#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								8744	SO:0001628	intergenic_variant	4508																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	8744		Missense_Mutation	SNP	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A,PatternScan_ATPASE_A	p.V73M		37	c.217		MT																																																																																			-	HMMPfam_ATP-synt_A,superfamily_ATPase_F0_A	0	0					MT-ATP6			G			8744	+1	no_errors	ENST00000361899	ensembl	human	known	54_36p	missense	SNP	NULL	A
ZDHHC11B	653082	genome.wustl.edu	37	5	733902	733902	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr5:733902T>G	ENST00000382776.4	-	8	987	c.988A>C	c.(988-990)Act>Cct	p.T330P	ZDHHC11B_ENST00000522356.1_5'Flank|ZDHHC11_ENST00000424784.2_Intron|ZDHHC11B_ENST00000508859.2_Missense_Mutation_p.T341P			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	330						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						TTTACTGAAGTGCAGAAGTGA	0.542																																																0			5																																								786902	SO:0001583	missense	653082					5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.988A>C	5.37:g.733902T>G	ENSP00000445280:p.Thr330Pro	Somatic		Capture	Illumina GAIIx	4	786902	A6NHR3	Missense_Mutation	SNP	HMMPfam_zf-DHHC	p.T330P	ENST00000382776.4	37	c.988		5	.	.	.	.	.	.	.	.	.	.	t	9.948	1.219486	0.22373	.	.	ENSG00000206077	ENST00000508859;ENST00000382776	T;T	0.32753	1.44;1.46	0.587	-1.06	0.10002	.	.	.	.	.	T	0.21509	0.0518	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28586	-1.0039	5	0.33141	T	0.24	.	.	.	.	.	.	.	.	P	341;330	ENSP00000442373:T341P;ENSP00000445280:T330P	ENSP00000445280:T330P	T	-	1	0	ZDHHC11B	786902	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.260000	0.08708	-0.403000	0.07622	0.241000	0.17934	ACT	-	NULL		0.542	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	protein_coding		T	XM_926053		786902	-1	no_errors	XM_926053	genbank	human	model	54_36p	missense	SNP	0.000	G
NUP98	4928	genome.wustl.edu	37	11	3704657	3704657	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr11:3704657G>T	ENST00000324932.7	-	30	5111	c.4691C>A	c.(4690-4692)gCt>gAt	p.A1564D	NUP98_ENST00000355260.3_Missense_Mutation_p.A1490D|NUP98_ENST00000359171.4_Missense_Mutation_p.A1490D	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1581					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		CTCTCGAACAGCCTTCTCACG	0.537			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	0			11											73.0	72.0	72.0					11																	3704657		2201	4298	6499	3661233	SO:0001583	missense	4928			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4691C>A	11.37:g.3704657G>T	ENSP00000316032:p.Ala1564Asp	Somatic		Capture	Illumina GAIIx	4	3661233	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	superfamily_SSF88633,HMMPfam_Nucleoporin2,superfamily_Peptidase_S59	p.A1564D	ENST00000324932.7	37	c.4691	CCDS7746.1	11	.	.	.	.	.	.	.	.	.	.	G	27.7	4.859246	0.91433	.	.	ENSG00000110713	ENST00000324932;ENST00000359171;ENST00000355260	.	.	.	5.87	5.87	0.94306	.	0.057960	0.64402	D	0.000002	D	0.82884	0.5134	M	0.78285	2.405	0.43007	D	0.99453	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.91635	0.999;0.998;0.925	T	0.82398	-0.0477	9	0.48119	T	0.1	-11.6672	19.2648	0.93982	0.0:0.0:1.0:0.0	.	1490;1564;1478	P52948-2;P52948-5;P52948-6	.;.;.	D	1564;1490;1490	.	ENSP00000316032:A1564D	A	-	2	0	NUP98	3661233	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	9.530000	0.98051	2.808000	0.96608	0.650000	0.86243	GCT	-	NULL		0.537	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP98	protein_coding	OTTHUMT00000032766.3	G	NM_016320		3661233	-1	no_errors	NM_016320	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
FARS2	10667	genome.wustl.edu	37	6	5771610	5771610	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr6:5771610A>T	ENST00000324331.6	+	7	1640	c.1304A>T	c.(1303-1305)cAg>cTg	p.Q435L	FARS2_ENST00000274680.4_Missense_Mutation_p.Q435L			O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2, mitochondrial	435	FDX-ACB. {ECO:0000255|PROSITE- ProRule:PRU00778}.				gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)|stomach(2)	15	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	CACATCCACCAGGCCTTGCAG	0.597																																																0			6											159.0	127.0	138.0					6																	5771610		2203	4300	6503	5716609	SO:0001583	missense	10667			AF097441	CCDS4494.1	6p25.1	2011-07-01	2007-02-23	2004-12-03	ENSG00000145982	ENSG00000145982	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	21062	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 2, mitochondrial"""	611592	"""phenylalanine-tRNA synthetase 1 (mitochondrial)"""	FARS1		10329163	Standard	NM_006567		Approved	dJ236A3.1	uc003mwr.2	O95363	OTTHUMG00000014178	ENST00000324331.6:c.1304A>T	6.37:g.5771610A>T	ENSP00000316335:p.Gln435Leu	Somatic		Capture	Illumina GAIIx	4	5716609	B2R664|Q53F66|Q5TCS3|Q6FG29|Q9NPY7|Q9P062	Missense_Mutation	SNP	superfamily_SSF55681,HMMPfam_tRNA-synt_2d,superfamily_Fdx_AntiC_bd,HMMPfam_FDX-ACB	p.Q435L	ENST00000324331.6	37	c.1304	CCDS4494.1	6	.	.	.	.	.	.	.	.	.	.	A	14.30	2.494191	0.44352	.	.	ENSG00000145982	ENST00000274680;ENST00000324331	T;T	0.77877	-1.13;-1.13	5.81	5.81	0.92471	Phenylalanyl-tRNA synthetase, beta subunit, ferrodoxin-fold anticodon-binding (5);	0.411796	0.22913	N	0.054104	T	0.51550	0.1681	N	0.19112	0.55	0.40671	D	0.982211	B	0.25743	0.133	B	0.19148	0.024	T	0.54423	-0.8296	10	0.37606	T	0.19	-33.9882	14.9939	0.71415	1.0:0.0:0.0:0.0	.	435	O95363	SYFM_HUMAN	L	435	ENSP00000274680:Q435L;ENSP00000316335:Q435L	ENSP00000274680:Q435L	Q	+	2	0	FARS2	5716609	0.999000	0.42202	1.000000	0.80357	0.919000	0.55068	1.002000	0.29796	2.217000	0.71921	0.533000	0.62120	CAG	-	superfamily_Fdx_AntiC_bd,HMMPfam_FDX-ACB		0.597	FARS2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FARS2	protein_coding	OTTHUMT00000467790.1	A	NM_006567		5716609	+1	no_errors	NM_006567	genbank	human	reviewed	54_36p	missense	SNP	0.992	T
TP53	7157	genome.wustl.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000413465.2_Missense_Mutation_p.G245S|TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	17	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	7518273	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	17.37:g.7577548C>T	ENSP00000269305:p.Gly245Ser	Somatic		Capture	Illumina GAIIx	4	7518273	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	HMMPfam_P53_TAD,HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53,HMMPfam_P53_tetramer,superfamily_p53 tetramerization domain	p.G245S	ENST00000269305.4	37	c.733	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	-	HMMPfam_P53,superfamily_p53-like transcription factors,PatternScan_P53		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7518273	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.996	T
GDF3	9573	genome.wustl.edu	37	12	7842853	7842853	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr12:7842853T>C	ENST00000329913.3	-	2	763	c.716A>G	c.(715-717)aAc>aGc	p.N239S		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	239					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						CTGATCAGGGTTGAGAGTCAC	0.512																																																0			12											103.0	94.0	97.0					12																	7842853		2203	4300	6503	7734120	SO:0001583	missense	9573			AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.716A>G	12.37:g.7842853T>C	ENSP00000331745:p.Asn239Ser	Somatic		Capture	Illumina GAIIx	4	7734120	Q8NEJ4	Missense_Mutation	SNP	superfamily_SSF57501,HMMPfam_TGF_beta,HMMSmart_TGFB,PatternScan_TGF_BETA_1	p.N239S	ENST00000329913.3	37	c.716	CCDS8581.1	12	.	.	.	.	.	.	.	.	.	.	T	8.120	0.780634	0.16120	.	.	ENSG00000184344	ENST00000329913	T	0.80653	-1.4	4.61	3.38	0.38709	.	0.813996	0.11942	N	0.514570	T	0.69424	0.3109	L	0.43554	1.36	0.34659	D	0.722436	B	0.28378	0.209	B	0.20577	0.03	T	0.66913	-0.5803	10	0.13470	T	0.59	.	9.3286	0.38008	0.1603:0.0:0.0:0.8397	.	239	Q9NR23	GDF3_HUMAN	S	239	ENSP00000331745:N239S	ENSP00000331745:N239S	N	-	2	0	GDF3	7734120	0.998000	0.40836	0.608000	0.28969	0.035000	0.12851	1.296000	0.33389	1.854000	0.53819	0.459000	0.35465	AAC	-	NULL		0.512	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF3	protein_coding	OTTHUMT00000399717.1	T			7734120	-1	no_errors	NM_020634	genbank	human	reviewed	54_36p	missense	SNP	0.975	C
LOC283299	283299	genome.wustl.edu	37	11	7870634	7870634	+	RNA	SNP	C	C	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr11:7870634C>T	ENST00000527847.1	-	0	5006				RP11-35J10.5_ENST00000527565.1_lincRNA	NR_036678.1																						CTGCAACCCCCTGATTTACAC	0.512																																																0			11																																								7827210			0																															11.37:g.7870634C>T		Somatic		Capture	Illumina GAIIx	4	7827210		Silent	SNP	HMMPfam_7tm_1,superfamily_SSF81321	p.L13	ENST00000527847.1	37	c.37		11																																																																																			-	HMMPfam_7tm_1,superfamily_SSF81321		0.512	RP11-494M8.4-001	KNOWN	basic	sense_overlapping	OR5E1P	sense_overlapping	OTTHUMT00000385693.1	C			7827210	+1	no_errors	ENST00000305754	ensembl	human	known	54_36p	silent	SNP	0.980	T
OR7G2	390882	genome.wustl.edu	37	19	9213963	9213963	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr19:9213963A>C	ENST00000305456.2	-	1	19	c.20T>G	c.(19-21)cTt>cGt	p.L7R		NM_001005193.1	NP_001005193.1	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G, member 2	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|skin(3)	16						AAAATCTGTAAGCAGcagctg	0.443																																					Esophageal Squamous(67;143 1448 28637 40648)											0			19											48.0	48.0	48.0					19																	9213963		2203	4300	6503	9074963	SO:0001583	missense	390882				CCDS32897.1	19p13.2	2013-09-24			ENSG00000170923	ENSG00000170923		"""GPCR / Class A : Olfactory receptors"""	8466	protein-coding gene	gene with protein product							Standard	NM_001005193		Approved	OST260	uc010xkk.2	Q8NG99	OTTHUMG00000179931	ENST00000305456.2:c.20T>G	19.37:g.9213963A>C	ENSP00000303822:p.Leu7Arg	Somatic		Capture	Illumina GAIIx	4	9074963	Q6IFJ4|Q96RA0	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L7R	ENST00000305456.2	37	c.20	CCDS32897.1	19	.	.	.	.	.	.	.	.	.	.	a	10.32	1.318252	0.23994	.	.	ENSG00000170923	ENST00000305456	T	0.11385	2.78	2.17	-4.3	0.03710	.	.	.	.	.	T	0.09686	0.0238	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34601	-0.9822	6	0.66056	D	0.02	.	4.2526	0.10702	0.3456:0.1906:0.4638:0.0	.	.	.	.	R	7	ENSP00000303822:L7R	ENSP00000303822:L7R	L	-	2	0	OR7G2	9074963	0.006000	0.16342	0.000000	0.03702	0.011000	0.07611	1.440000	0.35024	-1.004000	0.03421	0.397000	0.26171	CTT	-	NULL		0.443	OR7G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G2	protein_coding	OTTHUMT00000448994.1	A			9074963	-1	no_errors	NM_001005193	genbank	human	provisional	54_36p	missense	SNP	0.000	C
