	3.4783	0.07593	0.2745:0.3624:0.2836:0.0795	.	525	P56715	RP1_HUMAN	E	525	ENSP00000220676:Q525E	ENSP00000220676:Q525E	Q	+	1	0	RP1	55700568	0.000000	0.05858	0.014000	0.15608	0.347000	0.29111	-0.088000	0.11198	0.272000	0.22027	0.650000	0.86243	CAA	-	NULL		0.343	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	protein_coding	OTTHUMT00000378532.2	C	NM_006269		55700568	+1	no_errors	ENST00000220676	ensembl	human	known	54_36p	missense	SNP	0.000	G
B4GALNT1	2583	genome.wustl.edu	37	12	58022020	58022020	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr12:58022020G>A	ENST00000341156.4	-	9	1612	c.1028C>T	c.(1027-1029)gCc>gTc	p.A343V	B4GALNT1_ENST00000550943.1_5'Flank|B4GALNT1_ENST00000418555.2_Missense_Mutation_p.A288V	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	343					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TTGAGACACGGCCAGGTTCCG	0.617																																																0			12											101.0	92.0	95.0					12																	58022020		2203	4300	6503	56308287	SO:0001583	missense	2583			M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.1028C>T	12.37:g.58022020G>A	ENSP00000341562:p.Ala343Val	Somatic		Capture	Illumina GAIIx	4	56308287	B4DE26|Q8N636	Missense_Mutation	SNP	superfamily_SSF53448,HMMPfam_Glycos_transf_2	p.A343V	ENST00000341156.4	37	c.1028	CCDS8950.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	36|36	5.717388|5.717388	0.96839|0.96839	.|.	.|.	ENSG00000135454|ENSG00000135454	ENST00000341156;ENST00000418555|ENST00000547741	T;T|.	0.65732|.	-0.17;-0.17|.	4.79|4.79	4.79|4.79	0.61399|0.61399	Glycosyl transferase, family 2 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79516|0.79516	0.4459|0.4459	M|M	0.85630|0.85630	2.765|2.765	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.998;0.999|.	T|T	0.82145|0.82145	-0.0602|-0.0602	10|5	0.72032|.	D|.	0.01|.	-8.3832|-8.3832	16.7708|16.7708	0.85537|0.85537	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	288;343|.	B4DE26;Q00973|.	.;B4GN1_HUMAN|.	V|S	343;288|15	ENSP00000341562:A343V;ENSP00000401601:A288V|.	ENSP00000341562:A343V|.	A|P	-|-	2|1	0|0	B4GALNT1|B4GALNT1	56308287|56308287	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.990000|0.990000	0.78478|0.78478	9.014000|9.014000	0.93635|0.93635	2.514000|2.514000	0.84764|0.84764	0.561000|0.561000	0.74099|0.74099	GCC|CCG	-	superfamily_SSF53448,HMMPfam_Glycos_transf_2		0.617	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	protein_coding	OTTHUMT00000407853.1	G	NM_001478		56308287	-1	no_errors	NM_001478	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PRKCG	5582	genome.wustl.edu	37	19	54407996	54407996	+	Splice_Site	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:54407996G>A	ENST00000263431.3	+	16	2046	c.1764G>A	c.(1762-1764)ggG>ggA	p.G588G	PRKCG_ENST00000542049.1_Intron|PRKCG_ENST00000540413.1_Splice_Site_p.G588G	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	588	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	TCTGCAAGGGGGTGAGAGCCC	0.562																																																0			19											62.0	49.0	53.0					19																	54407996		2203	4300	6503	59099808	SO:0001630	splice_region_variant	5582			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1764+1G>A	19.37:g.54407996G>A		Somatic		Capture	Illumina GAIIx	4	59099808	B7Z8Q0	Silent	SNP	superfamily_SSF57889,HMMSmart_C1,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2,superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_S_TK_X,HMMPfam_Pkinase_C	p.G588	ENST00000263431.3	37	c.1764	CCDS12867.1	19																																																																																			-	superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase		0.562	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCG	protein_coding	OTTHUMT00000139233.3	G	NM_002739	Silent	59099808	+1	no_errors	NM_002739	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
NLRP4	147945	genome.wustl.edu	37	19	56369922	56369922	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:56369922C>T	ENST00000301295.6	+	3	1585	c.1163C>T	c.(1162-1164)cCg>cTg	p.P388L	NLRP4_ENST00000587891.1_Missense_Mutation_p.P313L|NLRP4_ENST00000346986.5_Missense_Mutation_p.P388L	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	388	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GCCGAGGGCCCGACTCCGCAA	0.562																																																0			19											59.0	57.0	57.0					19																	56369922		2203	4300	6503	61061734	SO:0001583	missense	147945			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1163C>T	19.37:g.56369922C>T	ENSP00000301295:p.Pro388Leu	Somatic		Capture	Illumina GAIIx	4	61061734	Q86W87|Q96AY6	Missense_Mutation	SNP	superfamily_DEATH domain,HMMPfam_PAAD_DAPIN,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_NACHT,superfamily_RNI-like,HMMSmart_SM00368	p.P388L	ENST00000301295.6	37	c.1163	CCDS12936.1	19	.	.	.	.	.	.	.	.	.	.	C	14.63	2.592711	0.46214	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.83755	-1.76;-1.76	4.01	1.87	0.25490	.	.	.	.	.	D	0.86451	0.5936	M	0.67397	2.05	0.09310	N	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.95;1.0;0.999	T	0.73642	-0.3918	9	0.17832	T	0.49	.	5.778	0.18289	0.0:0.7579:0.0:0.2421	.	388;313;388	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	L	388	ENSP00000301295:P388L;ENSP00000344787:P388L	ENSP00000301295:P388L	P	+	2	0	NLRP4	61061734	0.001000	0.12720	0.004000	0.12327	0.001000	0.01503	0.208000	0.17415	1.026000	0.39733	0.655000	0.94253	CCG	-	NULL		0.562	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	protein_coding	OTTHUMT00000457367.2	C	NM_134444		61061734	+1	no_errors	NM_134444	genbank	human	validated	54_36p	missense	SNP	0.002	T
ZSCAN5A	79149	genome.wustl.edu	37	19	56734079	56734079	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:56734079T>A	ENST00000587340.1	-	6	1315	c.620A>T	c.(619-621)gAc>gTc	p.D207V	ZSCAN5A_ENST00000587492.1_Missense_Mutation_p.D61V|ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.D207V|ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.D207V|ZSCAN5A_ENST00000254165.3_Missense_Mutation_p.D90V			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	207					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ACCTGTTACGTCAATACTCTT	0.502																																																0			19											175.0	146.0	156.0					19																	56734079		2203	4300	6503	61425891	SO:0001583	missense	79149			AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.620A>T	19.37:g.56734079T>A	ENSP00000467631:p.Asp207Val	Somatic		Capture	Illumina GAIIx	4	61425891	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SCAN,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.D207V	ENST00000587340.1	37	c.620	CCDS12941.1	19	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.788273	0.00628	.	.	ENSG00000131848	ENST00000391713;ENST00000254165	T;T	0.06449	3.3;3.32	2.05	-1.67	0.08238	.	.	.	.	.	T	0.02267	0.0070	N	0.04705	-0.18	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.47724	-0.9095	9	0.13470	T	0.59	.	2.2036	0.03930	0.329:0.0:0.4167:0.2543	.	90;207	B4DX98;Q9BUG6	.;ZSA5A_HUMAN	V	207;90	ENSP00000375593:D207V;ENSP00000254165:D90V	ENSP00000254165:D90V	D	-	2	0	ZSCAN5A	61425891	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.344000	0.07780	-0.301000	0.08882	-1.222000	0.01597	GAC	-	NULL		0.502	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZSCAN5A	protein_coding	OTTHUMT00000458110.1	T	NM_024303		61425891	-1	no_errors	NM_024303	genbank	human	provisional	54_36p	missense	SNP	0.000	A
SNX1	6642	genome.wustl.edu	37	15	64428539	64428539	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr15:64428539G>A	ENST00000559844.1	+	13	1390	c.1376G>A	c.(1375-1377)cGg>cAg	p.R459Q	SNX1_ENST00000353874.4_Missense_Mutation_p.R411Q|SNX1_ENST00000261889.5_Missense_Mutation_p.R459Q|SNX1_ENST00000560829.1_Missense_Mutation_p.R241Q|SNX1_ENST00000561026.1_Missense_Mutation_p.R394Q			Q13596	SNX1_HUMAN	sorting nexin 1	459	BAR.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)	p.R459P(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						TGGGAGTCTCGGGTGACTCAA	0.428																																																1	Substitution - Missense(1)	breast(1)	15											137.0	131.0	133.0					15																	64428539		2203	4300	6503	62215592	SO:0001583	missense	6642			BC000357	CCDS32266.1, CCDS32268.1, CCDS58371.1	15q22.31	2011-05-03			ENSG00000028528	ENSG00000028528		"""Sorting nexins"""	11172	protein-coding gene	gene with protein product		601272				8638121	Standard	NM_003099		Approved	SNX1A, MGC8664, HsT17379, Vps5	uc010uio.2	Q13596		ENST00000559844.1:c.1376G>A	15.37:g.64428539G>A	ENSP00000453785:p.Arg459Gln	Somatic		Capture	Illumina GAIIx	4	62215592	A6NM19|A8K6T7|H0Y2M5|O60750|O60751|Q6ZRJ8	Missense_Mutation	SNP	HMMPfam_Sorting_nexin,superfamily_PX domain,HMMPfam_PX,HMMSmart_SM00312,HMMPfam_Vps5	p.R459Q	ENST00000559844.1	37	c.1376	CCDS32266.1	15	.	.	.	.	.	.	.	.	.	.	G	18.21	3.573565	0.65765	.	.	ENSG00000028528	ENST00000380285;ENST00000353874;ENST00000261889	T	0.39997	1.05	6.02	6.02	0.97574	Vps5 C-terminal (1);	0.103433	0.64402	D	0.000002	T	0.50922	0.1644	L	0.34521	1.04	0.46478	D	0.999068	D;P;D;D;P;D	0.61697	0.99;0.942;0.973;0.974;0.954;0.973	P;B;P;B;P;P	0.56088	0.791;0.322;0.684;0.406;0.593;0.608	T	0.48080	-0.9066	10	0.66056	D	0.02	-0.3917	19.5289	0.95219	0.0:0.0:1.0:0.0	.	459;369;459;394;411;459	Q6ZRJ8;Q59GU6;Q53GY8;Q13596-2;A6NKH4;Q13596	.;.;.;.;.;SNX1_HUMAN	Q	459;411;394	ENSP00000326668:R411Q	ENSP00000261889:R394Q	R	+	2	0	SNX1	62215592	0.998000	0.40836	1.000000	0.80357	0.910000	0.53928	2.939000	0.48995	2.865000	0.98341	0.655000	0.94253	CGG	-	HMMPfam_Vps5		0.428	SNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX1	protein_coding	OTTHUMT00000418559.1	G	NM_003099		62215592	+1	no_errors	NM_003099	genbank	human	reviewed	54_36p	missense	SNP	0.961	A
DIS3L	115752	genome.wustl.edu	37	15	66615156	66615156	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr15:66615156T>A	ENST00000319212.4	+	10	1508	c.1458T>A	c.(1456-1458)gaT>gaA	p.D486E	DIS3L_ENST00000319194.5_Missense_Mutation_p.D403E|DIS3L_ENST00000441424.2_3'UTR|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	486					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						AAGATGTGGATGACACACTCT	0.443																																																0			15											124.0	109.0	114.0					15																	66615156		2201	4299	6500	64402210	SO:0001583	missense	115752				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.1458T>A	15.37:g.66615156T>A	ENSP00000321711:p.Asp486Glu	Somatic		Capture	Illumina GAIIx	4	64402210	Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	HMMPfam_RNB,PatternScan_RIBONUCLEASE_II	p.D403E	ENST00000319212.4	37	c.1209	CCDS45286.1	15	.	.	.	.	.	.	.	.	.	.	T	24.6	4.551533	0.86127	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.77877	-1.13;-1.13	5.85	-5.28	0.02755	Ribonuclease II/R (2);	0.043614	0.85682	N	0.000000	D	0.88358	0.6415	H	0.96365	3.81	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.85848	0.1402	10	0.87932	D	0	-5.6875	8.8819	0.35380	0.0:0.4068:0.106:0.4871	.	486;352;486	Q8TF46;Q8TF46-2;Q8TF46-3	DI3L1_HUMAN;.;.	E	403;486	ENSP00000321583:D403E;ENSP00000321711:D486E	ENSP00000321583:D403E	D	+	3	2	DIS3L	64402210	0.999000	0.42202	0.402000	0.26371	0.964000	0.63967	0.586000	0.23894	-1.418000	0.02014	-0.290000	0.09829	GAT	-	HMMPfam_RNB		0.443	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	protein_coding	OTTHUMT00000382792.2	T	NM_133375		64402210	+1	no_errors	NM_133375	genbank	human	validated	54_36p	missense	SNP	0.997	A
ESRP2	80004	genome.wustl.edu	37	16	68265861	68265861	+	Silent	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr16:68265861C>G	ENST00000565858.1	-	10	1259	c.1173G>C	c.(1171-1173)ctG>ctC	p.L391L	ESRP2_ENST00000473183.2_Silent_p.L381L|RP11-96D1.11_ENST00000571197.1_RNA	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	391	RRM 2.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						GCACAAAGAGCAGCCCCTCGG	0.662																																																0			16											45.0	44.0	44.0					16																	68265861		2198	4300	6498	66823362	SO:0001819	synonymous_variant	80004			AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.1173G>C	16.37:g.68265861C>G		Somatic		Capture	Illumina GAIIx	4	66823362	Q8N6H8|Q8WZ15|Q9H6I4	Silent	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1	p.L381	ENST00000565858.1	37	c.1143		16																																																																																			-	HMMSmart_RRM,superfamily_SSF54928		0.662	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	ESRP2	protein_coding	OTTHUMT00000433083.1	C	NM_024939		66823362	-1	no_errors	NM_024939	genbank	human	validated	54_36p	silent	SNP	1.000	G
GPR142	350383	genome.wustl.edu	37	17	72365698	72365698	+	Missense_Mutation	SNP	G	G	A	rs145323799	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr17:72365698G>A	ENST00000335666.4	+	2	383	c.335G>A	c.(334-336)cGg>cAg	p.R112Q		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	112						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						AGGGAGCTGCGGGGACCCTCA	0.592													G|||	3	0.000599042	0.0008	0.0029	5008	,	,		16136	0.0		0.0	False		,,,				2504	0.0															0			17						G	GLN/ARG	3,4333		0,3,2165	47.0	38.0	41.0		335	-3.1	0.0	17	dbSNP_134	41	6,8498		0,6,4246	yes	missense	GPR142	NM_181790.1	43	0,9,6411	AA,AG,GG		0.0706,0.0692,0.0701	benign	112/463	72365698	9,12831	2168	4252	6420	69877293	SO:0001583	missense	350383			AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.335G>A	17.37:g.72365698G>A	ENSP00000335158:p.Arg112Gln	Somatic		Capture	Illumina GAIIx	4	69877293	A4CYJ8|Q86SL3	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R112Q	ENST00000335666.4	37	c.335	CCDS11698.1	17	.	.	.	.	.	.	.	.	.	.	G	17.45	3.393910	0.62066	6.92E-4	7.06E-4	ENSG00000257008	ENST00000335666	T	0.68479	-0.33	3.58	-3.08	0.05347	.	.	.	.	.	T	0.38374	0.1038	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.13953	-1.0490	9	0.39692	T	0.17	.	4.2504	0.10691	0.3907:0.0:0.4503:0.159	.	112	Q7Z601	GP142_HUMAN	Q	112	ENSP00000335158:R112Q	ENSP00000335158:R112Q	R	+	2	0	GPR142	69877293	0.000000	0.05858	0.000000	0.03702	0.864000	0.49448	-0.367000	0.07553	-0.535000	0.06307	0.556000	0.70494	CGG	-	NULL		0.592	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR142	protein_coding	OTTHUMT00000442545.1	G	NM_181790		69877293	+1	no_errors	NM_181790	genbank	human	provisional	54_36p	missense	SNP	0.000	A
MAP3K9	4293	genome.wustl.edu	37	14	71267537	71267537	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr14:71267537C>T	ENST00000554752.2	-	2	666	c.667G>A	c.(667-669)Gct>Act	p.A223T	MAP3K9_ENST00000381250.4_Missense_Mutation_p.A223T|MAP3K9_ENST00000555993.2_Missense_Mutation_p.A223T	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	223	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		CCTCCACGAGCAAACTCCATG	0.517																																					GBM(114;411 1587 13539 28235 50070)											0			14											101.0	90.0	94.0					14																	71267537		2203	4300	6503	70337290	SO:0001583	missense	4293			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.667G>A	14.37:g.71267537C>T	ENSP00000451612:p.Ala223Thr	Somatic		Capture	Illumina GAIIx	4	70337290	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_Kinase_like,HMMSmart_TyrKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.A223T	ENST00000554752.2	37	c.667		14	.	.	.	.	.	.	.	.	.	.	C	35	5.450145	0.96205	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000381250	D;D	0.89681	-2.55;-2.55	5.93	5.93	0.95920	Serine/threonine-protein kinase-like domain (1);Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96034	0.8708	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	D	0.96018	0.9007	10	0.72032	D	0.01	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	223;223	P80192;P80192-4	M3K9_HUMAN;.	T	223	ENSP00000451612:A223T;ENSP00000370649:A223T	ENSP00000005198:A223T	A	-	1	0	MAP3K9	70337290	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.691000	0.84191	2.814000	0.96858	0.655000	0.94253	GCT	-	superfamily_Kinase_like,HMMSmart_TyrKc,HMMPfam_Pkinase		0.517	MAP3K9-001	KNOWN	basic	protein_coding	MAP3K9	protein_coding	OTTHUMT00000412550.2	C			70337290	-1	no_errors	NM_033141	genbank	human	validated	54_36p	missense	SNP	1.000	T
ACRC	93953	genome.wustl.edu	37	X	70823985	70823985	+	Silent	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:70823985C>T	ENST00000373695.1	+	7	1395	c.858C>T	c.(856-858)gaC>gaT	p.D286D	ACRC_ENST00000373696.3_Silent_p.D286D			Q96QF7	ACRC_HUMAN	acidic repeat containing	286	Asp/Ser-rich.					nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					AAGCTTCCGACGACAGCAGTG	0.542																																																0			X											110.0	107.0	108.0					X																	70823985		2203	4300	6503	70740710	SO:0001819	synonymous_variant	93953			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.858C>T	X.37:g.70823985C>T		Somatic		Capture	Illumina GAIIx	4	70740710	B9EG62	Silent	SNP	HMMPfam_SprT-like,HMMSmart_SM00731	p.D286	ENST00000373695.1	37	c.858	CCDS35326.1	X																																																																																			-	NULL		0.542	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACRC	protein_coding	OTTHUMT00000081856.1	C			70740710	+1	no_errors	NM_052957	genbank	human	validated	54_36p	silent	SNP	0.003	T
LLGL2	3993	genome.wustl.edu	37	17	73569666	73569666	+	Missense_Mutation	SNP	C	C	T	rs142772898	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr17:73569666C>T	ENST00000392550.3	+	21	2947	c.2830C>T	c.(2830-2832)Cgc>Tgc	p.R944C	LLGL2_ENST00000577200.1_Missense_Mutation_p.R944C|LLGL2_ENST00000167462.5_Missense_Mutation_p.R944C	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	944					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)	p.R944C(1)		NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAAGAACCACCGCCCTGGTAA	0.652													C|||	19	0.00379393	0.0008	0.0101	5008	,	,		10236	0.0		0.0109	False		,,,				2504	0.0															1	Substitution - Missense(1)	large_intestine(1)	17						C	CYS/ARG,CYS/ARG	8,4396		0,8,2194	29.0	32.0	31.0		2830,2830	-3.2	0.0	17	dbSNP_134	31	106,8486		0,106,4190	yes	missense,missense	LLGL2	NM_001031803.1,NM_004524.2	180,180	0,114,6384	TT,TC,CC		1.2337,0.1817,0.8772	benign,benign	944/1021,944/1016	73569666	114,12882	2202	4296	6498	71081261	SO:0001583	missense	3993			X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.2830C>T	17.37:g.73569666C>T	ENSP00000376333:p.Arg944Cys	Somatic		Capture	Illumina GAIIx	4	71081261	Q14521|Q9BR62	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_LLGL,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.R944C	ENST00000392550.3	37	c.2830	CCDS32733.1	17	13	0.005952380952380952	0	0.0	4	0.011049723756906077	0	0.0	9	0.011873350923482849	C	13.42	2.232946	0.39498	0.001817	0.012337	ENSG00000073350	ENST00000167462;ENST00000392550;ENST00000545227	T;T	0.05199	3.48;3.6	5.12	-3.2	0.05156	.	1.338190	0.04967	N	0.463057	T	0.03520	0.0101	L	0.39898	1.24	0.09310	N	1	B;B;B;B;B	0.14438	0.007;0.006;0.01;0.007;0.002	B;B;B;B;B	0.08055	0.002;0.001;0.003;0.002;0.001	T	0.44997	-0.9291	10	0.54805	T	0.06	-0.8888	2.0887	0.03651	0.2011:0.4356:0.0989:0.2645	.	571;933;933;944;944	B4DVR9;B3KX47;G3V1I9;Q6P1M3-2;Q6P1M3	.;.;.;.;L2GL2_HUMAN	C	944;944;933	ENSP00000167462:R944C;ENSP00000376333:R944C	ENSP00000167462:R944C	R	+	1	0	LLGL2	71081261	0.000000	0.05858	0.000000	0.03702	0.688000	0.40055	-0.135000	0.10420	-0.354000	0.08212	0.400000	0.26472	CGC	-	NULL		0.652	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LLGL2	protein_coding	OTTHUMT00000447633.1	C	NM_004524		71081261	+1	no_errors	NM_001031803	genbank	human	reviewed	54_36p	missense	SNP	0.002	T
