#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								3771	SO:0001628	intergenic_variant	4535																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	3771		Missense_Mutation	SNP	HMMPfam_NADHdh,PatternScan_COMPLEX1_ND1_1,PatternScan_COMPLEX1_ND1_2	p.L155P		37	c.464		MT																																																																																			-	HMMPfam_NADHdh	0	0					MT-ND1			T			3771	+1	no_errors	ENST00000361390	ensembl	human	known	54_36p	missense	SNP	NULL	C
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								7487	SO:0001628	intergenic_variant	0																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	7487		RNA	SNP	-	NULL		37	NULL		MT																																																																																			-	-	0	0					ENSG00000210151			G			7487	-1	no_errors	ENST00000387416	ensembl	human	novel	54_36p	rna	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								11494	SO:0001628	intergenic_variant	4538																															Unknown.37:g.0G>A		Somatic		Capture	Illumina GAIIx	4	11494		Missense_Mutation	SNP	HMMPfam_Oxidored_q5_N,HMMPfam_Oxidored_q1	p.R245H		37	c.734		MT																																																																																			-	HMMPfam_Oxidored_q1	0	0					MT-ND4			G			11494	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361381	ensembl	human	known	54_36p	missense	SNP	NULL	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	T	T	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrUnknown:0T>C								None (None upstream) : None (None downstream)																								0.0																																																0			MT																																								15310	SO:0001628	intergenic_variant	4519																															Unknown.37:g.0T>C		Somatic		Capture	Illumina GAIIx	4	15310		Missense_Mutation	SNP	superfamily_Transmembr_di-haem_cytochrome,HMMPfam_Cytochrom_B_N,HMMPfam_Cytochrom_B_C,superfamily_Cytochrome_b/b6_C	p.I188T		37	c.563		MT																																																																																			-	superfamily_Transmembr_di-haem_cytochrome,HMMPfam_Cytochrom_B_N	0	0					MT-CYB			T			15310	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000361789	ensembl	human	known	54_36p	missense	SNP	NULL	C
WNK1	65125	genome.wustl.edu	37	12	1005787	1005787	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr12:1005787A>C	ENST00000315939.6	+	24	6777	c.6134A>C	c.(6133-6135)aAt>aCt	p.N2045T	WNK1_ENST00000537687.1_Missense_Mutation_p.N2305T|WNK1_ENST00000530271.2_Missense_Mutation_p.N2543T|WNK1_ENST00000340908.4_Missense_Mutation_p.N1638T|WNK1_ENST00000535572.1_Missense_Mutation_p.N1797T	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	2045					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CCTAGCCAGAATCTAAGTCAA	0.463																																					Colon(19;451 567 6672 12618 28860)											0			12											49.0	50.0	50.0					12																	1005787		2203	4300	6503	876048	SO:0001583	missense	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.6134A>C	12.37:g.1005787A>C	ENSP00000313059:p.Asn2045Thr	Somatic		Capture	Illumina GAIIx	4	876048	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	superfamily_Kinase_like,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST	p.N2045T	ENST00000315939.6	37	c.6134	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	A	9.830	1.188262	0.21954	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000252477;ENST00000530271;ENST00000340908	T;T;T;T;T	0.70631	-0.5;-0.46;-0.46;-0.48;0.71	5.93	-11.9	0.00025	.	0.826958	0.11003	N	0.610336	T	0.50633	0.1627	L	0.36672	1.1	0.09310	N	0.999996	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.09377	0.004;0.003;0.001	T	0.20438	-1.0275	10	0.25751	T	0.34	0.0618	12.6542	0.56778	0.1685:0.3389:0.4926:0.0	.	1798;1797;2045	Q9H4A3-2;F5GWT4;Q9H4A3	.;.;WNK1_HUMAN	T	1797;2045;2305;1218;2543;1638	ENSP00000441972:N1797T;ENSP00000313059:N2045T;ENSP00000444465:N2305T;ENSP00000433548:N2543T;ENSP00000341292:N1638T	ENSP00000252477:N1218T	N	+	2	0	WNK1	876048	0.460000	0.25776	0.041000	0.18516	0.936000	0.57629	-0.769000	0.04710	-2.929000	0.00301	-1.231000	0.01572	AAT	-	NULL		0.463	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	protein_coding	OTTHUMT00000206683.1	A	NM_018979		876048	+1	no_errors	NM_018979	genbank	human	validated	54_36p	missense	SNP	0.508	C
IRX2	153572	genome.wustl.edu	37	5	2749663	2749663	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr5:2749663G>T	ENST00000382611.6	-	2	736	c.488C>A	c.(487-489)aCc>aAc	p.T163N	C5orf38_ENST00000334000.3_5'Flank|IRX2_ENST00000502957.1_5'UTR|C5orf38_ENST00000457752.2_5'Flank|IRX2_ENST00000302057.5_Missense_Mutation_p.T163N|C5orf38_ENST00000515640.1_5'Flank|C5orf38_ENST00000505778.1_5'Flank|C5orf38_ENST00000397835.4_5'Flank	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	163					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		GGCGAACCAGGTGGAGACCTG	0.602																																																0			5											174.0	148.0	157.0					5																	2749663		2203	4300	6503	2802663	SO:0001583	missense	153572			AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.488C>A	5.37:g.2749663G>T	ENSP00000372056:p.Thr163Asn	Somatic		Capture	Illumina GAIIx	4	2802663	Q68A19|Q7Z2I7	Missense_Mutation	SNP	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1,HMMSmart_IRO	p.T163N	ENST00000382611.6	37	c.488	CCDS3868.1	5	.	.	.	.	.	.	.	.	.	.	G	28.8	4.953648	0.92660	.	.	ENSG00000170561	ENST00000382611;ENST00000302057;ENST00000502957	D;D;D	0.89875	-2.58;-2.58;-2.58	4.85	4.85	0.62838	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.87042	0.6079	N	0.03253	-0.375	0.80722	D	1	D	0.58970	0.984	D	0.72982	0.979	D	0.88722	0.3230	10	0.33141	T	0.24	-29.4175	17.9697	0.89110	0.0:0.0:1.0:0.0	.	163	Q9BZI1	IRX2_HUMAN	N	163;163;70	ENSP00000372056:T163N;ENSP00000307006:T163N;ENSP00000426151:T70N	ENSP00000307006:T163N	T	-	2	0	IRX2	2802663	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.393000	0.97256	2.239000	0.73571	0.655000	0.94253	ACC	-	superfamily_Homeodomain_like,HMMSmart_HOX,HMMPfam_Homeobox,PatternScan_HOMEOBOX_1		0.602	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX2	protein_coding	OTTHUMT00000206749.2	G			2802663	-1	no_errors	NM_033267	genbank	human	validated	54_36p	missense	SNP	1.000	T
FAM90A20P	728430	genome.wustl.edu	37	8	7155474	7155474	+	IGR	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr8:7155474C>T								AF228730.2 (99364 upstream) : FAM66B (20587 downstream)																							GTGTTCGTGTCCCACCGAGCG	0.607																																																0			8											1.0	1.0	1.0					8																	7155474		2	10	12	7142884	SO:0001628	intergenic_variant	728430																															8.37:g.7155474C>T		Somatic		Capture	Illumina GAIIx	4	7142884		Silent	SNP	NULL	p.V441		37	c.1323		8																																																																																			-	NULL	0	0.607					FAM90A20			C			7142884	+1	no_errors	XM_001128051	genbank	human	model	54_36p	silent	SNP	0.002	T
ANKRD12	23253	genome.wustl.edu	37	18	9254628	9254628	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr18:9254628C>G	ENST00000262126.4	+	9	1603	c.1363C>G	c.(1363-1365)Caa>Gaa	p.Q455E	ANKRD12_ENST00000400020.3_Missense_Mutation_p.Q432E|ANKRD12_ENST00000383440.2_Missense_Mutation_p.Q432E	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	455						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TTCTGATATGCAAACCAAAAA	0.313																																																0			18											49.0	57.0	54.0					18																	9254628		2202	4286	6488	9244628	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.1363C>G	18.37:g.9254628C>G	ENSP00000262126:p.Gln455Glu	Somatic		Capture	Illumina GAIIx	4	9244628	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	superfamily_Ankyrin repeat,HMMSmart_SM00248,HMMPfam_Ank	p.Q455E	ENST00000262126.4	37	c.1363	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	C	3.203	-0.163262	0.06502	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158	T;T	0.04862	3.58;3.54	5.95	5.01	0.66863	.	0.049805	0.85682	D	0.000000	T	0.06142	0.0159	L	0.36672	1.1	0.30771	N	0.743008	B;B;B	0.28258	0.205;0.205;0.07	B;B;B	0.24394	0.053;0.036;0.016	T	0.04825	-1.0924	10	0.37606	T	0.19	-22.0863	11.714	0.51641	0.3769:0.623:0.0:0.0	.	82;432;455	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	E	432;455;162	ENSP00000372932:Q432E;ENSP00000262126:Q455E	ENSP00000262126:Q455E	Q	+	1	0	ANKRD12	9244628	0.998000	0.40836	0.899000	0.35326	0.348000	0.29142	5.178000	0.65037	2.827000	0.97445	0.650000	0.86243	CAA	-	superfamily_Ankyrin repeat		0.313	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	protein_coding	OTTHUMT00000254478.2	C	NM_015208		9244628	+1	no_errors	NM_015208	genbank	human	validated	54_36p	missense	SNP	0.963	G
TYK2	7297	genome.wustl.edu	37	19	10472497	10472497	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr19:10472497C>G	ENST00000525621.1	-	13	2389	c.1908G>C	c.(1906-1908)gaG>gaC	p.E636D	TYK2_ENST00000529370.1_Missense_Mutation_p.E636D|TYK2_ENST00000264818.6_Missense_Mutation_p.E636D|TYK2_ENST00000524462.1_Missense_Mutation_p.E451D	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	636	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CCACTCGTAGCTCCTGCCCAC	0.667																																																0			19											109.0	104.0	106.0					19																	10472497		2203	4300	6503	10333497	SO:0001583	missense	7297				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.1908G>C	19.37:g.10472497C>G	ENSP00000431885:p.Glu636Asp	Somatic		Capture	Illumina GAIIx	4	10333497	Q6QB10|Q96CH0	Missense_Mutation	SNP	PatternScan_FERM_1,PatternScan_FERM_2,HMMSmart_B41,superfamily_SSF55550,HMMSmart_SH2,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.E636D	ENST00000525621.1	37	c.1908	CCDS12236.1	19	.	.	.	.	.	.	.	.	.	.	C	10.51	1.371541	0.24771	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000543792;ENST00000529370	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	4.6	-0.511	0.11970	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.395064	0.20160	N	0.097975	T	0.69967	0.3170	L	0.45285	1.41	0.23620	N	0.997272	B;B	0.32302	0.363;0.151	B;B	0.33799	0.136;0.17	T	0.57539	-0.7794	10	0.36615	T	0.2	-19.501	1.8592	0.03185	0.1482:0.3832:0.29:0.1785	.	636;636	E9PPF2;P29597	.;TYK2_HUMAN	D	451;636;636;383;636	ENSP00000433203:E451D;ENSP00000431885:E636D;ENSP00000264818:E636D;ENSP00000432728:E636D	ENSP00000264818:E636D	E	-	3	2	TYK2	10333497	0.623000	0.27094	0.525000	0.27900	0.419000	0.31324	-0.157000	0.10085	0.040000	0.15660	-0.258000	0.10820	GAG	-	superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc		0.667	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	protein_coding	OTTHUMT00000389443.1	C			10333497	-1	no_errors	NM_003331	genbank	human	reviewed	54_36p	missense	SNP	0.883	G
MTOR	2475	genome.wustl.edu	37	1	11217297	11217297	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:11217297C>A	ENST00000361445.4	-	30	4457	c.4381G>T	c.(4381-4383)Gtg>Ttg	p.V1461L		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1461	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TCATAGGCCACAAGGGCATCC	0.542																																																0			1											167.0	136.0	147.0					1																	11217297		2203	4300	6503	11139884	SO:0001583	missense	2475			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4381G>T	1.37:g.11217297C>A	ENSP00000354558:p.Val1461Leu	Somatic		Capture	Illumina GAIIx	4	11139884	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_SSF48452,HMMPfam_FAT,HMMPfam_Rapamycin_bind,superfamily_FRAP_FKBP12_bind,superfamily_Kinase_like,HMMPfam_PI3_PI4_kinase,HMMSmart_PI3Kc,PatternScan_PI3_4_KINASE_1,PatternScan_PI3_4_KINASE_2,HMMPfam_FATC	p.V1461L	ENST00000361445.4	37	c.4381	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487308	0.44249	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.64438	-0.1	5.69	5.69	0.88448	PIK-related kinase (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.067589	0.64402	D	0.000016	T	0.44329	0.1288	N	0.04636	-0.2	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.29305	-1.0016	10	0.36615	T	0.2	.	19.8116	0.96549	0.0:1.0:0.0:0.0	.	1461	P42345	MTOR_HUMAN	L	1461	ENSP00000354558:V1461L	ENSP00000354558:V1461L	V	-	1	0	MTOR	11139884	1.000000	0.71417	0.215000	0.23724	0.780000	0.44128	4.482000	0.60257	2.674000	0.91012	0.655000	0.94253	GTG	-	superfamily_ARM-type_fold,superfamily_SSF48452		0.542	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAP1	protein_coding	OTTHUMT00000005558.1	C	NM_004958		11139884	-1	no_errors	NM_004958	genbank	human	reviewed	54_36p	missense	SNP	0.820	A
NMT2	9397	genome.wustl.edu	37	10	15175312	15175312	+	Missense_Mutation	SNP	G	G	A	rs540952796		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr10:15175312G>A	ENST00000378165.4	-	4	522	c.442C>T	c.(442-444)Cgc>Tgc	p.R148C	RPP38_ENST00000451677.1_Intron|NMT2_ENST00000378150.1_Missense_Mutation_p.R135C|NMT2_ENST00000535341.1_Missense_Mutation_p.R135C|NMT2_ENST00000540259.1_De_novo_Start_OutOfFrame	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	148					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						GGTTCTTGGCGTACGTTGTCT	0.398													G|||	1	0.000199681	0.0	0.0	5008	,	,		19974	0.0		0.0	False		,,,				2504	0.001				Melanoma(117;1345 1645 4130 12688 30625)											0			10											168.0	165.0	166.0					10																	15175312		2203	4300	6503	15215318	SO:0001583	missense	9397			AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.442C>T	10.37:g.15175312G>A	ENSP00000367407:p.Arg148Cys	Somatic		Capture	Illumina GAIIx	4	15215318	B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Missense_Mutation	SNP	superfamily_Acyl-CoA N-acyltransferases (Nat),HMMPfam_NMT,PatternScan_NMT_1,HMMPfam_NMT_C,PatternScan_NMT_2	p.R148C	ENST00000378165.4	37	c.442	CCDS7109.1	10	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324475	0.81580	.	.	ENSG00000152465	ENST00000378165;ENST00000378150;ENST00000378143;ENST00000535341	T	0.50277	0.75	5.81	5.81	0.92471	Acyl-CoA N-acyltransferase (2);Myristoyl-CoA:protein N-myristoyltransferase, N-terminal (1);	0.050733	0.85682	D	0.000000	T	0.69744	0.3145	H	0.95365	3.66	0.80722	D	1	P;P;P	0.51537	0.909;0.946;0.909	B;P;B	0.46510	0.381;0.519;0.381	T	0.80600	-0.1310	10	0.87932	D	0	-15.6528	20.0726	0.97729	0.0:0.0:1.0:0.0	.	148;135;148	B2RCF3;Q5VUC6;O60551	.;.;NMT2_HUMAN	C	148;135;179;135	ENSP00000367407:R148C	ENSP00000367385:R179C	R	-	1	0	NMT2	15215318	1.000000	0.71417	0.254000	0.24359	0.941000	0.58515	5.165000	0.64959	2.738000	0.93877	0.655000	0.94253	CGC	-	superfamily_Acyl-CoA N-acyltransferases (Nat),HMMPfam_NMT		0.398	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT2	protein_coding	OTTHUMT00000046958.2	G	NM_004808		15215318	-1	no_errors	NM_004808	genbank	human	reviewed	54_36p	missense	SNP	0.964	A
