#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								3060	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	3060		RNA	SNP	-	NULL		37	NULL		MT																																																																																			-	-	0	0					ENSG00000210082			T			3060	+1	no_errors	ENST00000387347	ensembl	human	known	54_36p	rna	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								4814	SO:0001628	intergenic_variant	0																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	4814		Missense_Mutation	SNP	HMMPfam_Oxidored_q1,HMMPfam_NADH_dehy_S2_C	p.V115A		37	c.344		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND2			T			4814	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361453	ensembl	human	known	54_36p	missense	SNP	NULL	C
NLRP6	171389	genome.wustl.edu	37	11	281191	281191	+	Missense_Mutation	SNP	C	C	A	rs558157091		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr11:281191C>A	ENST00000312165.5	+	4	1457	c.1457C>A	c.(1456-1458)cCg>cAg	p.P486Q	NLRP6_ENST00000534750.1_Missense_Mutation_p.P486Q	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	486	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		AAGGAGCTGCCGGGCGTGCTG	0.617																																																0			11											77.0	78.0	77.0					11																	281191		2203	4300	6503	271191	SO:0001583	missense	171389			AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.1457C>A	11.37:g.281191C>A	ENSP00000309767:p.Pro486Gln	Somatic		Capture	Illumina GAIIx	4	271191	A8K9F3|E9PJZ8	Missense_Mutation	SNP	superfamily_DEATH domain,HMMPfam_PAAD_DAPIN,HMMPfam_NACHT,superfamily_RNI-like,HMMSmart_SM00368	p.P486Q	ENST00000312165.5	37	c.1457	CCDS7693.1	11	.	.	.	.	.	.	.	.	.	.	C	0	-2.767130	0.00082	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.74315	-0.83;-0.78	3.26	2.35	0.29111	NACHT nucleoside triphosphatase (1);	0.433212	0.17213	N	0.182628	T	0.39009	0.1062	N	0.04320	-0.23	0.09310	N	1	B;P	0.39376	0.174;0.67	B;B	0.32022	0.052;0.139	T	0.48592	-0.9022	10	0.02654	T	1	.	5.3801	0.16186	0.0:0.7381:0.0:0.2619	.	486;486	E9PJZ8;P59044	.;NALP6_HUMAN	Q	486	ENSP00000433617:P486Q;ENSP00000309767:P486Q	ENSP00000309767:P486Q	P	+	2	0	NLRP6	271191	0.000000	0.05858	0.001000	0.08648	0.238000	0.25445	-0.121000	0.10643	0.940000	0.37473	0.455000	0.32223	CCG	-	NULL		0.617	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP6	protein_coding	OTTHUMT00000239283.1	C	NM_138329		271191	+1	no_errors	NM_138329	genbank	human	provisional	54_36p	missense	SNP	0.000	A
CYTL1	54360	genome.wustl.edu	37	4	5018906	5018906	+	Splice_Site	SNP	C	C	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr4:5018906C>A	ENST00000307746.4	-	2	180	c.154G>T	c.(154-156)Gag>Tag	p.E52*		NM_018659.2	NP_061129.1	Q9NRR1	CYTL1_HUMAN	cytokine-like 1	52					cartilage homeostasis (GO:1990079)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|inner ear development (GO:0048839)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)			breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		ACACATGGCTCCTGTGGAAAG	0.582																																					Colon(15;457 478 29696 43408 47165)											0			4											81.0	77.0	79.0					4																	5018906		2203	4300	6503	5069807	SO:0001630	splice_region_variant	54360			AF193766	CCDS3379.1	4p16-p15	2007-08-01			ENSG00000170891	ENSG00000170891			24435	protein-coding gene	gene with protein product		607930				10857752	Standard	NM_018659		Approved	C17, C4orf4	uc003gig.3	Q9NRR1	OTTHUMG00000125479	ENST00000307746.4:c.154-1G>T	4.37:g.5018906C>A		Somatic		Capture	Illumina GAIIx	4	5069807		Nonsense_Mutation	SNP	NULL	p.E52*	ENST00000307746.4	37	c.154	CCDS3379.1	4	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853110	0.91355	.	.	ENSG00000170891	ENST00000307746	.	.	.	4.5	4.5	0.54988	.	0.241934	0.41605	D	0.000848	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-18.7929	12.5913	0.56445	0.0:1.0:0.0:0.0	.	.	.	.	X	52	.	ENSP00000303550:E52X	E	-	1	0	CYTL1	5069807	1.000000	0.71417	0.988000	0.46212	0.867000	0.49689	3.659000	0.54489	2.333000	0.79357	0.555000	0.69702	GAG	-	NULL		0.582	CYTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTL1	protein_coding	OTTHUMT00000246802.1	C	NM_018659	Nonsense_Mutation	5069807	-1	no_errors	NM_018659	genbank	human	validated	54_36p	nonsense	SNP	0.667	A
FAM208B	54906	genome.wustl.edu	37	10	5791735	5791735	+	Silent	SNP	A	A	G			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr10:5791735A>G	ENST00000328090.5	+	15	6976	c.6351A>G	c.(6349-6351)gaA>gaG	p.E2117E		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	2117																	AGTATGCTGAATTCAACAAGG	0.373																																																0			10											81.0	77.0	78.0					10																	5791735		1903	4124	6027	5831741	SO:0001819	synonymous_variant	54906			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.6351A>G	10.37:g.5791735A>G		Somatic		Capture	Illumina GAIIx	4	5831741	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Silent	SNP	NULL	p.E2117	ENST00000328090.5	37	c.6351	CCDS41485.1	10																																																																																			-	NULL		0.373	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf18	protein_coding	OTTHUMT00000046571.2	A	NM_017782		5831741	+1	no_errors	NM_017782	genbank	human	validated	54_36p	silent	SNP	0.978	G
PTPRD	5789	genome.wustl.edu	37	9	8528585	8528585	+	Intron	SNP	C	C	T	rs375285393		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr9:8528585C>T	ENST00000381196.4	-	12	1085				PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000540109.1_Intron|PTPRD_ENST00000356435.5_Intron|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000463477.1_Intron|PTPRD_ENST00000537002.1_Missense_Mutation_p.V183I|PTPRD_ENST00000360074.4_Intron|PTPRD_ENST00000358503.5_Intron|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000486161.1_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AGTAACAAGACCCTACCTGAT	0.318										TSP Lung(15;0.13)																																						0			9											122.0	111.0	115.0					9																	8528585		2203	4300	6503	8518585	SO:0001627	intron_variant	5789			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.541+5G>A	9.37:g.8528585C>T		Somatic		Capture	Illumina GAIIx	4	8518585	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.V183I	ENST00000381196.4	37	c.547	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	C	8.060	0.768017	0.15983	.	.	ENSG00000153707	ENST00000537002	T	0.72282	-0.64	6.17	6.17	0.99709	.	.	.	.	.	D	0.82728	0.5100	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.79794	-0.1653	5	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	I	183	ENSP00000440515:V183I	.	V	-	1	0	PTPRD	8518585	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.972000	0.56838	2.941000	0.99782	0.655000	0.94253	GTC	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408		0.318	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	protein_coding	OTTHUMT00000055395.3	C			8518585	-1	no_errors	ENST00000356435	ensembl	human	known	54_36p	missense	SNP	1.000	T
USP7	7874	genome.wustl.edu	37	16	9015078	9015078	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr16:9015078C>G	ENST00000344836.4	-	4	656	c.458G>C	c.(457-459)cGt>cCt	p.R153P	USP7_ENST00000535863.1_Missense_Mutation_p.R54P|USP7_ENST00000566224.1_5'Flank|USP7_ENST00000381886.4_Missense_Mutation_p.R137P	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	153	Interaction with TSPYL5.|Interaction with p53/TP53, MDM2 and EBNA1.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.|Necessary for nuclear localization.				maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						ATGACTAATACGACGACTGAA	0.368																																																0			16											93.0	84.0	87.0					16																	9015078		2197	4300	6497	8922579	SO:0001583	missense	7874			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.458G>C	16.37:g.9015078C>G	ENSP00000343535:p.Arg153Pro	Somatic		Capture	Illumina GAIIx	4	8922579	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	superfamily_Traf_like,HMMSmart_MATH,HMMPfam_MATH,superfamily_SSF54001,HMMPfam_UCH,PatternScan_UCH_2_1,PatternScan_UCH_2_2	p.R153P	ENST00000344836.4	37	c.458	CCDS32385.1	16	.	.	.	.	.	.	.	.	.	.	C	16.36	3.100558	0.56183	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549;ENST00000542333	T;T;T	0.48522	0.81;0.81;0.81	5.9	5.9	0.94986	TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.42494	0.1205	L	0.29908	0.895	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.19391	0.025;0.025	T	0.13495	-1.0507	10	0.40728	T	0.16	.	20.3398	0.98759	0.0:1.0:0.0:0.0	.	153;137	Q93009;B7Z815	UBP7_HUMAN;.	P	153;161;54;54;95	ENSP00000343535:R153P;ENSP00000443646:R54P;ENSP00000439272:R95P	ENSP00000343535:R153P	R	-	2	0	USP7	8922579	1.000000	0.71417	0.293000	0.24932	0.918000	0.54935	5.822000	0.69265	2.817000	0.96982	0.552000	0.68991	CGT	-	superfamily_Traf_like,HMMSmart_MATH,HMMPfam_MATH		0.368	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP7	protein_coding	OTTHUMT00000434268.2	C			8922579	-1	no_errors	NM_003470	genbank	human	validated	54_36p	missense	SNP	1.000	G
MYH13	8735	genome.wustl.edu	37	17	10219343	10219343	+	Splice_Site	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr17:10219343C>T	ENST00000418404.3	-	27	3902		c.e27-1		MYH13_ENST00000252172.4_Splice_Site|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle						cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTATGTTACTCTTTAACAAAC	0.398																																																0			17											102.0	94.0	97.0					17																	10219343		1889	4125	6014	10160068	SO:0001630	splice_region_variant	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.3739-1G>A	17.37:g.10219343C>T		Somatic		Capture	Illumina GAIIx	4	10160068	O95252|Q9P0U8	Splice_Site	SNP	-	e26-1	ENST00000418404.3	37	c.3739-1	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	C	22.6	4.304853	0.81247	.	.	ENSG00000006788	ENST00000252172	.	.	.	4.38	4.38	0.52667	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2938	0.87164	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH13	10160068	0.558000	0.26554	1.000000	0.80357	0.949000	0.60115	0.741000	0.26202	2.134000	0.65973	0.563000	0.77884	.	-	-		0.398	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	protein_coding	OTTHUMT00000442255.1	C	NM_003802	Intron	10160068	-1	no_errors	NM_003802	genbank	human	validated	54_36p	splice_site	SNP	1.000	T
SYCP2L	221711	genome.wustl.edu	37	6	10907843	10907843	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr6:10907843C>A	ENST00000283141.6	+	10	1041	c.745C>A	c.(745-747)Ctt>Att	p.L249I	RP11-637O19.3_ENST00000480294.1_3'UTR|SYCP2L_ENST00000543878.1_Missense_Mutation_p.L90I	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	249						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			AAGGGATGAACTTGTCCATAA	0.373																																																0			6											130.0	124.0	126.0					6																	10907843		1843	4094	5937	11015829	SO:0001583	missense	221711			AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.745C>A	6.37:g.10907843C>A	ENSP00000283141:p.Leu249Ile	Somatic		Capture	Illumina GAIIx	4	11015829	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	NULL	p.L249I	ENST00000283141.6	37	c.745	CCDS43423.1	6	.	.	.	.	.	.	.	.	.	.	C	12.48	1.949641	0.34377	.	.	ENSG00000153157	ENST00000543878;ENST00000283141	T;T	0.52295	0.67;1.93	5.48	1.54	0.23209	.	0.476872	0.21043	N	0.081126	T	0.43567	0.1253	M	0.78637	2.42	0.80722	D	1	P;D	0.61697	0.944;0.99	P;P	0.53146	0.719;0.701	T	0.41324	-0.9515	10	0.48119	T	0.1	.	8.9143	0.35572	0.0:0.6274:0.0:0.3726	.	90;249	B4DFB8;Q5T4T6	.;SYC2L_HUMAN	I	90;249	ENSP00000440676:L90I;ENSP00000283141:L249I	ENSP00000283141:L249I	L	+	1	0	SYCP2L	11015829	0.830000	0.29337	0.001000	0.08648	0.108000	0.19459	1.383000	0.34385	-0.013000	0.14199	0.655000	0.94253	CTT	-	NULL		0.373	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2L	protein_coding	OTTHUMT00000039845.3	C	NM_194299		11015829	+1	no_errors	NM_001040274	genbank	human	provisional	54_36p	missense	SNP	0.723	A
