#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								764	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	764		RNA	SNP	-	NULL		37	NULL		MT																																																																																			-	-	0	0					ENSG00000211459			G			764	+1	no_errors	ENST00000389680	ensembl	human	novel	54_36p	rna	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								10972	SO:0001628	intergenic_variant	4538																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	10972		Nonsense_Mutation	SNP	HMMPfam_Oxidored_q5_N,HMMPfam_Oxidored_q1	p.W71*		37	c.212		MT																																																																																			-	HMMPfam_Oxidored_q5_N	0	0					MT-ND4			G			10972	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361381	ensembl	human	known	54_36p	nonsense	SNP	NULL	A
SGSM2	9905	genome.wustl.edu	37	17	2276756	2276756	+	Silent	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr17:2276756C>T	ENST00000426855.2	+	16	2089	c.1914C>T	c.(1912-1914)atC>atT	p.I638I	RP1-59D14.5_ENST00000574290.1_RNA|SGSM2_ENST00000268989.3_Silent_p.I683I|SGSM2_ENST00000574563.1_Silent_p.I638I	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	638	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		GCAGCAGCATCGACAGCCACG	0.672																																																0			17											79.0	65.0	69.0					17																	2276756		2203	4300	6503	2223506	SO:0001819	synonymous_variant	9905			BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.1914C>T	17.37:g.2276756C>T		Somatic		Capture	Illumina GAIIx	4	2223506	A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Silent	SNP	HMMPfam_RUN,HMMSmart_RUN,superfamily_RabGAP_TBC,HMMSmart_TBC,HMMPfam_TBC	p.I683	ENST00000426855.2	37	c.2049	CCDS45570.1	17																																																																																			-	superfamily_RabGAP_TBC,HMMSmart_TBC		0.672	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM2	protein_coding	OTTHUMT00000438186.1	C	NM_014853		2223506	+1	no_errors	NM_014853	genbank	human	validated	54_36p	silent	SNP	0.967	T
P2RX1	5023	genome.wustl.edu	37	17	3807287	3807287	+	Silent	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr17:3807287G>A	ENST00000225538.3	-	5	733	c.459C>T	c.(457-459)aaC>aaT	p.N153N		NM_002558.2	NP_002549.1	P51575	P2RX1_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 1	153					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ceramide biosynthetic process (GO:0046513)|insemination (GO:0007320)|ion transport (GO:0006811)|neuronal action potential (GO:0019228)|platelet activation (GO:0030168)|positive regulation of ion transport (GO:0043270)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of vascular smooth muscle contraction (GO:0003056)|response to ATP (GO:0033198)|serotonin secretion by platelet (GO:0002554)|signal transduction (GO:0007165)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|vasoconstriction (GO:0042310)	external side of cell outer membrane (GO:0031240)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	13				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		TCACAGTGTCGTTGAAGGCCA	0.602																																																0			17											106.0	83.0	91.0					17																	3807287		2203	4300	6503	3754036	SO:0001819	synonymous_variant	5023			X83688	CCDS11040.1	17p13.3	2012-01-17				ENSG00000108405		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8533	protein-coding gene	gene with protein product		600845				8834001	Standard	NM_002558		Approved	P2X1	uc002fww.3	P51575		ENST00000225538.3:c.459C>T	17.37:g.3807287G>A		Somatic		Capture	Illumina GAIIx	4	3754036	Q9UK84	Silent	SNP	HMMPfam_P2X_receptor,PatternScan_P2X_RECEPTOR	p.N153	ENST00000225538.3	37	c.459	CCDS11040.1	17																																																																																			-	HMMPfam_P2X_receptor		0.602	P2RX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX1	protein_coding	OTTHUMT00000438391.1	G	NM_002558		3754036	-1	no_errors	NM_002558	genbank	human	reviewed	54_36p	silent	SNP	0.036	A
TP53	7157	genome.wustl.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000455263.2_Missense_Mutation_p.R282W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	17	GRCh37	CM056413|CM920678	TP53	M	rs28934574	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	7517819	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp	Somatic		Capture	Illumina GAIIx	4	7517819	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.R282W	ENST00000269305.4	37	c.844	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG	-	HMMPfam_P53,superfamily_p53-like transcription factors		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546		7517819	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
PPP1R3B	79660	genome.wustl.edu	37	8	8998434	8998434	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr8:8998434A>T	ENST00000310455.3	-	2	878	c.728T>A	c.(727-729)aTg>aAg	p.M243K	RP11-10A14.3_ENST00000522057.1_RNA|PPP1R3B_ENST00000519699.1_Missense_Mutation_p.M243K|RP11-10A14.3_ENST00000520017.1_RNA	NM_001201329.1|NM_024607.3	NP_001188258.1|NP_078883.2	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory subunit 3B	243					glycogen metabolic process (GO:0005977)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)	glycogen granule (GO:0042587)|intracellular membrane-bounded organelle (GO:0043231)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase regulator activity (GO:0019888)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	12				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		GGGCTTGGTCATTCCCTGGGT	0.498																																																0			8											188.0	182.0	184.0					8																	8998434		2203	4300	6503	9035844	SO:0001583	missense	79660			AK024067	CCDS5973.1	8p23.1	2012-04-17	2011-10-04		ENSG00000173281	ENSG00000173281		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14942	protein-coding gene	gene with protein product	"""PP1 subunit R4"", ""hepatic glycogen-targeting subunit, G(L)"""	610541	"""protein phosphatase 1, regulatory (inhibitor) subunit 3B"""			11948623, 17555403	Standard	NM_024607		Approved	GL, FLJ14005, PPP1R4	uc003wsn.4	Q86XI6	OTTHUMG00000129329	ENST00000310455.3:c.728T>A	8.37:g.8998434A>T	ENSP00000308318:p.Met243Lys	Somatic		Capture	Illumina GAIIx	4	9035844	B3KTV3|Q9H812	Missense_Mutation	SNP	HMMPfam_CBM_21	p.M243K	ENST00000310455.3	37	c.728	CCDS5973.1	8	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.084435	0.00371	.	.	ENSG00000173281	ENST00000310455;ENST00000519699	T;T	0.39056	1.1;1.1	5.71	-4.84	0.03151	.	1.585610	0.03424	N	0.206711	T	0.11965	0.0291	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27157	-1.0082	10	0.05833	T	0.94	-0.1007	4.4781	0.11753	0.4311:0.095:0.386:0.0879	.	243	Q86XI6	PPR3B_HUMAN	K	243	ENSP00000308318:M243K;ENSP00000428642:M243K	ENSP00000308318:M243K	M	-	2	0	PPP1R3B	9035844	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.044000	0.13992	-0.738000	0.04817	-1.102000	0.02115	ATG	-	NULL		0.498	PPP1R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3B	protein_coding	OTTHUMT00000251472.1	A	NM_024607		9035844	-1	no_errors	NM_024607	genbank	human	validated	54_36p	missense	SNP	0.000	T
ADAM17	6868	genome.wustl.edu	37	2	9661438	9661438	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr2:9661438A>C	ENST00000310823.3	-	8	1033	c.851T>G	c.(850-852)aTt>aGt	p.I284S		NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	284	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		AGACTTGAGAATGCGAATCTA	0.353																																																0			2											176.0	168.0	171.0					2																	9661438		2203	4300	6503	9578889	SO:0001583	missense	6868			U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.851T>G	2.37:g.9661438A>C	ENSP00000309968:p.Ile284Ser	Somatic		Capture	Illumina GAIIx	4	9578889	O60226	Missense_Mutation	SNP	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,PatternScan_ZINC_PROTEASE,HMMPfam_Disintegrin,HMMSmart_SM00050,superfamily_Blood coagulation inhibitor (disintegrin)"	p.I284S	ENST00000310823.3	37	c.851	CCDS1665.1	2	.	.	.	.	.	.	.	.	.	.	A	23.2	4.386646	0.82902	.	.	ENSG00000151694	ENST00000310823	D	0.86432	-2.12	5.63	5.63	0.86233	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (1);	0.088195	0.85682	D	0.000000	D	0.92580	0.7643	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.986	D	0.93309	0.6683	10	0.87932	D	0	.	16.1359	0.81487	1.0:0.0:0.0:0.0	.	284;284	B2RNB2;P78536	.;ADA17_HUMAN	S	284	ENSP00000309968:I284S	ENSP00000309968:I284S	I	-	2	0	ADAM17	9578889	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.133000	0.77259	2.276000	0.75962	0.454000	0.30748	ATT	-	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin"		0.353	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM17	protein_coding	OTTHUMT00000206857.1	A			9578889	-1	no_errors	NM_003183	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	15	20434032	20434032	+	IGR	SNP	T	T	G			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr15:20434032T>G								RP11-173D3.1 (80826 upstream) : CHEK2P2 (53964 downstream)																							TCTTGGAGATTTTCTGGGTTT	0.493																																																0			15																																								18694046	SO:0001628	intergenic_variant	646090																															15.37:g.20434032T>G		Somatic		Capture	Illumina GAIIx	4	18694046		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.493					LOC646090			T			18694046	-1	pseudogene	XR_017120	genbank	human	model	54_36p	rna	SNP	0.988	G
GUSBP1	728411	genome.wustl.edu	37	5	21459800	21459800	+	RNA	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr5:21459800C>T	ENST00000607545.1	+	0	43					NR_027026.1		Q15486	GUSP1_HUMAN	glucuronidase, beta pseudogene 1						carbohydrate metabolic process (GO:0005975)|nervous system development (GO:0007399)|skeletal system development (GO:0001501)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										CAGGCTCAGACGCATCGGGAC	0.637											OREG0016459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			5																																								21495557			0			BC064850, X75940		5p14.3	2012-10-04			ENSG00000183666	ENSG00000183666			13670	pseudogene	pseudogene						8565635	Standard	NR_027026		Approved		uc010iub.3	Q15486	OTTHUMG00000162474		5.37:g.21459800C>T		Somatic	748	Capture	Illumina GAIIx	4	21495557	A6NLY8|A8K1B7|Q969T8|Q9BUH2	Silent	SNP	NULL	p.D13	ENST00000607545.1	37	c.39		5																																																																																			-	NULL		0.637	GUSBP1-006	KNOWN	basic	processed_transcript	uc003jgf.2	pseudogene	OTTHUMT00000470546.1	C	NG_008324		21495557	+1	no_errors	ENST00000399751	ensembl	human	known	54_36p	silent	SNP	0.299	T
HR	55806	genome.wustl.edu	37	8	21976511	21976511	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr8:21976511G>C	ENST00000381418.4	-	16	4645	c.3165C>G	c.(3163-3165)caC>caG	p.H1055Q	HR_ENST00000312841.8_Missense_Mutation_p.H1055Q	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	1055	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		CCCGGAACACGTGCCACACAG	0.682																																																0			8											47.0	51.0	50.0					8																	21976511		2203	4300	6503	22032456	SO:0001583	missense	55806			AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.3165C>G	8.37:g.21976511G>C	ENSP00000370826:p.His1055Gln	Somatic		Capture	Illumina GAIIx	4	22032456	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	HMMSmart_SM00558,HMMPfam_JmjC	p.H1055Q	ENST00000381418.4	37	c.3165	CCDS6022.1	8	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937984	0.73557	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.71579	-0.58;-0.49	5.28	-5.72	0.02406	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.56097	D	0.000028	T	0.79209	0.4407	M	0.73962	2.25	0.35485	D	0.798447	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.81803	-0.0765	10	0.87932	D	0	-14.8297	13.5746	0.61866	0.6733:0.0:0.3267:0.0	.	1055;1055	O43593-2;O43593	.;HAIR_HUMAN	Q	1055	ENSP00000370826:H1055Q;ENSP00000326765:H1055Q	ENSP00000326765:H1055Q	H	-	3	2	HR	22032456	0.997000	0.39634	0.880000	0.34516	0.893000	0.52053	0.192000	0.17096	-1.192000	0.02691	0.313000	0.20887	CAC	-	HMMSmart_SM00558		0.682	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HR	protein_coding	OTTHUMT00000214213.1	G			22032456	-1	no_errors	NM_005144	genbank	human	reviewed	54_36p	missense	SNP	0.997	C
FRG1B	284802	genome.wustl.edu	37	20	29612383	29612383	+	Intron	SNP	C	C	A	rs200667022	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr20:29612383C>A	ENST00000278882.3	+	1	257				FRG1B_ENST00000439954.2_Intron|FRG1B_ENST00000468180.2_Intron|FRG1B_ENST00000358464.4_Intron			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B											endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AGGCATCTCTCCAGGCCTCTG	0.542																																																0			20																																								28226044	SO:0001627	intron_variant	0					20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.-124+270C>A	20.37:g.29612383C>A		Somatic		Capture	Illumina GAIIx	4	28226044	C4AME5	Silent	SNP	NULL	p.L51	ENST00000278882.3	37	c.153		20																																																																																			-	NULL		0.542	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ENSG00000215548	protein_coding	OTTHUMT00000078494.2	C	NR_003579		28226044	+1	no_stop_codon	ENST00000358464	ensembl	human	known	54_36p	silent	SNP	0.078	A