SPEN	23013	genome.wustl.edu	37	1	16260797	16260797	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:16260797G>A	ENST00000375759.3	+	11	8266	c.8062G>A	c.(8062-8064)Ggg>Agg	p.G2688R		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2688	RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CACCCCTGCTGGGCCCGTGAA	0.597																																																0			1											69.0	74.0	73.0					1																	16260797		2203	4300	6503	16133384	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.8062G>A	1.37:g.16260797G>A	ENSP00000364912:p.Gly2688Arg	Somatic		Capture	Illumina GAIIx	4	16133384	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1,superfamily_SPOC-like,HMMPfam_SPOC	p.G2688R	ENST00000375759.3	37	c.8062	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.888400	0.33348	.	.	ENSG00000065526	ENST00000375759	T	0.14640	2.49	3.76	3.76	0.43208	.	.	.	.	.	T	0.11239	0.0274	N	0.08118	0	0.25818	N	0.984319	D	0.58268	0.982	P	0.52909	0.713	T	0.17623	-1.0363	9	0.17832	T	0.49	-21.0029	11.3667	0.49677	0.0:0.0:1.0:0.0	.	2688	Q96T58	MINT_HUMAN	R	2688	ENSP00000364912:G2688R	ENSP00000364912:G2688R	G	+	1	0	SPEN	16133384	0.991000	0.36638	0.468000	0.27192	0.689000	0.40095	2.873000	0.48475	2.392000	0.81423	0.561000	0.74099	GGG	-	NULL		0.597	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	protein_coding	OTTHUMT00000025993.1	G	NM_015001		16133384	+1	no_errors	NM_015001	genbank	human	reviewed	54_36p	missense	SNP	0.567	A
CTAGE1	64693	genome.wustl.edu	37	18	19995759	19995759	+	5'Flank	SNP	C	C	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr18:19995759C>A	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.L672F			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					CTACTGGAAACAATAAACCTC	0.483																																																0			18											98.0	108.0	105.0					18																	19995759		2202	4293	6495	18249757	SO:0001631	upstream_gene_variant	64693			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19995759C>A	Exception_encountered	Somatic		Capture	Illumina GAIIx	4	18249757	B0YIZ3	Missense_Mutation	SNP	NULL	p.L672F	ENST00000525417.1	37	c.2016		18	.	.	.	.	.	.	.	.	.	.	C	7.092	0.572280	0.13623	.	.	ENSG00000212710	ENST00000391403	T	0.10099	2.91	0.614	-0.676	0.11361	.	.	.	.	.	T	0.11623	0.0283	M	0.68952	2.095	0.09310	N	1	B	0.18610	0.029	B	0.28709	0.093	T	0.39542	-0.9609	7	.	.	.	.	.	.	.	.	672	Q96RT6	CTGE2_HUMAN	F	672	ENSP00000375220:L672F	.	L	-	3	2	CTAGE1	18249757	0.282000	0.24268	0.039000	0.18376	0.002000	0.02628	0.028000	0.13644	-0.663000	0.05331	-1.261000	0.01458	TTG	-	NULL		0.483	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	CTAGE1	protein_coding	OTTHUMT00000386767.1	C	NM_022663, NM_172241		18249757	-1	no_errors	NM_172241	genbank	human	validated	54_36p	missense	SNP	0.001	A
NCAN	1463	genome.wustl.edu	37	19	19338174	19338174	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr19:19338174C>G	ENST00000252575.6	+	8	1844	c.1745C>G	c.(1744-1746)gCc>gGc	p.A582G	NCAN_ENST00000538881.1_Missense_Mutation_p.A33G	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	582					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	CACAGCAGGGCCCCTGTCCTG	0.647																																																0			19											49.0	56.0	54.0					19																	19338174		2203	4300	6503	19199174	SO:0001583	missense	1463			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.1745C>G	19.37:g.19338174C>G	ENSP00000252575:p.Ala582Gly	Somatic		Capture	Illumina GAIIx	4	19199174	Q9UPK6	Missense_Mutation	SNP	superfamily_SSF48726,HMMSmart_IG,superfamily_C-type_lectin_fold,HMMSmart_LINK,HMMPfam_Xlink,PatternScan_LINK_1,superfamily_SSF57196,HMMSmart_EGF,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMSmart_EGF_CA,PatternScan_ASX_HYDROXYL,HMMSmart_CLECT,HMMPfam_Lectin_C,PatternScan_C_TYPE_LECTIN_1,superfamily_Complement_control_module,HMMPfam_Sushi,HMMSmart_CCP	p.A582G	ENST00000252575.6	37	c.1745	CCDS12397.1	19	.	.	.	.	.	.	.	.	.	.	C	11.69	1.714608	0.30413	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	D;D	0.85629	-1.86;-2.01	4.02	-1.38	0.09027	.	0.938887	0.08714	N	0.904503	T	0.65657	0.2712	N	0.24115	0.695	0.09310	N	1	P;B	0.39480	0.675;0.421	B;B	0.29862	0.108;0.05	T	0.56238	-0.8012	10	0.15952	T	0.53	.	4.0793	0.09919	0.0:0.376:0.3781:0.2459	.	596;582	Q4LE67;O14594	.;NCAN_HUMAN	G	596;582;33	ENSP00000252575:A582G;ENSP00000442202:A33G	ENSP00000252575:A582G	A	+	2	0	NCAN	19199174	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-1.167000	0.03126	0.071000	0.16664	0.313000	0.20887	GCC	-	NULL		0.647	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAN	protein_coding	OTTHUMT00000460111.2	C	NM_004386		19199174	+1	no_errors	NM_004386	genbank	human	validated	54_36p	missense	SNP	0.000	G
LAMA3	3909	genome.wustl.edu	37	18	21399905	21399905	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr18:21399905C>G	ENST00000313654.9	+	19	2489	c.2248C>G	c.(2248-2250)Ccg>Gcg	p.P750A	LAMA3_ENST00000399516.3_Missense_Mutation_p.P750A	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	750					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TGGATTTGATCCGCTGGCATT	0.468																																																0			18											130.0	125.0	127.0					18																	21399905		1937	4131	6068	19653903	SO:0001583	missense	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.2248C>G	18.37:g.21399905C>G	ENSP00000324532:p.Pro750Ala	Somatic		Capture	Illumina GAIIx	4	19653903	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	HMMSmart_SM00136,HMMPfam_Laminin_N,superfamily_Galactose-binding domain-like,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_LAM_1,HMMSmart_SM00181,HMMSmart_SM00281,HMMPfam_Laminin_B,PatternScan_EGF_2,HMMPfam_Laminin_I,HMMPfam_Laminin_II,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2,PatternScan_CHAPERONINS_CPN60	p.P750A	ENST00000313654.9	37	c.2248	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305043	0.60305	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.19250	2.17;2.16	5.47	4.59	0.56863	.	.	.	.	.	T	0.37705	0.1013	M	0.80847	2.515	0.80722	D	1	D;D	0.59767	0.986;0.983	P;P	0.53450	0.726;0.723	T	0.31558	-0.9939	9	0.66056	D	0.02	.	9.8264	0.40914	0.0:0.7864:0.1409:0.0727	.	750;750	Q6VU67;Q16787	.;LAMA3_HUMAN	A	750;750;748	ENSP00000324532:P750A;ENSP00000382432:P750A	ENSP00000324532:P750A	P	+	1	0	LAMA3	19653903	0.998000	0.40836	1.000000	0.80357	0.557000	0.35523	2.398000	0.44486	1.308000	0.44962	-0.314000	0.08810	CCG	-	NULL		0.468	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	protein_coding	OTTHUMT00000254824.3	C	NM_000227, NM_198129		19653903	+1	no_errors	NM_198129	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
MINOS1	440574	genome.wustl.edu	37	1	19934845	19934845	+	Intron	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:19934845G>A	ENST00000322753.6	+	1	120				MINOS1_ENST00000486890.1_Intron|MINOS1-NBL1_ENST00000602662.1_Intron	NM_001032363.3|NM_001204082.1|NM_001204083.1	NP_001027535.1|NP_001191011.1|NP_001191012.1	Q5TGZ0	MIC10_HUMAN	mitochondrial inner membrane organizing system 1							integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)											GACCACCCAGGATGTGGCCCA	0.557																																																0			1																																								19807432	SO:0001627	intron_variant	644068			AK094318	CCDS30620.1, CCDS72719.1	1p36.13	2013-10-11	2011-10-04	2011-10-04	ENSG00000173436	ENSG00000173436			32068	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 151"""	C1orf151		21944719	Standard	NM_001032363		Approved	RP5-1056L3.2, FLJ36999, MIO10	uc021ohu.1	Q5TGZ0	OTTHUMG00000002712	ENST00000322753.6:c.64+11242G>A	1.37:g.19934845G>A		Somatic		Capture	Illumina GAIIx	4	19807432	Q96G68	Missense_Mutation	SNP	superfamily_Translational machinery components,HMMPfam_Ribosomal_S11,PatternScan_RIBOSOMAL_S11	p.D80N	ENST00000322753.6	37	c.238	CCDS30620.1	1																																																																																			-	superfamily_Translational machinery components,HMMPfam_Ribosomal_S11		0.557	MINOS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGC87895	protein_coding	OTTHUMT00000007697.2	G	NM_001032363		19807432	+1	pseudogene	XM_930106	genbank	human	model	54_36p	missense	SNP	1.000	A
MLLT10	8028	genome.wustl.edu	37	10	22023050	22023050	+	Silent	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr10:22023050G>A	ENST00000307729.7	+	20	3028	c.2850G>A	c.(2848-2850)ctG>ctA	p.L950L	MLLT10_ENST00000446906.2_Silent_p.L950L|MLLT10_ENST00000377059.3_Silent_p.L950L|MLLT10_ENST00000377072.3_Silent_p.L966L			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	950					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						CAGCTACACTGACTAACAGGT	0.448			T	"""MLL, PICALM, CDK6"""	AL																																		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0			10											108.0	93.0	98.0					10																	22023050		2203	4300	6503	22063056	SO:0001819	synonymous_variant	8028			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.2850G>A	10.37:g.22023050G>A		Somatic		Capture	Illumina GAIIx	4	22063056	B1ANA8|Q5JT37|Q5VX90|Q66K63	Silent	SNP	superfamily_FYVE_PHD_ZnF,HMMSmart_PHD,HMMPfam_PHD,PatternScan_ZF_PHD_1	p.L966	ENST00000307729.7	37	c.2898	CCDS55708.1	10																																																																																			-	NULL		0.448	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	protein_coding	OTTHUMT00000047136.1	G			22063056	+1	no_errors	NM_004641	genbank	human	validated	54_36p	silent	SNP	0.879	A
RPP21	79897	genome.wustl.edu	37	6	30314223	30314223	+	Missense_Mutation	SNP	C	C	G	rs539399498		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr6:30314223C>G	ENST00000442966.2	+	4	269	c.256C>G	c.(256-258)Cgc>Ggc	p.R86G	RPP21_ENST00000433076.2_Missense_Mutation_p.R94G|RPP21_ENST00000428040.2_Missense_Mutation_p.R109G|RPP21_ENST00000466327.1_3'UTR|RPP21_ENST00000436442.2_Missense_Mutation_p.R86G|TRIM39-RPP21_ENST00000513556.1_Missense_Mutation_p.R347G			Q9H633	RPP21_HUMAN	ribonuclease P/MRP 21kDa subunit	86					response to drug (GO:0042493)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|ribonuclease P activity (GO:0004526)			endometrium(2)|ovary(1)|prostate(1)	4						CAGGGGACAGCGCTGGACCGT	0.562																																																0			6											74.0	71.0	72.0					6																	30314223		2203	4300	6503	30422202	SO:0001583	missense	79897			AK026291	CCDS4679.1, CCDS56409.1, CCDS56410.1	6p21.32	2012-05-21	2007-06-26	2004-03-19	ENSG00000241370	ENSG00000241370			21300	protein-coding gene	gene with protein product		612524	"""chromosome 6 open reading frame 135"", ""ribonuclease P 21kDa subunit"""	C6orf135			Standard	NM_001199120		Approved	FLJ22638, Em:AB014085.3		Q9H633	OTTHUMG00000031220	ENST00000442966.2:c.256C>G	6.37:g.30314223C>G	ENSP00000403833:p.Arg86Gly	Somatic		Capture	Illumina GAIIx	4	30422202	A2AAZ8|B0S834|B0S835|Q5JPL9|Q5JPM1|Q5STF8|Q5STF9|Q5STG2|Q5SU41|Q5SU42|Q86Y49|Q86Y50|Q86Y51|Q96F16	Missense_Mutation	SNP	HMMPfam_Rpr2	p.R86G	ENST00000442966.2	37	c.256	CCDS4679.1	6	.	.	.	.	.	.	.	.	.	.	C	21.5	4.156559	0.78114	.	.	ENSG00000204599;ENSG00000248167;ENSG00000241370;ENSG00000241370;ENSG00000241370;ENSG00000241370	ENST00000412529;ENST00000513556;ENST00000433076;ENST00000442966;ENST00000428040;ENST00000436442	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	5.87	5.01	0.66863	.	0.246350	0.40908	D	0.000996	T	0.28732	0.0712	M	0.65975	2.015	0.45899	D	0.998741	P;B;B;B	0.35226	0.491;0.017;0.059;0.132	B;B;B;B	0.34590	0.186;0.011;0.069;0.05	T	0.31194	-0.9952	10	0.87932	D	0	-12.0729	11.4778	0.50308	0.0:0.917:0.0:0.083	.	349;86;86;109	F5H2V3;Q9H633-3;Q9H633;Q9H633-2	.;.;RPP21_HUMAN;.	G	349;347;94;86;109;86	ENSP00000424048:R347G;ENSP00000409799:R94G;ENSP00000403833:R86G;ENSP00000394320:R109G;ENSP00000397778:R86G	ENSP00000394320:R109G	R	+	1	0	RPP21;TRIM39-RPP21;TRIM39	30422202	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.534000	0.45676	1.626000	0.50381	0.655000	0.94253	CGC	-	HMMPfam_Rpr2		0.562	RPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPP21	protein_coding	OTTHUMT00000076451.2	C	NM_024839		30422202	+1	no_errors	NM_024839	genbank	human	provisional	54_36p	missense	SNP	1.000	G
PPP1R18	170954	genome.wustl.edu	37	6	30653319	30653319	+	Silent	SNP	G	G	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr6:30653319G>T	ENST00000274853.3	-	1	2353	c.477C>A	c.(475-477)gcC>gcA	p.A159A	PPP1R18_ENST00000399199.3_Silent_p.A159A|PPP1R18_ENST00000488324.1_Intron|NRM_ENST00000470733.1_5'Flank	NM_133471.3	NP_597728.1	Q6NYC8	PPR18_HUMAN	protein phosphatase 1, regulatory subunit 18	159						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											TCAACTCTTGGGCTCCCCCTA	0.607																																																0			6											146.0	162.0	157.0					6																	30653319		1210	2511	3721	30761298	SO:0001819	synonymous_variant	170954			AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949		11853319	Standard	NM_001134870		Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.477C>A	6.37:g.30653319G>T		Somatic		Capture	Illumina GAIIx	4	30761298	A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	Silent	SNP	NULL	p.A159	ENST00000274853.3	37	c.477	CCDS43444.1	6																																																																																			-	NULL		0.607	PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1949	protein_coding	OTTHUMT00000076498.2	G	NM_133471		30761298	-1	no_errors	NM_133471	genbank	human	validated	54_36p	silent	SNP	0.001	T
SETD1A	9739	genome.wustl.edu	37	16	30974875	30974875	+	Splice_Site	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr16:30974875G>C	ENST00000262519.8	+	5	1325	c.639G>C	c.(637-639)acG>acC	p.T213T		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	213					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CCACTGAGACGGTGAGAAGTT	0.597																																																0			16											50.0	53.0	52.0					16																	30974875		2197	4300	6497	30882376	SO:0001630	splice_region_variant	9739			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.639+1G>C	16.37:g.30974875G>C		Somatic		Capture	Illumina GAIIx	4	30882376	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	superfamily_SSF54928,HMMSmart_RRM,HMMPfam_RRM_1,superfamily_SSF82199,HMMPfam_SET,HMMSmart_SET,HMMSmart_PostSET	p.T213	ENST00000262519.8	37	c.639	CCDS32435.1	16																																																																																			-	NULL		0.597	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	protein_coding	OTTHUMT00000318244.2	G	NM_014712	Silent	30882376	+1	no_errors	NM_014712	genbank	human	provisional	54_36p	silent	SNP	1.000	C