ZNF559	84527	genome.wustl.edu	37	19	9451831	9451831	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr19:9451831C>G	ENST00000393883.2	+	5	862	c.214C>G	c.(214-216)Cag>Gag	p.Q72E	ZNF559_ENST00000587557.1_Missense_Mutation_p.Q136E|ZNF177_ENST00000602856.1_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000592896.1_Missense_Mutation_p.Q100E|ZNF559_ENST00000586255.1_Missense_Mutation_p.Q100E|ZNF559_ENST00000317221.7_Missense_Mutation_p.Q72E|ZNF559_ENST00000538743.1_5'UTR|ZNF177_ENST00000446085.4_Intron|ZNF559_ENST00000603380.1_Missense_Mutation_p.Q72E|ZNF559_ENST00000592504.1_Missense_Mutation_p.Q72E|ZNF177_ENST00000541595.2_Intron|ZNF177_ENST00000605471.1_Intron|ZNF559_ENST00000585352.1_Missense_Mutation_p.Q72E	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	72	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						GAATTTTTTGCAGGGGAAAAC	0.323																																																0			19											94.0	107.0	102.0					19																	9451831		2203	4300	6503	9312831	SO:0001583	missense	84527			AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.214C>G	19.37:g.9451831C>G	ENSP00000377461:p.Gln72Glu	Somatic		Capture	Illumina GAIIx	4	9312831	K7EMG6	Missense_Mutation	SNP	superfamily_Krueppel-associated_box,HMMPfam_KRAB,HMMSmart_KRAB,superfamily_SSF57667,HMMSmart_ZnF_C2H2,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.Q72E	ENST00000393883.2	37	c.214	CCDS12211.1	19	.	.	.	.	.	.	.	.	.	.	C	0.048	-1.260744	0.01445	.	.	ENSG00000188321	ENST00000317221;ENST00000393883	T;T	0.06142	4.96;3.34	2.19	-4.37	0.03633	Krueppel-associated box (2);	.	.	.	.	T	0.03477	0.0100	N	0.26042	0.785	0.09310	N	0.999999	B;B	0.21753	0.007;0.06	B;B	0.23150	0.006;0.044	T	0.41945	-0.9480	9	0.30854	T	0.27	.	1.3241	0.02122	0.246:0.3089:0.2978:0.1473	.	72;72	B3KPL8;Q9BR84	.;ZN559_HUMAN	E	72	ENSP00000325393:Q72E;ENSP00000377461:Q72E	ENSP00000325393:Q72E	Q	+	1	0	ZNF559	9312831	0.000000	0.05858	0.000000	0.03702	0.837000	0.47467	-2.791000	0.00767	-1.842000	0.01181	0.455000	0.32223	CAG	-	HMMSmart_KRAB		0.323	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF559	protein_coding	OTTHUMT00000449021.1	C	NM_032497		9312831	+1	no_errors	NM_032497	genbank	human	provisional	54_36p	missense	SNP	0.011	G
MGST1	4257	genome.wustl.edu	37	12	16553574	16553574	+	Intron	SNP	A	A	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr12:16553574A>T	ENST00000359720.3	+	1	778							P10620	MGST1_HUMAN	microsomal glutathione S-transferase 1						cellular response to lipid hydroperoxide (GO:0071449)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|Leydig cell differentiation (GO:0033327)|oxidation-reduction process (GO:0055114)|protein homotrimerization (GO:0070207)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	apical part of cell (GO:0045177)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	glutathione binding (GO:0043295)|glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)			endometrium(2)|large_intestine(2)|lung(4)|ovary(1)	9		Hepatocellular(102;0.121)			Glutathione(DB00143)	AATTTCTTTGACAAAAGTCGC	0.423																																																0			12																																								16444841	SO:0001627	intron_variant	400011			U46494	CCDS8677.1, CCDS58209.1	12p12.3-p12.1	2012-06-21			ENSG00000008394	ENSG00000008394	2.5.1.18	"""Glutathione S-transferases / Microsomal"""	7061	protein-coding gene	gene with protein product		138330		GST12			Standard	NM_145792		Approved	MGST-I	uc031qgl.1	P10620	OTTHUMG00000168816	ENST00000359720.3:c.778+17036A>T	12.37:g.16553574A>T		Somatic		Capture	Illumina GAIIx	4	16444841	A8K533|G5EA53	RNA	SNP	-	NULL	ENST00000359720.3	37	NULL		12																																																																																			-	-		0.423	MGST1-016	KNOWN	basic	processed_transcript	LOC400011	protein_coding	OTTHUMT00000401275.1	A	NM_145791		16444841	-1	pseudogene	XR_016968	genbank	human	model	54_36p	rna	SNP	1.000	T
BZW2	28969	genome.wustl.edu	37	7	16737809	16737809	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr7:16737809A>T	ENST00000433922.2	+	10	1284	c.1106A>T	c.(1105-1107)aAa>aTa	p.K369I	AC073333.8_ENST00000418907.1_RNA|BZW2_ENST00000407633.1_Missense_Mutation_p.K175I|BZW2_ENST00000405202.1_Missense_Mutation_p.K293I|BZW2_ENST00000258761.3_Missense_Mutation_p.K369I	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	369	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		CTCTTTTATAAAGGTATCCAT	0.488																																																0			7											147.0	146.0	147.0					7																	16737809		2203	4300	6503	16704334	SO:0001583	missense	28969			AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.1106A>T	7.37:g.16737809A>T	ENSP00000397249:p.Lys369Ile	Somatic		Capture	Illumina GAIIx	4	16704334	A4D123|Q3B779|Q96JW5|Q9H3F7	Missense_Mutation	SNP	superfamily_ARM repeat,HMMSmart_SM00515,HMMPfam_W2	p.K369I	ENST00000433922.2	37	c.1106	CCDS5362.1	7	.	.	.	.	.	.	.	.	.	.	A	26.3	4.724863	0.89298	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000405202;ENST00000407633	T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45	6.17	6.17	0.99709	eIF4-gamma/eIF5/eIF2-epsilon (3);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	D	0.91981	0.7460	M	0.91768	3.24	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	D	0.93351	0.6718	10	0.72032	D	0.01	0.0048	16.8222	0.85835	1.0:0.0:0.0:0.0	.	369;369	E7ETZ4;Q9Y6E2	.;BZW2_HUMAN	I	369;369;369;293;175	ENSP00000403481:K369I;ENSP00000258761:K369I;ENSP00000397249:K369I;ENSP00000385577:K293I;ENSP00000384617:K175I	ENSP00000258761:K369I	K	+	2	0	BZW2	16704334	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	AAA	-	superfamily_ARM repeat,HMMSmart_SM00515,HMMPfam_W2		0.488	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BZW2	protein_coding	OTTHUMT00000253256.2	A	NM_014038		16704334	+1	no_errors	NM_014038	genbank	human	provisional	54_36p	missense	SNP	1.000	T
TMC5	79838	genome.wustl.edu	37	16	19509283	19509283	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr16:19509283G>T	ENST00000396229.2	+	22	3765	c.3016G>T	c.(3016-3018)Gcc>Tcc	p.A1006S	TMC5_ENST00000219821.5_Missense_Mutation_p.A760S|TMC5_ENST00000542583.2_Missense_Mutation_p.A1006S|TMC5_ENST00000564959.1_Missense_Mutation_p.A689S|TMC5_ENST00000381414.4_Missense_Mutation_p.A948S|TMC5_ENST00000541464.1_Missense_Mutation_p.A954S|TMC5_ENST00000561503.1_Missense_Mutation_p.A647S|RNU4-46P_ENST00000410818.1_RNA	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	1006					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TAATCCAAGGGCCTGATGACT	0.463																																																0			16											220.0	198.0	206.0					16																	19509283		2197	4300	6497	19416784	SO:0001583	missense	79838			AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.3016G>T	16.37:g.19509283G>T	ENSP00000379531:p.Ala1006Ser	Somatic		Capture	Illumina GAIIx	4	19416784	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	HMMPfam_TMC	p.A1006S	ENST00000396229.2	37	c.3016	CCDS45431.1	16	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415538	0.25552	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821	T;T;T;T;T	0.70164	-0.23;-0.16;-0.32;-0.32;-0.46	4.44	0.108	0.14548	.	48.651600	0.00166	N	0.000000	T	0.53786	0.1818	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.25441	0.126;0.015;0.045;0.126	B;B;B;B	0.21546	0.035;0.013;0.013;0.035	T	0.33523	-0.9865	10	0.46703	T	0.11	1.5638	1.5077	0.02489	0.1896:0.1668:0.4717:0.1719	.	954;760;1006;948	F5GYU8;Q6UXY8-3;Q6UXY8;Q6UXY8-2	.;.;TMC5_HUMAN;.	S	954;948;1006;1006;760	ENSP00000441227:A954S;ENSP00000370822:A948S;ENSP00000379531:A1006S;ENSP00000446274:A1006S;ENSP00000219821:A760S	ENSP00000219821:A760S	A	+	1	0	TMC5	19416784	0.001000	0.12720	0.000000	0.03702	0.063000	0.16089	0.305000	0.19254	0.071000	0.16664	-0.140000	0.14226	GCC	-	NULL		0.463	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC5	protein_coding	OTTHUMT00000435888.1	G	NM_024780		19416784	+1	no_errors	NM_001105248	genbank	human	validated	54_36p	missense	SNP	0.000	T
GPRC5B	51704	genome.wustl.edu	37	16	19883571	19883571	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr16:19883571G>T	ENST00000300571.2	-	2	788	c.597C>A	c.(595-597)gaC>gaA	p.D199E	GPRC5B_ENST00000569847.1_Missense_Mutation_p.D199E|GPRC5B_ENST00000535671.1_Missense_Mutation_p.D199E|GPRC5B_ENST00000537135.1_Missense_Mutation_p.D225E|GPRC5B_ENST00000569479.1_Missense_Mutation_p.D199E	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	199					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						CCATCACAAAGTCCATGGGCT	0.597																																																0			16											119.0	98.0	105.0					16																	19883571		2197	4300	6497	19791072	SO:0001583	missense	51704			AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.597C>A	16.37:g.19883571G>T	ENSP00000300571:p.Asp199Glu	Somatic		Capture	Illumina GAIIx	4	19791072	D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F3_1,PatternScan_G_PROTEIN_RECEP_F3_2,PatternScan_G_PROTEIN_RECEP_F3_3,HMMPfam_7tm_3	p.D199E	ENST00000300571.2	37	c.597	CCDS10581.1	16	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870847	0.72065	.	.	ENSG00000167191	ENST00000300571;ENST00000535671;ENST00000537135	D;D;D	0.88046	-2.33;-2.33;-2.33	5.27	1.23	0.21249	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.90724	0.7089	M	0.76574	2.34	0.51012	D	0.999909	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.994	D	0.87807	0.2629	9	.	.	.	.	6.6154	0.22774	0.593:0.0:0.407:0.0	.	225;199	B7Z831;Q9NZH0	.;GPC5B_HUMAN	E	199;199;225	ENSP00000300571:D199E;ENSP00000442858:D199E;ENSP00000441775:D225E	.	D	-	3	2	GPRC5B	19791072	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	2.981000	0.49329	0.422000	0.26005	0.650000	0.86243	GAC	-	HMMPfam_7tm_3		0.597	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5B	protein_coding	OTTHUMT00000254285.1	G			19791072	-1	no_errors	NM_016235	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
LRRC37A6P	387646	genome.wustl.edu	37	10	27536455	27536455	+	lincRNA	SNP	C	C	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr10:27536455C>T	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							TGGTGTTTCCCACTAACTTGT	0.542																																																0			10																																								27576461			387646																															10.37:g.27536455C>T		Somatic		Capture	Illumina GAIIx	4	27576461		RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			-	-		0.542	RP11-85G18.6-001	KNOWN	basic	lincRNA	LOC387646	lincRNA	OTTHUMT00000436904.1	C			27576461	-1	pseudogene	NR_003525	genbank	human	provisional	54_36p	rna	SNP	0.042	T
EOMES	8320	genome.wustl.edu	37	3	27759225	27759225	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr3:27759225G>T	ENST00000295743.4	-	6	1600	c.1397C>A	c.(1396-1398)cCt>cAt	p.P466H	EOMES_ENST00000537516.1_Missense_Mutation_p.P190H|EOMES_ENST00000461503.1_5'Flank|EOMES_ENST00000449599.1_Missense_Mutation_p.P485H			O95936	EOMES_HUMAN	eomesodermin	466					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						CCGACCTCCAGGGACAATCTG	0.478																																																0			3											55.0	59.0	58.0					3																	27759225		2203	4300	6503	27734229	SO:0001583	missense	8320			BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.1397C>A	3.37:g.27759225G>T	ENSP00000295743:p.Pro466His	Somatic		Capture	Illumina GAIIx	4	27734229	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Missense_Mutation	SNP	HMMSmart_TBOX,superfamily_P53_like_DNA_bnd,HMMPfam_T-box,PatternScan_TBOX_1,PatternScan_TBOX_2	p.P466H	ENST00000295743.4	37	c.1397	CCDS2646.1	3	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957747	0.73902	.	.	ENSG00000163508	ENST00000295743;ENST00000449599;ENST00000537516;ENST00000535713	D;D;D	0.90620	-2.16;-2.7;-2.23	5.1	5.1	0.69264	.	2.716050	0.02170	N	0.059586	D	0.96399	0.8825	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.984;1.0;0.999	D	0.87111	0.2185	10	0.59425	D	0.04	.	19.4135	0.94685	0.0:0.0:1.0:0.0	.	199;485;466	B7Z4I2;G3XAI5;O95936	.;.;EOMES_HUMAN	H	466;485;190;350	ENSP00000295743:P466H;ENSP00000388620:P485H;ENSP00000442097:P190H	ENSP00000295743:P466H	P	-	2	0	EOMES	27734229	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.420000	0.97426	2.769000	0.95229	0.655000	0.94253	CCT	-	NULL		0.478	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EOMES	protein_coding	OTTHUMT00000252995.1	G	NM_005442		27734229	-1	no_errors	NM_005442	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
