#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CLDN6	9074	genome.wustl.edu	37	16	3065899	3065899	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr16:3065899C>T	ENST00000396925.1	-	3	552	c.124G>A	c.(124-126)Gtg>Atg	p.V42M	TNFRSF12A_ENST00000573001.1_5'Flank|CLDN6_ENST00000328796.4_Missense_Mutation_p.V42M|CLDN6_ENST00000572154.1_Intron			P56747	CLD6_HUMAN	claudin 6	42					calcium-independent cell-cell adhesion (GO:0016338)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	10						ACCTGGGCCACCACGATGCTG	0.637																																																0			16											137.0	107.0	117.0					16																	3065899		2198	4300	6498	3005900	SO:0001583	missense	9074			AJ249735	CCDS10488.1	16p13.3	2008-08-01			ENSG00000184697	ENSG00000184697		"""Claudins"""	2048	protein-coding gene	gene with protein product		615798				9892664, 18234789	Standard	NM_021195		Approved		uc002csu.4	P56747	OTTHUMG00000128999	ENST00000396925.1:c.124G>A	16.37:g.3065899C>T	ENSP00000380131:p.Val42Met	Somatic		Capture	Illumina GAIIx	4	3005900	B3KQP9|D3DUA5	Missense_Mutation	SNP	HMMPfam_PMP22_Claudin,PatternScan_CLAUDIN	p.V42M	ENST00000396925.1	37	c.124	CCDS10488.1	16	.	.	.	.	.	.	.	.	.	.	C	16.26	3.071783	0.55646	.	.	ENSG00000184697	ENST00000396925;ENST00000328796	D;D	0.84298	-1.83;-1.83	4.61	4.61	0.57282	.	0.151595	0.43260	D	0.000597	D	0.87091	0.6091	M	0.84326	2.69	0.31720	N	0.638381	P	0.47034	0.889	B	0.43082	0.407	D	0.90438	0.4429	10	0.66056	D	0.02	.	15.3138	0.74056	0.0:1.0:0.0:0.0	.	42	P56747	CLD6_HUMAN	M	42	ENSP00000380131:V42M;ENSP00000328674:V42M	ENSP00000328674:V42M	V	-	1	0	CLDN6	3005900	0.067000	0.21026	1.000000	0.80357	0.996000	0.88848	0.165000	0.16564	2.557000	0.86248	0.655000	0.94253	GTG	-	HMMPfam_PMP22_Claudin		0.637	CLDN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN6	protein_coding	OTTHUMT00000250988.1	C	NM_021195		3005900	-1	no_errors	NM_021195	genbank	human	validated	54_36p	missense	SNP	0.986	T
WSCD1	23302	genome.wustl.edu	37	17	5991415	5991415	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr17:5991415G>T	ENST00000574946.1	+	3	923	c.533G>T	c.(532-534)tGt>tTt	p.C178F	WSCD1_ENST00000574232.1_Missense_Mutation_p.C178F|WSCD1_ENST00000539421.1_Missense_Mutation_p.C178F|WSCD1_ENST00000317744.5_Missense_Mutation_p.C178F|WSCD1_ENST00000573634.1_Missense_Mutation_p.C62F			Q658N2	WSCD1_HUMAN	WSC domain containing 1	178	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						CAGGATGCGTGTGCTGAGCGG	0.532																																																0			17											124.0	105.0	111.0					17																	5991415		2203	4300	6503	5932139	SO:0001583	missense	23302				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.533G>T	17.37:g.5991415G>T	ENSP00000460825:p.Cys178Phe	Somatic		Capture	Illumina GAIIx	4	5932139	A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	HMMSmart_WSC,HMMPfam_WSC,superfamily_SSF52540	p.C178F	ENST00000574946.1	37	c.533	CCDS32538.1	17	.	.	.	.	.	.	.	.	.	.	G	21.9	4.220433	0.79464	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	D;D	0.81821	-1.54;-1.54	5.83	5.83	0.93111	Carbohydrate-binding WSC (2);Carbohydrate-binding WSC, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.94748	0.8305	H	0.99425	4.56	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.96765	0.9564	10	0.87932	D	0	-22.5436	17.61	0.88050	0.0:0.0:1.0:0.0	.	178	Q658N2	WSCD1_HUMAN	F	178	ENSP00000323087:C178F;ENSP00000446032:C178F	ENSP00000323087:C178F	C	+	2	0	WSCD1	5932139	1.000000	0.71417	0.734000	0.30879	0.779000	0.44077	8.459000	0.90367	2.756000	0.94617	0.655000	0.94253	TGT	-	HMMSmart_WSC,HMMPfam_WSC		0.532	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSCD1	protein_coding	OTTHUMT00000438965.4	G	NM_015253		5932139	+1	no_errors	NM_015253	genbank	human	validated	54_36p	missense	SNP	1.000	T
KCNAB2	8514	genome.wustl.edu	37	1	6132838	6132838	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:6132838G>A	ENST00000164247.1	+	4	707	c.143G>A	c.(142-144)cGg>cAg	p.R48Q	KCNAB2_ENST00000458166.2_5'UTR|KCNAB2_ENST00000378087.3_Missense_Mutation_p.R48Q|KCNAB2_ENST00000352527.1_Missense_Mutation_p.R34Q|KCNAB2_ENST00000602612.1_Missense_Mutation_p.R48Q|KCNAB2_ENST00000378097.1_Missense_Mutation_p.R48Q|KCNAB2_ENST00000378083.3_Missense_Mutation_p.R81Q|KCNAB2_ENST00000378092.1_Missense_Mutation_p.R34Q|KCNAB2_ENST00000341524.1_Missense_Mutation_p.R48Q|KCNAB2_ENST00000378111.1_Missense_Mutation_p.R48Q	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2	48					hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.R48P(1)		large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGGCCTGCGGGTCTCCTGC	0.647																																																1	Substitution - Missense(1)	skin(1)	1											131.0	124.0	126.0					1																	6132838		2203	4300	6503	6055425	SO:0001583	missense	8514			U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.143G>A	1.37:g.6132838G>A	ENSP00000164247:p.Arg48Gln	Somatic		Capture	Illumina GAIIx	4	6055425	A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Missense_Mutation	SNP	superfamily_NAD(P)-linked oxidoreductase,HMMPfam_Aldo_ket_red	p.R48Q	ENST00000164247.1	37	c.143	CCDS55.1	1	.	.	.	.	.	.	.	.	.	.	-	27.1	4.797682	0.90538	.	.	ENSG00000069424	ENST00000378111;ENST00000378097;ENST00000378092;ENST00000445501;ENST00000428161;ENST00000389632;ENST00000378087;ENST00000341524;ENST00000352527;ENST00000435937;ENST00000164247;ENST00000378083	T;T;T;T;T;T;T;T;T;T;T	0.47528	0.84;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	4.71	4.71	0.59529	NADP-dependent oxidoreductase domain (2);	0.000000	0.85682	D	0.000000	T	0.47358	0.1441	N	0.08118	0	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;0.999;0.512	D;P;P;B	0.74674	0.984;0.834;0.751;0.04	T	0.48445	-0.9035	10	0.20519	T	0.43	-43.4851	17.0504	0.86517	0.0:0.0:1.0:0.0	.	81;34;48;48	Q13303-3;Q13303-2;Q13303;Q2YD85	.;.;KCAB2_HUMAN;.	Q	48;48;34;48;34;48;48;48;34;34;48;81	ENSP00000367351:R48Q;ENSP00000367337:R48Q;ENSP00000367332:R34Q;ENSP00000400285:R34Q;ENSP00000374283:R48Q;ENSP00000367327:R48Q;ENSP00000340824:R48Q;ENSP00000318772:R34Q;ENSP00000389151:R34Q;ENSP00000164247:R48Q;ENSP00000367323:R81Q	ENSP00000164247:R48Q	R	+	2	0	KCNAB2	6055425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.520000	0.90566	2.315000	0.78130	0.552000	0.68991	CGG	-	superfamily_NAD(P)-linked oxidoreductase,HMMPfam_Aldo_ket_red		0.647	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	KCNAB2	protein_coding	OTTHUMT00000002114.3	G	NM_172130		6055425	+1	no_errors	NM_003636	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
RPL22	6146	genome.wustl.edu	37	1	6246830	6246830	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:6246830G>A	ENST00000234875.4	-	4	327	c.289C>T	c.(289-291)Cgt>Tgt	p.R97C	RPL22_ENST00000484532.1_Intron|RPL22_ENST00000497965.1_Missense_Mutation_p.R64C	NM_000983.3	NP_000974.1	P35268	RL22_HUMAN	ribosomal protein L22	97					alpha-beta T cell differentiation (GO:0046632)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	Ovarian(185;0.0634)	all_cancers(23;2.78e-38)|all_epithelial(116;8.88e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.53e-38)|GBM - Glioblastoma multiforme(13;3.33e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.8e-19)|Colorectal(212;6.8e-08)|COAD - Colon adenocarcinoma(227;8.04e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		AACCAGTCACGTAGATTATTC	0.393			T	RUNX1	"""AML, CML"""																																		Dom	yes		1	1p36.31	6146	ribosomal protein L22 (EAP)		L	0			1											30.0	31.0	31.0					1																	6246830		2200	4295	6495	6169417	SO:0001583	missense	6146			BC058887	CCDS58.1	1p36.31	2011-04-06			ENSG00000116251	ENSG00000116251		"""L ribosomal proteins"""	10315	protein-coding gene	gene with protein product		180474				8395054	Standard	NM_000983		Approved	EAP, L22	uc001amd.3	P35268	OTTHUMG00000000953	ENST00000234875.4:c.289C>T	1.37:g.6246830G>A	ENSP00000346088:p.Arg97Cys	Somatic		Capture	Illumina GAIIx	4	6169417	B2R495|Q6IBD1	Missense_Mutation	SNP	HMMPfam_Ribosomal_L22e	p.R97C	ENST00000234875.4	37	c.289	CCDS58.1	1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633954	0.67130	.	.	ENSG00000116251	ENST00000234875	T	0.60171	0.21	5.43	5.43	0.79202	.	0.104546	0.64402	D	0.000005	T	0.66848	0.2831	M	0.86953	2.85	0.80722	D	1	B	0.12630	0.006	B	0.10450	0.005	T	0.67684	-0.5607	10	0.66056	D	0.02	-13.9147	19.2292	0.93831	0.0:0.0:1.0:0.0	.	97	P35268	RL22_HUMAN	C	97	ENSP00000346088:R97C	ENSP00000346088:R97C	R	-	1	0	RPL22	6169417	1.000000	0.71417	0.411000	0.26484	0.990000	0.78478	7.469000	0.80959	2.535000	0.85469	0.462000	0.41574	CGT	-	HMMPfam_Ribosomal_L22e		0.393	RPL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL22	protein_coding	OTTHUMT00000002830.1	G	NM_000983		6169417	-1	no_errors	NM_000983	genbank	human	reviewed	54_36p	missense	SNP	0.976	A
FLJ33360	401172	genome.wustl.edu	37	5	6312543	6312543	+	lincRNA	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr5:6312543G>A	ENST00000507444.1	-	0	429					NR_028351.1																						CAGCCTGGCAGGCAGCACTGG	0.597																																																0			5											27.0	31.0	30.0					5																	6312543		1984	4172	6156	6365543			401172																															5.37:g.6312543G>A		Somatic		Capture	Illumina GAIIx	4	6365543		Silent	SNP	NULL	p.A111	ENST00000507444.1	37	c.333		5																																																																																			-	NULL		0.597	CTD-2324F15.2-001	KNOWN	basic|exp_conf	lincRNA	FLJ33360	lincRNA	OTTHUMT00000365707.1	G			6365543	-1	no_errors	NM_001001702	genbank	human	predicted	54_36p	silent	SNP	0.003	A
TP53	7157	genome.wustl.edu	37	17	7577025	7577025	+	Nonsense_Mutation	SNP	T	T	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr17:7577025T>A	ENST00000269305.4	-	8	1102	c.913A>T	c.(913-915)Aag>Tag	p.K305*	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.K305*|TP53_ENST00000359597.4_Nonsense_Mutation_p.K305*|TP53_ENST00000445888.2_Nonsense_Mutation_p.K305*|TP53_ENST00000455263.2_Nonsense_Mutation_p.K305*|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	305	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		K -> E (in a sporadic cancer; somatic mutation).|K -> M (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation; loss of nuclear localization).|K -> R (in sporadic cancers; somatic mutation).|K -> T (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K305*(19)|p.0?(8)|p.?(3)|p.L265_K305del41(1)|p.K305E(1)|p.K305fs*32(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTACCTCGCTTAGTGCTCCCT	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	33	Substitution - Nonsense(19)|Whole gene deletion(8)|Unknown(3)|Deletion - In frame(1)|Insertion - Frameshift(1)|Substitution - Missense(1)	upper_aerodigestive_tract(8)|lung(5)|urinary_tract(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(2)|breast(2)|oesophagus(2)|large_intestine(1)|stomach(1)|liver(1)	17											118.0	103.0	108.0					17																	7577025		2203	4300	6503	7517750	SO:0001587	stop_gained	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.913A>T	17.37:g.7577025T>A	ENSP00000269305:p.Lys305*	Somatic		Capture	Illumina GAIIx	4	7517750	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.K305*	ENST00000269305.4	37	c.913	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	29.9	5.043953	0.93685	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	5.26	0.73747	.	1.688560	0.03760	N	0.258052	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.76	11.4858	0.50352	0.0:0.0:0.0:1.0	.	.	.	.	X	305;305;305;305;305;294;173	.	ENSP00000269305:K305X	K	-	1	0	TP53	7517750	1.000000	0.71417	0.901000	0.35422	0.316000	0.28119	4.679000	0.61649	2.208000	0.71279	0.459000	0.35465	AAG	-	NULL		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546		7517750	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	nonsense	SNP	0.993	A