MUC7	4589	genome.wustl.edu	37	4	71346632	71346632	+	Silent	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr4:71346632G>A	ENST00000304887.5	+	3	361	c.171G>A	c.(169-171)ccG>ccA	p.P57P	MUC7_ENST00000456088.1_Silent_p.P57P|MUC7_ENST00000413702.1_Silent_p.P57P|MUC7_ENST00000514512.1_3'UTR	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	57					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACCAGAAGCCGTTCATTAGAA	0.458																																																0			4											176.0	172.0	174.0					4																	71346632		2203	4300	6503	71381221	SO:0001819	synonymous_variant	4589			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.171G>A	4.37:g.71346632G>A		Somatic		Capture	Illumina GAIIx	4	71381221	Q9UCD7|Q9UCD8	Silent	SNP	NULL	p.P57	ENST00000304887.5	37	c.171	CCDS3541.1	4																																																																																			-	NULL		0.458	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC7	protein_coding	OTTHUMT00000252168.2	G	NM_152291		71381221	+1	no_errors	NM_152291	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
CLEC18B	497190	genome.wustl.edu	37	16	74444758	74444758	+	Intron	SNP	T	T	C	rs200267855	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr16:74444758T>C	ENST00000339953.5	-	9	1236					NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B							extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GGGTGGGGCATCACAACCCCT	0.627																																																0			16											1.0	1.0	1.0					16																	74444758		338	930	1268	73002259	SO:0001627	intron_variant	0			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.1114+44A>G	16.37:g.74444758T>C		Somatic		Capture	Illumina GAIIx	4	73002259	B4DF90	Missense_Mutation	SNP	HMMPfam_Lectin_C,superfamily_C-type lectin-like,PatternScan_C_TYPE_LECTIN_1	p.D6G	ENST00000339953.5	37	c.17	CCDS32484.1	16																																																																																			-	NULL		0.627	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC18B	protein_coding	OTTHUMT00000434697.1	T	NM_001011880		73002259	-1	no_start_codon	ENST00000268492	ensembl	human	known	54_36p	missense	SNP	0.000	C
TRPA1	8989	genome.wustl.edu	37	8	72935340	72935340	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr8:72935340A>G	ENST00000262209.4	-	27	3368	c.3161T>C	c.(3160-3162)cTt>cCt	p.L1054P	RP11-383H13.1_ENST00000524152.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000537896.1_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	1054					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GAGAAAAGTAAGATCCTTCAG	0.378																																																0			8											84.0	75.0	78.0					8																	72935340		2203	4300	6503	73097894	SO:0001583	missense	8989			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.3161T>C	8.37:g.72935340A>G	ENSP00000262209:p.Leu1054Pro	Somatic		Capture	Illumina GAIIx	4	73097894	A6NIN6	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank,PatternScan_EF_HAND_1,HMMPfam_Ion_trans	p.L1054P	ENST00000262209.4	37	c.3161	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	A	20.6	4.016867	0.75161	.	.	ENSG00000104321	ENST00000262209	T	0.47528	0.84	5.92	5.92	0.95590	.	0.218715	0.48767	D	0.000176	T	0.61400	0.2344	M	0.70595	2.14	0.80722	D	1	D	0.54207	0.965	P	0.52909	0.713	T	0.66110	-0.6005	10	0.87932	D	0	-5.9264	16.0368	0.80635	1.0:0.0:0.0:0.0	.	1054	O75762	TRPA1_HUMAN	P	1054	ENSP00000262209:L1054P	ENSP00000262209:L1054P	L	-	2	0	TRPA1	73097894	1.000000	0.71417	0.995000	0.50966	0.873000	0.50193	7.781000	0.85668	2.270000	0.75569	0.459000	0.35465	CTT	-	NULL		0.378	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	protein_coding	OTTHUMT00000379079.2	A	NM_007332		73097894	-1	no_errors	NM_007332	genbank	human	reviewed	54_36p	missense	SNP	0.910	G
P4HA3	283208	genome.wustl.edu	37	11	74009311	74009311	+	Silent	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr11:74009311C>T	ENST00000331597.4	-	4	708	c.663G>A	c.(661-663)gaG>gaA	p.E221E	P4HA3_ENST00000427714.2_Silent_p.E221E	NM_182904.3	NP_878907.1	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha polypeptide III	221						endoplasmic reticulum (GO:0005783)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			NS(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(1)	15	Breast(11;2.31e-05)					TTGCCTCATCCTCTGTCTTCC	0.473																																																0			11											115.0	101.0	106.0					11																	74009311		2200	4293	6493	73686959	SO:0001819	synonymous_variant	283208			AY327887	CCDS8230.1, CCDS73347.1	11q13	2008-12-09	2008-12-09			ENSG00000149380			30135	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(III)"""	608987	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III"""			14500733	Standard	XM_005273924		Approved	C-P4Halpha(III)	uc001ouz.3	Q7Z4N8		ENST00000331597.4:c.663G>A	11.37:g.74009311C>T		Somatic		Capture	Illumina GAIIx	4	73686959	A0AV13|B4DUD3|Q5EBL3|Q5JPA9	Silent	SNP	HMMPfam_P4Ha_N,superfamily_TPR-like,HMMSmart_SM00702,HMMPfam_2OG-FeII_Oxy	p.E221	ENST00000331597.4	37	c.663	CCDS8230.1	11																																																																																			-	superfamily_TPR-like		0.473	P4HA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HA3	protein_coding	OTTHUMT00000382988.1	C	NM_182904		73686959	-1	no_errors	NM_182904	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
KIAA2022	340533	genome.wustl.edu	37	X	73960161	73960161	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:73960161C>G	ENST00000055682.6	-	3	4842	c.4231G>C	c.(4231-4233)Ggt>Cgt	p.G1411R		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1411					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTTGCACGACCAGGATCACCT	0.438																																																0			X											215.0	173.0	187.0					X																	73960161		2203	4300	6503	73876886	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4231G>C	X.37:g.73960161C>G	ENSP00000055682:p.Gly1411Arg	Somatic		Capture	Illumina GAIIx	4	73876886	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.G1411R	ENST00000055682.6	37	c.4231	CCDS35337.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.42|13.42	2.232069|2.232069	0.39399|0.39399	.|.	.|.	ENSG00000050030|ENSG00000050030	ENST00000373468;ENST00000055682|ENST00000424929	T;T|.	0.31510|.	1.49;1.49|.	5.36|5.36	3.59|3.59	0.41128|0.41128	.|.	0.274686|.	0.34676|.	N|.	0.003763|.	T|T	0.38506|0.38506	0.1043|0.1043	L|L	0.29908|0.29908	0.895|0.895	0.33596|0.33596	D|D	0.601737|0.601737	P|.	0.49783|.	0.928|.	P|.	0.51385|.	0.668|.	T|T	0.46652|0.46652	-0.9176|-0.9176	10|5	0.87932|.	D|.	0|.	-4.2263|-4.2263	8.5644|8.5644	0.33531|0.33531	0.0:0.7575:0.0:0.2425|0.0:0.7575:0.0:0.2425	.|.	1411|.	Q5QGS0|.	K2022_HUMAN|.	R|S	1411|12	ENSP00000362567:G1411R;ENSP00000055682:G1411R|.	ENSP00000055682:G1411R|.	G|W	-|-	1|2	0|0	KIAA2022|KIAA2022	73876886|73876886	0.306000|0.306000	0.24490|0.24490	0.747000|0.747000	0.31113|0.31113	0.889000|0.889000	0.51656|0.51656	0.078000|0.078000	0.14761|0.14761	0.462000|0.462000	0.27095|0.27095	0.544000|0.544000	0.68410|0.68410	GGT|TGG	-	NULL		0.438	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	protein_coding	OTTHUMT00000057270.2	C	NM_001008537		73876886	-1	no_errors	NM_001008537	genbank	human	validated	54_36p	missense	SNP	0.979	G
CD109	135228	genome.wustl.edu	37	6	74517956	74517956	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr6:74517956A>G	ENST00000287097.5	+	26	3452	c.3340A>G	c.(3340-3342)Aga>Gga	p.R1114G	CD109_ENST00000437994.2_Missense_Mutation_p.R1114G|CD109_ENST00000422508.2_Missense_Mutation_p.R1037G			Q6YHK3	CD109_HUMAN	CD109 molecule	1114					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)	p.R1114R(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCTGACTTGGAGAGCAGAACA	0.373																																																1	Substitution - coding silent(1)	ovary(1)	6											94.0	95.0	95.0					6																	74517956		2203	4300	6503	74574677	SO:0001583	missense	135228			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.3340A>G	6.37:g.74517956A>G	ENSP00000287097:p.Arg1114Gly	Somatic		Capture	Illumina GAIIx	4	74574677	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	HMMPfam_A2M_N,HMMPfam_A2M_N_2,HMMPfam_A2M,superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_Thiol-ester_cl,PatternScan_ALPHA_2_MACROGLOBULIN,HMMPfam_A2M_comp,superfamily_Alpha-macroglobulin receptor domain,HMMPfam_A2M_recep	p.R1114G	ENST00000287097.5	37	c.3340	CCDS4982.1	6	.	.	.	.	.	.	.	.	.	.	A	10.56	1.384548	0.25031	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.38240	1.15;1.15;1.15	4.69	3.5	0.40072	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.455547	0.26089	N	0.026408	T	0.23806	0.0576	M	0.69523	2.12	0.41187	D	0.986274	B;B;B	0.23591	0.088;0.03;0.007	B;B;B	0.31337	0.128;0.06;0.078	T	0.05484	-1.0882	10	0.37606	T	0.19	.	11.076	0.48032	0.7949:0.2051:0.0:0.0	.	1037;1114;1114	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	G	1114;1037;1114	ENSP00000388062:R1114G;ENSP00000404475:R1037G;ENSP00000287097:R1114G	ENSP00000287097:R1114G	R	+	1	2	CD109	74574677	1.000000	0.71417	0.916000	0.36221	0.243000	0.25628	2.946000	0.49050	0.759000	0.33084	0.533000	0.62120	AGA	-	superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_A2M_comp		0.373	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	protein_coding	OTTHUMT00000041230.3	A	NM_133493		74574677	+1	no_errors	NM_133493	genbank	human	validated	54_36p	missense	SNP	0.996	G
CRISPLD1	83690	genome.wustl.edu	37	8	75941627	75941627	+	Silent	SNP	C	C	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr8:75941627C>A	ENST00000262207.4	+	14	1794	c.1326C>A	c.(1324-1326)tcC>tcA	p.S442S	CRISPLD1_ENST00000523524.1_Silent_p.S254S|CRISPLD1_ENST00000517786.1_Silent_p.S256S|RP11-300E4.2_ENST00000520778.1_RNA	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	442	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CTCAGCTGTCCAGTATCTGCA	0.423																																																0			8											85.0	76.0	79.0					8																	75941627		2203	4300	6503	76104182	SO:0001819	synonymous_variant	83690			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.1326C>A	8.37:g.75941627C>A		Somatic		Capture	Illumina GAIIx	4	76104182	B2RA60|B7Z929	Silent	SNP	superfamily_PR-1-like,HMMSmart_SM00198,HMMPfam_SCP,PatternScan_CRISP_2,superfamily_LCCL domain,HMMSmart_SM00603,HMMPfam_LCCL	p.S442	ENST00000262207.4	37	c.1326	CCDS6219.1	8																																																																																			-	superfamily_LCCL domain,HMMSmart_SM00603,HMMPfam_LCCL		0.423	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	protein_coding	OTTHUMT00000379117.1	C	NM_031461		76104182	+1	no_errors	NM_031461	genbank	human	validated	54_36p	silent	SNP	0.997	A
LRRIQ1	84125	genome.wustl.edu	37	12	85438509	85438509	+	Silent	SNP	A	A	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr12:85438509A>G	ENST00000393217.2	+	4	319	c.258A>G	c.(256-258)ggA>ggG	p.G86G		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	86										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GTAGTTATGGAGCAGTTTCTA	0.274																																																0			12											57.0	62.0	60.0					12																	85438509		2190	4244	6434	83962640	SO:0001819	synonymous_variant	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.258A>G	12.37:g.85438509A>G		Somatic		Capture	Illumina GAIIx	4	83962640	Q567P4|Q9BS17|Q9HA36	Silent	SNP	superfamily_RNI-like,HMMSmart_SM00015,HMMPfam_LRR_1,HMMSmart_SM00369,HMMPfam_IQ,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G86	ENST00000393217.2	37	c.258	CCDS41816.1	12																																																																																			-	NULL		0.274	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	protein_coding	OTTHUMT00000388249.2	A	NM_032165		83962640	+1	no_errors	NM_001079910	genbank	human	validated	54_36p	silent	SNP	0.020	G
SNAP91	9892	genome.wustl.edu	37	6	84270652	84270652	+	Silent	SNP	A	A	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr6:84270652A>T	ENST00000439399.2	-	27	2773	c.2457T>A	c.(2455-2457)ccT>ccA	p.P819P	SNAP91_ENST00000521485.1_Silent_p.P814P|SNAP91_ENST00000369694.2_Silent_p.P819P|SNAP91_ENST00000521743.1_Silent_p.P819P|SNAP91_ENST00000437520.1_Silent_p.P512P|SNAP91_ENST00000428679.2_Silent_p.P819P|SNAP91_ENST00000195649.6_Silent_p.P814P|SNAP91_ENST00000520302.1_Silent_p.P789P|SNAP91_ENST00000520213.1_Silent_p.P512P	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	819	Pro-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		AACTGGTTGGAGGTACAGCTC	0.423																																																0			6											45.0	45.0	45.0					6																	84270652		1946	4153	6099	84327371	SO:0001819	synonymous_variant	9892			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2457T>A	6.37:g.84270652A>T		Somatic		Capture	Illumina GAIIx	4	84327371	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Silent	SNP	superfamily_ENTH/VHS domain,HMMPfam_ANTH,HMMSmart_SM00273,superfamily_GAT-like domain	p.P819	ENST00000439399.2	37	c.2457	CCDS47455.1	6																																																																																			-	NULL		0.423	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	protein_coding	OTTHUMT00000375296.1	A			84327371	-1	no_errors	NM_014841	genbank	human	validated	54_36p	silent	SNP	1.000	T
NTRK2	4915	genome.wustl.edu	37	9	87342578	87342578	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr9:87342578C>T	ENST00000323115.4	+	8	1216	c.863C>T	c.(862-864)aCt>aTt	p.T288I	NTRK2_ENST00000376214.1_Missense_Mutation_p.T288I|NTRK2_ENST00000395882.1_Missense_Mutation_p.T288I|NTRK2_ENST00000359847.3_Missense_Mutation_p.T288I|NTRK2_ENST00000277120.3_Missense_Mutation_p.T288I|NTRK2_ENST00000376213.1_Missense_Mutation_p.T288I|NTRK2_ENST00000376208.1_Missense_Mutation_p.T288I|NTRK2_ENST00000395866.2_Missense_Mutation_p.T132I|NTRK2_ENST00000304053.6_Missense_Mutation_p.T288I			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	288					activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	GTTGCACCAACTATCACATTT	0.438										TSP Lung(25;0.17)																																						0			9											63.0	62.0	62.0					9																	87342578		2203	4300	6503	86532398	SO:0001583	missense	4915			AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.863C>T	9.37:g.87342578C>T	ENSP00000314586:p.Thr288Ile	Somatic		Capture	Illumina GAIIx	4	86532398	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRRNT,HMMSmart_LRRNT,HMMPfam_LRR_1,HMMSmart_LRRCT,HMMPfam_I-set,superfamily_SSF48726,HMMSmart_IGc2,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,PatternScan_RECEPTOR_TYR_KIN_II	p.T288I	ENST00000323115.4	37	c.863	CCDS35050.1	9	.	.	.	.	.	.	.	.	.	.	C	11.73	1.725493	0.30593	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	T;T;T;T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55;0.55	6.01	6.01	0.97437	.	0.104814	0.64402	D	0.000004	T	0.43322	0.1242	L	0.33710	1.025	0.31081	N	0.711907	B;B;B;B;B;B;B	0.33044	0.076;0.395;0.395;0.043;0.262;0.38;0.354	B;B;B;B;B;B;B	0.37888	0.031;0.191;0.191;0.041;0.133;0.26;0.044	T	0.53099	-0.8486	10	0.49607	T	0.09	.	8.3814	0.32474	0.1944:0.7291:0.0:0.0765	.	132;288;288;288;288;288;334	B4DFV9;Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1	.;.;.;.;NTRK2_HUMAN;.;.	I	288;288;288;288;288;288;288;288;132	ENSP00000365387:T288I;ENSP00000365386:T288I;ENSP00000379221:T288I;ENSP00000365381:T288I;ENSP00000306167:T288I;ENSP00000277120:T288I;ENSP00000314586:T288I;ENSP00000352906:T288I;ENSP00000379207:T132I	ENSP00000277120:T288I	T	+	2	0	NTRK2	86532398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.327000	0.43858	2.855000	0.98099	0.585000	0.79938	ACT	-	superfamily_SSF48726		0.438	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	protein_coding	OTTHUMT00000052882.1	C			86532398	+1	no_errors	NM_006180	genbank	human	reviewed	54_36p	missense	SNP	0.993	T
ATP6V0D2	245972	genome.wustl.edu	37	8	87162412	87162412	+	Silent	SNP	A	A	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr8:87162412A>G	ENST00000285393.3	+	6	853	c.711A>G	c.(709-711)cgA>cgG	p.R237R	CTD-3118D11.2_ENST00000522679.1_RNA	NM_152565.1	NP_689778.1	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2	237					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen ion transmembrane transporter activity (GO:0015078)			breast(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|prostate(1)	27						AAGAAGACCGAGAGACCCTCT	0.458																																																0			8											107.0	99.0	102.0					8																	87162412		2203	4300	6503	87231528	SO:0001819	synonymous_variant	245972			AY079172	CCDS6241.1	8q21.3	2014-01-28	2006-01-20	2002-05-24	ENSG00000147614	ENSG00000147614		"""ATPases / V-type"""	18266	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 38kD, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2"""			12384298	Standard	NM_152565		Approved	FLJ38708, VMA6, ATP6D2	uc003ydp.1	Q8N8Y2	OTTHUMG00000163637	ENST00000285393.3:c.711A>G	8.37:g.87162412A>G		Somatic		Capture	Illumina GAIIx	4	87231528		Silent	SNP	superfamily_ATPase_V0/A0_c/d,HMMPfam_vATP-synt_AC39	p.R237	ENST00000285393.3	37	c.711	CCDS6241.1	8																																																																																			-	superfamily_ATPase_V0/A0_c/d,HMMPfam_vATP-synt_AC39		0.458	ATP6V0D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0D2	protein_coding	OTTHUMT00000374651.1	A	NM_152565		87231528	+1	no_errors	NM_152565	genbank	human	validated	54_36p	silent	SNP	1.000	G
MESP2	145873	genome.wustl.edu	37	15	90320119	90320119	+	Silent	SNP	G	G	A	rs75049807	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr15:90320119G>A	ENST00000341735.3	+	1	531	c.531G>A	c.(529-531)gcG>gcA	p.A177A	MESP2_ENST00000560219.1_Intron|MESP2_ENST00000558723.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	177					mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			AGACGCaggcggaggggcagg	0.776													G|||	171	0.0341454	0.0098	0.0288	5008	,	,		11569	0.0556		0.0388	False		,,,				2504	0.044															0			15						G		36,2618		0,36,1291	3.0	3.0	3.0		531	1.2	0.0	15	dbSNP_131	3	296,6132		2,292,2920	no	coding-synonymous	MESP2	NM_001039958.1		2,328,4211	AA,AG,GG		4.6049,1.3564,3.6556		177/398	90320119	332,8750	1327	3214	4541	88121123	SO:0001819	synonymous_variant	145873				CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.531G>A	15.37:g.90320119G>A		Somatic		Capture	Illumina GAIIx	4	88121123	Q7RTU2	Silent	SNP	superfamily_HLH helix-loop-helix DNA-binding domain,HMMPfam_HLH,HMMSmart_SM00353	p.A177	ENST00000341735.3	37	c.531	CCDS42078.1	15																																																																																			-	NULL		0.776	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MESP2	protein_coding	OTTHUMT00000416421.1	G	XM_085261		88121123	+1	no_errors	NM_001039958	genbank	human	reviewed	54_36p	silent	SNP	0.865	A