ARHGAP23P1	102577425	genome.wustl.edu	37	16	33740826	33740826	+	RNA	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr16:33740826C>T	ENST00000567025.1	-	0	0									Rho GTPase activating protein 23 pseudogene 1																		TAATACACGGCCGTGTCCTCG	0.562																																																0			16																																								33648327			0					16p11.2	2013-01-23			ENSG00000260781	ENSG00000260781			45039	pseudogene	pseudogene							Standard	NG_033847		Approved				OTTHUMG00000176364		16.37:g.33740826C>T		Somatic		Capture	Illumina GAIIx	4	33648327		RNA	SNP	-	NULL	ENST00000567025.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	.	0.964	-0.702188	0.03255	.	.	ENSG00000226511	ENST00000450856	.	.	.	1.16	1.16	0.20824	.	.	.	.	.	T	0.42562	0.1208	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51092	-0.8749	3	.	.	.	.	8.2368	0.31631	0.0:1.0:0.0:0.0	.	.	.	.	T	89	.	.	A	-	1	0	AC140658.1	33648327	0.933000	0.31639	0.809000	0.32408	0.126000	0.20510	3.426000	0.52778	0.533000	0.28675	0.299000	0.19835	GCC	-	-		0.562	ARHGAP23P1-002	KNOWN	basic	processed_transcript	LOC647224	pseudogene	OTTHUMT00000431823.1	C			33648327	-1	pseudogene	XR_037918	genbank	human	model	54_36p	rna	SNP	1.000	T
BRPF3	27154	genome.wustl.edu	37	6	36168869	36168869	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr6:36168869G>A	ENST00000357641.6	+	2	1023	c.770G>A	c.(769-771)cGc>cAc	p.R257H	BRPF3_ENST00000339717.7_Missense_Mutation_p.R257H|BRPF3_ENST00000443324.2_Missense_Mutation_p.R257H|BRPF3_ENST00000543502.1_Missense_Mutation_p.R257H|BRPF3_ENST00000534694.1_Missense_Mutation_p.R257H|BRPF3_ENST00000534400.1_Missense_Mutation_p.R257H	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	257					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						TGGCTATGCCGCTGCTGCCTG	0.567																																																0			6											78.0	70.0	73.0					6																	36168869		2203	4300	6503	36276847	SO:0001583	missense	27154			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.770G>A	6.37:g.36168869G>A	ENSP00000350267:p.Arg257His	Somatic		Capture	Illumina GAIIx	4	36276847	A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	HMMPfam_EPL1,superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1,superfamily_Bromodomain,HMMSmart_BROMO,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1,superfamily_SSF63748,HMMPfam_PWWP,HMMSmart_PWWP	p.R257H	ENST00000357641.6	37	c.770	CCDS34437.1	6	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937270	0.92458	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324;ENST00000534400	D;D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28;-2.28	5.79	5.79	0.91817	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.92296	0.7556	M	0.66560	2.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73380	0.98;0.98;0.966	D	0.92305	0.5853	10	0.87932	D	0	.	20.0368	0.97565	0.0:0.0:1.0:0.0	.	257;257;257	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	H	257	ENSP00000350267:R257H;ENSP00000345419:R257H;ENSP00000434501:R257H;ENSP00000445352:R257H;ENSP00000387368:R257H;ENSP00000436504:R257H	ENSP00000345419:R257H	R	+	2	0	BRPF3	36276847	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.414000	0.97362	2.735000	0.93741	0.563000	0.77884	CGC	-	superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1		0.567	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	protein_coding	OTTHUMT00000040335.3	G	NM_015695		36276847	+1	no_errors	NM_015695	genbank	human	validated	54_36p	missense	SNP	1.000	A
N4BP2	55728	genome.wustl.edu	37	4	40104288	40104288	+	Missense_Mutation	SNP	G	G	A	rs202029831		TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr4:40104288G>A	ENST00000261435.6	+	4	1239	c.823G>A	c.(823-825)Gtt>Att	p.V275I		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	275					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						ATCTGAGTGCGTTGAGGCTCA	0.433													G|||	1	0.000199681	0.0	0.0	5008	,	,		19119	0.0		0.001	False		,,,				2504	0.0															0			4						G	ILE/VAL	0,4406		0,0,2203	75.0	78.0	77.0		823	-1.5	0.0	4		77	2,8598	2.2+/-6.3	0,2,4298	yes	missense	N4BP2	NM_018177.4	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	275/1771	40104288	2,13004	2203	4300	6503	39780683	SO:0001583	missense	55728			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.823G>A	4.37:g.40104288G>A	ENSP00000261435:p.Val275Ile	Somatic		Capture	Illumina GAIIx	4	39780683	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	superfamily_UBA-like,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_DUF1771,HMMSmart_SM00463,HMMPfam_Smr	p.V275I	ENST00000261435.6	37	c.823	CCDS3457.1	4	.	.	.	.	.	.	.	.	.	.	G	4.302	0.055296	0.08291	0.0	2.33E-4	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.79352	-1.26	5.33	-1.46	0.08800	.	2.107770	0.01862	N	0.036684	T	0.60830	0.2299	N	0.24115	0.695	0.09310	N	1	B;B	0.15473	0.013;0.008	B;B	0.13407	0.009;0.004	T	0.35699	-0.9778	10	0.22706	T	0.39	0.1573	1.7141	0.02898	0.3525:0.215:0.3182:0.1143	.	275;275	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	I	275;195	ENSP00000261435:V275I	ENSP00000261435:V275I	V	+	1	0	N4BP2	39780683	0.000000	0.05858	0.011000	0.14972	0.016000	0.09150	-0.195000	0.09546	-0.134000	0.11516	-0.145000	0.13849	GTT	-	NULL		0.433	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	protein_coding	OTTHUMT00000250458.2	G	NM_018177		39780683	+1	no_errors	NM_018177	genbank	human	reviewed	54_36p	missense	SNP	0.000	A
TSPEAR	54084	genome.wustl.edu	37	21	45987842	45987842	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr21:45987842C>A	ENST00000323084.4	-	2	195	c.130G>T	c.(130-132)Gcc>Tcc	p.A44S	TSPEAR_ENST00000397916.1_5'UTR	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	44					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						CCGCTTGTGGCGCCATCAGAA	0.597																																																0			21											62.0	56.0	58.0					21																	45987842		2203	4300	6503	44812270	SO:0001583	missense	54084			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.130G>T	21.37:g.45987842C>A	ENSP00000321987:p.Ala44Ser	Somatic		Capture	Illumina GAIIx	4	44812270		Missense_Mutation	SNP	HMMSmart_SM00210,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_EPTP	p.A44S	ENST00000323084.4	37	c.130	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	c	0.095	-1.161494	0.01673	.	.	ENSG00000175894	ENST00000323084;ENST00000397918;ENST00000341581	T	0.39592	1.07	4.88	-1.4	0.08968	Concanavalin A-like lectin/glucanase (1);	1.112690	0.06793	N	0.787278	T	0.28995	0.0720	L	0.45581	1.43	0.09310	N	0.999991	B	0.12630	0.006	B	0.04013	0.001	T	0.27434	-1.0074	10	0.07325	T	0.83	0.2249	5.7612	0.18201	0.1232:0.5092:0.0:0.3676	.	44	Q8WU66	TSEAR_HUMAN	S	44	ENSP00000321987:A44S	ENSP00000321987:A44S	A	-	1	0	TSPEAR	44812270	0.001000	0.12720	0.000000	0.03702	0.030000	0.12068	0.359000	0.20233	-0.099000	0.12263	-0.218000	0.12543	GCC	-	NULL		0.597	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf29	protein_coding	OTTHUMT00000098761.1	C	NM_144991		44812270	-1	no_errors	NM_144991	genbank	human	provisional	54_36p	missense	SNP	0.000	A
FCGBP	8857	genome.wustl.edu	37	19	40421180	40421180	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr19:40421180C>G	ENST00000221347.6	-	5	2748	c.2741G>C	c.(2740-2742)aGc>aCc	p.S914T		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	914	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CACAGTCTGGCTGCCCCGATG	0.692																																																0			19											20.0	21.0	21.0					19																	40421180		2202	4298	6500	45113020	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.2741G>C	19.37:g.40421180C>G	ENSP00000221347:p.Ser914Thr	Somatic		Capture	Illumina GAIIx	4	45113020	O95784	Missense_Mutation	SNP	HMMSmart_FOLN,HMMSmart_VWD,HMMPfam_VWD,HMMPfam_C8,superfamily_Cysrich_TIL,HMMPfam_TIL,HMMPfam_TIL_assoc,HMMSmart_VWC	p.S914T	ENST00000221347.6	37	c.2741	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	19.57	3.852497	0.71719	.	.	ENSG00000090920	ENST00000221347	T	0.59224	0.28	4.83	2.69	0.31865	von Willebrand factor, type D domain (3);	0.185429	0.42548	D	0.000692	T	0.60287	0.2257	L	0.28400	0.85	0.26990	N	0.965154	D	0.71674	0.998	D	0.87578	0.998	T	0.52223	-0.8604	10	0.27785	T	0.31	.	10.1932	0.43039	0.0:0.8328:0.0:0.1672	.	914	Q9Y6R7	FCGBP_HUMAN	T	914	ENSP00000221347:S914T	ENSP00000221347:S914T	S	-	2	0	FCGBP	45113020	0.005000	0.15991	0.975000	0.42487	0.989000	0.77384	0.174000	0.16743	0.563000	0.29222	0.491000	0.48974	AGC	-	HMMSmart_VWD,HMMPfam_VWD		0.692	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	C	NM_003890		45113020	-1	no_errors	NM_003890	genbank	human	validated	54_36p	missense	SNP	0.928	G
CELSR1	9620	genome.wustl.edu	37	22	46772988	46772988	+	Missense_Mutation	SNP	G	G	T	rs116079347	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr22:46772988G>T	ENST00000262738.3	-	24	7553	c.7554C>A	c.(7552-7554)ttC>ttA	p.F2518L		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2518					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TCCCAATCACGAACACCAGCT	0.612													G|||	125	0.0249601	0.09	0.0086	5008	,	,		17992	0.0		0.0	False		,,,				2504	0.0															0			22						G	LEU/PHE	343,4063	177.6+/-206.5	11,321,1871	64.0	52.0	56.0		7554	0.9	0.8	22	dbSNP_132	56	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CELSR1	NM_014246.1	22	11,323,6169	TT,TG,GG		0.0233,7.7848,2.6526	probably-damaging	2518/3015	46772988	345,12661	2203	4300	6503	45151652	SO:0001583	missense	9620			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.7554C>A	22.37:g.46772988G>T	ENSP00000262738:p.Phe2518Leu	Somatic		Capture	Illumina GAIIx	4	45151652	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,HMMSmart_SM00179,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,PatternScan_ASX_HYDROXYL,HMMPfam_Laminin_EGF,HMMSmart_SM00180,PatternScan_EGF_LAM_1,HMMSmart_SM00008,HMMPfam_HRM,HMMPfam_GPS,HMMSmart_SM00303,HMMPfam_7tm_2	p.F2518L	ENST00000262738.3	37	c.7554	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	G	15.48	2.846401	0.51164	0.077848	2.33E-4	ENSG00000075275	ENST00000262738	T	0.44482	0.92	4.67	0.883	0.19177	GPCR, family 2-like (1);	0.000000	0.64402	U	0.000001	T	0.07369	0.0186	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.991	T	0.20306	-1.0279	10	0.72032	D	0.01	.	8.7801	0.34787	0.3752:0.0:0.6248:0.0	.	839;2518	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	L	2518	ENSP00000262738:F2518L	ENSP00000262738:F2518L	F	-	3	2	CELSR1	45151652	0.999000	0.42202	0.836000	0.33094	0.078000	0.17371	0.424000	0.21330	0.423000	0.26033	-0.350000	0.07774	TTC	-	HMMPfam_7tm_2		0.612	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	protein_coding	OTTHUMT00000318037.1	G	NM_014246		45151652	-1	no_errors	NM_014246	genbank	human	reviewed	54_36p	missense	SNP	0.995	T
LRP4	4038	genome.wustl.edu	37	11	46897369	46897369	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr11:46897369C>T	ENST00000378623.1	-	26	3927	c.3685G>A	c.(3685-3687)Gat>Aat	p.D1229N	LRP4-AS1_ENST00000502049.2_RNA|LRP4-AS1_ENST00000531719.1_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1229					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		GTGTGGGCATCGGCCCATAGC	0.597																																																0			11											106.0	80.0	89.0					11																	46897369		2201	4299	6500	46853945	SO:0001583	missense	4038			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.3685G>A	11.37:g.46897369C>T	ENSP00000367888:p.Asp1229Asn	Somatic		Capture	Illumina GAIIx	4	46853945	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00181,superfamily_EGF/Laminin,HMMPfam_EGF,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b	p.D1229N	ENST00000378623.1	37	c.3685	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	C	29.4	5.003552	0.93287	.	.	ENSG00000134569	ENST00000378623	D	0.93307	-3.2	5.71	5.71	0.89125	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.97393	0.9147	M	0.89163	3.01	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.97704	1.0186	10	0.87932	D	0	.	19.8574	0.96764	0.0:1.0:0.0:0.0	.	1229	O75096	LRP4_HUMAN	N	1229	ENSP00000367888:D1229N	ENSP00000367888:D1229N	D	-	1	0	LRP4	46853945	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.662000	0.83803	2.704000	0.92352	0.555000	0.69702	GAT	-	superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b		0.597	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	protein_coding	OTTHUMT00000391133.1	C	NM_002334		46853945	-1	no_errors	NM_002334	genbank	human	validated	54_36p	missense	SNP	1.000	T
GALK2	2585	genome.wustl.edu	37	15	49611854	49611854	+	Nonsense_Mutation	SNP	C	C	T	rs144322038		TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr15:49611854C>T	ENST00000560031.1	+	9	1328	c.1021C>T	c.(1021-1023)Cga>Tga	p.R341*	GALK2_ENST00000544523.1_Nonsense_Mutation_p.R317*|GALK2_ENST00000396509.2_Nonsense_Mutation_p.R317*|GALK2_ENST00000561014.1_3'UTR|GALK2_ENST00000327171.3_Nonsense_Mutation_p.R330*|GALK2_ENST00000559454.1_Nonsense_Mutation_p.R317*|GALK2_ENST00000543495.1_3'UTR			Q01415	GALK2_HUMAN	galactokinase 2	341					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		CGAGGCTGCGCGAGTGCTCCA	0.507																																																0			15						C	stop/ARG,stop/ARG	0,4392		0,0,2196	92.0	84.0	86.0		988,1021	2.7	0.3	15	dbSNP_134	86	2,8588	1.2+/-3.3	0,2,4293	no	stop-gained,stop-gained	GALK2	NM_001001556.1,NM_002044.2	,	0,2,6489	TT,TC,CC		0.0233,0.0,0.0154	,	330/448,341/459	49611854	2,12980	2196	4295	6491	47399146	SO:0001587	stop_gained	2585				CCDS32236.1, CCDS42034.1, CCDS73724.1	15q21.1-q21.2	2013-09-20			ENSG00000156958	ENSG00000156958	2.7.1.6		4119	protein-coding gene	gene with protein product		137028					Standard	XM_005254279		Approved	GK2	uc001zxj.1	Q01415	OTTHUMG00000172325	ENST00000560031.1:c.1021C>T	15.37:g.49611854C>T	ENSP00000453129:p.Arg341*	Somatic		Capture	Illumina GAIIx	4	47399146	Q7Z4Q4	Nonsense_Mutation	SNP	superfamily_Ribosomal_S5_D2-typ_fold,HMMPfam_GalKase_gal_bdg,PatternScan_GALACTOKINASE,HMMPfam_GHMP_kinases_N,PatternScan_GHMP_KINASES_ATP,superfamily_SSF55060,HMMPfam_GHMP_kinases_C	p.R341*	ENST00000560031.1	37	c.1021	CCDS42034.1	15	.	.	.	.	.	.	.	.	.	.	C	37	6.214194	0.97380	0.0	2.33E-4	ENSG00000156958	ENST00000327171;ENST00000396509;ENST00000544523	.	.	.	5.89	2.65	0.31530	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.0092	14.4657	0.67482	0.5257:0.4743:0.0:0.0	.	.	.	.	X	330;341;317	.	ENSP00000316632:R330X	R	+	1	2	GALK2	47399146	0.948000	0.32251	0.300000	0.25030	0.989000	0.77384	2.199000	0.42715	0.754000	0.32968	0.655000	0.94253	CGA	-	superfamily_SSF55060		0.507	GALK2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GALK2	protein_coding	OTTHUMT00000417854.1	C			47399146	+1	no_errors	NM_002044	genbank	human	reviewed	54_36p	nonsense	SNP	0.760	T