ITGAM	3684	genome.wustl.edu	37	16	31308847	31308847	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr16:31308847T>C	ENST00000287497.8	+	13	1444	c.1369T>C	c.(1369-1371)Ttc>Ctc	p.F457L	ITGAM_ENST00000544665.3_Missense_Mutation_p.F457L			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	457					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						CGGCGCCTACTTCGGGGCCTC	0.587																																																0			16											118.0	129.0	125.0					16																	31308847		2190	4293	6483	31216348	SO:0001583	missense	3684			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.1369T>C	16.37:g.31308847T>C	ENSP00000287497:p.Phe457Leu	Somatic		Capture	Illumina GAIIx	4	31216348	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	superfamily_SSF69318,HMMSmart_Int_alpha,superfamily_SSF53300,HMMSmart_VWA,HMMPfam_VWA,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_SSF69179,PatternScan_INTEGRIN_ALPHA,HMMPfam_Integrin_alpha	p.F457L	ENST00000287497.8	37	c.1369	CCDS45470.1	16	.	.	.	.	.	.	.	.	.	.	T	13.49	2.253636	0.39797	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.28454	1.61;1.61	3.73	3.73	0.42828	.	.	.	.	.	T	0.55226	0.1907	H	0.95574	3.69	0.45837	D	0.998707	D;P	0.58970	0.984;0.926	P;P	0.53360	0.724;0.605	T	0.66364	-0.5942	9	0.66056	D	0.02	.	9.0074	0.36120	0.0:0.0:0.0:1.0	.	457;457	Q4VAK1;P11215	.;ITAM_HUMAN	L	457	ENSP00000441691:F457L;ENSP00000287497:F457L	ENSP00000287497:F457L	F	+	1	0	ITGAM	31216348	1.000000	0.71417	0.992000	0.48379	0.835000	0.47333	5.992000	0.70609	1.682000	0.51000	0.533000	0.62120	TTC	-	superfamily_SSF69318,HMMSmart_Int_alpha,HMMPfam_FG-GAP		0.587	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	protein_coding	OTTHUMT00000432816.1	T	NM_000632		31216348	+1	no_errors	NM_000632	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
STT3B	201595	genome.wustl.edu	37	3	31674583	31674583	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr3:31674583G>C	ENST00000295770.2	+	15	2553	c.2344G>C	c.(2344-2346)Gat>Cat	p.D782H		NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	782					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						GGAGACATTAGATCACAAACC	0.378																																																0			3											80.0	78.0	79.0					3																	31674583		2203	4300	6503	31649587	SO:0001583	missense	201595			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.2344G>C	3.37:g.31674583G>C	ENSP00000295770:p.Asp782His	Somatic		Capture	Illumina GAIIx	4	31649587	Q96JZ4|Q96KY7	Missense_Mutation	SNP	HMMPfam_STT3	p.D782H	ENST00000295770.2	37	c.2344	CCDS2650.1	3	.	.	.	.	.	.	.	.	.	.	G	15.79	2.938611	0.52972	.	.	ENSG00000163527	ENST00000295770	D	0.93133	-3.17	5.48	3.67	0.42095	.	0.208186	0.48286	D	0.000183	D	0.87881	0.6289	N	0.25647	0.755	0.41812	D	0.989978	B	0.29037	0.231	B	0.29942	0.109	D	0.86332	0.1699	10	0.52906	T	0.07	-7.1641	11.6298	0.51166	0.1436:0.0:0.8564:0.0	.	782	Q8TCJ2	STT3B_HUMAN	H	782	ENSP00000295770:D782H	ENSP00000295770:D782H	D	+	1	0	STT3B	31649587	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.662000	0.74426	1.458000	0.47871	0.655000	0.94253	GAT	-	NULL		0.378	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	protein_coding	OTTHUMT00000253166.2	G	NM_178862		31649587	+1	no_errors	NM_178862	genbank	human	provisional	54_36p	missense	SNP	1.000	C
CTNNBL1	56259	genome.wustl.edu	37	20	36488345	36488345	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr20:36488345G>C	ENST00000361383.6	+	14	1554	c.1437G>C	c.(1435-1437)gaG>gaC	p.E479D	CTNNBL1_ENST00000473857.1_3'UTR|CTNNBL1_ENST00000405275.2_Missense_Mutation_p.E452D|CTNNBL1_ENST00000373469.1_Missense_Mutation_p.E227D|CTNNBL1_ENST00000373473.1_Missense_Mutation_p.E292D	NM_030877.3	NP_110517.2	Q8WYA6	CTBL1_HUMAN	catenin, beta like 1	479					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|positive regulation of apoptotic process (GO:0043065)|RNA splicing (GO:0008380)|somatic diversification of immunoglobulins (GO:0016445)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(6)|lung(6)|ovary(3)|urinary_tract(1)	28		Myeloproliferative disorder(115;0.00878)				ACACCGAGGAGGAGTTCTACC	0.522																																					Ovarian(184;582 2038 3273 4106 42608)											0			20											56.0	53.0	54.0					20																	36488345		2203	4300	6503	35921759	SO:0001583	missense	56259			AL023804	CCDS13298.1	20q11.23-q12	2011-06-03	2002-05-27	2002-05-31	ENSG00000132792	ENSG00000132792			15879	protein-coding gene	gene with protein product	"""nuclear associated protein"""	611537	"""chromosome 20 open reading frame 33"""	C20orf33		12659813, 21385873	Standard	NM_030877		Approved	FLJ21108, P14L, P14, NAP, NYD-SP19	uc021wdj.1	Q8WYA6	OTTHUMG00000032428	ENST00000361383.6:c.1437G>C	20.37:g.36488345G>C	ENSP00000355050:p.Glu479Asp	Somatic		Capture	Illumina GAIIx	4	35921759	B4DE16|Q0VAL9|Q0VAM0|Q53HI8|Q5JWZ2|Q5JWZ3|Q5JWZ7|Q5JWZ8|Q8N454|Q8NCL2|Q8TBD6|Q96KD2|Q9H7A5|Q9NQF9|Q9NTX0|Q9Y3M7	Missense_Mutation	SNP	HMMPfam_DUF1716,superfamily_ARM repeat	p.E479D	ENST00000361383.6	37	c.1437	CCDS13298.1	20	.	.	.	.	.	.	.	.	.	.	G	0.885	-0.727561	0.03158	.	.	ENSG00000132792	ENST00000361383;ENST00000405275;ENST00000373473;ENST00000373469	T;T;T;T	0.41065	1.04;1.04;1.02;1.01	5.28	-1.12	0.09808	.	0.088043	0.85682	N	0.000000	T	0.18002	0.0432	N	0.16307	0.4	0.34552	D	0.71141	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.35624	-0.9781	10	0.06757	T	0.87	-17.0254	6.8533	0.24026	0.0:0.4344:0.2446:0.321	.	479;292	Q8WYA6;Q8WYA6-2	CTBL1_HUMAN;.	D	479;452;292;227	ENSP00000355050:E479D;ENSP00000384355:E452D;ENSP00000362572:E292D;ENSP00000362568:E227D	ENSP00000355050:E479D	E	+	3	2	CTNNBL1	35921759	0.087000	0.21565	0.996000	0.52242	0.607000	0.37147	-0.599000	0.05700	-0.201000	0.10284	-0.397000	0.06425	GAG	-	superfamily_ARM repeat		0.522	CTNNBL1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CTNNBL1	protein_coding	OTTHUMT00000079125.1	G	NM_030877		35921759	+1	no_errors	NM_030877	genbank	human	reviewed	54_36p	missense	SNP	0.874	C
BAIAP2L2	80115	genome.wustl.edu	37	22	38493113	38493113	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr22:38493113C>T	ENST00000381669.3	-	7	682	c.538G>A	c.(538-540)Gag>Aag	p.E180K	BAIAP2L2_ENST00000332536.5_Missense_Mutation_p.E180K	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	180	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					CGCCGCTTCTCTTCCAATTCA	0.612																																																0			22											32.0	40.0	37.0					22																	38493113		2090	4220	6310	36823059	SO:0001583	missense	80115			BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.538G>A	22.37:g.38493113C>T	ENSP00000371085:p.Glu180Lys	Somatic		Capture	Illumina GAIIx	4	36823059	B0QYE2|Q96BG7	Missense_Mutation	SNP	HMMPfam_IMD,superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2	p.E180K	ENST00000381669.3	37	c.538	CCDS43018.1	22	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413764	0.83449	.	.	ENSG00000128298	ENST00000381669;ENST00000402500;ENST00000332536	.	.	.	4.78	3.68	0.42216	IRSp53/MIM homology domain (IMD) (3);	0.051953	0.85682	D	0.000000	T	0.74489	0.3723	M	0.76170	2.325	0.80722	D	1	D	0.64830	0.994	P	0.58970	0.849	T	0.79451	-0.1798	9	0.87932	D	0	-18.2831	14.7031	0.69168	0.0:0.8543:0.1457:0.0	.	180	Q6UXY1	BI2L2_HUMAN	K	180	.	ENSP00000328876:E180K	E	-	1	0	BAIAP2L2	36823059	1.000000	0.71417	0.993000	0.49108	0.638000	0.38207	3.562000	0.53777	2.368000	0.80403	0.462000	0.41574	GAG	-	HMMPfam_IMD		0.612	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L2	protein_coding	OTTHUMT00000321727.1	C	NM_025045		36823059	-1	no_errors	NM_025045	genbank	human	validated	54_36p	missense	SNP	1.000	T
NECAP1P1	442668	genome.wustl.edu	37	7	37625332	37625332	+	IGR	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr7:37625332G>C								ELMO1 (136480 upstream) : GPR141 (98066 downstream)																							GAGGAGGACAGTGGGGGAATA	0.502																																																0			7																																								37591857	SO:0001628	intergenic_variant	442668																															7.37:g.37625332G>C		Somatic		Capture	Illumina GAIIx	4	37591857		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.502					LOC442668			G			37591857	-1	pseudogene	XR_017442	genbank	human	model	54_36p	rna	SNP	0.040	C
SCN11A	11280	genome.wustl.edu	37	3	38913741	38913741	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr3:38913741G>C	ENST00000302328.3	-	20	3636	c.3438C>G	c.(3436-3438)ttC>ttG	p.F1146L	SCN11A_ENST00000450244.1_Missense_Mutation_p.F1146L|SCN11A_ENST00000456224.3_Missense_Mutation_p.F1108L|SCN11A_ENST00000444237.2_Missense_Mutation_p.F1146L	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1146					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTAGAGTCCGGAAGGACTTCA	0.478																																																0			3											133.0	129.0	130.0					3																	38913741		2203	4300	6503	38888745	SO:0001583	missense	11280			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3438C>G	3.37:g.38913741G>C	ENSP00000307599:p.Phe1146Leu	Somatic		Capture	Illumina GAIIx	4	38888745	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc	p.F1146L	ENST00000302328.3	37	c.3438	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	G	2.987	-0.209065	0.06140	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.97924	-4.61;-4.61;-4.61;-4.61	5.54	1.12	0.20585	Ion transport (1);	0.245560	0.41097	N	0.000944	D	0.84853	0.5564	N	0.00608	-1.33	0.36284	D	0.855942	B	0.06786	0.001	B	0.10450	0.005	T	0.80714	-0.1259	10	0.02654	T	1	.	5.523	0.16943	0.2361:0.2873:0.4766:0.0	.	1146	Q9UI33	SCNBA_HUMAN	L	1146;1146;1108;1146	ENSP00000307599:F1146L;ENSP00000400945:F1146L;ENSP00000416757:F1108L;ENSP00000408028:F1146L	ENSP00000307599:F1146L	F	-	3	2	SCN11A	38888745	0.221000	0.23642	0.995000	0.50966	0.011000	0.07611	-0.394000	0.07296	0.661000	0.30985	0.561000	0.74099	TTC	-	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans		0.478	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	protein_coding	OTTHUMT00000109746.4	G	NM_014139		38888745	-1	no_errors	NM_014139	genbank	human	validated	54_36p	missense	SNP	0.996	C
RIT2	6014	genome.wustl.edu	37	18	40695395	40695395	+	Silent	SNP	T	T	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr18:40695395T>G	ENST00000326695.5	-	1	261	c.90A>C	c.(88-90)ggA>ggC	p.G30G	RIT2_ENST00000590910.1_Silent_p.G30G|RIT2_ENST00000282028.4_Silent_p.G30G|RIT2_ENST00000589109.1_Silent_p.G30G	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	30					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTTTACCAACTCCCCCTGCTC	0.507																																																0			18											128.0	126.0	127.0					18																	40695395		2203	4300	6503	38949393	SO:0001819	synonymous_variant	6014			BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.90A>C	18.37:g.40695395T>G		Somatic		Capture	Illumina GAIIx	4	38949393	B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176	p.G30	ENST00000326695.5	37	c.90	CCDS11921.1	18																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMSmart_SM00173,HMMSmart_SM00175,HMMPfam_Ras,HMMSmart_SM00174,HMMSmart_SM00176		0.507	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIT2	protein_coding	OTTHUMT00000255852.1	T	NM_002930		38949393	-1	no_errors	NM_002930	genbank	human	provisional	54_36p	silent	SNP	1.000	G
PABPC4	8761	genome.wustl.edu	37	1	40029570	40029570	+	Missense_Mutation	SNP	G	G	C	rs376164599		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:40029570G>C	ENST00000372857.3	-	11	2222	c.1430C>G	c.(1429-1431)gCt>gGt	p.A477G	PABPC4_ENST00000372858.3_Missense_Mutation_p.A493G|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372856.3_Intron|PABPC4_ENST00000372862.3_Intron	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	477					blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AAAGTCCATAGCCAAGCGGTC	0.577																																																0			1											72.0	70.0	71.0					1																	40029570		2203	4300	6503	39802157	SO:0001583	missense	8761			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.1430C>G	1.37:g.40029570G>C	ENSP00000361948:p.Ala477Gly	Somatic		Capture	Illumina GAIIx	4	39802157	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	superfamily_RNA-binding domain RBD,HMMSmart_SM00360,HMMPfam_RRM_1,HMMSmart_SM00361,superfamily_PABC (PABP) domain,HMMPfam_PABP,HMMSmart_SM00517	p.A477G	ENST00000372857.3	37	c.1430	CCDS438.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.22|10.22	1.290243|1.290243	0.23478|0.23478	.|.	.|.	ENSG00000090621|ENSG00000090621	ENST00000372858;ENST00000372857|ENST00000437136;ENST00000421687	T;T|.	0.45276|.	0.9;1.51|.	4.22|4.22	4.22|4.22	0.49857|0.49857	.|.	0.228496|.	0.31082|.	N|.	0.008297|.	T|T	0.49575|0.49575	0.1565|0.1565	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.0|.	T|T	0.38520|0.38520	-0.9657|-0.9657	10|5	0.08837|.	T|.	0.75|.	.|.	12.3787|12.3787	0.55295|0.55295	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	477;493|.	Q13310;Q4VC03|.	PABP4_HUMAN;.|.	G|V	493;477|32;395	ENSP00000361949:A493G;ENSP00000361948:A477G|.	ENSP00000361948:A477G|.	A|L	-|-	2|1	0|2	PABPC4|PABPC4	39802157|39802157	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.317000|4.317000	0.59184|0.59184	2.633000|2.633000	0.89246|0.89246	0.561000|0.561000	0.74099|0.74099	GCT|CTA	-	NULL		0.577	PABPC4-001	KNOWN	basic|CCDS	protein_coding	PABPC4	protein_coding	OTTHUMT00000025220.1	G	NM_001135653		39802157	-1	no_errors	NM_003819	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
SLC20A2	6575	genome.wustl.edu	37	8	42287611	42287611	+	Silent	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr8:42287611C>T	ENST00000342228.3	-	9	2049	c.1680G>A	c.(1678-1680)ggG>ggA	p.G560G	SLC20A2_ENST00000520262.1_Silent_p.G560G|SLC20A2_ENST00000520179.1_Silent_p.G560G	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	560					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TGAGGTCCTTCCCCATGGTCT	0.607																																																0			8											101.0	81.0	88.0					8																	42287611		2203	4300	6503	42406768	SO:0001819	synonymous_variant	6575				CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.1680G>A	8.37:g.42287611C>T		Somatic		Capture	Illumina GAIIx	4	42406768		Silent	SNP	HMMPfam_PHO4	p.G560	ENST00000342228.3	37	c.1680	CCDS6132.1	8																																																																																			-	HMMPfam_PHO4		0.607	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC20A2	protein_coding	OTTHUMT00000377578.1	C			42406768	-1	no_errors	NM_006749	genbank	human	provisional	54_36p	silent	SNP	0.993	T
CNPY3	10695	genome.wustl.edu	37	6	42902304	42902304	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr6:42902304C>G	ENST00000372836.4	+	2	614	c.243C>G	c.(241-243)gaC>gaG	p.D81E	CNPY3_ENST00000394142.3_Intron	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	81	Saposin B-type.				innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)				central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			GCATCCTGGACCAGAAGGCCT	0.557																																																0			6											116.0	97.0	104.0					6																	42902304		2203	4300	6503	43010282	SO:0001583	missense	10695			U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.243C>G	6.37:g.42902304C>G	ENSP00000361926:p.Asp81Glu	Somatic		Capture	Illumina GAIIx	4	43010282	O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	Missense_Mutation	SNP	NULL	p.D81E	ENST00000372836.4	37	c.243	CCDS4875.1	6	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587690	0.66105	.	.	ENSG00000137161	ENST00000372836	T	0.34072	1.38	4.68	2.81	0.32909	.	0.000000	0.85682	D	0.000000	T	0.33789	0.0875	L	0.43923	1.385	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.14699	-1.0463	10	0.51188	T	0.08	-34.4737	6.8603	0.24064	0.0:0.6963:0.0:0.3037	.	81	Q9BT09	CNPY3_HUMAN	E	81	ENSP00000361926:D81E	ENSP00000361926:D81E	D	+	3	2	CNPY3	43010282	0.998000	0.40836	0.999000	0.59377	0.971000	0.66376	0.445000	0.21677	0.906000	0.36621	0.650000	0.86243	GAC	-	NULL		0.557	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNPY3	protein_coding	OTTHUMT00000040564.1	C	NM_006586		43010282	+1	no_errors	NM_006586	genbank	human	validated	54_36p	missense	SNP	0.980	G