DOCK6	57572	genome.wustl.edu	37	19	11353770	11353770	+	Missense_Mutation	SNP	G	G	A	rs557547319		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr19:11353770G>A	ENST00000294618.7	-	13	1456	c.1445C>T	c.(1444-1446)cCg>cTg	p.P482L		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	482					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CAGGGACGACGGGCGCCTCAT	0.602											OREG0025252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0008	0.0	5008	,	,		16899	0.0		0.0	False		,,,				2504	0.0															0			19											75.0	82.0	80.0					19																	11353770		2113	4231	6344	11214770	SO:0001583	missense	57572				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.1445C>T	19.37:g.11353770G>A	ENSP00000294618:p.Pro482Leu	Somatic	671	Capture	Illumina GAIIx	4	11214770	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	HMMPfam_Ded_cyto	p.P482L	ENST00000294618.7	37	c.1445	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857875	0.91433	.	.	ENSG00000130158	ENST00000294618	T	0.76839	-1.05	4.32	4.32	0.51571	.	0.000000	0.85682	D	0.000000	D	0.88366	0.6417	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.90587	0.4534	10	0.87932	D	0	-29.4102	15.5966	0.76587	0.0:0.0:1.0:0.0	.	482	Q96HP0	DOCK6_HUMAN	L	482	ENSP00000294618:P482L	ENSP00000294618:P482L	P	-	2	0	DOCK6	11214770	1.000000	0.71417	0.833000	0.33012	0.982000	0.71751	8.922000	0.92789	1.946000	0.56461	0.462000	0.41574	CCG	-	NULL		0.602	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	protein_coding	OTTHUMT00000453155.1	G	NM_020812		11214770	-1	no_errors	NM_020812	genbank	human	validated	54_36p	missense	SNP	1.000	A
RP11-815J4.6	0	genome.wustl.edu	37	18	12076012	12076012	+	RNA	SNP	G	G	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr18:12076012G>T	ENST00000591780.1	-	0	583																											AAACACACCTGGTATCCTGTA	0.498																																																0			18																																								12066012			728211																															18.37:g.12076012G>T		Somatic		Capture	Illumina GAIIx	4	12066012		RNA	SNP	-	NULL	ENST00000591780.1	37	NULL		18																																																																																			-	-		0.498	RP11-815J4.6-002	KNOWN	basic	processed_transcript	LOC728211	pseudogene	OTTHUMT00000452539.1	G			12066012	-1	pseudogene	XR_015403	genbank	human	model	54_36p	rna	SNP	0.998	T
FREM1	158326	genome.wustl.edu	37	9	14769771	14769771	+	Missense_Mutation	SNP	C	C	T	rs201617511		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr9:14769771C>T	ENST00000380880.3	-	27	5938	c.5155G>A	c.(5155-5157)Gtg>Atg	p.V1719M	FREM1_ENST00000486223.1_5'UTR|FREM1_ENST00000422223.2_Missense_Mutation_p.V1719M|FREM1_ENST00000380894.1_Missense_Mutation_p.V255M|FREM1_ENST00000380881.4_Missense_Mutation_p.V1720M			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1719					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TGAAATTCCACGGTATCTGAA	0.353																																																0			9						C	MET/VAL,MET/VAL	1,3621		0,1,1810	95.0	93.0	93.0		763,5155	-11.7	0.0	9		93	2,8158		0,2,4078	yes	missense,missense	FREM1	NM_001177704.1,NM_144966.5	21,21	0,3,5888	TT,TC,CC		0.0245,0.0276,0.0255	benign,benign	255/716,1719/2180	14769771	3,11779	1811	4080	5891	14759771	SO:0001583	missense	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.5155G>A	9.37:g.14769771C>T	ENSP00000370262:p.Val1719Met	Somatic		Capture	Illumina GAIIx	4	14759771	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	superfamily_Cadherin-like,PatternScan_SPASE_I_1,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C	p.V1719M	ENST00000380880.3	37	c.5155	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	C	8.637	0.895140	0.17613	2.76E-4	2.45E-4	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880;ENST00000380892	T;T;T;T	0.45668	1.57;1.57;0.89;1.57	5.86	-11.7	0.00046	.	0.796389	0.12250	N	0.485735	T	0.07324	0.0185	N	0.00538	-1.39	0.09310	N	1	B;B	0.18610	0.002;0.029	B;B	0.10450	0.001;0.005	T	0.21415	-1.0246	10	0.32370	T	0.25	-0.1493	2.3519	0.04286	0.1784:0.3853:0.1996:0.2367	.	1719;255	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	M	1720;1719;255;1719;132	ENSP00000370263:V1720M;ENSP00000412940:V1719M;ENSP00000370278:V255M;ENSP00000370262:V1719M	ENSP00000370262:V1719M	V	-	1	0	FREM1	14759771	0.000000	0.05858	0.000000	0.03702	0.708000	0.40852	-0.759000	0.04761	-2.145000	0.00801	-1.159000	0.01794	GTG	-	NULL		0.353	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	protein_coding	OTTHUMT00000339474.2	C	NM_144966		14759771	-1	no_errors	NM_144966	genbank	human	validated	54_36p	missense	SNP	0.003	T
ZNF962P	729501	genome.wustl.edu	37	13	19042510	19042510	+	IGR	SNP	G	G	T	rs186349962		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr13:19042510G>T								None (None upstream) : LINC00349 (72126 downstream)																							ACTATCATATGCTTAGTAAGG	0.378																																																0			13																																								17940510	SO:0001628	intergenic_variant	729501																															13.37:g.19042510G>T		Somatic		Capture	Illumina GAIIx	4	17940510		RNA	SNP	-	NULL		37	NULL		13																																																																																			-	-	0	0.378					LOC729501			G			17940510	-1	no_errors	XR_037080	genbank	human	model	54_36p	rna	SNP	0.408	T
OR4N2	390429	genome.wustl.edu	37	14	20296476	20296476	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr14:20296476G>A	ENST00000315947.1	+	1	869	c.869G>A	c.(868-870)cGc>cAc	p.R290H	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TATACCCTTCGCAACCAGGAA	0.403																																																0			14											47.0	50.0	49.0					14																	20296476		2203	4296	6499	19366316	SO:0001583	missense	390429				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.869G>A	14.37:g.20296476G>A	ENSP00000319601:p.Arg290His	Somatic		Capture	Illumina GAIIx	4	19366316	Q6IEY9|Q6IFA2	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R290H	ENST00000315947.1	37	c.869	CCDS32022.1	14	.	.	.	.	.	.	.	.	.	.	.	7.943	0.743201	0.15642	.	.	ENSG00000176294	ENST00000315947	T	0.41065	1.01	4.57	2.73	0.32206	.	0.000000	0.39909	N	0.001237	T	0.49372	0.1553	M	0.93462	3.42	0.19945	N	0.999941	B	0.32302	0.363	B	0.27715	0.082	T	0.53844	-0.8381	10	0.87932	D	0	-6.4057	8.7854	0.34818	0.1889:0.0:0.8111:0.0	.	290	Q8NGD1	OR4N2_HUMAN	H	290	ENSP00000319601:R290H	ENSP00000319601:R290H	R	+	2	0	OR4N2	19366316	0.173000	0.23056	0.675000	0.29917	0.112000	0.19704	2.979000	0.49313	0.651000	0.30788	0.591000	0.81541	CGC	-	superfamily_SSF81321		0.403	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	protein_coding	OTTHUMT00000409821.2	G			19366316	+1	no_errors	NM_001004723	genbank	human	provisional	54_36p	missense	SNP	0.037	A
NCAM2	4685	genome.wustl.edu	37	21	22656620	22656620	+	Silent	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr21:22656620C>T	ENST00000400546.1	+	3	486	c.237C>T	c.(235-237)acC>acT	p.T79T	NCAM2_ENST00000284894.7_Intron|NCAM2_ENST00000535285.1_Silent_p.T104T|NCAM2_ENST00000486367.1_3'UTR	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	79	Ig-like C2-type 1.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CACGGTTAACCATCTACAATG	0.388																																																0			21											119.0	112.0	114.0					21																	22656620		1884	4110	5994	21578491	SO:0001819	synonymous_variant	4685				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.237C>T	21.37:g.22656620C>T		Somatic		Capture	Illumina GAIIx	4	21578491	A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	HMMPfam_I-set,superfamily_SSF48726,HMMSmart_IGc2,HMMPfam_ig,superfamily_FN_III-like,HMMSmart_FN3,HMMPfam_fn3	p.T79	ENST00000400546.1	37	c.237	CCDS42910.1	21																																																																																			-	HMMPfam_I-set,superfamily_SSF48726,HMMSmart_IGc2		0.388	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	protein_coding	OTTHUMT00000170915.1	C	NM_004540		21578491	+1	no_errors	NM_004540	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
IFNLR1	163702	genome.wustl.edu	37	1	24484051	24484051	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr1:24484051C>T	ENST00000327535.1	-	7	1144	c.1132G>A	c.(1132-1134)Gaa>Aaa	p.E378K	IFNLR1_ENST00000327575.2_3'UTR|IFNLR1_ENST00000374421.3_Missense_Mutation_p.E349K	NM_170743.3|NM_173064.2	NP_734464.1|NP_775087.1	Q8IU57	INLR1_HUMAN	interferon, lambda receptor 1	378					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mucosal immune response (GO:0002385)|negative regulation of cell proliferation (GO:0008285)|regulation of defense response to virus by host (GO:0050691)|response to type III interferon (GO:0034342)	integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)											GAGGAGCCTTCGCTTGGGACC	0.627																																																0			1											35.0	37.0	36.0					1																	24484051		2203	4300	6503	24356638	SO:0001583	missense	163702			AY129153	CCDS248.1, CCDS249.1, CCDS250.1	1p36.11	2012-11-27	2012-11-26	2012-11-26	ENSG00000185436	ENSG00000185436		"""Interferons"""	18584	protein-coding gene	gene with protein product	"""interferon lambda receptor 1"""	607404	"""interleukin 28 receptor, alpha"", ""interleukin 28 receptor, alpha (interferon, lambda receptor)"""	IL28RA			Standard	NM_173064		Approved	CRF2/12, IFNLR, IL-28R1	uc001bis.3	Q8IU57	OTTHUMG00000003036	ENST00000327535.1:c.1132G>A	1.37:g.24484051C>T	ENSP00000327824:p.Glu378Lys	Somatic		Capture	Illumina GAIIx	4	24356638	Q5VTX5|Q5VTX7|Q5VTX8|Q6ZML8|Q8IV66|Q8IZI7|Q8IZI8	Missense_Mutation	SNP	superfamily_Fibronectin type III	p.E378K	ENST00000327535.1	37	c.1132	CCDS248.1	1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365390	0.61513	.	.	ENSG00000185436	ENST00000327535;ENST00000374421	.	.	.	5.52	1.41	0.22369	.	7.169420	0.00166	N	0.000000	T	0.39172	0.1068	L	0.56769	1.78	0.09310	N	1	B;B	0.27971	0.123;0.196	B;B	0.14578	0.005;0.011	T	0.14364	-1.0475	9	0.46703	T	0.11	0.0475	5.2643	0.15591	0.0:0.6019:0.1479:0.2503	.	378;349	Q8IU57;Q8IU57-2	I28RA_HUMAN;.	K	378;349	.	ENSP00000327824:E378K	E	-	1	0	IL28RA	24356638	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.136000	0.10405	0.073000	0.16731	-0.140000	0.14226	GAA	-	NULL		0.627	IFNLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL28RA	protein_coding	OTTHUMT00000008402.1	C	NM_170743		24356638	-1	no_errors	NM_170743	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
CDH10	1008	genome.wustl.edu	37	5	24492938	24492938	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr5:24492938G>C	ENST00000264463.4	-	10	2119	c.1612C>G	c.(1612-1614)Cag>Gag	p.Q538E	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	538	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TCATTATCCTGTACTGTGAAG	0.348										HNSCC(23;0.051)																																						0			5											155.0	166.0	162.0					5																	24492938		2203	4297	6500	24528695	SO:0001583	missense	1008			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1612C>G	5.37:g.24492938G>C	ENSP00000264463:p.Gln538Glu	Somatic		Capture	Illumina GAIIx	4	24528695	Q9ULB3	Missense_Mutation	SNP	superfamily_Cadherin,HMMSmart_CA,HMMPfam_Cadherin,PatternScan_CADHERIN_1,HMMPfam_Cadherin_C	p.Q538E	ENST00000264463.4	37	c.1612	CCDS3892.1	5	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192149	0.38707	.	.	ENSG00000040731	ENST00000264463	T	0.58797	0.31	5.04	5.04	0.67666	Cadherin (4);Cadherin-like (1);	0.304873	0.32578	N	0.005909	T	0.50292	0.1607	N	0.20483	0.58	0.27561	N	0.950179	B	0.19200	0.034	B	0.34038	0.174	T	0.51671	-0.8676	10	0.48119	T	0.1	.	17.7384	0.88401	0.0:0.0:1.0:0.0	.	538	Q9Y6N8	CAD10_HUMAN	E	538	ENSP00000264463:Q538E	ENSP00000264463:Q538E	Q	-	1	0	CDH10	24528695	0.998000	0.40836	0.996000	0.52242	0.948000	0.59901	4.248000	0.58760	2.506000	0.84524	0.585000	0.79938	CAG	-	superfamily_Cadherin,HMMPfam_Cadherin,HMMSmart_CA		0.348	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	protein_coding	OTTHUMT00000207345.2	G	NM_006727		24528695	-1	no_errors	NM_006727	genbank	human	reviewed	54_36p	missense	SNP	0.051	C
SLC5A6	8884	genome.wustl.edu	37	2	27427730	27427730	+	Silent	SNP	G	G	C	rs376306193		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr2:27427730G>C	ENST00000310574.3	-	8	1277	c.804C>G	c.(802-804)ctC>ctG	p.L268L	SLC5A6_ENST00000461319.1_5'Flank|SLC5A6_ENST00000408041.1_Silent_p.L268L	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	268					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CGTATAAGGAGAGCATCATGA	0.587																																																0			2						G		0,4406		0,0,2203	103.0	95.0	98.0		804	-2.5	1.0	2		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC5A6	NM_021095.2		0,1,6502	CC,CG,GG		0.0116,0.0,0.0077		268/636	27427730	1,13005	2203	4300	6503	27281234	SO:0001819	synonymous_variant	8884			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.804C>G	2.37:g.27427730G>C		Somatic		Capture	Illumina GAIIx	4	27281234	B2RB85|D6W549|Q969Y5	Silent	SNP	PatternScan_NA_SOLUT_SYMP_2,HMMPfam_SSF,PatternScan_NA_SOLUT_SYMP_1	p.L268	ENST00000310574.3	37	c.804	CCDS1740.1	2																																																																																			-	HMMPfam_SSF		0.587	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	protein_coding	OTTHUMT00000214194.1	G	NM_021095		27281234	-1	no_errors	NM_021095	genbank	human	provisional	54_36p	silent	SNP	0.997	C