SCN8A	6334	genome.wustl.edu	37	12	52093371	52093371	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr12:52093371G>A	ENST00000354534.6	+	7	902	c.724G>A	c.(724-726)Ggt>Agt	p.G242S	SCN8A_ENST00000550891.1_Missense_Mutation_p.G242S|SCN8A_ENST00000545061.1_Missense_Mutation_p.G242S	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	242					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	GACAATTGTGGGTGCCCTGAT	0.542																																																0			12											88.0	86.0	86.0					12																	52093371		2097	4263	6360	50379638	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.724G>A	12.37:g.52093371G>A	ENSP00000346534:p.Gly242Ser	Somatic		Capture	Illumina GAIIx	4	50379638	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc,PatternScan_ODR_DC_2_1,HMMSmart_SM00015,HMMPfam_IQ	p.G242S	ENST00000354534.6	37	c.724	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.185878	0.94885	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961;ENST00000551216	D;D;D;D;D	0.98512	-4.97;-4.97;-4.97;-4.97;-4.97	4.32	4.32	0.51571	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98463	0.9488	L	0.52905	1.665	0.80722	D	1	D;P;P;D	0.89917	1.0;0.925;0.94;0.992	D;P;P;P	0.80764	0.994;0.798;0.83;0.887	D	0.99828	1.1052	10	0.87932	D	0	.	17.3774	0.87396	0.0:0.0:1.0:0.0	.	242;242;242;242	F8VWM7;Q9UQD0-3;F8VRN5;Q9UQD0	.;.;.;SCN8A_HUMAN	S	242;242;242;242;155;40	ENSP00000448415:G242S;ENSP00000346534:G242S;ENSP00000440360:G242S;ENSP00000347255:G242S;ENSP00000447567:G40S	ENSP00000346534:G242S	G	+	1	0	SCN8A	50379638	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.400000	0.81607	0.650000	0.86243	GGT	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.542	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	protein_coding	OTTHUMT00000404372.3	G	NM_014191		50379638	+1	no_errors	NM_014191	genbank	human	validated	54_36p	missense	SNP	1.000	A
KRT76	51350	genome.wustl.edu	37	12	53170617	53170617	+	Silent	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr12:53170617C>T	ENST00000332411.2	-	1	512	c.459G>A	c.(457-459)ggG>ggA	p.G153G		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	153	Head.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						CCTGAATTCCCCCAGGAAAGC	0.582																																																0			12											116.0	137.0	130.0					12																	53170617		2203	4300	6503	51456884	SO:0001819	synonymous_variant	51350			M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.459G>A	12.37:g.53170617C>T		Somatic		Capture	Illumina GAIIx	4	51456884	B4DRR3|Q7Z795	Silent	SNP	HMMPfam_Filament,superfamily_Prefoldin,PatternScan_IF	p.G153	ENST00000332411.2	37	c.459	CCDS8838.1	12																																																																																			-	NULL		0.582	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT76	protein_coding	OTTHUMT00000405928.1	C	NM_015848		51456884	-1	no_errors	NM_015848	genbank	human	validated	54_36p	silent	SNP	0.281	T
ARHGAP35	2909	genome.wustl.edu	37	19	47423034	47423034	+	Nonsense_Mutation	SNP	A	A	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr19:47423034A>T	ENST00000404338.3	+	1	1102	c.1102A>T	c.(1102-1104)Aag>Tag	p.K368*		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	368	FF 2.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										AAAAGCCAAAAAGCTCTTAGA	0.448																																																0			19											66.0	64.0	64.0					19																	47423034		1862	4099	5961	52114874	SO:0001587	stop_gained	2909			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.1102A>T	19.37:g.47423034A>T	ENSP00000385720:p.Lys368*	Somatic		Capture	Illumina GAIIx	4	52114874	A7E2A4|Q14452|Q9C0E1	Nonsense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Ras,HMMSmart_SM00441,HMMPfam_FF,superfamily_GTPase activation domain GAP,HMMSmart_SM00324,HMMPfam_RhoGAP	p.K368*	ENST00000404338.3	37	c.1102	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	A	36	5.896085	0.97081	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	.	.	.	5.74	4.67	0.58626	.	0.097203	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-36.6014	11.713	0.51637	0.8524:0.1475:0.0:0.0	.	.	.	.	X	368	.	ENSP00000324820:K368X	K	+	1	0	ARHGAP35	52114874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.475000	0.53136	2.187000	0.69744	0.477000	0.44152	AAG	-	NULL		0.448	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRLF1	protein_coding	OTTHUMT00000466652.1	A	NM_004491		52114874	+1	no_errors	NM_004491	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
ARL15	54622	genome.wustl.edu	37	5	53606308	53606308	+	Start_Codon_SNP	SNP	A	A	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr5:53606308A>T	ENST00000504924.1	-	1	95	c.2T>A	c.(1-3)aTg>aAg	p.M1K	ARL15_ENST00000510591.2_5'Flank|ARL15_ENST00000507646.2_Start_Codon_SNP_p.M1K|ARL15_ENST00000502271.1_5'UTR	NM_019087.2	NP_061960.1	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15	1					small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		Lung NSC(810;0.000779)				gagatcagacatccggcagcc	0.572																																																0			5											40.0	43.0	42.0					5																	53606308		1907	4136	6043	53642065	SO:0001582	initiator_codon_variant	54622			BC026093	CCDS54850.1	5p15.2	2014-05-09	2005-11-03	2005-11-03		ENSG00000185305		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25945	protein-coding gene	gene with protein product			"""ADP-ribosylation factor related protein 2"""	ARFRP2		12477932	Standard	NM_019087		Approved	FLJ20051	uc003jpg.1	Q9NXU5		ENST00000504924.1:c.2T>A	5.37:g.53606308A>T	ENSP00000433427:p.Met1Lys	Somatic		Capture	Illumina GAIIx	4	53642065	Q6IAD0	Missense_Mutation	SNP	HMMPfam_Arf,superfamily_SSF52540	p.M1K	ENST00000504924.1	37	c.2	CCDS54850.1	5	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083867	0.55861	.	.	ENSG00000185305	ENST00000504924;ENST00000507646	T;T	0.65364	0.2;-0.15	4.76	4.76	0.60689	.	.	.	.	.	T	0.56292	0.1975	.	.	.	0.37397	D	0.9127	P	0.34662	0.462	B	0.36534	0.227	T	0.66135	-0.5999	8	0.87932	D	0	.	10.8252	0.46627	1.0:0.0:0.0:0.0	.	1	Q9NXU5	ARL15_HUMAN	K	1	ENSP00000433427:M1K;ENSP00000432680:M1K	ENSP00000433427:M1K	M	-	2	0	ARL15	53642065	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.797000	0.55514	2.107000	0.64212	0.533000	0.62120	ATG	-	NULL		0.572	ARL15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL15	protein_coding	OTTHUMT00000368432.2	A	NM_019087	Missense_Mutation	53642065	-1	no_errors	NM_019087	genbank	human	validated	54_36p	missense	SNP	1.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56176578	56176578	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr5:56176578T>C	ENST00000399503.3	+	12	2128	c.2128T>C	c.(2128-2130)Tgc>Cgc	p.C710R		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	710					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GTTGGAACTGTGCAAAGGCCA	0.378																																																0			5											107.0	97.0	100.0					5																	56176578		1931	4135	6066	56212335	SO:0001583	missense	4214			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2128T>C	5.37:g.56176578T>C	ENSP00000382423:p.Cys710Arg	Somatic		Capture	Illumina GAIIx	4	56212335		Missense_Mutation	SNP	PatternScan_ZF_RING_1,HMMPfam_SWIM,superfamily_SSF57850,HMMSmart_RING,superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.C710R	ENST00000399503.3	37	c.2128	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	T	23.2	4.389266	0.82902	.	.	ENSG00000095015	ENST00000399503	T	0.66280	-0.2	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.76695	0.4023	L	0.56769	1.78	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.78628	-0.2130	10	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	710	Q13233	M3K1_HUMAN	R	710	ENSP00000382423:C710R	ENSP00000382423:C710R	C	+	1	0	MAP3K1	56212335	1.000000	0.71417	0.977000	0.42913	0.917000	0.54804	6.586000	0.74067	2.371000	0.80710	0.533000	0.62120	TGC	-	NULL		0.378	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	protein_coding	OTTHUMT00000132309.2	T	XM_042066		56212335	+1	no_errors	NM_005921	genbank	human	validated	54_36p	missense	SNP	1.000	C
SMTNL1	219537	genome.wustl.edu	37	11	57317542	57317542	+	Missense_Mutation	SNP	G	G	A	rs202111094	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr11:57317542G>A	ENST00000399154.2	+	8	1331	c.1331G>A	c.(1330-1332)cGc>cAc	p.R444H	SMTNL1_ENST00000527972.1_Missense_Mutation_p.R481H|SMTNL1_ENST00000457912.1_Missense_Mutation_p.R499H			A8MU46	SMTL1_HUMAN	smoothelin-like 1	444	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.|Calmodulin-binding. {ECO:0000250}.				negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						GAACTGTACCGCAGCCTTGTG	0.582													G|||	3	0.000599042	0.0008	0.0	5008	,	,		20195	0.0		0.0	False		,,,				2504	0.002															0			11						G	HIS/ARG	5,4199		0,5,2097	56.0	58.0	57.0		1442	4.9	1.0	11		57	3,8453		0,3,4225	yes	missense	SMTNL1	NM_001105565.2	29	0,8,6322	AA,AG,GG		0.0355,0.1189,0.0632	probably-damaging	481/495	57317542	8,12652	2102	4228	6330	57074118	SO:0001583	missense	219537			BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.1331G>A	11.37:g.57317542G>A	ENSP00000382108:p.Arg444His	Somatic		Capture	Illumina GAIIx	4	57074118		Missense_Mutation	SNP	HMMPfam_CH,HMMSmart_SM00033,superfamily_Calponin-homology domain CH-domain	p.R499H	ENST00000399154.2	37	c.1496		11	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193108	0.78902	0.001189	3.55E-4	ENSG00000214872	ENST00000457912;ENST00000527972;ENST00000399154	D;D;D	0.95272	-3.66;-3.66;-3.66	4.89	4.89	0.63831	.	.	.	.	.	D	0.93759	0.8005	N	0.12831	0.26	0.36671	D	0.878521	D	0.89917	1.0	D	0.83275	0.996	D	0.94293	0.7530	9	0.31617	T	0.26	-9.6427	16.9894	0.86349	0.0:0.0:1.0:0.0	.	499	C9J621	.	H	499;481;444	ENSP00000406485:R499H;ENSP00000432651:R481H;ENSP00000382108:R444H	ENSP00000382108:R444H	R	+	2	0	SMTNL1	57074118	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.527000	0.67123	2.549000	0.85964	0.561000	0.74099	CGC	-	HMMPfam_CH,superfamily_Calponin-homology domain CH-domain		0.582	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	SMTNL1	protein_coding		G	XM_166203		57074118	+1	no_errors	NM_001105565	genbank	human	provisional	54_36p	missense	SNP	1.000	A
DDX42	11325	genome.wustl.edu	37	17	61897305	61897305	+	IGR	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr17:61897305C>T	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Missense_Mutation_p.V801I	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						TTGGCTACAACGTAGGTGACA	0.527																																																0			17											142.0	132.0	136.0					17																	61897305		2203	4300	6503	59251037	SO:0001628	intergenic_variant	117246			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61897305C>T		Somatic		Capture	Illumina GAIIx	4	59251037	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	superfamily_S-adenosyl-L-methionine-dependent methyltransferases,HMMPfam_FtsJ,HMMPfam_Spb1_C	p.V801I	ENST00000578681.1	37	c.2401	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020734	0.75275	.	.	ENSG00000108592	ENST00000427159	T	0.41400	1.0	4.9	4.9	0.64082	Ribosomal RNA methyltransferase, Spb1, C-terminal (1);	0.000000	0.64402	D	0.000018	T	0.48909	0.1526	L	0.49455	1.56	0.50813	D	0.999896	D	0.69078	0.997	P	0.55011	0.766	T	0.43814	-0.9368	10	0.46703	T	0.11	-16.2566	11.3217	0.49426	0.0:0.8164:0.1836:0.0	.	801	Q8IY81	RRMJ3_HUMAN	I	801	ENSP00000396673:V801I	ENSP00000396673:V801I	V	-	1	0	FTSJ3	59251037	0.996000	0.38824	0.998000	0.56505	0.911000	0.54048	2.010000	0.40913	2.539000	0.85634	0.563000	0.77884	GTT	-	HMMPfam_Spb1_C		0.527	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ3	protein_coding	OTTHUMT00000444368.1	C	NM_007372		59251037	-1	no_errors	NM_017647	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CDH7	1005	genome.wustl.edu	37	18	63530053	63530053	+	Silent	SNP	C	C	T	rs138789170	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr18:63530053C>T	ENST00000397968.2	+	11	2190	c.1764C>T	c.(1762-1764)gaC>gaT	p.D588D	RP11-389J22.1_ENST00000581987.1_RNA|CDH7_ENST00000323011.3_Silent_p.D588D|CDH7_ENST00000536984.2_Silent_p.D588D	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	588	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D588D(2)		NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GTGATGCTGACGGCGTAGCCC	0.522													C|||	6	0.00119808	0.0008	0.0	5008	,	,		19261	0.0		0.003	False		,,,				2504	0.002															2	Substitution - coding silent(2)	kidney(2)	18						C	,	8,4398	14.3+/-33.2	0,8,2195	120.0	94.0	103.0		1764,1764	-7.2	0.0	18	dbSNP_134	103	41,8559	27.9+/-77.7	0,41,4259	no	coding-synonymous,coding-synonymous	CDH7	NM_004361.2,NM_033646.1	,	0,49,6454	TT,TC,CC		0.4767,0.1816,0.3767	,	588/786,588/786	63530053	49,12957	2203	4300	6503	61681033	SO:0001819	synonymous_variant	1005			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1764C>T	18.37:g.63530053C>T		Somatic		Capture	Illumina GAIIx	4	61681033	Q9H157	Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.D588	ENST00000397968.2	37	c.1764	CCDS11993.1	18																																																																																			-	superfamily_Cadherin-like,HMMSmart_SM00112		0.522	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	protein_coding	OTTHUMT00000256217.2	C	NM_033646		61681033	+1	no_errors	NM_004361	genbank	human	reviewed	54_36p	silent	SNP	0.999	T