RRP1B	23076	genome.wustl.edu	37	21	45104510	45104510	+	Missense_Mutation	SNP	G	G	A	rs369172517		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr21:45104510G>A	ENST00000340648.4	+	10	1085	c.968G>A	c.(967-969)cGc>cAc	p.R323H		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	323					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		AACAGGAAGCGCCTCTCCAAA	0.483																																																0			21						G	HIS/ARG	0,4406		0,0,2203	118.0	112.0	114.0		968	2.6	0.1	21		114	2,8598	2.2+/-6.3	0,2,4298	no	missense	RRP1B	NM_015056.2	29	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	323/759	45104510	2,13004	2203	4300	6503	43928938	SO:0001583	missense	23076			AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.968G>A	21.37:g.45104510G>A	ENSP00000339145:p.Arg323His	Somatic		Capture	Illumina GAIIx	4	43928938	Q8TBZ4	Missense_Mutation	SNP	HMMPfam_Nop52	p.R323H	ENST00000340648.4	37	c.968	CCDS33577.1	21	.	.	.	.	.	.	.	.	.	.	G	11.64	1.697731	0.30142	0.0	2.33E-4	ENSG00000160208	ENST00000340648	T	0.01215	5.16	5.4	2.63	0.31362	.	0.424262	0.28527	N	0.015032	T	0.01800	0.0057	M	0.80982	2.52	0.20764	N	0.999856	D	0.53312	0.959	B	0.35655	0.207	T	0.46748	-0.9169	10	0.87932	D	0	-0.3776	8.9001	0.35490	0.2295:0.0:0.7705:0.0	.	323	Q14684	RRP1B_HUMAN	H	323	ENSP00000339145:R323H	ENSP00000339145:R323H	R	+	2	0	RRP1B	43928938	0.505000	0.26131	0.130000	0.21974	0.463000	0.32649	2.841000	0.48223	0.268000	0.21939	-0.251000	0.11542	CGC	-	NULL		0.483	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP1B	protein_coding	OTTHUMT00000195651.1	G	NM_015056		43928938	+1	no_errors	NM_015056	genbank	human	validated	54_36p	missense	SNP	0.924	A
LARS2	23395	genome.wustl.edu	37	3	45559558	45559558	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr3:45559558C>G	ENST00000415258.1	+	17	2349	c.2208C>G	c.(2206-2208)atC>atG	p.I736M	LARS2_ENST00000467936.1_3'UTR|LARS2_ENST00000414984.1_Missense_Mutation_p.I693M|LARS2_ENST00000265537.3_Missense_Mutation_p.I736M			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	736					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	ACTCCGTCATCTCTCAGGTCA	0.542																																																0			3											43.0	41.0	42.0					3																	45559558		2203	4300	6503	45534562	SO:0001583	missense	23395			AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.2208C>G	3.37:g.45559558C>G	ENSP00000408576:p.Ile736Met	Somatic		Capture	Illumina GAIIx	4	45534562		Missense_Mutation	SNP	superfamily_SSF52374,HMMPfam_tRNA-synt_1g,PatternScan_AA_TRNA_LIGASE_I,superfamily_ValRS_IleRS_edit,HMMPfam_tRNA-synt_1,superfamily_tRNAsyn_1a_bind,HMMPfam_Anticodon_1	p.I736M	ENST00000415258.1	37	c.2208	CCDS2728.1	3	.	.	.	.	.	.	.	.	.	.	C	15.49	2.847846	0.51164	.	.	ENSG00000011376	ENST00000265537;ENST00000415258;ENST00000414984	T;T;T	0.17691	2.26;2.26;2.26	5.45	4.55	0.56014	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (1);Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.175195	0.50627	D	0.000119	T	0.36880	0.0983	M	0.83223	2.63	0.49213	D	0.999769	D;D	0.58268	0.982;0.982	P;P	0.62740	0.906;0.906	T	0.23154	-1.0196	10	0.87932	D	0	-16.8585	4.9605	0.14063	0.1571:0.6165:0.1427:0.0837	.	693;736	E9PHM2;Q15031	.;SYLM_HUMAN	M	736;736;693	ENSP00000265537:I736M;ENSP00000408576:I736M;ENSP00000412893:I693M	ENSP00000265537:I736M	I	+	3	3	LARS2	45534562	0.828000	0.29307	0.915000	0.36163	0.801000	0.45260	1.042000	0.30303	1.229000	0.43630	0.655000	0.94253	ATC	-	superfamily_tRNAsyn_1a_bind,HMMPfam_Anticodon_1		0.542	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LARS2	protein_coding	OTTHUMT00000345001.1	C	NM_015340		45534562	+1	no_errors	NM_015340	genbank	human	reviewed	54_36p	missense	SNP	0.042	G
SOCS5	9655	genome.wustl.edu	37	2	46985991	46985991	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr2:46985991C>G	ENST00000306503.5	+	2	494	c.322C>G	c.(322-324)Ctt>Gtt	p.L108V	SOCS5_ENST00000394861.2_Missense_Mutation_p.L108V	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	108					cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			AGGAACAAGACTTGCACGAAG	0.398																																																0			2											69.0	66.0	67.0					2																	46985991		2203	4300	6503	46839495	SO:0001583	missense	9655			AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.322C>G	2.37:g.46985991C>G	ENSP00000305133:p.Leu108Val	Somatic		Capture	Illumina GAIIx	4	46839495	Q53SD4|Q8IYZ4	Missense_Mutation	SNP	superfamily_SH2 domain,HMMSmart_SM00252,HMMPfam_SH2,HMMSmart_SM00253,HMMPfam_SOCS_box	p.L108V	ENST00000306503.5	37	c.322	CCDS1830.1	2	.	.	.	.	.	.	.	.	.	.	C	14.35	2.509482	0.44660	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	T;T	0.32753	1.44;1.44	5.39	5.39	0.77823	.	0.137987	0.48767	D	0.000179	T	0.21267	0.0512	L	0.29908	0.895	0.43007	D	0.994535	P	0.37955	0.612	B	0.32533	0.147	T	0.02893	-1.1097	10	0.41790	T	0.15	-20.5431	12.3015	0.54876	0.0:0.9224:0.0:0.0775	.	108	O75159	SOCS5_HUMAN	V	108	ENSP00000305133:L108V;ENSP00000378330:L108V	ENSP00000305133:L108V	L	+	1	0	SOCS5	46839495	1.000000	0.71417	0.945000	0.38365	0.988000	0.76386	3.549000	0.53681	2.801000	0.96364	0.650000	0.86243	CTT	-	NULL		0.398	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS5	protein_coding	OTTHUMT00000250791.2	C			46839495	+1	no_errors	NM_014011	genbank	human	reviewed	54_36p	missense	SNP	0.996	G
CYP4A11	1579	genome.wustl.edu	37	1	47399896	47399896	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:47399896C>T	ENST00000310638.4	-	8	1071	c.1040G>A	c.(1039-1041)tGc>tAc	p.C347Y	CYP4A11_ENST00000371905.1_Missense_Mutation_p.C347Y|CYP4A11_ENST00000371904.4_Missense_Mutation_p.C348Y|CYP4A11_ENST00000457840.2_3'UTR|CYP4A11_ENST00000462347.1_Intron|CYP4A11_ENST00000496519.1_5'UTR	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	347					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CTCCTCCCGGCACCTCTCCTG	0.607																																																0			1											51.0	52.0	52.0					1																	47399896		2203	4300	6503	47172483	SO:0001583	missense	1579			L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.1040G>A	1.37:g.47399896C>T	ENSP00000311095:p.Cys347Tyr	Somatic		Capture	Illumina GAIIx	4	47172483	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	HMMPfam_p450,superfamily_Cytochrome P450,PatternScan_CYTOCHROME_P450	p.C347Y	ENST00000310638.4	37	c.1040	CCDS543.1	1	.	.	.	.	.	.	.	.	.	.	-	16.29	3.080799	0.55753	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	T;T;T	0.68479	-0.33;-0.33;-0.33	5.23	4.31	0.51392	.	0.000000	0.85682	D	0.000000	D	0.84483	0.5482	M	0.89601	3.045	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.88296	0.2946	10	0.87932	D	0	.	15.4763	0.75481	0.14:0.86:0.0:0.0	.	347	Q02928	CP4AB_HUMAN	Y	347;348;347	ENSP00000311095:C347Y;ENSP00000360971:C348Y;ENSP00000360972:C347Y	ENSP00000311095:C347Y	C	-	2	0	CYP4A11	47172483	1.000000	0.71417	0.998000	0.56505	0.293000	0.27360	5.951000	0.70273	1.325000	0.45301	0.650000	0.86243	TGC	-	HMMPfam_p450,superfamily_Cytochrome P450		0.607	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4A11	protein_coding	OTTHUMT00000022022.1	C	NM_000778		47172483	-1	no_errors	NM_000778	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MAP4	4134	genome.wustl.edu	37	3	47957507	47957507	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr3:47957507C>A	ENST00000360240.6	-	7	2328	c.1810G>T	c.(1810-1812)Gat>Tat	p.D604Y	MAP4_ENST00000395734.3_Missense_Mutation_p.D604Y|MAP4_ENST00000426837.2_Missense_Mutation_p.D621Y|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	604					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	AAATGGGAATCCTCACTTATT	0.438																																																0			3											223.0	221.0	222.0					3																	47957507		2203	4300	6503	47932511	SO:0001583	missense	4134				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1810G>T	3.37:g.47957507C>A	ENSP00000353375:p.Asp604Tyr	Somatic		Capture	Illumina GAIIx	4	47932511	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	HMMPfam_Tubulin-binding,PatternScan_TAU_MAP	p.D604Y	ENST00000360240.6	37	c.1810	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	C	11.73	1.727199	0.30593	.	.	ENSG00000047849	ENST00000395734;ENST00000426837;ENST00000360240	T;T;T	0.14022	2.59;2.54;2.6	3.69	1.89	0.25635	.	.	.	.	.	T	0.27489	0.0675	L	0.56769	1.78	0.21604	N	0.999622	D;D;D	0.89917	1.0;0.995;0.991	D;D;P	0.69824	0.966;0.919;0.885	T	0.05716	-1.0868	9	0.72032	D	0.01	-1.1447	5.7703	0.18249	0.0:0.7571:0.0:0.2429	.	581;604;604	C9JFC3;P27816-6;P27816	.;.;MAP4_HUMAN	Y	604;621;604	ENSP00000379083:D604Y;ENSP00000407602:D621Y;ENSP00000353375:D604Y	ENSP00000353375:D604Y	D	-	1	0	MAP4	47932511	0.015000	0.18098	0.267000	0.24556	0.866000	0.49608	1.685000	0.37659	0.538000	0.28769	0.563000	0.77884	GAT	-	NULL		0.438	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	protein_coding	OTTHUMT00000346085.1	C	NM_002375		47932511	-1	no_errors	NM_002375	genbank	human	reviewed	54_36p	missense	SNP	0.149	A
XRCC1	7515	genome.wustl.edu	37	19	44050049	44050049	+	Silent	SNP	C	C	G	rs201452576	byFrequency	TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr19:44050049C>G	ENST00000262887.5	-	14	2089	c.1542G>C	c.(1540-1542)ccG>ccC	p.P514P	XRCC1_ENST00000543982.1_Silent_p.P483P			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	514			P -> L (in dbSNP:rs25474).		base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				AGCCTGCATACGGGTCTTCCC	0.612								Other BER factors																																								0			19											117.0	103.0	108.0					19																	44050049		2203	4299	6502	48741889	SO:0001819	synonymous_variant	7515			M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.1542G>C	19.37:g.44050049C>G		Somatic		Capture	Illumina GAIIx	4	48741889	Q6IBS4|Q9HCB1	Silent	SNP	HMMPfam_XRCC1_N,superfamily_Galactose-binding domain-like,superfamily_BRCT domain,HMMPfam_BRCT,HMMSmart_SM00292	p.P514	ENST00000262887.5	37	c.1542	CCDS12624.1	19																																																																																			-	NULL		0.612	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC1	protein_coding	OTTHUMT00000463194.1	C	NM_006297		48741889	-1	no_errors	NM_006297	genbank	human	reviewed	54_36p	silent	SNP	0.957	G
SLC25A20	788	genome.wustl.edu	37	3	48929501	48929501	+	Missense_Mutation	SNP	C	C	T	rs371250509		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr3:48929501C>T	ENST00000319017.4	-	2	308	c.110G>A	c.(109-111)cGa>cAa	p.R37Q	SLC25A20_ENST00000544097.1_5'UTR|SLC25A20_ENST00000430379.1_Missense_Mutation_p.R37Q	NM_000387.5	NP_000378.1	O43772	MCAT_HUMAN	solute carrier family 25 (carnitine/acylcarnitine translocase), member 20	37					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)		p.R37L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.000168)|Kidney(197;0.00231)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	L-Carnitine(DB00583)	TGTCTGCAGTCGGACCTGAAA	0.498																																																1	Substitution - Missense(1)	kidney(1)	3						C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	94.0	90.0	92.0		110	4.8	1.0	3		92	0,8600		0,0,4300	no	missense	SLC25A20	NM_000387.5	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	37/302	48929501	1,13005	2203	4300	6503	48904505	SO:0001583	missense	788			Y10319	CCDS2779.1	3p21.31	2013-05-22			ENSG00000178537	ENSG00000178537		"""Solute carriers"""	1421	protein-coding gene	gene with protein product	"""carnitine-acylcarnitine carrier"", ""carnitine/acylcarnitine translocase"""	613698		CACT		9399886, 9533014	Standard	NM_000387		Approved	CAC	uc003cva.4	O43772	OTTHUMG00000133538	ENST00000319017.4:c.110G>A	3.37:g.48929501C>T	ENSP00000326305:p.Arg37Gln	Somatic		Capture	Illumina GAIIx	4	48904505	B2R7F4|Q9UIQ2	Missense_Mutation	SNP	superfamily_Mitoch_carrier,HMMPfam_Mito_carr	p.R37Q	ENST00000319017.4	37	c.110	CCDS2779.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.154828	0.94686	2.27E-4	0.0	ENSG00000178537	ENST00000430379;ENST00000319017	D;D	0.83591	-1.74;-1.74	4.76	4.76	0.60689	Mitochondrial carrier domain (2);	0.066915	0.64402	D	0.000015	D	0.91439	0.7298	M	0.84326	2.69	0.80722	D	1	D;D	0.71674	0.998;0.987	D;P	0.76575	0.988;0.73	D	0.92736	0.6204	10	0.87932	D	0	-15.5576	16.7083	0.85378	0.0:1.0:0.0:0.0	.	37;37	C9JPE1;O43772	.;MCAT_HUMAN	Q	37	ENSP00000388986:R37Q;ENSP00000326305:R37Q	ENSP00000326305:R37Q	R	-	2	0	SLC25A20	48904505	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.623000	0.74238	2.477000	0.83638	0.455000	0.32223	CGA	-	superfamily_Mitoch_carrier,HMMPfam_Mito_carr		0.498	SLC25A20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A20	protein_coding	OTTHUMT00000257516.2	C	NM_000387		48904505	-1	no_errors	NM_000387	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
SLC4A8	9498	genome.wustl.edu	37	12	51868177	51868177	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr12:51868177G>A	ENST00000453097.2	+	15	2173	c.1956G>A	c.(1954-1956)tgG>tgA	p.W652*	SLC4A8_ENST00000535225.2_Nonsense_Mutation_p.W599*|SLC4A8_ENST00000514353.3_Nonsense_Mutation_p.W599*|SLC4A8_ENST00000394856.1_Nonsense_Mutation_p.W599*|SLC4A8_ENST00000358657.3_Nonsense_Mutation_p.W679*	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		TCCAGTACTGGAAGGACCACA	0.483																																																0			12											175.0	128.0	144.0					12																	51868177		2203	4300	6503	50154444	SO:0001587	stop_gained	9498			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1956G>A	12.37:g.51868177G>A	ENSP00000405812:p.Trp652*	Somatic		Capture	Illumina GAIIx	4	50154444		Nonsense_Mutation	SNP	superfamily_Phoshotransferase/anion transport protein,HMMPfam_Band_3_cyto,HMMPfam_HCO3_cotransp	p.W652*	ENST00000453097.2	37	c.1956	CCDS44890.1	12	.	.	.	.	.	.	.	.	.	.	G	40	8.011881	0.98610	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	17.5181	0.87780	0.0:0.0:1.0:0.0	.	.	.	.	X	599;679;652;599;652;599;599	.	ENSP00000315789:W652X	W	+	3	0	SLC4A8	50154444	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.437000	0.97535	2.756000	0.94617	0.655000	0.94253	TGG	-	HMMPfam_HCO3_cotransp		0.483	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A8	protein_coding	OTTHUMT00000404356.1	G	NM_004858		50154444	+1	no_errors	NM_001039960	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