MTOR	2475	genome.wustl.edu	37	1	11308150	11308150	+	Splice_Site	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:11308150C>T	ENST00000361445.4	-	7	918	c.842G>A	c.(841-843)cGt>cAt	p.R281H		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	281	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TTCTCTCAGACGCTATATATA	0.418																																																0			1											89.0	91.0	90.0					1																	11308150		2203	4300	6503	11230737	SO:0001630	splice_region_variant	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.841-1G>A	1.37:g.11308150C>T		Somatic		Capture	Illumina GAIIx	4	11230737	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_SSF48452,HMMPfam_FAT,HMMPfam_Rapamycin_bind,superfamily_FRAP_FKBP12_bind,superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2,HMMPfam_FATC	p.R281H	ENST00000361445.4	37	c.842	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.487778	0.64074	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.64618	-0.11	5.37	5.37	0.77165	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64594	0.2612	M	0.74881	2.28	0.80722	D	1	P	0.49783	0.928	B	0.39660	0.306	T	0.70403	-0.4881	10	0.48119	T	0.1	-4.5534	19.3137	0.94202	0.0:1.0:0.0:0.0	.	281	P42345	MTOR_HUMAN	H	281	ENSP00000354558:R281H	ENSP00000354558:R281H	R	-	2	0	MTOR	11230737	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	7.289000	0.78701	2.788000	0.95919	0.650000	0.86243	CGT	-	superfamily_ARM-type_fold		0.418	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAP1	protein_coding	OTTHUMT00000005558.1	C	NM_004958	Missense_Mutation	11230737	-1	no_errors	NM_004958	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
DNAH9	1770	genome.wustl.edu	37	17	11672440	11672440	+	Splice_Site	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr17:11672440C>T	ENST00000262442.4	+	38	7414	c.7346C>T	c.(7345-7347)gCg>gTg	p.A2449V	DNAH9_ENST00000454412.2_Splice_Site_p.A2449V	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2449	AAA 3. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CCATTCCAGGCGTGTTTGGTG	0.592																																																0			17											80.0	78.0	79.0					17																	11672440		2203	4300	6503	11613165	SO:0001630	splice_region_variant	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.7345-1C>T	17.37:g.11672440C>T		Somatic		Capture	Illumina GAIIx	4	11613165	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	HMMPfam_DHC_N1,superfamily_Spectrin repeat,HMMPfam_DHC_N2,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_AAA_5,HMMPfam_Dynein_heavy,PatternScan_CPSASE_2	p.A2449V	ENST00000262442.4	37	c.7346	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	14.20	2.464385	0.43736	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.48836	0.8;0.8	5.77	5.77	0.91146	.	0.365897	0.28296	N	0.015870	T	0.51449	0.1675	M	0.71206	2.165	0.80722	D	1	P	0.36065	0.535	B	0.33690	0.168	T	0.53627	-0.8412	10	0.46703	T	0.11	.	19.9873	0.97353	0.0:1.0:0.0:0.0	.	2449	Q9NYC9	DYH9_HUMAN	V	2449;2449;1031	ENSP00000262442:A2449V;ENSP00000414874:A2449V	ENSP00000262442:A2449V	A	+	2	0	DNAH9	11613165	0.998000	0.40836	0.961000	0.40146	0.058000	0.15608	3.744000	0.55112	2.732000	0.93576	0.655000	0.94253	GCG	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.592	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	protein_coding	OTTHUMT00000252756.2	C	NM_001372	Missense_Mutation	11613165	+1	no_errors	NM_001372	genbank	human	reviewed	54_36p	missense	SNP	0.935	T
DUSP16	80824	genome.wustl.edu	37	12	12630091	12630091	+	Silent	SNP	A	A	G			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr12:12630091A>G	ENST00000228862.2	-	7	2305	c.1674T>C	c.(1672-1674)taT>taC	p.Y558Y	DUSP16_ENST00000545864.1_5'Flank|DUSP16_ENST00000298573.4_3'UTR	NM_030640.2	NP_085143.1	Q9BY84	DUS16_HUMAN	dual specificity phosphatase 16	558					dephosphorylation (GO:0016311)|inactivation of MAPK activity (GO:0000188)|MAPK export from nucleus (GO:0045204)|MAPK phosphatase export from nucleus, leptomycin B sensitive (GO:0045209)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(7)|kidney(2)|large_intestine(6)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(3)	26		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)		CTGTGGCAAAATACCAGCTGC	0.597																																					Ovarian(158;443 1896 15437 36069 46477)											0			12											97.0	106.0	103.0					12																	12630091		2203	4300	6503	12521358	SO:0001819	synonymous_variant	80824			AB052156	CCDS8650.1	12p13	2011-06-09				ENSG00000111266		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	17909	protein-coding gene	gene with protein product	"""MAPK phosphatase-7"""	607175				11359773, 11489891, 15888437	Standard	NM_030640		Approved	MKP-7, KIAA1700, MKP7	uc001rao.2	Q9BY84		ENST00000228862.2:c.1674T>C	12.37:g.12630091A>G		Somatic		Capture	Illumina GAIIx	4	12521358	Q547C7|Q96QS2|Q9C0G3	Silent	SNP	superfamily_Rhodanese-like,HMMPfam_Rhodanese,HMMSmart_RHOD,superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc,PatternScan_TYR_PHOSPHATASE_1	p.Y558	ENST00000228862.2	37	c.1674	CCDS8650.1	12																																																																																			-	NULL		0.597	DUSP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP16	protein_coding	OTTHUMT00000400311.1	A	NM_030640		12521358	-1	no_errors	NM_030640	genbank	human	validated	54_36p	silent	SNP	1.000	G
TRMT2A	27037	genome.wustl.edu	37	22	20103847	20103847	+	Missense_Mutation	SNP	G	G	A	rs531731507		TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr22:20103847G>A	ENST00000252136.7	-	2	701	c.313C>T	c.(313-315)Ctc>Ttc	p.L105F	TRMT2A_ENST00000403707.3_Missense_Mutation_p.L105F|RANBP1_ENST00000402752.1_5'Flank|TRMT2A_ENST00000492988.1_5'Flank|TRMT2A_ENST00000404751.3_Missense_Mutation_p.L105F|TRMT2A_ENST00000439169.2_Missense_Mutation_p.L105F|RANBP1_ENST00000430524.1_5'UTR|RANBP1_ENST00000331821.3_5'Flank	NM_001257994.1|NM_022727.5|NM_182984.4	NP_001244923.1|NP_073564.3|NP_892029.2	Q8IZ69	TRM2A_HUMAN	tRNA methyltransferase 2 homolog A (S. cerevisiae)	105	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				RNA processing (GO:0006396)		nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)			breast(2)|endometrium(2)|lung(5)	9						TGCCCAAAGAGTTTGGTTTTG	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18378	0.0		0.0	False		,,,				2504	0.0															0			22											43.0	46.0	45.0					22																	20103847		2203	4296	6499	18483847	SO:0001583	missense	27037			BC017184	CCDS13774.1, CCDS58793.1	22q11.21	2014-02-12	2012-06-12		ENSG00000099899	ENSG00000099899			24974	protein-coding gene	gene with protein product	"""HpaII tiny fragments locus 9C"""	611151				9417108, 18075473	Standard	NM_022727		Approved	HTF9C	uc002zrl.2	Q8IZ69	OTTHUMG00000150454	ENST00000252136.7:c.313C>T	22.37:g.20103847G>A	ENSP00000252136:p.Leu105Phe	Somatic		Capture	Illumina GAIIx	4	18483847	D3DX25|Q32P57|Q96ME6|Q9H732	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_Methyltransf_11	p.L105F	ENST00000252136.7	37	c.313	CCDS13774.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.243265|5.243265	0.95272|0.95272	.|.	.|.	ENSG00000099899|ENSG00000099901	ENST00000252136;ENST00000403707;ENST00000404751;ENST00000439169;ENST00000445045|ENST00000432879	T;T;T;T;T|.	0.50001|.	3.02;3.02;3.02;3.02;0.76|.	5.68|5.68	5.68|5.68	0.88126|0.88126	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70552|0.70552	0.3237|0.3237	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.992;0.992|.	D;D;D|.	0.78314|.	0.991;0.954;0.969|.	T|T	0.66705|0.66705	-0.5856|-0.5856	10|6	0.49607|0.29301	T|T	0.09|0.29	-40.0739|-40.0739	13.6791|13.6791	0.62472|0.62472	0.0748:0.0:0.9252:0.0|0.0748:0.0:0.9252:0.0	.|.	105;105;105|.	B4E213;F2Z2W7;Q8IZ69|.	.;.;TRM2A_HUMAN|.	F|N	105;105;105;105;93|47	ENSP00000252136:L105F;ENSP00000385807:L105F;ENSP00000384968:L105F;ENSP00000395738:L105F;ENSP00000393911:L93F|.	ENSP00000252136:L105F|ENSP00000404724:S47N	L|S	-|+	1|2	0|0	TRMT2A|RANBP1	18483847|18483847	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.847000|0.847000	0.48162|0.48162	7.291000|7.291000	0.78721|0.78721	2.697000|2.697000	0.92050|0.92050	0.491000|0.491000	0.48974|0.48974	CTC|AGT	-	superfamily_RNA-binding domain RBD		0.617	TRMT2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT2A	protein_coding	OTTHUMT00000318168.3	G	NM_022727		18483847	-1	no_errors	NM_022727	genbank	human	validated	54_36p	missense	SNP	1.000	A
PQLC2	54896	genome.wustl.edu	37	1	19644239	19644239	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:19644239G>A	ENST00000375153.3	+	2	708	c.68G>A	c.(67-69)tGg>tAg	p.W23*	PQLC2_ENST00000400548.2_Intron|PQLC2_ENST00000375155.3_Nonsense_Mutation_p.W23*|RN7SL85P_ENST00000583604.1_RNA	NM_001040125.1	NP_001035214.1	Q6ZP29	LAAT1_HUMAN	PQ loop repeat containing 2	23					amino acid homeostasis (GO:0080144)|arginine transport (GO:0015809)|lysine transport (GO:0015819)	integral component of organelle membrane (GO:0031301)|lysosomal membrane (GO:0005765)	arginine transmembrane transporter activity (GO:0015181)|basic amino acid transmembrane transporter activity (GO:0015174)|L-lysine transmembrane transporter activity (GO:0015189)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(1)	10		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;1.89e-05)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CAGTGGATATGGGATGTGTTG	0.627																																																0			1											222.0	218.0	220.0					1																	19644239		2203	4300	6503	19516826	SO:0001587	stop_gained	54896			BC015324	CCDS195.2, CCDS30618.1	1p36.13	2013-10-11			ENSG00000040487	ENSG00000040487			26001	protein-coding gene	gene with protein product		614760				23169667	Standard	XM_005245915		Approved	FLJ20320	uc001bby.3	Q6ZP29	OTTHUMG00000002521	ENST00000375153.3:c.68G>A	1.37:g.19644239G>A	ENSP00000364295:p.Trp23*	Somatic		Capture	Illumina GAIIx	4	19516826	B3KWQ5|Q6ZMJ3|Q6ZP27|Q9NXC7	Nonsense_Mutation	SNP	HMMPfam_PQ-loop,HMMSmart_SM00679	p.W23*	ENST00000375153.3	37	c.68	CCDS195.2	1	.	.	.	.	.	.	.	.	.	.	G	39	7.674716	0.98425	.	.	ENSG00000040487	ENST00000375155;ENST00000375153	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-21.0247	17.7092	0.88317	0.0:0.0:1.0:0.0	.	.	.	.	X	23	.	ENSP00000364295:W23X	W	+	2	0	PQLC2	19516826	1.000000	0.71417	1.000000	0.80357	0.181000	0.23173	6.271000	0.72569	2.539000	0.85634	0.478000	0.44815	TGG	-	NULL		0.627	PQLC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PQLC2	protein_coding	OTTHUMT00000007255.1	G	NM_017765		19516826	+1	no_errors	NM_001040125	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
GYS2	2998	genome.wustl.edu	37	12	21693497	21693497	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr12:21693497G>C	ENST00000261195.2	-	14	1910	c.1656C>G	c.(1654-1656)atC>atG	p.I552M		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	552					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GCCTGTCAACGATGTAAATAC	0.408																																					Colon(149;9 1820 3690 10544 50424)											0			12											82.0	82.0	82.0					12																	21693497		2203	4300	6503	21584764	SO:0001583	missense	2998				CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1656C>G	12.37:g.21693497G>C	ENSP00000261195:p.Ile552Met	Somatic		Capture	Illumina GAIIx	4	21584764	A0AVD8	Missense_Mutation	SNP	HMMPfam_Glycogen_syn,superfamily_UDP-Glycosyltransferase/glycogen phosphorylase	p.I552M	ENST00000261195.2	37	c.1656	CCDS8690.1	12	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138735	0.56936	.	.	ENSG00000111713	ENST00000261195	T	0.70164	-0.46	5.1	-4.34	0.03666	.	0.053040	0.64402	D	0.000001	T	0.80539	0.4642	M	0.88241	2.94	0.52099	D	0.999944	D	0.89917	1.0	D	0.97110	1.0	T	0.81357	-0.0969	10	0.87932	D	0	-17.6182	13.0923	0.59172	0.2036:0.0:0.6844:0.1119	.	552	P54840	GYS2_HUMAN	M	552	ENSP00000261195:I552M	ENSP00000261195:I552M	I	-	3	3	GYS2	21584764	0.357000	0.24938	0.940000	0.37924	0.978000	0.69477	-0.179000	0.09768	-0.993000	0.03467	-0.355000	0.07637	ATC	-	HMMPfam_Glycogen_syn,superfamily_UDP-Glycosyltransferase/glycogen phosphorylase		0.408	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS2	protein_coding	OTTHUMT00000402396.1	G	NM_021957		21584764	-1	no_errors	NM_021957	genbank	human	validated	54_36p	missense	SNP	0.891	C