PLCB3	5331	genome.wustl.edu	37	11	64031527	64031527	+	Silent	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr11:64031527C>T	ENST00000540288.1	+	22	2698	c.2595C>T	c.(2593-2595)caC>caT	p.H865H	PLCB3_ENST00000279230.6_Silent_p.H865H|PLCB3_ENST00000325234.5_Silent_p.H798H	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	865					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						CCATTAAGCACGTCAGCCTGA	0.677																																																0			11											54.0	61.0	58.0					11																	64031527		2201	4297	6498	63788103	SO:0001819	synonymous_variant	5331			Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.2595C>T	11.37:g.64031527C>T		Somatic		Capture	Illumina GAIIx	4	63788103	A5PKZ6|G5E960|Q8N1A4	Silent	SNP	superfamily_EF-hand,HMMPfam_efhand_like,HMMSmart_SM00148,HMMPfam_PI-PLC-X,superfamily_PLC-like phosphodiesterases,HMMPfam_PI-PLC-Y,HMMSmart_SM00149,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,HMMPfam_PLC-beta_C	p.H865	ENST00000540288.1	37	c.2595	CCDS8064.1	11																																																																																			-	NULL		0.677	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	PLCB3	protein_coding	OTTHUMT00000396405.1	C			63788103	+1	no_errors	NM_000932	genbank	human	provisional	54_36p	silent	SNP	0.997	T
HYDIN	54768	genome.wustl.edu	37	16	70894688	70894688	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr16:70894688C>T	ENST00000393567.2	-	70	12044	c.11894G>A	c.(11893-11895)cGc>cAc	p.R3965H		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3965					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CTCTGGGTTGCGCTGATGGCC	0.572																																																0			16											1.0	1.0	1.0					16																	70894688		1004	2219	3223	69452189	SO:0001583	missense	54768			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11894G>A	16.37:g.70894688C>T	ENSP00000377197:p.Arg3965His	Somatic		Capture	Illumina GAIIx	4	69452189	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R3964H	ENST00000393567.2	37	c.11891	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836226	0.32421	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01854	4.6	5.69	0.519	0.17035	.	0.000000	0.33712	U	0.004628	T	0.05686	0.0149	M	0.64676	1.99	0.80722	D	1	D	0.63046	0.992	P	0.56278	0.795	T	0.26608	-1.0098	10	0.59425	D	0.04	.	6.9293	0.24432	0.0:0.6298:0.115:0.2553	.	3964	F8WD23	.	H	3965;3964	ENSP00000377197:R3965H	ENSP00000313052:R3964H	R	-	2	0	HYDIN	69452189	0.988000	0.35896	0.394000	0.26270	0.001000	0.01503	1.382000	0.34374	-0.099000	0.12263	-1.448000	0.01049	CGC	-	NULL		0.572	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	C			69452189	-1	no_errors	NM_032821	genbank	human	validated	54_36p	missense	SNP	0.965	T
PTGR2	145482	genome.wustl.edu	37	14	74343823	74343823	+	Silent	SNP	A	A	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr14:74343823A>T	ENST00000555661.1	+	5	616	c.471A>T	c.(469-471)acA>acT	p.T157T	PTGR2_ENST00000553813.1_Silent_p.T23T|PTGR2_ENST00000267568.4_Silent_p.T157T|RP5-1021I20.4_ENST00000556551.2_Silent_p.T157T|PTGR2_ENST00000555228.1_Silent_p.T157T			Q8N8N7	PTGR2_HUMAN	prostaglandin reductase 2	157					prostaglandin metabolic process (GO:0006693)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)			NS(1)|large_intestine(3)|lung(2)|prostate(1)|skin(2)	9					Indomethacin(DB00328)	CTAATAAGACAATGGTTGTCA	0.408																																					Esophageal Squamous(98;1155 1417 16452 47043 47872)											0			14											141.0	135.0	137.0					14																	74343823		2203	4300	6503	73413576	SO:0001819	synonymous_variant	145482			AK096410	CCDS9820.1	14q24.1-q24.2	2008-06-04	2008-06-02	2008-06-03		ENSG00000140043			20149	protein-coding gene	gene with protein product		608642	"""zinc binding alcohol dehydrogenase domain containing 1"""	ZADH1		17449869	Standard	NM_152444		Approved	FLJ39091	uc001xow.3	Q8N8N7		ENST00000555661.1:c.471A>T	14.37:g.74343823A>T		Somatic		Capture	Illumina GAIIx	4	73413576	Q3L8A4|Q6MZH8	Silent	SNP	superfamily_GroES-like,superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_ADH_zinc_N	p.T157	ENST00000555661.1	37	c.471	CCDS9820.1	14																																																																																			-	superfamily_NAD(P)-binding Rossmann-fold domains,HMMPfam_ADH_zinc_N		0.408	PTGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGR2	protein_coding	OTTHUMT00000412575.1	A			73413576	+1	no_errors	NM_152444	genbank	human	provisional	54_36p	silent	SNP	0.967	T
MTHFD2	10797	genome.wustl.edu	37	2	74432890	74432890	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr2:74432890C>T	ENST00000394053.2	+	2	240	c.160C>T	c.(160-162)Cgg>Tgg	p.R54W	MTHFD2_ENST00000264090.4_Intron|MTHFD2_ENST00000409804.1_Missense_Mutation_p.R54W|MTHFD2_ENST00000409601.1_Missense_Mutation_p.R54W|MTHFD2_ENST00000477455.1_3'UTR|MTHFD2_ENST00000394050.3_Intron	NM_006636.3	NP_006627.2	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase	54					folic acid-containing compound biosynthetic process (GO:0009396)|one-carbon metabolic process (GO:0006730)|tetrahydrofolate metabolic process (GO:0046653)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	magnesium ion binding (GO:0000287)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|phosphate ion binding (GO:0042301)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6					Tetrahydrofolic acid(DB00116)	GCAGGAAGTGCGGCAGGAGGT	0.498																																																0			2											67.0	69.0	68.0					2																	74432890		1944	4142	6086	74286398	SO:0001583	missense	10797			X16396	CCDS1935.2	2p13.1	2008-05-02			ENSG00000065911	ENSG00000065911			7434	protein-coding gene	gene with protein product		604887				2587219, 8218174	Standard	NR_027405		Approved		uc002skk.3	P13995	OTTHUMG00000129814	ENST00000394053.2:c.160C>T	2.37:g.74432890C>T	ENSP00000377617:p.Arg54Trp	Somatic		Capture	Illumina GAIIx	4	74286398	Q53G90|Q53GV5|Q53S36|Q7Z650	Missense_Mutation	SNP	superfamily_SSF53223,HMMPfam_THF_DHG_CYH,PatternScan_THF_DHG_CYH_1,superfamily_NAD(P)-bd,HMMPfam_THF_DHG_CYH_C,PatternScan_THF_DHG_CYH_2	p.R54W	ENST00000394053.2	37	c.160	CCDS1935.2	2	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321128	0.60634	.	.	ENSG00000065911	ENST00000394053;ENST00000409804;ENST00000409601	T;T;T	0.48201	1.77;0.82;1.82	4.84	4.84	0.62591	Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain (1);	0.111149	0.64402	D	0.000008	T	0.59155	0.2173	M	0.91663	3.23	0.80722	D	1	B;B	0.22800	0.075;0.014	B;B	0.21546	0.035;0.022	T	0.65166	-0.6234	10	0.59425	D	0.04	.	15.8296	0.78741	0.0:1.0:0.0:0.0	.	54;54	B8ZZU9;P13995	.;MTDC_HUMAN	W	54	ENSP00000377617:R54W;ENSP00000386536:R54W;ENSP00000386542:R54W	ENSP00000377617:R54W	R	+	1	2	MTHFD2	74286398	0.997000	0.39634	1.000000	0.80357	0.966000	0.64601	2.316000	0.43761	2.399000	0.81585	0.655000	0.94253	CGG	-	superfamily_SSF53223,HMMPfam_THF_DHG_CYH		0.498	MTHFD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFD2	protein_coding	OTTHUMT00000252045.2	C			74286398	+1	no_errors	NM_006636	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	11	74790307	74790307	+	IGR	SNP	G	G	C			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr11:74790307G>C								NEU3 (60369 upstream) : OR2AT4 (9450 downstream)																							TTTTCTTAAAGAGACTTCCTC	0.363																																																0			11																																								74467955	SO:0001628	intergenic_variant	0																															11.37:g.74790307G>C		Somatic		Capture	Illumina GAIIx	4	74467955		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.363					LOC100129795			G			74467955	-1	pseudogene	XR_037716	genbank	human	model	54_36p	rna	SNP	0.992	C
PQLC1	80148	genome.wustl.edu	37	18	77679249	77679249	+	Silent	SNP	G	G	A	rs114428753	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr18:77679249G>A	ENST00000397778.2	-	5	725	c.543C>T	c.(541-543)acC>acT	p.T181T	PQLC1_ENST00000409073.1_Silent_p.T98T|PQLC1_ENST00000357575.4_Silent_p.T163T|PQLC1_ENST00000590381.1_Intron	NM_025078.4	NP_079354.2	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1	181	PQ-loop 2.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	9		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		GCATGGCTTCGGTCAGCACAG	0.652													G|||	18	0.00359425	0.0129	0.0014	5008	,	,		17889	0.0		0.0	False		,,,				2504	0.0															0			18						G	,,	50,4356	50.9+/-86.3	0,50,2153	88.0	75.0	79.0		,489,543	-10.2	0.2	18	dbSNP_132	79	0,8600		0,0,4300	no	intron,coding-synonymous,coding-synonymous	PQLC1	NM_001146343.1,NM_001146345.1,NM_025078.4	,,	0,50,6453	AA,AG,GG		0.0,1.1348,0.3844	,,	,163/254,181/272	77679249	50,12956	2203	4300	6503	75780237	SO:0001819	synonymous_variant	80148			AK123870	CCDS12020.1, CCDS54192.1, CCDS54193.1	18q23	2004-01-14			ENSG00000122490	ENSG00000122490			26188	protein-coding gene	gene with protein product						12477932	Standard	NM_025078		Approved	FLJ22378	uc002lnl.2	Q8N2U9	OTTHUMG00000132921	ENST00000397778.2:c.543C>T	18.37:g.77679249G>A		Somatic		Capture	Illumina GAIIx	4	75780237	B7Z7D9|G5E989|Q9H6D0	Silent	SNP	HMMPfam_PQ-loop,HMMSmart_SM00679	p.T181	ENST00000397778.2	37	c.543	CCDS12020.1	18																																																																																			-	HMMPfam_PQ-loop		0.652	PQLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PQLC1	protein_coding	OTTHUMT00000256434.1	G	NM_025078		75780237	-1	no_errors	NM_025078	genbank	human	provisional	54_36p	silent	SNP	0.998	A
PRSS35	167681	genome.wustl.edu	37	6	84233812	84233812	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr6:84233812G>T	ENST00000369700.3	+	2	829	c.652G>T	c.(652-654)Ggt>Tgt	p.G218C	PRSS35_ENST00000536636.1_Missense_Mutation_p.G218C	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	218	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		CCAAAGAGAGGGTACCAGAGA	0.522																																																0			6											61.0	69.0	66.0					6																	84233812		2203	4300	6503	84290531	SO:0001583	missense	167681			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.652G>T	6.37:g.84233812G>T	ENSP00000358714:p.Gly218Cys	Somatic		Capture	Illumina GAIIx	4	84290531	A8K7B3|Q9BQP6	Missense_Mutation	SNP	PatternScan_TRYPSIN_SER,superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc,HMMPfam_Trypsin,PatternScan_TRYPSIN_HIS	p.G218C	ENST00000369700.3	37	c.652	CCDS4999.1	6	.	.	.	.	.	.	.	.	.	.	G	6.592	0.477554	0.12521	.	.	ENSG00000146250	ENST00000536636;ENST00000369700	T;T	0.45668	0.89;0.89	5.41	4.5	0.54988	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.984279	0.08300	N	0.966980	T	0.17023	0.0409	L	0.29908	0.895	0.09310	N	1	P	0.45348	0.856	B	0.40101	0.319	T	0.14254	-1.0479	10	0.62326	D	0.03	-16.6576	9.2313	0.37439	0.172:0.0:0.828:0.0	.	218	Q8N3Z0	PRS35_HUMAN	C	218	ENSP00000440870:G218C;ENSP00000358714:G218C	ENSP00000358714:G218C	G	+	1	0	PRSS35	84290531	0.000000	0.05858	0.002000	0.10522	0.101000	0.19017	0.942000	0.29017	1.210000	0.43336	0.462000	0.41574	GGT	-	superfamily_Pept_Ser_Cys,HMMSmart_Tryp_SPc		0.522	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS35	protein_coding	OTTHUMT00000041352.1	G	NM_153362		84290531	+1	no_errors	NM_153362	genbank	human	provisional	54_36p	missense	SNP	0.006	T
NAALAD2	10003	genome.wustl.edu	37	11	89914856	89914856	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr11:89914856G>A	ENST00000534061.1	+	17	2157	c.1927G>A	c.(1927-1929)Gtt>Att	p.V643I	NAALAD2_ENST00000375944.3_Intron|NAALAD2_ENST00000321955.4_Missense_Mutation_p.V610I	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	643					neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				ACTTATACAAGTTGATCTTAA	0.274																																																0			11											33.0	37.0	35.0					11																	89914856		2200	4290	6490	89554504	SO:0001583	missense	10003			AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.1927G>A	11.37:g.89914856G>A	ENSP00000432481:p.Val643Ile	Somatic		Capture	Illumina GAIIx	4	89554504	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	superfamily_Transferrin receptor ectodomain apical domain,HMMPfam_PA,superfamily_Zn-dependent exopeptidases,HMMPfam_Peptidase_M28,superfamily_Transferrin receptor ectodomain C-terminal domain,HMMPfam_TFR_dimer	p.V643I	ENST00000534061.1	37	c.1927	CCDS8288.1	11	.	.	.	.	.	.	.	.	.	.	G	5.180	0.218843	0.09810	.	.	ENSG00000077616	ENST00000534061;ENST00000321955	T;T	0.57273	0.41;0.41	5.2	1.7	0.24286	Transferrin receptor-like, dimerisation domain (3);	0.607307	0.16177	N	0.226040	T	0.26882	0.0658	N	0.11000	0.08	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.04796	-1.0926	9	.	.	.	-13.8546	6.2218	0.20685	0.2284:0.3951:0.3765:0.0	.	643	Q9Y3Q0	NALD2_HUMAN	I	643;610	ENSP00000432481:V643I;ENSP00000320083:V610I	.	V	+	1	0	NAALAD2	89554504	0.000000	0.05858	0.972000	0.41901	0.965000	0.64279	-0.198000	0.09505	0.656000	0.30886	0.650000	0.86243	GTT	-	superfamily_Transferrin receptor ectodomain C-terminal domain,HMMPfam_TFR_dimer		0.274	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAALAD2	protein_coding	OTTHUMT00000389424.2	G	NM_005467		89554504	+1	no_errors	NM_005467	genbank	human	reviewed	54_36p	missense	SNP	0.936	A