THOC5	8563	genome.wustl.edu	37	22	29913092	29913092	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr22:29913092G>C	ENST00000490103.1	-	17	1729	c.1607C>G	c.(1606-1608)aCc>aGc	p.T536S	CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397871.1_Missense_Mutation_p.T536S|THOC5_ENST00000397872.1_Missense_Mutation_p.T536S|THOC5_ENST00000397873.2_Missense_Mutation_p.T536S	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	536					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AATGTCTTTGGTGAAGTGCAG	0.537																																																0			22											146.0	135.0	139.0					22																	29913092		2203	4300	6503	28243092	SO:0001583	missense	8563			AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.1607C>G	22.37:g.29913092G>C	ENSP00000420306:p.Thr536Ser	Somatic		Capture	Illumina GAIIx	4	28243092	O60839|Q9UPZ5	Missense_Mutation	SNP	HMMPfam_FimP	p.T536S	ENST00000490103.1	37	c.1607	CCDS13859.1	22	.	.	.	.	.	.	.	.	.	.	G	14.82	2.648498	0.47258	.	.	ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	5.66	5.66	0.87406	.	0.089387	0.85682	D	0.000000	T	0.24005	0.0581	M	0.62723	1.935	0.52099	D	0.999948	B	0.34015	0.435	B	0.27262	0.078	T	0.03335	-1.1047	10	0.22109	T	0.4	-35.4518	19.3554	0.94410	0.0:0.0:1.0:0.0	.	536	Q13769	THOC5_HUMAN	S	536	ENSP00000420306:T536S;ENSP00000380970:T536S;ENSP00000380969:T536S;ENSP00000380971:T536S	ENSP00000380969:T536S	T	-	2	0	THOC5	28243092	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.323000	0.79105	2.675000	0.91044	0.655000	0.94253	ACC	-	NULL		0.537	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC5	protein_coding	OTTHUMT00000322097.1	G	NM_003678		28243092	-1	no_errors	NM_001002877	genbank	human	validated	54_36p	missense	SNP	1.000	C
HERC2P10	390561	genome.wustl.edu	37	15	31108741	31108741	+	IGR	SNP	G	G	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr15:31108741G>A								AC004460.1 (15150 upstream) : FAN1 (87313 downstream)																							AGGGGAAAGGGGGATTACTTC	0.552																																																0			15																																								28896033	SO:0001628	intergenic_variant	390561																															15.37:g.31108741G>A		Somatic		Capture	Illumina GAIIx	4	28896033		Silent	SNP	NULL	p.G1076		37	c.3228		15																																																																																			-	NULL	0	0.552					LOC390561			G			28896033	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	XM_001726958	genbank	human	model	54_36p	silent	SNP	1.000	A
BRCA2	675	genome.wustl.edu	37	13	32914221	32914221	+	Missense_Mutation	SNP	A	A	G	rs276174863		TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr13:32914221A>G	ENST00000380152.3	+	11	5962	c.5729A>G	c.(5728-5730)aAt>aGt	p.N1910S	BRCA2_ENST00000544455.1_Missense_Mutation_p.N1910S			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1910					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TCTCTAGATAATGATGAATGT	0.338			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0			13											57.0	55.0	56.0					13																	32914221		2203	4300	6503	31812221	SO:0001583	missense	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.5729A>G	13.37:g.32914221A>G	ENSP00000369497:p.Asn1910Ser	Somatic		Capture	Illumina GAIIx	4	31812221	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	HMMPfam_BRCA2,superfamily_BRCA2_helical,HMMPfam_BRCA-2_helical,superfamily_Nucleic_acid_OB,HMMPfam_BRCA-2_OB1,HMMPfam_Tower,superfamily_SSF81878,HMMPfam_BRCA-2_OB3	p.N1910S	ENST00000380152.3	37	c.5729	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.211861	0.00289	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.66815	-0.23;-0.23	5.17	-3.44	0.04796	.	2.496540	0.01257	N	0.009041	T	0.45196	0.1330	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13683	-1.0500	10	0.28530	T	0.3	.	3.5787	0.07943	0.353:0.373:0.1861:0.0879	.	1910	P51587	BRCA2_HUMAN	S	1910	ENSP00000369497:N1910S;ENSP00000439902:N1910S	ENSP00000369497:N1910S	N	+	2	0	BRCA2	31812221	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.686000	0.05161	-1.312000	0.02306	-1.162000	0.01777	AAT	-	NULL		0.338	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	protein_coding	OTTHUMT00000046000.2	A	NM_000059		31812221	+1	no_errors	NM_000059	genbank	human	reviewed	54_36p	missense	SNP	0.000	G
MTMR12	54545	genome.wustl.edu	37	5	32243641	32243641	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr5:32243641C>T	ENST00000382142.3	-	11	1256	c.1086G>A	c.(1084-1086)tgG>tgA	p.W362*	MTMR12_ENST00000264934.5_Nonsense_Mutation_p.W362*|MTMR12_ENST00000280285.5_Nonsense_Mutation_p.W362*	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	362	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TTATGTCAAGCCAGCTGCTAC	0.328																																																0			5											105.0	106.0	106.0					5																	32243641		2203	4300	6503	32279398	SO:0001587	stop_gained	54545			AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.1086G>A	5.37:g.32243641C>T	ENSP00000371577:p.Trp362*	Somatic		Capture	Illumina GAIIx	4	32279398	Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Nonsense_Mutation	SNP	superfamily_PH domain-like,superfamily_(Phosphotyrosine protein) phosphatases II,HMMPfam_Myotub-related	p.W362*	ENST00000382142.3	37	c.1086	CCDS34138.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.419732	0.97550	.	.	ENSG00000150712	ENST00000280285;ENST00000382142;ENST00000264934	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	.	.	.	X	362	.	ENSP00000264934:W362X	W	-	3	0	MTMR12	32279398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.190000	0.72057	2.793000	0.96121	0.655000	0.94253	TGG	-	superfamily_(Phosphotyrosine protein) phosphatases II		0.328	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR12	protein_coding	OTTHUMT00000366579.1	C	NM_019061		32279398	-1	no_errors	NM_001040446	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	T
AGGF1P6	106481737	genome.wustl.edu	37	16	34723625	34723625	+	lincRNA	SNP	A	A	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr16:34723625A>T	ENST00000566562.1	-	0	960																											AGGCAATGTAACTGCAGAAGA	0.488																																																0			16																																								34581126			0																															16.37:g.34723625A>T		Somatic		Capture	Illumina GAIIx	4	34581126		RNA	SNP	-	NULL	ENST00000566562.1	37	NULL		16																																																																																			-	-		0.488	RP11-80F22.14-001	KNOWN	basic	lincRNA	LOC100130041	lincRNA	OTTHUMT00000431377.1	A			34581126	+1	pseudogene	XR_037947	genbank	human	model	54_36p	rna	SNP	0.977	T
AGXT2	64902	genome.wustl.edu	37	5	35033638	35033638	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr5:35033638C>G	ENST00000231420.6	-	6	802	c.602G>C	c.(601-603)aGt>aCt	p.S201T	AC010368.1_ENST00000390793.2_RNA	NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	201					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	TGTGTAAGGACTGCATCCATG	0.493																																																0			5											94.0	79.0	84.0					5																	35033638		2203	4300	6503	35069395	SO:0001583	missense	64902			AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.602G>C	5.37:g.35033638C>G	ENSP00000231420:p.Ser201Thr	Somatic		Capture	Illumina GAIIx	4	35069395	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase_major,HMMPfam_Aminotran_3,PatternScan_AA_TRANSFER_CLASS_3	p.S201T	ENST00000231420.6	37	c.602	CCDS3908.1	5	.	.	.	.	.	.	.	.	.	.	C	18.48	3.632214	0.67015	.	.	ENSG00000113492	ENST00000231420	D	0.82081	-1.57	5.71	4.79	0.61399	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.076452	0.85682	D	0.000000	T	0.69369	0.3103	N	0.04018	-0.295	0.42812	D	0.993967	B;P;P	0.41597	0.149;0.756;0.478	B;P;B	0.44647	0.173;0.456;0.078	T	0.68051	-0.5511	10	0.11182	T	0.66	-4.6034	16.5233	0.84322	0.0:0.8695:0.1305:0.0	.	109;201;201	B7Z3M3;E9PDL7;Q9BYV1	.;.;AGT2_HUMAN	T	201	ENSP00000231420:S201T	ENSP00000231420:S201T	S	-	2	0	AGXT2	35069395	1.000000	0.71417	0.998000	0.56505	0.942000	0.58702	4.585000	0.60977	2.861000	0.98227	0.650000	0.86243	AGT	-	superfamily_PyrdxlP-dep_Trfase_major,HMMPfam_Aminotran_3		0.493	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2	protein_coding	OTTHUMT00000207574.2	C	NM_031900		35069395	-1	no_errors	NM_031900	genbank	human	reviewed	54_36p	missense	SNP	0.999	G
TGM4	7047	genome.wustl.edu	37	3	44943145	44943145	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr3:44943145G>C	ENST00000296125.4	+	7	855	c.787G>C	c.(787-789)Gtg>Ctg	p.V263L	RP11-272D20.2_ENST00000427258.1_RNA	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	263					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	GAAGCAGGCTGTGTGCTTTGG	0.592																																																0			3											125.0	117.0	119.0					3																	44943145		2203	4300	6503	44918149	SO:0001583	missense	7047			BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.787G>C	3.37:g.44943145G>C	ENSP00000296125:p.Val263Leu	Somatic		Capture	Illumina GAIIx	4	44918149	Q16707|Q96QN4	Missense_Mutation	SNP	superfamily_Ig_E-set,HMMPfam_Transglut_N,superfamily_SSF54001,HMMSmart_TGc,PatternScan_TRANSGLUTAMINASES,HMMPfam_Transglut_core,superfamily_Transglut_C,HMMPfam_Transglut_C	p.V263L	ENST00000296125.4	37	c.787	CCDS2723.1	3	.	.	.	.	.	.	.	.	.	.	G	19.37	3.813754	0.70912	.	.	ENSG00000163810	ENST00000296125	T	0.52057	0.68	2.69	2.69	0.31865	Transglutaminase-like (2);	0.000000	0.39985	U	0.001202	T	0.74703	0.3751	M	0.93420	3.415	0.49130	D	0.999754	D	0.89917	1.0	D	0.83275	0.996	T	0.83180	-0.0089	10	0.87932	D	0	.	14.1159	0.65154	0.0:0.0:1.0:0.0	.	263	P49221	TGM4_HUMAN	L	263	ENSP00000296125:V263L	ENSP00000296125:V263L	V	+	1	0	TGM4	44918149	0.998000	0.40836	0.001000	0.08648	0.010000	0.07245	3.471000	0.53107	1.434000	0.47414	0.563000	0.77884	GTG	-	superfamily_SSF54001,HMMSmart_TGc		0.592	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM4	protein_coding	OTTHUMT00000256755.2	G	NM_003241		44918149	+1	no_errors	NM_003241	genbank	human	validated	54_36p	missense	SNP	0.435	C
AGAP10P	653234	genome.wustl.edu	37	10	46187607	46187607	+	IGR	SNP	G	G	T	rs183108397	byFrequency	TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr10:46187607G>T								ZFAND4 (19379 upstream) : FAM21FP (34116 downstream)																							CAATAATATCGTGAGTACAAC	0.373																																																0			10																																								45507613	SO:0001628	intergenic_variant	653234																															10.37:g.46187607G>T		Somatic		Capture	Illumina GAIIx	4	45507613		Splice_Site	SNP	-	NULL		37	c.NULL		10																																																																																			-	-	0	0.373					CTGLF10P			G			45507613	+1	no_coding_region:pseudogene	ENST00000406820	ensembl	human	known	54_36p	splice_site	SNP	0.999	T
ZNF41	7592	genome.wustl.edu	37	X	47308564	47308564	+	Nonsense_Mutation	SNP	G	G	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chrX:47308564G>T	ENST00000377065.4	-	5	1244	c.605C>A	c.(604-606)tCa>tAa	p.S202*	ZNF41_ENST00000313116.7_Nonsense_Mutation_p.S202*|ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000397050.2_Nonsense_Mutation_p.S212*	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	244					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				ATGATTATGTGAGTTTAAAGT	0.328																																																0			X											129.0	120.0	123.0					X																	47308564		2203	4300	6503	47193508	SO:0001587	stop_gained	7592			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.605C>A	X.37:g.47308564G>T	ENSP00000366265:p.Ser202*	Somatic		Capture	Illumina GAIIx	4	47193508	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Nonsense_Mutation	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.S202*	ENST00000377065.4	37	c.605	CCDS14279.1	X	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916900	0.52546	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	.	.	.	2.96	-1.13	0.09775	.	0.351374	0.16240	N	0.223214	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	3.1278	0.06413	0.3904:0.0:0.3972:0.2125	.	.	.	.	X	202;202;212	.	ENSP00000315173:S202X	S	-	2	0	ZNF41	47193508	0.491000	0.26019	0.215000	0.23724	0.005000	0.04900	0.923000	0.28757	-0.318000	0.08665	-1.412000	0.01120	TCA	-	NULL		0.328	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF41	protein_coding	OTTHUMT00000056429.1	G	NM_153380		47193508	-1	no_errors	NM_007130	genbank	human	reviewed	54_36p	nonsense	SNP	0.002	T