FAM126A	84668	genome.wustl.edu	37	7	22985376	22985376	+	Silent	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr7:22985376C>T	ENST00000432176.2	-	11	1630	c.1398G>A	c.(1396-1398)ccG>ccA	p.P466P	FAM126A_ENST00000409923.1_3'UTR|FAM126A_ENST00000498833.1_5'Flank	NM_032581.3	NP_115970.2	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	466					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|urinary_tract(2)	23						CAGCAGATGACGGGTTATGTG	0.463																																																0			7											102.0	95.0	98.0					7																	22985376		2203	4300	6503	22951901	SO:0001819	synonymous_variant	84668			BC018710	CCDS5377.1	7p15.3	2008-10-02			ENSG00000122591	ENSG00000122591			24587	protein-coding gene	gene with protein product	"""down regulated by Ctnnb1, a"""	610531				10910037, 16951682	Standard	NM_032581		Approved	DRCTNNB1A, HCC, HYCC1, hyccin	uc003svm.4	Q9BYI3	OTTHUMG00000128435	ENST00000432176.2:c.1398G>A	7.37:g.22985376C>T		Somatic		Capture	Illumina GAIIx	4	22951901	A4D145|Q6N010|Q75MR4|Q7LDZ4|Q96MX1|Q96NQ6	Silent	SNP	HMMPfam_Hyccin	p.P466	ENST00000432176.2	37	c.1398	CCDS5377.1	7																																																																																			-	NULL		0.463	FAM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126A	protein_coding	OTTHUMT00000250230.1	C	NM_032581		22951901	-1	no_errors	NM_032581	genbank	human	reviewed	54_36p	silent	SNP	0.004	T
RBBP6	5930	genome.wustl.edu	37	16	24582569	24582569	+	Silent	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr16:24582569C>T	ENST00000319715.4	+	18	4614	c.4182C>T	c.(4180-4182)aaC>aaT	p.N1394N	RBBP6_ENST00000381039.3_Silent_p.N554N|RBBP6_ENST00000348022.2_Silent_p.N1360N	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1394					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		GTTCAAAAAACTCTGCATCTA	0.398																																																0			16											48.0	48.0	48.0					16																	24582569		2197	4300	6497	24490070	SO:0001819	synonymous_variant	5930				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4182C>T	16.37:g.24582569C>T		Somatic		Capture	Illumina GAIIx	4	24490070	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Silent	SNP	HMMPfam_DWNN,superfamily_Retrovirus zinc finger-like domains,HMMPfam_zf-CCHC,HMMSmart_SM00343,superfamily_RING/U-box,HMMPfam_U-box,HMMSmart_SM00184	p.N1394	ENST00000319715.4	37	c.4182	CCDS10621.1	16																																																																																			-	NULL		0.398	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	protein_coding	OTTHUMT00000214067.2	C	NM_006910		24490070	+1	no_errors	NM_006910	genbank	human	reviewed	54_36p	silent	SNP	0.000	T
ZKSCAN2	342357	genome.wustl.edu	37	16	25258425	25258425	+	Silent	SNP	A	A	C			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr16:25258425A>C	ENST00000328086.7	-	5	1895	c.1092T>G	c.(1090-1092)ctT>ctG	p.L364L		NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	364					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		GACAGGCCTGAAGTGTTTCAT	0.463																																																0			16											113.0	108.0	110.0					16																	25258425		2197	4300	6497	25165926	SO:0001819	synonymous_variant	342357			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.1092T>G	16.37:g.25258425A>C		Somatic		Capture	Illumina GAIIx	4	25165926	A1L3B4|Q6ZN77	Silent	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.L364	ENST00000328086.7	37	c.1092	CCDS32410.1	16																																																																																			-	NULL		0.463	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN2	protein_coding	OTTHUMT00000435739.1	A	NM_001012981		25165926	-1	no_errors	NM_001012981	genbank	human	validated	54_36p	silent	SNP	0.885	C
HIST1H2BC	8347	genome.wustl.edu	37	6	26123776	26123776	+	Silent	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr6:26123776G>A	ENST00000314332.5	-	1	362	c.357C>T	c.(355-357)gtC>gtT	p.V119V	HIST1H2AC_ENST00000377791.2_5'Flank|HIST1H2AC_ENST00000602637.1_5'Flank|HIST1H2BC_ENST00000396984.1_Silent_p.V119V			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	119					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						TGTACTTGGTGACGGCCTTGG	0.572																																																0			6											83.0	86.0	85.0					6																	26123776		2203	4300	6503	26231755	SO:0001819	synonymous_variant	8347			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.357C>T	6.37:g.26123776G>A		Somatic		Capture	Illumina GAIIx	4	26231755	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	superfamily_Histone-fold,HMMSmart_SM00427,HMMPfam_Histone,PatternScan_HISTONE_H2B	p.V119	ENST00000314332.5	37	c.357	CCDS4584.1	6																																																																																			-	superfamily_Histone-fold,HMMSmart_SM00427		0.572	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BC	protein_coding	OTTHUMT00000468022.1	G	NM_003526		26231755	-1	no_errors	NM_003526	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
HIST1H4G	8369	genome.wustl.edu	37	6	26246972	26246972	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr6:26246972C>A	ENST00000244537.4	-	1	287	c.234G>T	c.(232-234)aaG>aaT	p.K78N		NM_003547.2	NP_003538.1	Q99525	H4G_HUMAN	histone cluster 1, H4g	78						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				CCGTCTTGCGCTTGGCGTGCT	0.582																																																0			6											74.0	62.0	66.0					6																	26246972		2203	4300	6503	26354951	SO:0001583	missense	8369			Z80788	CCDS4599.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124578	ENSG00000275663		"""Histones / Replication-dependent"""	4792	protein-coding gene	gene with protein product		602832	"""H4 histone family, member L"", ""histone 1, H4g"""	H4FL		9119399, 12408966	Standard	NM_003547		Approved	H4/l	uc003nhf.3	Q99525	OTTHUMG00000014444	ENST00000244537.4:c.234G>T	6.37:g.26246972C>A	ENSP00000244537:p.Lys78Asn	Somatic		Capture	Illumina GAIIx	4	26354951		Missense_Mutation	SNP	PatternScan_HISTONE_H4,superfamily_Histone-fold,HMMSmart_H4,HMMPfam_Histone	p.K78N	ENST00000244537.4	37	c.234	CCDS4599.1	6	.	.	.	.	.	.	.	.	.	.	.	6.747	0.506585	0.12883	.	.	ENSG00000124578	ENST00000244537	T	0.75050	-0.9	3.05	1.16	0.20824	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.57344	0.2047	.	.	.	0.33092	D	0.538011	B	0.20887	0.049	B	0.37387	0.248	T	0.54282	-0.8317	8	0.66056	D	0.02	.	8.1345	0.31046	0.0:0.7901:0.0:0.2099	.	78	Q99525	H4G_HUMAN	N	78	ENSP00000244537:K78N	ENSP00000244537:K78N	K	-	3	2	HIST1H4G	26354951	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	5.238000	0.65366	0.131000	0.18576	0.391000	0.25812	AAG	-	superfamily_Histone-fold,HMMSmart_H4,HMMPfam_Histone		0.582	HIST1H4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4G	protein_coding	OTTHUMT00000040107.1	C	NM_003547		26354951	-1	no_errors	NM_003547	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
ASXL3	80816	genome.wustl.edu	37	18	31319056	31319056	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr18:31319056C>T	ENST00000269197.5	+	11	1688	c.1688C>T	c.(1687-1689)aCt>aTt	p.T563I		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	563					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GAGTCAGAAACTGCAGTAGAG	0.408																																																0			18											75.0	70.0	71.0					18																	31319056		1912	4140	6052	29573054	SO:0001583	missense	80816			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1688C>T	18.37:g.31319056C>T	ENSP00000269197:p.Thr563Ile	Somatic		Capture	Illumina GAIIx	4	29573054	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	NULL	p.T563I	ENST00000269197.5	37	c.1688	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	C	1.474	-0.559139	0.03967	.	.	ENSG00000141431	ENST00000269197	T	0.16324	2.35	5.47	2.59	0.31030	.	1.625600	0.02974	N	0.144725	T	0.17916	0.0430	L	0.47716	1.5	0.09310	N	1	B	0.34103	0.437	B	0.27500	0.08	T	0.31888	-0.9927	10	0.41790	T	0.15	.	9.582	0.39493	0.2532:0.6801:0.0:0.0667	.	563	Q9C0F0	ASXL3_HUMAN	I	563	ENSP00000269197:T563I	ENSP00000269197:T563I	T	+	2	0	ASXL3	29573054	0.024000	0.19004	0.176000	0.23000	0.083000	0.17756	1.045000	0.30341	0.308000	0.22923	-0.444000	0.05651	ACT	-	NULL		0.408	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	protein_coding	OTTHUMT00000441865.2	C			29573054	+1	no_errors	NM_030632	genbank	human	validated	54_36p	missense	SNP	0.035	T
SRCAP	10847	genome.wustl.edu	37	16	30736378	30736378	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr16:30736378C>G	ENST00000262518.4	+	25	6018	c.5633C>G	c.(5632-5634)cCa>cGa	p.P1878R	SRCAP_ENST00000395059.2_Missense_Mutation_p.P1816R|SRCAP_ENST00000344771.4_Missense_Mutation_p.P1720R	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1878	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CAGCCCCCCCCACCACCTCGT	0.567																																																0			16											49.0	60.0	56.0					16																	30736378		2196	4290	6486	30643879	SO:0001583	missense	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5633C>G	16.37:g.30736378C>G	ENSP00000262518:p.Pro1878Arg	Somatic		Capture	Illumina GAIIx	4	30643879	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	HMMPfam_HSA,HMMSmart_SM00573,HMMSmart_SM00487,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_SNF2_N,HMMSmart_SM00490,HMMPfam_Helicase_C,HMMPfam_AT_hook,HMMSmart_SM00384	p.P1878R	ENST00000262518.4	37	c.5633	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	14.30	2.495189	0.44352	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91792	-2.86;-2.89;-2.91	5.91	5.91	0.95273	.	0.000000	0.53938	D	0.000060	D	0.92841	0.7723	N	0.19112	0.55	0.41053	D	0.985312	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74674	0.984;0.984;0.963	D	0.93888	0.7177	10	0.72032	D	0.01	-10.9053	17.7921	0.88555	0.0:1.0:0.0:0.0	.	1720;1816;1878	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	R	1878;1816;1720	ENSP00000262518:P1878R;ENSP00000378499:P1816R;ENSP00000343042:P1720R	ENSP00000262518:P1878R	P	+	2	0	SRCAP	30643879	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.589000	0.46145	2.802000	0.96397	0.655000	0.94253	CCA	-	NULL		0.567	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	protein_coding	OTTHUMT00000255523.1	C	NM_006662		30643879	+1	no_errors	NM_006662	genbank	human	validated	54_36p	missense	SNP	1.000	G
HERPUD2	64224	genome.wustl.edu	37	7	35674035	35674035	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr7:35674035G>A	ENST00000396081.1	-	7	1750	c.946C>T	c.(946-948)Caa>Taa	p.Q316*	HERPUD2_ENST00000426180.1_5'UTR|HERPUD2_ENST00000311350.3_Nonsense_Mutation_p.Q316*	NM_022373.4	NP_071768.3	Q9BSE4	HERP2_HUMAN	HERPUD family member 2	316					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				kidney(3)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)	18						CATCCAGCTTGGTGTCTGTTC	0.343																																																0			7											116.0	105.0	108.0					7																	35674035		2203	4300	6503	35640560	SO:0001587	stop_gained	64224			BC020264	CCDS5446.1	7p14.2	2006-03-20	2006-03-20		ENSG00000122557	ENSG00000122557			21915	protein-coding gene	gene with protein product	"""homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 2"""						Standard	NM_022373		Approved	FLJ22313	uc003tes.4	Q9BSE4	OTTHUMG00000128687	ENST00000396081.1:c.946C>T	7.37:g.35674035G>A	ENSP00000379390:p.Gln316*	Somatic		Capture	Illumina GAIIx	4	35640560	A4D1Y8|Q9H6F9	Nonsense_Mutation	SNP	superfamily_SSF54236,HMMSmart_UBQ,HMMPfam_ubiquitin	p.Q316*	ENST00000396081.1	37	c.946	CCDS5446.1	7	.	.	.	.	.	.	.	.	.	.	G	42	9.450084	0.99174	.	.	ENSG00000122557	ENST00000396081;ENST00000311350	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-10.0626	19.5324	0.95234	0.0:0.0:1.0:0.0	.	.	.	.	X	316	.	ENSP00000310729:Q316X	Q	-	1	0	HERPUD2	35640560	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.621000	0.90949	2.619000	0.88677	0.460000	0.39030	CAA	-	NULL		0.343	HERPUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERPUD2	protein_coding	OTTHUMT00000250584.1	G	NM_022373		35640560	-1	no_errors	NM_022373	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