DPYD	1806	genome.wustl.edu	37	1	98165101	98165101	+	Silent	SNP	T	T	C			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr1:98165101T>C	ENST00000370192.3	-	6	586	c.486A>G	c.(484-486)gtA>gtG	p.V162V	DPYD_ENST00000423006.2_3'UTR|DPYD_ENST00000474241.1_5'UTR	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	162					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TTGCTTTGAATACCTACGGGG	0.363																																																0			1											113.0	114.0	114.0					1																	98165101		2203	4299	6502	97937689	SO:0001819	synonymous_variant	1806			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.486A>G	1.37:g.98165101T>C		Somatic		Capture	Illumina GAIIx	4	97937689	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Silent	SNP	superfamily_Helical_ferredxn,superfamily_SSF51971,HMMPfam_Pyr_redox_2,superfamily_SSF51395,HMMPfam_DHO_dh,superfamily_SSF54862,HMMPfam_Fer4,PatternScan_4FE4S_FER_1	p.V162	ENST00000370192.3	37	c.486	CCDS30777.1	1																																																																																			-	superfamily_Helical_ferredxn		0.363	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	protein_coding	OTTHUMT00000095698.3	T	NM_000110		97937689	-1	no_errors	NM_000110	genbank	human	reviewed	54_36p	silent	SNP	0.799	C
STAG3	10734	genome.wustl.edu	37	7	99802723	99802723	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr7:99802723C>T	ENST00000426455.1	+	28	3454	c.3047C>T	c.(3046-3048)tCc>tTc	p.S1016F	STAG3_ENST00000440830.1_3'UTR|STAG3_ENST00000317296.5_Missense_Mutation_p.S1016F|GATS_ENST00000436886.2_Intron|GATS_ENST00000543273.1_RNA|STAG3_ENST00000394018.2_Missense_Mutation_p.S958F	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	1016					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCAGAGTTTTCCCCCCGACTC	0.547																																																0			7											147.0	154.0	151.0					7																	99802723		2203	4300	6503	99640659	SO:0001583	missense	10734			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.3047C>T	7.37:g.99802723C>T	ENSP00000400359:p.Ser1016Phe	Somatic		Capture	Illumina GAIIx	4	99640659	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_STAG	p.S1016F	ENST00000426455.1	37	c.3047	CCDS34703.1	7	.	.	.	.	.	.	.	.	.	.	.	19.79	3.893694	0.72639	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000379577;ENST00000317296	D;D;D	0.84589	-1.87;-1.87;-1.87	5.28	5.28	0.74379	.	0.000000	0.46145	D	0.000302	D	0.92747	0.7694	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.99;0.998;0.998	D	0.93690	0.7006	10	0.87932	D	0	-15.9625	16.4332	0.83860	0.0:1.0:0.0:0.0	.	958;1016;1016	B4DZ10;D6W5U7;Q9UJ98	.;.;STAG3_HUMAN	F	1016;958;36;1016	ENSP00000400359:S1016F;ENSP00000377586:S958F;ENSP00000319318:S1016F	ENSP00000319318:S1016F	S	+	2	0	STAG3	99640659	1.000000	0.71417	0.999000	0.59377	0.794000	0.44872	5.485000	0.66850	2.455000	0.83008	0.655000	0.94253	TCC	-	superfamily_ARM repeat		0.547	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	protein_coding	OTTHUMT00000338734.2	C	NM_012447		99640659	+1	no_errors	NM_012447	genbank	human	validated	54_36p	missense	SNP	0.998	T
MUC17	140453	genome.wustl.edu	37	7	100679280	100679280	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr7:100679280G>C	ENST00000306151.4	+	3	4647	c.4583G>C	c.(4582-4584)aGt>aCt	p.S1528T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1528	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACAGTGGCCAGTTCTGAAATC	0.488																																																0			7											254.0	222.0	233.0					7																	100679280		2203	4300	6503	100466000	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4583G>C	7.37:g.100679280G>C	ENSP00000302716:p.Ser1528Thr	Somatic		Capture	Illumina GAIIx	4	100466000	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	superfamily_EGF/Laminin,PatternScan_EGF_1,superfamily_SEA domain,HMMSmart_SM00200,HMMPfam_SEA	p.S1528T	ENST00000306151.4	37	c.4583	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.067863	0.00382	.	.	ENSG00000169876	ENST00000306151	T	0.01981	4.52	.	.	.	.	.	.	.	.	T	0.00815	0.0027	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44967	-0.9293	7	0.08381	T	0.77	.	.	.	.	.	1528	Q685J3	MUC17_HUMAN	T	1528	ENSP00000302716:S1528T	ENSP00000302716:S1528T	S	+	2	0	MUC17	100466000	0.000000	0.05858	0.007000	0.13788	0.004000	0.04260	-2.931000	0.00688	-1.729000	0.01364	-1.721000	0.00707	AGT	-	NULL		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	G	NM_001040105		100466000	+1	no_errors	NM_001040105	genbank	human	provisional	54_36p	missense	SNP	0.001	C
UBR5	51366	genome.wustl.edu	37	8	103271255	103271255	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr8:103271255C>T	ENST00000520539.1	-	57	8665	c.8059G>A	c.(8059-8061)Gtg>Atg	p.V2687M	UBR5_ENST00000518205.1_Missense_Mutation_p.V415M|UBR5_ENST00000521922.1_Missense_Mutation_p.V2680M|UBR5_ENST00000220959.4_Missense_Mutation_p.V2686M|KB-431C1.5_ENST00000606361.1_RNA	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2687	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AGCATTTGCACATTGACTTCA	0.343																																					Ovarian(131;96 1741 5634 7352 27489)											0			8											103.0	106.0	105.0					8																	103271255		2203	4300	6503	103340431	SO:0001583	missense	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.8059G>A	8.37:g.103271255C>T	ENSP00000429084:p.Val2687Met	Somatic		Capture	Illumina GAIIx	4	103340431	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	HMMPfam_zf-UBR,HMMSmart_ZnF_UBR1,superfamily_HECT,superfamily_PABP_HYD,HMMPfam_PABP,HMMSmart_PolyA,HMMSmart_HECTc,HMMPfam_HECT	p.V2687M	ENST00000520539.1	37	c.8059	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	C	31	5.097907	0.94197	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	5.73	5.73	0.89815	HECT (4);	0.000000	0.64402	D	0.000001	T	0.71333	0.3327	M	0.84156	2.68	0.80722	D	1	P;P	0.41673	0.759;0.759	P;P	0.46585	0.521;0.521	T	0.75560	-0.3275	10	0.87932	D	0	.	19.8966	0.96963	0.0:1.0:0.0:0.0	.	2680;2687	E7EMW7;O95071	.;UBR5_HUMAN	M	2687;2686;415;2680	ENSP00000429084:V2687M;ENSP00000220959:V2686M;ENSP00000428693:V415M;ENSP00000427819:V2680M	ENSP00000220959:V2686M	V	-	1	0	UBR5	103340431	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.487000	0.81328	2.700000	0.92200	0.655000	0.94253	GTG	-	superfamily_HECT,HMMSmart_HECTc,HMMPfam_HECT		0.343	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	protein_coding	OTTHUMT00000380075.2	C	NM_015902		103340431	-1	no_errors	NM_015902	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
NCK2	8440	genome.wustl.edu	37	2	106471603	106471603	+	Silent	SNP	G	G	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr2:106471603G>T	ENST00000233154.4	+	3	526	c.84G>T	c.(82-84)cgG>cgT	p.R28R	AC009505.2_ENST00000596418.1_RNA|NCK2_ENST00000393349.2_Silent_p.R28R|AC009505.2_ENST00000598281.1_RNA|NCK2_ENST00000522586.1_Silent_p.R28R|NCK2_ENST00000451463.2_Silent_p.R28R|AC009505.2_ENST00000427050.2_RNA	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	28	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						AGAACGAGCGGCTGTGGTTGC	0.567																																																0			2											86.0	83.0	84.0					2																	106471603		2203	4300	6503	105838035	SO:0001819	synonymous_variant	8440			AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.84G>T	2.37:g.106471603G>T		Somatic		Capture	Illumina GAIIx	4	105838035	D3DVK1|Q9BWN9|Q9UIC3	Silent	SNP	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2	p.R28	ENST00000233154.4	37	c.84	CCDS33266.1	2																																																																																			-	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3		0.567	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCK2	protein_coding	OTTHUMT00000329634.1	G	NM_003581		105838035	+1	no_errors	NM_001004720	genbank	human	reviewed	54_36p	silent	SNP	0.710	T
SORCS1	114815	genome.wustl.edu	37	10	108439447	108439447	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr10:108439447A>T	ENST00000263054.6	-	11	1613	c.1606T>A	c.(1606-1608)Tac>Aac	p.Y536N	SORCS1_ENST00000369698.1_Missense_Mutation_p.Y71N|SORCS1_ENST00000344440.6_Missense_Mutation_p.Y536N	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	536					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CCTGATGTGTAGGGATTCTCA	0.423																																																0			10											119.0	97.0	104.0					10																	108439447		2203	4300	6503	108429437	SO:0001583	missense	114815			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1606T>A	10.37:g.108439447A>T	ENSP00000263054:p.Tyr536Asn	Somatic		Capture	Illumina GAIIx	4	108429437	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	superfamily_SSF110296,HMMSmart_VPS10,HMMSmart_PKD,superfamily_PKD,HMMPfam_PKD	p.Y536N	ENST00000263054.6	37	c.1606	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	A	26.7	4.760866	0.89932	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.33654	1.4;1.4;1.4	6.17	6.17	0.99709	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.61763	0.2373	M	0.74881	2.28	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;1.0	T	0.61710	-0.7007	9	.	.	.	-20.6703	16.8222	0.85835	1.0:0.0:0.0:0.0	.	536;536;536;536;536	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	N	71;536;536	ENSP00000358712:Y71N;ENSP00000263054:Y536N;ENSP00000345964:Y536N	.	Y	-	1	0	SORCS1	108429437	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	TAC	-	superfamily_SSF110296,HMMSmart_VPS10		0.423	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	protein_coding	OTTHUMT00000050232.4	A	NM_052918		108429437	-1	no_errors	NM_001013031	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZNF462	58499	genome.wustl.edu	37	9	109771845	109771845	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr9:109771845C>A	ENST00000277225.5	+	12	7498	c.7209C>A	c.(7207-7209)gaC>gaA	p.D2403E	ZNF462_ENST00000542028.1_Missense_Mutation_p.D360E|RP11-508N12.2_ENST00000439901.1_RNA|ZNF462_ENST00000441147.2_Missense_Mutation_p.D1309E|ZNF462_ENST00000457913.1_Missense_Mutation_p.D2463E			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2403					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GATTTTCTGACCACGGGGCTG	0.478																																																0			9											111.0	100.0	104.0					9																	109771845		2203	4300	6503	108811666	SO:0001583	missense	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.7209C>A	9.37:g.109771845C>A	ENSP00000277225:p.Asp2403Glu	Somatic		Capture	Illumina GAIIx	4	108811666	Q5T0T4|Q8N408	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_beta-sandwich domain of Sec23/24	p.D2403E	ENST00000277225.5	37	c.7209	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630528	0.28978	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147;ENST00000542028	T;T;T;T;T	0.14266	3.56;4.02;4.13;4.14;2.52	5.67	1.24	0.21308	.	0.447384	0.24280	N	0.039917	T	0.07143	0.0181	N	0.20881	0.62	0.23243	N	0.998052	B;B	0.09022	0.002;0.002	B;B	0.14578	0.011;0.003	T	0.42548	-0.9445	10	0.10111	T	0.7	.	7.5424	0.27746	0.0:0.4386:0.4049:0.1565	.	2463;2403	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	E	2403;2463;1346;1309;360	ENSP00000277225:D2403E;ENSP00000414570:D2463E;ENSP00000363818:D1346E;ENSP00000397306:D1309E;ENSP00000439771:D360E	ENSP00000277225:D2403E	D	+	3	2	ZNF462	108811666	0.000000	0.05858	0.714000	0.30535	0.953000	0.61014	-0.596000	0.05720	0.221000	0.20879	0.557000	0.71058	GAC	-	superfamily_beta-sandwich domain of Sec23/24,superfamily_C2H2 and C2HC zinc fingers		0.478	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	protein_coding	OTTHUMT00000053532.2	C	NM_021224		108811666	+1	no_errors	NM_021224	genbank	human	validated	54_36p	missense	SNP	0.340	A
ZGRF1	55345	genome.wustl.edu	37	4	113539521	113539521	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr4:113539521C>T	ENST00000505019.1	-	6	1802	c.1677G>A	c.(1675-1677)tgG>tgA	p.W559*	C4orf21_ENST00000445203.2_Nonsense_Mutation_p.W528*|C4orf21_ENST00000309071.5_Nonsense_Mutation_p.W559*	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		559						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TGTCCTTTACCCAACTCTCTG	0.373																																																0			4											106.0	105.0	105.0					4																	113539521		2203	4299	6502	113758970	SO:0001587	stop_gained	55345																														ENST00000505019.1:c.1677G>A	4.37:g.113539521C>T	ENSP00000424737:p.Trp559*	Somatic		Capture	Illumina GAIIx	4	113758970	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Nonsense_Mutation	SNP	HMMPfam_DUF2439	p.W559*	ENST00000505019.1	37	c.1677		4	.	.	.	.	.	.	.	.	.	.	C	27.2	4.813503	0.90790	.	.	ENSG00000138658	ENST00000505019;ENST00000309071;ENST00000445203	.	.	.	5.21	3.48	0.39840	.	1.645180	0.03077	N	0.158039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.4779	7.8313	0.29344	0.3974:0.5279:0.0:0.0746	.	.	.	.	X	559;559;528	.	ENSP00000309095:W559X	W	-	3	0	C4orf21	113758970	0.000000	0.05858	0.001000	0.08648	0.043000	0.13939	0.562000	0.23531	0.693000	0.31634	0.557000	0.71058	TGG	-	NULL		0.373	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	C4orf21	protein_coding	OTTHUMT00000256413.1	C			113758970	-1	no_errors	NM_018392	genbank	human	predicted	54_36p	nonsense	SNP	0.000	T