EHD3	30845	genome.wustl.edu	37	2	31484511	31484511	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr2:31484511A>G	ENST00000322054.5	+	5	1297	c.1012A>G	c.(1012-1014)Atc>Gtc	p.I338V	EHD3_ENST00000541626.1_Intron	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	338					blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					CCTGGCCGAGATCTATGGCCG	0.567																																																0			2											138.0	130.0	133.0					2																	31484511		2203	4300	6503	31338015	SO:0001583	missense	30845			AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1012A>G	2.37:g.31484511A>G	ENSP00000327116:p.Ile338Val	Somatic		Capture	Illumina GAIIx	4	31338015	B4DFR5|D6W574|Q8N514|Q9NZB3	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Dynamin_N,superfamily_EF-hand,HMMSmart_SM00027,PatternScan_EF_HAND_1	p.I338V	ENST00000322054.5	37	c.1012	CCDS1774.1	2	.	.	.	.	.	.	.	.	.	.	A	9.155	1.017178	0.19355	.	.	ENSG00000013016	ENST00000322054	T	0.19105	2.17	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.19127	0.0459	L	0.39326	1.205	0.80722	D	1	B	0.22346	0.068	B	0.24006	0.05	T	0.06698	-1.0812	10	0.10111	T	0.7	-20.8036	16.5763	0.84648	1.0:0.0:0.0:0.0	.	338	Q9NZN3	EHD3_HUMAN	V	338	ENSP00000327116:I338V	ENSP00000327116:I338V	I	+	1	0	EHD3	31338015	1.000000	0.71417	0.963000	0.40424	0.055000	0.15305	6.118000	0.71583	2.317000	0.78254	0.459000	0.35465	ATC	-	NULL		0.567	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD3	protein_coding	OTTHUMT00000216810.1	A	NM_014600		31338015	+1	no_errors	NM_014600	genbank	human	provisional	54_36p	missense	SNP	1.000	G
ZNF341	84905	genome.wustl.edu	37	20	32332983	32332983	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr20:32332983C>T	ENST00000375200.1	+	3	582	c.217C>T	c.(217-219)Cgg>Tgg	p.R73W	ZNF341_ENST00000342427.2_Missense_Mutation_p.R73W	NM_001282933.1	NP_001269862.1	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	73					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	31						GACCCACAAGCGGGAACAGTG	0.592																																																0			20											73.0	72.0	72.0					20																	32332983		2203	4300	6503	31796644	SO:0001583	missense	84905			AK027550	CCDS13227.1, CCDS74719.1	20q11.22	2013-01-08			ENSG00000131061	ENSG00000131061		"""Zinc fingers, C2H2-type"""	15992	protein-coding gene	gene with protein product							Standard	NM_001282933		Approved	dJ553F4.3	uc002wzx.3	Q9BYN7	OTTHUMG00000032275	ENST00000375200.1:c.217C>T	20.37:g.32332983C>T	ENSP00000364346:p.Arg73Trp	Somatic		Capture	Illumina GAIIx	4	31796644	A2RUF4|B2RXE5|B7ZM09|Q5JXM8|Q96ST5	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2,superfamily_SSF57667,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.R73W	ENST00000375200.1	37	c.217		20	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023252	0.75275	.	.	ENSG00000131061	ENST00000342427;ENST00000375200	T;T	0.38722	1.12;1.12	5.58	3.61	0.41365	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.48874	0.1524	L	0.34521	1.04	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.973	T	0.50048	-0.8873	10	0.87932	D	0	-36.0878	8.8854	0.35400	0.3647:0.5646:0.0:0.0707	.	73;73	Q9BYN7;Q9BYN7-2	ZN341_HUMAN;.	W	73	ENSP00000344308:R73W;ENSP00000364346:R73W	ENSP00000344308:R73W	R	+	1	2	ZNF341	31796644	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.882000	0.28186	1.351000	0.45789	0.563000	0.77884	CGG	-	HMMSmart_ZnF_C2H2		0.592	ZNF341-201	KNOWN	basic	protein_coding	ZNF341	protein_coding		C			31796644	+1	no_errors	NM_032819	genbank	human	validated	54_36p	missense	SNP	1.000	T
KIFC1	3833	genome.wustl.edu	37	6	33374608	33374608	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr6:33374608G>A	ENST00000428849.2	+	10	2383	c.1933G>A	c.(1933-1935)Gag>Aag	p.E645K		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	645	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						TCCACTGGAAGAGAACGTCTC	0.547																																																0			6											117.0	106.0	110.0					6																	33374608		2203	4300	6503	33482586	SO:0001583	missense	3833			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.1933G>A	6.37:g.33374608G>A	ENSP00000393963:p.Glu645Lys	Somatic		Capture	Illumina GAIIx	4	33482586	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	superfamily_SSF52540,HMMSmart_KISc,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1	p.E645K	ENST00000428849.2	37	c.1933	CCDS34430.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.652169	0.96724	.	.	ENSG00000237649	ENST00000428849	T	0.74632	-0.86	5.09	5.09	0.68999	Kinesin, motor domain (3);	0.056836	0.64402	D	0.000002	T	0.70945	0.3282	N	0.17312	0.475	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.74674	0.947;0.984	T	0.75488	-0.3300	10	0.52906	T	0.07	-2.4534	16.0508	0.80760	0.0:0.0:1.0:0.0	.	637;645	B4E063;Q9BW19	.;KIFC1_HUMAN	K	645	ENSP00000393963:E645K	ENSP00000393963:E645K	E	+	1	0	KIFC1	33482586	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.590000	0.74085	2.656000	0.90262	0.563000	0.77884	GAG	-	superfamily_SSF52540,HMMSmart_KISc,HMMPfam_Kinesin		0.547	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	protein_coding	OTTHUMT00000076417.1	G	NM_002263		33482586	+1	no_errors	NM_002263	genbank	human	validated	54_36p	missense	SNP	1.000	A
PHF20	51230	genome.wustl.edu	37	20	34458978	34458978	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr20:34458978C>T	ENST00000374012.3	+	8	1153	c.1024C>T	c.(1024-1026)Cct>Tct	p.P342S	PHF20_ENST00000439301.1_3'UTR|PHF20_ENST00000481202.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	342					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					GATCCTAGATCCTGACTTGGT	0.448																																																0			20											173.0	155.0	161.0					20																	34458978		2203	4300	6503	33922392	SO:0001583	missense	51230			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.1024C>T	20.37:g.34458978C>T	ENSP00000363124:p.Pro342Ser	Somatic		Capture	Illumina GAIIx	4	33922392	A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Missense_Mutation	SNP	superfamily_Tudor/PWWP/MBT,HMMSmart_SM00333,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00249,HMMPfam_PHD,PatternScan_ZF_PHD_1	p.P342S	ENST00000374012.3	37	c.1024	CCDS13268.1	20	.	.	.	.	.	.	.	.	.	.	C	13.46	2.245263	0.39697	.	.	ENSG00000025293	ENST00000374012;ENST00000339089;ENST00000374000	T;T;T	0.42513	1.58;0.97;0.97	5.41	0.897	0.19258	.	0.857221	0.10671	N	0.647584	T	0.24005	0.0581	L	0.34521	1.04	0.80722	D	1	B;B	0.19583	0.0;0.037	B;B	0.14023	0.0;0.01	T	0.16689	-1.0394	10	0.12430	T	0.62	.	2.3472	0.04274	0.1153:0.4518:0.1835:0.2494	.	342;342	Q9BVI0;Q66K49	PHF20_HUMAN;.	S	342	ENSP00000363124:P342S;ENSP00000341900:P342S;ENSP00000363112:P342S	ENSP00000341900:P342S	P	+	1	0	PHF20	33922392	0.935000	0.31712	0.998000	0.56505	0.940000	0.58332	-0.103000	0.10940	0.279000	0.22186	-0.218000	0.12543	CCT	-	NULL		0.448	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF20	protein_coding	OTTHUMT00000078949.2	C	NM_016436		33922392	+1	no_errors	NM_016436	genbank	human	validated	54_36p	missense	SNP	0.914	T
BRWD1	54014	genome.wustl.edu	37	21	40668205	40668205	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr21:40668205G>A	ENST00000333229.2	-	6	761	c.434C>T	c.(433-435)tCc>tTc	p.S145F	BRWD1_ENST00000380800.3_Missense_Mutation_p.S145F|BRWD1_ENST00000342449.3_Missense_Mutation_p.S145F|BRWD1_ENST00000470108.1_5'Flank	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	145					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ATTTGGTGGGGAACCATAATT	0.368																																					Melanoma(170;988 1986 4794 16843 39731)											0			21											135.0	139.0	138.0					21																	40668205		2203	4300	6503	39590075	SO:0001583	missense	54014			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.434C>T	21.37:g.40668205G>A	ENSP00000330753:p.Ser145Phe	Somatic		Capture	Illumina GAIIx	4	39590075	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	HMMSmart_SM00320,superfamily_WD40 repeat-like,HMMPfam_WD40,PatternScan_WD_REPEATS_1,HMMSmart_SM00297,superfamily_Bromodomain,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.S145F	ENST00000333229.2	37	c.434	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	G	8.096	0.775584	0.16051	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.17370	2.28;2.28;2.28	5.9	3.98	0.46160	.	0.423728	0.24640	N	0.036814	T	0.10766	0.0263	L	0.28400	0.85	0.19300	N	0.99997	B;B	0.18013	0.002;0.025	B;B	0.10450	0.004;0.005	T	0.21759	-1.0236	10	0.25106	T	0.35	-0.0607	6.3696	0.21473	0.0689:0.1338:0.6582:0.1391	.	145;145	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	F	145	ENSP00000330753:S145F;ENSP00000344333:S145F;ENSP00000370178:S145F	ENSP00000330753:S145F	S	-	2	0	BRWD1	39590075	0.025000	0.19082	1.000000	0.80357	0.975000	0.68041	1.012000	0.29924	1.487000	0.48415	0.644000	0.83932	TCC	-	NULL		0.368	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	protein_coding	OTTHUMT00000141398.3	G	NM_033656		39590075	-1	no_errors	NM_018963	genbank	human	reviewed	54_36p	missense	SNP	0.526	A
RPL5P34	388907	genome.wustl.edu	37	22	43173015	43173015	+	IGR	SNP	A	A	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr22:43173015A>T								Y_RNA (14050 upstream) : ARFGAP3 (19492 downstream)																							AATATGCAGCAGCATAATTTG	0.507																																																0			22																																								41502959	SO:0001628	intergenic_variant	388907																															22.37:g.43173015A>T		Somatic		Capture	Illumina GAIIx	4	41502959		RNA	SNP	-	NULL		37	NULL		22																																																																																			-	-	0	0.507					LOC388907			A			41502959	-1	pseudogene	XR_017615	genbank	human	model	54_36p	rna	SNP	1.000	T
C2CD2	25966	genome.wustl.edu	37	21	43319355	43319355	+	Silent	SNP	C	C	T	rs150987090	byFrequency	TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr21:43319355C>T	ENST00000380486.3	-	13	1918	c.1677G>A	c.(1675-1677)ccG>ccA	p.P559P	C2CD2_ENST00000329623.7_Silent_p.P404P	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	559						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						CTTCCTCTGGCGGGGCAGAGG	0.682													C|||	5	0.000998403	0.0008	0.0014	5008	,	,		9954	0.0		0.002	False		,,,				2504	0.001															0			21						C	,	0,4394		0,0,2197	21.0	25.0	23.0		1677,1212	-9.9	0.0	21	dbSNP_134	23	12,8562		0,12,4275	no	coding-synonymous,coding-synonymous	C2CD2	NM_015500.1,NM_199050.2	,	0,12,6472	TT,TC,CC		0.14,0.0,0.0925	,	559/697,404/542	43319355	12,12956	2197	4287	6484	42192424	SO:0001819	synonymous_variant	25966			AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.1677G>A	21.37:g.43319355C>T		Somatic		Capture	Illumina GAIIx	4	42192424	Q5R2V7|Q6AHX8|Q9NSE6	Silent	SNP	superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.P559	ENST00000380486.3	37	c.1677	CCDS42933.1	21	4	0.0018315018315018315	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	5.592	0.294091	0.10567	0.0	0.0014	ENSG00000157617	ENST00000449165	.	.	.	4.96	-9.92	0.00455	.	.	.	.	.	T	0.16514	0.0397	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.10660	-1.0620	4	.	.	.	-14.3947	3.7676	0.08629	0.0995:0.1908:0.1944:0.5153	.	.	.	.	T	45	.	.	A	-	1	0	C2CD2	42192424	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-3.532000	0.00440	-2.705000	0.00396	-1.327000	0.01280	GCC	-	NULL		0.682	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD2	protein_coding	OTTHUMT00000195228.2	C	NM_015500		42192424	-1	no_errors	NM_015500	genbank	human	validated	54_36p	silent	SNP	0.000	T
MYO5B	4645	genome.wustl.edu	37	18	47489318	47489318	+	Splice_Site	SNP	C	C	G			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr18:47489318C>G	ENST00000285039.7	-	11	1704		c.e11+1			NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB						endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		ACCAAGCCTACCGAGTTGAAC	0.517																																																0			18											164.0	167.0	166.0					18																	47489318		1881	4110	5991	45743316	SO:0001630	splice_region_variant	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1404+1G>C	18.37:g.47489318C>G		Somatic		Capture	Illumina GAIIx	4	45743316	B0I1R3|Q0P656|Q9H6Y6	Splice_Site	SNP	-	e11+1	ENST00000285039.7	37	c.1404+1	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599254	0.87055	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.693	0.96009	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYO5B	45743316	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	7.711000	0.84669	2.746000	0.94184	0.655000	0.94253	.	-	-		0.517	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	protein_coding	OTTHUMT00000448515.2	C		Intron	45743316	-1	no_errors	NM_001080467	genbank	human	provisional	54_36p	splice_site	SNP	1.000	G