KRT36	8689	genome.wustl.edu	37	17	39644653	39644653	+	Splice_Site	SNP	T	T	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr17:39644653T>A	ENST00000328119.6	-	3	542		c.e3-2		KRT36_ENST00000393986.2_Splice_Site	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36						regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				GTCTCATACCTGCACACACAG	0.602																																																0			17											59.0	51.0	54.0					17																	39644653		2203	4300	6503	36898179	SO:0001630	splice_region_variant	8689			Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.543-2A>T	17.37:g.39644653T>A		Somatic		Capture	Illumina GAIIx	4	36898179	Q86XG4	Splice_Site	SNP	-	e3-2	ENST00000328119.6	37	c.543-2	CCDS11395.1	17	.	.	.	.	.	.	.	.	.	.	T	18.49	3.634755	0.67130	.	.	ENSG00000126337	ENST00000393986;ENST00000328119	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3978	0.74812	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT36	36898179	1.000000	0.71417	0.998000	0.56505	0.592000	0.36648	7.698000	0.84413	2.234000	0.73211	0.460000	0.39030	.	-	-		0.602	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT36	protein_coding	OTTHUMT00000259508.1	T	NM_003771	Intron	36898179	-1	no_errors	NM_003771	genbank	human	reviewed	54_36p	splice_site	SNP	0.997	A
KIF18B	146909	genome.wustl.edu	37	17	43003538	43003538	+	Silent	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr17:43003538G>A	ENST00000593135.1	-	16	2566	c.2469C>T	c.(2467-2469)ccC>ccT	p.P823P	KIF18B_ENST00000339151.4_Silent_p.P826P|KIF18B_ENST00000438933.2_3'UTR|KIF18B_ENST00000587309.1_3'UTR	NM_001265577.1	NP_001252506.1	Q86Y91	KI18B_HUMAN	kinesin family member 18B	835					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|regulation of cell division (GO:0051302)	astral microtubule (GO:0000235)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule plus-end (GO:0035371)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	21		Prostate(33;0.155)				TAGGGCACAGGGGACTCAAGG	0.632																																																0			17											71.0	78.0	76.0					17																	43003538		2094	4222	6316	40359064	SO:0001819	synonymous_variant	146909				CCDS45709.1, CCDS58555.1, CCDS45709.2	17q21.31	2014-09-04			ENSG00000186185			"""Kinesins"""	27102	protein-coding gene	gene with protein product		614570				16084724	Standard	NM_001264573		Approved		uc010wjh.3	Q86Y91	OTTHUMG00000179867	ENST00000593135.1:c.2469C>T	17.37:g.43003538G>A		Somatic		Capture	Illumina GAIIx	4	40359064	A6NJI2|B7ZM49|B9EGM8|D5L6I1	Silent	SNP	HMMSmart_SM00129,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1	p.P826	ENST00000593135.1	37	c.2478	CCDS45709.2	17																																																																																			-	NULL		0.632	KIF18B-001	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	KIF18B	protein_coding	OTTHUMT00000448724.1	G	NM_001080443		40359064	-1	no_errors	NM_001080443	genbank	human	provisional	54_36p	silent	SNP	0.197	A
RNF165	494470	genome.wustl.edu	37	18	44030700	44030700	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr18:44030700G>A	ENST00000269439.7	+	6	805	c.754G>A	c.(754-756)Gtg>Atg	p.V252M	RNF165_ENST00000543885.1_Missense_Mutation_p.V60M	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	252							zinc ion binding (GO:0008270)			NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		GTTGGGTAATGTGACTCGGGG	0.517																																																0			18											93.0	78.0	83.0					18																	44030700		2203	4300	6503	42284698	SO:0001583	missense	494470			BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.754G>A	18.37:g.44030700G>A	ENSP00000269439:p.Val252Met	Somatic		Capture	Illumina GAIIx	4	42284698	B3KVD1	Missense_Mutation	SNP	PatternScan_ZF_RING_1,superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4	p.V252M	ENST00000269439.7	37	c.754	CCDS32823.1	18	.	.	.	.	.	.	.	.	.	.	G	34	5.339908	0.95783	.	.	ENSG00000141622	ENST00000269439;ENST00000543885	T;T	0.25085	1.87;1.82	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000001	T	0.41026	0.1141	M	0.71581	2.175	0.80722	D	1	P	0.46859	0.885	P	0.46362	0.514	T	0.24404	-1.0161	10	0.66056	D	0.02	-4.1565	20.5948	0.99439	0.0:0.0:1.0:0.0	.	252	Q6ZSG1	RN165_HUMAN	M	252;60	ENSP00000269439:V252M;ENSP00000444285:V60M	ENSP00000269439:V252M	V	+	1	0	RNF165	42284698	1.000000	0.71417	0.988000	0.46212	0.976000	0.68499	7.903000	0.87398	2.873000	0.98535	0.563000	0.77884	GTG	-	NULL		0.517	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF165	protein_coding	OTTHUMT00000445358.1	G	NM_152470		42284698	+1	no_errors	NM_152470	genbank	human	validated	54_36p	missense	SNP	1.000	A
BMS1	9790	genome.wustl.edu	37	10	43281118	43281118	+	Nonsense_Mutation	SNP	C	C	G			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr10:43281118C>G	ENST00000374518.5	+	3	428	c.365C>G	c.(364-366)tCa>tGa	p.S122*		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	122	Bms1-type G.				ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						ACGATTGTGTCAGGTAGGAGA	0.473																																																0			10											100.0	103.0	102.0					10																	43281118		2203	4300	6503	42601124	SO:0001587	stop_gained	9790			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.365C>G	10.37:g.43281118C>G	ENSP00000363642:p.Ser122*	Somatic		Capture	Illumina GAIIx	4	42601124	Q5QPT5|Q86XJ9	Nonsense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_AARP2CN,HMMSmart_SM00785,HMMPfam_DUF663	p.S122*	ENST00000374518.5	37	c.365	CCDS7199.1	10	.	.	.	.	.	.	.	.	.	.	c	37	6.050977	0.97236	.	.	ENSG00000165733	ENST00000374518	.	.	.	4.73	4.73	0.59995	.	0.130209	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	17.7968	0.88575	0.0:1.0:0.0:0.0	.	.	.	.	X	122	.	ENSP00000363642:S122X	S	+	2	0	BMS1	42601124	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	7.530000	0.81962	2.202000	0.70862	0.508000	0.49915	TCA	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.473	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMS1	protein_coding	OTTHUMT00000047690.2	C	NM_014753		42601124	+1	no_errors	NM_014753	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	G
FAM98C	147965	genome.wustl.edu	37	19	38899447	38899447	+	Silent	SNP	C	C	G			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr19:38899447C>G	ENST00000252530.5	+	8	994	c.975C>G	c.(973-975)ccC>ccG	p.P325P	FAM98C_ENST00000588262.1_3'UTR|FAM98C_ENST00000343358.7_Silent_p.P243P	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	325										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGGAGCCTCCCATGCCCACCT	0.567																																																0			19											51.0	57.0	55.0					19																	38899447		1833	4070	5903	43591287	SO:0001819	synonymous_variant	147965				CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.975C>G	19.37:g.38899447C>G		Somatic		Capture	Illumina GAIIx	4	43591287	A6NMW3|Q66K45	Silent	SNP	HMMPfam_DUF2465	p.P325	ENST00000252530.5	37	c.975	CCDS42562.1	19																																																																																			-	HMMPfam_DUF2465		0.567	FAM98C-001	KNOWN	basic|CCDS	protein_coding	FAM98C	protein_coding	OTTHUMT00000459222.1	C	NM_174905		43591287	+1	no_errors	NM_174905	genbank	human	validated	54_36p	silent	SNP	1.000	G
FBN1	2200	genome.wustl.edu	37	15	48703284	48703284	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr15:48703284T>C	ENST00000316623.5	-	66	8974	c.8519A>G	c.(8518-8520)aAa>aGa	p.K2840R	FBN1_ENST00000561429.1_5'Flank	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2840					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTTAAGTTCTTTCTTTTTATA	0.378																																																0			15											124.0	125.0	124.0					15																	48703284		2198	4297	6495	46490576	SO:0001583	missense	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8519A>G	15.37:g.48703284T>C	ENSP00000325527:p.Lys2840Arg	Somatic		Capture	Illumina GAIIx	4	46490576	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	HMMSmart_SM00181,HMMPfam_EGF,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF_2,superfamily_Concanavalin A-like lectins/glucanases,superfamily_TB module/8-cys domain,HMMPfam_TB,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,PatternScan_ZINC_FINGER_C2H2_1,superfamily_Growth factor receptor domain	p.K2840R	ENST00000316623.5	37	c.8519	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	T	15.47	2.843371	0.51057	.	.	ENSG00000166147	ENST00000316623	D	0.82081	-1.57	5.57	5.57	0.84162	.	0.147572	0.64402	D	0.000015	T	0.78065	0.4225	L	0.45051	1.395	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.72484	-0.4279	10	0.31617	T	0.26	.	15.6817	0.77373	0.0:0.0:0.0:1.0	.	2840	P35555	FBN1_HUMAN	R	2840	ENSP00000325527:K2840R	ENSP00000325527:K2840R	K	-	2	0	FBN1	46490576	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.638000	0.61353	2.247000	0.74100	0.528000	0.53228	AAA	-	NULL		0.378	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	protein_coding	OTTHUMT00000417355.1	T			46490576	-1	no_errors	NM_000138	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
ZNF816	125893	genome.wustl.edu	37	19	53454524	53454524	+	Silent	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr19:53454524G>A	ENST00000357666.4	-	5	804	c.504C>T	c.(502-504)caC>caT	p.H168H	ZNF321P_ENST00000391777.3_Intron|ZNF816_ENST00000434371.2_Intron|ZNF816_ENST00000444460.2_Silent_p.H168H	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						TCTGAAACATGTGGAGTTCAG	0.423																																																0			19											148.0	159.0	155.0					19																	53454524		2203	4300	6503	58146336	SO:0001819	synonymous_variant	125893			BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.504C>T	19.37:g.53454524G>A		Somatic		Capture	Illumina GAIIx	4	58146336	A8K7H5|Q3KR39|Q659B3	Silent	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMPfam_zf-C2H2,HMMSmart_ZnF_C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_SSF48695	p.H168	ENST00000357666.4	37	c.504	CCDS33096.1	19																																																																																			-	NULL		0.423	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF816A	protein_coding	OTTHUMT00000396132.1	G	NM_001031665		58146336	-1	no_errors	NM_001031665	genbank	human	validated	54_36p	silent	SNP	0.000	A
LEPR	3953	genome.wustl.edu	37	1	66036294	66036294	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:66036294C>T	ENST00000349533.6	+	4	364	c.179C>T	c.(178-180)tCg>tTg	p.S60L	LEPR_ENST00000371060.3_Missense_Mutation_p.S60L|LEPR_ENST00000371059.3_Missense_Mutation_p.S60L|LEPR_ENST00000344610.8_Missense_Mutation_p.S60L|snoU13_ENST00000459362.1_RNA|LEPR_ENST00000406510.3_5'UTR|LEPR_ENST00000371058.1_Missense_Mutation_p.S60L|LEPR_ENST00000462765.1_3'UTR	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		ACTTCAAATTCGAATGGACAT	0.383																																																0			1											123.0	121.0	122.0					1																	66036294		2203	4300	6503	65808882	SO:0001583	missense	3953			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.179C>T	1.37:g.66036294C>T	ENSP00000330393:p.Ser60Leu	Somatic		Capture	Illumina GAIIx	4	65808882	Q6FHL5	Missense_Mutation	SNP	superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_HEMATOPO_REC_S_F1,HMMPfam_Lep_receptor_Ig,PatternScan_HEMATOPO_REC_L_F2	p.S60L	ENST00000349533.6	37	c.179	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	C	0.185	-1.058467	0.01950	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.51325	0.73;0.76;0.74;0.71;0.73	5.41	-3.54	0.04653	.	2.060570	0.01789	N	0.032190	T	0.03520	0.0101	N	0.00771	-1.2	0.09310	N	0.999999	B;B;B;B	0.10296	0.0;0.0;0.001;0.003	B;B;B;B	0.04013	0.001;0.0;0.0;0.001	T	0.18241	-1.0343	10	0.02654	T	1	3.2094	5.8506	0.18691	0.0:0.3276:0.3199:0.3525	.	60;60;60;60	P48357-4;P48357;P48357-2;P48357-3	.;LEPR_HUMAN;.;.	L	60	ENSP00000340884:S60L;ENSP00000330393:S60L;ENSP00000360099:S60L;ENSP00000360098:S60L;ENSP00000360097:S60L	ENSP00000340884:S60L	S	+	2	0	LEPR	65808882	0.000000	0.05858	0.000000	0.03702	0.609000	0.37215	-0.592000	0.05747	-0.574000	0.05990	-0.501000	0.04562	TCG	-	NULL		0.383	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	protein_coding	OTTHUMT00000025275.1	C	NM_002303		65808882	+1	no_errors	NM_002303	genbank	human	validated	54_36p	missense	SNP	0.000	T