ZNF229	7772	genome.wustl.edu	37	19	44933591	44933591	+	Silent	SNP	G	G	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr19:44933591G>A	ENST00000588931.1	-	6	1798	c.1365C>T	c.(1363-1365)caC>caT	p.H455H	ZNF229_ENST00000591289.1_Intron|CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000291187.4_Silent_p.H449H	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				TTTCTCCAGGGTGAATGTGCT	0.577																																																0			19											59.0	66.0	64.0					19																	44933591		2190	4297	6487	49625431	SO:0001819	synonymous_variant	7772			AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.1365C>T	19.37:g.44933591G>A		Somatic		Capture	Illumina GAIIx	4	49625431	B2RWN3|Q59FV2|Q86WL9	Silent	SNP	superfamily_KRAB domain (Kruppel-associated box Pfam 01352),HMMPfam_KRAB,HMMSmart_SM00349,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.H455	ENST00000588931.1	37	c.1365	CCDS42574.1	19																																																																																			-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.577	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF229	protein_coding	OTTHUMT00000460833.1	G	NM_014518		49625431	-1	no_errors	NM_014518	genbank	human	validated	54_36p	silent	SNP	0.550	A
GIPR	2696	genome.wustl.edu	37	19	46181163	46181163	+	Splice_Site	SNP	G	G	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr19:46181163G>C	ENST00000590918.1	+	11	1023		c.e11-1		GIPR_ENST00000593127.1_Splice_Site|GIPR_ENST00000263281.3_Splice_Site|GIPR_ENST00000304207.8_Splice_Site|MIR642A_ENST00000385039.1_RNA	NM_000164.2	NP_000155.1	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor						activation of adenylate cyclase activity (GO:0007190)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|endocrine pancreas development (GO:0031018)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|response to axon injury (GO:0048678)|response to calcium ion (GO:0051592)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gastric inhibitory peptide receptor activity (GO:0016519)|peptide hormone binding (GO:0017046)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|kidney(2)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	12		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		TCTCCCCACAGATTAATTTCC	0.572																																																0			19											79.0	71.0	74.0					19																	46181163		2203	4300	6503	50873003	SO:0001630	splice_region_variant	2696				CCDS12671.1	19q13.2-q13.3	2012-08-10				ENSG00000010310		"""GPCR / Class B : Glucagon receptors"""	4271	protein-coding gene	gene with protein product		137241				7490109	Standard	NM_000164		Approved		uc002pcu.1	P48546		ENST00000590918.1:c.925-1G>C	19.37:g.46181163G>C		Somatic		Capture	Illumina GAIIx	4	50873003	B7WP14|B7ZKQ0|Q14401|Q16400|Q52M04|Q9UPI1	Splice_Site	SNP	-	e10-1	ENST00000590918.1	37	c.925-1	CCDS12671.1	19	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893646	0.72639	.	.	ENSG00000010310	ENST00000263281;ENST00000304207	.	.	.	4.19	4.19	0.49359	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8859	0.52602	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GIPR	50873003	1.000000	0.71417	0.999000	0.59377	0.899000	0.52679	6.037000	0.70956	2.162000	0.67917	0.313000	0.20887	.	-	-		0.572	GIPR-001	KNOWN	basic|CCDS	protein_coding	GIPR	protein_coding	OTTHUMT00000459640.1	G		Intron	50873003	+1	no_errors	NM_000164	genbank	human	validated	54_36p	splice_site	SNP	1.000	C
SUOX	6821	genome.wustl.edu	37	12	56398614	56398614	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr12:56398614C>T	ENST00000394109.3	+	3	2165	c.1441C>T	c.(1441-1443)Cgc>Tgc	p.R481C	SUOX_ENST00000394115.2_Missense_Mutation_p.R481C|SUOX_ENST00000548274.1_Missense_Mutation_p.R481C|SUOX_ENST00000266971.3_Missense_Mutation_p.R481C|SUOX_ENST00000356124.4_Missense_Mutation_p.R481C|IKZF4_ENST00000262032.5_5'Flank			P51687	SUOX_HUMAN	sulfite oxidase	481	Homodimerization. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			AGAGGAACAGCGCCCCAGGAA	0.582																																																0			12											190.0	169.0	177.0					12																	56398614		2203	4300	6503	54684881	SO:0001583	missense	6821			BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.1441C>T	12.37:g.56398614C>T	ENSP00000377668:p.Arg481Cys	Somatic		Capture	Illumina GAIIx	4	54684881		Missense_Mutation	SNP	superfamily_Cyt_B5,HMMPfam_Cyt-b5,PatternScan_CYTOCHROME_B5_1,superfamily_Oxidored_molyb,HMMPfam_Oxidored_molyb,PatternScan_MOLYBDOPTERIN_EUK,HMMPfam_Mo-co_dimer,superfamily_Ig_E-set	p.R481C	ENST00000394109.3	37	c.1441	CCDS8901.2	12	.	.	.	.	.	.	.	.	.	.	C	9.152	1.016504	0.19355	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000548274;ENST00000394109	D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72	4.76	-0.756	0.11057	Immunoglobulin E-set (1);Moybdenum cofactor oxidoreductase, dimerisation (2);	0.694992	0.14311	N	0.327669	T	0.73241	0.3562	L	0.58510	1.815	0.21762	N	0.999551	B	0.11235	0.004	B	0.15484	0.013	T	0.61917	-0.6964	10	0.51188	T	0.08	-27.6409	1.0504	0.01578	0.1508:0.3511:0.1469:0.3512	.	481	P51687	SUOX_HUMAN	C	481	ENSP00000348440:R481C;ENSP00000266971:R481C;ENSP00000377674:R481C;ENSP00000450245:R481C;ENSP00000377668:R481C	ENSP00000266971:R481C	R	+	1	0	SUOX	54684881	0.000000	0.05858	0.198000	0.23420	0.883000	0.51084	-1.210000	0.02999	0.036000	0.15547	0.467000	0.42956	CGC	-	HMMPfam_Mo-co_dimer,superfamily_Ig_E-set		0.582	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUOX	protein_coding	OTTHUMT00000250309.1	C	NM_000456		54684881	+1	no_errors	NM_000456	genbank	human	reviewed	54_36p	missense	SNP	0.238	T
TMEM260	54916	genome.wustl.edu	37	14	57082679	57082679	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr14:57082679T>C	ENST00000261556.6	+	8	997	c.875T>C	c.(874-876)aTg>aCg	p.M292T	TMEM260_ENST00000536419.1_5'UTR|TMEM260_ENST00000538838.1_Missense_Mutation_p.M292T|TMEM260_ENST00000553335.1_3'UTR	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	292						integral component of membrane (GO:0016021)											GTAACAAATATGAGGACCGAA	0.318																																																0			14											128.0	133.0	131.0					14																	57082679		2203	4299	6502	56152432	SO:0001583	missense	54916			AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.875T>C	14.37:g.57082679T>C	ENSP00000261556:p.Met292Thr	Somatic		Capture	Illumina GAIIx	4	56152432	A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	NULL	p.M292T	ENST00000261556.6	37	c.875	CCDS9727.2	14	.	.	.	.	.	.	.	.	.	.	T	13.55	2.269293	0.40095	.	.	ENSG00000070269	ENST00000261556;ENST00000538838	T;T	0.43688	1.49;0.94	5.89	5.89	0.94794	.	0.161870	0.64402	D	0.000003	T	0.42449	0.1203	M	0.65975	2.015	0.80722	D	1	P	0.48230	0.907	B	0.41036	0.346	T	0.36261	-0.9755	10	0.27082	T	0.32	-12.7519	13.8303	0.63377	0.0:0.0:0.0:1.0	.	292	Q9NX78	CN101_HUMAN	T	292	ENSP00000261556:M292T;ENSP00000441934:M292T	ENSP00000261556:M292T	M	+	2	0	C14orf101	56152432	1.000000	0.71417	0.996000	0.52242	0.300000	0.27592	4.158000	0.58150	2.250000	0.74265	0.477000	0.44152	ATG	-	NULL		0.318	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf101	protein_coding	OTTHUMT00000276924.1	T	NM_017799		56152432	+1	no_errors	NM_017799	genbank	human	validated	54_36p	missense	SNP	1.000	C
OR5AP2	338675	genome.wustl.edu	37	11	56408996	56408996	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr11:56408996A>T	ENST00000302981.1	-	1	919	c.920T>A	c.(919-921)cTa>cAa	p.L307Q	OR5AP2_ENST00000544374.1_Missense_Mutation_p.L308Q	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						GATCTTCTTTAGGGCCTTTTT	0.338																																																0			11											79.0	77.0	77.0					11																	56408996		2201	4296	6497	56165572	SO:0001583	missense	338675			AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.920T>A	11.37:g.56408996A>T	ENSP00000303111:p.Leu307Gln	Somatic		Capture	Illumina GAIIx	4	56165572	B2RNM8	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.L307Q	ENST00000302981.1	37	c.920	CCDS31534.1	11	.	.	.	.	.	.	.	.	.	.	A	5.882	0.346900	0.11126	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.48522	0.81;0.81	4.94	4.94	0.65067	.	0.393075	0.18469	N	0.140271	T	0.67316	0.2880	H	0.97240	3.965	0.09310	N	1	P	0.49447	0.924	B	0.44085	0.44	T	0.72187	-0.4366	10	0.87932	D	0	.	13.7369	0.62824	1.0:0.0:0.0:0.0	.	307	Q8NGF4	O5AP2_HUMAN	Q	308;307	ENSP00000442701:L308Q;ENSP00000303111:L307Q	ENSP00000303111:L307Q	L	-	2	0	OR5AP2	56165572	0.352000	0.24895	0.006000	0.13384	0.185000	0.23345	5.056000	0.64287	2.090000	0.63153	0.519000	0.50382	CTA	-	superfamily_Family A G protein-coupled receptor-like		0.338	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OR5AP2	protein_coding	OTTHUMT00000391613.1	A	NM_001002925		56165572	-1	no_errors	NM_001002925	genbank	human	provisional	54_36p	missense	SNP	0.251	T
PEG3	5178	genome.wustl.edu	37	19	57325167	57325167	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr19:57325167C>T	ENST00000326441.9	-	10	5006	c.4643G>A	c.(4642-4644)cGt>cAt	p.R1548H	ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.R1548H|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R1422H|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.R1424H	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1548					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R1548H(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GGTGCTGGCACGTTCGATGTA	0.517																																																2	Substitution - Missense(2)	pancreas(2)	19											148.0	126.0	133.0					19																	57325167		2203	4300	6503	62016979	SO:0001583	missense	5178			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4643G>A	19.37:g.57325167C>T	ENSP00000326581:p.Arg1548His	Somatic		Capture	Illumina GAIIx	4	62016979	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	HMMPfam_SCAN,HMMSmart_SM00431,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.R1548H	ENST00000326441.9	37	c.4643	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	0.953	-0.705788	0.03255	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02682	4.2;4.2	3.97	-3.58	0.04597	.	1.335950	0.05106	N	0.488052	T	0.01287	0.0042	N	0.04508	-0.205	.	.	.	B;B;B	0.09022	0.002;0.0;0.002	B;B;B	0.04013	0.001;0.0;0.001	T	0.45086	-0.9285	9	0.02654	T	1	-2.2214	6.3924	0.21593	0.0:0.3664:0.1317:0.5018	.	1424;1548;1483	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	H	1548	ENSP00000326581:R1548H;ENSP00000403051:R1548H	ENSP00000326581:R1548H	R	-	2	0	ZIM2	62016979	0.000000	0.05858	0.000000	0.03702	0.794000	0.44872	-0.514000	0.06298	-1.033000	0.03299	-1.094000	0.02160	CGT	-	NULL		0.517	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	protein_coding	OTTHUMT00000416099.2	C			62016979	-1	no_errors	NM_006210	genbank	human	provisional	54_36p	missense	SNP	0.000	T