CCR3	1232	genome.wustl.edu	37	3	46307517	46307517	+	Missense_Mutation	SNP	G	G	A	rs199944063		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr3:46307517G>A	ENST00000357422.2	+	4	1411	c.868G>A	c.(868-870)Gcc>Acc	p.A290T	CCR3_ENST00000395942.2_Missense_Mutation_p.A290T|CCR3_ENST00000545097.1_Missense_Mutation_p.A311T|CCR3_ENST00000541018.1_Missense_Mutation_p.A290T|CCR3_ENST00000395940.2_Missense_Mutation_p.A290T			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	290					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		AGAGGTGATCGCCTACTCCCA	0.522																																																0			3											124.0	104.0	110.0					3																	46307517		2203	4300	6503	46282521	SO:0001583	missense	1232			AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.868G>A	3.37:g.46307517G>A	ENSP00000350003:p.Ala290Thr	Somatic		Capture	Illumina GAIIx	4	46282521	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.A290T	ENST00000357422.2	37	c.868	CCDS2738.1	3	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087145	0.55968	.	.	ENSG00000183625	ENST00000357422;ENST00000545097;ENST00000541018;ENST00000395940;ENST00000395942	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	5.73	-0.946	0.10385	GPCR, rhodopsin-like superfamily (1);	0.474665	0.18676	N	0.134312	T	0.48892	0.1525	M	0.86420	2.815	0.21256	N	0.999742	D;D	0.54964	0.962;0.969	P;P	0.51742	0.55;0.678	T	0.44498	-0.9324	10	0.56958	D	0.05	.	1.7135	0.02896	0.2082:0.0981:0.2695:0.4241	.	311;290	F5GWL6;P51677	.;CCR3_HUMAN	T	290;311;290;290;290	ENSP00000350003:A290T;ENSP00000441600:A311T;ENSP00000440097:A290T;ENSP00000379271:A290T;ENSP00000379273:A290T	ENSP00000350003:A290T	A	+	1	0	CCR3	46282521	0.978000	0.34361	0.809000	0.32408	0.505000	0.33919	2.071000	0.41500	-0.249000	0.09569	0.655000	0.94253	GCC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.522	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR3	protein_coding	OTTHUMT00000257380.2	G			46282521	+1	no_errors	NM_001837	genbank	human	reviewed	54_36p	missense	SNP	0.004	A
ZNF423	23090	genome.wustl.edu	37	16	49764715	49764715	+	Silent	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr16:49764715G>A	ENST00000561648.1	-	3	297	c.244C>T	c.(244-246)Ctg>Ttg	p.L82L	ZNF423_ENST00000562520.1_Silent_p.L22L|ZNF423_ENST00000262383.2_Silent_p.L82L|ZNF423_ENST00000563137.2_Silent_p.L22L|ZNF423_ENST00000562871.1_Silent_p.L22L	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	82					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TGGTCCGTCAGGTCTGCCAGA	0.522																																																0			16											234.0	190.0	205.0					16																	49764715		2198	4300	6498	48322216	SO:0001819	synonymous_variant	23090			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.244C>T	16.37:g.49764715G>A		Somatic		Capture	Illumina GAIIx	4	48322216	O94860|Q76N04|Q9NZ13	Silent	SNP	HMMSmart_ZnF_C2H2,superfamily_SSF57667,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.L82	ENST00000561648.1	37	c.244	CCDS32445.1	16																																																																																			-	HMMSmart_ZnF_C2H2		0.522	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	protein_coding	OTTHUMT00000423258.1	G	NM_015069		48322216	-1	no_errors	NM_015069	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
KPNA3	3839	genome.wustl.edu	37	13	50296164	50296164	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr13:50296164C>T	ENST00000261667.3	-	9	1067	c.653G>A	c.(652-654)cGg>cAg	p.R218Q		NM_002267.3	NP_002258.2	O00505	IMA4_HUMAN	karyopherin alpha 3 (importin alpha 4)	218	NLS binding site (major). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)|protein complex assembly (GO:0006461)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(4)	21		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		TGTGACGTTCCGAAGGAAGGT	0.478																																																0			13											127.0	116.0	120.0					13																	50296164		2203	4300	6503	49194165	SO:0001583	missense	3839			D89618	CCDS9421.1	13q14.3	2013-02-14			ENSG00000102753	ENSG00000102753		"""Importins"", ""Armadillo repeat containing"""	6396	protein-coding gene	gene with protein product		601892				9154134, 9435235	Standard	NM_002267		Approved	SRP1gamma, SRP4, hSRP1, IPOA4	uc001vdj.2	O00505	OTTHUMG00000016922	ENST00000261667.3:c.653G>A	13.37:g.50296164C>T	ENSP00000261667:p.Arg218Gln	Somatic		Capture	Illumina GAIIx	4	49194165	O00191|O43195|Q5JVM9|Q96AA7	Missense_Mutation	SNP	HMMPfam_IBB,superfamily_ARM repeat,HMMPfam_Arm,HMMSmart_SM00185	p.R218Q	ENST00000261667.3	37	c.653	CCDS9421.1	13	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751261	0.89753	.	.	ENSG00000102753	ENST00000261667	T	0.70986	-0.53	5.73	5.73	0.89815	Armadillo-like helical (1);Armadillo-type fold (1);	0.105662	0.64402	D	0.000004	T	0.76364	0.3977	M	0.89601	3.045	0.80722	D	1	D	0.57571	0.98	B	0.37508	0.252	D	0.84042	0.0365	10	0.87932	D	0	-11.1239	19.8994	0.96980	0.0:1.0:0.0:0.0	.	218	O00505	IMA3_HUMAN	Q	218	ENSP00000261667:R218Q	ENSP00000261667:R218Q	R	-	2	0	KPNA3	49194165	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.703000	0.92315	0.650000	0.86243	CGG	-	superfamily_ARM repeat,HMMPfam_Arm,HMMSmart_SM00185		0.478	KPNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA3	protein_coding	OTTHUMT00000044939.2	C	NM_002267		49194165	-1	no_errors	NM_002267	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
PPAP2A	8611	genome.wustl.edu	37	5	54826651	54826651	+	Intron	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr5:54826651C>T	ENST00000307259.8	-	1	479				PPAP2A_ENST00000515132.1_Intron|PPAP2A_ENST00000264775.5_Intron	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A						androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				TTTTGAGCACCTCCTGACAGA	0.617																																																0			5																																								54862408	SO:0001627	intron_variant	379013			AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.58+3748G>A	5.37:g.54826651C>T		Somatic		Capture	Illumina GAIIx	4	54862408	B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	RNA	SNP	-	NULL	ENST00000307259.8	37	NULL	CCDS34159.1	5																																																																																			-	-		0.617	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF138P1	protein_coding	OTTHUMT00000368073.1	C			54862408	-1	pseudogene	NR_001575	genbank	human	provisional	54_36p	rna	SNP	0.601	T
OR5M3	219482	genome.wustl.edu	37	11	56237094	56237094	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr11:56237094C>T	ENST00000312240.2	-	1	920	c.880G>A	c.(880-882)Gat>Aat	p.D294N		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					TTTTTCACATCCTTGTTCCTC	0.383																																																0			11											16.0	18.0	17.0					11																	56237094		2167	4216	6383	55993670	SO:0001583	missense	219482			AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.880G>A	11.37:g.56237094C>T	ENSP00000312208:p.Asp294Asn	Somatic		Capture	Illumina GAIIx	4	55993670	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.D294N	ENST00000312240.2	37	c.880	CCDS31532.1	11	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747853	0.30955	.	.	ENSG00000174937	ENST00000312240	T	0.38077	1.16	5.08	4.14	0.48551	.	0.172475	0.27455	N	0.019281	T	0.49389	0.1554	M	0.90082	3.085	0.33922	D	0.640965	B	0.21606	0.058	B	0.27076	0.076	T	0.63075	-0.6718	10	0.56958	D	0.05	-7.867	14.0408	0.64674	0.0:0.8474:0.1526:0.0	.	294	Q8NGP4	OR5M3_HUMAN	N	294	ENSP00000312208:D294N	ENSP00000312208:D294N	D	-	1	0	OR5M3	55993670	1.000000	0.71417	0.907000	0.35723	0.067000	0.16453	4.631000	0.61304	1.075000	0.40932	0.549000	0.68633	GAT	-	superfamily_Family A G protein-coupled receptor-like		0.383	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M3	protein_coding	OTTHUMT00000391639.1	C	NM_001004742		55993670	-1	no_errors	NM_001004742	genbank	human	provisional	54_36p	missense	SNP	0.978	T
C14orf37	145407	genome.wustl.edu	37	14	58606017	58606017	+	Silent	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr14:58606017G>A	ENST00000267485.7	-	2	254	c.60C>T	c.(58-60)agC>agT	p.S20S	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	20						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						GTGTGGCAACGCTGAAAAGCA	0.478																																																0			14											102.0	103.0	103.0					14																	58606017		2203	4300	6503	57675770	SO:0001819	synonymous_variant	145407				CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.60C>T	14.37:g.58606017G>A		Somatic		Capture	Illumina GAIIx	4	57675770	A8K8Z8|Q6P5Q1|Q86TY1	Silent	SNP	NULL	p.S20	ENST00000267485.7	37	c.60	CCDS32089.1	14																																																																																			-	NULL		0.478	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf37	protein_coding	OTTHUMT00000412059.1	G	NM_001001872		57675770	-1	no_errors	NM_001001872	genbank	human	predicted	54_36p	silent	SNP	0.022	A
LILRB4	11006	genome.wustl.edu	37	19	55178156	55178156	+	Missense_Mutation	SNP	G	G	A	rs532643436	byFrequency	TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr19:55178156G>A	ENST00000391736.1	+	12	1312	c.997G>A	c.(997-999)Gtg>Atg	p.V333M	LILRB4_ENST00000270452.2_Missense_Mutation_p.V333M|LILRB4_ENST00000430952.2_Missense_Mutation_p.V333M|LILRB4_ENST00000391733.3_Missense_Mutation_p.V334M|LILRB4_ENST00000391734.3_Missense_Mutation_p.V333M	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	333					immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		AGGTGCTGCCGTGAAGAACAC	0.612													G|||	2	0.000399361	0.0	0.0014	5008	,	,		17111	0.0		0.0	False		,,,				2504	0.001															0			19											120.0	109.0	113.0					19																	55178156		2203	4300	6503	59869968	SO:0001583	missense	11006			U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.997G>A	19.37:g.55178156G>A	ENSP00000375616:p.Val333Met	Somatic		Capture	Illumina GAIIx	4	59869968	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_ig	p.V333M	ENST00000391736.1	37	c.997	CCDS12902.1	19	.	.	.	.	.	.	.	.	.	.	G	3.919	-0.018432	0.07681	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.00561	6.8;6.8;6.63;6.95;6.82;6.59	1.73	-3.46	0.04767	.	.	.	.	.	T	0.00936	0.0031	M	0.83774	2.66	0.09310	N	1	P;P;P;P;P	0.50943	0.696;0.901;0.94;0.837;0.57	B;B;P;B;B	0.45474	0.069;0.382;0.482;0.386;0.215	T	0.05146	-1.0903	9	0.72032	D	0.01	.	8.7457	0.34585	0.3029:0.0:0.6971:0.0	.	333;332;334;333;333	A8MUE1;C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6	.;.;.;.;LIRB4_HUMAN	M	333;333;333;333;334;332	ENSP00000375616:V333M;ENSP00000270452:V333M;ENSP00000408995:V333M;ENSP00000375614:V333M;ENSP00000375613:V334M;ENSP00000401962:V332M	ENSP00000270452:V333M	V	+	1	0	LILRB4	59869968	0.000000	0.05858	0.002000	0.10522	0.025000	0.11179	-3.339000	0.00506	-1.505000	0.01807	-1.387000	0.01160	GTG	-	NULL		0.612	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB4	protein_coding	OTTHUMT00000141127.3	G			59869968	+1	no_errors	NM_006847	genbank	human	reviewed	54_36p	missense	SNP	0.001	A
Unknown	0	genome.wustl.edu	37	X	65176240	65176240	+	IGR	SNP	C	C	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chrX:65176240C>A								MSN (214449 upstream) : RP6-159A1.3 (43352 downstream)																							AGGAGGGTACCCCCTTTCCAT	0.547																																																0			X																																								65092965	SO:0001628	intergenic_variant	0																															X.37:g.65176240C>A		Somatic		Capture	Illumina GAIIx	4	65092965		Missense_Mutation	SNP	NULL	p.G47C		37	c.139		X																																																																																			-	NULL	0	0.547					LOC100129585			C			65092965	-1	no_errors	XM_001721365	genbank	human	model	54_36p	missense	SNP	1.000	A
VAC14	55697	genome.wustl.edu	37	16	70816975	70816975	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr16:70816975C>T	ENST00000261776.5	-	7	1032	c.772G>A	c.(772-774)Gag>Aag	p.E258K		NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	258					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				TTGGCCATCTCAGCAAACTTC	0.512																																																0			16											137.0	141.0	139.0					16																	70816975		2198	4300	6498	69374476	SO:0001583	missense	55697			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.772G>A	16.37:g.70816975C>T	ENSP00000261776:p.Glu258Lys	Somatic		Capture	Illumina GAIIx	4	69374476	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	superfamily_ARM-type_fold,HMMPfam_HEAT	p.E258K	ENST00000261776.5	37	c.772	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	C	15.75	2.927070	0.52759	.	.	ENSG00000103043	ENST00000261776	T	0.65732	-0.17	5.38	5.38	0.77491	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53334	0.1790	L	0.28556	0.865	0.80722	D	1	B	0.22003	0.063	B	0.27715	0.082	T	0.47209	-0.9135	10	0.16420	T	0.52	-30.5395	19.1503	0.93485	0.0:1.0:0.0:0.0	.	258	Q08AM6	VAC14_HUMAN	K	258	ENSP00000261776:E258K	ENSP00000261776:E258K	E	-	1	0	VAC14	69374476	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.469000	0.80959	2.528000	0.85240	0.561000	0.74099	GAG	-	superfamily_ARM-type_fold		0.512	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	protein_coding	OTTHUMT00000268973.3	C	NM_018052		69374476	-1	no_errors	NM_018052	genbank	human	validated	54_36p	missense	SNP	1.000	T