RNGTT	8732	genome.wustl.edu	37	6	89554087	89554087	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr6:89554087T>G	ENST00000369485.4	-	11	1444	c.1258A>C	c.(1258-1260)Act>Cct	p.T420P	RNGTT_ENST00000369475.3_Missense_Mutation_p.T420P|RNGTT_ENST00000265607.6_Missense_Mutation_p.T420P|RNGTT_ENST00000538899.1_Missense_Mutation_p.T360P	NM_003800.3	NP_003791.3	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase	420	GTase.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA processing (GO:0006396)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|mRNA guanylyltransferase activity (GO:0004484)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA guanylyltransferase activity (GO:0008192)|triphosphatase activity (GO:0050355)			endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	21		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		TTTCTTGAAGTACAGATGTCA	0.328																																																0			6											106.0	107.0	106.0					6																	89554087		2202	4300	6502	89610806	SO:0001583	missense	8732			AF025654	CCDS5017.1	6q16	2011-06-09			ENSG00000111880	ENSG00000111880	2.7.7.50	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	10073	protein-coding gene	gene with protein product		603512				9828141, 9512541	Standard	NM_001286428		Approved	HCE, HCE1, hCAP	uc003pmr.2	O60942	OTTHUMG00000015190	ENST00000369485.4:c.1258A>C	6.37:g.89554087T>G	ENSP00000358497:p.Thr420Pro	Somatic		Capture	Illumina GAIIx	4	89610806	E1P513|E1P514|O43483|O60257|O60351|Q5TCW8|Q8WUM8	Missense_Mutation	SNP	superfamily_(Phosphotyrosine protein) phosphatases II,HMMPfam_DSPc,PatternScan_TYR_PHOSPHATASE_1,superfamily_DNA ligase/mRNA capping enzyme catalytic domain,HMMPfam_mRNA_cap_enzyme,HMMPfam_mRNA_cap_C,superfamily_Nucleic acid-binding proteins	p.T420P	ENST00000369485.4	37	c.1258	CCDS5017.1	6	.	.	.	.	.	.	.	.	.	.	T	10.80	1.452955	0.26161	.	.	ENSG00000111880	ENST00000369485;ENST00000265607;ENST00000538899;ENST00000536746;ENST00000369475	D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88	5.7	0.845	0.18950	mRNA capping enzyme (1);	0.299519	0.41500	D	0.000866	T	0.71533	0.3351	L	0.60455	1.87	0.24833	N	0.99252	B;B;B;B	0.27765	0.097;0.188;0.045;0.051	B;P;B;B	0.45138	0.061;0.471;0.05;0.351	T	0.64647	-0.6358	10	0.02654	T	1	.	10.2938	0.43612	0.0:0.5276:0.0:0.4724	.	360;420;420;420	B4DSJ8;Q5TCW7;O60942-2;O60942	.;.;.;MCE1_HUMAN	P	420;420;360;391;420	ENSP00000358497:T420P;ENSP00000265607:T420P;ENSP00000442609:T360P;ENSP00000358487:T420P	ENSP00000265607:T420P	T	-	1	0	RNGTT	89610806	0.998000	0.40836	0.147000	0.22382	0.307000	0.27823	0.959000	0.29240	0.131000	0.18576	0.460000	0.39030	ACT	-	superfamily_DNA ligase/mRNA capping enzyme catalytic domain,HMMPfam_mRNA_cap_enzyme		0.328	RNGTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNGTT	protein_coding	OTTHUMT00000041469.1	T			89610806	-1	no_errors	NM_003800	genbank	human	validated	54_36p	missense	SNP	0.999	G
SV2B	9899	genome.wustl.edu	37	15	91811786	91811786	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr15:91811786T>C	ENST00000394232.1	+	9	1794	c.1324T>C	c.(1324-1326)Ttc>Ctc	p.F442L	SV2B_ENST00000545111.2_Missense_Mutation_p.F291L|SV2B_ENST00000330276.4_Missense_Mutation_p.F442L	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	442					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			CACAATCAACTTCACGATGGA	0.433																																																0			15											133.0	130.0	131.0					15																	91811786		2198	4298	6496	89612790	SO:0001583	missense	9899			AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.1324T>C	15.37:g.91811786T>C	ENSP00000377779:p.Phe442Leu	Somatic		Capture	Illumina GAIIx	4	89612790	B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.F442L	ENST00000394232.1	37	c.1324	CCDS10370.1	15	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735636	0.69189	.	.	ENSG00000185518	ENST00000545111;ENST00000394232;ENST00000330276	T;T;T	0.38240	1.15;1.15;1.15	5.35	5.35	0.76521	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.35278	0.0926	L	0.59436	1.845	0.80722	D	1	P	0.35456	0.502	B	0.34722	0.188	T	0.11494	-1.0585	10	0.23302	T	0.38	-26.7181	14.4534	0.67401	0.0:0.0:0.0:1.0	.	442	Q7L1I2	SV2B_HUMAN	L	291;442;442	ENSP00000443243:F291L;ENSP00000377779:F442L;ENSP00000332818:F442L	ENSP00000332818:F442L	F	+	1	0	SV2B	89612790	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.747000	0.85070	2.140000	0.66376	0.533000	0.62120	TTC	-	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1		0.433	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2B	protein_coding	OTTHUMT00000313494.3	T	NM_014848		89612790	+1	no_errors	NM_014848	genbank	human	validated	54_36p	missense	SNP	1.000	C
SEMA4D	10507	genome.wustl.edu	37	9	92020511	92020511	+	5'UTR	SNP	C	C	G	rs78280708	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr9:92020511C>G	ENST00000450295.1	-	0	637				SEMA4D_ENST00000343780.4_5'UTR|SEMA4D_ENST00000356444.2_5'UTR|SEMA4D_ENST00000420987.1_5'UTR|SEMA4D_ENST00000339861.4_5'UTR|SEMA4D_ENST00000422704.2_5'UTR|SEMA4D_ENST00000438547.2_5'UTR|SEMA4D_ENST00000455551.2_5'UTR			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						ACAGCGCGGTCCCTGAGAATC	0.612													C|||	208	0.0415335	0.0431	0.0533	5008	,	,		18322	0.0		0.0686	False		,,,				2504	0.046															0			9																																								91210331	SO:0001623	5_prime_UTR_variant	0			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.-140G>C	9.37:g.92020511C>G		Somatic		Capture	Illumina GAIIx	4	91210331	B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	NULL	p.D129H	ENST00000450295.1	37	c.385	CCDS6685.1	9																																																																																			-	NULL		0.612	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100133304	protein_coding	OTTHUMT00000342411.1	C	NM_006378		91210331	-1	no_errors	XM_001716330	genbank	human	model	54_36p	missense	SNP	0.000	G
COL1A2	1278	genome.wustl.edu	37	7	94047844	94047844	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr7:94047844C>A	ENST00000297268.6	+	33	2476	c.2005C>A	c.(2005-2007)Cct>Act	p.P669T		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	669					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	AATTGGTAACCCTGGCAGAGA	0.338										HNSCC(75;0.22)																																						0			7											177.0	172.0	174.0					7																	94047844		2203	4300	6503	93885780	SO:0001583	missense	1278			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2005C>A	7.37:g.94047844C>A	ENSP00000297268:p.Pro669Thr	Somatic		Capture	Illumina GAIIx	4	93885780	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	HMMPfam_Collagen,HMMSmart_SM00038,HMMPfam_COLFI	p.P669T	ENST00000297268.6	37	c.2005	CCDS34682.1	7	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880569	0.33255	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.96651	-4.08	5.85	-3.47	0.04753	.	0.858971	0.10553	N	0.661259	D	0.93517	0.7931	L	0.51422	1.61	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.80926	-0.1164	10	0.38643	T	0.18	.	15.6664	0.77234	0.7355:0.2084:0.0:0.0561	.	669	P08123	CO1A2_HUMAN	T	669;670	ENSP00000297268:P669T	ENSP00000297268:P669T	P	+	1	0	COL1A2	93885780	0.000000	0.05858	0.009000	0.14445	0.958000	0.62258	-1.152000	0.03172	-0.786000	0.04516	-0.182000	0.12963	CCT	-	HMMPfam_Collagen		0.338	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	protein_coding	OTTHUMT00000309045.2	C	NM_000089		93885780	+1	no_errors	NM_000089	genbank	human	reviewed	54_36p	missense	SNP	0.027	A
RPA4	29935	genome.wustl.edu	37	X	96139557	96139557	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:96139557C>T	ENST00000373040.3	+	1	651	c.248C>T	c.(247-249)gCa>gTa	p.A83V	DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000373061.3_Intron|DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000373054.4_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	83					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						ATCAGAGGGGCAGAGAAGGCT	0.468								Other identified genes with known or suspected DNA repair function																																								0			X											97.0	85.0	89.0					X																	96139557		2203	4300	6503	96026213	SO:0001583	missense	29935			U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.248C>T	X.37:g.96139557C>T	ENSP00000362131:p.Ala83Val	Somatic		Capture	Illumina GAIIx	4	96026213	Q3SY03	Missense_Mutation	SNP	superfamily_Nucleic_acid_OB,HMMPfam_tRNA_anti,HMMPfam_RPA_C,superfamily_SSF46785	p.A83V	ENST00000373040.3	37	c.248	CCDS35345.1	X	.	.	.	.	.	.	.	.	.	.	C	13.20	2.165379	0.38217	.	.	ENSG00000204086	ENST00000373040	T	0.19250	2.16	3.66	-2.48	0.06423	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	.	.	.	.	T	0.07143	0.0181	N	0.11313	0.125	0.09310	N	1	B	0.34313	0.448	B	0.23716	0.048	T	0.25398	-1.0133	9	0.30854	T	0.27	-13.0981	3.1746	0.06564	0.3193:0.2552:0.0:0.4256	.	83	Q13156	RFA4_HUMAN	V	83	ENSP00000362131:A83V	ENSP00000362131:A83V	A	+	2	0	RPA4	96026213	0.493000	0.26035	0.000000	0.03702	0.112000	0.19704	-0.012000	0.12699	-0.873000	0.04032	0.600000	0.82982	GCA	-	superfamily_Nucleic_acid_OB,HMMPfam_tRNA_anti		0.468	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA4	protein_coding	OTTHUMT00000057464.1	C	NM_013347		96026213	+1	no_errors	NM_013347	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
AGL	178	genome.wustl.edu	37	1	100346734	100346734	+	Splice_Site	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:100346734G>C	ENST00000294724.4	+	15	2479		c.e15+1		AGL_ENST00000361915.3_Splice_Site|AGL_ENST00000361302.3_Splice_Site|AGL_ENST00000370165.3_Splice_Site|AGL_ENST00000370161.2_Splice_Site|AGL_ENST00000361522.4_Splice_Site|AGL_ENST00000370163.3_Splice_Site	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GCCTCATCAGGTTTGTTTATA	0.333																																																0			1											142.0	131.0	135.0					1																	100346734		2203	4300	6503	100119322	SO:0001630	splice_region_variant	178			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2001+1G>C	1.37:g.100346734G>C		Somatic		Capture	Illumina GAIIx	4	100119322	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Splice_Site	SNP	-	e14+1	ENST00000294724.4	37	c.2001+1	CCDS759.1	1	.	.	.	.	.	.	.	.	.	.	G	18.33	3.599449	0.66332	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	.	.	.	6.01	6.01	0.97437	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1245	0.97974	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AGL	100119322	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	9.239000	0.95389	2.850000	0.98022	0.655000	0.94253	.	-	-		0.333	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGL	protein_coding	OTTHUMT00000029778.1	G	NM_000028	Intron	100119322	+1	no_errors	NM_000028	genbank	human	validated	54_36p	splice_site	SNP	1.000	C
DYNC1H1	1778	genome.wustl.edu	37	14	102499420	102499420	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr14:102499420G>C	ENST00000360184.4	+	53	10262	c.10098G>C	c.(10096-10098)aaG>aaC	p.K3366N	DYNC1H1_ENST00000556791.1_3'UTR	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3366	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TAAGGGAGAAGATGAAGAAAA	0.398																																																0			14											97.0	93.0	94.0					14																	102499420		2203	4300	6503	101569173	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10098G>C	14.37:g.102499420G>C	ENSP00000348965:p.Lys3366Asn	Somatic		Capture	Illumina GAIIx	4	101569173	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.K3366N	ENST00000360184.4	37	c.10098	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	15.51	2.854760	0.51376	.	.	ENSG00000197102	ENST00000360184	T	0.74106	-0.81	5.36	4.46	0.54185	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	T	0.76983	0.4064	M	0.81942	2.565	0.80722	D	1	P	0.43431	0.807	P	0.45099	0.469	T	0.75119	-0.3430	10	0.24483	T	0.36	.	12.4306	0.55571	0.1416:0.0:0.8584:0.0	.	3366	Q14204	DYHC1_HUMAN	N	3366	ENSP00000348965:K3366N	ENSP00000348965:K3366N	K	+	3	2	DYNC1H1	101569173	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.902000	0.48703	1.259000	0.44117	0.467000	0.42956	AAG	-	NULL		0.398	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	G	NM_001376		101569173	+1	no_errors	NM_001376	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
DYNC2H1	79659	genome.wustl.edu	37	11	103153793	103153793	+	Silent	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr11:103153793C>T	ENST00000375735.2	+	73	11013	c.10869C>T	c.(10867-10869)agC>agT	p.S3623S	DYNC2H1_ENST00000398093.3_Silent_p.S3630S|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3623					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AGGAACGAAGCTGGGCCGTGG	0.343																																																0			11											75.0	76.0	76.0					11																	103153793		1857	4084	5941	102659003	SO:0001819	synonymous_variant	79659			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10869C>T	11.37:g.103153793C>T		Somatic		Capture	Illumina GAIIx	4	102659003	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Silent	SNP	HMMPfam_DHC_N1,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,HMMPfam_Dynein_heavy	p.S3630	ENST00000375735.2	37	c.10890	CCDS53701.1	11																																																																																			-	HMMPfam_Dynein_heavy		0.343	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	protein_coding	OTTHUMT00000387196.1	C	XM_370652		102659003	+1	no_errors	NM_001080463	genbank	human	provisional	54_36p	silent	SNP	0.998	T
COL11A1	1301	genome.wustl.edu	37	1	103345264	103345264	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:103345264A>C	ENST00000370096.3	-	66	5561	c.5249T>G	c.(5248-5250)aTc>aGc	p.I1750S	COL11A1_ENST00000353414.4_Missense_Mutation_p.I1711S|COL11A1_ENST00000358392.2_Missense_Mutation_p.I1762S|COL11A1_ENST00000512756.1_Missense_Mutation_p.I1634S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1750	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CAGTGTTTTGATAAAAGGATT	0.448																																																0			1											139.0	129.0	132.0					1																	103345264		2203	4300	6503	103117852	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.5249T>G	1.37:g.103345264A>C	ENSP00000359114:p.Ile1750Ser	Somatic		Capture	Illumina GAIIx	4	103117852	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	HMMSmart_TSPN,superfamily_ConA_like_lec_gl,HMMSmart_LamG,HMMPfam_Laminin_G_2,HMMPfam_Collagen,HMMSmart_COLFI,HMMPfam_COLFI	p.I1762S	ENST00000370096.3	37	c.5285	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	A	19.98	3.927017	0.73327	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	5.52	5.52	0.82312	Fibrillar collagen, C-terminal (4);	0.157285	0.56097	D	0.000028	T	0.71392	0.3334	M	0.74258	2.255	0.80722	D	1	B;B;B;B;B	0.31459	0.117;0.277;0.277;0.324;0.13	B;B;B;B;B	0.38225	0.211;0.175;0.175;0.268;0.125	T	0.76288	-0.3014	10	0.72032	D	0.01	.	15.9209	0.79570	1.0:0.0:0.0:0.0	.	1634;1711;1762;1750;970	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	S	1750;1762;1711;970;1634	ENSP00000359114:I1750S;ENSP00000351163:I1762S;ENSP00000302551:I1711S;ENSP00000426533:I1634S	ENSP00000302551:I1711S	I	-	2	0	COL11A1	103117852	1.000000	0.71417	1.000000	0.80357	0.593000	0.36681	9.283000	0.95860	2.217000	0.71921	0.482000	0.46254	ATC	-	HMMSmart_COLFI,HMMPfam_COLFI		0.448	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	protein_coding	OTTHUMT00000029997.1	A	NM_080630		103117852	-1	no_errors	NM_080629	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
UBR5	51366	genome.wustl.edu	37	8	103298812	103298812	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr8:103298812T>C	ENST00000520539.1	-	38	5597	c.4991A>G	c.(4990-4992)gAt>gGt	p.D1664G	UBR5_ENST00000521922.1_Missense_Mutation_p.D1658G|UBR5_ENST00000220959.4_Missense_Mutation_p.D1664G|UBR5_ENST00000519528.1_5'Flank	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1664					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TTGAGAATCATCTTCAGAAAA	0.348																																					Ovarian(131;96 1741 5634 7352 27489)											0			8											84.0	78.0	80.0					8																	103298812		2203	4300	6503	103367988	SO:0001583	missense	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.4991A>G	8.37:g.103298812T>C	ENSP00000429084:p.Asp1664Gly	Somatic		Capture	Illumina GAIIx	4	103367988	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	HMMPfam_zf-UBR,HMMSmart_ZnF_UBR1,superfamily_HECT,superfamily_PABP_HYD,HMMPfam_PABP,HMMSmart_PolyA,HMMSmart_HECTc,HMMPfam_HECT	p.D1664G	ENST00000520539.1	37	c.4991	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	T	19.34	3.809546	0.70797	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.54479	0.58;0.58;0.57	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.66005	0.2746	L	0.42245	1.32	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.70935	0.971;0.971	T	0.68191	-0.5474	10	0.72032	D	0.01	.	16.243	0.82426	0.0:0.0:0.0:1.0	.	1658;1664	E7EMW7;O95071	.;UBR5_HUMAN	G	1664;1664;1658	ENSP00000429084:D1664G;ENSP00000220959:D1664G;ENSP00000427819:D1658G	ENSP00000220959:D1664G	D	-	2	0	UBR5	103367988	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.991000	0.88244	2.238000	0.73509	0.533000	0.62120	GAT	-	NULL		0.348	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	protein_coding	OTTHUMT00000380075.2	T	NM_015902		103367988	-1	no_errors	NM_015902	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
SLC9B1	150159	genome.wustl.edu	37	4	103867939	103867939	+	Silent	SNP	T	T	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr4:103867939T>C	ENST00000296422.7	-	5	531	c.390A>G	c.(388-390)ttA>ttG	p.L130L	SLC9B1_ENST00000394789.3_Silent_p.L130L	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	130					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										AACCAGCCAGTAACATCCCTT	0.333																																																0			4											49.0	49.0	49.0					4																	103867939		2202	4297	6499	104087388	SO:0001819	synonymous_variant	150159			AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.390A>G	4.37:g.103867939T>C		Somatic		Capture	Illumina GAIIx	4	104087388	A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Silent	SNP	HMMPfam_Na_H_Exchanger	p.L130	ENST00000296422.7	37	c.390	CCDS34041.1	4																																																																																			-	HMMPfam_Na_H_Exchanger		0.333	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHEDC1	protein_coding	OTTHUMT00000363841.1	T	NM_139173		104087388	-1	no_errors	NM_139173	genbank	human	reviewed	54_36p	silent	SNP	1.000	C
TEX13A	56157	genome.wustl.edu	37	X	104464723	104464723	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:104464723G>A	ENST00000413579.1	-	2	470	c.359C>T	c.(358-360)aCg>aTg	p.T120M	TEX13A_ENST00000372578.3_Missense_Mutation_p.T120M|IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372575.1_Missense_Mutation_p.T120M|IL1RAPL2_ENST00000344799.4_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	120							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						CTTGCGTTCCGTCTCCTGCTG	0.612																																																0			X											36.0	36.0	36.0					X																	104464723		2157	4235	6392	104351379	SO:0001583	missense	56157			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.359C>T	X.37:g.104464723G>A	ENSP00000399753:p.Thr120Met	Somatic		Capture	Illumina GAIIx	4	104351379	B1B1G8|Q32NB6	Missense_Mutation	SNP	superfamily_Znf265 first zinc-finger domain,HMMPfam_zf-RanBP,PatternScan_ZF_RANBP2_1	p.T120M	ENST00000413579.1	37	c.359		X	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.272780	0.00257	.	.	ENSG00000133149	ENST00000372578;ENST00000372575;ENST00000413579	.	.	.	2.84	0.362	0.16113	.	1.169440	0.06546	N	0.744169	T	0.18593	0.0446	.	.	.	0.09310	N	1	B;B	0.19935	0.04;0.04	B;B	0.06405	0.002;0.002	T	0.22452	-1.0216	8	0.22706	T	0.39	.	1.9493	0.03363	0.5682:0.0:0.1623:0.2695	.	120;120	C9JWK0;Q9BXU3	.;TX13A_HUMAN	M	120	.	ENSP00000361656:T120M	T	-	2	0	TEX13A	104351379	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.350000	0.20079	-0.007000	0.14345	-1.492000	0.00969	ACG	-	NULL		0.612	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	TEX13A	protein_coding		G	NM_031274		104351379	-1	no_errors	ENST00000255513	ensembl	human	known	54_36p	missense	SNP	0.000	A
TEX13A	56157	genome.wustl.edu	37	X	104464793	104464793	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:104464793C>T	ENST00000413579.1	-	2	400	c.289G>A	c.(289-291)Gcc>Acc	p.A97T	TEX13A_ENST00000372578.3_Missense_Mutation_p.A97T|IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372575.1_Missense_Mutation_p.A97T|IL1RAPL2_ENST00000344799.4_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	97							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						TGCAGTTTGGCGAAGCCGTGC	0.637																																																0			X											31.0	31.0	31.0					X																	104464793		2198	4278	6476	104351449	SO:0001583	missense	56157			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.289G>A	X.37:g.104464793C>T	ENSP00000399753:p.Ala97Thr	Somatic		Capture	Illumina GAIIx	4	104351449	B1B1G8|Q32NB6	Missense_Mutation	SNP	HMMPfam_zf-RanBP,PatternScan_ZF_RANBP2_1,superfamily_Znf265 first zinc-finger domain	p.A97T	ENST00000413579.1	37	c.289		X	.	.	.	.	.	.	.	.	.	.	C	10.23	1.292517	0.23564	.	.	ENSG00000133149	ENST00000372578;ENST00000372575;ENST00000413579	.	.	.	2.84	-2.05	0.07321	.	0.501798	0.14964	N	0.288195	T	0.15305	0.0369	.	.	.	0.09310	N	1	P;P	0.41008	0.735;0.735	B;B	0.35240	0.198;0.198	T	0.10567	-1.0624	8	0.44086	T	0.13	.	2.8076	0.05432	0.4596:0.2651:0.0:0.2754	.	97;97	C9JWK0;Q9BXU3	.;TX13A_HUMAN	T	97	.	ENSP00000361656:A97T	A	-	1	0	TEX13A	104351449	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.445000	0.02401	-0.642000	0.05480	0.506000	0.49869	GCC	-	NULL		0.637	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	TEX13A	protein_coding		C	NM_031274		104351449	-1	no_errors	ENST00000255513	ensembl	human	known	54_36p	missense	SNP	0.035	T