SYVN1	84447	genome.wustl.edu	37	11	64899001	64899001	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr11:64899001G>A	ENST00000377190.3	-	7	692	c.598C>T	c.(598-600)Cag>Tag	p.Q200*	SYVN1_ENST00000526060.1_Nonsense_Mutation_p.Q200*|SYVN1_ENST00000294256.8_Nonsense_Mutation_p.Q200*|SYVN1_ENST00000307289.6_Nonsense_Mutation_p.Q149*|SYVN1_ENST00000526121.1_5'UTR	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	200					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TTCTCACTCTGGAGGTCCACG	0.552																																																0			11											119.0	96.0	104.0					11																	64899001		2201	4297	6498	64655577	SO:0001587	stop_gained	84447			AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.598C>T	11.37:g.64899001G>A	ENSP00000366395:p.Gln200*	Somatic		Capture	Illumina GAIIx	4	64655577	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Nonsense_Mutation	SNP	superfamily_RING/U-box,HMMSmart_SM00184,HMMPfam_zf-C3HC4	p.Q200*	ENST00000377190.3	37	c.598	CCDS31605.1	11	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952383	0.73787	.	.	ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000434219;ENST00000307289;ENST00000526060;ENST00000531018;ENST00000528487	.	.	.	4.49	4.49	0.54785	.	0.127611	0.53938	D	0.000055	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-16.837	14.7344	0.69406	0.0:0.0:1.0:0.0	.	.	.	.	X	200;200;200;149;200;140;185	.	ENSP00000294256:Q200X	Q	-	1	0	SYVN1	64655577	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.288000	0.78691	2.321000	0.78463	0.563000	0.77884	CAG	-	NULL		0.552	SYVN1-001	KNOWN	basic|CCDS	protein_coding	SYVN1	protein_coding	OTTHUMT00000385274.1	G	NM_032431		64655577	-1	no_errors	NM_172230	genbank	human	reviewed	54_36p	nonsense	SNP	1.000	A
CALN1	83698	genome.wustl.edu	37	7	71488739	71488739	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr7:71488739T>C	ENST00000329008.5	-	4	576	c.278A>G	c.(277-279)gAt>gGt	p.D93G	CALN1_ENST00000395276.2_Missense_Mutation_p.D93G|CALN1_ENST00000405452.2_Missense_Mutation_p.D93G|CALN1_ENST00000431984.1_Missense_Mutation_p.D93G|CALN1_ENST00000412588.1_Missense_Mutation_p.D135G|CALN1_ENST00000395275.2_Missense_Mutation_p.D135G	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	93	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				TTCATCAAAATCCACCTGGCC	0.458																																																0			7											118.0	100.0	106.0					7																	71488739		2203	4300	6503	71126675	SO:0001583	missense	83698			AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.278A>G	7.37:g.71488739T>C	ENSP00000332498:p.Asp93Gly	Somatic		Capture	Illumina GAIIx	4	71126675	J3KQA7	Missense_Mutation	SNP	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_EF_HAND_1,PatternScan_S100_CABP	p.D135G	ENST00000329008.5	37	c.404	CCDS5541.1	7	.	.	.	.	.	.	.	.	.	.	T	18.47	3.631642	0.67015	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452;ENST00000446128	T;T;T;T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59	5.87	5.87	0.94306	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.71929	0.3398	M	0.76170	2.325	0.80722	D	1	B;B	0.12013	0.005;0.005	B;B	0.17979	0.02;0.02	T	0.70513	-0.4851	10	0.87932	D	0	-29.5575	14.5226	0.67863	0.0:0.0:0.0:1.0	.	93;93	A4D1Z1;Q9BXU9	.;CABP8_HUMAN	G	93;135;93;93;135;93;93	ENSP00000332498:D93G;ENSP00000378690:D135G;ENSP00000378691:D93G;ENSP00000410704:D93G;ENSP00000391882:D135G;ENSP00000384354:D93G;ENSP00000411806:D93G	ENSP00000332498:D93G	D	-	2	0	CALN1	71126675	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.305000	0.78891	2.371000	0.80710	0.533000	0.62120	GAT	-	superfamily_EF-hand,HMMSmart_SM00054,HMMPfam_efhand,PatternScan_S100_CABP,PatternScan_EF_HAND_1		0.458	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CALN1	protein_coding	OTTHUMT00000320044.2	T	NM_031468		71126675	-1	no_errors	NM_031468	genbank	human	validated	54_36p	missense	SNP	1.000	C
SPDYE7P	441251	genome.wustl.edu	37	7	72336988	72336988	+	IGR	SNP	G	G	T	rs371596606		TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr7:72336988G>T								RN7SL625P (24683 upstream) : POM121 (12947 downstream)																							AGGCCGGCCCGGCTGAAATAC	0.522													.|||	1	0.000199681	0.0	0.0	5008	,	,		16319	0.001		0.0	False		,,,				2504	0.0															0			7																																								71974924	SO:0001628	intergenic_variant	0																															7.37:g.72336988G>T		Somatic		Capture	Illumina GAIIx	4	71974924		Silent	SNP	NULL	p.R91		37	c.271		7																																																																																			-	NULL	0	0.522					ENSG00000179994			G			71974924	-1	no_errors	ENST00000355920	ensembl	human	known	54_36p	silent	SNP	0.086	T
NEK9	91754	genome.wustl.edu	37	14	75555217	75555217	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr14:75555217G>T	ENST00000238616.5	-	20	2728	c.2570C>A	c.(2569-2571)gCt>gAt	p.A857D		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	857	Interaction with NEK6.|Pro/Ser/Thr-rich.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		TTCCAAAGGAGCTTCAGAGGC	0.488											OREG0022811	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			14											135.0	132.0	133.0					14																	75555217		2203	4300	6503	74624970	SO:0001583	missense	91754			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.2570C>A	14.37:g.75555217G>T	ENSP00000238616:p.Ala857Asp	Somatic	1161	Capture	Illumina GAIIx	4	74624970	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	PatternScan_RCC1_1,PatternScan_RCC1_2,PatternScan_PROTEIN_KINASE_ATP,superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST,superfamily_RCC1/BLIP-II,HMMPfam_RCC1	p.A857D	ENST00000238616.5	37	c.2570	CCDS9839.1	14	.	.	.	.	.	.	.	.	.	.	G	12.43	1.935933	0.34189	.	.	ENSG00000119638	ENST00000238616	T	0.71103	-0.54	6.17	4.27	0.50696	.	0.571046	0.19124	N	0.122089	T	0.49541	0.1563	N	0.14661	0.345	0.22842	N	0.998664	B;B	0.24186	0.099;0.05	B;B	0.29176	0.04;0.099	T	0.35375	-0.9791	10	0.12766	T	0.61	.	6.9771	0.24681	0.1346:0.0:0.7059:0.1595	.	857;200	Q8TD19;Q6PKF2	NEK9_HUMAN;.	D	857	ENSP00000238616:A857D	ENSP00000238616:A857D	A	-	2	0	NEK9	74624970	0.877000	0.30153	0.047000	0.18901	0.982000	0.71751	2.803000	0.47924	0.831000	0.34780	0.655000	0.94253	GCT	-	NULL		0.488	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK9	protein_coding	OTTHUMT00000415021.1	G	NM_033116		74624970	-1	no_errors	NM_033116	genbank	human	validated	54_36p	missense	SNP	0.976	T
SLC44A5	204962	genome.wustl.edu	37	1	75685020	75685020	+	Silent	SNP	C	C	T	rs531608712		TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr1:75685020C>T	ENST00000370855.5	-	16	1301	c.1188G>A	c.(1186-1188)gcG>gcA	p.A396A	SLC44A5_ENST00000370859.3_Silent_p.A396A|SLC44A5_ENST00000535611.1_Silent_p.A266A	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	396					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A396A(1)		kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CCCCCGATGTCGCCAAGAAAC	0.393													C|||	1	0.000199681	0.0	0.0	5008	,	,		17200	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	large_intestine(1)	1											89.0	83.0	85.0					1																	75685020		2203	4300	6503	75457608	SO:0001819	synonymous_variant	204962			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1188G>A	1.37:g.75685020C>T		Somatic		Capture	Illumina GAIIx	4	75457608	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent	SNP	HMMPfam_DUF580	p.A396	ENST00000370855.5	37	c.1188	CCDS667.1	1																																																																																			-	HMMPfam_DUF580		0.393	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	protein_coding	OTTHUMT00000026921.1	C	NM_152697		75457608	-1	no_errors	NM_152697	genbank	human	validated	54_36p	silent	SNP	1.000	T
SLC38A10	124565	genome.wustl.edu	37	17	79250915	79250915	+	Silent	SNP	G	G	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr17:79250915G>A	ENST00000374759.3	-	7	1028	c.645C>T	c.(643-645)taC>taT	p.Y215Y	SLC38A10_ENST00000288439.5_Silent_p.Y215Y|SLC38A10_ENST00000546352.1_5'UTR	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	215					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCAGGCTGTCGTAGGTGGGCA	0.557																																																0			17											159.0	117.0	131.0					17																	79250915		2203	4300	6503	76865510	SO:0001819	synonymous_variant	124565			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.645C>T	17.37:g.79250915G>A		Somatic		Capture	Illumina GAIIx	4	76865510	Q6ZRC5|Q8NA99|Q96C66	Silent	SNP	HMMPfam_Aa_trans	p.Y215	ENST00000374759.3	37	c.645	CCDS42397.1	17																																																																																			-	HMMPfam_Aa_trans		0.557	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	protein_coding	OTTHUMT00000397747.1	G	NM_138570		76865510	-1	no_errors	NM_001037984	genbank	human	validated	54_36p	silent	SNP	0.998	A
MAGI2	9863	genome.wustl.edu	37	7	77756681	77756681	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr7:77756681G>C	ENST00000354212.4	-	19	3509	c.3256C>G	c.(3256-3258)Cct>Gct	p.P1086A	MAGI2_ENST00000419488.1_Missense_Mutation_p.P1072A|MAGI2_ENST00000522391.1_Missense_Mutation_p.P1086A	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	1086	Pro-rich.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GTGAATGGAGGCTGTCGGATG	0.527																																																0			7											121.0	105.0	110.0					7																	77756681		2203	4300	6503	77594617	SO:0001583	missense	9863			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.3256C>G	7.37:g.77756681G>C	ENSP00000346151:p.Pro1086Ala	Somatic		Capture	Illumina GAIIx	4	77594617	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	superfamily_PDZ domain-like,HMMPfam_PDZ,HMMSmart_SM00228,HMMSmart_SM00072,superfamily_P-loop containing nucleoside triphosphate hydrolases,PatternScan_GUANYLATE_KINASE_1,HMMPfam_Guanylate_kin,superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1	p.P1086A	ENST00000354212.4	37	c.3256	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295578	0.81025	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.10668	2.93;2.94;2.85	5.19	5.19	0.71726	.	0.000000	0.36482	U	0.002562	T	0.22085	0.0532	L	0.32530	0.975	0.80722	D	1	D;P;D	0.76494	0.999;0.856;0.999	D;P;D	0.80764	0.986;0.62;0.994	T	0.05131	-1.0904	10	0.12430	T	0.62	.	19.0671	0.93116	0.0:0.0:1.0:0.0	.	1086;1072;1086	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	A	1072;1086;1086;1086	ENSP00000405766:P1072A;ENSP00000346151:P1086A;ENSP00000428389:P1086A	ENSP00000346151:P1086A	P	-	1	0	MAGI2	77594617	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.420000	0.97426	2.556000	0.86216	0.655000	0.94253	CCT	-	NULL		0.527	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	protein_coding	OTTHUMT00000253197.3	G	NM_012301		77594617	-1	no_errors	NM_012301	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
AKAP13	11214	genome.wustl.edu	37	15	86273755	86273755	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr15:86273755C>T	ENST00000394518.2	+	30	7194	c.7099C>T	c.(7099-7101)Cag>Tag	p.Q2367*	AKAP13_ENST00000394510.2_Nonsense_Mutation_p.Q612*|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Nonsense_Mutation_p.Q2371*	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2367	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						ACAACTTCACCAGAAGGACCA	0.453											OREG0023425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(94;603 1453 3280 32295 32951)											0			15											124.0	117.0	119.0					15																	86273755		2202	4299	6501	84074759	SO:0001587	stop_gained	11214			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.7099C>T	15.37:g.86273755C>T	ENSP00000378026:p.Gln2367*	Somatic	1243	Capture	Illumina GAIIx	4	84074759	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Nonsense_Mutation	SNP	superfamily_ANK,HMMPfam_RII_binding_1,superfamily_SSF57889,HMMSmart_C1,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,PatternScan_EF_HAND_1,superfamily_DH-domain,HMMPfam_RhoGEF,HMMSmart_RhoGEF,HMMPfam_PH,superfamily_SSF50729,HMMSmart_PH	p.Q2371*	ENST00000394518.2	37	c.7111	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	C	48	14.702181	0.99806	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	18.8905	0.92399	0.0:1.0:0.0:0.0	.	.	.	.	X	2371;2367;2370;2346;612	.	ENSP00000354718:Q2371X	Q	+	1	0	AKAP13	84074759	1.000000	0.71417	0.972000	0.41901	0.978000	0.69477	4.905000	0.63286	2.712000	0.92718	0.650000	0.86243	CAG	-	NULL		0.453	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	protein_coding	OTTHUMT00000417318.1	C	NM_007200		84074759	+1	no_errors	NM_006738	genbank	human	reviewed	54_36p	nonsense	SNP	0.994	T