ANK2	287	genome.wustl.edu	37	4	114253186	114253186	+	Missense_Mutation	SNP	C	C	T	rs147934418		TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr4:114253186C>T	ENST00000357077.4	+	28	3237	c.3184C>T	c.(3184-3186)Cgc>Tgc	p.R1062C	ANK2_ENST00000506722.1_Missense_Mutation_p.R1053C|ANK2_ENST00000264366.6_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000394537.3_Missense_Mutation_p.R1062C	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1062	Interaction with SPTBN1.|ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TTTGGTCAGCCGCATTCTTCA	0.493																																																0			4						C	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	119.0	128.0	125.0		3157,3184,3184	4.8	1.0	4	dbSNP_134	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ANK2	NM_001127493.1,NM_001148.4,NM_020977.3	180,180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	1053/1864,1062/3958,1062/1873	114253186	1,13005	2203	4300	6503	114472635	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3184C>T	4.37:g.114253186C>T	ENSP00000349588:p.Arg1062Cys	Somatic		Capture	Illumina GAIIx	4	114472635	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank,HMMPfam_ZU5,PatternScan_ALDEHYDE_DEHYDR_GLU,superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death	p.R1062C	ENST00000357077.4	37	c.3184	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	C	18.50	3.637050	0.67130	0.0	1.16E-4	ENSG00000145362	ENST00000503271;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000343056	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	5.62	4.75	0.60458	ZU5 (3);	0.000000	0.32970	N	0.005431	T	0.54095	0.1837	N	0.08118	0	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.996;1.0;0.996;0.992	T	0.64715	-0.6342	10	0.87932	D	0	.	15.962	0.79939	0.1352:0.8648:0.0:0.0	.	1029;1062;1062;1053;1053	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	C	1041;1053;1077;1062;1062;1053	ENSP00000423799:R1041C;ENSP00000421067:R1053C;ENSP00000424722:R1077C;ENSP00000378044:R1062C;ENSP00000349588:R1062C	ENSP00000340561:R1053C	R	+	1	0	ANK2	114472635	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.607000	0.46300	2.643000	0.89663	0.655000	0.94253	CGC	-	HMMPfam_ZU5		0.493	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	protein_coding	OTTHUMT00000256422.2	C	NM_001148		114472635	+1	no_errors	NM_001148	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CEP164	22897	genome.wustl.edu	37	11	117253563	117253563	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr11:117253563T>A	ENST00000278935.3	+	14	1776	c.1629T>A	c.(1627-1629)caT>caA	p.H543Q	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	543	Glu-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		AGGAGCAGCATTCCCAGGCCG	0.597																																																0			11											73.0	70.0	71.0					11																	117253563		2201	4296	6497	116758773	SO:0001583	missense	22897			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.1629T>A	11.37:g.117253563T>A	ENSP00000278935:p.His543Gln	Somatic		Capture	Illumina GAIIx	4	116758773	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW	p.H543Q	ENST00000278935.3	37	c.1629	CCDS31683.1	11	.	.	.	.	.	.	.	.	.	.	T	3.107	-0.183534	0.06340	.	.	ENSG00000110274	ENST00000278935;ENST00000529538	T	0.56941	0.43	4.27	-1.41	0.08941	.	1.018410	0.07855	N	0.965275	T	0.33352	0.0860	L	0.29908	0.895	0.09310	N	1	B;B;B	0.17268	0.012;0.021;0.021	B;B;B	0.14023	0.003;0.01;0.01	T	0.19712	-1.0297	10	0.17832	T	0.49	2.3711	4.1978	0.10452	0.0:0.4224:0.1695:0.4081	.	517;543;546	E9PI34;Q9UPV0;Q9UPV0-2	.;CE164_HUMAN;.	Q	543;517	ENSP00000278935:H543Q	ENSP00000278935:H543Q	H	+	3	2	CEP164	116758773	0.000000	0.05858	0.006000	0.13384	0.735000	0.41995	-0.527000	0.06200	-0.315000	0.08703	-0.177000	0.13119	CAT	-	NULL		0.597	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	protein_coding	OTTHUMT00000392893.1	T	NM_014956		116758773	+1	no_errors	NM_014956	genbank	human	validated	54_36p	missense	SNP	0.000	A
KPNA5	3841	genome.wustl.edu	37	6	117010541	117010541	+	Silent	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr6:117010541C>T	ENST00000368564.1	+	2	211	c.63C>T	c.(61-63)gcC>gcT	p.A21A	KPNA5_ENST00000356348.1_Silent_p.A21A			O15131	IMA6_HUMAN	karyopherin alpha 5 (importin alpha 6)	18	IBB. {ECO:0000255|PROSITE- ProRule:PRU00561}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(6)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		AGAATAAAGCCCTAAATCCTC	0.348																																																0			6											122.0	133.0	130.0					6																	117010541		2203	4300	6503	117117234	SO:0001819	synonymous_variant	3841			AF005361	CCDS5111.1	6q22.2	2013-02-14			ENSG00000196911	ENSG00000196911		"""Importins"", ""Armadillo repeat containing"""	6398	protein-coding gene	gene with protein product		604545				9395085	Standard	NM_002269		Approved	SRP6, IPOA6	uc003pxh.3	O15131	OTTHUMG00000015448	ENST00000368564.1:c.63C>T	6.37:g.117010541C>T		Somatic		Capture	Illumina GAIIx	4	117117234	B2RAI5|Q86X23	Silent	SNP	HMMPfam_IBB,superfamily_ARM repeat,HMMPfam_Arm,HMMSmart_SM00185	p.A21	ENST00000368564.1	37	c.63	CCDS5111.1	6																																																																																			-	HMMPfam_IBB		0.348	KPNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA5	protein_coding	OTTHUMT00000041967.1	C	NM_002269		117117234	+1	no_errors	NM_002269	genbank	human	reviewed	54_36p	silent	SNP	0.847	T
OASL	8638	genome.wustl.edu	37	12	121469368	121469368	+	Silent	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr12:121469368G>A	ENST00000257570.5	-	3	804	c.534C>T	c.(532-534)atC>atT	p.I178I	OASL_ENST00000339275.5_Silent_p.I178I	NM_003733.3	NP_003724.1	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like	178					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|transferase activity (GO:0016740)			NS(1)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CGCAGGCCTTGATCAGGCTCA	0.557																																					Colon(192;517 2041 31392 31913 39966)											0			12											77.0	75.0	75.0					12																	121469368		2203	4300	6503	119953751	SO:0001819	synonymous_variant	8638			AF063611	CCDS9211.1, CCDS9212.1, CCDS73536.1	12q24.2	2008-08-05			ENSG00000135114	ENSG00000135114			8090	protein-coding gene	gene with protein product		603281				10087211	Standard	NM_003733		Approved	TRIP14, p59OASL	uc001tzj.2	Q15646	OTTHUMG00000154981	ENST00000257570.5:c.534C>T	12.37:g.121469368G>A		Somatic		Capture	Illumina GAIIx	4	119953751	B2RAZ2|I1YDD2|O75686|Q17R95|Q9Y6K6|Q9Y6K7	Silent	SNP	superfamily_Nucleotidyltransferase,PatternScan_25A_SYNTH_1,HMMPfam_OAS1_C,superfamily_PAP/OAS1 substrate-binding domain,PatternScan_25A_SYNTH_2,HMMSmart_SM00213,superfamily_Ubiquitin-like,HMMPfam_ubiquitin	p.I178	ENST00000257570.5	37	c.534	CCDS9211.1	12	.	.	.	.	.	.	.	.	.	.	G	5.294	0.239580	0.10023	.	.	ENSG00000135114	ENST00000543677	.	.	.	5.52	-2.0	0.07433	.	.	.	.	.	T	0.38612	0.1047	.	.	.	0.38845	D	0.956153	.	.	.	.	.	.	T	0.30765	-0.9967	4	.	.	.	-16.9388	1.0502	0.01578	0.1641:0.1502:0.2404:0.4453	.	.	.	.	L	76	.	.	S	-	2	0	OASL	119953751	0.004000	0.15560	0.009000	0.14445	0.076000	0.17211	-0.164000	0.09983	-0.492000	0.06687	-0.311000	0.09066	TCA	-	superfamily_Nucleotidyltransferase,HMMPfam_OAS1_C		0.557	OASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OASL	protein_coding	OTTHUMT00000337875.2	G	NM_003733		119953751	-1	no_errors	NM_003733	genbank	human	validated	54_36p	silent	SNP	0.154	A
CLASP1	23332	genome.wustl.edu	37	2	122216508	122216508	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr2:122216508C>T	ENST00000263710.4	-	13	1611	c.1222G>A	c.(1222-1224)Gaa>Aaa	p.E408K	CLASP1_ENST00000541859.1_Missense_Mutation_p.E177K|CLASP1_ENST00000545861.1_Missense_Mutation_p.E176K|CLASP1_ENST00000397587.3_Missense_Mutation_p.E408K|CLASP1_ENST00000455322.2_Missense_Mutation_p.E408K|CLASP1_ENST00000541377.1_Missense_Mutation_p.E408K|CLASP1_ENST00000409078.3_Missense_Mutation_p.E408K|CLASP1_ENST00000430234.1_5'UTR	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	408					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					ATAATGGCTTCAGCTCCATGG	0.368																																																0			2											143.0	140.0	141.0					2																	122216508		1854	4096	5950	121932978	SO:0001583	missense	23332			AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.1222G>A	2.37:g.122216508C>T	ENSP00000263710:p.Glu408Lys	Somatic		Capture	Illumina GAIIx	4	121932978	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.E408K	ENST00000263710.4	37	c.1222		2	.	.	.	.	.	.	.	.	.	.	C	26.5	4.741534	0.89573	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.67345	-0.26;0.74;0.74;0.74;-0.26;0.74;-0.26	5.45	5.45	0.79879	Armadillo-type fold (1);CLASP N-terminal domain (1);	0.090055	0.85682	D	0.000000	T	0.78259	0.4255	M	0.80422	2.495	0.80722	D	1	P;P;P;P	0.40638	0.674;0.623;0.725;0.472	B;B;P;P	0.48368	0.386;0.267;0.466;0.575	T	0.80393	-0.1401	10	0.66056	D	0.02	-10.3643	19.6233	0.95669	0.0:1.0:0.0:0.0	.	408;408;408;408	E7EUA5;F5GWS0;B7ZLX3;Q7Z460	.;.;.;CLAP1_HUMAN	K	408;408;408;408;177;408;176	ENSP00000263710:E408K;ENSP00000389372:E408K;ENSP00000380717:E408K;ENSP00000441625:E408K;ENSP00000441770:E177K;ENSP00000386442:E408K;ENSP00000438620:E176K	ENSP00000263710:E408K	E	-	1	0	CLASP1	121932978	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.782000	0.85680	2.714000	0.92807	0.655000	0.94253	GAA	-	superfamily_ARM repeat		0.368	CLASP1-201	KNOWN	basic	protein_coding	CLASP1	protein_coding		C	NM_015282		121932978	-1	no_errors	NM_015282	genbank	human	validated	54_36p	missense	SNP	1.000	T
HSPA5	3309	genome.wustl.edu	37	9	127998994	127998994	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr9:127998994T>A	ENST00000324460.6	-	8	2045	c.1842A>T	c.(1840-1842)gaA>gaT	p.E614D		NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	614					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CTTTGAAGTCTTCAATGTCAG	0.433										Prostate(1;0.17)																																						0			9											116.0	110.0	112.0					9																	127998994		2203	4300	6503	127038815	SO:0001583	missense	3309				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.1842A>T	9.37:g.127998994T>A	ENSP00000324173:p.Glu614Asp	Somatic		Capture	Illumina GAIIx	4	127038815	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Missense_Mutation	SNP	superfamily_Actin-like ATPase domain,HMMPfam_HSP70,PatternScan_HSP70_1,PatternScan_HSP70_2,PatternScan_HSP70_3,superfamily_Heat shock protein 70kD (HSP70) peptide-binding domain,superfamily_Heat shock protein 70kD (HSP70) C-terminal subdomain	p.E614D	ENST00000324460.6	37	c.1842	CCDS6863.1	9	.	.	.	.	.	.	.	.	.	.	T	13.16	2.153448	0.38021	.	.	ENSG00000044574	ENST00000324460	T	0.16073	2.37	4.87	4.87	0.63330	.	0.050634	0.85682	D	0.000000	T	0.13415	0.0325	N	0.25992	0.78	0.80722	D	1	B	0.14438	0.01	B	0.22880	0.042	T	0.09228	-1.0684	10	0.23302	T	0.38	-19.9751	13.9572	0.64157	0.0:0.0:0.0:1.0	.	614	P11021	GRP78_HUMAN	D	614	ENSP00000324173:E614D	ENSP00000324173:E614D	E	-	3	2	HSPA5	127038815	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.358000	0.34102	1.955000	0.56771	0.477000	0.44152	GAA	-	HMMPfam_HSP70,superfamily_Heat shock protein 70kD (HSP70) C-terminal subdomain		0.433	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA5	protein_coding	OTTHUMT00000054062.1	T			127038815	-1	no_errors	NM_005347	genbank	human	validated	54_36p	missense	SNP	1.000	A
AK1	203	genome.wustl.edu	37	9	130630328	130630328	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr9:130630328C>G	ENST00000373176.1	-	7	696	c.544G>C	c.(544-546)Gtc>Ctc	p.V182L	AK1_ENST00000223836.10_Missense_Mutation_p.V198L|MIR4672_ENST00000583126.1_RNA|AK1_ENST00000373156.1_Missense_Mutation_p.V182L|RP11-203J24.9_ENST00000476274.2_RNA	NM_000476.2	NP_000467.1			adenylate kinase 1											endometrium(1)|prostate(1)	2						TGGGAGAAGACACTGTCCACG	0.662																																																0			9											85.0	77.0	79.0					9																	130630328		2203	4300	6503	129670149	SO:0001583	missense	203			J04809	CCDS6881.1	9q34.1	2008-02-05			ENSG00000106992	ENSG00000106992	2.7.4.3	"""Adenylate kinases"""	361	protein-coding gene	gene with protein product		103000					Standard	NM_000476		Approved		uc004bsm.4	P00568	OTTHUMG00000020722	ENST00000373176.1:c.544G>C	9.37:g.130630328C>G	ENSP00000362271:p.Val182Leu	Somatic		Capture	Illumina GAIIx	4	129670149		Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_ADK,PatternScan_ADENYLATE_KINASE	p.V182L	ENST00000373176.1	37	c.544	CCDS6881.1	9	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755557	0.69648	.	.	ENSG00000106992	ENST00000373176;ENST00000373156;ENST00000223836	T;T;T	0.75367	-0.93;-0.93;-0.93	5.19	4.22	0.49857	.	0.058565	0.64402	D	0.000002	T	0.78207	0.4247	M	0.89353	3.025	0.53688	D	0.999975	P	0.45348	0.856	B	0.40285	0.325	D	0.84438	0.0581	10	0.87932	D	0	-28.5983	14.2577	0.66062	0.0:0.85:0.15:0.0	.	182	P00568	KAD1_HUMAN	L	182;182;198	ENSP00000362271:V182L;ENSP00000362249:V182L;ENSP00000223836:V198L	ENSP00000223836:V198L	V	-	1	0	AK1	129670149	0.996000	0.38824	0.995000	0.50966	0.998000	0.95712	3.553000	0.53713	2.579000	0.87056	0.655000	0.94253	GTC	-	superfamily_P-loop containing nucleoside triphosphate hydrolases		0.662	AK1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AK1	protein_coding	OTTHUMT00000054307.1	C			129670149	-1	no_errors	NM_000476	genbank	human	reviewed	54_36p	missense	SNP	0.998	G