PKHD1	5314	genome.wustl.edu	37	6	51900403	51900403	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr6:51900403T>G	ENST00000371117.3	-	28	3489	c.3214A>C	c.(3214-3216)Aaa>Caa	p.K1072Q	PKHD1_ENST00000340994.4_Missense_Mutation_p.K1072Q	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1072	IPT/TIG 5.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGTGGAACTTTGCACTGAATT	0.413																																																0			6											145.0	131.0	136.0					6																	51900403		2203	4300	6503	52008362	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3214A>C	6.37:g.51900403T>G	ENSP00000360158:p.Lys1072Gln	Somatic		Capture	Illumina GAIIx	4	52008362	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG,HMMSmart_SM00710,HMMPfam_G8,superfamily_Pectin lyase-like	p.K1072Q	ENST00000371117.3	37	c.3214	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	T	13.14	2.146793	0.37923	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.75938	-0.98;-0.98	5.69	3.27	0.37495	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.905414	0.09704	N	0.766612	T	0.47746	0.1462	M	0.62723	1.935	0.23391	N	0.997772	B;B	0.25390	0.051;0.125	B;B	0.25614	0.027;0.062	T	0.41142	-0.9525	10	0.30854	T	0.27	.	3.3112	0.07017	0.1311:0.0736:0.1579:0.6374	.	1072;1072	P08F94-2;P08F94	.;PKHD1_HUMAN	Q	1072	ENSP00000360158:K1072Q;ENSP00000341097:K1072Q	ENSP00000341097:K1072Q	K	-	1	0	PKHD1	52008362	0.985000	0.35326	0.860000	0.33809	0.902000	0.53008	0.642000	0.24735	0.416000	0.25844	0.528000	0.53228	AAA	-	superfamily_E set domains,HMMSmart_SM00429,HMMPfam_TIG		0.413	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	protein_coding	OTTHUMT00000040893.1	T	NM_138694		52008362	-1	no_errors	NM_138694	genbank	human	reviewed	54_36p	missense	SNP	0.947	G
SMC1A	8243	genome.wustl.edu	37	X	53439958	53439958	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrX:53439958A>G	ENST00000322213.4	-	5	873	c.746T>C	c.(745-747)aTc>aCc	p.I249T	SMC1A_ENST00000375340.6_Intron	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	249					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						gtccttctcgatctccttgtt	0.478																																																0			X											166.0	126.0	140.0					X																	53439958		2203	4300	6503	53456683	SO:0001583	missense	8243			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.746T>C	X.37:g.53439958A>G	ENSP00000323421:p.Ile249Thr	Somatic		Capture	Illumina GAIIx	4	53456683	O14995|Q16351|Q2M228	Missense_Mutation	SNP	HMMPfam_SMC_N,superfamily_SSF52540,superfamily_SMC_hinge,HMMPfam_SMC_hinge	p.I249T	ENST00000322213.4	37	c.746	CCDS14352.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.09|10.09	1.254869|1.254869	0.22965|0.22965	.|.	.|.	ENSG00000072501|ENSG00000072501	ENST00000322213|ENST00000428014	T|.	0.78816|.	-1.21|.	4.4|4.4	4.4|4.4	0.53042|0.53042	RecF/RecN/SMC (1);|.	0.121139|.	0.52532|.	D|.	0.000076|.	T|T	0.54679|0.54679	0.1873|0.1873	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	B;B;B|.	0.30526|.	0.014;0.283;0.25|.	B;B;B|.	0.35899|.	0.017;0.178;0.213|.	T|T	0.51116|0.51116	-0.8746|-0.8746	10|5	0.51188|.	T|.	0.08|.	.|.	12.1112|12.1112	0.53840|0.53840	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	227;249;249|.	Q6MZR8;A8K7A6;Q14683|.	.;.;SMC1A_HUMAN|.	T|P	249|254	ENSP00000323421:I249T|.	ENSP00000323421:I249T|.	I|S	-|-	2|1	0|0	SMC1A|SMC1A	53456683|53456683	1.000000|1.000000	0.71417|0.71417	0.952000|0.952000	0.39060|0.39060	0.543000|0.543000	0.35085|0.35085	7.132000|7.132000	0.77251|0.77251	1.560000|1.560000	0.49568|0.49568	0.356000|0.356000	0.21956|0.21956	ATC|TCG	-	HMMPfam_SMC_N,superfamily_SSF52540		0.478	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	protein_coding	OTTHUMT00000056756.2	A	NM_006306		53456683	-1	no_errors	NM_006306	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HUWE1	10075	genome.wustl.edu	37	X	53563449	53563449	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrX:53563449T>A	ENST00000342160.3	-	78	12774	c.12317A>T	c.(12316-12318)tAc>tTc	p.Y4106F	HUWE1_ENST00000262854.6_Missense_Mutation_p.Y4106F			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	4106	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						AAACTTGAAGTAGCTGAGGTG	0.473																																																0			X											208.0	173.0	185.0					X																	53563449		2203	4300	6503	53580174	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.12317A>T	X.37:g.53563449T>A	ENSP00000340648:p.Tyr4106Phe	Somatic		Capture	Illumina GAIIx	4	53580174	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	HMMPfam_DUF908,superfamily_ARM repeat,HMMPfam_DUF913,superfamily_UBA-like,HMMPfam_UBA,HMMSmart_SM00165,HMMPfam_WWE,superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT	p.Y4106F	ENST00000342160.3	37	c.12317	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	T	16.34	3.095534	0.56075	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.59502	0.26;0.26	5.62	5.62	0.85841	HECT (4);	0.000000	0.85682	D	0.000000	T	0.70500	0.3231	M	0.69248	2.105	0.80722	D	1	P;D	0.60575	0.939;0.988	D;D	0.70227	0.968;0.966	T	0.67197	-0.5731	10	0.13853	T	0.58	.	13.9194	0.63921	0.0:0.0:0.0:1.0	.	4106;4090	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	F	4106	ENSP00000340648:Y4106F;ENSP00000262854:Y4106F	ENSP00000262854:Y4106F	Y	-	2	0	HUWE1	53580174	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.435000	0.80391	2.000000	0.58554	0.481000	0.45027	TAC	-	superfamily_Hect E3 ligase catalytic domain,HMMSmart_SM00119,HMMPfam_HECT		0.473	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	protein_coding	OTTHUMT00000056766.1	T	XM_497119		53580174	-1	no_errors	NM_031407	genbank	human	validated	54_36p	missense	SNP	1.000	A
NDC1	55706	genome.wustl.edu	37	1	54233690	54233690	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:54233690C>T	ENST00000371429.3	-	18	2576	c.1978G>A	c.(1978-1980)Gca>Aca	p.A660T	NDC1_ENST00000537333.1_Missense_Mutation_p.A325T|SNORA58_ENST00000364133.1_RNA|NDC1_ENST00000540001.1_3'UTR|NDC1_ENST00000234725.8_Missense_Mutation_p.A545T	NM_001168551.1|NM_018087.4	NP_001162023.1|NP_060557.3	Q9BTX1	NDC1_HUMAN	NDC1 transmembrane nucleoporin	660					mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore distribution (GO:0031081)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)										TGATGTTCTGCAGATGCTTGC	0.333																																																0			1											92.0	85.0	88.0					1																	54233690		2202	4299	6501	54006278	SO:0001583	missense	55706			AL354613	CCDS583.1	1p32.3	2014-01-28	2013-05-23	2013-05-23	ENSG00000058804	ENSG00000058804			25525	protein-coding gene	gene with protein product	"""nuclear division cycle 1 homolog (S. cerevisiae)"""	610115	"""transmembrane protein 48"""	TMEM48		16779818, 12958361	Standard	NR_033142		Approved	FLJ10407, NET3		Q9BTX1	OTTHUMG00000008073	ENST00000371429.3:c.1978G>A	1.37:g.54233690C>T	ENSP00000360483:p.Ala660Thr	Somatic		Capture	Illumina GAIIx	4	54006278	B4DHA3|B4DQQ5|G3XA81|Q8NB76|Q9H9T6|Q9NSG3|Q9NSG4|Q9NVZ7	Missense_Mutation	SNP	HMMPfam_Ndc1_Nup	p.A660T	ENST00000371429.3	37	c.1978	CCDS583.1	1	.	.	.	.	.	.	.	.	.	.	C	10.14	1.269450	0.23221	.	.	ENSG00000058804	ENST00000371429;ENST00000360494;ENST00000537333;ENST00000234725	T;T;T	0.47177	0.85;0.85;0.85	5.89	5.89	0.94794	.	0.212706	0.49916	D	0.000129	T	0.24812	0.0602	N	0.11201	0.11	0.80722	D	1	B;B	0.25667	0.064;0.131	B;B	0.24974	0.027;0.057	T	0.19712	-1.0297	10	0.12103	T	0.63	.	8.1011	0.30857	0.0:0.7525:0.1614:0.0861	.	620;660	B4DHA3;Q9BTX1	.;NDC1_HUMAN	T	660;543;325;545	ENSP00000360483:A660T;ENSP00000439947:A325T;ENSP00000234725:A545T	ENSP00000234725:A545T	A	-	1	0	TMEM48	54006278	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.358000	0.34102	2.787000	0.95880	0.591000	0.81541	GCA	-	HMMPfam_Ndc1_Nup		0.333	NDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM48	protein_coding	OTTHUMT00000022101.1	C	NM_018087		54006278	-1	no_errors	NM_018087	genbank	human	provisional	54_36p	missense	SNP	1.000	T
FAM120C	54954	genome.wustl.edu	37	X	54099581	54099581	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrX:54099581G>C	ENST00000375180.2	-	16	3232	c.3176C>G	c.(3175-3177)tCc>tGc	p.S1059C	FAM120C_ENST00000328235.4_3'UTR	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	1059							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GCTGTCTCTGGATAAGGCACA	0.458																																																0			X											218.0	163.0	181.0					X																	54099581		2203	4300	6503	54116306	SO:0001583	missense	54954			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.3176C>G	X.37:g.54099581G>C	ENSP00000364324:p.Ser1059Cys	Somatic		Capture	Illumina GAIIx	4	54116306	B2RMT7	Missense_Mutation	SNP	NULL	p.S1059C	ENST00000375180.2	37	c.3176	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311214	0.60414	.	.	ENSG00000184083	ENST00000375180	T	0.26067	1.76	5.11	3.34	0.38264	.	0.416040	0.23194	N	0.050871	T	0.29491	0.0735	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.64595	0.927	T	0.06006	-1.0851	10	0.66056	D	0.02	-1.5314	10.9248	0.47185	0.1393:0.0:0.8607:0.0	.	1059	Q9NX05	F120C_HUMAN	C	1059	ENSP00000364324:S1059C	ENSP00000364324:S1059C	S	-	2	0	FAM120C	54116306	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.351000	0.44071	0.486000	0.27676	0.600000	0.82982	TCC	-	NULL		0.458	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	protein_coding	OTTHUMT00000056795.2	G	NM_017848		54116306	-1	no_errors	NM_017848	genbank	human	validated	54_36p	missense	SNP	1.000	C
GNL3L	54552	genome.wustl.edu	37	X	54586975	54586975	+	Silent	SNP	T	T	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrX:54586975T>C	ENST00000336470.4	+	16	1828	c.1689T>C	c.(1687-1689)tcT>tcC	p.S563S	GNL3L_ENST00000360845.2_Silent_p.S563S	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	563					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						GCAAGCTGTCTGATTCCATGA	0.512																																																0			X											263.0	213.0	230.0					X																	54586975		2203	4300	6503	54603700	SO:0001819	synonymous_variant	54552			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.1689T>C	X.37:g.54586975T>C		Somatic		Capture	Illumina GAIIx	4	54603700		Silent	SNP	superfamily_SSF52540,HMMPfam_MMR_HSR1	p.S563	ENST00000336470.4	37	c.1689	CCDS14360.1	X																																																																																			-	NULL		0.512	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3L	protein_coding	OTTHUMT00000056805.1	T	NM_019067		54603700	+1	no_errors	NM_019067	genbank	human	validated	54_36p	silent	SNP	1.000	C
SKIV2L2	23517	genome.wustl.edu	37	5	54683921	54683921	+	Silent	SNP	A	A	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr5:54683921A>G	ENST00000230640.5	+	19	2426	c.2172A>G	c.(2170-2172)ggA>ggG	p.G724G	SKIV2L2_ENST00000545714.1_Silent_p.G623G	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	724					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				ATGAGAAAGGAGAGATGCAGG	0.373																																					Melanoma(2;92 134 23744 29976 33782)											0			5											97.0	99.0	98.0					5																	54683921		2203	4300	6503	54719678	SO:0001819	synonymous_variant	23517			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.2172A>G	5.37:g.54683921A>G		Somatic		Capture	Illumina GAIIx	4	54719678	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Silent	SNP	superfamily_SSF52540,HMMSmart_DEXDc,HMMPfam_DEAD,HMMSmart_HELICc,HMMPfam_Helicase_C,HMMPfam_DSHCT	p.G724	ENST00000230640.5	37	c.2172	CCDS3967.1	5																																																																																			-	NULL		0.373	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L2	protein_coding	OTTHUMT00000214108.1	A			54719678	+1	no_errors	NM_015360	genbank	human	validated	54_36p	silent	SNP	1.000	G
BSND	7809	genome.wustl.edu	37	1	55472818	55472818	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:55472818C>G	ENST00000371265.4	+	3	675	c.421C>G	c.(421-423)Ctg>Gtg	p.L141V		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	141					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						GCAGCCGAAGCTGGGAACCAG	0.607																																					Ovarian(191;1657 2078 22894 42033 48899)											0			1											77.0	73.0	74.0					1																	55472818		2203	4300	6503	55245406	SO:0001583	missense	7809			AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.421C>G	1.37:g.55472818C>G	ENSP00000360312:p.Leu141Val	Somatic		Capture	Illumina GAIIx	4	55245406	Q6NT28	Missense_Mutation	SNP	NULL	p.L141V	ENST00000371265.4	37	c.421	CCDS602.1	1	.	.	.	.	.	.	.	.	.	.	C	7.454	0.643379	0.14451	.	.	ENSG00000162399	ENST00000371265	T	0.64085	-0.08	3.89	1.94	0.25998	.	1.110930	0.06955	N	0.815265	T	0.44371	0.1290	N	0.22421	0.69	0.09310	N	1	B	0.24426	0.103	B	0.28011	0.085	T	0.34004	-0.9846	10	0.13108	T	0.6	4.0E-4	4.519	0.11950	0.4115:0.4793:0.0:0.1093	.	141	Q8WZ55	BSND_HUMAN	V	141	ENSP00000360312:L141V	ENSP00000360312:L141V	L	+	1	2	BSND	55245406	0.280000	0.24249	0.002000	0.10522	0.078000	0.17371	0.760000	0.26475	0.562000	0.29204	0.478000	0.44815	CTG	-	NULL		0.607	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSND	protein_coding	OTTHUMT00000022213.4	C	NM_057176		55245406	+1	no_errors	NM_057176	genbank	human	reviewed	54_36p	missense	SNP	0.001	G
IL6ST	3572	genome.wustl.edu	37	5	55253093	55253093	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr5:55253093A>G	ENST00000381298.2	-	9	1312	c.1000T>C	c.(1000-1002)Tat>Cat	p.Y334H	IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000522633.2_Intron|IL6ST_ENST00000336909.5_Missense_Mutation_p.Y334H|IL6ST_ENST00000381294.3_Missense_Mutation_p.Y334H|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000381287.4_Intron|IL6ST_ENST00000536319.1_Intron|IL6ST_ENST00000502326.3_Missense_Mutation_p.Y334H	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	334	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TCTATTTTATACCAGAAACTT	0.279			O		hepatocellular ca																																		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	0			5											84.0	91.0	88.0					5																	55253093		2203	4299	6502	55288850	SO:0001583	missense	3572			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.1000T>C	5.37:g.55253093A>G	ENSP00000370698:p.Tyr334His	Somatic		Capture	Illumina GAIIx	4	55288850	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	HMMPfam_Lep_receptor_Ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_HEMATOPO_REC_L_F2	p.Y334H	ENST00000381298.2	37	c.1000	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	A	18.29	3.591859	0.66219	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	T;T;T	0.41065	1.01;1.01;1.01	5.15	5.15	0.70609	Fibronectin, type III (3);	0.532611	0.19941	N	0.102646	T	0.52240	0.1722	M	0.63428	1.95	0.80722	D	1	D;D;D	0.62365	0.991;0.988;0.991	P;P;P	0.57679	0.798;0.825;0.798	T	0.50898	-0.8773	10	0.39692	T	0.17	.	8.7444	0.34578	0.7319:0.0:0.0:0.2681	.	334;334;334	Q17RA0;Q5FC04;P40189	.;.;IL6RB_HUMAN	H	334	ENSP00000370698:Y334H;ENSP00000338799:Y334H;ENSP00000370694:Y334H	ENSP00000338799:Y334H	Y	-	1	0	IL6ST	55288850	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.089000	0.50183	2.049000	0.60858	0.477000	0.44152	TAT	-	superfamily_Fibronectin type III,HMMSmart_SM00060		0.279	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	protein_coding	OTTHUMT00000214146.3	A	NM_002184		55288850	-1	no_errors	NM_002184	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