SNHG16	100507246	genome.wustl.edu	37	17	74557209	74557209	+	RNA	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr17:74557209C>T	ENST00000363315.1	+	0	156				SNHG16_ENST00000364968.1_RNA|SNORD1B_ENST00000363091.1_RNA					small nucleolar RNA host gene 16 (non-protein coding)																		ATGATGATTTCAAGTTATCCC	0.413																																																0			17											87.0	85.0	85.0					17																	74557209		876	1991	2867	72068804			0			BC042949, BC100293, AB447886		17q25.1	2014-02-13			ENSG00000163597	ENSG00000163597		"""Long non-coding RNAs"", ""-"""	44352	non-coding RNA	RNA, long non-coding	"""non-coding RNA expressed in aggressive neuroblastoma"""					19287950, 21147498, 24519959	Standard	NR_038109		Approved	ncRAN	uc002jsd.2		OTTHUMG00000132201		17.37:g.74557209C>T		Somatic		Capture	Illumina GAIIx	4	72068804		RNA	SNP	-	NULL	ENST00000363315.1	37	NULL		17																																																																																			-	-		0.413	SNHG16-201	KNOWN	basic	snoRNA	SNORD1B	processed_transcript		C	NR_038108		72068804	+1	no_errors	ENST00000363091	ensembl	human	known	54_36p	rna	SNP	0.204	T
ZNF717	100131827	genome.wustl.edu	37	3	75790448	75790448	+	Missense_Mutation	SNP	T	T	C	rs141704469	byFrequency	TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr3:75790448T>C	ENST00000478296.1	-	3	382	c.106A>G	c.(106-108)Acc>Gcc	p.T36A	ZNF717_ENST00000477374.1_Missense_Mutation_p.T86A|ZNF717_ENST00000491507.1_5'UTR|ZNF717_ENST00000400845.3_Missense_Mutation_p.T79A|ZNF717_ENST00000422325.1_Missense_Mutation_p.T86A|MIR4273_ENST00000582824.1_RNA			Q9BY31	ZN717_HUMAN	zinc finger protein 717	79	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						AGGTTTGGGGTTTCTTCTACT	0.448																																																0			3											28.0	19.0	21.0					3																	75790448		479	1312	1791	75873138	SO:0001583	missense	0			AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.106A>G	3.37:g.75790448T>C	ENSP00000419377:p.Thr36Ala	Somatic		Capture	Illumina GAIIx	4	75873138		Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB	p.T79A	ENST00000478296.1	37	c.235		3	1228	0.5622710622710623	207	0.42073170731707316	224	0.6187845303867403	326	0.5699300699300699	471	0.6213720316622692	.	0.004	-2.295223	0.00245	.	.	ENSG00000227124	ENST00000477374;ENST00000478296;ENST00000422325;ENST00000400845;ENST00000468296;ENST00000471541	T;T;T;T;T;T	0.38722	5.7;1.12;1.12;1.12;5.76;4.12	1.95	-3.9	0.04181	.	.	.	.	.	T	0.00012	0.0000	N	0.01431	-0.87	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33189	-0.9878	8	0.07325	T	0.83	.	1.5855	0.02643	0.1313:0.33:0.2956:0.2431	.	86	C9JSV9	.	A	86;36;86;79;86;36	ENSP00000417902:T86A;ENSP00000419377:T36A;ENSP00000409514:T86A;ENSP00000383643:T79A;ENSP00000418187:T86A;ENSP00000420241:T36A	ENSP00000383643:T79A	T	-	1	0	ZNF717	75873138	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.603000	0.02077	-2.782000	0.00360	-2.489000	0.00195	ACC	-	NULL		0.448	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	ENSG00000185044	protein_coding	OTTHUMT00000352764.2	T	NM_001128223		75873138	-1	no_stop_codon	ENST00000329536	ensembl	human	known	54_36p	missense	SNP	0.000	C
F2R	2149	genome.wustl.edu	37	5	76028582	76028582	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr5:76028582G>A	ENST00000319211.4	+	2	797	c.532G>A	c.(532-534)Gtc>Atc	p.V178I		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	178					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	GTGTCGCTTCGTCACTGCAGC	0.488																																																0			5											202.0	199.0	200.0					5																	76028582		2203	4300	6503	76064338	SO:0001583	missense	2149			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.532G>A	5.37:g.76028582G>A	ENSP00000321326:p.Val178Ile	Somatic		Capture	Illumina GAIIx	4	76064338	Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V178I	ENST00000319211.4	37	c.532	CCDS4032.1	5	.	.	.	.	.	.	.	.	.	.	G	7.772	0.707740	0.15239	.	.	ENSG00000181104	ENST00000319211	T	0.38077	1.16	4.89	0.978	0.19740	GPCR, rhodopsin-like superfamily (1);	0.128399	0.52532	N	0.000073	T	0.31575	0.0801	L	0.58969	1.84	0.80722	D	1	B	0.22800	0.075	B	0.21360	0.034	T	0.10200	-1.0640	10	0.45353	T	0.12	-15.3103	9.8842	0.41251	0.3637:0.0:0.6363:0.0	.	178	P25116	PAR1_HUMAN	I	178	ENSP00000321326:V178I	ENSP00000321326:V178I	V	+	1	0	F2R	76064338	0.987000	0.35691	0.180000	0.23079	0.024000	0.10985	1.893000	0.39758	0.052000	0.16007	0.561000	0.74099	GTC	-	superfamily_SSF81321,HMMPfam_7tm_1		0.488	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2R	protein_coding	OTTHUMT00000254068.2	G			76064338	+1	no_errors	NM_001992	genbank	human	reviewed	54_36p	missense	SNP	0.981	A
MYF5	4617	genome.wustl.edu	37	12	81111238	81111238	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr12:81111238G>C	ENST00000228644.3	+	1	548	c.396G>C	c.(394-396)gaG>gaC	p.E132D		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	132	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						GCTACATCGAGAGCCTGCAGG	0.587																																																0			12											98.0	99.0	98.0					12																	81111238		2203	4300	6503	79635369	SO:0001583	missense	4617				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.396G>C	12.37:g.81111238G>C	ENSP00000228644:p.Glu132Asp	Somatic		Capture	Illumina GAIIx	4	79635369	Q6ISR9	Missense_Mutation	SNP	HMMPfam_Basic,HMMSmart_BASIC,superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH	p.E132D	ENST00000228644.3	37	c.396	CCDS9020.1	12	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370173	0.82573	.	.	ENSG00000111049	ENST00000228644	D	0.97906	-4.6	6.06	6.06	0.98353	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98140	0.9386	L	0.56199	1.76	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.98308	1.0522	10	0.59425	D	0.04	-5.2483	15.7203	0.77705	0.0668:0.0:0.9332:0.0	.	132	P13349	MYF5_HUMAN	D	132	ENSP00000228644:E132D	ENSP00000228644:E132D	E	+	3	2	MYF5	79635369	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.556000	0.45862	2.882000	0.98803	0.655000	0.94253	GAG	-	superfamily_HLH_basic,HMMPfam_HLH,HMMSmart_HLH		0.587	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF5	protein_coding	OTTHUMT00000407757.1	G	NM_005593		79635369	+1	no_errors	NM_005593	genbank	human	validated	54_36p	missense	SNP	1.000	C
SEMA3C	10512	genome.wustl.edu	37	7	80374553	80374553	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr7:80374553T>A	ENST00000265361.3	-	18	2474	c.1913A>T	c.(1912-1914)cAa>cTa	p.Q638L	SEMA3C_ENST00000419255.2_Missense_Mutation_p.Q638L|SEMA3C_ENST00000544525.1_Missense_Mutation_p.Q656L	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	638	Ig-like C2-type.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						ATAAAGTCCTTGGTCAGAACC	0.403																																																0			7											72.0	71.0	72.0					7																	80374553		2203	4300	6503	80212489	SO:0001583	missense	10512			AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.1913A>T	7.37:g.80374553T>A	ENSP00000265361:p.Gln638Leu	Somatic		Capture	Illumina GAIIx	4	80212489	B4DRL8	Missense_Mutation	SNP	superfamily_Sema,HMMPfam_Sema,HMMSmart_Sema,HMMSmart_PSI,superfamily_Plexin-like_fold,superfamily_SSF48726,HMMSmart_IG	p.Q638L	ENST00000265361.3	37	c.1913	CCDS5596.1	7	.	.	.	.	.	.	.	.	.	.	T	16.12	3.033134	0.54896	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525	T;T;T	0.67345	-0.26;-0.26;-0.26	5.56	5.56	0.83823	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.099589	0.64402	D	0.000001	T	0.58566	0.2131	L	0.46157	1.445	0.80722	D	1	B;B	0.26147	0.143;0.076	B;B	0.29440	0.062;0.102	T	0.58429	-0.7638	10	0.45353	T	0.12	.	8.3648	0.32380	0.0:0.1168:0.0:0.8832	.	656;638	F5H1Z7;Q99985	.;SEM3C_HUMAN	L	638;638;656	ENSP00000265361:Q638L;ENSP00000411193:Q638L;ENSP00000445649:Q656L	ENSP00000265361:Q638L	Q	-	2	0	SEMA3C	80212489	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.096000	0.50243	2.130000	0.65690	0.528000	0.53228	CAA	-	superfamily_SSF48726,HMMSmart_IG		0.403	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3C	protein_coding	OTTHUMT00000253279.1	T	NM_006379		80212489	-1	no_errors	NM_006379	genbank	human	validated	54_36p	missense	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	8	86787799	86787799	+	IGR	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr8:86787799G>A								REXO1L10P (29054 upstream) : CTA-392E5.1 (64134 downstream)																							ACAGTCCAAGGCGTAGATTCC	0.587																																																0			8																																								86872648	SO:0001628	intergenic_variant	441361																															8.37:g.86787799G>A		Somatic		Capture	Illumina GAIIx	4	86872648		Missense_Mutation	SNP	superfamily_Ribonuclease H-like,HMMSmart_SM00479,HMMPfam_Exonuc_X-T	p.A503V		37	c.1508		8																																																																																			-	superfamily_Ribonuclease H-like,HMMSmart_SM00479,HMMPfam_Exonuc_X-T	0	0.587					REXO1L5P			G			86872648	-1	pseudogene	XM_496983	genbank	human	model	54_36p	missense	SNP	0.998	A
ZNF778	197320	genome.wustl.edu	37	16	89293742	89293742	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr16:89293742T>C	ENST00000433976.2	+	6	1294	c.962T>C	c.(961-963)cTc>cCc	p.L321P	ZNF778_ENST00000306502.6_Missense_Mutation_p.L279P|RP11-46C24.6_ENST00000563182.1_RNA	NM_001201407.1|NM_182531.3	NP_001188336.1|NP_872337.2	Q96MU6	ZN778_HUMAN	zinc finger protein 778	321					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|skin(2)	24				BRCA - Breast invasive adenocarcinoma(80;0.0269)		TTCACTGGACTCTCAGGTCTT	0.463																																																0			16											55.0	60.0	58.0					16																	89293742		2097	4243	6340	87821243	SO:0001583	missense	197320			AK056437	CCDS45550.1, CCDS73928.1	16q24.3	2014-09-17			ENSG00000170100	ENSG00000170100		"""Zinc fingers, C2H2-type"", ""-"""	26479	protein-coding gene	gene with protein product							Standard	NM_182531		Approved	FLJ31875	uc021tms.1	Q96MU6		ENST00000433976.2:c.962T>C	16.37:g.89293742T>C	ENSP00000405289:p.Leu321Pro	Somatic		Capture	Illumina GAIIx	4	87821243	Q08AG0	Missense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.L321P	ENST00000433976.2	37	c.962	CCDS45550.1	16	.	.	.	.	.	.	.	.	.	.	T	2.458	-0.324896	0.05350	.	.	ENSG00000170100	ENST00000433976;ENST00000306502	T;T	0.15603	2.41;2.41	1.13	-1.36	0.09085	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07863	0.0197	N	0.12443	0.215	0.09310	N	1	B;B	0.22800	0.075;0.045	B;B	0.22601	0.04;0.018	T	0.33497	-0.9866	9	0.44086	T	0.13	.	3.3839	0.07264	0.1798:0.0:0.5741:0.2461	.	279;321	Q96MU6-2;Q96MU6	.;ZN778_HUMAN	P	321;279	ENSP00000405289:L321P;ENSP00000305203:L279P	ENSP00000305203:L279P	L	+	2	0	ZNF778	87821243	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-1.213000	0.02991	-0.380000	0.07894	-1.044000	0.02363	CTC	-	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355		0.463	ZNF778-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF778	protein_coding	OTTHUMT00000430383.1	T	NM_182531		87821243	+1	no_errors	NM_182531	genbank	human	validated	54_36p	missense	SNP	0.000	C
RIPK2	8767	genome.wustl.edu	37	8	90798863	90798863	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr8:90798863C>G	ENST00000220751.4	+	9	1386	c.1072C>G	c.(1072-1074)Cct>Gct	p.P358A	RIPK2_ENST00000540020.1_Missense_Mutation_p.P221A	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	358					activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			TAGTGGTTCTCCTGAAACTTC	0.323																																																0			8											112.0	114.0	113.0					8																	90798863		2203	4300	6503	90868004	SO:0001583	missense	8767			AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.1072C>G	8.37:g.90798863C>G	ENSP00000220751:p.Pro358Ala	Somatic		Capture	Illumina GAIIx	4	90868004	B7Z748|Q6UWF0	Missense_Mutation	SNP	superfamily_Protein kinase-like (PK-like),HMMPfam_Pkinase,HMMSmart_SM00219,HMMSmart_SM00220,PatternScan_PROTEIN_KINASE_ST,superfamily_DEATH domain,HMMPfam_CARD	p.P358A	ENST00000220751.4	37	c.1072	CCDS6247.1	8	.	.	.	.	.	.	.	.	.	.	C	3.944	-0.013542	0.07727	.	.	ENSG00000104312	ENST00000220751;ENST00000540020	T;T	0.81078	-1.2;-1.45	5.51	0.379	0.16213	.	0.792782	0.10650	N	0.649984	T	0.60856	0.2301	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38585	-0.9654	10	0.14252	T	0.57	-0.0866	0.9218	0.01316	0.1698:0.407:0.149:0.2742	.	358	O43353	RIPK2_HUMAN	A	358;221	ENSP00000220751:P358A;ENSP00000441623:P221A	ENSP00000220751:P358A	P	+	1	0	RIPK2	90868004	0.000000	0.05858	0.000000	0.03702	0.176000	0.22953	-0.363000	0.07593	-0.111000	0.12001	0.557000	0.71058	CCT	-	NULL		0.323	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK2	protein_coding	OTTHUMT00000375686.1	C			90868004	+1	no_errors	NM_003821	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