PTPN21	11099	genome.wustl.edu	37	14	88967714	88967714	+	Splice_Site	SNP	T	T	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr14:88967714T>C	ENST00000556564.1	-	7	872		c.e7-2		PTPN21_ENST00000554628.1_Splice_Site|RP11-507K2.2_ENST00000555444.1_RNA|PTPN21_ENST00000328736.3_Splice_Site	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21						peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GTGAGCCCTCTGCAACCCAAA	0.403																																																0			14											123.0	122.0	122.0					14																	88967714		2203	4300	6503	88037467	SO:0001630	splice_region_variant	11099			X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.588-2A>G	14.37:g.88967714T>C		Somatic		Capture	Illumina GAIIx	4	88037467		Splice_Site	SNP	-	e6-2	ENST00000556564.1	37	c.588-2	CCDS9884.1	14	.	.	.	.	.	.	.	.	.	.	T	15.95	2.985389	0.53934	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0059	0.71513	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTPN21	88037467	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	7.452000	0.80683	2.031000	0.59945	0.533000	0.62120	.	-	-		0.403	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN21	protein_coding	OTTHUMT00000410303.1	T		Intron	88037467	-1	no_errors	NM_007039	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	C
GSC	145258	genome.wustl.edu	37	14	95234843	95234843	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr14:95234843C>G	ENST00000238558.3	-	3	968	c.759G>C	c.(757-759)ttG>ttC	p.L253F		NM_173849.2	NP_776248.1	P56915	GSC_HUMAN	goosecoid homeobox	253					dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|gastrulation (GO:0007369)|middle ear morphogenesis (GO:0042474)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell fate specification (GO:0014036)|signal transduction involved in regulation of gene expression (GO:0023019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)			skin(1)	1		all_cancers(154;0.0896)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.202)|Epithelial(152;0.239)		TGTCCGAGTCCAAATCGCTTT	0.557																																					Pancreas(105;2165 2186 4892 18008)											0			14											171.0	140.0	150.0					14																	95234843		2203	4300	6503	94304596	SO:0001583	missense	145258				CCDS9930.1	14q32.13	2011-06-20	2007-07-11			ENSG00000133937		"""Homeoboxes / PRD class"""	4612	protein-coding gene	gene with protein product		138890				7916327	Standard	NM_173849		Approved		uc001ydu.3	P56915		ENST00000238558.3:c.759G>C	14.37:g.95234843C>G	ENSP00000238558:p.Leu253Phe	Somatic		Capture	Illumina GAIIx	4	94304596	Q86YR1	Missense_Mutation	SNP	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1	p.L253F	ENST00000238558.3	37	c.759	CCDS9930.1	14	.	.	.	.	.	.	.	.	.	.	C	21.4	4.136849	0.77662	.	.	ENSG00000133937	ENST00000238558	D	0.92965	-3.14	5.5	5.5	0.81552	.	0.258317	0.32161	N	0.006500	D	0.88923	0.6569	L	0.27053	0.805	0.58432	D	0.999998	B	0.22909	0.077	B	0.28849	0.095	D	0.85212	0.1021	10	0.56958	D	0.05	-12.7633	19.3816	0.94540	0.0:1.0:0.0:0.0	.	253	P56915	GSC_HUMAN	F	253	ENSP00000238558:L253F	ENSP00000238558:L253F	L	-	3	2	GSC	94304596	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.397000	0.79903	2.580000	0.87095	0.462000	0.41574	TTG	-	NULL		0.557	GSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSC	protein_coding	OTTHUMT00000410746.1	C			94304596	-1	no_errors	NM_173849	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
FAHD2B	151313	genome.wustl.edu	37	2	97751583	97751583	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr2:97751583C>A	ENST00000414820.1	-	6	808	c.538G>T	c.(538-540)Gcc>Tcc	p.A180S	FAHD2B_ENST00000440566.2_Missense_Mutation_p.A180S|FAHD2B_ENST00000468548.1_5'Flank|FAHD2B_ENST00000272610.3_Missense_Mutation_p.A180S			Q6P2I3	FAH2B_HUMAN	fumarylacetoacetate hydrolase domain containing 2B	180							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			kidney(5)|large_intestine(2)|lung(3)|skin(2)	12						GCCACGTGGGCCATGGCATCT	0.557																																																0			2											70.0	69.0	69.0					2																	97751583		2203	4297	6500	97115310	SO:0001583	missense	151313				CCDS2030.1	2q11.2	2012-06-29			ENSG00000144199	ENSG00000144199			25318	protein-coding gene	gene with protein product							Standard	NM_199336		Approved	DKFZp434N062	uc002sxm.3	Q6P2I3	OTTHUMG00000130533	ENST00000414820.1:c.538G>T	2.37:g.97751583C>A	ENSP00000410470:p.Ala180Ser	Somatic		Capture	Illumina GAIIx	4	97115310	D3DXH7|Q8NDK1	Missense_Mutation	SNP	superfamily_Fumarylacetoacetase_C-rel,HMMPfam_FAA_hydrolase	p.A180S	ENST00000414820.1	37	c.538	CCDS2030.1	2	.	.	.	.	.	.	.	.	.	.	c	10.61	1.399551	0.25291	.	.	ENSG00000144199	ENST00000414820;ENST00000272610;ENST00000440566	D;D;D	0.96396	-4.0;-4.0;-4.0	0.624	0.624	0.17659	Fumarylacetoacetase, C-terminal-related (2);Fumarylacetoacetase, C-terminal (1);	0.538202	0.19877	N	0.104065	D	0.86322	0.5905	N	0.02708	-0.52	0.24873	N	0.992279	B	0.10296	0.003	B	0.10450	0.005	T	0.78532	-0.2168	10	0.30078	T	0.28	.	7.0501	0.25069	0.0:0.9999:0.0:1.0E-4	.	180	Q6P2I3	FAH2B_HUMAN	S	180	ENSP00000410470:A180S;ENSP00000272610:A180S;ENSP00000444599:A180S	ENSP00000272610:A180S	A	-	1	0	FAHD2B	97115310	1.000000	0.71417	0.949000	0.38748	0.881000	0.50899	0.634000	0.24614	0.587000	0.29643	0.306000	0.20318	GCC	-	superfamily_Fumarylacetoacetase_C-rel,HMMPfam_FAA_hydrolase		0.557	FAHD2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAHD2B	protein_coding	OTTHUMT00000339482.1	C	NM_199336		97115310	-1	no_errors	NM_199336	genbank	human	provisional	54_36p	missense	SNP	0.993	A
SYTL4	94121	genome.wustl.edu	37	X	99931047	99931047	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chrX:99931047G>T	ENST00000372989.1	-	19	2325	c.1994C>A	c.(1993-1995)gCc>gAc	p.A665D	SYTL4_ENST00000263033.5_Missense_Mutation_p.A665D|SYTL4_ENST00000455616.1_Missense_Mutation_p.A665D|SYTL4_ENST00000276141.6_Missense_Mutation_p.A665D|RP11-524D16__A.3_ENST00000568809.1_RNA|SYTL4_ENST00000454200.2_Missense_Mutation_p.A667D|SYTL4_ENST00000491602.1_5'UTR	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	665					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTTCTGCTTGGCCATTGAGGA	0.547																																																0			X											106.0	75.0	85.0					X																	99931047		2203	4300	6503	99817703	SO:0001583	missense	94121				CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.1994C>A	X.37:g.99931047G>T	ENSP00000362080:p.Ala665Asp	Somatic		Capture	Illumina GAIIx	4	99817703	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	HMMPfam_RPH3A_effector,superfamily_FYVE/PHD zinc finger,superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2	p.A665D	ENST00000372989.1	37	c.1994	CCDS14472.1	X	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766390	0.69878	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033	T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01	5.77	3.04	0.35103	C2 calcium/lipid-binding domain, CaLB (1);	0.611020	0.17698	N	0.165013	T	0.18173	0.0436	L	0.33189	0.99	0.27235	N	0.959287	P	0.40398	0.716	B	0.42771	0.397	T	0.06770	-1.0808	9	.	.	.	-2.1847	9.9122	0.41413	0.2269:0.0:0.7731:0.0	.	665	Q96C24	SYTL4_HUMAN	D	665;665;667;665;665	ENSP00000362080:A665D;ENSP00000390252:A665D;ENSP00000403556:A667D;ENSP00000276141:A665D;ENSP00000263033:A665D	.	A	-	2	0	SYTL4	99817703	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.136000	0.31467	0.218000	0.20820	0.538000	0.68166	GCC	-	NULL		0.547	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL4	protein_coding	OTTHUMT00000057488.1	G	NM_080737		99817703	-1	no_errors	NM_080737	genbank	human	validated	54_36p	missense	SNP	0.998	T
MTTP	4547	genome.wustl.edu	37	4	100534180	100534180	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr4:100534180G>T	ENST00000265517.5	+	15	2303	c.2100G>T	c.(2098-2100)caG>caT	p.Q700H	MTTP_ENST00000457717.1_Missense_Mutation_p.Q700H|MTTP_ENST00000511045.1_Missense_Mutation_p.Q727H|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	700					cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TTGATGTTCAGCTCAGACCTG	0.502																																																0			4											194.0	175.0	181.0					4																	100534180		2203	4300	6503	100753203	SO:0001583	missense	4547				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.2100G>T	4.37:g.100534180G>T	ENSP00000265517:p.Gln700His	Somatic		Capture	Illumina GAIIx	4	100753203	A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	superfamily_Lipid_transp_b-sht_shell,HMMPfam_Vitellogenin_N,HMMSmart_LPD_N,superfamily_LV_superhelical	p.Q700H	ENST00000265517.5	37	c.2100	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	G	15.11	2.735953	0.49045	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	T;T;T	0.64803	-0.12;-0.1;-0.1	5.3	1.68	0.24146	.	0.000000	0.85682	D	0.000000	T	0.61110	0.2321	M	0.70275	2.135	0.58432	D	0.99999	P;P	0.41159	0.74;0.69	B;B	0.42959	0.403;0.225	T	0.58792	-0.7574	10	0.54805	T	0.06	-25.8166	9.5121	0.39082	0.422:0.0:0.578:0.0	.	727;700	E9PBP6;P55157	.;MTP_HUMAN	H	727;700;700	ENSP00000427679:Q727H;ENSP00000400821:Q700H;ENSP00000265517:Q700H	ENSP00000265517:Q700H	Q	+	3	2	MTTP	100753203	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	1.257000	0.32932	0.003000	0.14656	-0.225000	0.12378	CAG	-	NULL		0.502	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	protein_coding	OTTHUMT00000253662.3	G			100753203	+1	no_errors	NM_000253	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CKAP2L	150468	genome.wustl.edu	37	2	113514249	113514249	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr2:113514249A>C	ENST00000302450.6	-	4	777	c.699T>G	c.(697-699)aaT>aaG	p.N233K	CKAP2L_ENST00000481732.1_5'Flank|CKAP2L_ENST00000541405.1_Missense_Mutation_p.N68K	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	233						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						GAACAGCACTATTAACTGAAC	0.368																																																0			2											110.0	113.0	112.0					2																	113514249		2203	4299	6502	113230720	SO:0001583	missense	150468			AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.699T>G	2.37:g.113514249A>C	ENSP00000305204:p.Asn233Lys	Somatic		Capture	Illumina GAIIx	4	113230720	A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	NULL	p.N233K	ENST00000302450.6	37	c.699	CCDS2100.1	2	.	.	.	.	.	.	.	.	.	.	A	16.84	3.235073	0.58886	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.12879	2.64;3.29	5.0	-3.18	0.05186	.	0.464825	0.20407	N	0.092938	T	0.11537	0.0281	M	0.62723	1.935	0.09310	N	1	B	0.16396	0.017	B	0.15052	0.012	T	0.19289	-1.0310	10	0.45353	T	0.12	-1.8001	6.5916	0.22649	0.3454:0.1656:0.489:0.0	.	233	Q8IYA6	CKP2L_HUMAN	K	68;233	ENSP00000438763:N68K;ENSP00000305204:N233K	ENSP00000305204:N233K	N	-	3	2	CKAP2L	113230720	0.000000	0.05858	0.000000	0.03702	0.975000	0.68041	-0.568000	0.05909	-0.409000	0.07553	0.477000	0.44152	AAT	-	NULL		0.368	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP2L	protein_coding	OTTHUMT00000254082.2	A	NM_152515		113230720	-1	no_errors	NM_152515	genbank	human	validated	54_36p	missense	SNP	0.000	C