C1D	10438	genome.wustl.edu	37	2	68270116	68270116	+	Nonsense_Mutation	SNP	T	T	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr2:68270116T>A	ENST00000355848.3	-	5	378	c.331A>T	c.(331-333)Aga>Tga	p.R111*	C1D_ENST00000409302.1_Nonsense_Mutation_p.R111*|C1D_ENST00000407324.1_Nonsense_Mutation_p.R150*|C1D_ENST00000410067.3_Nonsense_Mutation_p.R111*			Q13901	C1D_HUMAN	C1D nuclear receptor corepressor	111	Interaction with NCOR1 and NCOR2. {ECO:0000250}.				apoptotic process (GO:0006915)|maturation of 5.8S rRNA (GO:0000460)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)			lung(2)|urinary_tract(1)	3						GCTGCACCTCTGTCCAGCTTG	0.338																																																0			2											23.0	25.0	24.0					2																	68270116		2201	4292	6493	68123620	SO:0001587	stop_gained	10438				CCDS1883.1	2p13-p12	2010-06-10	2010-06-10		ENSG00000197223	ENSG00000197223			29911	protein-coding gene	gene with protein product	"""small unique nuclear receptor co-repressor"""	606997	"""C1D nuclear receptor co-repressor"""			9469821, 17599775, 17412707, 11801738, 9405624	Standard	NM_006333		Approved	SUNCOR, SUN-CoR, LRP1	uc002seb.3	Q13901	OTTHUMG00000129564	ENST00000355848.3:c.331A>T	2.37:g.68270116T>A	ENSP00000348107:p.Arg111*	Somatic		Capture	Illumina GAIIx	4	68123620	A8K336|D6W5F8|Q05D64	Nonsense_Mutation	SNP	HMMPfam_Sas10_Utp3	p.R111*	ENST00000355848.3	37	c.331	CCDS1883.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.276813	0.95459	.	.	ENSG00000197223	ENST00000355848;ENST00000407324;ENST00000410067;ENST00000409302	.	.	.	5.33	4.16	0.48862	.	0.231992	0.49916	D	0.000131	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	12.7127	0.57098	0.0:0.0:0.1376:0.8624	.	.	.	.	X	111;150;111;111	.	ENSP00000348107:R111X	R	-	1	2	C1D	68123620	1.000000	0.71417	0.957000	0.39632	0.991000	0.79684	7.356000	0.79445	0.937000	0.37394	0.383000	0.25322	AGA	-	NULL		0.338	C1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1D	protein_coding	OTTHUMT00000251757.3	T	NM_006333		68123620	-1	no_errors	NM_006333	genbank	human	reviewed	54_36p	nonsense	SNP	0.990	A
MTO1	25821	genome.wustl.edu	37	6	74189702	74189702	+	Missense_Mutation	SNP	C	C	T	rs369718258		TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr6:74189702C>T	ENST00000370300.4	+	6	1072	c.982C>T	c.(982-984)Cgt>Tgt	p.R328C	AL603910.1_ENST00000580608.1_RNA|MTO1_ENST00000498286.1_Missense_Mutation_p.R328C|MTO1_ENST00000370305.1_Missense_Mutation_p.R254C|MTO1_ENST00000415954.2_Missense_Mutation_p.R328C	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	328					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						TTTTCCAAACCGTCTACATCA	0.388											OREG0003887	type=REGULATORY REGION|Gene=MTO1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																				0			6						C	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	131.0	122.0	125.0		982,982,982	5.1	1.0	6		125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	MTO1	NM_001123226.1,NM_012123.3,NM_133645.2	180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	328/733,328/693,328/718	74189702	1,13005	2203	4300	6503	74246423	SO:0001583	missense	25821			AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.982C>T	6.37:g.74189702C>T	ENSP00000359323:p.Arg328Cys	Somatic	1151	Capture	Illumina GAIIx	4	74246423	B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Missense_Mutation	SNP	superfamily_FAD/NAD(P)-binding domain,HMMPfam_GIDA,PatternScan_GIDA_1,PatternScan_GIDA_2	p.R328C	ENST00000370300.4	37	c.982	CCDS4979.1	6	.	.	.	.	.	.	.	.	.	.	C	28.5	4.922957	0.92319	0.0	1.16E-4	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000357845;ENST00000370305;ENST00000370300	T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.88306	0.6401	M	0.88704	2.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.983;0.983;0.99	D	0.90194	0.4252	10	0.87932	D	0	-15.8608	16.1022	0.81184	0.0:1.0:0.0:0.0	.	328;328;328	Q9Y2Z2-6;Q9Y2Z2-4;Q9Y2Z2	.;.;MTO1_HUMAN	C	328;328;231;254;328	ENSP00000402038:R328C;ENSP00000419561:R328C;ENSP00000359328:R254C;ENSP00000359323:R328C	ENSP00000350506:R231C	R	+	1	0	MTO1	74246423	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	5.081000	0.64444	2.556000	0.86216	0.591000	0.81541	CGT	-	superfamily_FAD/NAD(P)-binding domain,HMMPfam_GIDA		0.388	MTO1-003	KNOWN	basic|CCDS	protein_coding	MTO1	protein_coding	OTTHUMT00000041215.2	C	NM_012123		74246423	+1	no_errors	NM_133645	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SV2C	22987	genome.wustl.edu	37	5	75427930	75427930	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr5:75427930G>T	ENST00000502798.2	+	2	797	c.355G>T	c.(355-357)Gac>Tac	p.D119Y	SV2C_ENST00000322285.7_Missense_Mutation_p.D119Y	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	119					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TGAGTACAAGGACCGGCGGGA	0.537																																																0			5											96.0	112.0	107.0					5																	75427930		2073	4211	6284	75463686	SO:0001583	missense	22987			AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.355G>T	5.37:g.75427930G>T	ENSP00000423541:p.Asp119Tyr	Somatic		Capture	Illumina GAIIx	4	75463686	Q496K1|Q9UPU8	Missense_Mutation	SNP	superfamily_MFS_gen_substrate_transporter,HMMPfam_MFS_1	p.D119Y	ENST00000502798.2	37	c.355	CCDS43331.1	5	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160568	0.78226	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	T;T	0.44881	0.91;0.91	5.71	4.82	0.62117	Major facilitator superfamily domain, general substrate transporter (1);	0.586391	0.18590	N	0.136756	T	0.58694	0.2140	M	0.71581	2.175	0.54753	D	0.999986	D	0.59357	0.985	P	0.55667	0.781	T	0.63120	-0.6708	10	0.62326	D	0.03	-16.6433	15.9153	0.79512	0.0:0.0:0.8638:0.1362	.	119	Q496J9	SV2C_HUMAN	Y	119	ENSP00000423541:D119Y;ENSP00000316983:D119Y	ENSP00000316983:D119Y	D	+	1	0	SV2C	75463686	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	5.693000	0.68264	1.369000	0.46134	0.655000	0.94253	GAC	-	superfamily_MFS_gen_substrate_transporter		0.537	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2C	protein_coding	OTTHUMT00000368700.4	G			75463686	+1	no_errors	NM_014979	genbank	human	provisional	54_36p	missense	SNP	1.000	T
RCHY1	25898	genome.wustl.edu	37	4	76434436	76434436	+	Missense_Mutation	SNP	C	C	T	rs377417374		TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr4:76434436C>T	ENST00000324439.5	-	2	559	c.161G>A	c.(160-162)cGc>cAc	p.R54H	RCHY1_ENST00000451788.1_Missense_Mutation_p.R54H|RCHY1_ENST00000380840.2_Intron|RCHY1_ENST00000512706.1_Missense_Mutation_p.R32H|RCHY1_ENST00000513257.1_Missense_Mutation_p.R54H|RCHY1_ENST00000514021.1_5'UTR	NM_001278536.1|NM_001278538.1|NM_001278539.1	NP_001265465.1|NP_001265467.1|NP_001265468.1	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase	54					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(2)|pancreas(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CACTTTAAAGCGATCTAGTTG	0.353																																																0			4						C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	61.0	57.0	59.0		161,161,161	5.7	1.0	4		59	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense	RCHY1	NM_001008925.2,NM_001009922.2,NM_015436.3	29,29,29	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	54/201,54/253,54/262	76434436	1,13003	2203	4299	6502	76653460	SO:0001583	missense	25898			AF255666	CCDS3567.1, CCDS34012.1, CCDS63990.1, CCDS63991.1, CCDS63992.1	4q21.1-q21.3	2014-02-17	2012-02-23	2004-03-30	ENSG00000163743	ENSG00000163743		"""RING-type (C3HC4) zinc fingers"""	17479	protein-coding gene	gene with protein product	"""androgen-receptor N-terminal-interacting protein"", ""p53-induced protein with a RING-H2 domain"", ""zinc finger, CHY-type"""	607680	"""zinc finger protein 363"", ""ring finger and CHY zinc finger domain containing 1"""	ZNF363		12654245	Standard	NM_015436		Approved	CHIMP, DKFZp586C1620, PRO1996, RNF199, ARNIP, PIRH2, ZCHY	uc003hik.3	Q96PM5	OTTHUMG00000130105	ENST00000324439.5:c.161G>A	4.37:g.76434436C>T	ENSP00000321239:p.Arg54His	Somatic		Capture	Illumina GAIIx	4	76653460	B3KRG3|C7E541|C7E542|C7E543|D3YRV2|E7EMC8|E7ETW5|J3KPI0|Q2KN33|Q59GN7|Q86X26|Q96PR5	Missense_Mutation	SNP	HMMPfam_zf-CHY,superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4	p.R54H	ENST00000324439.5	37	c.161	CCDS3567.1	4	.	.	.	.	.	.	.	.	.	.	C	33	5.215039	0.95104	0.0	1.16E-4	ENSG00000163743	ENST00000324439;ENST00000451788;ENST00000512706;ENST00000513257	T;T	0.38722	1.14;1.12	5.7	5.7	0.88788	Zinc finger, CHY-type (2);	0.000000	0.85682	D	0.000000	T	0.75686	0.3883	H	0.95187	3.635	0.80722	D	1	D;D;D;D	0.89917	0.999;0.997;1.0;1.0	D;P;D;D	0.97110	0.909;0.796;1.0;1.0	T	0.82851	-0.0253	10	0.72032	D	0.01	-22.879	17.3381	0.87288	0.0:1.0:0.0:0.0	.	54;54;54;54	Q2KN33;Q96PM5-2;Q96PM5;G3FDP4	.;.;ZN363_HUMAN;.	H	54;54;32;54	ENSP00000321239:R54H;ENSP00000423976:R32H	ENSP00000321239:R54H	R	-	2	0	RCHY1	76653460	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.606000	0.74159	2.681000	0.91329	0.650000	0.86243	CGC	-	HMMPfam_zf-CHY		0.353	RCHY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCHY1	protein_coding	OTTHUMT00000252411.2	C	NM_015436		76653460	-1	no_errors	NM_015436	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
NTRK2	4915	genome.wustl.edu	37	9	87342780	87342780	+	Silent	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr9:87342780C>T	ENST00000323115.4	+	8	1418	c.1065C>T	c.(1063-1065)aaC>aaT	p.N355N	NTRK2_ENST00000359847.3_Silent_p.N355N|NTRK2_ENST00000304053.6_Silent_p.N355N|NTRK2_ENST00000395866.2_Silent_p.N199N|NTRK2_ENST00000277120.3_Silent_p.N355N|NTRK2_ENST00000395882.1_Silent_p.N355N|NTRK2_ENST00000376214.1_Silent_p.N355N|NTRK2_ENST00000376213.1_Silent_p.N355N|NTRK2_ENST00000376208.1_Silent_p.N355N			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	355	Ig-like C2-type 2.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	CTCACATGAACAATGGGGACT	0.443										TSP Lung(25;0.17)																																						0			9											125.0	116.0	119.0					9																	87342780		2203	4300	6503	86532600	SO:0001819	synonymous_variant	4915			AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1065C>T	9.37:g.87342780C>T		Somatic		Capture	Illumina GAIIx	4	86532600	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Silent	SNP	superfamily_SSF52058,HMMPfam_LRRNT,HMMSmart_LRRNT,HMMPfam_LRR_1,HMMSmart_LRRCT,HMMPfam_I-set,superfamily_SSF48726,HMMSmart_IGc2,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR,PatternScan_RECEPTOR_TYR_KIN_II	p.N355	ENST00000323115.4	37	c.1065	CCDS35050.1	9																																																																																			-	superfamily_SSF48726		0.443	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	protein_coding	OTTHUMT00000052882.1	C			86532600	+1	no_errors	NM_006180	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
IGKV1-39	28930	genome.wustl.edu	37	2	89619423	89619423	+	RNA	SNP	T	T	C			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr2:89619423T>C	ENST00000498574.1	-	0	357									immunoglobulin kappa variable 1-39 (gene/pseudogene)																		AGTTGCAAAATCTTCAGGTTG	0.478																																																0			2											1.0	1.0	1.0					2																	89619423		14	49	63	89400538			0			X59315		2p11.2	2012-02-08	2008-09-12		ENSG00000242371	ENSG00000242371		"""Immunoglobulins / IGK locus"""	5740	other	immunoglobulin gene			"""immunoglobulin kappa variable 1-39"""				Standard	NG_000834		Approved				OTTHUMG00000151678		2.37:g.89619423T>C		Somatic		Capture	Illumina GAIIx	4	89400538		Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406	p.D104G	ENST00000498574.1	37	c.311		2																																																																																			-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00406		0.478	IGKV1-39-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211618	IG_V_gene	OTTHUMT00000323476.1	T	NG_000834		89400538	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390263	ensembl	human	known	54_36p	missense	SNP	1.000	C