ABCA1	19	genome.wustl.edu	37	9	107555134	107555134	+	Missense_Mutation	SNP	C	C	T	rs564049659		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr9:107555134C>T	ENST00000374736.3	-	42	6084	c.5690G>A	c.(5689-5691)cGg>cAg	p.R1897Q		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1897			R -> W (in HDLD2; uncertain pathological significance). {ECO:0000269|PubMed:15722566}.		apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.R1897L(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CTGTCTTTCCCGCCTCACATC	0.403													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18562	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	lung(1)	9											131.0	115.0	120.0					9																	107555134		2203	4300	6503	106594955	SO:0001583	missense	19			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.5690G>A	9.37:g.107555134C>T	ENSP00000363868:p.Arg1897Gln	Somatic		Capture	Illumina GAIIx	4	106594955	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00382,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.R1897Q	ENST00000374736.3	37	c.5690	CCDS6762.1	9	.	.	.	.	.	.	.	.	.	.	C	16.60	3.167555	0.57476	.	.	ENSG00000165029	ENST00000374736	T	0.76060	-0.99	5.76	5.76	0.90799	.	0.100949	0.64402	D	0.000005	T	0.60418	0.2267	N	0.12182	0.205	0.80722	D	1	B	0.23316	0.083	B	0.12156	0.007	T	0.54529	-0.8280	10	0.30854	T	0.27	.	19.568	0.95403	0.0:1.0:0.0:0.0	.	1897	O95477	ABCA1_HUMAN	Q	1897	ENSP00000363868:R1897Q	ENSP00000363868:R1897Q	R	-	2	0	ABCA1	106594955	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	5.614000	0.67695	2.736000	0.93811	0.655000	0.94253	CGG	-	NULL		0.403	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	protein_coding	OTTHUMT00000053491.1	C	NM_005502		106594955	-1	no_errors	NM_005502	genbank	human	reviewed	54_36p	missense	SNP	0.992	T
CSMD3	114788	genome.wustl.edu	37	8	113276040	113276040	+	Splice_Site	SNP	A	A	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr8:113276040A>T	ENST00000297405.5	-	61	9934	c.9690T>A	c.(9688-9690)gcT>gcA	p.A3230A	CSMD3_ENST00000352409.3_Splice_Site_p.A3160A|CSMD3_ENST00000455883.2_Splice_Site_p.A3061A|CSMD3_ENST00000343508.3_Splice_Site_p.A3190A	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3230	Sushi 24. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGCAGGTAACAGCTGCAATTA	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						0			8											61.0	57.0	58.0					8																	113276040		2203	4300	6503	113345216	SO:0001630	splice_region_variant	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9689-1T>A	8.37:g.113276040A>T		Somatic		Capture	Illumina GAIIx	4	113345216	Q96PZ3	Silent	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,PatternScan_GLYCOSYL_HYDROL_F10	p.A3230	ENST00000297405.5	37	c.9690	CCDS6315.1	8																																																																																			-	superfamily_Complement control module/SCR domain		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	A	NM_052900	Silent	113345216	-1	no_errors	NM_198123	genbank	human	validated	54_36p	silent	SNP	1.000	T
SPICE1	152185	genome.wustl.edu	37	3	113176055	113176055	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr3:113176055T>C	ENST00000295872.4	-	13	1844	c.1585A>G	c.(1585-1587)Att>Gtt	p.I529V		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	529					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)				NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						GGCTCAAAAATATGTGCTGGA	0.448																																																0			3											91.0	89.0	90.0					3																	113176055		2203	4300	6503	114658745	SO:0001583	missense	152185			AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.1585A>G	3.37:g.113176055T>C	ENSP00000295872:p.Ile529Val	Somatic		Capture	Illumina GAIIx	4	114658745	D3DN72|Q8WUX6	Missense_Mutation	SNP	NULL	p.I529V	ENST00000295872.4	37	c.1585	CCDS2973.1	3	.	.	.	.	.	.	.	.	.	.	T	5.006	0.186815	0.09547	.	.	ENSG00000163611	ENST00000295872	T	0.30714	1.52	5.63	-4.67	0.03319	.	0.554011	0.19068	N	0.123569	T	0.11965	0.0291	N	0.10733	0.035	0.19775	N	0.999956	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.28170	-1.0052	10	0.12103	T	0.63	-1.7511	12.8099	0.57634	0.0:0.5316:0.0:0.4684	.	425;529	B3KX77;Q8N0Z3	.;SPICE_HUMAN	V	529	ENSP00000295872:I529V	ENSP00000295872:I529V	I	-	1	0	SPICE1	114658745	0.000000	0.05858	0.138000	0.22173	0.961000	0.63080	-2.262000	0.01175	-1.187000	0.02709	-0.411000	0.06167	ATT	-	NULL		0.448	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC52	protein_coding	OTTHUMT00000354177.2	T	NM_144718		114658745	-1	no_errors	NM_144718	genbank	human	validated	54_36p	missense	SNP	0.925	C
GPR37	2861	genome.wustl.edu	37	7	124386666	124386666	+	Silent	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr7:124386666G>A	ENST00000303921.2	-	2	2405	c.1755C>T	c.(1753-1755)aaC>aaT	p.N585N		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	585					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TGGTGTACTCGTTGTCATTGT	0.498																																																0			7											180.0	150.0	160.0					7																	124386666		2203	4300	6503	124173902	SO:0001819	synonymous_variant	2861				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1755C>T	7.37:g.124386666G>A		Somatic		Capture	Illumina GAIIx	4	124173902	A4D0Y6|O00348|O14768|Q8TD39	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.N585	ENST00000303921.2	37	c.1755	CCDS5792.1	7																																																																																			-	superfamily_Family A G protein-coupled receptor-like		0.498	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	protein_coding	OTTHUMT00000347873.1	G	NM_005302		124173902	-1	no_errors	NM_005302	genbank	human	provisional	54_36p	silent	SNP	0.998	A
PIK3CB	5291	genome.wustl.edu	37	3	138383924	138383924	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr3:138383924A>G	ENST00000477593.1	-	19	2699	c.2626T>C	c.(2626-2628)Ttc>Ctc	p.F876L	PIK3CB_ENST00000289153.2_Missense_Mutation_p.F876L|PIK3CB_ENST00000544716.1_Missense_Mutation_p.F327L			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	876	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	TCTTTGTTGAAGGCTGCTGCA	0.418																																																0			3											81.0	76.0	78.0					3																	138383924		2203	4300	6503	139866614	SO:0001583	missense	5291				CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.2626T>C	3.37:g.138383924A>G	ENSP00000418143:p.Phe876Leu	Somatic		Capture	Illumina GAIIx	4	139866614	D3DNF0|Q24JU2	Missense_Mutation	SNP	HMMPfam_PI3K_p85B,HMMSmart_PI3K_p85B,superfamily_SSF54236,HMMPfam_PI3K_rbd,HMMSmart_PI3K_rbd,HMMSmart_PI3K_C2,superfamily_C2_CaLB,HMMPfam_PI3K_C2,superfamily_ARM-type_fold,HMMSmart_PI3Ka,HMMPfam_PI3Ka,superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2	p.F876L	ENST00000477593.1	37	c.2626	CCDS3104.1	3	.	.	.	.	.	.	.	.	.	.	A	23.1	4.370354	0.82573	.	.	ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153	T;T;T	0.78481	-1.18;-1.18;-1.18	5.46	5.46	0.80206	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.82829	0.5122	L	0.38953	1.18	0.80722	D	1	D;D;P	0.89917	1.0;0.965;0.854	D;P;B	0.83275	0.996;0.861;0.392	T	0.82703	-0.0326	10	0.41790	T	0.15	-16.7895	15.8404	0.78840	1.0:0.0:0.0:0.0	.	876;463;327	P42338;B4DZI3;Q68DL0	PK3CB_HUMAN;.;.	L	876;327;876	ENSP00000418143:F876L;ENSP00000438259:F327L;ENSP00000289153:F876L	ENSP00000289153:F876L	F	-	1	0	PIK3CB	139866614	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.197000	0.70478	0.454000	0.30748	TTC	-	superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc		0.418	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CB	protein_coding	OTTHUMT00000358019.1	A			139866614	-1	no_errors	NM_006219	genbank	human	provisional	54_36p	missense	SNP	1.000	G
LRP1B	53353	genome.wustl.edu	37	2	141660724	141660724	+	Silent	SNP	C	C	G			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr2:141660724C>G	ENST00000389484.3	-	23	4502	c.3531G>C	c.(3529-3531)tcG>tcC	p.S1177S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1177	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATTGTTCAGCGAACACTCAT	0.393										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)											0			2											77.0	66.0	70.0					2																	141660724		2203	4300	6503	141377194	SO:0001819	synonymous_variant	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3531G>C	2.37:g.141660724C>G		Somatic		Capture	Illumina GAIIx	4	141377194	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	superfamily_LDL_rcpt_classA_cys-rich,HMMPfam_Ldl_recept_a,HMMSmart_LDLa,PatternScan_LDLRA_1,superfamily_SSF57196,HMMSmart_EGF,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_SSF63825,HMMSmart_LY,HMMPfam_Ldl_recept_b,HMMPfam_EGF,HMMPfam_NHL,HMMPfam_EGF_2,PatternScan_EGF_1	p.S1177	ENST00000389484.3	37	c.3531	CCDS2182.1	2																																																																																			-	superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF		0.393	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	C	NM_018557		141377194	-1	no_errors	NM_018557	genbank	human	validated	54_36p	silent	SNP	0.111	G
RNF115	27246	genome.wustl.edu	37	1	145682024	145682024	+	Splice_Site	SNP	A	A	G			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr1:145682024A>G	ENST00000369291.5	+	5	634	c.430A>G	c.(430-432)Ata>Gta	p.I144V		NM_014455.2	NP_055270.1			ring finger protein 115											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13						CTGTAACAGAATACTACAACA	0.358																																																0			1											172.0	167.0	169.0					1																	145682024		2203	4300	6503	144393381	SO:0001630	splice_region_variant	27246			AF419857	CCDS72863.1	1q12	2013-01-09	2008-06-16	2008-06-16	ENSG00000121848	ENSG00000265491		"""RING-type (C3HC4) zinc fingers"""	18154	protein-coding gene	gene with protein product			"""zinc finger protein 364"""	ZNF364			Standard	NM_014455		Approved	CL469780	uc001eoj.3	Q9Y4L5	OTTHUMG00000013758	ENST00000369291.5:c.429-1A>G	1.37:g.145682024A>G		Somatic		Capture	Illumina GAIIx	4	144393381		Missense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4	p.I144V	ENST00000369291.5	37	c.430	CCDS922.1	1	.	.	.	.	.	.	.	.	.	.	A	10.92	1.486582	0.26686	.	.	ENSG00000121848	ENST00000369291	T	0.13420	2.59	4.82	2.37	0.29283	.	0.107337	0.64402	N	0.000007	T	0.03053	0.0090	L	0.39566	1.225	0.45227	D	0.998234	B	0.06786	0.001	B	0.08055	0.003	T	0.32771	-0.9894	10	0.12103	T	0.63	-4.3691	7.2843	0.26328	0.8008:0.0:0.1992:0.0	.	144	Q9Y4L5	RN115_HUMAN	V	144	ENSP00000358297:I144V	ENSP00000358297:I144V	I	+	1	0	RNF115	144393381	1.000000	0.71417	0.998000	0.56505	0.525000	0.34531	3.040000	0.49799	0.297000	0.22615	0.533000	0.62120	ATA	-	NULL		0.358	RNF115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF115	protein_coding	OTTHUMT00000038554.2	A	NM_014455	Missense_Mutation	144393381	+1	no_errors	NM_014455	genbank	human	validated	54_36p	missense	SNP	0.995	G
CNTNAP2	26047	genome.wustl.edu	37	7	146829390	146829390	+	Silent	SNP	C	C	T	rs78543192	byFrequency	TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr7:146829390C>T	ENST00000361727.3	+	8	1653	c.1137C>T	c.(1135-1137)aaC>aaT	p.N379N		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	379					adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TCTTTTTCAACGCTACAAGTT	0.458										HNSCC(39;0.1)			T|||	30	0.00599042	0.0219	0.0014	5008	,	,		20040	0.0		0.0	False		,,,				2504	0.0															0			7						T		66,4340	820.5+/-416.4	0,66,2137	126.0	121.0	122.0		1137	3.3	1.0	7	dbSNP_132	122	0,8600		0,0,4300	no	coding-synonymous	CNTNAP2	NM_014141.5		0,66,6437	TT,TC,CC		0.0,1.498,0.5075		379/1332	146829390	66,12940	2203	4300	6503	146460323	SO:0001819	synonymous_variant	26047			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1137C>T	7.37:g.146829390C>T		Somatic		Capture	Illumina GAIIx	4	146460323	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	HMMSmart_SM00231,superfamily_Galactose-binding domain-like,HMMPfam_F5_F8_type_C,PatternScan_FA58C_1,PatternScan_FA58C_2,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00181,HMMPfam_EGF,superfamily_Fibrinogen C-terminal domain-like,PatternScan_GLYCO_HORMONE_BETA_1,HMMSmart_SM00294	p.N379	ENST00000361727.3	37	c.1137	CCDS5889.1	7																																																																																			-	superfamily_Concanavalin A-like lectins/glucanases		0.458	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	protein_coding	OTTHUMT00000327668.1	C			146460323	+1	no_errors	NM_014141	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