LAMB1	3912	genome.wustl.edu	37	7	107626474	107626474	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr7:107626474C>A	ENST00000222399.6	-	7	899	c.669G>T	c.(667-669)agG>agT	p.R223S	LAMB1_ENST00000393560.1_Missense_Mutation_p.R223S|LAMB1_ENST00000393561.1_Missense_Mutation_p.R247S	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	223	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TACTCTGTATCCTTGGGCTAT	0.338																																																0			7											90.0	87.0	88.0					7																	107626474		2203	4300	6503	107413710	SO:0001583	missense	3912			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.669G>T	7.37:g.107626474C>A	ENSP00000222399:p.Arg223Ser	Somatic		Capture	Illumina GAIIx	4	107413710	Q14D91	Missense_Mutation	SNP	HMMSmart_SM00136,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_LAM_1,HMMSmart_SM00181,PatternScan_EGF_2,superfamily_Prefoldin	p.R223S	ENST00000222399.6	37	c.669	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	C	12.77	2.036653	0.35893	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.75704	-0.96;-0.96;-0.96	5.55	5.55	0.83447	Laminin, N-terminal (3);	.	.	.	.	D	0.83179	0.5198	L	0.55103	1.725	0.48236	D	0.999616	P;B;D	0.65815	0.714;0.392;0.995	B;B;D	0.65987	0.268;0.348;0.94	T	0.80975	-0.1142	9	0.36615	T	0.2	.	19.5071	0.95124	0.0:1.0:0.0:0.0	.	223;223;247	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	S	247;223;223	ENSP00000377191:R247S;ENSP00000222399:R223S;ENSP00000377190:R223S	ENSP00000222399:R223S	R	-	3	2	LAMB1	107413710	0.146000	0.22672	1.000000	0.80357	0.614000	0.37383	-0.082000	0.11304	2.617000	0.88574	0.557000	0.71058	AGG	-	HMMSmart_SM00136,HMMPfam_Laminin_N		0.338	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	protein_coding	OTTHUMT00000314584.1	C	NM_002291		107413710	-1	no_errors	NM_002291	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
COL4A5	1287	genome.wustl.edu	37	X	107924178	107924178	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:107924178G>C	ENST00000361603.2	+	44	4305	c.4061G>C	c.(4060-4062)gGt>gCt	p.G1354A	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1360A	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1354	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGACTTATTGGTCCTCCAGGT	0.448									Alport syndrome with Diffuse Leiomyomatosis																																							0			X											108.0	101.0	104.0					X																	107924178		2203	4300	6503	107810834	SO:0001583	missense	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4061G>C	X.37:g.107924178G>C	ENSP00000354505:p.Gly1354Ala	Somatic		Capture	Illumina GAIIx	4	107810834	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	HMMPfam_Collagen,superfamily_C-type_lectin_fold,HMMPfam_C4,HMMSmart_C4	p.G1360A	ENST00000361603.2	37	c.4079	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354062	0.61293	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99329	-5.75;-4.16	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.99641	0.9868	H	0.95884	3.735	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.996	D	0.97603	1.0124	10	0.72032	D	0.01	.	18.2781	0.90089	0.0:0.0:1.0:0.0	.	1357;1354	E7EVY4;P29400	.;CO4A5_HUMAN	A	1360;1354;1360	ENSP00000331902:G1360A;ENSP00000354505:G1354A	ENSP00000331902:G1360A	G	+	2	0	COL4A5	107810834	1.000000	0.71417	0.132000	0.22025	0.367000	0.29736	9.076000	0.94009	2.255000	0.74692	0.506000	0.49869	GGT	-	HMMPfam_Collagen		0.448	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	protein_coding	OTTHUMT00000057880.2	G			107810834	+1	no_errors	NM_033380	genbank	human	reviewed	54_36p	missense	SNP	0.965	C
EPS8L3	79574	genome.wustl.edu	37	1	110294652	110294652	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:110294652G>C	ENST00000361965.4	-	15	1505	c.1399C>G	c.(1399-1401)Cgg>Ggg	p.R467G	EPS8L3_ENST00000361852.4_Missense_Mutation_p.R437G|EPS8L3_ENST00000369805.3_Missense_Mutation_p.R468G|RP4-735C1.4_ENST00000431955.1_RNA	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	467	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)		p.R468W(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GTCAGTTCCCGTGGGTTCCTA	0.602																																																1	Substitution - Missense(1)	lung(1)	1											103.0	104.0	104.0					1																	110294652		2203	4300	6503	110096175	SO:0001583	missense	79574			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.1399C>G	1.37:g.110294652G>C	ENSP00000355255:p.Arg467Gly	Somatic		Capture	Illumina GAIIx	4	110096175	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	HMMPfam_PTB,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3	p.R468G	ENST00000361965.4	37	c.1402	CCDS814.1	1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577033	0.45902	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.27557	1.66;1.66;1.66	5.57	3.7	0.42460	Src homology-3 domain (4);	0.425012	0.26863	N	0.022112	T	0.08980	0.0222	N	0.05230	-0.09	0.30929	N	0.727099	P;P;B	0.49559	0.925;0.796;0.447	B;P;B	0.48552	0.446;0.581;0.14	T	0.07927	-1.0747	10	0.45353	T	0.12	-7.6284	9.1043	0.36687	0.0:0.1601:0.6735:0.1664	.	437;467;468	Q8TE67-2;Q8TE67;Q8TE67-3	.;ES8L3_HUMAN;.	G	437;468;467	ENSP00000354551:R437G;ENSP00000358820:R468G;ENSP00000355255:R467G	ENSP00000354551:R437G	R	-	1	2	EPS8L3	110096175	0.883000	0.30277	0.854000	0.33618	0.873000	0.50193	1.690000	0.37711	0.712000	0.32039	0.655000	0.94253	CGG	-	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3		0.602	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EPS8L3	protein_coding	OTTHUMT00000032234.1	G	NM_024526		110096175	-1	no_errors	NM_139053	genbank	human	reviewed	54_36p	missense	SNP	0.996	C
AHCYL1	10768	genome.wustl.edu	37	1	110562188	110562188	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:110562188C>T	ENST00000369799.5	+	15	1772	c.1405C>T	c.(1405-1407)Ctc>Ttc	p.L469F	AHCYL1_ENST00000393614.4_Missense_Mutation_p.L422F|AHCYL1_ENST00000359172.3_Missense_Mutation_p.L422F	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	469					mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		ACTGATAGAACTCTATAATGC	0.413																																																0			1											134.0	142.0	139.0					1																	110562188		2203	4300	6503	110363711	SO:0001583	missense	10768			U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.1405C>T	1.37:g.110562188C>T	ENSP00000358814:p.Leu469Phe	Somatic		Capture	Illumina GAIIx	4	110363711	B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	superfamily_Formate/glycerate dehydrogenase catalytic domain-like,HMMPfam_AdoHcyase,PatternScan_ADOHCYASE_1,superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_AdoHcyase_NAD,PatternScan_ADOHCYASE_2	p.L469F	ENST00000369799.5	37	c.1405	CCDS818.1	1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574180	0.86542	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	D;D;D	0.84370	-1.84;-1.84;-1.84	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.95937	0.8677	H	0.98407	4.225	0.80722	D	1	D	0.67145	0.996	D	0.72625	0.978	D	0.96590	0.9437	10	0.87932	D	0	-6.2906	20.8794	0.99867	0.0:1.0:0.0:0.0	.	469	O43865	SAHH2_HUMAN	F	469;422;422	ENSP00000358814:L469F;ENSP00000352092:L422F;ENSP00000377238:L422F	ENSP00000352092:L422F	L	+	1	0	AHCYL1	110363711	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.294000	0.51787	2.941000	0.99782	0.655000	0.94253	CTC	-	superfamily_Formate/glycerate dehydrogenase catalytic domain-like,HMMPfam_AdoHcyase		0.413	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHCYL1	protein_coding	OTTHUMT00000032243.1	C			110363711	+1	no_errors	NM_006621	genbank	human	validated	54_36p	missense	SNP	1.000	T
NAA25	80018	genome.wustl.edu	37	12	112509774	112509774	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr12:112509774G>A	ENST00000261745.4	-	10	1209	c.961C>T	c.(961-963)Cga>Tga	p.R321*	Y_RNA_ENST00000363818.1_RNA	NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	321						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						TGTGGTCCTCGGAGATGGCGA	0.408																																																0			12											164.0	132.0	142.0					12																	112509774		2203	4300	6503	110994157	SO:0001587	stop_gained	80018			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.961C>T	12.37:g.112509774G>A	ENSP00000261745:p.Arg321*	Somatic		Capture	Illumina GAIIx	4	110994157	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Nonsense_Mutation	SNP	superfamily_TPR-like,HMMPfam_NatB_MDM20	p.R321*	ENST00000261745.4	37	c.961	CCDS9159.1	12	.	.	.	.	.	.	.	.	.	.	G	38	7.154691	0.98099	.	.	ENSG00000111300	ENST00000261745	.	.	.	5.8	4.91	0.64330	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.1688	13.906	0.63836	0.0:0.0:0.7226:0.2774	.	.	.	.	X	321	.	ENSP00000261745:R321X	R	-	1	2	NAA25	110994157	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.928000	0.48908	1.439000	0.47511	-0.181000	0.13052	CGA	-	superfamily_TPR-like,HMMPfam_NatB_MDM20		0.408	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf30	protein_coding	OTTHUMT00000405205.1	G	NM_024953		110994157	-1	no_errors	NM_024953	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
TOX4P1	285412	genome.wustl.edu	37	4	113378139	113378139	+	IGR	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr4:113378139C>G								ALPK1 (14377 upstream) : NEUROG2 (56532 downstream)																							TGTGGCAAACCAGGCATCTTC	0.507																																																0			4																																								113597588	SO:0001628	intergenic_variant	285412																															4.37:g.113378139C>G		Somatic		Capture	Illumina GAIIx	4	113597588		RNA	SNP	-	NULL		37	NULL		4																																																																																			-	-	0	0.507					LOC285412			C			113597588	+1	pseudogene	XR_017405	genbank	human	model	54_36p	rna	SNP	0.006	G
ZDHHC23	254887	genome.wustl.edu	37	3	113667713	113667713	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr3:113667713C>T	ENST00000330212.3	+	2	363	c.64C>T	c.(64-66)Ccc>Tcc	p.P22S	ZDHHC23_ENST00000498275.1_Missense_Mutation_p.P16S|RP11-255E6.6_ENST00000609657.1_RNA	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	22					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						TGAATTGGAGCCCCTGTGCTG	0.483																																																0			3											193.0	183.0	186.0					3																	113667713		2203	4300	6503	115150403	SO:0001583	missense	254887			AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.64C>T	3.37:g.113667713C>T	ENSP00000330485:p.Pro22Ser	Somatic		Capture	Illumina GAIIx	4	115150403	D3DN76	Missense_Mutation	SNP	HMMPfam_zf-DHHC	p.P22S	ENST00000330212.3	37	c.64	CCDS33827.1	3	.	.	.	.	.	.	.	.	.	.	C	15.67	2.900880	0.52227	.	.	ENSG00000184307	ENST00000330212;ENST00000498275;ENST00000491556	T;T;T	0.44482	0.92;0.94;0.95	5.38	5.38	0.77491	.	0.318079	0.30151	N	0.010296	T	0.26557	0.0649	N	0.20807	0.61	0.27935	N	0.937728	B	0.27229	0.172	B	0.16289	0.015	T	0.11891	-1.0569	10	0.34782	T	0.22	-21.211	11.5884	0.50931	0.2866:0.7134:0.0:0.0	.	22	Q8IYP9	ZDH23_HUMAN	S	22;16;22	ENSP00000330485:P22S;ENSP00000417840:P16S;ENSP00000420292:P22S	ENSP00000330485:P22S	P	+	1	0	ZDHHC23	115150403	0.646000	0.27295	1.000000	0.80357	0.927000	0.56198	0.761000	0.26489	2.518000	0.84900	0.591000	0.81541	CCC	-	NULL		0.483	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC23	protein_coding	OTTHUMT00000354702.1	C	NM_173570		115150403	+1	no_errors	NM_173570	genbank	human	validated	54_36p	missense	SNP	1.000	T
GOPC	57120	genome.wustl.edu	37	6	117900079	117900079	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr6:117900079G>A	ENST00000368498.2	-	2	509	c.434C>T	c.(433-435)aCc>aTc	p.T145I	GOPC_ENST00000535237.1_Missense_Mutation_p.T145I|GOPC_ENST00000052569.6_Missense_Mutation_p.T145I	NM_020399.3	NP_065132.1	Q9HD26	GOPC_HUMAN	golgi-associated PDZ and coiled-coil motif containing	145					apical protein localization (GO:0045176)|cytoplasmic sequestering of CFTR protein (GO:0043004)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane transport (GO:0006893)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|spermatid nucleus differentiation (GO:0007289)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|trans-Golgi network transport vesicle (GO:0030140)	ion channel binding (GO:0044325)|small GTPase regulator activity (GO:0005083)		GOPC/ROS1(14)	endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		TGCCTTAATGGTACCAGAGTC	0.373			O	ROS1	glioblastoma																																		Dom	yes		6	6q21	57120	golgi associated PDZ and coiled-coil motif containing		O	0			6											96.0	89.0	91.0					6																	117900079		2203	4300	6503	118006772	SO:0001583	missense	57120			AF287894	CCDS5117.1, CCDS34523.1	6q21	2010-02-12	2010-02-12		ENSG00000047932	ENSG00000047932			17643	protein-coding gene	gene with protein product		606845				11162552, 11520064	Standard	NM_020399		Approved	dJ94G16.2, PIST, FIG, GOPC1, CAL		Q9HD26	OTTHUMG00000015457	ENST00000368498.2:c.434C>T	6.37:g.117900079G>A	ENSP00000357484:p.Thr145Ile	Somatic		Capture	Illumina GAIIx	4	118006772	A6NM30|Q59FS4|Q969U8	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,PatternScan_RCC1_2	p.T145I	ENST00000368498.2	37	c.434	CCDS5117.1	6	.	.	.	.	.	.	.	.	.	.	G	15.66	2.898300	0.52227	.	.	ENSG00000047932	ENST00000052569;ENST00000368498;ENST00000535237	D;D;T	0.83163	-1.69;-1.69;2.42	5.71	5.71	0.89125	.	0.272309	0.43416	D	0.000561	T	0.59348	0.2187	N	0.12182	0.205	0.26982	N	0.965345	B;B	0.14805	0.011;0.011	B;B	0.12156	0.007;0.003	T	0.47873	-0.9083	10	0.30854	T	0.27	-19.9858	19.8426	0.96695	0.0:0.0:1.0:0.0	.	145;145	Q9HD26-2;Q9HD26	.;GOPC_HUMAN	I	145	ENSP00000052569:T145I;ENSP00000357484:T145I;ENSP00000445690:T145I	ENSP00000052569:T145I	T	-	2	0	GOPC	118006772	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.583000	0.67484	2.686000	0.91538	0.585000	0.79938	ACC	-	NULL		0.373	GOPC-002	KNOWN	basic|CCDS	protein_coding	GOPC	protein_coding	OTTHUMT00000041988.1	G	NM_020399		118006772	-1	no_errors	NM_020399	genbank	human	validated	54_36p	missense	SNP	1.000	A
DMXL1	1657	genome.wustl.edu	37	5	118500236	118500236	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr5:118500236C>G	ENST00000311085.8	+	20	4817	c.4737C>G	c.(4735-4737)caC>caG	p.H1579Q	DMXL1_ENST00000539542.1_Missense_Mutation_p.H1579Q	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1579										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GGGCATTTCACTCAGTAGCAG	0.398																																																0			5											98.0	94.0	95.0					5																	118500236		2202	4300	6502	118528135	SO:0001583	missense	1657			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.4737C>G	5.37:g.118500236C>G	ENSP00000309690:p.His1579Gln	Somatic		Capture	Illumina GAIIx	4	118528135		Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_SUBTILASE_ASP,PatternScan_WD_REPEATS_1	p.H1579Q	ENST00000311085.8	37	c.4737	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	C	19.23	3.787274	0.70337	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.51817	0.69;0.69	5.36	-4.04	0.04010	.	0.097480	0.64402	D	0.000001	T	0.62405	0.2425	M	0.83118	2.625	0.44843	D	0.997853	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.63980	-0.6514	10	0.66056	D	0.02	-10.0186	8.6992	0.34316	0.1227:0.1443:0.0:0.7329	.	1579;1579	F5H269;Q9Y485	.;DMXL1_HUMAN	Q	1579	ENSP00000309690:H1579Q;ENSP00000439479:H1579Q	ENSP00000309690:H1579Q	H	+	3	2	DMXL1	118528135	0.926000	0.31397	0.908000	0.35775	0.997000	0.91878	0.041000	0.13927	-0.658000	0.05366	0.591000	0.81541	CAC	-	NULL		0.398	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	protein_coding	OTTHUMT00000250862.1	C	NM_005509		118528135	+1	no_errors	NM_005509	genbank	human	validated	54_36p	missense	SNP	0.994	G
GRIK4	2900	genome.wustl.edu	37	11	120833301	120833301	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr11:120833301T>A	ENST00000527524.2	+	18	2464	c.2177T>A	c.(2176-2178)aTg>aAg	p.M726K	GRIK4_ENST00000438375.2_Missense_Mutation_p.M726K	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	726					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		GAATCCACCATGAACGAGTAC	0.552																																																0			11											94.0	89.0	91.0					11																	120833301		2203	4299	6502	120338511	SO:0001583	missense	2900			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.2177T>A	11.37:g.120833301T>A	ENSP00000435648:p.Met726Lys	Somatic		Capture	Illumina GAIIx	4	120338511	A8K9L1	Missense_Mutation	SNP	superfamily_SSF53822,HMMPfam_ANF_receptor,HMMSmart_PBPe,superfamily_SSF53850,HMMPfam_Lig_chan-Glu_bd,HMMPfam_Lig_chan	p.M726K	ENST00000527524.2	37	c.2177	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	T	22.7	4.319292	0.81469	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.11169	2.8;2.8	5.69	5.69	0.88448	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.28566	0.0707	L	0.49640	1.575	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	T	0.00651	-1.1626	10	0.59425	D	0.04	.	15.6035	0.76642	0.0:0.0:0.0:1.0	.	726;726	A6H8K8;Q16099	.;GRIK4_HUMAN	K	726	ENSP00000435648:M726K;ENSP00000404063:M726K	ENSP00000404063:M726K	M	+	2	0	GRIK4	120338511	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.167000	0.64972	2.162000	0.67917	0.533000	0.62120	ATG	-	HMMSmart_PBPe,superfamily_SSF53850,HMMPfam_Lig_chan		0.552	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	protein_coding	OTTHUMT00000109760.4	T	NM_014619		120338511	+1	no_errors	NM_014619	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
NDNF	79625	genome.wustl.edu	37	4	121966869	121966869	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr4:121966869C>T	ENST00000379692.4	-	2	650	c.124G>A	c.(124-126)Gat>Aat	p.D42N		NM_024574.3	NP_078850.3	Q8TB73	NDNF_HUMAN	neuron-derived neurotrophic factor	42					cell growth (GO:0016049)|extracellular matrix organization (GO:0030198)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron projection development (GO:0010976)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(3)|skin(1)|urinary_tract(1)	29						ACTGACGAATCATGAAAAAAT	0.433																																																0			4											71.0	71.0	71.0					4																	121966869		1870	4106	5976	122186319	SO:0001583	missense	79625			BC019351	CCDS3717.2	4q27	2011-07-05	2011-07-05	2011-07-05	ENSG00000173376	ENSG00000173376			26256	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 31"""	C4orf31		12975309, 20969804	Standard	NM_024574		Approved	FLJ23191	uc003idq.1	Q8TB73	OTTHUMG00000132973	ENST00000379692.4:c.124G>A	4.37:g.121966869C>T	ENSP00000369014:p.Asp42Asn	Somatic		Capture	Illumina GAIIx	4	122186319	A8K0Q0|Q6UWE5|Q9H5P7	Missense_Mutation	SNP	superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_DUF2369	p.D42N	ENST00000379692.4	37	c.124	CCDS3717.2	4	.	.	.	.	.	.	.	.	.	.	C	14.47	2.544386	0.45280	.	.	ENSG00000173376	ENST00000379692;ENST00000515757;ENST00000511408	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.56140	0.1965	L	0.48362	1.52	0.80722	D	1	B	0.26081	0.141	B	0.28553	0.091	T	0.50338	-0.8840	9	0.16420	T	0.52	-23.4507	16.1723	0.81825	0.0:0.867:0.133:0.0	.	42	Q8TB73	NDNF_HUMAN	N	42	.	ENSP00000369014:D42N	D	-	1	0	NDNF	122186319	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.727000	0.68523	2.717000	0.92951	0.655000	0.94253	GAT	-	NULL		0.433	NDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf31	protein_coding	OTTHUMT00000256532.2	C	NM_024574		122186319	-1	no_errors	NM_024574	genbank	human	validated	54_36p	missense	SNP	1.000	T