GRID2	2895	genome.wustl.edu	37	4	94376819	94376819	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr4:94376819G>A	ENST00000282020.4	+	11	1810	c.1552G>A	c.(1552-1554)Gac>Aac	p.D518N	GRID2_ENST00000510992.1_Missense_Mutation_p.D423N	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	518					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TCAGAGAGCCGACATAGGGAT	0.408																																																0			4											62.0	63.0	63.0					4																	94376819		2203	4300	6503	94595842	SO:0001583	missense	2895			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1552G>A	4.37:g.94376819G>A	ENSP00000282020:p.Asp518Asn	Somatic		Capture	Illumina GAIIx	4	94595842	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	superfamily_SSF53822,HMMPfam_ANF_receptor,HMMSmart_PBPe,superfamily_SSF53850,HMMPfam_Lig_chan-Glu_bd,HMMPfam_Lig_chan	p.D518N	ENST00000282020.4	37	c.1552	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.199873	0.94997	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.63580	-0.05;-0.05	5.73	5.73	0.89815	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.85022	0.5602	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.87891	0.2684	10	0.87932	D	0	.	19.9133	0.97031	0.0:0.0:1.0:0.0	.	423;518	E9PH24;O43424	.;GRID2_HUMAN	N	518;423	ENSP00000282020:D518N;ENSP00000421257:D423N	ENSP00000282020:D518N	D	+	1	0	GRID2	94595842	1.000000	0.71417	0.963000	0.40424	0.984000	0.73092	9.869000	0.99810	2.721000	0.93114	0.655000	0.94253	GAC	-	HMMSmart_PBPe,superfamily_SSF53850		0.408	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	protein_coding	OTTHUMT00000253588.2	G			94595842	+1	no_errors	NM_001510	genbank	human	validated	54_36p	missense	SNP	1.000	A
MUC17	140453	genome.wustl.edu	37	7	100683892	100683892	+	Silent	SNP	C	C	G			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr7:100683892C>G	ENST00000306151.4	+	3	9259	c.9195C>G	c.(9193-9195)acC>acG	p.T3065T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3065	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGGCTAGCACCCTTTCAACAA	0.488																																																0			7											272.0	276.0	275.0					7																	100683892		2203	4300	6503	100470612	SO:0001819	synonymous_variant	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9195C>G	7.37:g.100683892C>G		Somatic		Capture	Illumina GAIIx	4	100470612	O14761|Q685J2|Q8TDH7	Silent	SNP	superfamily_EGF/Laminin,PatternScan_EGF_1,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.T3065	ENST00000306151.4	37	c.9195	CCDS34711.1	7																																																																																			-	NULL		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	C	NM_001040105		100470612	+1	no_errors	NM_001040105	genbank	human	provisional	54_36p	silent	SNP	0.000	G
GLT8D2	83468	genome.wustl.edu	37	12	104390577	104390577	+	Missense_Mutation	SNP	G	G	A	rs143994495		TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr12:104390577G>A	ENST00000360814.4	-	8	941	c.536C>T	c.(535-537)gCg>gTg	p.A179V	GLT8D2_ENST00000548660.1_Missense_Mutation_p.A179V|GLT8D2_ENST00000546436.1_Missense_Mutation_p.A179V	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	179						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						TGAGAAAGCCGCCGCGTGGCC	0.483																																																0			12						G	VAL/ALA	0,4406		0,0,2203	102.0	106.0	104.0		536	5.1	0.8	12	dbSNP_134	104	2,8598	2.2+/-6.3	0,2,4298	yes	missense	GLT8D2	NM_031302.3	64	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	179/350	104390577	2,13004	2203	4300	6503	102914707	SO:0001583	missense	83468			BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.536C>T	12.37:g.104390577G>A	ENSP00000354053:p.Ala179Val	Somatic		Capture	Illumina GAIIx	4	102914707	Q96KA2	Missense_Mutation	SNP	superfamily_SSF53448,HMMPfam_Glyco_transf_8	p.A179V	ENST00000360814.4	37	c.536	CCDS9096.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.147822	0.94603	0.0	2.33E-4	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660	T;T;T	0.40756	1.02;1.02;1.02	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.60547	0.2277	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58115	-0.7693	10	0.05721	T	0.95	.	18.6084	0.91275	0.0:0.0:1.0:0.0	.	179	Q9H1C3	GL8D2_HUMAN	V	179	ENSP00000354053:A179V;ENSP00000449750:A179V;ENSP00000447450:A179V	ENSP00000354053:A179V	A	-	2	0	GLT8D2	102914707	1.000000	0.71417	0.805000	0.32314	0.801000	0.45260	9.766000	0.98957	2.385000	0.81259	0.563000	0.77884	GCG	-	superfamily_SSF53448,HMMPfam_Glyco_transf_8		0.483	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT8D2	protein_coding	OTTHUMT00000407371.1	G	NM_031302		102914707	-1	no_errors	NM_031302	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ACTL7A	10881	genome.wustl.edu	37	9	111624743	111624743	+	Silent	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr9:111624743G>A	ENST00000333999.3	+	1	141	c.141G>A	c.(139-141)acG>acA	p.T47T		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	47	Required for interaction with TES.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TCCGCCATACGAGTTCAGAGC	0.617																																					Esophageal Squamous(177;1480 3591 17554)											0			9											59.0	58.0	59.0					9																	111624743		2203	4300	6503	110664564	SO:0001819	synonymous_variant	10881			BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.141G>A	9.37:g.111624743G>A		Somatic		Capture	Illumina GAIIx	4	110664564	B2RC83|Q5JSV0	Silent	SNP	HMMPfam_Actin,superfamily_Actin-like ATPase domain,HMMSmart_SM00268	p.T47	ENST00000333999.3	37	c.141	CCDS6772.1	9																																																																																			-	NULL		0.617	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7A	protein_coding	OTTHUMT00000053570.1	G	NM_006687		110664564	+1	no_errors	NM_006687	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
OAS2	4939	genome.wustl.edu	37	12	113442915	113442915	+	Silent	SNP	C	C	G			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr12:113442915C>G	ENST00000342315.4	+	7	1570	c.1356C>G	c.(1354-1356)gtC>gtG	p.V452V	RP1-71H24.1_ENST00000552784.1_RNA|OAS2_ENST00000392583.2_Silent_p.V452V	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	452	OAS domain 2.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						AGCTTGAAGTCAGCTTTGAGC	0.498																																					Pancreas(199;709 2232 18410 33584 35052)											0			12											79.0	70.0	73.0					12																	113442915		2203	4300	6503	111927298	SO:0001819	synonymous_variant	4939			M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.1356C>G	12.37:g.113442915C>G		Somatic		Capture	Illumina GAIIx	4	111927298	A8K9T1|Q6PJ33|Q86XX8	Silent	SNP	superfamily_Nucleotidyltransferase,PatternScan_25A_SYNTH_1,HMMPfam_OAS1_C,superfamily_PAP/OAS1 substrate-binding domain,PatternScan_25A_SYNTH_2,HMMPfam_NTP_transf_2	p.V452	ENST00000342315.4	37	c.1356	CCDS31906.1	12																																																																																			-	superfamily_Nucleotidyltransferase,HMMPfam_NTP_transf_2		0.498	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OAS2	protein_coding	OTTHUMT00000405937.1	C			111927298	+1	no_errors	NM_016817	genbank	human	reviewed	54_36p	silent	SNP	0.006	G
METTL14	57721	genome.wustl.edu	37	4	119618343	119618343	+	Silent	SNP	A	A	G			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr4:119618343A>G	ENST00000388822.5	+	7	677	c.510A>G	c.(508-510)ttA>ttG	p.L170L	METTL14_ENST00000506780.1_Silent_p.L132L			Q9HCE5	MET14_HUMAN	methyltransferase like 14	170					mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)	16						ATAGGTACTTACAAGCCGATA	0.313																																																0			4											56.0	57.0	57.0					4																	119618343		2203	4300	6503	119837791	SO:0001819	synonymous_variant	57721			AB046847	CCDS34053.1	4q26	2009-02-24			ENSG00000145388	ENSG00000145388			29330	protein-coding gene	gene with protein product						10997877	Standard	NM_020961		Approved	KIAA1627	uc003icf.3	Q9HCE5	OTTHUMG00000161167	ENST00000388822.5:c.510A>G	4.37:g.119618343A>G		Somatic		Capture	Illumina GAIIx	4	119837791	A6NIG1|Q969V2	Silent	SNP	HMMPfam_MT-A70	p.L170	ENST00000388822.5	37	c.510	CCDS34053.1	4																																																																																			-	NULL		0.313	METTL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL14	protein_coding	OTTHUMT00000364034.3	A	NM_020961		119837791	+1	no_errors	NM_020961	genbank	human	provisional	54_36p	silent	SNP	1.000	G
C11orf63	79864	genome.wustl.edu	37	11	122774777	122774777	+	Silent	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr11:122774777C>T	ENST00000531316.1	+	2	581	c.489C>T	c.(487-489)ctC>ctT	p.L163L	C11orf63_ENST00000227349.2_Silent_p.L163L|C11orf63_ENST00000307257.6_Silent_p.L163L			Q6NUN7	CK063_HUMAN	chromosome 11 open reading frame 63	163					axoneme assembly (GO:0035082)|brain development (GO:0007420)|cerebrospinal fluid secretion (GO:0033326)|ciliary basal body organization (GO:0032053)					breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(13)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	47		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		TGGCTCCCCTCTACCCTTCCC	0.517																																																0			11											60.0	68.0	66.0					11																	122774777		2202	4299	6501	122279987	SO:0001819	synonymous_variant	79864			BC068507	CCDS8438.1, CCDS8439.1	11q24.1	2012-05-25			ENSG00000109944	ENSG00000109944			26288	protein-coding gene	gene with protein product						12477932	Standard	NM_024806		Approved	FLJ23554	uc001pym.4	Q6NUN7	OTTHUMG00000166027	ENST00000531316.1:c.489C>T	11.37:g.122774777C>T		Somatic		Capture	Illumina GAIIx	4	122279987	A8K6G0|Q96GB5|Q9H5D6	Silent	SNP	NULL	p.L163	ENST00000531316.1	37	c.489	CCDS8438.1	11																																																																																			-	NULL		0.517	C11orf63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf63	protein_coding	OTTHUMT00000387511.1	C	NM_024806		122279987	+1	no_errors	NM_024806	genbank	human	validated	54_36p	silent	SNP	0.001	T
ZNF608	57507	genome.wustl.edu	37	5	123980226	123980226	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr5:123980226C>G	ENST00000306315.5	-	5	4269	c.3834G>C	c.(3832-3834)gaG>gaC	p.E1278D	ZNF608_ENST00000504926.1_Missense_Mutation_p.E851D|ZNF608_ENST00000513985.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1278							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GCACACCACTCTCTTTATTAG	0.428																																																0			5											176.0	172.0	174.0					5																	123980226		2203	4300	6503	124008125	SO:0001583	missense	57507			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.3834G>C	5.37:g.123980226C>G	ENSP00000307746:p.Glu1278Asp	Somatic		Capture	Illumina GAIIx	4	124008125	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	PatternScan_ZINC_FINGER_C2H2_1	p.E1278D	ENST00000306315.5	37	c.3834	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	C	2.490	-0.317737	0.05386	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.47177	0.85;0.86	5.55	4.68	0.58851	.	0.432949	0.27700	N	0.018219	T	0.28699	0.0711	N	0.22421	0.69	0.29787	N	0.83353	B	0.11235	0.004	B	0.11329	0.006	T	0.14587	-1.0467	9	.	.	.	-32.08	5.3371	0.15963	0.0:0.6311:0.1646:0.2043	.	1278	Q9ULD9	ZN608_HUMAN	D	851;1278	ENSP00000427657:E851D;ENSP00000307746:E1278D	.	E	-	3	2	ZNF608	124008125	0.743000	0.28239	0.981000	0.43875	0.953000	0.61014	0.370000	0.20433	1.482000	0.48325	-0.152000	0.13540	GAG	-	NULL		0.428	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	protein_coding	OTTHUMT00000371300.1	C	XM_114432		124008125	-1	no_errors	NM_020747	genbank	human	validated	54_36p	missense	SNP	0.732	G
TMEM132B	114795	genome.wustl.edu	37	12	126004129	126004129	+	Missense_Mutation	SNP	C	C	A	rs371482632	byFrequency	TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr12:126004129C>A	ENST00000299308.3	+	4	1244	c.1236C>A	c.(1234-1236)ttC>ttA	p.F412L		NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	412						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CCGAGATCTTCGTCAGCCAGA	0.517																																																0			12											100.0	100.0	100.0					12																	126004129		1959	4138	6097	124570082	SO:0001583	missense	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1236C>A	12.37:g.126004129C>A	ENSP00000299308:p.Phe412Leu	Somatic		Capture	Illumina GAIIx	4	124570082	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	NULL	p.F412L	ENST00000299308.3	37	c.1236	CCDS41859.1	12	.	.	.	.	.	.	.	.	.	.	c	18.12	3.552683	0.65425	.	.	ENSG00000139364	ENST00000299308	T	0.16073	2.37	4.94	-0.934	0.10428	.	0.196353	0.22313	U	0.061718	T	0.14399	0.0348	N	0.17800	0.525	0.80722	D	1	D	0.59767	0.986	P	0.54759	0.76	T	0.07290	-1.0780	10	0.10902	T	0.67	.	11.2606	0.49080	0.0:0.3851:0.0:0.6149	.	412	Q14DG7	T132B_HUMAN	L	412	ENSP00000299308:F412L	ENSP00000299308:F412L	F	+	3	2	TMEM132B	124570082	0.094000	0.21725	0.969000	0.41365	0.995000	0.86356	-1.117000	0.03283	-0.227000	0.09884	0.621000	0.83404	TTC	-	NULL		0.517	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	protein_coding	OTTHUMT00000400043.1	C	NM_052907		124570082	+1	no_errors	NM_052907	genbank	human	provisional	54_36p	missense	SNP	0.995	A