OR5J1P	401687	genome.wustl.edu	37	11	55838812	55838812	+	IGR	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr11:55838812G>A								OR5AS1 (39943 upstream) : OR8I2 (21940 downstream)																							CTATTCATCAGTTTTTGCACC	0.398																																																0			11																																								55595388	SO:0001628	intergenic_variant	0																															11.37:g.55838812G>A		Somatic		Capture	Illumina GAIIx	4	55595388		Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.V103I		37	c.307		11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1	0	0.398					OR5J1P			G			55595388	+1	no_errors	ENST00000313544	ensembl	human	known	54_36p	missense	SNP	0.001	A
LRP1	4035	genome.wustl.edu	37	12	57589144	57589144	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr12:57589144G>T	ENST00000243077.3	+	52	8865	c.8399G>T	c.(8398-8400)tGt>tTt	p.C2800F	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2800	LDL-receptor class A 17. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GACAAAGACTGTGCTGATGGT	0.632																																																0			12											154.0	160.0	158.0					12																	57589144		2203	4300	6503	55875411	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.8399G>T	12.37:g.57589144G>T	ENSP00000243077:p.Cys2800Phe	Somatic		Capture	Illumina GAIIx	4	55875411	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2,superfamily_YWTD domain,HMMSmart_SM00135,HMMPfam_Ldl_recept_b,PatternScan_EGF_1	p.C2800F	ENST00000243077.3	37	c.8399	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669255	0.47677	.	.	ENSG00000123384	ENST00000243077	D	0.96459	-4.02	4.95	4.95	0.65309	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98865	0.9616	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99474	1.0946	10	0.87932	D	0	.	17.1132	0.86681	0.0:0.0:1.0:0.0	.	2800	Q07954	LRP1_HUMAN	F	2800	ENSP00000243077:C2800F	ENSP00000243077:C2800F	C	+	2	0	LRP1	55875411	1.000000	0.71417	1.000000	0.80357	0.174000	0.22865	9.558000	0.98132	2.562000	0.86427	0.561000	0.74099	TGT	-	superfamily_YWTD domain,superfamily_LDL receptor-like module,HMMPfam_Ldl_recept_a,HMMSmart_SM00192,PatternScan_LDLRA_1		0.632	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	G	NM_002332		55875411	+1	no_errors	NM_002332	genbank	human	validated	54_36p	missense	SNP	1.000	T
CNGB1	1258	genome.wustl.edu	37	16	57951379	57951379	+	Splice_Site	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr16:57951379G>A	ENST00000251102.8	-	21	2019	c.1959C>T	c.(1957-1959)aaC>aaT	p.N653N	CNGB1_ENST00000564448.1_Splice_Site_p.N647N	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	653					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						CATACATCAGGTCTGTGGGGA	0.547																																					Colon(156;1293 1853 16336 28962 38659)											0			16											88.0	93.0	91.0					16																	57951379		2086	4210	6296	56508880	SO:0001630	splice_region_variant	1258			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.1958-1C>T	16.37:g.57951379G>A		Somatic		Capture	Illumina GAIIx	4	56508880	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Silent	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding,PatternScan_CNMP_BINDING_1,PatternScan_CNMP_BINDING_2	p.N653	ENST00000251102.8	37	c.1959	CCDS42169.1	16																																																																																			-	superfamily_Voltage-gated potassium channels		0.547	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGB1	protein_coding	OTTHUMT00000337167.2	G	NM_001297	Silent	56508880	-1	no_errors	NM_001297	genbank	human	validated	54_36p	silent	SNP	1.000	A
ZNF451	26036	genome.wustl.edu	37	6	57013069	57013069	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr6:57013069T>C	ENST00000370706.4	+	10	2430	c.2186T>C	c.(2185-2187)aTc>aCc	p.I729T	RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.I729T|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|ZNF451_ENST00000357489.3_Missense_Mutation_p.I729T	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	729					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GAGAGTTACATCTGTAAAGTC	0.378																																																0			6											46.0	44.0	45.0					6																	57013069		2203	4300	6503	57121028	SO:0001583	missense	26036			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2186T>C	6.37:g.57013069T>C	ENSP00000359740:p.Ile729Thr	Somatic		Capture	Illumina GAIIx	4	57121028	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1,HMMPfam_zf-C2H2	p.I729T	ENST00000370706.4	37	c.2186	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	T	3.596	-0.082600	0.07141	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.17213	2.29;2.31;2.29	5.16	3.91	0.45181	.	0.758370	0.13031	N	0.419339	T	0.04092	0.0114	L	0.40543	1.245	0.58432	D	0.999997	B;B;B;B	0.30973	0.302;0.242;0.224;0.116	B;B;B;B	0.21708	0.036;0.022;0.034;0.022	T	0.30504	-0.9976	10	0.14656	T	0.56	-0.9953	5.0019	0.14268	0.0:0.1539:0.1604:0.6857	.	729;729;729;729	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	T	729	ENSP00000359740:I729T;ENSP00000350083:I729T;ENSP00000421645:I729T	ENSP00000350083:I729T	I	+	2	0	ZNF451	57121028	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	0.177000	0.16801	2.059000	0.61396	0.455000	0.32223	ATC	-	NULL		0.378	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	protein_coding	OTTHUMT00000041035.2	T	NM_015555		57121028	+1	no_errors	NM_001031623	genbank	human	validated	54_36p	missense	SNP	0.972	C
CTAGE16P	341689	genome.wustl.edu	37	13	59105064	59105064	+	IGR	SNP	C	C	T	rs545365827	byFrequency	TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr13:59105064C>T								RNY4P29 (3179 upstream) : RNU7-88P (949139 downstream)																							GATTTCCCCCCACCACCCCCA	0.517																																																0			13																																								58003065	SO:0001628	intergenic_variant	341689																															13.37:g.59105064C>T		Somatic		Capture	Illumina GAIIx	4	58003065		RNA	SNP	-	NULL		37	NULL		13																																																																																			-	-	0	0.517					LOC341689			C			58003065	+1	no_errors	XR_017487	genbank	human	model	54_36p	rna	SNP	0.878	T
SERPINB5	5268	genome.wustl.edu	37	18	61154236	61154236	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr18:61154236G>A	ENST00000382771.4	+	3	518	c.226G>A	c.(226-228)Gat>Aat	p.D76N	RP11-635N19.3_ENST00000602456.1_RNA|SERPINB5_ENST00000489441.1_Missense_Mutation_p.D76N	NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	76					cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D76N(1)		kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						AGTAACATCGGATGTAAACAA	0.353																																																1	Substitution - Missense(1)	kidney(1)	18											108.0	107.0	107.0					18																	61154236		2203	4299	6502	59305216	SO:0001583	missense	5268			U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.226G>A	18.37:g.61154236G>A	ENSP00000372221:p.Asp76Asn	Somatic		Capture	Illumina GAIIx	4	59305216	B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	HMMPfam_Serpin,superfamily_Serpins,HMMSmart_SM00093,PatternScan_SERPIN	p.D76N	ENST00000382771.4	37	c.226	CCDS32839.1	18	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523709	0.85600	.	.	ENSG00000206075	ENST00000382771;ENST00000424602	D;D	0.84223	-1.82;-1.82	5.32	5.32	0.75619	Serpin domain (3);	0.000000	0.64402	D	0.000001	D	0.88808	0.6537	L	0.51422	1.61	0.54753	D	0.999984	D;B	0.60160	0.987;0.072	P;B	0.58210	0.835;0.037	D	0.88718	0.3227	10	0.51188	T	0.08	.	18.1356	0.89618	0.0:0.0:1.0:0.0	.	76;76	P36952;P36952-2	SPB5_HUMAN;.	N	76	ENSP00000372221:D76N;ENSP00000408821:D76N	ENSP00000372221:D76N	D	+	1	0	SERPINB5	59305216	1.000000	0.71417	0.908000	0.35775	0.820000	0.46376	5.984000	0.70548	2.659000	0.90383	0.650000	0.86243	GAT	-	HMMPfam_Serpin,superfamily_Serpins,HMMSmart_SM00093		0.353	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB5	protein_coding	OTTHUMT00000280629.1	G	NM_002639		59305216	+1	no_errors	NM_002639	genbank	human	validated	54_36p	missense	SNP	0.991	A
PTK6	5753	genome.wustl.edu	37	20	62163958	62163958	+	Silent	SNP	G	G	A	rs148258053		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr20:62163958G>A	ENST00000217185.2	-	5	780	c.753C>T	c.(751-753)taC>taT	p.Y251Y	PTK6_ENST00000542869.1_Silent_p.Y150Y	NM_005975.3	NP_005966.1	Q13882	PTK6_HUMAN	protein tyrosine kinase 6	251	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|intestinal epithelial cell differentiation (GO:0060575)|negative regulation of growth (GO:0045926)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(1)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	15	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)		Vandetanib(DB05294)	ACACCACGGCGTACAGCGCCA	0.662													g|||	1	0.000199681	0.0	0.0	5008	,	,		17730	0.0		0.0	False		,,,				2504	0.001															0			20								0,4406		0,0,2203	115.0	93.0	100.0		753	-2.1	0.1	20	dbSNP_134	100	4,8596	3.0+/-9.4	0,4,4296	no	coding-synonymous	PTK6	NM_005975.2		0,4,6499	AA,AG,GG		0.0465,0.0,0.0308		251/452	62163958	4,13002	2203	4300	6503	61634402	SO:0001819	synonymous_variant	5753			U61412	CCDS13524.1, CCDS74750.1	20q13.3	2013-02-18	2013-02-18		ENSG00000101213	ENSG00000101213	2.7.10.1	"""SH2 domain containing"""	9617	protein-coding gene	gene with protein product		602004	"""PTK6 protein tyrosine kinase 6"""			8247543, 9284935	Standard	NM_005975		Approved	BRK	uc002yfg.4	Q13882	OTTHUMG00000033039	ENST00000217185.2:c.753C>T	20.37:g.62163958G>A		Somatic		Capture	Illumina GAIIx	4	61634402	B2RCR3|B4DW46|Q58F01	Silent	SNP	superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.Y251	ENST00000217185.2	37	c.753	CCDS13524.1	20																																																																																			-	superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc		0.662	PTK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK6	protein_coding	OTTHUMT00000080313.1	G			61634402	-1	no_errors	NM_005975	genbank	human	reviewed	54_36p	silent	SNP	0.966	A
ATL3	25923	genome.wustl.edu	37	11	63420033	63420033	+	Silent	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr11:63420033C>G	ENST00000398868.3	-	4	696	c.420G>C	c.(418-420)ctG>ctC	p.L140L	ATL3_ENST00000332645.4_Silent_p.L167L|ATL3_ENST00000538786.1_Silent_p.L122L|RP11-697H9.2_ENST00000540307.1_RNA	NM_015459.3	NP_056274.3	Q6DD88	ATLA3_HUMAN	atlastin GTPase 3	140	GB1/RHD3-type G.				endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	11						GGGTATCCATCAGAACAACTG	0.378																																																0			11											80.0	75.0	77.0					11																	63420033		1862	4114	5976	63176609	SO:0001819	synonymous_variant	25923				CCDS41663.1, CCDS73309.1	11q13.1	2008-09-17			ENSG00000184743	ENSG00000184743			24526	protein-coding gene	gene with protein product		609369				18270207	Standard	XM_005273891		Approved	DKFZP564J0863	uc001nxk.1	Q6DD88	OTTHUMG00000167854	ENST00000398868.3:c.420G>C	11.37:g.63420033C>G		Somatic		Capture	Illumina GAIIx	4	63176609	Q8N7W5|Q9H8Q5|Q9UFL1	Silent	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GBP,superfamily_Interferon-induced guanylate-binding protein 1 (GBP1) C-terminal domain	p.L140	ENST00000398868.3	37	c.420	CCDS41663.1	11																																																																																			-	superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_GBP		0.378	ATL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATL3	protein_coding	OTTHUMT00000396637.1	C	NM_015459		63176609	-1	no_errors	NM_015459	genbank	human	validated	54_36p	silent	SNP	1.000	G
LARP1BP1	644578	genome.wustl.edu	37	4	64216470	64216470	+	IGR	SNP	T	T	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr4:64216470T>C								RP11-257A22.1 (206871 upstream) : RP11-12K22.1 (117948 downstream)																							GTTCAGGCTCTCACTACAAAC	0.408																																																0			4																																								63899065	SO:0001628	intergenic_variant	644578																															4.37:g.64216470T>C		Somatic		Capture	Illumina GAIIx	4	63899065		Missense_Mutation	SNP	"superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00715,HMMPfam_La"	p.L268P		37	c.803		4																																																																																			-	"superfamily_""Winged helix"" DNA-binding domain,HMMSmart_SM00715,HMMPfam_La"	0	0.408					LOC644578			T			63899065	+1	no_errors	XM_927694	genbank	human	model	54_36p	missense	SNP	1.000	C
ZBTB25	7597	genome.wustl.edu	37	14	64954618	64954618	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr14:64954618C>T	ENST00000608382.1	-	3	522	c.331G>A	c.(331-333)Gca>Aca	p.A111T	ZBTB25_ENST00000555220.1_Intron|ZBTB25_ENST00000394715.1_Missense_Mutation_p.A111T|ZBTB25_ENST00000555424.1_Intron	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	111					gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		ATTTCAGTTGCAATGTGAGAA	0.428																																																0			14											115.0	106.0	109.0					14																	64954618		2203	4300	6503	64024371	SO:0001583	missense	7597			X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.331G>A	14.37:g.64954618C>T	ENSP00000476746:p.Ala111Thr	Somatic		Capture	Illumina GAIIx	4	64024371	B3KUX6|Q8IYH9	Missense_Mutation	SNP	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225,superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.A111T	ENST00000608382.1	37	c.331	CCDS9765.1	14	.	.	.	.	.	.	.	.	.	.	C	19.88	3.908532	0.72868	.	.	ENSG00000089775	ENST00000261683;ENST00000394715	T;T	0.68025	-0.3;-0.3	5.92	5.92	0.95590	BTB/POZ-like (1);BTB/POZ fold (1);	0.094031	0.64402	D	0.000001	T	0.79793	0.4507	L	0.54323	1.7	0.54753	D	0.999983	D	0.76494	0.999	D	0.72338	0.977	T	0.77429	-0.2591	10	0.46703	T	0.11	-15.672	20.3207	0.98668	0.0:1.0:0.0:0.0	.	111	P24278	ZBT25_HUMAN	T	111	ENSP00000261683:A111T;ENSP00000378204:A111T	ENSP00000261683:A111T	A	-	1	0	ZBTB25	64024371	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	1.954000	0.40362	2.813000	0.96785	0.561000	0.74099	GCA	-	superfamily_POZ domain,HMMPfam_BTB,HMMSmart_SM00225		0.428	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB25	protein_coding	OTTHUMT00000280649.2	C	NM_006977		64024371	-1	no_errors	NM_006977	genbank	human	validated	54_36p	missense	SNP	0.983	T