TRPC3	7222	genome.wustl.edu	37	4	122853735	122853735	+	Silent	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr4:122853735G>A	ENST00000379645.3	-	2	751	c.678C>T	c.(676-678)gaC>gaT	p.D226D	TRPC3_ENST00000264811.5_Silent_p.D153D|TRPC3_ENST00000513531.1_Silent_p.D153D	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	141					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AGCGCGTGCCGTCCTCGTCGT	0.622																																																0			4											86.0	79.0	81.0					4																	122853735		2203	4300	6503	123073185	SO:0001819	synonymous_variant	7222			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.678C>T	4.37:g.122853735G>A		Somatic		Capture	Illumina GAIIx	4	123073185	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Silent	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank,HMMPfam_TRP_2,HMMPfam_Ion_trans	p.D153	ENST00000379645.3	37	c.459	CCDS47130.1	4																																																																																			-	superfamily_ANK		0.622	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	protein_coding	OTTHUMT00000364252.1	G	NM_003305		123073185	-1	no_errors	NM_003305	genbank	human	validated	54_36p	silent	SNP	1.000	A
DMBT1	1755	genome.wustl.edu	37	10	124359662	124359662	+	Intron	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr10:124359662C>G	ENST00000338354.3	+	27	3416				DMBT1_ENST00000368909.3_Intron|DMBT1_ENST00000344338.3_Intron|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368955.3_Intron|DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000368956.2_Intron			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1						defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGCCCAATCACCCCTTCCACA	0.527																																					Ovarian(182;93 2026 18125 22222 38972)											0			10											78.0	71.0	73.0					10																	124359662		691	1590	2281	124349652	SO:0001627	intron_variant	1755				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.3310+53C>G	10.37:g.124359662C>G		Somatic		Capture	Illumina GAIIx	4	124349652	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	superfamily_Srcr_receptor,HMMSmart_SR,HMMPfam_SRCR,PatternScan_SRCR_1,superfamily_CUB,HMMPfam_CUB,HMMSmart_CUB,HMMPfam_Zona_pellucida,HMMSmart_ZP,PatternScan_ZP_1	p.H898Q	ENST00000338354.3	37	c.2694		10																																																																																			-	NULL		0.527	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	protein_coding	OTTHUMT00000050792.2	C	NM_004406		124349652	+1	no_errors	ENST00000398134	ensembl	human	known	54_36p	missense	SNP	0.001	G
MBNL3	55796	genome.wustl.edu	37	X	131525093	131525093	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:131525093G>A	ENST00000370853.3	-	4	631	c.553C>T	c.(553-555)Cgt>Tgt	p.R185C	MBNL3_ENST00000394311.2_Missense_Mutation_p.R89C|MBNL3_ENST00000538204.1_Missense_Mutation_p.R135C|MBNL3_ENST00000370849.3_Missense_Mutation_p.R135C|MBNL3_ENST00000370857.3_Missense_Mutation_p.R185C|MBNL3_ENST00000473364.1_5'UTR|RAP2C-AS1_ENST00000441399.2_RNA|MBNL3_ENST00000370839.3_Missense_Mutation_p.R185C|MBNL3_ENST00000370844.1_Missense_Mutation_p.R89C|RAP2C-AS1_ENST00000421483.2_RNA	NM_018388.3	NP_060858.2	Q9NUK0	MBNL3_HUMAN	muscleblind-like splicing regulator 3	185					mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|negative regulation of myoblast differentiation (GO:0045662)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R185C(2)		NS(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)	16	Acute lymphoblastic leukemia(192;0.000127)					CAATTTCCACGCTGAAATTCT	0.443																																																2	Substitution - Missense(2)	endometrium(2)	X											93.0	80.0	85.0					X																	131525093		2203	4300	6503	131352774	SO:0001583	missense	55796			AF491305	CCDS14633.1, CCDS14634.1, CCDS55492.1, CCDS55493.1, CCDS55494.1	Xq26.2	2013-01-18	2012-02-23		ENSG00000076770	ENSG00000076770		"""Zinc fingers, CCCH-type domain containing"""	20564	protein-coding gene	gene with protein product		300413	"""muscleblind-like 3 (Drosophila)"""			12297108, 10970838	Standard	NM_018388		Approved	CHCR, FLJ11316, MBLX39, MBXL	uc004ewv.4	Q9NUK0	OTTHUMG00000022426	ENST00000370853.3:c.553C>T	X.37:g.131525093G>A	ENSP00000359890:p.Arg185Cys	Somatic		Capture	Illumina GAIIx	4	131352774	Q5JXN8|Q5JXN9|Q5JXP4|Q6UDQ1|Q8IUR4|Q8TAD9|Q8TAF4|Q9H0Z7|Q9UF37	Missense_Mutation	SNP	HMMSmart_SM00356,HMMPfam_zf-CCCH,superfamily_CCCH zinc finger	p.R185C	ENST00000370853.3	37	c.553	CCDS14633.1	X	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469010	0.84533	.	.	ENSG00000076770	ENST00000394311;ENST00000538204;ENST00000370857;ENST00000370853;ENST00000370849;ENST00000370839;ENST00000370844;ENST00000436215;ENST00000421707	T;T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.85	5.85	0.93711	Zinc finger, CCCH-type (2);	0.000000	0.64402	D	0.000001	T	0.67998	0.2953	M	0.85373	2.75	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.993;0.999;0.999;0.999;0.997	T	0.73260	-0.4039	10	0.87932	D	0	-13.8141	13.9389	0.64043	0.0:0.0:0.8483:0.1516	.	135;185;185;135;89	Q9NUK0-4;Q9NUK0;Q9NUK0-2;Q9NUK0-3;Q8IUR4	.;MBNL3_HUMAN;.;.;.	C	89;135;185;185;135;185;89;89;89	ENSP00000377848:R89C;ENSP00000439618:R135C;ENSP00000359894:R185C;ENSP00000359890:R185C;ENSP00000359886:R135C;ENSP00000359876:R185C;ENSP00000359881:R89C;ENSP00000406014:R89C;ENSP00000402128:R89C	ENSP00000359876:R185C	R	-	1	0	MBNL3	131352774	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.444000	0.82710	0.513000	0.50165	CGT	-	superfamily_CCCH zinc finger,HMMSmart_SM00356,HMMPfam_zf-CCCH		0.443	MBNL3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MBNL3	protein_coding	OTTHUMT00000058319.1	G	NM_018388		131352774	-1	no_errors	NM_018388	genbank	human	provisional	54_36p	missense	SNP	1.000	A
PLXNA4	91584	genome.wustl.edu	37	7	131829916	131829916	+	Silent	SNP	A	A	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr7:131829916A>T	ENST00000359827.3	-	29	6149	c.5187T>A	c.(5185-5187)atT>atA	p.I1729I	PLXNA4_ENST00000321063.4_Silent_p.I1729I			Q9HCM2	PLXA4_HUMAN	plexin A4	1729					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GCGGGTCATGAATGCCATGTT	0.572																																																0			7											89.0	91.0	91.0					7																	131829916		2203	4300	6503	131480456	SO:0001819	synonymous_variant	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.5187T>A	7.37:g.131829916A>T		Somatic		Capture	Illumina GAIIx	4	131480456	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP	p.I1729	ENST00000359827.3	37	c.5187	CCDS43646.1	7																																																																																			-	HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP		0.572	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	protein_coding	OTTHUMT00000338422.2	A	NM_181775		131480456	-1	no_errors	NM_020911	genbank	human	validated	54_36p	silent	SNP	0.988	T
PCDH10	57575	genome.wustl.edu	37	4	134084199	134084199	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr4:134084199G>A	ENST00000264360.5	+	4	3691	c.2865G>A	c.(2863-2865)atG>atA	p.M955I		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	955					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GGTGCTGGATGCCTTCTTTTG	0.483																																																0			4											181.0	153.0	163.0					4																	134084199		2203	4300	6503	134303649	SO:0001583	missense	57575			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2865G>A	4.37:g.134084199G>A	ENSP00000264360:p.Met955Ile	Somatic		Capture	Illumina GAIIx	4	134303649	Q4W5F6|Q96SF0	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin-like,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin,PatternScan_EGF_1	p.M955I	ENST00000264360.5	37	c.2865	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	G	18.97	3.734920	0.69189	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.68479	-0.33	4.94	4.94	0.65067	.	0.000000	0.44097	D	0.000482	T	0.76730	0.4028	L	0.52126	1.63	0.80722	D	1	P	0.50528	0.936	P	0.61201	0.885	T	0.77365	-0.2615	10	0.56958	D	0.05	.	18.3153	0.90218	0.0:0.0:1.0:0.0	.	955	Q9P2E7	PCD10_HUMAN	I	955	ENSP00000264360:M955I	ENSP00000264360:M955I	M	+	3	0	PCDH10	134303649	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.208000	0.95075	2.717000	0.92951	0.650000	0.86243	ATG	-	NULL		0.483	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	protein_coding	OTTHUMT00000364457.2	G	NM_032961		134303649	+1	no_errors	NM_032961	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
GPR112	139378	genome.wustl.edu	37	X	135482201	135482201	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:135482201T>G	ENST00000394143.1	+	21	8792	c.8501T>G	c.(8500-8502)aTg>aGg	p.M2834R	GPR112_ENST00000394141.1_Missense_Mutation_p.M2629R|GPR112_ENST00000287534.4_Missense_Mutation_p.M2587R|GPR112_ENST00000370652.1_Missense_Mutation_p.M2834R|GPR112_ENST00000412101.1_Missense_Mutation_p.M2629R	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2834					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GCAGTCCACATGTATTTGGCT	0.388																																																0			X											225.0	181.0	196.0					X																	135482201		2203	4300	6503	135309867	SO:0001583	missense	139378			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8501T>G	X.37:g.135482201T>G	ENSP00000377699:p.Met2834Arg	Somatic		Capture	Illumina GAIIx	4	135309867	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	superfamily_ConA_like_lec_gl,HMMPfam_GPS,HMMSmart_GPS,HMMPfam_7tm_2,PatternScan_G_PROTEIN_RECEP_F2_2	p.M2834R	ENST00000394143.1	37	c.8501	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	T	18.95	3.731841	0.69189	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.04706	3.57;3.57;3.57;3.57;3.57	5.1	5.1	0.69264	GPCR, family 2-like (1);	.	.	.	.	T	0.28067	0.0692	M	0.91406	3.205	0.40992	D	0.984869	D;D	0.76494	0.998;0.999	D;D	0.87578	0.988;0.998	T	0.27157	-1.0082	9	0.87932	D	0	.	13.8948	0.63764	0.0:0.0:0.0:1.0	.	2629;2834	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	R	2834;2834;2629;2587;2629	ENSP00000377699:M2834R;ENSP00000359686:M2834R;ENSP00000416526:M2629R;ENSP00000287534:M2587R;ENSP00000377697:M2629R	ENSP00000287534:M2587R	M	+	2	0	GPR112	135309867	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.606000	0.82863	1.805000	0.52779	0.441000	0.28932	ATG	-	HMMPfam_7tm_2		0.388	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	protein_coding	OTTHUMT00000286639.1	T			135309867	+1	no_errors	NM_153834	genbank	human	validated	54_36p	missense	SNP	1.000	G
FAM13B	51306	genome.wustl.edu	37	5	137275973	137275973	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr5:137275973C>G	ENST00000033079.3	-	23	3140	c.2689G>C	c.(2689-2691)Gcc>Ccc	p.A897P	PKD2L2_ENST00000508883.1_Intron|PKD2L2_ENST00000502810.1_3'UTR|FAM13B_ENST00000425075.2_Missense_Mutation_p.A773P|PKD2L2_ENST00000290431.5_3'UTR|PKD2L2_ENST00000508638.1_3'UTR|FAM13B_ENST00000420893.2_Missense_Mutation_p.A869P	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	897					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						CTAAGCTTGGCTTTAATTTTC	0.348																																																0			5											110.0	107.0	108.0					5																	137275973		2203	4300	6503	137303872	SO:0001583	missense	51306			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.2689G>C	5.37:g.137275973C>G	ENSP00000033079:p.Ala897Pro	Somatic		Capture	Illumina GAIIx	4	137303872	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	superfamily_Rho_GAP,HMMSmart_RhoGAP,HMMPfam_RhoGAP	p.A897P	ENST00000033079.3	37	c.2689	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.122591	0.94429	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.34472	2.49;1.36;2.41	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.66097	-0.6008	10	0.87932	D	0	-4.0636	19.4556	0.94886	0.0:1.0:0.0:0.0	.	773;869;897	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	P	897;773;869	ENSP00000033079:A897P;ENSP00000394669:A773P;ENSP00000388521:A869P	ENSP00000033079:A897P	A	-	1	0	FAM13B	137303872	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.398000	0.79919	2.679000	0.91253	0.591000	0.81541	GCC	-	NULL		0.348	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	protein_coding	OTTHUMT00000251279.1	C			137303872	-1	no_errors	NM_016603	genbank	human	validated	54_36p	missense	SNP	1.000	G
IFNGR1	3459	genome.wustl.edu	37	6	137519663	137519663	+	Silent	SNP	C	C	T	rs376124136		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr6:137519663C>T	ENST00000367739.4	-	7	1096	c.975G>A	c.(973-975)ccG>ccA	p.P325P	IFNGR1_ENST00000543628.1_Silent_p.P297P	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	325					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	CTGGAGACAACGGCTCTTCAC	0.423																																																0			6						C		1,4405	2.1+/-5.4	0,1,2202	92.0	84.0	87.0		975	-0.7	0.0	6		87	0,8600		0,0,4300	no	coding-synonymous	IFNGR1	NM_000416.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		325/490	137519663	1,13005	2203	4300	6503	137561356	SO:0001819	synonymous_variant	3459				CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.975G>A	6.37:g.137519663C>T		Somatic		Capture	Illumina GAIIx	4	137561356	B4DFT7|E1P587|Q53Y96	Silent	SNP	HMMPfam_IFNGR1,superfamily_Fibronectin type III	p.P325	ENST00000367739.4	37	c.975	CCDS5185.1	6																																																																																			-	HMMPfam_IFNGR1		0.423	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNGR1	protein_coding	OTTHUMT00000042401.1	C			137561356	-1	no_errors	NM_000416	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
STAG1	10274	genome.wustl.edu	37	3	136192384	136192384	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr3:136192384G>T	ENST00000383202.2	-	11	1378	c.1122C>A	c.(1120-1122)ttC>ttA	p.F374L	STAG1_ENST00000236698.5_Missense_Mutation_p.F374L|STAG1_ENST00000536929.1_5'UTR|STAG1_ENST00000434713.2_Missense_Mutation_p.F148L	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	374	SCD. {ECO:0000255|PROSITE- ProRule:PRU00750}.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						TGCTTACCTTGAATCGGTTAG	0.338																																																0			3											90.0	91.0	90.0					3																	136192384		2203	4300	6503	137675074	SO:0001583	missense	10274			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1122C>A	3.37:g.136192384G>T	ENSP00000372689:p.Phe374Leu	Somatic		Capture	Illumina GAIIx	4	137675074	O00539|Q6P275	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_STAG	p.F374L	ENST00000383202.2	37	c.1122	CCDS3090.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.43|18.43	3.622286|3.622286	0.66787|0.66787	.|.	.|.	ENSG00000118007|ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713|ENST00000492318	T;T;T|.	0.25912|.	1.77;1.77;1.77|.	5.7|5.7	5.7|5.7	0.88788|0.88788	Stromalin conservative domain (1);Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.81740|.	0.4886|.	M|M	0.94101|0.94101	3.495|3.495	0.80722|0.80722	D|D	1|1	P;B;P|.	0.36438|.	0.553;0.008;0.553|.	P;B;P|.	0.46940|.	0.532;0.02;0.532|.	D|.	0.85347|.	0.1099|.	10|.	0.62326|.	D|.	0.03|.	.|.	10.2766|10.2766	0.43515|0.43515	0.1463:0.0:0.8537:0.0|0.1463:0.0:0.8537:0.0	.|.	391;374;374|.	Q4LE48;Q6P275;Q8WVM7|.	.;.;STAG1_HUMAN|.	L|X	374;374;148|21	ENSP00000372689:F374L;ENSP00000236698:F374L;ENSP00000404396:F148L|.	ENSP00000236698:F374L|.	F|S	-|-	3|2	2|0	STAG1|STAG1	137675074|137675074	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.969000|0.969000	0.65631|0.65631	3.472000|3.472000	0.53114|0.53114	2.678000|2.678000	0.91216|0.91216	0.655000|0.655000	0.94253|0.94253	TTC|TCA	-	superfamily_ARM-type_fold		0.338	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	protein_coding	OTTHUMT00000357366.1	G	NM_005862		137675074	-1	no_errors	NM_005862	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
THSD7B	80731	genome.wustl.edu	37	2	138378267	138378267	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr2:138378267C>A	ENST00000409968.1	+	20	3948	c.3770C>A	c.(3769-3771)aCa>aAa	p.T1257K	THSD7B_ENST00000272643.3_Missense_Mutation_p.T1260K|THSD7B_ENST00000413152.2_Missense_Mutation_p.T1229K|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1259	TSP type-1 16. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		ACGGCTTGGACAGAGTGTTCA	0.473																																																0			2											183.0	179.0	180.0					2																	138378267		1953	4166	6119	138094737	SO:0001583	missense	80731					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3770C>A	2.37:g.138378267C>A	ENSP00000387145:p.Thr1257Lys	Somatic		Capture	Illumina GAIIx	4	138094737		Missense_Mutation	SNP	superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1	p.T1228K	ENST00000409968.1	37	c.3683		2	.	.	.	.	.	.	.	.	.	.	C	18.10	3.547496	0.65311	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.54279	0.58;0.58;0.58	4.71	3.76	0.43208	.	0.300799	0.35407	N	0.003223	T	0.55016	0.1894	M	0.80183	2.485	0.80722	D	1	P	0.38020	0.615	B	0.35813	0.211	T	0.67078	-0.5761	10	0.87932	D	0	.	14.507	0.67761	0.0:0.8514:0.1486:0.0	.	1229	C9JKN6	.	K	1257;1260;1229	ENSP00000387145:T1257K;ENSP00000272643:T1260K;ENSP00000413841:T1229K	ENSP00000272643:T1260K	T	+	2	0	THSD7B	138094737	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.976000	0.63785	2.603000	0.88011	0.650000	0.86243	ACA	-	superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1		0.473	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	protein_coding	OTTHUMT00000331769.2	C	XM_046570.9		138094737	+1	no_errors	NM_001080427	genbank	human	provisional	54_36p	missense	SNP	0.998	A
PCDHGB2	56103	genome.wustl.edu	37	5	140740359	140740359	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr5:140740359C>G	ENST00000522605.1	+	1	657	c.657C>G	c.(655-657)gaC>gaG	p.D219E	PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	219	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGGCGGAGACCCACCTCAAA	0.507																																																0			5											64.0	71.0	69.0					5																	140740359		2054	4188	6242	140720543	SO:0001583	missense	56103			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.657C>G	5.37:g.140740359C>G	ENSP00000429018:p.Asp219Glu	Somatic		Capture	Illumina GAIIx	4	140720543	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.D219E	ENST00000522605.1	37	c.657	CCDS54924.1	5	.	.	.	.	.	.	.	.	.	.	.	0.460	-0.889337	0.02511	.	.	ENSG00000253910	ENST00000522605	T	0.49432	0.78	5.54	-1.52	0.08637	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.31918	0.0812	L	0.33245	0.995	0.09310	N	0.999999	B;B	0.22746	0.074;0.041	B;B	0.26693	0.072;0.06	T	0.29212	-1.0019	9	0.25106	T	0.35	.	6.7304	0.23381	0.0:0.4832:0.115:0.4019	.	219;219	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	E	219	ENSP00000429018:D219E	ENSP00000429018:D219E	D	+	3	2	PCDHGB2	140720543	0.000000	0.05858	0.043000	0.18650	0.034000	0.12701	-2.888000	0.00711	-0.015000	0.14150	0.655000	0.94253	GAC	-	superfamily_Cadherin-like,HMMSmart_SM00112,HMMPfam_Cadherin		0.507	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	protein_coding	OTTHUMT00000374741.1	C	NM_018923		140720543	+1	no_errors	NM_018923	genbank	human	reviewed	54_36p	missense	SNP	0.002	G
PCDHGB3	56102	genome.wustl.edu	37	5	140750730	140750730	+	Missense_Mutation	SNP	G	G	A	rs79773129		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr5:140750730G>A	ENST00000576222.1	+	1	900	c.769G>A	c.(769-771)Gct>Act	p.A257T	PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	257	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACCTGCCCGCTGGCTCCTC	0.473																																																0			5											74.0	79.0	78.0					5																	140750730		2102	4232	6334	140730914	SO:0001583	missense	56102			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.769G>A	5.37:g.140750730G>A	ENSP00000461862:p.Ala257Thr	Somatic		Capture	Illumina GAIIx	4	140730914	A7E229|Q9Y5C7	Missense_Mutation	SNP	HMMSmart_SM00112,superfamily_Cadherin-like,HMMPfam_Cadherin_2,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.A257T	ENST00000576222.1	37	c.769	CCDS58980.1	5																																																																																			-	superfamily_Cadherin-like,HMMPfam_Cadherin		0.473	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	protein_coding	OTTHUMT00000437094.1	G	NM_018924		140730914	+1	no_errors	NM_018924	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