TG	7038	genome.wustl.edu	37	8	133935735	133935735	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr8:133935735G>A	ENST00000220616.4	+	22	4721	c.4681G>A	c.(4681-4683)Gag>Aag	p.E1561K	TG_ENST00000377869.1_Intron|TG_ENST00000542445.1_5'UTR	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1561	Thyroglobulin type-1 11. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GGCCCCTCTTGAGGACTCACA	0.582																																																0			8											61.0	59.0	60.0					8																	133935735		2203	4300	6503	134004917	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4681G>A	8.37:g.133935735G>A	ENSP00000220616:p.Glu1561Lys	Somatic		Capture	Illumina GAIIx	4	134004917	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	superfamily_Thyroglobulin type-1 domain,HMMPfam_Thyroglobulin_1,PatternScan_THYROGLOBULIN_1_1,HMMSmart_SM00211,superfamily_TNF receptor-like,HMMPfam_GCC2_GCC3,HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases,PatternScan_CARBOXYLESTERASE_B_2	p.E1561K	ENST00000220616.4	37	c.4681	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	G	7.705	0.693953	0.15039	.	.	ENSG00000042832	ENST00000543313;ENST00000220616	T	0.62498	0.02	4.84	-3.12	0.05282	Thyroglobulin type-1 (3);	7.777730	0.00909	N	0.002452	T	0.44953	0.1318	N	0.22421	0.69	0.09310	N	1	B	0.23185	0.081	B	0.14023	0.01	T	0.29488	-1.0010	10	0.87932	D	0	.	3.4813	0.07603	0.3869:0.0:0.271:0.3421	.	1561	P01266	THYG_HUMAN	K	367;1561	ENSP00000220616:E1561K	ENSP00000220616:E1561K	E	+	1	0	TG	134004917	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.116000	0.10724	-0.900000	0.03896	-0.266000	0.10368	GAG	-	superfamily_Thyroglobulin type-1 domain,HMMSmart_SM00211		0.582	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	protein_coding	OTTHUMT00000379606.1	G	NM_003235		134004917	+1	no_errors	NM_003235	genbank	human	validated	54_36p	missense	SNP	0.000	A
CEL	1056	genome.wustl.edu	37	9	135947125	135947125	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr9:135947125C>A	ENST00000372080.4	+	11	2261	c.2245C>A	c.(2245-2247)Cag>Aag	p.Q749K	CEL_ENST00000351304.7_Missense_Mutation_p.Q680K	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	746					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CAAGGAAGCTCAGATGCCTGC	0.647																																																0			9											19.0	22.0	21.0					9																	135947125		1865	4082	5947	134936946	SO:0001583	missense	1056			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.2245C>A	9.37:g.135947125C>A	ENSP00000361151:p.Gln749Lys	Somatic		Capture	Illumina GAIIx	4	134936946	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	HMMPfam_COesterase,superfamily_alpha/beta-Hydrolases,PatternScan_CARBOXYLESTERASE_B_2,PatternScan_CARBOXYLESTERASE_B_1	p.Q749K	ENST00000372080.4	37	c.2245	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	c	12.33	1.906255	0.33628	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.69435	-0.2;-0.4	3.11	2.21	0.28008	.	0.735594	0.11715	N	0.536474	T	0.47967	0.1474	N	0.19112	0.55	0.20926	N	0.999822	B	0.22003	0.063	B	0.19666	0.026	T	0.42498	-0.9448	10	0.66056	D	0.02	.	5.2697	0.15618	0.0:0.7386:0.0:0.2614	.	746	P19835	CEL_HUMAN	K	749;680;715	ENSP00000361151:Q749K;ENSP00000342217:Q680K	ENSP00000304021:Q715K	Q	+	1	0	CEL	134936946	0.023000	0.18921	0.891000	0.34965	0.140000	0.21249	0.884000	0.28214	0.890000	0.36211	0.460000	0.39030	CAG	-	NULL		0.647	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	protein_coding	OTTHUMT00000054823.1	C			134936946	+1	no_errors	NM_001807	genbank	human	validated	54_36p	missense	SNP	0.243	A
GFRA3	2676	genome.wustl.edu	37	5	137600068	137600068	+	Silent	SNP	C	C	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr5:137600068C>T	ENST00000274721.3	-	2	507	c.261G>A	c.(259-261)ctG>ctA	p.L87L	GFRA3_ENST00000378362.3_Silent_p.L87L	NM_001496.3	NP_001487.2	O60609	GFRA3_HUMAN	GDNF family receptor alpha 3	87					nervous system development (GO:0007399)|neuron migration (GO:0001764)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extrinsic component of membrane (GO:0019898)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|receptor binding (GO:0005102)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GTGCTGCCTCCAGGCAGTCAG	0.587																																																0			5											103.0	87.0	92.0					5																	137600068		2203	4300	6503	137627967	SO:0001819	synonymous_variant	2676			AY358997	CCDS4201.1	5q31.1-q31.3	2008-02-05			ENSG00000146013	ENSG00000146013			4245	protein-coding gene	gene with protein product		605710				9407096	Standard	NM_001496		Approved	GFRa-3	uc003lcn.3	O60609	OTTHUMG00000129200	ENST00000274721.3:c.261G>A	5.37:g.137600068C>T		Somatic		Capture	Illumina GAIIx	4	137627967	B2RA36|B4DMY9|Q6UW20|Q8IUZ2	Silent	SNP	superfamily_GDNF receptor-like (Pfam 02351),HMMPfam_GDNF	p.L87	ENST00000274721.3	37	c.261	CCDS4201.1	5																																																																																			-	superfamily_GDNF receptor-like (Pfam 02351),HMMPfam_GDNF		0.587	GFRA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GFRA3	protein_coding	OTTHUMT00000251277.1	C	NM_001496		137627967	-1	no_errors	NM_001496	genbank	human	reviewed	54_36p	silent	SNP	0.422	T
PCDHGA4	56111	genome.wustl.edu	37	5	140736473	140736473	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr5:140736473C>A	ENST00000571252.1	+	1	1706	c.1706C>A	c.(1705-1707)aCt>aAt	p.T569N	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	569					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCTTCCCTACTGATGGCTCC	0.582																																																0			5											183.0	193.0	190.0					5																	140736473		2195	4298	6493	140716657	SO:0001583	missense	56111			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1706C>A	5.37:g.140736473C>A	ENSP00000458570:p.Thr569Asn	Somatic		Capture	Illumina GAIIx	4	140716657	Q9Y5D3	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin_2,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.T569N	ENST00000571252.1	37	c.1706	CCDS58979.1	5																																																																																			-	superfamily_Cadherin-like		0.582	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	protein_coding	OTTHUMT00000437959.1	C	NM_018917		140716657	+1	no_errors	NM_018917	genbank	human	reviewed	54_36p	missense	SNP	0.651	A
FLG	2312	genome.wustl.edu	37	1	152284381	152284381	+	Missense_Mutation	SNP	C	C	T	rs150406394		TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:152284381C>T	ENST00000368799.1	-	3	3016	c.2981G>A	c.(2980-2982)gGt>gAt	p.G994D	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	994	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGCCCGTGACCGGCTCTGTC	0.572									Ichthyosis																																							0			1						C	ASP/GLY	0,4406		0,0,2203	242.0	245.0	244.0		2981	-1.4	0.0	1	dbSNP_134	244	1,8599	1.2+/-3.3	0,1,4299	no	missense	FLG	NM_002016.1	94	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	994/4062	152284381	1,13005	2203	4300	6503	150551005	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2981G>A	1.37:g.152284381C>T	ENSP00000357789:p.Gly994Asp	Somatic		Capture	Illumina GAIIx	4	150551005	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	superfamily_SSF47473,HMMPfam_S_100,PatternScan_S100_CABP,PatternScan_EF_HAND_1,HMMPfam_Filaggrin	p.G994D	ENST00000368799.1	37	c.2981	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	c	5.639	0.302528	0.10678	0.0	1.16E-4	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.00730	5.77	2.34	-1.39	0.08997	.	.	.	.	.	T	0.00241	0.0007	M	0.67953	2.075	0.09310	N	1	P	0.41232	0.743	B	0.28991	0.097	T	0.40869	-0.9540	9	0.12766	T	0.61	.	4.2758	0.10808	0.0:0.3649:0.4716:0.1635	.	994	P20930	FILA_HUMAN	D	994;201	ENSP00000357789:G994D	ENSP00000357789:G994D	G	-	2	0	FLG	150551005	0.000000	0.05858	0.000000	0.03702	0.132000	0.20833	-0.217000	0.09253	-0.761000	0.04670	0.291000	0.19559	GGT	-	NULL		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	C	NM_002016		150551005	-1	no_errors	NM_002016	genbank	human	provisional	54_36p	missense	SNP	0.000	T
CLRN1	7401	genome.wustl.edu	37	3	150645734	150645734	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr3:150645734G>T	ENST00000327047.1	-	3	978	c.688C>A	c.(688-690)Cta>Ata	p.L230I	RP11-166N6.3_ENST00000569170.1_Intron|CLRN1-AS1_ENST00000476886.1_RNA|CLRN1_ENST00000328863.4_Missense_Mutation_p.L243I|CLRN1_ENST00000295911.2_Intron|RP11-166N6.2_ENST00000469268.1_RNA	NM_174878.2	NP_777367.1	P58418	CLRN1_HUMAN	clarin 1	230					actin filament organization (GO:0007015)|auditory receptor cell stereocilium organization (GO:0060088)|cell motility (GO:0048870)|equilibrioception (GO:0050957)|photoreceptor cell maintenance (GO:0045494)|positive regulation of lamellipodium assembly (GO:0010592)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CAGTACATTAGATCTGCAGCT	0.363																																																0			3											56.0	59.0	58.0					3																	150645734		2203	4300	6503	152128424	SO:0001583	missense	7401			AF388366	CCDS3153.1, CCDS35492.1, CCDS56285.1	3q25.1	2014-09-17	2006-11-23	2006-11-23	ENSG00000163646	ENSG00000163646			12605	protein-coding gene	gene with protein product		606397	"""Usher syndrome 3A"""	USH3, USH3A, RP61		7711740, 8975700	Standard	NM_052995		Approved		uc021xfr.1	P58418	OTTHUMG00000140368	ENST00000327047.1:c.688C>A	3.37:g.150645734G>T	ENSP00000322280:p.Leu230Ile	Somatic		Capture	Illumina GAIIx	4	152128424	D3DNJ3|E1ACU9|Q8N6A9	Missense_Mutation	SNP	NULL	p.L230I	ENST00000327047.1	37	c.688	CCDS3153.1	3	.	.	.	.	.	.	.	.	.	.	G	12.03	1.816660	0.32145	.	.	ENSG00000163646	ENST00000327047;ENST00000328863	D;D	0.86297	-2.1;-2.1	5.91	2.9	0.33743	.	0.064023	0.64402	N	0.000005	D	0.87116	0.6097	L	0.43757	1.38	0.58432	D	0.999992	D	0.69078	0.997	D	0.78314	0.991	T	0.81634	-0.0844	10	0.08599	T	0.76	-0.1087	7.4489	0.27227	0.0829:0.0:0.6203:0.2968	.	230	P58418	CLRN1_HUMAN	I	230;243	ENSP00000322280:L230I;ENSP00000329158:L243I	ENSP00000322280:L230I	L	-	1	2	CLRN1	152128424	1.000000	0.71417	0.803000	0.32268	0.980000	0.70556	3.834000	0.55798	0.272000	0.22027	-0.181000	0.13052	CTA	-	NULL		0.363	CLRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLRN1	protein_coding	OTTHUMT00000277060.1	G			152128424	-1	no_errors	NM_174878	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
IQGAP3	128239	genome.wustl.edu	37	1	156496285	156496285	+	Missense_Mutation	SNP	C	C	G	rs140982853	byFrequency	TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:156496285C>G	ENST00000361170.2	-	38	4899	c.4889G>C	c.(4888-4890)cGg>cCg	p.R1630P	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1630					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)	p.R1630L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTGTCACTTCCGCAAAAACTT	0.488																																																1	Substitution - Missense(1)	lung(1)	1											101.0	84.0	90.0					1																	156496285		2203	4300	6503	154762909	SO:0001583	missense	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4889G>C	1.37:g.156496285C>G	ENSP00000354451:p.Arg1630Pro	Somatic		Capture	Illumina GAIIx	4	154762909	Q5T3H8	Missense_Mutation	SNP	superfamily_Calponin-homology,HMMPfam_CH,HMMSmart_CH,HMMSmart_IQ,superfamily_SSF52540,HMMPfam_IQ,superfamily_Rho_GAP,HMMSmart_RasGAP,HMMPfam_RasGAP,PatternScan_RAS_GTPASE_ACTIV_1,HMMPfam_RasGAP_C	p.R1630P	ENST00000361170.2	37	c.4889	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.134727	0.37728	.	.	ENSG00000183856	ENST00000361170	T	0.02890	4.12	4.97	2.95	0.34219	.	0.224065	0.37348	N	0.002122	T	0.00936	0.0031	L	0.47190	1.495	0.37600	D	0.920506	P	0.49253	0.921	B	0.30716	0.119	T	0.59979	-0.7352	10	0.62326	D	0.03	-15.0581	6.1436	0.20273	0.1621:0.6621:0.0:0.1758	.	1630	Q86VI3	IQGA3_HUMAN	P	1630	ENSP00000354451:R1630P	ENSP00000354451:R1630P	R	-	2	0	IQGAP3	154762909	0.552000	0.26505	0.992000	0.48379	0.697000	0.40408	0.397000	0.20883	1.321000	0.45227	0.561000	0.74099	CGG	-	NULL		0.488	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	protein_coding	OTTHUMT00000080657.1	C	NM_178229		154762909	-1	no_errors	NM_178229	genbank	human	validated	54_36p	missense	SNP	0.998	G