SAMD3	154075	genome.wustl.edu	37	6	130476019	130476019	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr6:130476019G>A	ENST00000368134.2	-	11	1582	c.974C>T	c.(973-975)cCt>cTt	p.P325L	SAMD3_ENST00000437477.2_Missense_Mutation_p.P325L|SAMD3_ENST00000457563.2_Missense_Mutation_p.P349L|SAMD3_ENST00000439090.2_Missense_Mutation_p.P325L	NM_001258275.1	NP_001245204.1	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3	325										breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(15)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	29				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		GTCCTTCAGAGGTGTTCGGCT	0.353																																																0			6											116.0	105.0	109.0					6																	130476019		2203	4300	6503	130517712	SO:0001583	missense	154075			AK091351	CCDS34539.1, CCDS64525.1	6q23.1	2013-01-10			ENSG00000164483	ENSG00000164483		"""Sterile alpha motif (SAM) domain containing"""	21574	protein-coding gene	gene with protein product							Standard	NM_001017373		Approved	bA73O6.2, FLJ34032	uc031spp.1	Q8N6K7	OTTHUMG00000015556	ENST00000368134.2:c.974C>T	6.37:g.130476019G>A	ENSP00000357116:p.Pro325Leu	Somatic		Capture	Illumina GAIIx	4	130517712	B4DY20|E1P576|J3KQK4|Q4VXD8|Q8NAY1|Q8NB96	Missense_Mutation	SNP	superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_1	p.P325L	ENST00000368134.2	37	c.974	CCDS34539.1	6	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739537	0.49045	.	.	ENSG00000164483	ENST00000368134;ENST00000457563;ENST00000439090;ENST00000437477	T;T;T;T	0.61274	0.17;0.12;0.17;0.17	5.74	4.88	0.63580	.	0.172827	0.41823	D	0.000802	T	0.49253	0.1546	M	0.64997	1.995	0.80722	D	1	D	0.55605	0.972	P	0.46543	0.52	T	0.59118	-0.7514	10	0.87932	D	0	.	13.1904	0.59706	0.0735:0.0:0.9265:0.0	.	325	Q8N6K7	SAMD3_HUMAN	L	325;349;325;325	ENSP00000357116:P325L;ENSP00000402092:P349L;ENSP00000403565:P325L;ENSP00000391163:P325L	ENSP00000357116:P325L	P	-	2	0	SAMD3	130517712	1.000000	0.71417	0.946000	0.38457	0.904000	0.53231	4.509000	0.60448	1.572000	0.49736	0.563000	0.77884	CCT	-	NULL		0.353	SAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD3	protein_coding	OTTHUMT00000042197.3	G	NM_152552		130517712	-1	no_errors	NM_001017373	genbank	human	validated	54_36p	missense	SNP	0.995	A
GYPB	2994	genome.wustl.edu	37	4	144922436	144922436	+	Splice_Site	SNP	T	T	G	rs201662569	byFrequency	TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr4:144922436T>G	ENST00000502664.1	-	2	89	c.38A>C	c.(37-39)gAa>gCa	p.E13A	GYPB_ENST00000283126.7_Splice_Site_p.E13A|RP11-673E1.4_ENST00000506982.1_RNA|GYPB_ENST00000513128.1_Intron|GYPB_ENST00000429670.2_Splice_Site_p.E13A|GYPB_ENST00000510196.2_5'UTR	NM_002100.4	NP_002091	P06028	GLPB_HUMAN	glycophorin B (MNS blood group)	13						integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.E13A(1)		breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					GCTCACAATTTCTGTATAAAA	0.403																																																1	Substitution - Missense(1)	skin(1)	4											76.0	98.0	91.0					4																	144922436		2195	4297	6492	145141886	SO:0001630	splice_region_variant	2994				CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000502664.1:c.38-1A>C	4.37:g.144922436T>G		Somatic		Capture	Illumina GAIIx	4	145141886	B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Missense_Mutation	SNP	HMMPfam_Glycophorin_A,PatternScan_GLYCOPHORIN_A	p.E13A	ENST00000502664.1	37	c.38	CCDS54809.1	4	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.468978	0.01053	.	.	ENSG00000250361	ENST00000283126;ENST00000502664;ENST00000429670	T;T;T	0.06849	4.29;4.29;3.25	1.74	-3.49	0.04724	.	.	.	.	.	T	0.04272	0.0118	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.39121	-0.9629	8	0.21540	T	0.41	.	4.8253	0.13412	0.0:0.3816:0.3337:0.2847	.	13	E2QBW7	.	A	13	ENSP00000283126:E13A;ENSP00000427690:E13A;ENSP00000394200:E13A	ENSP00000283126:E13A	E	-	2	0	GYPB	145141886	0.000000	0.05858	0.001000	0.08648	0.084000	0.17831	-2.531000	0.00943	-2.543000	0.00484	-1.616000	0.00795	GAA	-	NULL		0.403	GYPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYPB	protein_coding	OTTHUMT00000364791.1	T	NM_002100	Missense_Mutation	145141886	-1	no_errors	NM_002100	genbank	human	reviewed	54_36p	missense	SNP	0.002	G
SH3TC2	79628	genome.wustl.edu	37	5	148392159	148392159	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr5:148392159C>A	ENST00000515425.1	-	13	3293	c.3192G>T	c.(3190-3192)gaG>gaT	p.E1064D	SH3TC2_ENST00000538184.1_Missense_Mutation_p.E611D|SH3TC2_ENST00000512049.1_Missense_Mutation_p.E1057D	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	1064					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGGCACAGCTCCACCAGCT	0.592																																																0			5											51.0	52.0	51.0					5																	148392159		2203	4300	6503	148372352	SO:0001583	missense	79628			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.3192G>T	5.37:g.148392159C>A	ENSP00000423660:p.Glu1064Asp	Somatic		Capture	Illumina GAIIx	4	148372352	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	superfamily_SH3-domain,HMMPfam_SH3_2,HMMPfam_SH3_1,HMMSmart_SM00326,HMMSmart_SM00028,superfamily_TPR-like,HMMPfam_TPR_1	p.E1064D	ENST00000515425.1	37	c.3192	CCDS4293.1	5	.	.	.	.	.	.	.	.	.	.	C	7.139	0.581414	0.13686	.	.	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049	T;T;T	0.76448	-0.99;-1.02;-0.99	5.67	1.32	0.21799	Tetratricopeptide-like helical (1);	0.066286	0.64402	D	0.000015	T	0.51466	0.1676	N	0.16166	0.38	0.80722	D	1	P;B;P	0.38617	0.64;0.391;0.64	B;B;B	0.34038	0.174;0.115;0.174	T	0.40627	-0.9553	10	0.13108	T	0.6	-17.6995	6.5013	0.22170	0.0:0.5297:0.134:0.3362	.	1057;1064;1064	Q14CC0;E9PDF1;Q8TF17	.;.;S3TC2_HUMAN	D	611;1064;1057	ENSP00000441427:E611D;ENSP00000423660:E1064D;ENSP00000421860:E1057D	ENSP00000425627:E1064D	E	-	3	2	SH3TC2	148372352	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.722000	0.25925	0.721000	0.32231	0.655000	0.94253	GAG	-	superfamily_TPR-like,HMMSmart_SM00028		0.592	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3TC2	protein_coding	OTTHUMT00000252186.2	C	NM_024577		148372352	-1	no_errors	NM_024577	genbank	human	reviewed	54_36p	missense	SNP	0.982	A
FBXW7	55294	genome.wustl.edu	37	4	153273826	153273826	+	Intron	SNP	A	A	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr4:153273826A>C	ENST00000281708.4	-	3	1731				FBXW7_ENST00000603548.1_Intron|FBXW7_ENST00000603841.1_Intron|FBXW7_ENST00000263981.5_Silent_p.V19V|FBXW7_ENST00000296555.5_Intron	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)			NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CCGGCAACAAAACTCCACAGT	0.443			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	0			4											73.0	69.0	70.0					4																	153273826		2203	4300	6503	153493276	SO:0001627	intron_variant	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.502-2550T>G	4.37:g.153273826A>C		Somatic		Capture	Illumina GAIIx	4	153493276	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Silent	SNP	superfamily_SSF81383,HMMPfam_F-box,HMMSmart_FBOX,superfamily_WD40_like,HMMSmart_WD40,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.V19	ENST00000281708.4	37	c.57	CCDS3777.1	4																																																																																			-	NULL		0.443	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	protein_coding	OTTHUMT00000469956.1	A			153493276	-1	no_errors	NM_018315	genbank	human	validated	54_36p	silent	SNP	1.000	C
SCAF8	22828	genome.wustl.edu	37	6	155153521	155153521	+	Silent	SNP	G	G	T			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr6:155153521G>T	ENST00000367178.3	+	20	3384	c.2808G>T	c.(2806-2808)ggG>ggT	p.G936G	SCAF8_ENST00000367186.4_Silent_p.G1002G|TIAM2_ENST00000461783.3_5'Flank|SCAF8_ENST00000417268.1_Silent_p.G936G	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	936	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						AGGCACCTGGGCCAAGATTCC	0.512																																																0			6											153.0	165.0	161.0					6																	155153521		2203	4300	6503	155195213	SO:0001819	synonymous_variant	22828			AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.2808G>T	6.37:g.155153521G>T		Somatic		Capture	Illumina GAIIx	4	155195213	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Silent	SNP	superfamily_ENTH_VHS,HMMSmart_RPR,HMMPfam_DUF618,superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1	p.G936	ENST00000367178.3	37	c.2808	CCDS5247.1	6																																																																																			-	NULL		0.512	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM16	protein_coding	OTTHUMT00000042798.1	G	NM_014892		155195213	+1	no_errors	NM_014892	genbank	human	validated	54_36p	silent	SNP	0.996	T
ADAMTS4	9507	genome.wustl.edu	37	1	161166005	161166005	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr1:161166005T>A	ENST00000367996.5	-	3	1474	c.1046A>T	c.(1045-1047)gAg>gTg	p.E349V	ADAMTS4_ENST00000367995.3_3'UTR|ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4	349	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	CCCATCATCCTCCACAATGGC	0.587																																																0			1											106.0	100.0	102.0					1																	161166005		2203	4300	6503	159432629	SO:0001583	missense	9507			AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.1046A>T	1.37:g.161166005T>A	ENSP00000356975:p.Glu349Val	Somatic		Capture	Illumina GAIIx	4	159432629	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Missense_Mutation	SNP	"HMMPfam_Pep_M12B_propep,superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin,HMMSmart_SM00608,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMPfam_ADAM_spacer1"	p.E349V	ENST00000367996.5	37	c.1046	CCDS1223.1	1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.419081	0.83559	.	.	ENSG00000158859	ENST00000367996	D	0.87256	-2.23	5.12	5.12	0.69794	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000005	D	0.94719	0.8296	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96062	0.9039	10	0.87932	D	0	.	14.0115	0.64500	0.0:0.0:0.0:1.0	.	349	O75173	ATS4_HUMAN	V	349	ENSP00000356975:E349V	ENSP00000356975:E349V	E	-	2	0	ADAMTS4	159432629	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	6.124000	0.71620	2.144000	0.66660	0.402000	0.26972	GAG	-	"superfamily_Metalloproteases (""zincins"") catalytic domain,HMMPfam_Reprolysin"		0.587	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS4	protein_coding	OTTHUMT00000083066.2	T	NM_005099		159432629	-1	no_errors	NM_005099	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
LY75	4065	genome.wustl.edu	37	2	160755339	160755339	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr2:160755339T>G	ENST00000263636.4	-	2	353	c.326A>C	c.(325-327)aAa>aCa	p.K109T	LY75_ENST00000554112.1_Missense_Mutation_p.K109T|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.K109T|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.K109T|LY75_ENST00000553424.1_Missense_Mutation_p.K109T	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	109	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		GTGCTCACATTTCCACCACAG	0.498																																																0			2											97.0	86.0	90.0					2																	160755339		2203	4300	6503	160463585	SO:0001583	missense	4065			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.326A>C	2.37:g.160755339T>G	ENSP00000263636:p.Lys109Thr	Somatic		Capture	Illumina GAIIx	4	160463585	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	superfamily_Ricin B-like lectins,HMMSmart_SM00458,superfamily_Kringle-like,HMMSmart_SM00059,HMMPfam_fn2,PatternScan_FN2_1,superfamily_C-type lectin-like,HMMSmart_SM00034,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1	p.K109T	ENST00000263636.4	37	c.326	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	T	17.64	3.440014	0.63067	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.92	5.92	0.95590	Ricin B-related lectin (1);Ricin B lectin (1);	0.000000	0.37437	N	0.002095	T	0.61123	0.2322	M	0.77820	2.39	0.39896	D	0.973839	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.983;0.94;0.998	T	0.67647	-0.5617	10	0.66056	D	0.02	-25.4612	6.3377	0.21304	0.0:0.1893:0.0:0.8107	.	109;109;109	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	T	109	ENSP00000451511:K109T;ENSP00000451446:K109T;ENSP00000263636:K109T;ENSP00000423463:K109T;ENSP00000421035:K109T	ENSP00000423463:K109T	K	-	2	0	LY75;LY75-CD302	160463585	1.000000	0.71417	0.996000	0.52242	0.586000	0.36452	3.090000	0.50191	2.274000	0.75844	0.533000	0.62120	AAA	-	superfamily_Ricin B-like lectins,HMMSmart_SM00458		0.498	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	protein_coding	OTTHUMT00000255035.1	T			160463585	-1	no_errors	NM_002349	genbank	human	validated	54_36p	missense	SNP	0.994	G