Unknown	0	genome.wustl.edu	37	3	143574758	143574758	+	IGR	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr3:143574758C>G								SLC9A9 (7385 upstream) : C3orf58 (115881 downstream)																							TGTTTTCTCTCTCCTCCTCCT	0.488																																																0			3																																								145057448	SO:0001628	intergenic_variant	257039																															3.37:g.143574758C>G		Somatic		Capture	Illumina GAIIx	4	145057448		Missense_Mutation	SNP	HMMPfam_Ribosomal_S17e	p.E164D		37	c.492		3																																																																																			-	HMMPfam_Ribosomal_S17e	0	0.488					LOC257039			C			145057448	-1	no_errors	XM_172230	genbank	human	model	54_36p	missense	SNP	1.000	G
CUL1	8454	genome.wustl.edu	37	7	148486911	148486911	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr7:148486911C>T	ENST00000325222.4	+	15	1946	c.1667C>T	c.(1666-1668)cCg>cTg	p.P556L	CUL1_ENST00000602748.1_Missense_Mutation_p.P556L|CUL1_ENST00000409469.1_Missense_Mutation_p.P556L	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	556					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TTTGCCTTGCCGTCAGAGGTA	0.572																																																0			7											147.0	142.0	144.0					7																	148486911		2203	4300	6503	148117844	SO:0001583	missense	8454			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1667C>T	7.37:g.148486911C>T	ENSP00000326804:p.Pro556Leu	Somatic		Capture	Illumina GAIIx	4	148117844	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	"superfamily_Cullin repeat,HMMPfam_Cullin,superfamily_Cullin homology domain,HMMSmart_SM00182,superfamily_""Winged helix"" DNA-binding domain,HMMPfam_Cullin_Nedd8,PatternScan_CULLIN_1"	p.P556L	ENST00000325222.4	37	c.1667	CCDS34772.1	7	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757262	0.69648	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	D;D	0.93547	-3.24;-3.24	5.08	5.08	0.68730	Cullin, N-terminal (1);Cullin homology (3);	0.108726	0.64402	D	0.000005	D	0.98169	0.9395	H	0.97962	4.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99824	1.1049	10	0.87932	D	0	-15.6332	18.4804	0.90809	0.0:1.0:0.0:0.0	.	483;556	E7EWR0;Q13616	.;CUL1_HUMAN	L	556;556;514;483	ENSP00000387160:P556L;ENSP00000326804:P556L	ENSP00000326804:P556L	P	+	2	0	CUL1	148117844	1.000000	0.71417	0.940000	0.37924	0.155000	0.21991	7.354000	0.79424	2.359000	0.80004	0.591000	0.81541	CCG	-	HMMPfam_Cullin,superfamily_Cullin homology domain,HMMSmart_SM00182		0.572	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CUL1	protein_coding	OTTHUMT00000467785.1	C	NM_003592		148117844	+1	no_errors	NM_003592	genbank	human	validated	54_36p	missense	SNP	1.000	T
NR3C2	4306	genome.wustl.edu	37	4	149035327	149035327	+	Silent	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr4:149035327C>T	ENST00000358102.3	-	8	3089	c.2727G>A	c.(2725-2727)aaG>aaA	p.K909K	NR3C2_ENST00000511528.1_Silent_p.K913K|NR3C2_ENST00000512865.1_Silent_p.K792K|NR3C2_ENST00000355292.3_Silent_p.K913K|NR3C2_ENST00000344721.4_Silent_p.K909K	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	909	Steroid-binding.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	TGTTGGGACACTTAGTTACCA	0.468																																					Melanoma(27;428 957 40335 51025 51111)											0			4											162.0	134.0	143.0					4																	149035327		2203	4300	6503	149254777	SO:0001819	synonymous_variant	4306			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2727G>A	4.37:g.149035327C>T		Somatic		Capture	Illumina GAIIx	4	149254777	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Silent	SNP	HMMSmart_ZnF_C4,HMMPfam_zf-C4,superfamily_SSF57716,PatternScan_NUCLEAR_REC_DBD_1,superfamily_Str_ncl_receptor,HMMSmart_HOLI,HMMPfam_Hormone_recep	p.K909	ENST00000358102.3	37	c.2727	CCDS3772.1	4																																																																																			-	superfamily_Str_ncl_receptor,HMMSmart_HOLI,HMMPfam_Hormone_recep		0.468	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NR3C2	protein_coding	OTTHUMT00000364986.1	C			149254777	-1	no_errors	NM_000901	genbank	human	validated	54_36p	silent	SNP	1.000	T
VMA21	203547	genome.wustl.edu	37	X	150572160	150572160	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:150572160G>A	ENST00000330374.6	+	2	216	c.111G>A	c.(109-111)atG>atA	p.M37I	VMA21_ENST00000370361.1_Missense_Mutation_p.M92I|VMA21_ENST00000477649.1_3'UTR	NM_001017980.3	NP_001017980.1			VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	7						CAGCTTTAATGATCACTGTTC	0.343																																																0			X											191.0	180.0	183.0					X																	150572160		2203	4300	6503	150322818	SO:0001583	missense	203547			AK096835	CCDS35430.1	Xq28	2014-09-17			ENSG00000160131	ENSG00000160131			22082	protein-coding gene	gene with protein product		300913	"""myopathy with excessive autophagy"""	MEAX		2892402, 10757644, 19379691	Standard	NM_001017980		Approved	XMEA	uc004feu.3	Q3ZAQ7	OTTHUMG00000024168	ENST00000330374.6:c.111G>A	X.37:g.150572160G>A	ENSP00000333255:p.Met37Ile	Somatic		Capture	Illumina GAIIx	4	150322818		Missense_Mutation	SNP	HMMPfam_VMA21	p.M37I	ENST00000330374.6	37	c.111	CCDS35430.1	X	.	.	.	.	.	.	.	.	.	.	.	16.15	3.040499	0.55003	.	.	ENSG00000160131	ENST00000370361;ENST00000330374	.	.	.	5.88	5.88	0.94601	Vacuolar ATPase assembly integral membrane protein VMA21-like domain (1);	0.000000	0.85682	D	0.000000	T	0.71962	0.3402	L	0.48642	1.525	0.80722	D	1	P	0.49559	0.925	D	0.65140	0.932	T	0.66630	-0.5875	9	0.24483	T	0.36	-6.0648	16.3955	0.83604	0.0:0.0:1.0:0.0	.	37	Q3ZAQ7	VMA21_HUMAN	I	92;37	.	ENSP00000333255:M37I	M	+	3	0	VMA21	150322818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.804000	0.99143	2.478000	0.83669	0.594000	0.82650	ATG	-	HMMPfam_VMA21		0.343	VMA21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VMA21	protein_coding	OTTHUMT00000060876.1	G	NM_001017980		150322818	+1	no_errors	NM_001017980	genbank	human	provisional	54_36p	missense	SNP	1.000	A
SLC4A2	6522	genome.wustl.edu	37	7	150771800	150771800	+	Silent	SNP	A	A	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr7:150771800A>T	ENST00000485713.1	+	19	3959	c.2919A>T	c.(2917-2919)ccA>ccT	p.P973P	SLC4A2_ENST00000461735.1_Silent_p.P959P|SLC4A2_ENST00000310317.5_Silent_p.P891P|SLC4A2_ENST00000392826.2_Silent_p.P964P|FASTK_ENST00000489884.1_5'Flank|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000413384.2_Silent_p.P973P	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	973	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGACTGCCCCAGAAAAGAGGG	0.582																																																0			7											82.0	85.0	84.0					7																	150771800		2203	4300	6503	150402733	SO:0001819	synonymous_variant	6522				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.2919A>T	7.37:g.150771800A>T		Somatic		Capture	Illumina GAIIx	4	150402733	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Silent	SNP	superfamily_Phoshotransferase/anion transport protein,HMMPfam_Band_3_cyto,HMMPfam_HCO3_cotransp,PatternScan_ANION_EXCHANGER_1,PatternScan_ANION_EXCHANGER_2	p.P973	ENST00000485713.1	37	c.2919	CCDS5917.1	7																																																																																			-	HMMPfam_HCO3_cotransp		0.582	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	protein_coding	OTTHUMT00000351039.1	A	NM_003040		150402733	+1	no_errors	NM_003040	genbank	human	validated	54_36p	silent	SNP	0.004	T
FLG	2312	genome.wustl.edu	37	1	152285871	152285871	+	Missense_Mutation	SNP	G	G	C	rs116222149	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:152285871G>C	ENST00000368799.1	-	3	1526	c.1491C>G	c.(1489-1491)caC>caG	p.H497Q	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	497	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGCCTGCTCGTGGTGCGATC	0.612									Ichthyosis																																							0			1											287.0	270.0	276.0					1																	152285871		2203	4300	6503	150552495	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1491C>G	1.37:g.152285871G>C	ENSP00000357789:p.His497Gln	Somatic		Capture	Illumina GAIIx	4	150552495	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,PatternScan_S100_CABP,PatternScan_EF_HAND_1,HMMPfam_Filaggrin	p.H497Q	ENST00000368799.1	37	c.1491	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	-	7.513	0.655130	0.14580	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.04015	3.73	3.43	-6.87	0.01671	.	.	.	.	.	T	0.02533	0.0077	M	0.62154	1.92	0.09310	N	1	D	0.63046	0.992	P	0.62491	0.903	T	0.13899	-1.0492	9	0.12766	T	0.61	.	1.9968	0.03458	0.501:0.1098:0.168:0.2212	.	497	P20930	FILA_HUMAN	Q	497;29	ENSP00000357789:H497Q	ENSP00000357789:H497Q	H	-	3	2	FLG	150552495	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.380000	0.00127	-2.600000	0.00451	-2.189000	0.00312	CAC	-	NULL		0.612	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	G	NM_002016		150552495	-1	no_errors	NM_002016	genbank	human	provisional	54_36p	missense	SNP	0.000	C
FCRL2	79368	genome.wustl.edu	37	1	157736735	157736735	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:157736735T>A	ENST00000361516.3	-	7	1237	c.1189A>T	c.(1189-1191)Atg>Ttg	p.M397L	FCRL2_ENST00000368181.4_Missense_Mutation_p.M113L|FCRL2_ENST00000469986.1_Missense_Mutation_p.M144L|FCRL2_ENST00000392274.3_Missense_Mutation_p.M397L	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	397					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCAGCTGTCATGAGGTCTCTT	0.458																																																0			1											115.0	115.0	115.0					1																	157736735		2203	4300	6503	156003359	SO:0001583	missense	79368			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.1189A>T	1.37:g.157736735T>A	ENSP00000355157:p.Met397Leu	Somatic		Capture	Illumina GAIIx	4	156003359	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	superfamily_Immunoglobulin	p.M144L	ENST00000361516.3	37	c.430	CCDS1168.1	1	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.553252	0.00918	.	.	ENSG00000132704	ENST00000292389;ENST00000361516;ENST00000368181;ENST00000392274;ENST00000469986	T;T;T;T	0.17854	2.37;3.84;2.25;3.27	3.02	-1.49	0.08718	.	2.069140	0.03309	U	0.190162	T	0.01558	0.0050	N	0.11064	0.09	0.09310	N	1	B;B;B;B	0.10296	0.0;0.0;0.0;0.003	B;B;B;B	0.06405	0.0;0.001;0.0;0.002	T	0.21075	-1.0256	10	0.02654	T	1	.	3.309	0.07010	0.0:0.3407:0.2169:0.4424	.	397;113;397;144	B4DVJ9;Q96LA5-5;Q96LA5;Q96LA5-2	.;.;FCRL2_HUMAN;.	L	113;397;113;397;144	ENSP00000355157:M397L;ENSP00000357163:M113L;ENSP00000376100:M397L;ENSP00000417393:M144L	ENSP00000292389:M113L	M	-	1	0	FCRL2	156003359	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-2.919000	0.00694	-0.182000	0.10602	-0.242000	0.12053	ATG	-	NULL		0.458	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL2	protein_coding	OTTHUMT00000051408.2	T	NM_030764		156003359	-1	no_errors	NM_138738	genbank	human	validated	54_36p	missense	SNP	0.000	A
AIM2	9447	genome.wustl.edu	37	1	159038359	159038359	+	Splice_Site	SNP	T	T	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:159038359T>A	ENST00000368130.4	-	3	683	c.395A>T	c.(394-396)aAg>aTg	p.K132M	AIM2_ENST00000411768.1_5'UTR	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	132					activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					TTATCCTACCTTAACATGAGG	0.453																																																0			1											236.0	179.0	198.0					1																	159038359		2203	4300	6503	157304983	SO:0001630	splice_region_variant	9447			AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.396+1A>T	1.37:g.159038359T>A		Somatic		Capture	Illumina GAIIx	4	157304983	A8K7M7|Q5T3V9|Q96FG9	Missense_Mutation	SNP	superfamily_DEATH_like,HMMPfam_PAAD_DAPIN,HMMPfam_HIN	p.K132M	ENST00000368130.4	37	c.395	CCDS1181.1	1	.	.	.	.	.	.	.	.	.	.	T	13.17	2.155976	0.38021	.	.	ENSG00000163568	ENST00000368130;ENST00000411768	T;T	0.47869	2.75;0.83	2.26	2.26	0.28386	.	.	.	.	.	T	0.35913	0.0948	L	0.27053	0.805	0.20873	N	0.999839	D	0.89917	1.0	D	0.83275	0.996	T	0.07102	-1.0790	9	0.51188	T	0.08	-7.6508	6.4693	0.21999	0.0:0.0:0.0:1.0	.	132	O14862	AIM2_HUMAN	M	132	ENSP00000357112:K132M;ENSP00000405197:K132M	ENSP00000357112:K132M	K	-	2	0	AIM2	157304983	0.292000	0.24362	0.293000	0.24932	0.044000	0.14063	2.239000	0.43079	1.282000	0.44496	0.459000	0.35465	AAG	-	NULL		0.453	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM2	protein_coding	OTTHUMT00000090341.1	T	NM_004833	Missense_Mutation	157304983	-1	no_errors	NM_004833	genbank	human	reviewed	54_36p	missense	SNP	0.051	A
ITGB6	3694	genome.wustl.edu	37	2	160994612	160994612	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr2:160994612G>C	ENST00000283249.2	-	9	1443	c.1206C>G	c.(1204-1206)caC>caG	p.H402Q	ITGB6_ENST00000409967.2_Missense_Mutation_p.H402Q|ITGB6_ENST00000428609.2_Missense_Mutation_p.H360Q|ITGB6_ENST00000409872.1_Missense_Mutation_p.H402Q	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	402					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						ATTTCTTTTGGTGTTGGAAGA	0.453																																																0			2											265.0	226.0	239.0					2																	160994612		2203	4300	6503	160702858	SO:0001583	missense	3694				CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.1206C>G	2.37:g.160994612G>C	ENSP00000283249:p.His402Gln	Somatic		Capture	Illumina GAIIx	4	160702858	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Missense_Mutation	SNP	HMMSmart_SM00423,HMMPfam_Integrin_beta,HMMSmart_SM00187,superfamily_Integrin domains,superfamily_vWA-like,PatternScan_EGF_1,superfamily_EGF/Laminin,HMMPfam_EGF_2,PatternScan_INTEGRIN_BETA,PatternScan_EGF_2,superfamily_Integrin beta tail domain,HMMPfam_Integrin_B_tail,HMMPfam_Integrin_b_cyt	p.H402Q	ENST00000283249.2	37	c.1206	CCDS2212.1	2	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505414	0.26949	.	.	ENSG00000115221	ENST00000283249;ENST00000428609;ENST00000409967;ENST00000409872	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.3	1.97	0.26223	Integrin beta subunit, N-terminal (2);	0.126162	0.53938	D	0.000041	T	0.37892	0.1020	N	0.16862	0.45	0.33330	D	0.568461	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.26950	-1.0088	10	0.29301	T	0.29	.	4.4625	0.11673	0.2816:0.1891:0.5293:0.0	.	360;402	E9PEE8;P18564	.;ITB6_HUMAN	Q	402;360;402;402	ENSP00000283249:H402Q;ENSP00000408024:H360Q;ENSP00000386828:H402Q;ENSP00000386367:H402Q	ENSP00000283249:H402Q	H	-	3	2	ITGB6	160702858	0.984000	0.35163	1.000000	0.80357	0.865000	0.49528	0.164000	0.16542	0.717000	0.32145	-0.145000	0.13849	CAC	-	HMMPfam_Integrin_beta,HMMSmart_SM00187,superfamily_Integrin domains		0.453	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB6	protein_coding	OTTHUMT00000255036.1	G	NM_000888		160702858	-1	no_errors	NM_000888	genbank	human	provisional	54_36p	missense	SNP	0.441	C
PSMC1P7	646085	genome.wustl.edu	37	3	161047501	161047501	+	IGR	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr3:161047501C>T								NMD3 (76181 upstream) : SPTSSB (15078 downstream)																							CATAGGTCTCCTGGGGAGTCT	0.478																																																0			3																																								162530195	SO:0001628	intergenic_variant	646085																															3.37:g.161047501C>T		Somatic		Capture	Illumina GAIIx	4	162530195		RNA	SNP	-	NULL		37	NULL		3																																																																																			-	-	0	0.478					LOC646085			C			162530195	-1	pseudogene	XR_017630	genbank	human	model	54_36p	rna	SNP	1.000	T
FIGN	55137	genome.wustl.edu	37	2	164467021	164467021	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr2:164467021G>T	ENST00000333129.3	-	3	1635	c.1321C>A	c.(1321-1323)Cca>Aca	p.P441T	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	441					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.P441T(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						CCTTGCATTGGGTGAGAGAGG	0.512																																																1	Substitution - Missense(1)	ovary(1)	2											115.0	117.0	116.0					2																	164467021		2149	4251	6400	164175267	SO:0001583	missense	55137			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1321C>A	2.37:g.164467021G>T	ENSP00000333836:p.Pro441Thr	Somatic		Capture	Illumina GAIIx	4	164175267	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_AAA,PatternScan_AAA	p.P441T	ENST00000333129.3	37	c.1321	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	G	3.664	-0.068943	0.07228	.	.	ENSG00000182263	ENST00000333129	D	0.92099	-2.97	6.04	2.1	0.27182	.	0.357334	0.33005	N	0.005399	T	0.81809	0.4901	N	0.08118	0	0.43852	D	0.99644	B	0.02656	0.0	B	0.01281	0.0	T	0.70288	-0.4913	10	0.39692	T	0.17	-1.6922	11.6091	0.51049	0.0:0.1138:0.4156:0.4706	.	441	Q5HY92	FIGN_HUMAN	T	441	ENSP00000333836:P441T	ENSP00000333836:P441T	P	-	1	0	FIGN	164175267	1.000000	0.71417	0.965000	0.40720	0.994000	0.84299	1.514000	0.35834	0.100000	0.17581	-0.261000	0.10672	CCA	-	NULL		0.512	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	protein_coding	OTTHUMT00000157220.2	G	NM_018086		164175267	-1	no_errors	NM_018086	genbank	human	validated	54_36p	missense	SNP	0.998	T
SCN3A	6328	genome.wustl.edu	37	2	165997453	165997453	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr2:165997453C>A	ENST00000360093.3	-	13	2218	c.1727G>T	c.(1726-1728)aGc>aTc	p.S576I	SCN3A_ENST00000409101.3_Missense_Mutation_p.S576I|SCN3A_ENST00000283254.7_Missense_Mutation_p.S576I	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	576					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACTGAAAATGCTTGTTTTGCT	0.468																																																0			2											79.0	70.0	73.0					2																	165997453		2203	4300	6503	165705699	SO:0001583	missense	6328			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1727G>T	2.37:g.165997453C>A	ENSP00000353206:p.Ser576Ile	Somatic		Capture	Illumina GAIIx	4	165705699	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,HMMSmart_IQ,HMMPfam_IQ	p.S576I	ENST00000360093.3	37	c.1727		2	.	.	.	.	.	.	.	.	.	.	C	28.6	4.932031	0.92389	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58	6.07	6.07	0.98685	Domain of unknown function DUF3451 (1);	0.000000	0.85682	D	0.000000	D	0.98121	0.9380	M	0.92555	3.32	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.997;0.999;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.996;0.996;0.996;0.981	D	0.98268	1.0502	10	0.87932	D	0	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	576;576;576;576;576	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	I	576	ENSP00000353206:S576I;ENSP00000283254:S576I;ENSP00000386726:S576I;ENSP00000403348:S576I	ENSP00000283254:S576I	S	-	2	0	SCN3A	165705699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.885000	0.99019	0.655000	0.94253	AGC	-	NULL		0.468	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	protein_coding		C	NM_006922		165705699	-1	no_errors	NM_006922	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DDX60	55601	genome.wustl.edu	37	4	169183863	169183863	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr4:169183863G>C	ENST00000393743.3	-	23	3406	c.3115C>G	c.(3115-3117)Caa>Gaa	p.Q1039E	DDX60_ENST00000505393.1_5'UTR	NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1039					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TTCCAAATTTGAAACATGGCA	0.343																																																0			4											91.0	96.0	94.0					4																	169183863		2203	4300	6503	169420438	SO:0001583	missense	55601			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.3115C>G	4.37:g.169183863G>C	ENSP00000377344:p.Gln1039Glu	Somatic		Capture	Illumina GAIIx	4	169420438	Q6PK35|Q9NVE3	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00487,HMMPfam_DEAD,HMMSmart_SM00490,HMMPfam_Helicase_C	p.Q1039E	ENST00000393743.3	37	c.3115	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	G	1.718	-0.497289	0.04291	.	.	ENSG00000137628	ENST00000393743;ENST00000537338	T	0.15256	2.44	5.2	-0.237	0.13061	.	0.788155	0.11371	N	0.570841	T	0.20088	0.0483	M	0.63428	1.95	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.28713	-1.0035	10	0.32370	T	0.25	.	15.7624	0.78096	0.0:0.7065:0.1889:0.1046	.	1039	Q8IY21	DDX60_HUMAN	E	1039;131	ENSP00000377344:Q1039E	ENSP00000377344:Q1039E	Q	-	1	0	DDX60	169420438	0.008000	0.16893	0.028000	0.17463	0.329000	0.28539	-0.332000	0.07904	-0.097000	0.12307	0.305000	0.20034	CAA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.343	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	protein_coding	OTTHUMT00000364622.1	G	NM_017631		169420438	-1	no_errors	NM_017631	genbank	human	validated	54_36p	missense	SNP	0.024	C