ZNF117	51351	genome.wustl.edu	37	7	64438578	64438578	+	Silent	SNP	A	A	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr7:64438578A>C	ENST00000282869.6	-	4	2655	c.1371T>G	c.(1369-1371)tcT>tcG	p.S457S		NM_015852.3	NP_056936.2	Q03924	ZN117_HUMAN	zinc finger protein 117	457					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(1)|skin(1)	22		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TAAGTGTTGAAGATTGGTTAA	0.363																																																0			7											66.0	71.0	69.0					7																	64438578		2162	4281	6443	64076013	SO:0001819	synonymous_variant	7670			M27879	CCDS43593.1	7q11.2	2013-01-08	2006-06-12		ENSG00000152926	ENSG00000152926		"""Zinc fingers, C2H2-type"""	12897	protein-coding gene	gene with protein product		194624	"""zinc finger protein 117 (HPF9)"""			1427907	Standard	NM_015852		Approved	HPF9, H-plk	uc003ttr.2	Q03924	OTTHUMG00000156631	ENST00000282869.6:c.1371T>G	7.37:g.64438578A>C		Somatic		Capture	Illumina GAIIx	4	64076013	Q02313|Q7Z7Q7	Silent	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMSmart_SM00355,HMMPfam_zf-C2H2,PatternScan_ZINC_FINGER_C2H2_1	p.S457	ENST00000282869.6	37	c.1371	CCDS43593.1	7																																																																																			-	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1		0.363	ZNF117-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF117	protein_coding	OTTHUMT00000344863.3	A	NM_024498		64076013	-1	no_errors	NM_015852	genbank	human	validated	54_36p	silent	SNP	0.000	C
SPDYC	387778	genome.wustl.edu	37	11	64940670	64940670	+	Silent	SNP	G	G	T	rs148562610		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr11:64940670G>T	ENST00000377185.2	+	7	946	c.864G>T	c.(862-864)ccG>ccT	p.P288P	AP003068.18_ENST00000534819.1_RNA	NM_001008778.1	NP_001008778.1			speedy/RINGO cell cycle regulator family member C											breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)	16						CAAAGCCTCCGGCACGCCCTG	0.637																																																0			11											83.0	77.0	79.0					11																	64940670		2201	4297	6498	64697246	SO:0001819	synonymous_variant	387778			AY820305	CCDS31606.1	11q13.1	2013-05-08	2013-05-08		ENSG00000204710	ENSG00000204710		"""Speedy homologs"""	32681	protein-coding gene	gene with protein product		614030	"""speedy homolog C (Xenopus laevis)"""			15611625	Standard	NM_001008778		Approved	Ringo2	uc010rnz.2	Q5MJ68	OTTHUMG00000165611	ENST00000377185.2:c.864G>T	11.37:g.64940670G>T		Somatic		Capture	Illumina GAIIx	4	64697246		Silent	SNP	NULL	p.P288	ENST00000377185.2	37	c.864	CCDS31606.1	11																																																																																			-	NULL		0.637	SPDYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDYC	protein_coding	OTTHUMT00000385299.1	G	NM_001008778		64697246	+1	no_errors	NM_001008778	genbank	human	provisional	54_36p	silent	SNP	0.000	T
PTPRR	5801	genome.wustl.edu	37	12	71092083	71092083	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr12:71092083C>T	ENST00000283228.2	-	8	1693	c.1241G>A	c.(1240-1242)cGt>cAt	p.R414H	PTPRR_ENST00000440835.2_Missense_Mutation_p.R169H|PTPRR_ENST00000549308.1_Missense_Mutation_p.R169H|PTPRR_ENST00000342084.4_Missense_Mutation_p.R302H|PTPRR_ENST00000378778.1_Missense_Mutation_p.R208H	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	414	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		AGTTCCATGACGCGGAATATC	0.348																																																0			12											86.0	88.0	87.0					12																	71092083		2202	4300	6502	69378350	SO:0001583	missense	5801			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.1241G>A	12.37:g.71092083C>T	ENSP00000283228:p.Arg414His	Somatic		Capture	Illumina GAIIx	4	69378350	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194,HMMPfam_Y_phosphatase,HMMSmart_SM00404,PatternScan_TYR_PHOSPHATASE_1	p.R414H	ENST00000283228.2	37	c.1241	CCDS8998.1	12	.	.	.	.	.	.	.	.	.	.	C	17.10	3.303861	0.60305	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308;ENST00000550661	T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55	5.79	5.79	0.91817	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.245199	0.28940	N	0.013652	T	0.24812	0.0602	N	0.11756	0.17	0.34452	D	0.700805	P;P;D;P	0.58970	0.921;0.86;0.984;0.863	B;B;B;B	0.44044	0.092;0.136;0.439;0.094	T	0.21586	-1.0241	10	0.49607	T	0.09	-5.594	20.0341	0.97551	0.0:1.0:0.0:0.0	.	263;302;208;414	B7Z998;F5GXR7;Q15256-4;Q15256	.;.;.;PTPRR_HUMAN	H	169;414;208;302;169;169	ENSP00000391750:R169H;ENSP00000283228:R414H;ENSP00000368054:R208H;ENSP00000339605:R302H;ENSP00000446943:R169H;ENSP00000449616:R169H	ENSP00000283228:R414H	R	-	2	0	PTPRR	69378350	0.993000	0.37304	0.998000	0.56505	0.955000	0.61496	3.121000	0.50438	2.753000	0.94483	0.555000	0.69702	CGT	-	superfamily_(Phosphotyrosine protein) phosphatases II,HMMSmart_SM00194		0.348	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRR	protein_coding	OTTHUMT00000404485.1	C	NM_002849		69378350	-1	no_errors	NM_002849	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
UBE2O	63893	genome.wustl.edu	37	17	74391853	74391853	+	Missense_Mutation	SNP	T	T	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr17:74391853T>C	ENST00000319380.7	-	15	2963	c.2899A>G	c.(2899-2901)Acc>Gcc	p.T967A	UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	967					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						GGCAGTGAGGTAGCCAGCAGC	0.522																																																0			17											124.0	108.0	113.0					17																	74391853		2203	4300	6503	71903448	SO:0001583	missense	63893			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.2899A>G	17.37:g.74391853T>C	ENSP00000323687:p.Thr967Ala	Somatic		Capture	Illumina GAIIx	4	71903448	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	PatternScan_UBIQUITIN_CONJUGAT_1,superfamily_UBQ-conjugat/RWD-like,HMMSmart_UBCc,HMMPfam_UQ_con	p.T967A	ENST00000319380.7	37	c.2899	CCDS32742.1	17	.	.	.	.	.	.	.	.	.	.	T	21.1	4.098406	0.76870	.	.	ENSG00000175931	ENST00000319380	T	0.37235	1.21	5.24	5.24	0.73138	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	N	0.25426	0.745	0.54753	D	0.999985	D	0.69078	0.997	D	0.80764	0.994	T	0.30268	-0.9984	10	0.25106	T	0.35	-41.5374	15.1507	0.72696	0.0:0.0:0.0:1.0	.	967	Q9C0C9	UBE2O_HUMAN	A	967	ENSP00000323687:T967A	ENSP00000323687:T967A	T	-	1	0	UBE2O	71903448	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	7.817000	0.86213	1.973000	0.57446	0.460000	0.39030	ACC	-	superfamily_UBQ-conjugat/RWD-like,HMMSmart_UBCc,HMMPfam_UQ_con		0.522	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2O	protein_coding	OTTHUMT00000450123.1	T	NM_022066		71903448	-1	no_errors	NM_022066	genbank	human	validated	54_36p	missense	SNP	0.995	C
ZNF236	7776	genome.wustl.edu	37	18	74620501	74620501	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr18:74620501G>C	ENST00000253159.8	+	14	2715	c.2517G>C	c.(2515-2517)ttG>ttC	p.L839F	ZNF236_ENST00000320610.9_Missense_Mutation_p.L841F	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	839					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GCCAGCAGTTGGCAGATCAGC	0.572																																																0			18											58.0	68.0	65.0					18																	74620501		2060	4209	6269	72749489	SO:0001583	missense	7776			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.2517G>C	18.37:g.74620501G>C	ENSP00000253159:p.Leu839Phe	Somatic		Capture	Illumina GAIIx	4	72749489	B2RTX9|Q9UL37	Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.L839F	ENST00000253159.8	37	c.2517	CCDS42447.1	18	.	.	.	.	.	.	.	.	.	.	G	14.39	2.522549	0.44866	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.12255	2.7;2.86	4.94	4.04	0.47022	.	0.093427	0.44097	D	0.000485	T	0.16642	0.0400	M	0.62723	1.935	0.09310	N	0.999996	P	0.47106	0.89	B	0.42245	0.381	T	0.13308	-1.0514	10	0.48119	T	0.1	.	11.7708	0.51958	0.1438:0.0:0.8562:0.0	.	839	Q9UL36	ZN236_HUMAN	F	839	ENSP00000253159:L839F;ENSP00000444524:L839F	ENSP00000253159:L839F	L	+	3	2	ZNF236	72749489	0.991000	0.36638	0.001000	0.08648	0.099000	0.18886	2.199000	0.42715	2.441000	0.82636	0.467000	0.42956	TTG	-	NULL		0.572	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	protein_coding	OTTHUMT00000445776.1	G			72749489	+1	no_errors	NM_007345	genbank	human	validated	54_36p	missense	SNP	0.421	C
SNUPN	10073	genome.wustl.edu	37	15	75890848	75890848	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr15:75890848G>C	ENST00000564644.1	-	10	1512	c.934C>G	c.(934-936)Cac>Gac	p.H312D	SNUPN_ENST00000564675.1_Missense_Mutation_p.H312D|SNUPN_ENST00000567134.1_Missense_Mutation_p.H312D|SNUPN_ENST00000371091.5_Missense_Mutation_p.H354D|SNUPN_ENST00000308588.5_Missense_Mutation_p.H312D|CTD-2323K18.1_ENST00000568707.1_RNA			O95149	SPN1_HUMAN	snurportin 1	312	Necessary for binding to the m3G-cap structure.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein import into nucleus (GO:0006606)|RNA metabolic process (GO:0016070)|snRNA import into nucleus (GO:0061015)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	protein transporter activity (GO:0008565)|RNA cap binding (GO:0000339)			endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)	8						CTCTTCTTGTGCTCCATAATC	0.542																																																0			15											136.0	136.0	136.0					15																	75890848		2197	4294	6491	73677903	SO:0001583	missense	10073			AF039029	CCDS10281.1	15q24.2	2008-02-05	2006-07-14	2006-07-14	ENSG00000169371	ENSG00000169371			14245	protein-coding gene	gene with protein product		607902	"""RNA, U transporter 1"""	RNUT1		9670026	Standard	NM_005701		Approved	SNURPORTIN-1, Snurportin1	uc002bas.3	O95149	OTTHUMG00000142833	ENST00000564644.1:c.934C>G	15.37:g.75890848G>C	ENSP00000454852:p.His312Asp	Somatic		Capture	Illumina GAIIx	4	73677903	A6NE34|A8K0B0|D3DW76	Missense_Mutation	SNP	NULL	p.H312D	ENST00000564644.1	37	c.934	CCDS10281.1	15	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377014	0.82682	.	.	ENSG00000169371	ENST00000308588;ENST00000371091	T;T	0.62639	0.01;0.01	5.9	4.98	0.66077	.	0.131721	0.64402	D	0.000001	T	0.66257	0.2771	M	0.72894	2.215	0.58432	D	0.999994	P;P	0.50617	0.937;0.835	P;B	0.48704	0.587;0.368	T	0.69131	-0.5226	10	0.54805	T	0.06	-28.1519	9.8478	0.41037	0.0735:0.0:0.7798:0.1466	.	354;312	C9K0X5;O95149	.;SPN1_HUMAN	D	312;354	ENSP00000309831:H312D;ENSP00000360132:H354D	ENSP00000309831:H312D	H	-	1	0	SNUPN	73677903	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.297000	0.59061	1.518000	0.48934	0.555000	0.69702	CAC	-	NULL		0.542	SNUPN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNUPN	protein_coding	OTTHUMT00000420332.1	G	NM_005701		73677903	-1	no_errors	NM_001042581	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
LTBP2	4053	genome.wustl.edu	37	14	74976028	74976028	+	Missense_Mutation	SNP	C	C	T	rs201430837		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr14:74976028C>T	ENST00000261978.4	-	22	3702	c.3316G>A	c.(3316-3318)Gga>Aga	p.G1106R	LTBP2_ENST00000556690.1_Missense_Mutation_p.G1106R	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1106	Cys-rich.|EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GTGCAGACTCCGGAGGGGCAG	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		17305	0.0		0.001	False		,,,				2504	0.0															0			14											65.0	75.0	71.0					14																	74976028		2203	4300	6503	74045781	SO:0001583	missense	4053				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.3316G>A	14.37:g.74976028C>T	ENSP00000261978:p.Gly1106Arg	Somatic		Capture	Illumina GAIIx	4	74045781	Q99907|Q9NS51	Missense_Mutation	SNP	superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,superfamily_TB module/8-cys domain,HMMPfam_TB,PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,PatternScan_ASX_HYDROXYL,HMMPfam_EGF,superfamily_Growth factor receptor domain	p.G1106R	ENST00000261978.4	37	c.3316	CCDS9831.1	14	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	C|C	14.82|14.82	2.648916|2.648916	0.47362|0.47362	.|.	.|.	ENSG00000119681|ENSG00000119681	ENST00000261978;ENST00000556690|ENST00000556206	D;D|.	0.92249|.	-3.0;-2.47|.	5.31|5.31	5.31|5.31	0.75309|0.75309	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);|.	0.181300|.	0.26642|.	N|.	0.023259|.	D|D	0.84754|0.84754	0.5542|0.5542	M|M	0.91612|0.91612	3.225|3.225	0.44685|0.44685	D|D	0.997679|0.997679	B|.	0.29253|.	0.239|.	B|.	0.32393|.	0.145|.	D|D	0.87649|0.87649	0.2527|0.2527	10|5	0.87932|.	D|.	0|.	.|.	16.008|16.008	0.80377|0.80377	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1106|.	Q14767|.	LTBP2_HUMAN|.	R|Q	1106|38	ENSP00000261978:G1106R;ENSP00000451477:G1106R|.	ENSP00000261978:G1106R|.	G|R	-|-	1|2	0|0	LTBP2|LTBP2	74045781|74045781	0.985000|0.985000	0.35326|0.35326	0.183000|0.183000	0.23137|0.23137	0.289000|0.289000	0.27227|0.27227	6.050000|6.050000	0.71063|0.71063	2.768000|2.768000	0.95171|0.95171	0.491000|0.491000	0.48974|0.48974	GGA|CGG	-	PatternScan_EGF_CA,HMMPfam_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181		0.657	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	protein_coding	OTTHUMT00000413595.1	C	NM_000428		74045781	-1	no_errors	NM_000428	genbank	human	reviewed	54_36p	missense	SNP	0.068	T
FPGT-TNNI3K	100526835	genome.wustl.edu	37	1	74835155	74835155	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:74835155A>T	ENST00000370899.3	+	18	1893	c.1856A>T	c.(1855-1857)cAt>cTt	p.H619L	FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.H632L|FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.H619L|TNNI3K_ENST00000326637.3_Missense_Mutation_p.H518L|TNNI3K_ENST00000370891.2_Missense_Mutation_p.H619L|RP11-439H8.4_ENST00000415549.2_RNA	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		CAGCTCAATCATCCCTGCGTA	0.478																																																0			1											238.0	206.0	217.0					1																	74835155		2203	4300	6503	74607743	SO:0001583	missense	51086					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.1856A>T	1.37:g.74835155A>T	ENSP00000359936:p.His619Leu	Somatic		Capture	Illumina GAIIx	4	74607743		Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,PatternScan_PROTEIN_KINASE_ATP	p.H518L	ENST00000370899.3	37	c.1553		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.3|27.3	4.820151|4.820151	0.90873|0.90873	.|.	.|.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783;ENSG00000116783|ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637;ENST00000534020|ENST00000526236;ENST00000525480	T;T;T;T;T;T|.	0.54071|.	0.59;0.59;0.59;0.59;0.59;0.59|.	5.27|5.27	5.27|5.27	0.74061|0.74061	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84804|0.84804	0.5553|0.5553	H|H	0.95043|0.95043	3.615|3.615	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.69078|.	0.997;0.996;0.996;0.997|.	D;D;D;D|.	0.78314|.	0.933;0.918;0.918;0.991|.	D|D	0.89738|0.89738	0.3931|0.3931	10|5	0.87932|.	D|.	0|.	.|.	15.1862|15.1862	0.73002|0.73002	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	518;619;619;619|.	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3|.	TNI3K_HUMAN;.;.;.|.	L|F	619;619;619;619;518;42|65;38	ENSP00000359936:H619L;ENSP00000359932:H619L;ENSP00000450895:H619L;ENSP00000359928:H619L;ENSP00000322251:H518L;ENSP00000434975:H42L|.	ENSP00000322251:H518L|.	H|I	+|+	2|1	0|0	RP11-653A5.2;AC093158.1|AC093158.1	74607743|74607743	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	8.799000|8.799000	0.91895|0.91895	1.982000|1.982000	0.57802|0.57802	0.459000|0.459000	0.35465|0.35465	CAT|ATC	-	superfamily_Kinase_like,HMMPfam_Pkinase_Tyr		0.478	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	TNNI3K	protein_coding	OTTHUMT00000026438.3	A			74607743	+1	no_errors	NM_015978	genbank	human	validated	54_36p	missense	SNP	1.000	T