XIRP2	129446	genome.wustl.edu	37	2	168099401	168099401	+	Missense_Mutation	SNP	G	G	A	rs201393718	byFrequency	TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr2:168099401G>A	ENST00000409195.1	+	9	1588	c.1499G>A	c.(1498-1500)cGt>cAt	p.R500H	XIRP2_ENST00000409273.1_Missense_Mutation_p.R278H|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.R500H|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	325					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GAATTAAACCGTTTATATAAA	0.368													G|||	4	0.000798722	0.0	0.0	5008	,	,		19370	0.003		0.0	False		,,,				2504	0.001															0			2											40.0	38.0	39.0					2																	168099401		1803	4066	5869	167807647	SO:0001583	missense	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.1499G>A	2.37:g.168099401G>A	ENSP00000386840:p.Arg500His	Somatic		Capture	Illumina GAIIx	4	167807647	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	HMMPfam_Xin	p.R500H	ENST00000409195.1	37	c.1499	CCDS42769.1	2	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	23.1	4.378569	0.82682	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.19669	2.17;2.17;2.13	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.44746	0.1308	M	0.66939	2.045	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.999	T	0.35101	-0.9802	10	0.87932	D	0	-10.015	13.75	0.62901	0.0757:0.0:0.9243:0.0	.	325;325;278	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	H	500;500;278	ENSP00000386840:R500H;ENSP00000295237:R500H;ENSP00000387255:R278H	ENSP00000295237:R500H	R	+	2	0	XIRP2	167807647	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	4.222000	0.58580	2.615000	0.88500	0.655000	0.94253	CGT	-	NULL		0.368	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	protein_coding	OTTHUMT00000333547.1	G	NM_152381		167807647	+1	no_errors	NM_152381	genbank	human	validated	54_36p	missense	SNP	1.000	A
CACNA1E	777	genome.wustl.edu	37	1	181745244	181745244	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr1:181745244A>G	ENST00000367573.2	+	38	5147	c.5147A>G	c.(5146-5148)aAc>aGc	p.N1716S	CACNA1E_ENST00000526775.1_Missense_Mutation_p.N1697S|CACNA1E_ENST00000358338.5_Missense_Mutation_p.N1648S|CACNA1E_ENST00000367567.4_Missense_Mutation_p.N1323S|CACNA1E_ENST00000360108.3_Missense_Mutation_p.N1697S|CACNA1E_ENST00000367570.1_Missense_Mutation_p.N1716S|CACNA1E_ENST00000357570.5_Missense_Mutation_p.N1667S	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1716					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CAGATGCTCAACCTGTTTGTG	0.557																																																0			1											230.0	230.0	230.0					1																	181745244		2006	4184	6190	180011867	SO:0001583	missense	777			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5147A>G	1.37:g.181745244A>G	ENSP00000356545:p.Asn1716Ser	Somatic		Capture	Illumina GAIIx	4	180011867	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Ca_chan_IQ	p.N1716S	ENST00000367573.2	37	c.5147	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	A	29.8	5.038290	0.93630	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.99239	-5.61;-5.61;-5.61;-5.61;-5.61;-5.61;-5.61	5.83	5.83	0.93111	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99585	0.9850	H	0.94620	3.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.999;0.987	D	0.97920	1.0314	10	0.87932	D	0	.	15.8624	0.79035	1.0:0.0:0.0:0.0	.	1697;1716;1716	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	S	1716;1697;1667;1648;1323;1697;1716	ENSP00000356542:N1716S;ENSP00000434814:N1697S;ENSP00000350183:N1667S;ENSP00000351101:N1648S;ENSP00000356539:N1323S;ENSP00000353222:N1697S;ENSP00000356545:N1716S	ENSP00000350183:N1667S	N	+	2	0	CACNA1E	180011867	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.210000	0.95106	2.235000	0.73313	0.533000	0.62120	AAC	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.557	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	protein_coding	OTTHUMT00000090793.2	A	NM_000721		180011867	+1	no_errors	NM_000721	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
C1orf74	148304	genome.wustl.edu	37	1	209956631	209956631	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr1:209956631C>A	ENST00000294811.1	-	2	605	c.349G>T	c.(349-351)Gtt>Ttt	p.V117F		NM_152485.2	NP_689698.1	Q96LT6	CA074_HUMAN	chromosome 1 open reading frame 74	117										endometrium(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	15				OV - Ovarian serous cystadenocarcinoma(81;0.0328)		CAGCTGGAAACATCCACAAAG	0.532																																																0			1											59.0	55.0	56.0					1																	209956631		2203	4300	6503	208023254	SO:0001583	missense	148304			AK057807	CCDS1491.1	1q32.2	2008-02-05			ENSG00000162757	ENSG00000162757			26319	protein-coding gene	gene with protein product						12477932	Standard	NM_152485		Approved	FLJ25078	uc001hhp.1	Q96LT6	OTTHUMG00000036483	ENST00000294811.1:c.349G>T	1.37:g.209956631C>A	ENSP00000294811:p.Val117Phe	Somatic		Capture	Illumina GAIIx	4	208023254		Missense_Mutation	SNP	PatternScan_TONB_DEPENDENT_REC_1	p.V117F	ENST00000294811.1	37	c.349	CCDS1491.1	1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939521	0.52972	.	.	ENSG00000162757	ENST00000294811	T	0.66099	-0.19	5.61	4.5	0.54988	.	0.064498	0.64402	D	0.000010	T	0.77123	0.4084	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.79766	-0.1665	10	0.87932	D	0	-3.9708	15.0932	0.72211	0.0:0.9194:0.0:0.0806	.	117	Q96LT6	CA074_HUMAN	F	117	ENSP00000294811:V117F	ENSP00000294811:V117F	V	-	1	0	C1orf74	208023254	1.000000	0.71417	1.000000	0.80357	0.266000	0.26442	5.216000	0.65246	2.652000	0.90054	0.655000	0.94253	GTT	-	NULL		0.532	C1orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf74	protein_coding	OTTHUMT00000088745.1	C	NM_152485		208023254	-1	no_errors	NM_152485	genbank	human	predicted	54_36p	missense	SNP	1.000	A
CPS1	1373	genome.wustl.edu	37	2	211441215	211441215	+	Splice_Site	SNP	G	G	A			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr2:211441215G>A	ENST00000233072.5	+	3	577		c.e3+1		CPS1_ENST00000430249.2_Splice_Site	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial						anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TGGAATCAAGGTAGTACCAGT	0.408																																																0			2											126.0	120.0	122.0					2																	211441215		2203	4300	6503	211149460	SO:0001630	splice_region_variant	1373			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.381+1G>A	2.37:g.211441215G>A		Somatic		Capture	Illumina GAIIx	4	211149460	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Splice_Site	SNP	-	e3+1	ENST00000233072.5	37	c.381+1	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333994	0.60853	.	.	ENSG00000021826	ENST00000523702;ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	.	.	.	5.97	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4425	0.83906	0.0:0.0:0.8676:0.1324	.	.	.	.	.	-1	.	.	.	+	.	.	CPS1	211149460	1.000000	0.71417	0.992000	0.48379	0.657000	0.38888	9.188000	0.94921	1.493000	0.48517	0.655000	0.94253	.	-	-		0.408	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	protein_coding	OTTHUMT00000256569.5	G		Intron	211149460	+1	no_errors	NM_001875	genbank	human	reviewed	54_36p	splice_site	SNP	1.000	A
CDC14A	8556	genome.wustl.edu	37	1	100964497	100964515	+	Frame_Shift_Del	DEL	CTCCCGGCTAGCCAGTTCT	CTCCCGGCTAGCCAGTTCT	-	rs200850931|rs145305805		TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	CTCCCGGCTAGCCAGTTCT	CTCCCGGCTAGCCAGTTCT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr1:100964497_100964515delCTCCCGGCTAGCCAGTTCT	ENST00000336454.3	+	15	1789_1807	c.1434_1452delCTCCCGGCTAGCCAGTTCT	c.(1432-1452)aactcccggctagccagttctfs	p.NSRLASS478fs	CDC14A_ENST00000542213.1_Frame_Shift_Del_p.NSRLASS420fs|CDC14A_ENST00000370125.2_3'UTR|CDC14A_ENST00000544534.1_Frame_Shift_Del_p.NSRLASS478fs|CDC14A_ENST00000361544.6_Frame_Shift_Del_p.NSRLASS478fs	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	478					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		TTTCCATAAACTCCCGGCTAGCCAGTTCTCTAGGGAACT	0.447																																																0			1																																								100737103	SO:0001589	frameshift_variant	8556			AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.1434_1452delCTCCCGGCTAGCCAGTTCT	1.37:g.100964497_100964515delCTCCCGGCTAGCCAGTTCT	ENSP00000336739:p.Asn478fs	Somatic		Capture	Illumina GAIIx	4	100737085	A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Frame_Shift_Del	DEL	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00195,HMMSmart_SM00404,HMMPfam_DSPc,PatternScan_TYR_PHOSPHATASE_1	p.S479fs	ENST00000336454.3	37	c.1434_1452	CCDS769.1	1																																																																																			(deletion:cds_exon[100737073,100737523])	NULL		0.447	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDC14A	protein_coding	OTTHUMT00000030220.1	CTCCCGGCTAGCCAGTTCT	NM_033312		100737103	+1	no_errors	NM_033312	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
PTPN22	26191	genome.wustl.edu	37	1	114380859	114380859	+	Frame_Shift_Del	DEL	T	T	-			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr1:114380859delT	ENST00000359785.5	-	13	1298	c.1163delA	c.(1162-1164)gacfs	p.D388fs	PTPN22_ENST00000528414.1_Frame_Shift_Del_p.D333fs|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000420377.2_Frame_Shift_Del_p.D388fs|PTPN22_ENST00000538253.1_Frame_Shift_Del_p.D144fs|PTPN22_ENST00000525799.1_Frame_Shift_Del_p.D261fs	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	388					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGCATTTTTGTCAAAACTGTA	0.398																																																0			1											92.0	90.0	90.0					1																	114380859		2203	4300	6503	114182382	SO:0001589	frameshift_variant	26191			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.1163delA	1.37:g.114380859delT	ENSP00000352833:p.Asp388fs	Somatic		Capture	Illumina GAIIx	4	114182382	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Frame_Shift_Del	DEL	superfamily_SSF52799,HMMSmart_PTPc,HMMPfam_Y_phosphatase,PatternScan_TYR_PHOSPHATASE_1	p.D388fs	ENST00000359785.5	37	c.1163	CCDS863.1	1																																																																																			(deletion:cds_exon[114181735,114182552])	NULL		0.398	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	protein_coding	OTTHUMT00000033015.1	T	NM_015967		114182382	-1	no_errors	NM_015967	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.124	-
OR2T2	401992	genome.wustl.edu	37	1	248616272	248616272	+	Silent	SNP	A	A	C			TCGA-61-1903-01A-01W-0639-09	TCGA-61-1903-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	a67ce4fe-9da2-4eef-aa08-928658c25570	eaab9831-3f75-4083-9772-eba8674fd54c	g.chr1:248616272A>C	ENST00000342927.3	+	1	196	c.174A>C	c.(172-174)acA>acC	p.T58T		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCCTCCACACACCCATGTACT	0.507																																																0			1											97.0	107.0	104.0					1																	248616272		2202	4281	6483	246682895	SO:0001819	synonymous_variant	401992			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.174A>C	1.37:g.248616272A>C		Somatic		Capture	Illumina GAIIx	4	246682895	B2RNM1|B9EH01	Silent	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.T58	ENST00000342927.3	37	c.174	CCDS31116.1	1																																																																																			-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.507	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	protein_coding	OTTHUMT00000097421.1	A	NM_001004136		246682895	+1	no_errors	NM_001004136	genbank	human	provisional	54_36p	silent	SNP	0.354	C