DOCK2	1794	genome.wustl.edu	37	5	169506008	169506008	+	Missense_Mutation	SNP	C	C	T	rs201322810		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr5:169506008C>T	ENST00000256935.8	+	49	5104	c.5024C>T	c.(5023-5025)aCg>aTg	p.T1675M	DOCK2_ENST00000520908.1_Missense_Mutation_p.T1167M|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.T736M	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1675					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCACCCAAGACGCCGAGAGTG	0.557													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19088	0.0		0.0	False		,,,				2504	0.0															0			5						C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	103.0	110.0	108.0		5024	4.1	0.0	5		108	0,8600		0,0,4300	yes	missense	DOCK2	NM_004946.2	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	1675/1831	169506008	1,13005	2203	4300	6503	169438586	SO:0001583	missense	1794			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5024C>T	5.37:g.169506008C>T	ENSP00000256935:p.Thr1675Met	Somatic		Capture	Illumina GAIIx	4	169438586	Q2M3I0|Q96AK7	Missense_Mutation	SNP	superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_Cytochrome c	p.T1675M	ENST00000256935.8	37	c.5024	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	C	13.36	2.213024	0.39102	2.27E-4	0.0	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.08546	3.73;3.37;3.08	4.92	4.05	0.47172	.	0.536026	0.18828	N	0.130075	T	0.05686	0.0149	N	0.14661	0.345	0.09310	N	0.999998	P;P;B	0.50156	0.661;0.932;0.349	B;B;B	0.38712	0.115;0.28;0.072	T	0.24835	-1.0149	10	0.51188	T	0.08	.	13.8967	0.63775	0.1538:0.8462:0.0:0.0	.	1167;231;1675	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	M	1675;1167;736	ENSP00000256935:T1675M;ENSP00000429283:T1167M;ENSP00000438827:T736M	ENSP00000256935:T1675M	T	+	2	0	DOCK2	169438586	0.069000	0.21087	0.008000	0.14137	0.128000	0.20619	1.306000	0.33505	1.195000	0.43115	0.650000	0.86243	ACG	-	NULL		0.557	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	C	NM_004946		169438586	+1	no_errors	NM_004946	genbank	human	validated	54_36p	missense	SNP	0.551	T
ASTN1	460	genome.wustl.edu	37	1	176833503	176833503	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:176833503G>A	ENST00000367654.3	-	23	4037	c.3826C>T	c.(3826-3828)Ctc>Ttc	p.L1276F	ASTN1_ENST00000361833.2_Missense_Mutation_p.L1268F|ASTN1_ENST00000367657.3_Intron	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1276					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCCCGGCTGAGCTCCGCCCAG	0.572																																																0			1											109.0	105.0	107.0					1																	176833503		2203	4300	6503	175100126	SO:0001583	missense	460			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3826C>T	1.37:g.176833503G>A	ENSP00000356626:p.Leu1276Phe	Somatic		Capture	Illumina GAIIx	4	175100126	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	HMMSmart_EGF,HMMSmart_MACPF,superfamily_FN_III-like,HMMSmart_FN3	p.L1268F	ENST00000367654.3	37	c.3802		1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885719	0.72410	.	.	ENSG00000152092	ENST00000361833;ENST00000367654	T;T	0.11930	2.73;2.73	4.61	4.61	0.57282	.	0.115692	0.64402	D	0.000015	T	0.16128	0.0388	L	0.27053	0.805	0.80722	D	1	P	0.51351	0.944	P	0.47470	0.548	T	0.02378	-1.1168	10	0.72032	D	0.01	-18.7185	17.4153	0.87498	0.0:0.0:1.0:0.0	.	1268	O14525-2	.	F	1268;1276	ENSP00000354536:L1268F;ENSP00000356626:L1276F	ENSP00000354536:L1268F	L	-	1	0	ASTN1	175100126	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.485000	0.66850	2.282000	0.76494	0.555000	0.69702	CTC	-	NULL		0.572	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	protein_coding		G	NM_004319		175100126	-1	no_errors	NM_004319	genbank	human	validated	54_36p	missense	SNP	1.000	A
SNCB	6620	genome.wustl.edu	37	5	176053739	176053739	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr5:176053739C>G	ENST00000310112.3	-	4	395	c.145G>C	c.(145-147)Gta>Cta	p.V49L	SNCB_ENST00000393693.2_Missense_Mutation_p.V49L|MIR4281_ENST00000580852.1_RNA|SNCB_ENST00000506696.1_Missense_Mutation_p.V49L|SNCB_ENST00000510387.1_Missense_Mutation_p.V49L	NM_001001502.1	NP_001001502.1	Q16143	SYUB_HUMAN	synuclein, beta	49	4 X 11 AA tandem repeats of [EGS]-K-T-K- [EQ]-[GQ]-V-X(4).				dopamine metabolic process (GO:0042417)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)|phospholipase inhibitor activity (GO:0004859)			breast(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	10	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACACCTTGTACCACACCTTCT	0.587																																																0			5											108.0	102.0	104.0					5																	176053739		2203	4300	6503	175986345	SO:0001583	missense	6620			AF053134	CCDS4406.1	5q35	2008-07-18			ENSG00000074317	ENSG00000074317			11140	protein-coding gene	gene with protein product		602569				7558013, 9806846	Standard	NM_003085		Approved		uc003meq.3	Q16143	OTTHUMG00000130661	ENST00000310112.3:c.145G>C	5.37:g.176053739C>G	ENSP00000308057:p.Val49Leu	Somatic		Capture	Illumina GAIIx	4	175986345	Q6IAX7	Missense_Mutation	SNP	HMMPfam_Synuclein	p.V49L	ENST00000310112.3	37	c.145	CCDS4406.1	5	.	.	.	.	.	.	.	.	.	.	C	14.10	2.434352	0.43224	.	.	ENSG00000074317	ENST00000310112;ENST00000393693;ENST00000510387;ENST00000506696	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	4.12	4.12	0.48240	.	0.495783	0.19595	N	0.110533	D	0.86838	0.6029	M	0.67700	2.07	0.42217	D	0.991835	B;B	0.30146	0.27;0.0	B;B	0.32533	0.147;0.001	D	0.87925	0.2706	10	0.72032	D	0.01	-17.8705	15.9004	0.79369	0.0:1.0:0.0:0.0	.	49;49	G4Y815;Q16143	.;SYUB_HUMAN	L	49	ENSP00000308057:V49L;ENSP00000377296:V49L;ENSP00000424073:V49L;ENSP00000422223:V49L	ENSP00000308057:V49L	V	-	1	0	SNCB	175986345	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.123000	0.57917	2.317000	0.78254	0.462000	0.41574	GTA	-	HMMPfam_Synuclein		0.587	SNCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCB	protein_coding	OTTHUMT00000253152.2	C	NM_001001502		175986345	-1	no_errors	NM_001001502	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HMCN1	83872	genome.wustl.edu	37	1	186094795	186094795	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:186094795A>C	ENST00000271588.4	+	82	12788	c.12559A>C	c.(12559-12561)Att>Ctt	p.I4187L	HMCN1_ENST00000367492.2_Missense_Mutation_p.I4187L	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4187	Ig-like C2-type 41.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTCACAAGCCATTCTTCCATG	0.413																																																0			1											95.0	95.0	95.0					1																	186094795		2203	4300	6503	184361418	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12559A>C	1.37:g.186094795A>C	ENSP00000271588:p.Ile4187Leu	Somatic		Capture	Illumina GAIIx	4	184361418	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	superfamily_vWA-like,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,HMMPfam_I-set,HMMSmart_SM00406,PatternScan_CECROPIN,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00682,HMMPfam_G2F,superfamily_GFP-like,PatternScan_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,HMMPfam_EGF_CA,PatternScan_EGF_2	p.I4187L	ENST00000271588.4	37	c.12559	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	A	6.468	0.454419	0.12283	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66460	-0.21;-0.21	5.04	-6.37	0.01963	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.742601	0.13636	N	0.373283	T	0.38374	0.1038	N	0.13043	0.29	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.39981	-0.9587	10	0.08837	T	0.75	.	10.9603	0.47381	0.2749:0.226:0.4991:0.0	.	4187	Q96RW7	HMCN1_HUMAN	L	4187	ENSP00000271588:I4187L;ENSP00000356462:I4187L	ENSP00000271588:I4187L	I	+	1	0	HMCN1	184361418	0.000000	0.05858	0.004000	0.12327	0.931000	0.56810	-1.104000	0.03326	-1.276000	0.02414	0.528000	0.53228	ATT	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408		0.413	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	A	NM_031935		184361418	+1	no_errors	NM_031935	genbank	human	reviewed	54_36p	missense	SNP	0.007	C
MCF2L2	23101	genome.wustl.edu	37	3	182941960	182941960	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr3:182941960A>C	ENST00000328913.3	-	19	2431	c.2134T>G	c.(2134-2136)Tat>Gat	p.Y712D	MCF2L2_ENST00000473233.1_Missense_Mutation_p.Y712D	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	712	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TATTTAAAATATATCTGAAGA	0.373																																																0			3											92.0	98.0	96.0					3																	182941960		2203	4300	6503	184424654	SO:0001583	missense	23101			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.2134T>G	3.37:g.182941960A>C	ENSP00000328118:p.Tyr712Asp	Somatic		Capture	Illumina GAIIx	4	184424654	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	HMMSmart_SM00516,superfamily_Spectrin repeat,HMMSmart_SM00150,superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325,superfamily_PH domain-like,HMMPfam_PH,HMMSmart_SM00233	p.Y712D	ENST00000328913.3	37	c.2134	CCDS3243.1	3	.	.	.	.	.	.	.	.	.	.	A	17.31	3.357135	0.61293	.	.	ENSG00000053524	ENST00000328913;ENST00000473233	T;T	0.69040	-0.37;-0.37	4.61	4.61	0.57282	Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000001	D	0.87200	0.6118	H	0.97940	4.11	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.90303	0.4331	10	0.87932	D	0	.	10.5888	0.45298	1.0:0.0:0.0:0.0	.	712	Q86YR7	MF2L2_HUMAN	D	712	ENSP00000328118:Y712D;ENSP00000420070:Y712D	ENSP00000328118:Y712D	Y	-	1	0	MCF2L2	184424654	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	4.253000	0.58791	2.067000	0.61834	0.460000	0.39030	TAT	-	superfamily_DBL homology domain (DH-domain),HMMPfam_RhoGEF,HMMSmart_SM00325		0.373	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCF2L2	protein_coding	OTTHUMT00000350868.1	A	NM_015078		184424654	-1	no_errors	NM_015078	genbank	human	validated	54_36p	missense	SNP	0.999	C
TPR	7175	genome.wustl.edu	37	1	186287710	186287710	+	Silent	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:186287710G>A	ENST00000367478.4	-	48	6986	c.6690C>T	c.(6688-6690)acC>acT	p.T2230T		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	2230					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AAGCATCAGAGGTGGTGCTCT	0.383			T	NTRK1	papillary thyroid																																		Dom	yes		1	1q25	7175	translocated promoter region		E	0			1											111.0	99.0	103.0					1																	186287710		1915	4134	6049	184554333	SO:0001819	synonymous_variant	7175			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.6690C>T	1.37:g.186287710G>A		Somatic		Capture	Illumina GAIIx	4	184554333	Q15655|Q5SWY0|Q99968	Silent	SNP	superfamily_Prefoldin,HMMPfam_TPR_MLP1_2	p.T2230	ENST00000367478.4	37	c.6690	CCDS41446.1	1																																																																																			-	NULL		0.383	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	protein_coding	OTTHUMT00000086353.2	G	NM_003292		184554333	-1	no_errors	NM_003292	genbank	human	reviewed	54_36p	silent	SNP	0.932	A
WDR53	348793	genome.wustl.edu	37	3	196288253	196288253	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr3:196288253C>T	ENST00000332629.5	-	3	661	c.94G>A	c.(94-96)Gat>Aat	p.D32N	WDR53_ENST00000433160.1_Intron|WDR53_ENST00000429115.1_Intron	NM_182627.1	NP_872433.1	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53	32										breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	13	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		GCCGTGAGATCTCCGCCCTCT	0.542																																																0			3											75.0	72.0	73.0					3																	196288253		2203	4300	6503	197772650	SO:0001583	missense	348793			BC054030	CCDS3318.1	3q29	2013-01-09			ENSG00000185798	ENSG00000185798		"""WD repeat domain containing"""	28786	protein-coding gene	gene with protein product		615110				12477932	Standard	NM_182627		Approved	MGC64882, MGC12928	uc003fwt.3	Q7Z5U6	OTTHUMG00000155572	ENST00000332629.5:c.94G>A	3.37:g.196288253C>T	ENSP00000328079:p.Asp32Asn	Somatic		Capture	Illumina GAIIx	4	197772650	A0MNP1	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.D32N	ENST00000332629.5	37	c.94	CCDS3318.1	3	.	.	.	.	.	.	.	.	.	.	C	11.19	1.564550	0.27915	.	.	ENSG00000185798	ENST00000332629;ENST00000456677;ENST00000425888	T;T;T	0.73469	1.63;-0.47;-0.75	6.02	5.1	0.69264	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.220980	0.45606	D	0.000355	T	0.65923	0.2738	L	0.29908	0.895	0.80722	D	1	B	0.27559	0.181	B	0.26969	0.075	T	0.66252	-0.5970	10	0.72032	D	0.01	-0.0106	16.8478	0.85985	0.0:0.8718:0.1282:0.0	.	32	Q7Z5U6	WDR53_HUMAN	N	32	ENSP00000328079:D32N;ENSP00000408087:D32N;ENSP00000396248:D32N	ENSP00000328079:D32N	D	-	1	0	WDR53	197772650	1.000000	0.71417	0.999000	0.59377	0.117000	0.20001	4.221000	0.58574	2.878000	0.98634	0.650000	0.86243	GAT	-	HMMSmart_SM00320,superfamily_WD40 repeat-like		0.542	WDR53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR53	protein_coding	OTTHUMT00000340689.1	C	NM_182627		197772650	-1	no_errors	NM_182627	genbank	human	provisional	54_36p	missense	SNP	0.955	T
PIK3C2B	5287	genome.wustl.edu	37	1	204403038	204403038	+	Silent	SNP	A	A	G			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:204403038A>G	ENST00000367187.3	-	26	4282	c.3726T>C	c.(3724-3726)taT>taC	p.Y1242Y	PIK3C2B_ENST00000424712.2_Silent_p.Y1214Y|RP11-739N20.2_ENST00000443515.1_RNA	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1242	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CGTTGATGACATACGCCATGT	0.552																																																0			1											107.0	94.0	98.0					1																	204403038		2203	4300	6503	202669661	SO:0001819	synonymous_variant	5287			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.3726T>C	1.37:g.204403038A>G		Somatic		Capture	Illumina GAIIx	4	202669661	O95666|Q5SW99	Silent	SNP	superfamily_Ubiquitin-like,HMMPfam_PI3K_rbd,HMMSmart_SM00144,HMMSmart_SM00142,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMPfam_PI3K_C2,superfamily_ARM repeat,HMMSmart_SM00145,HMMPfam_PI3Ka,superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2,superfamily_PX domain,HMMPfam_PX,HMMSmart_SM00312,HMMSmart_SM00239,HMMPfam_C2	p.Y1242	ENST00000367187.3	37	c.3726	CCDS1446.1	1																																																																																			-	superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146		0.552	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	protein_coding	OTTHUMT00000087965.1	A	NM_002646		202669661	-1	no_errors	NM_002646	genbank	human	reviewed	54_36p	silent	SNP	1.000	G
SNORA51	677831	genome.wustl.edu	37	1	228786244	228786244	+	RNA	SNP	G	G	C			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:228786244G>C	ENST00000384151.1	+	0	0				RNA5SP18_ENST00000390935.1_RNA					small nucleolar RNA, H/ACA box 51																		GGCCGTGATGGTGCTGAACTA	0.692																																																0			1																																								226852867			574029			AJ609477		20p13	2013-09-05			ENSG00000207427	ENSG00000271798		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32644	non-coding RNA	RNA, small nucleolar						15199136, 16381836	Standard	NR_002981		Approved	ACA51	uc002wgk.1				1.37:g.228786244G>C		Somatic		Capture	Illumina GAIIx	4	226852867		RNA	SNP	-	NULL	ENST00000384151.1	37	NULL		1																																																																																			-	-		0.692	SNORA51.6-201	NOVEL	basic	snoRNA	DUSP5P	snoRNA		G	NR_002981		226852867	+1	pseudogene	NR_002834	genbank	human	provisional	54_36p	rna	SNP	0.997	C
TARBP1	6894	genome.wustl.edu	37	1	234613920	234613920	+	Splice_Site	SNP	G	G	T	rs139752194		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:234613920G>T	ENST00000040877.1	-	1	929	c.930C>A	c.(928-930)aaC>aaA	p.N310K		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	310					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			GGCAGGTACCGTTTCCTTCCT	0.647																																																0			1											10.0	12.0	11.0					1																	234613920		2132	4215	6347	232680543	SO:0001630	splice_region_variant	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.931+1C>A	1.37:g.234613920G>T		Somatic		Capture	Illumina GAIIx	4	232680543	Q9H581	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_SSF75217,HMMPfam_SpoU_methylase	p.N310K	ENST00000040877.1	37	c.930	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	G	6.498	0.460055	0.12342	.	.	ENSG00000059588	ENST00000040877	T	0.05580	3.42	5.01	0.125	0.14718	.	1.049480	0.07398	N	0.890238	T	0.02494	0.0076	N	0.08118	0	0.20403	N	0.999901	B	0.02656	0.0	B	0.04013	0.001	T	0.44682	-0.9312	10	0.06236	T	0.91	-22.6729	2.2014	0.03924	0.1222:0.1492:0.4323:0.2962	.	310	Q13395	TARB1_HUMAN	K	310	ENSP00000040877:N310K	ENSP00000040877:N310K	N	-	3	2	TARBP1	232680543	0.328000	0.24687	0.037000	0.18230	0.550000	0.35303	0.428000	0.21395	-0.295000	0.08960	0.484000	0.47621	AAC	-	NULL		0.647	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	protein_coding	OTTHUMT00000092616.1	G	NM_005646	Missense_Mutation	232680543	-1	no_errors	NM_005646	genbank	human	reviewed	54_36p	missense	SNP	0.291	T
RYR2	6262	genome.wustl.edu	37	1	237754040	237754040	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr1:237754040G>A	ENST00000366574.2	+	31	4225	c.3908G>A	c.(3907-3909)cGc>cAc	p.R1303H	RYR2_ENST00000360064.6_Missense_Mutation_p.R1301H|RYR2_ENST00000542537.1_Missense_Mutation_p.R1287H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1303	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGTTTTATCGCCTGAGCATG	0.517																																																0			1																																								235820663	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3908G>A	1.37:g.237754040G>A	ENSP00000355533:p.Arg1303His	Somatic		Capture	Illumina GAIIx	4	235820663	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	HMMPfam_Ins145_P3_rec,HMMSmart_SM00472,HMMPfam_MIR,superfamily_MIR domain (Pfam 02815),HMMPfam_RYDR_ITPR,HMMPfam_SPRY,HMMSmart_SM00449,HMMPfam_RyR,HMMPfam_RIH_assoc,superfamily_EF-hand,HMMPfam_RR_TM4-6,HMMPfam_Ion_trans	p.R1303H	ENST00000366574.2	37	c.3908	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	g	16.48	3.134275	0.56828	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.98249	-4.82;-4.8;-4.81	5.03	5.03	0.67393	.	0.000000	0.56097	D	0.000032	D	0.97207	0.9087	M	0.78456	2.415	0.80722	D	1	P	0.34892	0.474	B	0.25884	0.064	D	0.97495	1.0056	10	0.87932	D	0	.	18.915	0.92501	0.0:0.0:1.0:0.0	.	1303	Q92736	RYR2_HUMAN	H	1303;1301;1287	ENSP00000355533:R1303H;ENSP00000353174:R1301H;ENSP00000443798:R1287H	ENSP00000353174:R1301H	R	+	2	0	RYR2	235820663	1.000000	0.71417	0.978000	0.43139	0.226000	0.24999	9.597000	0.98273	2.777000	0.95525	0.655000	0.94253	CGC	-	NULL		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	G	NM_001035		235820663	+1	no_errors	NM_001035	genbank	human	reviewed	54_36p	missense	SNP	0.877	A