SLC23A1	9963	genome.wustl.edu	37	5	138715947	138715947	+	Silent	SNP	G	G	A	rs200969580		TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr5:138715947G>A	ENST00000348729.3	-	6	643	c.597C>T	c.(595-597)gtC>gtT	p.V199V	SLC23A1_ENST00000353963.3_Silent_p.V203V|SLC23A1_ENST00000503919.1_5'Flank	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	199					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	CAGCTTGGAAGACAGAAAGGC	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17515	0.0		0.0	False		,,,				2504	0.0															0			5											42.0	50.0	48.0					5																	138715947		2195	4295	6490	138743846	SO:0001819	synonymous_variant	9963			AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.597C>T	5.37:g.138715947G>A		Somatic		Capture	Illumina GAIIx	4	138743846	O95191|Q8WWB6|Q9UGH4|Q9UI39	Silent	SNP	HMMPfam_Xan_ur_permease	p.V203	ENST00000348729.3	37	c.609	CCDS4212.1	5																																																																																			-	HMMPfam_Xan_ur_permease		0.642	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	SLC23A1	protein_coding	OTTHUMT00000374185.1	G	NM_152685		138743846	-1	no_errors	NM_152685	genbank	human	reviewed	54_36p	silent	SNP	0.994	A
PCDHA2	56146	genome.wustl.edu	37	5	140174859	140174859	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr5:140174859A>T	ENST00000526136.1	+	1	310	c.310A>T	c.(310-312)Atc>Ttc	p.I104F	PCDHA2_ENST00000378132.1_Missense_Mutation_p.I104F|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Missense_Mutation_p.I104F	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	104	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAATGTAGCATCCACGTGGA	0.537																																																0			5											111.0	126.0	121.0					5																	140174859		2203	4300	6503	140155043	SO:0001583	missense	56146			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.310A>T	5.37:g.140174859A>T	ENSP00000431748:p.Ile104Phe	Somatic		Capture	Illumina GAIIx	4	140155043	O75287|Q9BTV3	Missense_Mutation	SNP	superfamily_Cadherin-like,HMMSmart_SM00112,HMMPfam_Cadherin_2,PatternScan_CADHERIN_1,HMMPfam_Cadherin	p.I104F	ENST00000526136.1	37	c.310	CCDS54914.1	5	.	.	.	.	.	.	.	.	.	.	a	12.39	1.923089	0.33908	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.38560	1.13;1.13;1.13	3.66	2.48	0.30137	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.209129	0.23870	U	0.043753	T	0.50429	0.1615	M	0.78456	2.415	0.09310	N	0.999991	P;P;P	0.46952	0.8;0.887;0.8	P;B;P	0.53185	0.611;0.361;0.72	T	0.43669	-0.9377	10	0.59425	D	0.04	.	4.0639	0.09851	0.575:0.1997:0.2253:0.0	.	104;104;104	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	F	104	ENSP00000430584:I104F;ENSP00000367372:I104F;ENSP00000431748:I104F	ENSP00000367372:I104F	I	+	1	0	PCDHA2	140155043	0.140000	0.22579	1.000000	0.80357	0.453000	0.32348	0.658000	0.24979	0.583000	0.29574	0.524000	0.50904	ATC	-	superfamily_Cadherin-like,HMMSmart_SM00112,HMMPfam_Cadherin_2		0.537	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	protein_coding	OTTHUMT00000372877.3	A	NM_018905		140155043	+1	no_errors	NM_018905	genbank	human	reviewed	54_36p	missense	SNP	0.259	T
PCDHB10	56126	genome.wustl.edu	37	5	140573668	140573668	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr5:140573668G>A	ENST00000239446.4	+	1	1727	c.1543G>A	c.(1543-1545)Gcc>Acc	p.A515T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	515	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCACCTGTTCGCCCTCAGGTC	0.701																																																0			5											103.0	120.0	114.0					5																	140573668		2203	4298	6501	140553852	SO:0001583	missense	56126			AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1543G>A	5.37:g.140573668G>A	ENSP00000239446:p.Ala515Thr	Somatic		Capture	Illumina GAIIx	4	140553852	Q96T99	Missense_Mutation	SNP	HMMPfam_Cadherin_2,superfamily_Cadherin,PatternScan_CADHERIN_1,HMMPfam_Cadherin,HMMSmart_CA	p.A515T	ENST00000239446.4	37	c.1543	CCDS4252.1	5	.	.	.	.	.	.	.	.	.	.	g	19.93	3.918463	0.73098	.	.	ENSG00000120324	ENST00000239446	T	0.01745	4.66	3.53	3.53	0.40419	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.05868	0.0153	L	0.33792	1.035	0.30005	N	0.815699	D	0.76494	0.999	D	0.70487	0.969	T	0.14035	-1.0487	9	0.87932	D	0	.	15.3153	0.74069	0.0:0.0:1.0:0.0	.	515	Q9UN67	PCDBA_HUMAN	T	515	ENSP00000239446:A515T	ENSP00000239446:A515T	A	+	1	0	PCDHB10	140553852	0.000000	0.05858	0.887000	0.34795	0.974000	0.67602	0.768000	0.26590	1.994000	0.58287	0.549000	0.68633	GCC	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.701	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB10	protein_coding	OTTHUMT00000251821.1	G	NM_018930		140553852	+1	no_errors	NM_018930	genbank	human	reviewed	54_36p	missense	SNP	0.256	A
MROH5	389690	genome.wustl.edu	37	8	142506444	142506444	+	RNA	SNP	A	A	G	rs145059710	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr8:142506444A>G	ENST00000430863.1	-	0	318					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		TCCCCCATGAACATCCTGTGC	0.637													A|||	40	0.00798722	0.0287	0.0029	5008	,	,		19858	0.0		0.0	False		,,,				2504	0.0															0			8						A	LEU/PHE	152,4164		6,140,2012	93.0	93.0	93.0		238	4.4	0.9	8	dbSNP_134	93	0,8510		0,0,4255	yes	missense	FLJ43860	NM_207414.2	22	6,140,6267	GG,GA,AA		0.0,3.5218,1.1851	possibly-damaging	80/1319	142506444	152,12674	2158	4255	6413	142575626			389690					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142506444A>G		Somatic		Capture	Illumina GAIIx	4	142575626		Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.F80L	ENST00000430863.1	37	c.238		8	13	0.005952380952380952	13	0.026422764227642278	0	0.0	0	0.0	0	0.0	A	15.98	2.992015	0.54041	0.035218	0.0	ENSG00000226807	ENST00000521161	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	T	0.24122	0.0584	N	0.24115	0.695	.	.	.	D	0.67145	0.996	D	0.77557	0.99	T	0.58370	-0.7648	7	0.54805	T	0.06	.	9.8713	0.41175	1.0:0.0:0.0:0.0	.	80	Q6ZUA9	.	L	45	.	ENSP00000431031:F80L	F	-	1	0	AC100803.1	142575626	0.968000	0.33430	0.886000	0.34754	0.039000	0.13416	2.308000	0.43690	1.826000	0.53198	0.459000	0.35465	TTC	-	NULL		0.637	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	polymorphic_pseudogene	OTTHUMT00000342412.4	A	NM_207414		142575626	-1	pseudogene	NM_207414	genbank	human	validated	54_36p	missense	SNP	0.830	G
KYNU	8942	genome.wustl.edu	37	2	143742671	143742671	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr2:143742671G>C	ENST00000264170.4	+	9	1006	c.748G>C	c.(748-750)Gat>Cat	p.D250H	KYNU_ENST00000375773.2_Missense_Mutation_p.D250H|KYNU_ENST00000409512.1_Missense_Mutation_p.D250H	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		TGTTGGCTTTGATCTAGCACA	0.343																																																0			2											208.0	192.0	198.0					2																	143742671		2203	4300	6503	143459141	SO:0001583	missense	8942			U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.748G>C	2.37:g.143742671G>C	ENSP00000264170:p.Asp250His	Somatic		Capture	Illumina GAIIx	4	143459141		Missense_Mutation	SNP	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_5	p.D250H	ENST00000264170.4	37	c.748	CCDS2183.1	2	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424012	0.83667	.	.	ENSG00000115919	ENST00000264170;ENST00000375773;ENST00000409512	D;D;D	0.92397	-3.03;-3.03;-3.03	6.07	6.07	0.98685	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.098619	0.64402	D	0.000002	D	0.97517	0.9187	H	0.94542	3.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97670	1.0166	10	0.87932	D	0	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	250;250	Q16719;Q9BVW3	KYNU_HUMAN;.	H	250	ENSP00000264170:D250H;ENSP00000364928:D250H;ENSP00000386731:D250H	ENSP00000264170:D250H	D	+	1	0	KYNU	143459141	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.385000	0.90163	2.890000	0.99128	0.650000	0.86243	GAT	-	superfamily_PLP-dependent transferases,HMMPfam_Aminotran_5		0.343	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KYNU	protein_coding	OTTHUMT00000254772.1	G	NM_001032998		143459141	+1	no_errors	NM_003937	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
REPIN1	29803	genome.wustl.edu	37	7	150068824	150068824	+	Missense_Mutation	SNP	G	G	A	rs138254226	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr7:150068824G>A	ENST00000425389.2	+	1	572	c.494G>A	c.(493-495)cGg>cAg	p.R165Q	REPIN1_ENST00000489432.2_Missense_Mutation_p.R222Q|REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000482680.1_3'UTR|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000444957.1_Missense_Mutation_p.R165Q|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000397281.2_Missense_Mutation_p.R165Q|REPIN1_ENST00000540729.1_Missense_Mutation_p.R165Q	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	165				R -> Q (in Ref. 2; CAB53100). {ECO:0000305}.	DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			GCTCATCTGCGGCGGTGCCAC	0.647													G|||	24	0.00479233	0.0174	0.0014	5008	,	,		15203	0.0		0.0	False		,,,				2504	0.0															0			7						G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	100,3942		1,98,1922	17.0	21.0	20.0		665,494,494,494	3.4	0.6	7	dbSNP_134	20	1,8323		0,1,4161	yes	missense,missense,missense,missense	REPIN1	NM_001099695.1,NM_001099696.2,NM_013400.3,NM_014374.3	43,43,43,43	1,99,6083	AA,AG,GG		0.012,2.474,0.8168	probably-damaging,probably-damaging,probably-damaging,probably-damaging	222/625,165/568,165/568,165/568	150068824	101,12265	2021	4162	6183	149699757	SO:0001583	missense	29803			AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.494G>A	7.37:g.150068824G>A	ENSP00000388287:p.Arg165Gln	Somatic		Capture	Illumina GAIIx	4	149699757	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.R222Q	ENST00000425389.2	37	c.665	CCDS43677.1	7	9	0.004120879120879121	9	0.018292682926829267	0	0.0	0	0.0	0	0.0	G	10.75	1.438652	0.25900	0.02474	1.2E-4	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000475514;ENST00000488943;ENST00000425389	T;T;T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13;-1.13;-1.13	5.26	3.38	0.38709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.73799	0.3633	L	0.58101	1.795	0.19300	N	0.999978	D;D	0.76494	0.999;0.999	D;D	0.80764	0.956;0.994	T	0.66697	-0.5858	9	0.62326	D	0.03	-14.5708	8.4402	0.32810	0.0836:0.0:0.7643:0.1521	.	222;165	C9J3L7;Q9BWE0	.;REPI1_HUMAN	Q	165;165;165;222;224;225;165	ENSP00000445016:R165Q;ENSP00000380451:R165Q;ENSP00000407714:R165Q;ENSP00000417291:R222Q;ENSP00000419789:R224Q;ENSP00000419872:R225Q;ENSP00000388287:R165Q	ENSP00000380451:R165Q	R	+	2	0	REPIN1	149699757	0.000000	0.05858	0.617000	0.29091	0.984000	0.73092	0.186000	0.16978	1.172000	0.42781	0.462000	0.41574	CGG	-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.647	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	REPIN1	protein_coding	OTTHUMT00000376940.1	G	NM_014374		149699757	+1	no_errors	NM_001099695	genbank	human	validated	54_36p	missense	SNP	0.013	A
PLXNA3	55558	genome.wustl.edu	37	X	153692568	153692568	+	Silent	SNP	G	G	A	rs186879417		TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chrX:153692568G>A	ENST00000369682.3	+	8	1915	c.1740G>A	c.(1738-1740)gcG>gcA	p.A580A		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	580					axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGCGGCGGCGGAGAACGAGG	0.692													g|||	1	0.000264901	0.0008	0.0	3775	,	,		11729	0.0		0.0	False		,,,				2504	0.0															0			X								2,3824		0,2,1628,566	27.0	25.0	26.0		1740	-10.7	0.0	X		26	0,6719		0,0,2427,1865	no	coding-synonymous	PLXNA3	NM_017514.3		0,2,4055,2431	AA,AG,GG,G		0.0,0.0523,0.019		580/1872	153692568	2,10543	2196	4292	6488	153345762	SO:0001819	synonymous_variant	55558			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.1740G>A	X.37:g.153692568G>A		Somatic		Capture	Illumina GAIIx	4	153345762	Q5HY36	Silent	SNP	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMPfam_PSI,HMMSmart_PSI,superfamily_Plexin-like_fold,HMMSmart_IPT,superfamily_Ig_E-set,HMMPfam_TIG,HMMPfam_Plexin_cytopl,superfamily_Rho_GAP	p.A580	ENST00000369682.3	37	c.1740	CCDS14752.1	X																																																																																			-	NULL		0.692	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA3	protein_coding	OTTHUMT00000081634.1	G	NM_017514		153345762	+1	no_errors	NM_017514	genbank	human	validated	54_36p	silent	SNP	0.000	A
Unknown	0	genome.wustl.edu	37	1	157043024	157043024	+	IGR	SNP	G	G	A	rs112025019	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr1:157043024G>A								ARHGEF11 (27862 upstream) : ETV3L (18811 downstream)																							GGTTTGGCCCGCCTGCCTCCA	0.537													G|||	231	0.0461262	0.0772	0.0288	5008	,	,		14464	0.0298		0.0239	False		,,,				2504	0.0562															0			1																																								155309648	SO:0001628	intergenic_variant	149501																															1.37:g.157043024G>A		Somatic		Capture	Illumina GAIIx	4	155309648		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.537					LOC149501			G			155309648	+1	pseudogene	XR_017100	genbank	human	model	54_36p	rna	SNP	0.004	A
TULP4	56995	genome.wustl.edu	37	6	158923864	158923864	+	Missense_Mutation	SNP	G	G	A	rs138066719		TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr6:158923864G>A	ENST00000367097.3	+	13	4526	c.3169G>A	c.(3169-3171)Gcc>Acc	p.A1057T	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1057					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GGCCCATACCGCCAGCGCCTC	0.701																																																0			6						G	,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	27.0	28.0	28.0		,3169	2.8	0.1	6	dbSNP_134	28	1,8589	1.2+/-3.3	0,1,4294	no	intron,missense	TULP4	NM_001007466.1,NM_020245.3	,58	0,2,6496	AA,AG,GG		0.0116,0.0227,0.0154	,benign	,1057/1544	158923864	2,12994	2203	4295	6498	158843852	SO:0001583	missense	56995				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.3169G>A	6.37:g.158923864G>A	ENSP00000356064:p.Ala1057Thr	Somatic		Capture	Illumina GAIIx	4	158843852	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Missense_Mutation	SNP	HMMSmart_SM00320,HMMPfam_WD40,superfamily_WD40 repeat-like,superfamily_TNF-like,HMMPfam_SOCS_box,superfamily_Transcriptional factor tubby C-terminal domain,HMMPfam_Tub	p.A1057T	ENST00000367097.3	37	c.3169	CCDS34561.1	6	.	.	.	.	.	.	.	.	.	.	G	5.925	0.354698	0.11239	2.27E-4	1.16E-4	ENSG00000130338	ENST00000367097	T	0.60672	0.17	5.06	2.8	0.32819	.	0.524304	0.21363	N	0.075774	T	0.29491	0.0735	L	0.44542	1.39	0.58432	D	0.999999	B	0.19817	0.039	B	0.16722	0.016	T	0.13791	-1.0496	10	0.39692	T	0.17	-10.3901	9.1674	0.37060	0.2105:0.0:0.7895:0.0	.	1057	Q9NRJ4	TULP4_HUMAN	T	1057	ENSP00000356064:A1057T	ENSP00000356064:A1057T	A	+	1	0	TULP4	158843852	0.994000	0.37717	0.111000	0.21465	0.015000	0.08874	2.675000	0.46875	0.775000	0.33450	0.561000	0.74099	GCC	-	NULL		0.701	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	protein_coding	OTTHUMT00000042869.1	G	NM_020245		158843852	+1	no_errors	NM_020245	genbank	human	validated	54_36p	missense	SNP	0.811	A