KMT2C	58508	genome.wustl.edu	37	7	151970859	151970859	+	Missense_Mutation	SNP	C	C	T	rs149992209	byFrequency	TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr7:151970859C>T	ENST00000262189.6	-	7	1161	c.943G>A	c.(943-945)Ggc>Agc	p.G315S	KMT2C_ENST00000355193.2_Missense_Mutation_p.G315S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	315					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TGAAAGGTGCCGGCTCCTGCA	0.428																																																0			7											263.0	245.0	251.0					7																	151970859		2203	4300	6503	151601792	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.943G>A	7.37:g.151970859C>T	ENSP00000262189:p.Gly315Ser	Somatic		Capture	Illumina GAIIx	4	151601792	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	PatternScan_HMGI_Y,HMMPfam_AT_hook,HMMSmart_SM00249,superfamily_FYVE/PHD zinc finger,HMMPfam_PHD,HMMSmart_SM00184,PatternScan_ZF_PHD_1,PatternScan_ATPASE_ALPHA_BETA,HMMSmart_SM00398,HMMPfam_HMG_box,HMMPfam_FYRN,HMMSmart_SM00541,HMMPfam_FYRC,HMMSmart_SM00542,superfamily_SET domain,HMMPfam_SET,HMMSmart_SM00317,HMMSmart_SM00508	p.G315S	ENST00000262189.6	37	c.943	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265939	0.80358	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.72615	-0.67;-0.67	4.87	4.87	0.63330	Zinc finger, PHD-type (1);	0.000000	0.45606	D	0.000359	D	0.85999	0.5828	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87947	0.2721	10	0.59425	D	0.04	.	18.3752	0.90433	0.0:1.0:0.0:0.0	.	315	Q8NEZ4	MLL3_HUMAN	S	315	ENSP00000262189:G315S;ENSP00000347325:G315S	ENSP00000262189:G315S	G	-	1	0	MLL3	151601792	1.000000	0.71417	0.992000	0.48379	0.975000	0.68041	7.752000	0.85141	2.423000	0.82170	0.650000	0.86243	GGC	-	HMMSmart_SM00249		0.428	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	protein_coding	OTTHUMT00000318887.3	C			151601792	-1	no_errors	NM_170606	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
FNDC9	408263	genome.wustl.edu	37	5	156770193	156770193	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr5:156770193C>A	ENST00000312349.4	-	2	539	c.352G>T	c.(352-354)Gcc>Tcc	p.A118S	CYFIP2_ENST00000541131.1_Intron|CYFIP2_ENST00000377576.3_Intron|CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000442283.2_Intron|CYFIP2_ENST00000318218.6_Intron|CYFIP2_ENST00000521420.1_Intron|CYFIP2_ENST00000435847.2_Intron|CYFIP2_ENST00000347377.6_Intron	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9	118						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						AGCAGAATGGCCATCAGCACC	0.587											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			5											72.0	71.0	71.0					5																	156770193		2203	4300	6503	156702771	SO:0001583	missense	408263			BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248	ENST00000312349.4:c.352G>T	5.37:g.156770193C>A	ENSP00000310594:p.Ala118Ser	Somatic	1781	Capture	Illumina GAIIx	4	156702771	A8K0Y6	Missense_Mutation	SNP	superfamily_FN_III-like	p.A118S	ENST00000312349.4	37	c.352	CCDS4337.1	5	.	.	.	.	.	.	.	.	.	.	C	5.798	0.331510	0.10956	.	.	ENSG00000172568	ENST00000312349;ENST00000520782	T;T	0.21543	2.0;2.05	4.98	4.1	0.47936	.	0.284190	0.27861	N	0.017559	T	0.07007	0.0178	N	0.02916	-0.46	0.33734	D	0.618626	B	0.18310	0.027	B	0.17722	0.019	T	0.22836	-1.0205	10	0.09338	T	0.73	-0.9131	5.9994	0.19511	0.1896:0.709:0.0:0.1014	.	118	Q8TBE3	FNDC9_HUMAN	S	118	ENSP00000310594:A118S;ENSP00000429434:A118S	ENSP00000310594:A118S	A	-	1	0	FNDC9	156702771	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	2.876000	0.48498	1.064000	0.40671	0.491000	0.48974	GCC	-	NULL		0.587	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf40	protein_coding	OTTHUMT00000252573.2	C	NM_001001343		156702771	-1	no_errors	NM_001001343	genbank	human	validated	54_36p	missense	SNP	0.989	A
PTPRN2	5799	genome.wustl.edu	37	7	157926524	157926524	+	Silent	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr7:157926524G>A	ENST00000389418.4	-	9	1410	c.1401C>T	c.(1399-1401)gcC>gcT	p.A467A	PTPRN2_ENST00000389413.3_Silent_p.A467A|PTPRN2_ENST00000409483.1_Silent_p.A429A|PTPRN2_ENST00000404321.2_Silent_p.A490A|PTPRN2_ENST00000389416.4_Silent_p.A450A	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	467					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A467A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CAAACGCAGCGGCCCCGGGCT	0.632																																																1	Substitution - coding silent(1)	cervix(1)	7											44.0	50.0	48.0					7																	157926524		2203	4300	6503	157619285	SO:0001819	synonymous_variant	5799			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1401C>T	7.37:g.157926524G>A		Somatic		Capture	Illumina GAIIx	4	157619285	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.A467	ENST00000389418.4	37	c.1401	CCDS5947.1	7																																																																																			-	NULL		0.632	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	protein_coding	OTTHUMT00000353214.1	G			157619285	-1	no_errors	NM_002847	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
KCNAB1	7881	genome.wustl.edu	37	3	156177657	156177657	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr3:156177657G>A	ENST00000490337.1	+	5	543	c.479G>A	c.(478-480)tGg>tAg	p.W160*	KCNAB1_ENST00000389634.5_Nonsense_Mutation_p.W142*|KCNAB1_ENST00000302490.8_Nonsense_Mutation_p.W142*|KCNAB1_ENST00000389636.5_Nonsense_Mutation_p.W160*|KCNAB1_ENST00000471742.1_Nonsense_Mutation_p.W149*|KCNAB1_ENST00000497291.1_3'UTR	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	160					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AAGAAAGGCTGGAGGTATTGC	0.388																																																0			3											127.0	133.0	131.0					3																	156177657		2203	4300	6503	157660351	SO:0001587	stop_gained	7881			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.479G>A	3.37:g.156177657G>A	ENSP00000419952:p.Trp160*	Somatic		Capture	Illumina GAIIx	4	157660351	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Nonsense_Mutation	SNP	superfamily_NAD(P)-linked oxidoreductase,HMMPfam_Aldo_ket_red	p.W160*	ENST00000490337.1	37	c.479	CCDS3174.1	3	.	.	.	.	.	.	.	.	.	.	G	38	6.652274	0.97734	.	.	ENSG00000169282	ENST00000472028;ENST00000490337;ENST00000389636;ENST00000471742;ENST00000475456;ENST00000302490;ENST00000389634	.	.	.	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.4136	14.3062	0.66386	0.0:0.0:1.0:0.0	.	.	.	.	X	78;160;160;149;103;142;142	.	ENSP00000305858:W142X	W	+	2	0	KCNAB1	157660351	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.645000	0.83430	2.501000	0.84356	0.467000	0.42956	TGG	-	superfamily_NAD(P)-linked oxidoreductase,HMMPfam_Aldo_ket_red		0.388	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	KCNAB1	protein_coding	OTTHUMT00000351411.1	G	NM_003471		157660351	+1	no_errors	NM_172160	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
IL12A-AS1	101928376	genome.wustl.edu	37	3	159818885	159818885	+	RNA	SNP	G	G	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr3:159818885G>A	ENST00000497452.1	-	0	517									IL12A antisense RNA 1																		agaaaacggagaagagttaag	0.468																																																0			3																																								161301579			647076			AK097161		3q25.33	2013-09-02			ENSG00000244040	ENSG00000244040		"""Long non-coding RNAs"""	49094	non-coding RNA	RNA, long non-coding							Standard	NR_108088		Approved				OTTHUMG00000158951		3.37:g.159818885G>A		Somatic		Capture	Illumina GAIIx	4	161301579		RNA	SNP	-	NULL	ENST00000497452.1	37	NULL		3																																																																																			-	-		0.468	IL12A-AS1-001	KNOWN	basic	antisense	BRD7P2	antisense	OTTHUMT00000352647.1	G			161301579	+1	pseudogene	XR_017374	genbank	human	model	54_36p	rna	SNP	0.024	A
Unknown	0	genome.wustl.edu	37	2	162437214	162437214	+	IGR	SNP	A	A	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr2:162437214A>T								snoU13 (22058 upstream) : SLC4A10 (43630 downstream)																							ATTGCTCTTCATGAAGAACCA	0.493																																																0			2																																								162145460	SO:0001628	intergenic_variant	391458																															2.37:g.162437214A>T		Somatic		Capture	Illumina GAIIx	4	162145460		Missense_Mutation	SNP	HMMPfam_Filament	p.M115L		37	c.343		2																																																																																			-	HMMPfam_Filament	0	0.493					KRT18P46			A			162145460	+1	pseudogene	XM_001720115	genbank	human	model	54_36p	missense	SNP	0.993	T
PRRC2C	23215	genome.wustl.edu	37	1	171504669	171504669	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr1:171504669C>T	ENST00000338920.4	+	13	2207	c.1970C>T	c.(1969-1971)cCg>cTg	p.P657L	PRRC2C_ENST00000392078.3_Missense_Mutation_p.P659L|PRRC2C_ENST00000426496.2_Missense_Mutation_p.P657L|PRRC2C_ENST00000367742.3_Missense_Mutation_p.P659L	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	657					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										CAACCTCGGCCGGCTGTATTA	0.448																																																0			1											120.0	130.0	127.0					1																	171504669		2203	4300	6503	169771293	SO:0001583	missense	23215			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.1970C>T	1.37:g.171504669C>T	ENSP00000343629:p.Pro657Leu	Somatic		Capture	Illumina GAIIx	4	169771293	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	HMMPfam_BAT2_N	p.P657L	ENST00000338920.4	37	c.1970	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.498042	0.44455	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.07567	3.18;3.18;3.18;3.18	5.29	4.39	0.52855	.	0.145393	0.31784	N	0.007079	T	0.05273	0.0140	M	0.68593	2.085	0.80722	D	1	B	0.31640	0.333	B	0.22880	0.042	T	0.06320	-1.0833	10	0.87932	D	0	.	14.2013	0.65707	0.0:0.9278:0.0:0.0722	.	657	Q9Y520-4	.	L	659;658;657;659;657;414;416	ENSP00000375928:P659L;ENSP00000410219:P657L;ENSP00000356716:P659L;ENSP00000343629:P657L	ENSP00000343629:P657L	P	+	2	0	PRRC2C	169771293	1.000000	0.71417	0.993000	0.49108	0.879000	0.50718	5.094000	0.64523	1.233000	0.43693	-0.123000	0.14984	CCG	-	NULL		0.448	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	BAT2D1	protein_coding	OTTHUMT00000314826.4	C	NM_015172		169771293	+1	no_errors	ENST00000392080	ensembl	human	known	54_36p	missense	SNP	1.000	T
NPHS2	7827	genome.wustl.edu	37	1	179528829	179528829	+	Silent	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr1:179528829C>T	ENST00000367615.4	-	4	587	c.519G>A	c.(517-519)gaG>gaA	p.E173E	NPHS2_ENST00000367616.4_Silent_p.E173E	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	173					actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						GAAAAGGTATCTCCAGAGTTT	0.393																																																0			1											58.0	50.0	53.0					1																	179528829		2203	4299	6502	177795452	SO:0001819	synonymous_variant	7827			AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.519G>A	1.37:g.179528829C>T		Somatic		Capture	Illumina GAIIx	4	177795452	B1AM32|B1AM33|Q8N6Q5	Silent	SNP	HMMSmart_SM00244,HMMPfam_Band_7,PatternScan_BAND_7	p.E173	ENST00000367615.4	37	c.519	CCDS1331.1	1																																																																																			-	HMMSmart_SM00244,HMMPfam_Band_7		0.393	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS2	protein_coding	OTTHUMT00000085283.1	C			177795452	-1	no_errors	NM_014625	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