ALLC	55821	genome.wustl.edu	37	2	3749152	3749154	+	In_Frame_Del	DEL	GAA	GAA	-	rs34308920|rs66473381|rs201406139|rs397869421|rs200664184	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	GAA	GAA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr2:3749152_3749154delGAA	ENST00000252505.3	+	11	1063_1065	c.901_903delGAA	c.(901-903)gaadel	p.E303del	ALLC_ENST00000471711.1_3'UTR|AC010907.5_ENST00000441632.1_RNA	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	322					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)	p.E301delE(2)		breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		GACAACTCAGGAAGAAGAAGCCG	0.512										HNSCC(21;0.051)				2063	0.411941	0.621	0.2997	5008	,	,		17803	0.3284		0.4404	False		,,,				2504	0.2658															2	Deletion - In frame(2)	upper_aerodigestive_tract(1)|breast(1)	2								2273,1463		704,865,299						0.4	0.2		dbSNP_130	58	3628,4278		863,1902,1188	no	coding	ALLC	NM_018436.3		1567,2767,1487	A1A1,A1R,RR		45.8892,39.1595,49.3128				5901,5741				3727029	SO:0001651	inframe_deletion	55821			AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.901_903delGAA	2.37:g.3749158_3749160delGAA	ENSP00000252505:p.Glu303del	Somatic		Capture	Illumina GAIIx	4	3727027	Q53T95|Q5RL81|Q96RE6|Q9NZA7	In_Frame_Del	DEL	superfamily_Gal_bind_like,HMMPfam_Allantoicase	p.E303in_frame_del	ENST00000252505.3	37	c.901_903	CCDS46223.1	2																																																																																			(deletion:cds_exon[3726977,3727101])	superfamily_Gal_bind_like,HMMPfam_Allantoicase		0.512	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALLC	protein_coding	OTTHUMT00000322855.1	GAA			3727029	+1	no_errors	NM_018436	genbank	human	validated	54_36p	in_frame_del	DEL	0.866:0.921:0.929	-
ELAVL3	1995	genome.wustl.edu	37	19	11569102	11569125	+	Splice_Site	DEL	CTGCCAGGGGGCAGGGATGTCCAT	CTGCCAGGGGGCAGGGATGTCCAT	-	rs370267373		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	CTGCCAGGGGGCAGGGATGTCCAT	CTGCCAGGGGGCAGGGATGTCCAT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr19:11569102_11569125delCTGCCAGGGGGCAGGGATGTCCAT	ENST00000359227.3	-	5	912		c.e5-1		ELAVL3_ENST00000438662.2_Splice_Site	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3						cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						CGAGAGACACCTGCCAGGGGGCAGGGATGTCCATCACGACGACC	0.598																																																0			19																																								11430125	SO:0001630	splice_region_variant	1995				CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.488-1ATGGACATCCCTGCCCCCTGGCAG>-	19.37:g.11569102_11569125delCTGCCAGGGGGCAGGGATGTCCAT		Somatic		Capture	Illumina GAIIx	4	11430102	Q16135|Q96CL8|Q96QS9	Splice_Site	DEL	-	e5-1	ENST00000359227.3	37	c.488-24_488-1	CCDS32912.1	19																																																																																			(deletion:intron[11430102,11430272])	-		0.598	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELAVL3	protein_coding	OTTHUMT00000458827.2	CTGCCAGGGGGCAGGGATGTCCAT	NM_001420	Intron	11430125	-1	no_errors	NM_001420	genbank	human	reviewed	54_36p	splice_site_del	DEL	1.000:1.000:0.998:0.245:0.027:0.000:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.002:0.025:0.046:0.000:0.000:0.001:0.001:0.001:0.001:0.000:0.000	-
CTPS2	56474	genome.wustl.edu	37	X	16716458	16716482	+	Splice_Site	DEL	AACTGTAGAAAGAAGTATTAATACA	AACTGTAGAAAGAAGTATTAATACA	-	rs367875778|rs191710086		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	AACTGTAGAAAGAAGTATTAATACA	AACTGTAGAAAGAAGTATTAATACA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chrX:16716458_16716482delAACTGTAGAAAGAAGTATTAATACA	ENST00000443824.1	-	4	1081_1082	c.338_339delTGTATTAATACTTCTTTCTACAGTT	c.(337-339)gtg>g	p.V114fs	CTPS2_ENST00000359276.4_Splice_Site_p.V114fs|CTPS2_ENST00000380241.3_Splice_Site_p.V114fs	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	114					'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					TGTGAGGGACAACTGTAGAAAGAAGTATTAATACAAAAGTTTATT	0.422																																																0			X																																								16626403	SO:0001630	splice_region_variant	56474			AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.338-1TGTATTAATACTTCTTTCTACAGTT>-	X.37:g.16716458_16716482delAACTGTAGAAAGAAGTATTAATACA		Somatic		Capture	Illumina GAIIx	4	16626379	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Frame_Shift_Del	DEL	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_CTP_synth_N,superfamily_Class I glutamine amidotransferase-like,HMMPfam_GATase	p.V113fs	ENST00000443824.1	37	c.339_338	CCDS14175.1	X																																																																																			(deletion:cds_exon[16626280,16626380], intron[16626381,16626966])	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_CTP_synth_N		0.422	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS2	protein_coding	OTTHUMT00000055906.1	AACTGTAGAAAGAAGTATTAATACA	NM_019857	Frame_Shift_Del	16626403	-1	no_errors	NM_019857	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.999:1.000	-
Unknown	0	genome.wustl.edu	37	6	29855581	29855586	+	IGR	DEL	CCCTGA	CCCTGA	-	rs71815816|rs115805339|rs199733457|rs59958576|rs201936605	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	CCCTGA	CCCTGA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr6:29855581_29855586delCCCTGA								HLA-G (56679 upstream) : HLA-A (53450 downstream)																							GGGGCCCTGGCCCTGACCCTGACCCA	0.718														3859	0.770567	0.7088	0.7622	5008	,	,		10339	0.876		0.7197	False		,,,				2504	0.8037															0			6																																								29963565	SO:0001628	intergenic_variant	0																															6.37:g.29855587_29855592delCCCTGA		Somatic		Capture	Illumina GAIIx	4	29963560		In_Frame_Del	DEL	HMMPfam_MHC_I,superfamily_MHC antigen-recognition domain,superfamily_Immunoglobulin,HMMPfam_C1-set,HMMSmart_SM00407,PatternScan_IG_MHC,HMMPfam_MHC_I_C	p.LT21in_frame_del		37	c.53_58		6																																																																																			(deletion:cds_exon[29963508,29963586])	NULL	0	0.718					ENSG00000196306			CCCTGA			29963565	+1	no_errors	ENST00000360432	ensembl	human	known	54_36p	in_frame_del	DEL	0.006:0.005:0.008:0.010:0.007:0.004	-
RALY	22913	genome.wustl.edu	37	20	32664864	32664865	+	In_Frame_Ins	INS	-	-	CAG	rs10649600|rs57852506	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr20:32664864_32664865insCAG	ENST00000246194.3	+	8	1191_1192	c.689_690insCAG	c.(688-693)gccggc>gcCAGcggc	p.230_231AG>ASG	RALY_ENST00000375114.3_In_Frame_Ins_p.214_215AG>ASG	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	230	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.			A -> AS (in Ref. 2; AAC28898). {ECO:0000305}.	mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						GGAggtggcgccggcggcggcg	0.658																																																0			20																																								32128526	SO:0001652	inframe_insertion	22913			AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	Exception_encountered	20.37:g.32664864_32664865insCAG	ENSP00000246194:p.Ala230_Gly231insSer	Somatic		Capture	Illumina GAIIx	4	32128525	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	In_Frame_Ins	INS	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.231in_frame_insS	ENST00000246194.3	37	c.689_690	CCDS13230.1	20																																																																																			-	NULL		0.658	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALY	protein_coding	OTTHUMT00000078753.1	-			32128526	+1	no_errors	NM_016732	genbank	human	reviewed	54_36p	in_frame_ins	INS	0.001:0.002	CAG
CARD10	29775	genome.wustl.edu	37	22	37906309	37906314	+	In_Frame_Del	DEL	CTCCTT	CTCCTT	-	rs113275238|rs60611523	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	CTCCTT	CTCCTT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr22:37906309_37906314delCTCCTT	ENST00000403299.1	-	5	1030_1035	c.814_819delAAGGAG	c.(814-819)aaggagdel	p.KE272del	CARD10_ENST00000406271.3_5'Flank|CARD10_ENST00000494166.1_5'UTR|CARD10_ENST00000251973.5_In_Frame_Del_p.KE272del			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	272					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					CATTGTCTGGctccttctccttctcc	0.631														1551	0.309704	0.4743	0.2536	5008	,	,		16347	0.3036		0.2535	False		,,,				2504	0.1912															0			22																																								36236260	SO:0001651	inframe_deletion	29775			AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.814_819delAAGGAG	22.37:g.37906315_37906320delCTCCTT	ENSP00000384570:p.Lys272_Glu273del	Somatic		Capture	Illumina GAIIx	4	36236255	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	In_Frame_Del	DEL	superfamily_DEATH_like,HMMPfam_CARD,superfamily_SSF52540	p.KE272in_frame_del	ENST00000403299.1	37	c.819_814	CCDS13948.1	22																																																																																			(deletion:cds_exon[36236165,36236374])	NULL		0.631	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD10	protein_coding	OTTHUMT00000318997.1	CTCCTT	NM_014550		36236260	-1	no_errors	NM_014550	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.883:0.892:0.901:0.911:0.921:0.932	-
TTBK1	84630	genome.wustl.edu	37	6	43250726	43250728	+	In_Frame_Del	DEL	GAA	GAA	-	rs373093693|rs113160341	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	GAA	GAA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr6:43250726_43250728delGAA	ENST00000259750.4	+	14	2331_2333	c.2248_2250delGAA	c.(2248-2250)gaadel	p.E771del		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	771	Glu-rich.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			agaggatgaggaagaagaagagg	0.596														1066	0.212859	0.3041	0.1988	5008	,	,		16464	0.1131		0.172	False		,,,				2504	0.2444															0			6								1250,3010		180,890,1060						2.3	0.3		dbSNP_132	18	1640,6596		164,1312,2642	no	coding	TTBK1	NM_032538.1		344,2202,3702	A1A1,A1R,RR		19.9126,29.3427,23.1274				2890,9606				43358706	SO:0001651	inframe_deletion	84630			AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.2248_2250delGAA	6.37:g.43250732_43250734delGAA	ENSP00000259750:p.Glu771del	Somatic		Capture	Illumina GAIIx	4	43358704	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	In_Frame_Del	DEL	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ATP	p.E753in_frame_del	ENST00000259750.4	37	c.2248_2250	CCDS34455.1	6																																																																																			(deletion:cds_exon[43358443,43360028])	NULL		0.596	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK1	protein_coding	OTTHUMT00000040584.3	GAA			43358706	+1	no_errors	NM_032538	genbank	human	validated	54_36p	in_frame_del	DEL	0.944:0.724:0.281	-
MOAP1	64112	genome.wustl.edu	37	14	93650125	93650141	+	Frame_Shift_Del	DEL	GCTGAAGAGCCTCTAAT	GCTGAAGAGCCTCTAAT	-	rs148364724		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	GCTGAAGAGCCTCTAAT	GCTGAAGAGCCTCTAAT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr14:93650125_93650141delGCTGAAGAGCCTCTAAT	ENST00000556883.1	-	2	931_947	c.447_463delATTAGAGGCTCTTCAGC	c.(445-465)gcattagaggctcttcagcctfs	p.LEALQP150fs	RP11-371E8.4_ENST00000557574.1_5'Flank|MOAP1_ENST00000298894.4_Frame_Shift_Del_p.LEALQP150fs|TMEM251_ENST00000283534.4_5'Flank|TMEM251_ENST00000415050.2_5'Flank			Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1	150					apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	13		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		tgcagggcaggctgaagagcctctaatgcctgtgcca	0.516																																																0			14																																								92719894	SO:0001589	frameshift_variant	64112			BC015044	CCDS9908.1	14q32.12	2012-02-09			ENSG00000165943	ENSG00000165943		"""Paraneoplastic Ma antigens"""	16658	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 4"""	609485				11060313	Standard	NM_022151		Approved	MAP-1, PNMA4	uc001ybj.3	Q96BY2	OTTHUMG00000169184	ENST00000556883.1:c.447_463delATTAGAGGCTCTTCAGC	14.37:g.93650125_93650141delGCTGAAGAGCCTCTAAT	ENSP00000451594:p.Leu150fs	Somatic		Capture	Illumina GAIIx	4	92719878	B2RDF6|Q9H833|Q9HAS1	Frame_Shift_Del	DEL	NULL	p.L150fs	ENST00000556883.1	37	c.463_447	CCDS9908.1	14																																																																																			(deletion:cds_exon[92719285,92720340])	NULL		0.516	MOAP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MOAP1	protein_coding	OTTHUMT00000412685.1	GCTGAAGAGCCTCTAAT			92719894	-1	no_errors	NM_022151	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.967:0.967:0.962:0.918:0.885:0.811:0.641:0.007:0.005:0.002:0.000:0.000:0.001:0.003:0.267:0.282:0.347	-
ZAN	7455	genome.wustl.edu	37	7	100385562	100385596	+	RNA	DEL	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	-	rs549519838|rs369526619|rs112538235|rs373952854|rs113714278|rs72364644|rs59541653	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr7:100385562_100385596delGCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	ENST00000348028.3	+	0	7195_7229				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACATTTGACGGCTTCAGCTACCGCTTGCAAGGCCGCATGACCTATGTTCTGATCA	0.583														1187	0.237021	0.1029	0.2752	5008	,	,		26483	0.0327		0.5388	False		,,,				2504	0.2914															0			7							,	590,3208		88,414,1397					,	-3.1	0.0		dbSNP_130	52	3589,4247		975,1639,1304	no	frameshift,frameshift	ZAN	NM_173059.1,NM_003386.1	,	1063,2053,2701	A1A1,A1R,RR		45.8014,15.5345,35.9206	,	,		4179,7455				100223532			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100385562_100385596delGCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT		Somatic		Capture	Illumina GAIIx	4	100223498	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Frame_Shift_Del	DEL	HMMSmart_SM00137,HMMPfam_MAM,PatternScan_MAM_1,superfamily_Serine proterase inhibitors,HMMPfam_TIL,PatternScan_EGF_2,HMMSmart_SM00215,HMMPfam_TIL_assoc,HMMSmart_SM00216,HMMPfam_VWD,HMMPfam_C8,HMMSmart_SM00181,HMMSmart_SM00214,superfamily_EGF/Laminin,HMMPfam_EGF,PatternScan_EGF_1	p.F2344fs	ENST00000348028.3	37	c.7028_7062		7																																																																																			(deletion:cds_exon[100223447,100223694])	HMMSmart_SM00216,HMMPfam_VWD		0.583	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	polymorphic_pseudogene	OTTHUMT00000347214.1	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	NM_003386		100223532	+1	no_errors	ENST00000349350	ensembl	human	known	54_36p	frame_shift_del	DEL	0.088:0.076:0.047:0.031:0.008:0.004:0.007:0.317:0.790:0.908:0.967:0.964:0.963:0.997:1.000:0.999:0.997:0.968:0.891:0.954:1.000:1.000:1.000:0.999:0.998:0.998:1.000:0.999:1.000:1.000:1.000:1.000:1.000:0.990:0.736	-
GOT1	2805	genome.wustl.edu	37	10	101180491	101180509	+	Frame_Shift_Del	DEL	CATTAGCAATCTTCTGCTC	CATTAGCAATCTTCTGCTC	-	rs376034578|rs201941343		TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	CATTAGCAATCTTCTGCTC	CATTAGCAATCTTCTGCTC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr10:101180491_101180509delCATTAGCAATCTTCTGCTC	ENST00000370508.5	-	2	199_217	c.172_190delGAGCAGAAGATTGCTAATG	c.(172-192)gagcagaagattgctaatgacfs	p.EQKIAND58fs	GOT1_ENST00000543866.1_Frame_Shift_Del_p.EQKIAND37fs|GOT1_ENST00000471741.1_5'UTR	NM_002079.2	NP_002070.1	P17174	AATC_HUMAN	glutamic-oxaloacetic transaminase 1, soluble	58					2-oxoglutarate metabolic process (GO:0006103)|aspartate biosynthetic process (GO:0006532)|aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|carbohydrate metabolic process (GO:0005975)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to insulin stimulus (GO:0032869)|fatty acid homeostasis (GO:0055089)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glutamate catabolic process to 2-oxoglutarate (GO:0019551)|glutamate catabolic process to aspartate (GO:0019550)|glutamate metabolic process (GO:0006536)|glycerol biosynthetic process (GO:0006114)|L-methionine biosynthetic process from methylthioadenosine (GO:0019509)|oxaloacetate metabolic process (GO:0006107)|polyamine metabolic process (GO:0006595)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	carboxylic acid binding (GO:0031406)|L-aspartate:2-oxoglutarate aminotransferase activity (GO:0004069)|L-cysteine:2-oxoglutarate aminotransferase activity (GO:0047801)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|phosphatidylserine decarboxylase activity (GO:0004609)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)	16		Ovarian(717;0.028)|Colorectal(252;0.234)		Epithelial(162;4.76e-10)|all cancers(201;3.84e-08)	L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)	AGGCTATTGTCATTAGCAATCTTCTGCTCCACTTTCTTC	0.507																																					Melanoma(173;770 3544 21601)											0			10																																								101170499	SO:0001589	frameshift_variant	2805			M37400	CCDS7479.1	10q24.1-q25.1	2013-05-29	2013-05-29		ENSG00000120053	ENSG00000120053	2.6.1.1		4432	protein-coding gene	gene with protein product	"""aspartate aminotransferase 1"", ""aspartate transaminase 1"""	138180	"""glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1)"""			1974457	Standard	NM_002079		Approved		uc001kpr.3	P17174	OTTHUMG00000018882	ENST00000370508.5:c.172_190delGAGCAGAAGATTGCTAATG	10.37:g.101180491_101180509delCATTAGCAATCTTCTGCTC	ENSP00000359539:p.Glu58fs	Somatic		Capture	Illumina GAIIx	4	101170481	B2R6R7|B7Z7E9|Q5VW80	Frame_Shift_Del	DEL	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_1_2,PatternScan_AA_TRANSFER_CLASS_1	p.E58fs	ENST00000370508.5	37	c.190_172	CCDS7479.1	10																																																																																			(deletion:cds_exon[101170371,101170552])	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_1_2		0.507	GOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOT1	protein_coding	OTTHUMT00000049794.1	CATTAGCAATCTTCTGCTC	NM_002079		101170499	-1	no_errors	NM_002079	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.893:0.005:0.024:0.031:0.067:0.984:0.997:0.995:1.000:1.000:1.000:0.998:0.994:0.996:1.000:1.000:1.000:1.000:1.000	-
ATM	472	genome.wustl.edu	37	11	108178698	108178718	+	Splice_Site	DEL	AGAAGACAAAAGAGGTAATGT	AGAAGACAAAAGAGGTAATGT	-	rs148064985|rs377289524	byFrequency	TCGA-61-1727-01A-01W-0639-09	TCGA-61-1727-11A-01W-0639-09	AGAAGACAAAAGAGGTAATGT	AGAAGACAAAAGAGGTAATGT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a937f182-b6f2-4c03-acec-95f76d7bf20c	98704722-7d91-4cee-a64f-cdf4de6c0658	g.chr11:108178698_108178718delAGAAGACAAAAGAGGTAATGT	ENST00000452508.2	+	39	5938_5951	c.5749_5762delAGAAGACAAAAGAGGTAATGT	c.(5749-5763)agaagacaaaagagg>g	p.RRQKR1917del	ATM_ENST00000278616.4_Splice_Site_p.RRQKR1917del			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1917					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGACTACATGAGAAGACAAAAGAGGTAATGTAATGAGTGTT	0.362			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0			11	GRCh37	CM980145	ATM	M																																				107683928	SO:0001630	splice_region_variant	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.5762+1AGAAGACAAAAGAGGTAATGT>-	11.37:g.108178698_108178718delAGAAGACAAAAGAGGTAATGT		Somatic		Capture	Illumina GAIIx	4	107683908	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Frame_Shift_Del	DEL	superfamily_ARM repeat,HMMPfam_FAT,superfamily_Protein kinase-like (PK-like),HMMPfam_PI3_PI4_kinase,HMMSmart_SM00146,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2,HMMPfam_FATC	p.R1917fs	ENST00000452508.2	37	c.5749_5762	CCDS31669.1	11																																																																																			(deletion:cds_exon[107683834,107683921], intron[107683922,107686096])	superfamily_ARM repeat		0.362	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	protein_coding	OTTHUMT00000389938.1	AGAAGACAAAAGAGGTAATGT	NM_000051	In_Frame_Del	107683928	+1	no_errors	NM_000051	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