PLA2R1	22925	genome.wustl.edu	37	2	160889591	160889591	+	Silent	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr2:160889591G>A	ENST00000283243.7	-	4	926	c.720C>T	c.(718-720)caC>caT	p.H240H	PLA2R1_ENST00000392771.1_Silent_p.H240H	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	240	C-type lectin 1. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						GGTAGCAAATGTGTGAATTGA	0.413																																																0			2											139.0	132.0	135.0					2																	160889591		2203	4300	6503	160597837	SO:0001819	synonymous_variant	22925			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.720C>T	2.37:g.160889591G>A		Somatic		Capture	Illumina GAIIx	4	160597837	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	superfamily_Ricin B-like lectins,HMMSmart_SM00458,superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1	p.H240	ENST00000283243.7	37	c.720	CCDS33309.1	2																																																																																			-	superfamily_C-type lectin-like,HMMSmart_SM00034		0.413	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	protein_coding	OTTHUMT00000333820.1	G			160597837	-1	no_errors	NM_007366	genbank	human	validated	54_36p	silent	SNP	1.000	A
HOXD10	3236	genome.wustl.edu	37	2	176982003	176982003	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr2:176982003G>A	ENST00000249501.4	+	1	697	c.442G>A	c.(442-444)Gtc>Atc	p.V148I	HOXD10_ENST00000490088.2_Intron	NM_002148.3	NP_002139.2	P28358	HXD10_HUMAN	homeobox D10	148					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|neuromuscular process (GO:0050905)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		TGAGGTTCCCGTCCCTGGATA	0.527																																																0			2											109.0	126.0	121.0					2																	176982003		2203	4300	6503	176690249	SO:0001583	missense	3236				CCDS2266.1	2q31.1	2014-09-17	2005-12-22		ENSG00000128710	ENSG00000128710		"""Homeoboxes / ANTP class : HOXL subclass"""	5133	protein-coding gene	gene with protein product		142984	"""homeo box D10"""	HOX4, HOX4D		1973146, 1358459	Standard	NM_002148		Approved		uc002ukj.3	P28358	OTTHUMG00000132511	ENST00000249501.4:c.442G>A	2.37:g.176982003G>A	ENSP00000249501:p.Val148Ile	Somatic		Capture	Illumina GAIIx	4	176690249	Q6NT10	Missense_Mutation	SNP	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.V148I	ENST00000249501.4	37	c.442	CCDS2266.1	2	.	.	.	.	.	.	.	.	.	.	G	16.61	3.170414	0.57584	.	.	ENSG00000128710	ENST00000249501	T	0.27720	1.65	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	L	0.54323	1.7	0.80722	D	1	P	0.41748	0.761	B	0.32211	0.142	T	0.09552	-1.0669	10	0.48119	T	0.1	.	20.4756	0.99175	0.0:0.0:1.0:0.0	.	148	P28358	HXD10_HUMAN	I	148	ENSP00000249501:V148I	ENSP00000249501:V148I	V	+	1	0	HOXD10	176690249	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.847000	0.97988	0.655000	0.94253	GTC	-	NULL		0.527	HOXD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXD10	protein_coding	OTTHUMT00000255692.2	G			176690249	+1	no_errors	NM_002148	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179596450	179596450	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr2:179596450T>C	ENST00000591111.1	-	56	16425	c.16201A>G	c.(16201-16203)Agc>Ggc	p.S5401G	TTN_ENST00000589042.1_Missense_Mutation_p.S5718G|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.S4474G|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12219	Ig-like 34.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCAGATGCTGCTGCCCACC	0.478																																																0			2											103.0	103.0	103.0					2																	179596450		1954	4143	6097	179304695	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.16201A>G	2.37:g.179596450T>C	ENSP00000465570:p.Ser5401Gly	Somatic		Capture	Illumina GAIIx	4	179304695	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,HMMPfam_Titin_Z,HMMSmart_SM00406,PatternScan_IG_MHC,HMMPfam_PPAK,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_TYR	p.S4474G	ENST00000591111.1	37	c.13420		2	.	.	.	.	.	.	.	.	.	.	T	8.160	0.789261	0.16258	.	.	ENSG00000155657	ENST00000342992	T	0.68025	-0.3	5.93	4.78	0.61160	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51907	0.1702	L	0.31804	0.96	0.80722	D	1	B	0.24317	0.101	B	0.25614	0.062	T	0.51710	-0.8671	9	0.87932	D	0	.	5.8003	0.18410	0.2407:0.0771:0.0:0.6822	.	5401	Q8WZ42	TITIN_HUMAN	G	4474	ENSP00000343764:S4474G	ENSP00000343764:S4474G	S	-	1	0	TTN	179304695	0.644000	0.27277	1.000000	0.80357	0.879000	0.50718	1.633000	0.37113	1.085000	0.41206	0.533000	0.62120	AGC	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409		0.478	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378		179304695	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	0.916	C
TTN	7273	genome.wustl.edu	37	2	179659786	179659786	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr2:179659786T>A	ENST00000591111.1	-	7	1332	c.1108A>T	c.(1108-1110)Atc>Ttc	p.I370F	TTN_ENST00000589042.1_Missense_Mutation_p.I370F|TTN_ENST00000342175.6_Missense_Mutation_p.I370F|TTN_ENST00000342992.6_Missense_Mutation_p.I370F|TTN_ENST00000360870.5_Missense_Mutation_p.I370F|TTN_ENST00000359218.5_Missense_Mutation_p.I370F|TTN_ENST00000460472.2_Missense_Mutation_p.I370F			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGTCCTGATCTGAGTAGAG	0.582																																																0			2											121.0	110.0	114.0					2																	179659786		2203	4300	6503	179368031	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1108A>T	2.37:g.179659786T>A	ENSP00000465570:p.Ile370Phe	Somatic		Capture	Illumina GAIIx	4	179368031	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_Titin_Z,HMMPfam_ig,PatternScan_IG_MHC,PatternScan_THIOL_PROTEASE_HIS	p.I370F	ENST00000591111.1	37	c.1108		2	.	.	.	.	.	.	.	.	.	.	T	10.29	1.310244	0.23821	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.66099	-0.19;0.05;0.03;0.02;0.13	6.16	5.02	0.67125	.	.	.	.	.	T	0.58736	0.2143	L	0.54323	1.7	0.30045	N	0.812241	P;P;P;P;P	0.46512	0.664;0.664;0.664;0.664;0.879	B;B;B;B;B	0.41988	0.125;0.125;0.125;0.125;0.372	T	0.62627	-0.6814	9	0.87932	D	0	.	10.7968	0.46466	0.0:0.1297:0.0:0.8703	.	370;370;370;370;370	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	F	370	ENSP00000343764:I370F;ENSP00000434586:I370F;ENSP00000340554:I370F;ENSP00000352154:I370F;ENSP00000354117:I370F	ENSP00000340554:I370F	I	-	1	0	TTN	179368031	1.000000	0.71417	0.997000	0.53966	0.483000	0.33249	2.278000	0.43426	1.159000	0.42565	-0.256000	0.11100	ATC	-	NULL		0.582	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378		179368031	-1	no_errors	NM_133379	genbank	human	reviewed	54_36p	missense	SNP	0.999	A
LAX1	54900	genome.wustl.edu	37	1	203743519	203743519	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:203743519A>G	ENST00000442561.2	+	5	1297	c.907A>G	c.(907-909)Agt>Ggt	p.S303G	LAX1_ENST00000367217.5_Missense_Mutation_p.S287G|LAX1_ENST00000367215.1_3'UTR	NM_017773.3	NP_060243.2	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1	303					antigen receptor-mediated signaling pathway (GO:0050851)|B cell activation (GO:0042113)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)			central_nervous_system(2)|endometrium(3)|large_intestine(2)|lung(13)|prostate(1)|stomach(1)|urinary_tract(2)	24	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGCAGATCCCAGTGGAAGCCA	0.517																																																0			1											77.0	74.0	75.0					1																	203743519		2203	4300	6503	202010142	SO:0001583	missense	54900			AK000347	CCDS1441.2, CCDS44297.1	1q32.1	2008-02-05			ENSG00000122188	ENSG00000122188			26005	protein-coding gene	gene with protein product	"""LAT-like membrane associated protein"", ""linker for activation of x cells"""					12359715	Standard	NM_017773		Approved	LAX, FLJ20340	uc001haa.3	Q8IWV1	OTTHUMG00000035908	ENST00000442561.2:c.907A>G	1.37:g.203743519A>G	ENSP00000406970:p.Ser303Gly	Somatic		Capture	Illumina GAIIx	4	202010142	B7Z744|J3KP69|Q6NSZ6|Q9NXB4	Missense_Mutation	SNP	NULL	p.S303G	ENST00000442561.2	37	c.907	CCDS1441.2	1	.	.	.	.	.	.	.	.	.	.	A	14.53	2.563215	0.45694	.	.	ENSG00000122188	ENST00000442561;ENST00000367217	.	.	.	4.79	2.34	0.29019	.	0.866628	0.10281	N	0.693580	T	0.29288	0.0729	L	0.36672	1.1	0.09310	N	1	B;B	0.27732	0.187;0.187	B;B	0.25140	0.058;0.058	T	0.24440	-1.0160	9	0.39692	T	0.17	-1.1395	3.9964	0.09559	0.6696:0.2116:0.1188:0.0	.	287;303	B7Z744;Q8IWV1	.;LAX1_HUMAN	G	303;287	.	ENSP00000356186:S287G	S	+	1	0	LAX1	202010142	0.000000	0.05858	0.001000	0.08648	0.666000	0.39218	0.246000	0.18160	0.369000	0.24510	0.533000	0.62120	AGT	-	NULL		0.517	LAX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAX1	protein_coding	OTTHUMT00000087468.3	A	NM_017773		202010142	+1	no_errors	NM_017773	genbank	human	validated	54_36p	missense	SNP	0.000	G
PLXNA2	5362	genome.wustl.edu	37	1	208391298	208391298	+	5'UTR	DEL	C	C	-			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:208391298delC	ENST00000367033.3	-	0	727					NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2						axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GGAGACGGCTCCTGTGTGTGC	0.617																																																0			1											8.0	10.0	9.0					1																	208391298		2110	4169	6279	206457921	SO:0001623	5_prime_UTR_variant	5362			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.-31G>-	1.37:g.208391298delC		Somatic		Capture	Illumina GAIIx	4	206457921	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Frame_Shift_Del	DEL	superfamily_Sema domain,HMMPfam_Sema,HMMSmart_SM00630,HMMPfam_PSI,HMMSmart_SM00423,superfamily_Plexin repeat,HMMSmart_SM00429,superfamily_E set domains,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_GTPase activation domain GAP	p.S6fs	ENST00000367033.3	37	c.15	CCDS31013.1	1																																																																																			(deletion:cds_exon[206456703,206457935])	NULL		0.617	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	protein_coding	OTTHUMT00000088932.6	C	NM_025179		206457921	-1	no_errors	ENST00000321063	ensembl	human	known	54_36p	frame_shift_del	DEL	0.233	-
OR2L3	391192	genome.wustl.edu	37	1	248224437	248224437	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1733-01A-01W-0639-09	TCGA-61-1733-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	5df269f0-fa83-414a-b784-46b4a5038062	2cce7130-6bf7-4dee-9984-a5b1155c1160	g.chr1:248224437T>C	ENST00000359959.3	+	1	454	c.454T>C	c.(454-456)Tcg>Ccg	p.S152P	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GATCATAGGCTCGATCAATGC	0.433																																																0			1											177.0	202.0	193.0					1																	248224437		2203	4300	6503	246291060	SO:0001583	missense	391192			AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.454T>C	1.37:g.248224437T>C	ENSP00000353044:p.Ser152Pro	Somatic		Capture	Illumina GAIIx	4	246291060	B9EH44	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.S152P	ENST00000359959.3	37	c.454	CCDS31104.1	1	.	.	.	.	.	.	.	.	.	.	.	13.43	2.235249	0.39498	.	.	ENSG00000198128	ENST00000359959	T	0.00115	8.71	1.91	1.91	0.25777	GPCR, rhodopsin-like superfamily (1);	1.218230	0.06416	U	0.721499	T	0.00384	0.0012	M	0.81497	2.545	0.09310	N	1	P	0.50272	0.933	P	0.54590	0.756	T	0.51482	-0.8700	10	0.66056	D	0.02	.	9.2456	0.37523	0.0:0.0:0.0:1.0	.	152	Q8NG85	OR2L3_HUMAN	P	152	ENSP00000353044:S152P	ENSP00000353044:S152P	S	+	1	0	OR2L3	246291060	0.000000	0.05858	0.242000	0.24170	0.014000	0.08584	-0.170000	0.09897	0.853000	0.35312	0.379000	0.24179	TCG	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.433	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L3	protein_coding	OTTHUMT00000096852.1	T	NM_001004687		246291060	+1	no_errors	NM_001004687	genbank	human	provisional	54_36p	missense	SNP	0.000	C