CCDC141	285025	genome.wustl.edu	37	2	179702170	179702170	+	Missense_Mutation	SNP	C	C	A	rs551700764		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr2:179702170C>A	ENST00000420890.2	-	23	3893	c.3776G>T	c.(3775-3777)gGg>gTg	p.G1259V	CCDC141_ENST00000295723.5_Missense_Mutation_p.G684V|CCDC141_ENST00000480419.1_5'UTR	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1259										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			CTGGGCATCCCCTGGGCTGCT	0.532																																																0			2											63.0	65.0	64.0					2																	179702170		2203	4300	6503	179410415	SO:0001583	missense	285025			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3776G>T	2.37:g.179702170C>A	ENSP00000395995:p.Gly1259Val	Somatic		Capture	Illumina GAIIx	4	179410415	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	HMMPfam_I-set	p.G684V	ENST00000420890.2	37	c.2051		2	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369415	0.42003	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.47177	0.85;1.42;1.42	5.71	3.85	0.44370	.	0.771428	0.11797	N	0.528597	T	0.53334	0.1790	L	0.50333	1.59	0.30202	N	0.798552	D;D	0.57571	0.98;0.98	P;P	0.53649	0.731;0.663	T	0.52682	-0.8543	10	0.87932	D	0	-2.1218	9.007	0.36117	0.0:0.6999:0.0:0.3001	.	684;684	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	V	1259;703;684	ENSP00000395995:G1259V;ENSP00000344627:G703V;ENSP00000295723:G684V	ENSP00000295723:G684V	G	-	2	0	CCDC141	179410415	0.220000	0.23631	0.168000	0.22838	0.670000	0.39368	0.064000	0.14437	0.691000	0.31592	-0.355000	0.07637	GGG	-	NULL		0.532	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	CCDC141	protein_coding		C	NM_173648		179410415	-1	no_errors	NM_173648	genbank	human	provisional	54_36p	missense	SNP	0.059	A
RGS1	5996	genome.wustl.edu	37	1	192545962	192545962	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr1:192545962C>A	ENST00000367459.3	+	3	343	c.277C>A	c.(277-279)Caa>Aaa	p.Q93K	RGS1_ENST00000469578.2_Missense_Mutation_p.Q93K	NM_002922.3	NP_002913.3	Q08116	RGS1_HUMAN	regulator of G-protein signaling 1	93	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|immune response (GO:0006955)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			kidney(8)|large_intestine(1)|lung(13)	22		Breast(1374;0.188)				TCTTGCCAACCAAAGTAAGTA	0.338																																																0			1											121.0	122.0	121.0					1																	192545962		2203	4300	6503	190812585	SO:0001583	missense	5996			AF493925	CCDS1375.2	1q31	2008-02-05	2007-08-14		ENSG00000090104	ENSG00000090104		"""Regulators of G-protein signaling"""	9991	protein-coding gene	gene with protein product		600323	"""regulator of G-protein signalling 1"""	IER1		8241276, 8602223	Standard	NM_002922		Approved	1R20, IR20, BL34	uc001gsi.1	Q08116	OTTHUMG00000035598	ENST00000367459.3:c.277C>A	1.37:g.192545962C>A	ENSP00000356429:p.Gln93Lys	Somatic		Capture	Illumina GAIIx	4	190812585	B2RDM9|B4DZY0|Q07918|Q9H1W2	Missense_Mutation	SNP	superfamily_Regulator of G-protein signaling RGS,HMMPfam_RGS,HMMSmart_SM00315	p.Q93K	ENST00000367459.3	37	c.277	CCDS1375.2	1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141173	0.37825	.	.	ENSG00000090104	ENST00000367459	T	0.27557	1.66	5.91	3.9	0.45041	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.330083	0.30134	N	0.010322	T	0.08626	0.0214	N	0.00985	-1.075	0.38736	D	0.953781	B;B	0.17268	0.021;0.007	B;B	0.12837	0.008;0.002	T	0.24119	-1.0169	10	0.02654	T	1	.	10.2189	0.43186	0.1404:0.5952:0.2643:0.0	.	93;93	Q08116-2;Q08116	.;RGS1_HUMAN	K	93	ENSP00000356429:Q93K	ENSP00000356429:Q93K	Q	+	1	0	RGS1	190812585	0.927000	0.31430	0.997000	0.53966	0.975000	0.68041	1.620000	0.36976	1.466000	0.48025	0.650000	0.86243	CAA	-	superfamily_Regulator of G-protein signaling RGS,HMMPfam_RGS,HMMSmart_SM00315		0.338	RGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS1	protein_coding	OTTHUMT00000086391.1	C	NM_002922		190812585	+1	no_errors	NM_002922	genbank	human	reviewed	54_36p	missense	SNP	0.883	A
GPR1	2825	genome.wustl.edu	37	2	207041527	207041527	+	Nonsense_Mutation	SNP	G	G	A	rs150274953	byFrequency	TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr2:207041527G>A	ENST00000407325.2	-	3	807	c.445C>T	c.(445-447)Cga>Tga	p.R149*	GPR1_ENST00000437420.1_Nonsense_Mutation_p.R149*	NM_001098199.1|NM_001261452.1|NM_001261453.1|NM_001261454.1|NM_001261455.1|NM_005279.3	NP_001091669.1|NP_001248381.1|NP_001248382.1|NP_001248383.1|NP_001248384.1|NP_005270.2	P46091	GPR1_HUMAN	G protein-coupled receptor 1	149					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	18		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		TTGAGGGTTCGATGCCGATGA	0.468													G|||	9	0.00179712	0.0068	0.0	5008	,	,		21618	0.0		0.0	False		,,,				2504	0.0															0			2						G	stop/ARG,stop/ARG	14,4392	20.2+/-43.8	0,14,2189	106.0	103.0	104.0		445,445	5.0	0.8	2	dbSNP_134	104	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained,stop-gained	GPR1	NM_001098199.1,NM_005279.3	,	0,15,6488	AA,AG,GG		0.0116,0.3177,0.1153	,	149/356,149/356	207041527	15,12991	2203	4300	6503	206749772	SO:0001587	stop_gained	2825				CCDS2368.1	2q33.3	2014-01-30			ENSG00000183671	ENSG00000183671		"""GPCR / Class A : Orphans"""	4463	protein-coding gene	gene with protein product		600239				7851889	Standard	NM_005279		Approved		uc031rqv.1	P46091	OTTHUMG00000132894	ENST00000407325.2:c.445C>T	2.37:g.207041527G>A	ENSP00000384345:p.Arg149*	Somatic		Capture	Illumina GAIIx	4	206749772	A5JUU6|A8K4L1|Q53TR9|Q6NVX4	Nonsense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.R149*	ENST00000407325.2	37	c.445	CCDS2368.1	2	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	31	5.081881	0.94050	0.003177	1.16E-4	ENSG00000183671	ENST00000407325;ENST00000437420;ENST00000442134;ENST00000451790	.	.	.	5.84	4.96	0.65561	.	0.069594	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2267	0.65863	0.0:0.0:0.6169:0.3831	.	.	.	.	X	149	.	ENSP00000384345:R149X	R	-	1	2	GPR1	206749772	1.000000	0.71417	0.762000	0.31397	0.748000	0.42578	5.450000	0.66626	1.469000	0.48083	0.650000	0.86243	CGA	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.468	GPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR1	protein_coding	OTTHUMT00000256394.2	G	NM_001098199		206749772	-1	no_errors	NM_001098199	genbank	human	validated	54_36p	nonsense	SNP	0.999	A
MARCH4	57574	genome.wustl.edu	37	2	217124133	217124133	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr2:217124133A>G	ENST00000273067.4	-	4	2901	c.1135T>C	c.(1135-1137)Tat>Cat	p.Y379H	AC012513.6_ENST00000417481.1_RNA	NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	379						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		AGGATGGTATAAGCACAGTGG	0.627																																																0			2											75.0	74.0	74.0					2																	217124133		2203	4300	6503	216832378	SO:0001583	missense	57574			AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.1135T>C	2.37:g.217124133A>G	ENSP00000273067:p.Tyr379His	Somatic		Capture	Illumina GAIIx	4	216832378	Q4KMN7|Q86WR8	Missense_Mutation	SNP	HMMSmart_RINGv,HMMPfam_zf-C3HC4	p.Y379H	ENST00000273067.4	37	c.1135	CCDS33376.1	2	.	.	.	.	.	.	.	.	.	.	A	23.1	4.375953	0.82682	.	.	ENSG00000144583	ENST00000273067	T	0.39406	1.08	5.47	5.47	0.80525	.	0.263822	0.39615	N	0.001316	T	0.64034	0.2562	M	0.70275	2.135	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.68078	-0.5504	10	0.87932	D	0	-23.6344	14.7419	0.69461	1.0:0.0:0.0:0.0	.	379	Q9P2E8	MARH4_HUMAN	H	379	ENSP00000273067:Y379H	ENSP00000273067:Y379H	Y	-	1	0	MARCH4	216832378	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.962000	0.93254	2.076000	0.62316	0.459000	0.35465	TAT	-	NULL		0.627	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH4	protein_coding	OTTHUMT00000337272.2	A	NM_020814		216832378	-1	no_errors	NM_020814	genbank	human	validated	54_36p	missense	SNP	1.000	G
OR2M4	26245	genome.wustl.edu	37	1	248402273	248402273	+	Silent	SNP	C	C	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr1:248402273C>T	ENST00000306687.1	+	1	43	c.43C>T	c.(43-45)Ctg>Ttg	p.L15L		NM_017504.1	NP_059974.1	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M, member 4	15					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(27)|skin(3)|upper_aerodigestive_tract(2)	50	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CTTCATCCTGCTGGGAATCTT	0.428																																																0			1											122.0	120.0	120.0					1																	248402273		2203	4300	6503	246468896	SO:0001819	synonymous_variant	26245			X64992	CCDS31108.1	1q44	2012-08-09			ENSG00000171180	ENSG00000171180		"""GPCR / Class A : Olfactory receptors"""	8270	protein-coding gene	gene with protein product						1370859, 9119360	Standard	NM_017504		Approved	HTPCRX18, TPCR100, HSHTPCRX18, OST710	uc010pzh.2	Q96R27	OTTHUMG00000040456	ENST00000306687.1:c.43C>T	1.37:g.248402273C>T		Somatic		Capture	Illumina GAIIx	4	246468896	Q15611|Q8NG82	Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L15	ENST00000306687.1	37	c.43	CCDS31108.1	1																																																																																			-	superfamily_SSF81321		0.428	OR2M4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M4	protein_coding	OTTHUMT00000097352.1	C	NM_017504		246468896	+1	no_errors	NM_017504	genbank	human	provisional	54_36p	silent	SNP	0.282	T
LYAR	55646	genome.wustl.edu	37	4	4270283	4270283	+	Frame_Shift_Del	DEL	T	T	-			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr4:4270283delT	ENST00000343470.4	-	9	1219	c.979delA	c.(979-981)atafs	p.I327fs	LYAR_ENST00000452476.1_Frame_Shift_Del_p.I327fs	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	327	Lys-rich.					nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TTGATGGTTATTTCATTGTCT	0.323																																																0			4											221.0	211.0	214.0					4																	4270283		2203	4300	6503	4321184	SO:0001589	frameshift_variant	55646			AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.979delA	4.37:g.4270283delT	ENSP00000345917:p.Ile327fs	Somatic		Capture	Illumina GAIIx	4	4321184	D3DVS4|Q6FI78|Q9NYS1	Frame_Shift_Del	DEL	HMMPfam_zf-LYAR	p.I327fs	ENST00000343470.4	37	c.979	CCDS3374.1	4																																																																																			(deletion:cds_exon[4321158,4321243])	NULL		0.323	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYAR	protein_coding	OTTHUMT00000246800.2	T	NM_017816		4321184	-1	no_errors	NM_017816	genbank	human	validated	54_36p	frame_shift_del	DEL	0.727	-
RALY	22913	genome.wustl.edu	37	20	32660032	32660033	+	Frame_Shift_Ins	INS	-	-	T			TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	-	-					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr20:32660032_32660033insT	ENST00000246194.3	+	3	654_655	c.152_153insT	c.(151-156)tgttctfs	p.S52fs	RALY_ENST00000375114.3_Frame_Shift_Ins_p.S52fs|RALY_ENST00000493399.1_Intron	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	52	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						GTGGCCGGCTGTTCTGTGCACA	0.559																																																0			20																																								32123694	SO:0001589	frameshift_variant	22913			AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.154dupT	20.37:g.32660034_32660034dupT	ENSP00000246194:p.Ser52fs	Somatic		Capture	Illumina GAIIx	4	32123693	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Frame_Shift_Ins	INS	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1	p.S52fs	ENST00000246194.3	37	c.152_153	CCDS13230.1	20																																																																																			-	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1		0.559	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALY	protein_coding	OTTHUMT00000078753.1	-			32123694	+1	no_errors	NM_016732	genbank	human	reviewed	54_36p	frame_shift_ins	INS	1.000:1.000	T
RPAP2	79871	genome.wustl.edu	37	1	92846389	92846394	+	In_Frame_Del	DEL	AAGTCT	AAGTCT	-	rs369665737		TCGA-61-1899-01A-01W-0639-09	TCGA-61-1899-11A-01W-0639-09	AAGTCT	AAGTCT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	df06fa82-6da5-499e-9cbb-d2e7a1811510	a2420405-8104-4c72-a446-0f5f7849d4a2	g.chr1:92846389_92846394delAAGTCT	ENST00000610020.1	+	12	1906_1911	c.1797_1802delAAGTCT	c.(1795-1803)gaaagtcta>gaa	p.SL600del		NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	600					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		AAGACCTTGAAAGTCTAACCATCATA	0.35																																																0			1																																								92618982	SO:0001651	inframe_deletion	79871			AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.1797_1802delAAGTCT	1.37:g.92846389_92846394delAAGTCT	ENSP00000476948:p.Ser600_Leu601del	Somatic		Capture	Illumina GAIIx	4	92618977	C9JKB5|Q49AS7|Q9H8Y2	In_Frame_Del	DEL	HMMPfam_RPAP2_Rtr1	p.SL600in_frame_del	ENST00000610020.1	37	c.1797_1802	CCDS740.1	1																																																																																			(deletion:cds_exon[92618869,92619018])	NULL		0.350	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP2	protein_coding	OTTHUMT00000028368.2	AAGTCT	NM_024813		92618982	+1	no_errors	NM_024813	genbank	human	provisional	54_36p	in_frame_del	DEL	1.000:1.000:0.998:0.994:0.998:0.998	-