GABRG2	2566	genome.wustl.edu	37	5	161576575	161576575	+	Intron	SNP	A	A	C			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr5:161576575A>C	ENST00000361925.4	+	8	1348				GABRG2_ENST00000414552.2_Intron|GABRG2_ENST00000393933.4_Intron|GABRG2_ENST00000356592.3_Intron			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2						adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGGAGACTAAAGCCATTTTTG	0.373																																																0			5											27.0	27.0	27.0					5																	161576575		875	1988	2863	161509153	SO:0001627	intron_variant	2566				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1128+256A>C	5.37:g.161576575A>C		Somatic		Capture	Illumina GAIIx	4	161509153	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	superfamily_Neur_chan_LBD,HMMPfam_Neur_chan_LBD,PatternScan_NEUROTR_ION_CHANNEL,superfamily_Neu_channel_TM,HMMPfam_Neur_chan_memb	p.K379T	ENST00000361925.4	37	c.1136	CCDS4358.1	5																																																																																			-	superfamily_Neu_channel_TM,HMMPfam_Neur_chan_memb		0.373	GABRG2-002	KNOWN	basic|CCDS	protein_coding	GABRG2	protein_coding	OTTHUMT00000252706.1	A			161509153	+1	no_stop_codon	ENST00000393933	ensembl	human	known	54_36p	missense	SNP	0.000	C
TTN	7273	genome.wustl.edu	37	2	179438584	179438584	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr2:179438584G>T	ENST00000591111.1	-	276	67576	c.67352C>A	c.(67351-67353)tCa>tAa	p.S22451*	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.S15152*|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.S15219*|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.S24092*|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.S21524*|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Nonsense_Mutation_p.S15027*			Q8WZ42	TITIN_HUMAN	titin	22451	Ig-like 116.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCTTCTTGTTGAATCTTTGTT	0.408																																																0			2											92.0	86.0	88.0					2																	179438584		1861	4098	5959	179146830	SO:0001587	stop_gained	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.67352C>A	2.37:g.179438584G>T	ENSP00000465570:p.Ser22451*	Somatic		Capture	Illumina GAIIx	4	179146830	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,HMMPfam_Titin_Z,HMMSmart_SM00406,PatternScan_IG_MHC,HMMPfam_PPAK,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_TYR	p.S20073*	ENST00000591111.1	37	c.60218		2	.	.	.	.	.	.	.	.	.	.	G	62	69.818224	0.99992	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.4488	0.99124	0.0:0.0:1.0:0.0	.	.	.	.	X	21524;15027;15219;15152;15025	.	ENSP00000340554:S15219X	S	-	2	0	TTN	179146830	1.000000	0.71417	0.997000	0.53966	0.868000	0.49771	9.807000	0.99171	2.843000	0.97960	0.655000	0.94253	TCA	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179146830	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	nonsense	SNP	0.998	T
PIK3CA	5290	genome.wustl.edu	37	3	178916957	178916957	+	Missense_Mutation	SNP	G	G	T	rs200018596		TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr3:178916957G>T	ENST00000263967.3	+	2	501	c.344G>T	c.(343-345)cGa>cTa	p.R115L		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	115					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.R115L(3)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	ATCCTCAATCGAGAAATTGGT	0.333		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	3	Substitution - Missense(3)	endometrium(2)|upper_aerodigestive_tract(1)	3											71.0	67.0	69.0					3																	178916957		1815	4070	5885	180399651	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.344G>T	3.37:g.178916957G>T	ENSP00000263967:p.Arg115Leu	Somatic		Capture	Illumina GAIIx	4	180399651	Q14CW1|Q99762	Missense_Mutation	SNP	HMMPfam_PI3K_p85B,HMMSmart_PI3K_p85B,superfamily_SSF54236,HMMPfam_PI3K_rbd,HMMSmart_PI3K_rbd,HMMSmart_PI3K_C2,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_PI3K_C2,superfamily_ARM-type_fold,HMMSmart_PI3Ka,HMMPfam_PI3Ka,superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2	p.R115L	ENST00000263967.3	37	c.344	CCDS43171.1	3	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.05	3.536439	0.65085	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.72282	0.9;-0.64	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.59555	0.2202	L	0.34521	1.04	0.80722	D	1	P	0.42785	0.79	B	0.34180	0.177	T	0.60021	-0.7344	9	.	.	.	-14.1086	19.4271	0.94746	0.0:0.0:1.0:0.0	.	115	P42336	PK3CA_HUMAN	L	115	ENSP00000263967:R115L;ENSP00000417479:R115L	.	R	+	2	0	PIK3CA	180399651	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.289000	0.96061	2.584000	0.87258	0.555000	0.69702	CGA	-	superfamily_SSF54236		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	protein_coding	OTTHUMT00000348409.2	G			180399651	+1	no_errors	NM_006218	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
FAM171B	165215	genome.wustl.edu	37	2	187605046	187605046	+	Silent	SNP	G	G	A	rs112566975	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr2:187605046G>A	ENST00000304698.5	+	2	533	c.330G>A	c.(328-330)acG>acA	p.T110T		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	110						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TAAACTACACGAAGACAAATT	0.383													G|||	4	0.000798722	0.003	0.0	5008	,	,		18632	0.0		0.0	False		,,,				2504	0.0															0			2						G		16,4390	23.3+/-48.9	0,16,2187	130.0	113.0	119.0		330	-5.5	0.8	2	dbSNP_132	119	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FAM171B	NM_177454.3		0,17,6486	AA,AG,GG		0.0116,0.3631,0.1307		110/827	187605046	17,12989	2203	4300	6503	187313291	SO:0001819	synonymous_variant	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.330G>A	2.37:g.187605046G>A		Somatic		Capture	Illumina GAIIx	4	187313291	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	HMMPfam_UPF0560	p.T110	ENST00000304698.5	37	c.330	CCDS33347.1	2																																																																																			-	HMMPfam_UPF0560		0.383	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	protein_coding	OTTHUMT00000334679.1	G	NM_177454		187313291	+1	no_errors	NM_177454	genbank	human	validated	54_36p	silent	SNP	0.988	A
Unknown	0	genome.wustl.edu	37	4	189660213	189660213	+	IGR	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr4:189660213G>A								RNU7-192P (22334 upstream) : RP11-756P10.4 (18619 downstream)																							TGATTAATCCGAAAGATTTGA	0.468																																																0			4																																								189897207	SO:0001628	intergenic_variant	0																															4.37:g.189660213G>A		Somatic		Capture	Illumina GAIIx	4	189897207		Silent	SNP	superfamily_SSF75620,HMMPfam_PCRF,HMMPfam_RF-1	p.P203		37	c.609		4																																																																																			-	superfamily_SSF75620,HMMPfam_RF-1	0	0.468					ENSG00000180015			G			189897207	+1	no_start_codon	ENST00000321235	ensembl	human	known	54_36p	silent	SNP	0.996	A
CFHR1	3078	genome.wustl.edu	37	1	196799736	196799736	+	Silent	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr1:196799736G>A	ENST00000320493.5	+	5	802	c.714G>A	c.(712-714)caG>caA	p.Q238Q	CFHR1_ENST00000367424.4_Silent_p.Q179Q|CFHR2_ENST00000367421.3_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	238	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						ACCAATGCCAGAACTTGTATC	0.433																																																0			1											67.0	80.0	76.0					1																	196799736		1846	4096	5942	195066359	SO:0001819	synonymous_variant	3078			M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.714G>A	1.37:g.196799736G>A		Somatic		Capture	Illumina GAIIx	4	195066359	A8K465|Q3B774|Q9UJ17	Silent	SNP	superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP	p.Q238	ENST00000320493.5	37	c.714	CCDS1386.1	1																																																																																			-	superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP		0.433	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR1	protein_coding	OTTHUMT00000088251.2	G	NM_002113		195066359	+1	no_errors	NM_002113	genbank	human	validated	54_36p	silent	SNP	0.680	A
ADIPOR1	51094	genome.wustl.edu	37	1	202911318	202911318	+	Silent	SNP	G	G	A			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr1:202911318G>A	ENST00000340990.5	-	7	1132	c.834C>T	c.(832-834)ggC>ggT	p.G278G	ADIPOR1_ENST00000436244.1_Silent_p.G278G	NM_015999.4	NP_057083.2	Q96A54	ADR1_HUMAN	adiponectin receptor 1	278					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|hormone-mediated signaling pathway (GO:0009755)|leptin-mediated signaling pathway (GO:0033210)|negative regulation of cell growth (GO:0030308)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of JAK-STAT cascade (GO:0046427)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)	p.G278G(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(75;0.141)			TGGGCACGACGCCACTCAAGC	0.532																																																1	Substitution - coding silent(1)	lung(1)	1											75.0	69.0	71.0					1																	202911318		2203	4300	6503	201177941	SO:0001819	synonymous_variant	51094				CCDS1430.1	1q32.1	2012-08-22			ENSG00000159346	ENSG00000159346		"""GPCR / Unclassified : Adiponectin receptors"""	24040	protein-coding gene	gene with protein product		607945				12802337	Standard	XM_006711360		Approved	PAQR1, ACDCR1	uc001gyq.5	Q96A54	OTTHUMG00000041391	ENST00000340990.5:c.834C>T	1.37:g.202911318G>A		Somatic		Capture	Illumina GAIIx	4	201177941	B3KMB0|Q53HS7|Q53YY6|Q9Y360	Silent	SNP	HMMPfam_HlyIII	p.G278	ENST00000340990.5	37	c.834	CCDS1430.1	1																																																																																			-	HMMPfam_HlyIII		0.532	ADIPOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADIPOR1	protein_coding	OTTHUMT00000099160.2	G	NM_015999		201177941	-1	no_errors	NM_015999	genbank	human	validated	54_36p	silent	SNP	0.959	A
OBSL1	23363	genome.wustl.edu	37	2	220431609	220431609	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr2:220431609C>T	ENST00000404537.1	-	5	2133	c.2077G>A	c.(2077-2079)Gcc>Acc	p.A693T	OBSL1_ENST00000289656.3_Missense_Mutation_p.A280T|OBSL1_ENST00000603926.1_Missense_Mutation_p.A693T|OBSL1_ENST00000265318.4_Missense_Mutation_p.A693T|OBSL1_ENST00000373873.4_Missense_Mutation_p.A693T|OBSL1_ENST00000373876.1_Missense_Mutation_p.A693T	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	693					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CCGACCAGGGCACCGCTGTCC	0.637																																																0			2											53.0	58.0	56.0					2																	220431609		2074	4207	6281	220139853	SO:0001583	missense	23363			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.2077G>A	2.37:g.220431609C>T	ENSP00000385636:p.Ala693Thr	Somatic		Capture	Illumina GAIIx	4	220139853	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	superfamily_SSF48726,HMMPfam_I-set,HMMSmart_IGc2,HMMSmart_IG,HMMPfam_ig,HMMPfam_fn3,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_V-set	p.A693T	ENST00000404537.1	37	c.2077	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	C	16.21	3.060099	0.55432	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873;ENST00000289656	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.23	4.35	0.52113	Immunoglobulin-like fold (1);	.	.	.	.	T	0.42291	0.1196	L	0.28274	0.84	0.58432	D	0.999998	D;D;B;D	0.65815	0.995;0.995;0.129;0.981	D;D;B;D	0.81914	0.995;0.995;0.145;0.951	T	0.15378	-1.0439	9	0.20519	T	0.43	.	11.1871	0.48664	0.0:0.9157:0.0:0.0843	.	694;693;280;693	A4KVA4;O75147;A8MSZ8;O75147-2	.;OBSL1_HUMAN;.;.	T	693;693;693;693;280	ENSP00000265318:A693T;ENSP00000385636:A693T;ENSP00000362983:A693T;ENSP00000362980:A693T;ENSP00000289656:A280T	ENSP00000265318:A693T	A	-	1	0	OBSL1	220139853	0.998000	0.40836	0.999000	0.59377	0.686000	0.39977	3.193000	0.50997	1.440000	0.47531	0.655000	0.94253	GCC	-	superfamily_SSF48726		0.637	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	protein_coding	OTTHUMT00000322012.1	C			220139853	-1	no_errors	NM_015311	genbank	human	provisional	54_36p	missense	SNP	0.923	T
Unknown	0	genome.wustl.edu	37	1	226314895	226314895	+	IGR	SNP	C	C	T	rs115086063	byFrequency	TCGA-61-1738-01A-01W-0639-09	TCGA-61-1738-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	22fc11f7-fd86-4de0-8e21-ff4aea4e6f83	4a03326c-ccd1-4545-b569-8c4c45e38feb	g.chr1:226314895C>T								RP11-396C23.2 (37698 upstream) : ACBD3 (17484 downstream)																							GCTGACGGAGCGGTGTGGGGC	0.652													C|||	121	0.0241613	0.09	0.0029	5008	,	,		15682	0.0		0.0	False		,,,				2504	0.0															0			1																																								224381518	SO:0001628	intergenic_variant	0																															1.37:g.226314895C>T		Somatic		Capture	Illumina GAIIx	4	224381518		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.652					LOC100133328			C			224381518	+1	pseudogene	XR_038620	genbank	human	model	54_36p	rna	SNP	0.014	T