PRKRIR	5612	genome.wustl.edu	37	11	76063068	76063068	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr11:76063068C>T	ENST00000260045.3	-	5	1231	c.1126G>A	c.(1126-1128)Gga>Aga	p.G376R	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	376					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						ACAGATACTCCCATAACAGGT	0.378																																																0			11											60.0	59.0	59.0					11																	76063068		2191	4267	6458	75740716	SO:0001583	missense	5612			AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.1126G>A	11.37:g.76063068C>T	ENSP00000260045:p.Gly376Arg	Somatic		Capture	Illumina GAIIx	4	75740716	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Missense_Mutation	SNP	HMMPfam_THAP,HMMSmart_SM00692,HMMPfam_hATC	p.G376R	ENST00000260045.3	37	c.1126	CCDS8243.1	11	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774211	0.69992	.	.	ENSG00000137492	ENST00000529901;ENST00000260045	T;T	0.21361	2.01;2.01	4.78	4.78	0.61160	Ribonuclease H-like (1);	0.094910	0.64402	D	0.000001	T	0.38348	0.1037	L	0.56769	1.78	0.54753	D	0.999987	D	0.65815	0.995	P	0.60068	0.868	T	0.06110	-1.0845	10	0.19147	T	0.46	.	18.3441	0.90315	0.0:1.0:0.0:0.0	.	376	O43422	P52K_HUMAN	R	201;376	ENSP00000436249:G201R;ENSP00000260045:G376R	ENSP00000260045:G376R	G	-	1	0	PRKRIR	75740716	0.636000	0.27207	1.000000	0.80357	0.999000	0.98932	1.656000	0.37355	2.416000	0.81992	0.644000	0.83932	GGA	-	NULL		0.378	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKRIR	protein_coding	OTTHUMT00000383188.1	C	NM_004705		75740716	-1	no_errors	NM_004705	genbank	human	provisional	54_36p	missense	SNP	0.997	T
CCDC137	339230	genome.wustl.edu	37	17	79637264	79637264	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr17:79637264C>T	ENST00000329214.8	+	3	681	c.278C>T	c.(277-279)aCc>aTc	p.T93I		NM_199287.2	NP_954981.1	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	93							poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(2)	12	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GCCCAGGTGACCTTCAGAAAG	0.577																																																0			17											27.0	31.0	29.0					17																	79637264		2029	4191	6220	77247669	SO:0001583	missense	339230			BC009369	CCDS42400.1	17q25.3	2008-07-04				ENSG00000185298			33451	protein-coding gene	gene with protein product		614271					Standard	NM_199287		Approved	MGC16597	uc002kbc.4	Q6PK04		ENST00000329214.8:c.278C>T	17.37:g.79637264C>T	ENSP00000329360:p.Thr93Ile	Somatic		Capture	Illumina GAIIx	4	77247669		Missense_Mutation	SNP	NULL	p.T93I	ENST00000329214.8	37	c.278	CCDS42400.1	17	.	.	.	.	.	.	.	.	.	.	C	8.936	0.964617	0.18583	.	.	ENSG00000185298	ENST00000329214	D	0.90133	-2.62	4.74	2.75	0.32379	.	1.222610	0.05765	N	0.605673	D	0.82356	0.5019	N	0.22421	0.69	0.20489	N	0.999892	P	0.36535	0.557	B	0.30782	0.12	T	0.71384	-0.4609	10	0.35671	T	0.21	1.7164	6.7881	0.23685	0.0:0.7894:0.0:0.2106	.	93	Q6PK04	CC137_HUMAN	I	93	ENSP00000329360:T93I	ENSP00000329360:T93I	T	+	2	0	CCDC137	77247669	0.003000	0.15002	0.945000	0.38365	0.091000	0.18340	0.147000	0.16202	0.591000	0.29711	0.655000	0.94253	ACC	-	NULL		0.577	CCDC137-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC137	protein_coding	OTTHUMT00000440387.1	C			77247669	+1	no_errors	NM_199287	genbank	human	validated	54_36p	missense	SNP	0.959	T
LRRTM4	80059	genome.wustl.edu	37	2	77746454	77746454	+	Missense_Mutation	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr2:77746454G>A	ENST00000409093.1	-	3	877	c.541C>T	c.(541-543)Cgg>Tgg	p.R181W	LRRTM4_ENST00000409282.1_Missense_Mutation_p.R182W|LRRTM4_ENST00000409884.1_Missense_Mutation_p.R181W|LRRTM4_ENST00000409911.1_Missense_Mutation_p.R182W|LRRTM4_ENST00000409088.3_Missense_Mutation_p.R181W			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	181					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		TCAAGATTCCGACAGTCTTGA	0.413																																																0			2											62.0	60.0	61.0					2																	77746454		1847	4074	5921	77599962	SO:0001583	missense	80059			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.541C>T	2.37:g.77746454G>A	ENSP00000386357:p.Arg181Trp	Somatic		Capture	Illumina GAIIx	4	77599962	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	HMMSmart_LRRNT,superfamily_SSF52058,HMMSmart_LRR_TYP,HMMPfam_LRR_1	p.R181W	ENST00000409093.1	37	c.541	CCDS46346.1	2	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666997	0.47677	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.71451	0.3341	M	0.64567	1.98	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.72966	-0.4131	10	0.72032	D	0.01	.	18.2226	0.89906	0.0:0.0:1.0:0.0	.	182;181;181	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	W	182;181;181;181;182	ENSP00000387228:R182W;ENSP00000387297:R181W;ENSP00000386357:R181W;ENSP00000386236:R181W;ENSP00000386286:R182W	ENSP00000386236:R181W	R	-	1	2	LRRTM4	77599962	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.672000	0.46850	2.648000	0.89879	0.563000	0.77884	CGG	-	superfamily_SSF52058		0.413	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRTM4	protein_coding	OTTHUMT00000328225.1	G	NM_024993		77599962	-1	no_errors	NM_024993	genbank	human	provisional	54_36p	missense	SNP	1.000	A
ZNF750	79755	genome.wustl.edu	37	17	80788202	80788202	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr17:80788202C>T	ENST00000269394.3	-	3	2821	c.1988G>A	c.(1987-1989)tGc>tAc	p.C663Y	TBCD_ENST00000355528.4_Intron|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000539345.2_Intron|ZNF750_ENST00000572562.1_Missense_Mutation_p.C264Y	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	663					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GTCTTGCCGGCAGGCAGGTTC	0.637																																																0			17											73.0	73.0	73.0					17																	80788202		2203	4300	6503	78381491	SO:0001583	missense	79755			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.1988G>A	17.37:g.80788202C>T	ENSP00000269394:p.Cys663Tyr	Somatic		Capture	Illumina GAIIx	4	78381491	Q9H899	Missense_Mutation	SNP	HMMSmart_ZnF_C2H2	p.C663Y	ENST00000269394.3	37	c.1988	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	C	6.077	0.382573	0.11524	.	.	ENSG00000141579	ENST00000269394;ENST00000543850	T	0.12984	2.63	5.23	-1.06	0.10002	.	0.718085	0.12389	N	0.473239	T	0.11196	0.0273	L	0.47716	1.5	0.09310	N	1	B	0.30824	0.296	B	0.27380	0.079	T	0.25293	-1.0136	9	.	.	.	-3.7886	10.5577	0.45127	0.1976:0.1867:0.6157:0.0	.	663	Q32MQ0	ZN750_HUMAN	Y	663;256	ENSP00000269394:C663Y	.	C	-	2	0	ZNF750	78381491	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.744000	0.04839	-0.073000	0.12842	0.591000	0.81541	TGC	-	NULL		0.637	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	protein_coding	OTTHUMT00000439074.2	C	NM_024702		78381491	-1	no_errors	NM_024702	genbank	human	reviewed	54_36p	missense	SNP	0.000	T
RBM26	64062	genome.wustl.edu	37	13	79951643	79951643	+	Silent	SNP	C	C	T	rs148317097		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr13:79951643C>T	ENST00000438737.2	-	3	638	c.198G>A	c.(196-198)caG>caA	p.Q66Q	RBM26_ENST00000267229.7_Silent_p.Q66Q|RBM26_ENST00000438724.1_Silent_p.Q66Q			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	66				Q -> H (in Ref. 5; CAI56708). {ECO:0000305}.	mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		CCACAAATATCTGTGTCTCTA	0.353																																																0			13											58.0	58.0	58.0					13																	79951643		2203	4300	6503	78849644	SO:0001819	synonymous_variant	64062			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.198G>A	13.37:g.79951643C>T		Somatic		Capture	Illumina GAIIx	4	78849644	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Silent	SNP	superfamily_SSF101233,HMMPfam_DUF1777,HMMPfam_zf-CCCH,HMMSmart_ZnF_C3H1,superfamily_SSF54928,HMMSmart_RRM	p.Q66	ENST00000438737.2	37	c.198		13																																																																																			-	superfamily_SSF101233		0.353	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	RBM26	protein_coding	OTTHUMT00000045373.4	C	NM_022118		78849644	-1	no_errors	NM_022118	genbank	human	validated	54_36p	silent	SNP	1.000	T
KCNK10	54207	genome.wustl.edu	37	14	88654311	88654311	+	Splice_Site	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr14:88654311C>G	ENST00000340700.5	-	6	1447	c.996G>C	c.(994-996)gaG>gaC	p.E332D	KCNK10_ENST00000319231.5_Splice_Site_p.E337D|KCNK10_ENST00000312350.5_Splice_Site_p.E337D	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	332					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						GGGGTCCTACCTCTTCTTTTG	0.493																																																0			14											144.0	145.0	145.0					14																	88654311		2203	4300	6503	87724064	SO:0001630	splice_region_variant	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.996+1G>C	14.37:g.88654311C>G		Somatic		Capture	Illumina GAIIx	4	87724064	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans_2	p.E337D	ENST00000340700.5	37	c.1011	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	C	33	5.255953	0.95336	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	T;T;T	0.24151	1.87;1.87;1.87	5.82	5.82	0.92795	.	0.045796	0.85682	D	0.000000	T	0.48589	0.1508	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.85130	0.997;0.992;0.997	T	0.17410	-1.0370	9	.	.	.	.	19.0811	0.93182	0.0:1.0:0.0:0.0	.	332;337;337	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	D	332;337;337	ENSP00000343104:E332D;ENSP00000310568:E337D;ENSP00000312811:E337D	.	E	-	3	2	KCNK10	87724064	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.067000	0.71193	2.756000	0.94617	0.561000	0.74099	GAG	-	superfamily_Voltage-gated potassium channels		0.493	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	protein_coding	OTTHUMT00000410167.1	C	NM_021161	Missense_Mutation	87724064	-1	no_errors	NM_138317	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
KERA	11081	genome.wustl.edu	37	12	91449298	91449298	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr12:91449298A>G	ENST00000266719.3	-	2	1008	c.761T>C	c.(760-762)cTc>cCc	p.L254P		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	254					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						TCTTGATGGGAGACCCTCATC	0.393																																																0			12											118.0	110.0	113.0					12																	91449298		2203	4299	6502	89973429	SO:0001583	missense	11081			AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.761T>C	12.37:g.91449298A>G	ENSP00000266719:p.Leu254Pro	Somatic		Capture	Illumina GAIIx	4	89973429		Missense_Mutation	SNP	superfamily_SSF52058,HMMPfam_LRRNT,HMMSmart_LRRNT,HMMPfam_LRR_1	p.L254P	ENST00000266719.3	37	c.761	CCDS9037.1	12	.	.	.	.	.	.	.	.	.	.	A	18.08	3.543386	0.65198	.	.	ENSG00000139330	ENST00000266719	T	0.26810	1.71	5.91	5.91	0.95273	.	0.220301	0.46145	D	0.000305	T	0.57036	0.2026	M	0.89095	3.005	0.80722	D	1	D	0.69078	0.997	D	0.67231	0.95	T	0.65434	-0.6169	10	0.72032	D	0.01	-12.7814	15.5248	0.75894	1.0:0.0:0.0:0.0	.	254	O60938	KERA_HUMAN	P	254	ENSP00000266719:L254P	ENSP00000266719:L254P	L	-	2	0	KERA	89973429	1.000000	0.71417	0.998000	0.56505	0.639000	0.38242	8.737000	0.91562	2.269000	0.75478	0.533000	0.62120	CTC	-	superfamily_SSF52058		0.393	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KERA	protein_coding	OTTHUMT00000407149.2	A	NM_007035		89973429	-1	no_errors	NM_007035	genbank	human	validated	54_36p	missense	SNP	0.994	G
MTNR1B	4544	genome.wustl.edu	37	11	92714701	92714701	+	Silent	SNP	C	C	T	rs139515067		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr11:92714701C>T	ENST00000257068.2	+	2	318	c.312C>T	c.(310-312)gaC>gaT	p.D104D		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	104					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)	p.D104D(2)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	TCTTCTATGACGGCTGGGCCC	0.567																																																2	Substitution - coding silent(2)	large_intestine(1)|prostate(1)	11						C		0,4402		0,0,2201	171.0	168.0	169.0		312	-7.9	0.0	11	dbSNP_134	169	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	MTNR1B	NM_005959.3		0,1,6498	TT,TC,CC		0.0116,0.0,0.0077		104/363	92714701	1,12997	2201	4298	6499	92354349	SO:0001819	synonymous_variant	4544			AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.312C>T	11.37:g.92714701C>T		Somatic		Capture	Illumina GAIIx	4	92354349		Silent	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.D104	ENST00000257068.2	37	c.312	CCDS8290.1	11																																																																																			-	superfamily_SSF81321,HMMPfam_7tm_1		0.567	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTNR1B	protein_coding	OTTHUMT00000394323.1	C			92354349	+1	no_errors	NM_005959	genbank	human	reviewed	54_36p	silent	SNP	0.226	T
LOC440311	440311	genome.wustl.edu	37	15	95399482	95399482	+	lincRNA	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr15:95399482C>T	ENST00000602330.1	-	0	293																											CTCTCAGCGGCCCACGAGGTG	0.682																																																0			15																																								93200486			440311																															15.37:g.95399482C>T		Somatic		Capture	Illumina GAIIx	4	93200486		RNA	SNP	-	NULL	ENST00000602330.1	37	NULL		15																																																																																			-	-		0.682	CTD-2576F9.2-001	KNOWN	basic	lincRNA	LOC440311	lincRNA	OTTHUMT00000467393.1	C			93200486	+1	pseudogene	XR_016779	genbank	human	model	54_36p	rna	SNP	0.886	T
ABCA4	24	genome.wustl.edu	37	1	94495004	94495004	+	Silent	SNP	G	G	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:94495004G>T	ENST00000370225.3	-	30	4622	c.4536C>A	c.(4534-4536)ccC>ccA	p.P1512P		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1512					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CAGGTACCTGGGGGGGCGGGA	0.627																																																0			1											13.0	11.0	12.0					1																	94495004		2162	4211	6373	94267592	SO:0001819	synonymous_variant	24			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.4536C>A	1.37:g.94495004G>T		Somatic		Capture	Illumina GAIIx	4	94267592	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	superfamily_SSF52540,HMMSmart_AAA,HMMPfam_ABC_tran,PatternScan_ABC_TRANSPORTER_1	p.P1512	ENST00000370225.3	37	c.4536	CCDS747.1	1																																																																																			-	NULL		0.627	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	G	NM_000350		94267592	-1	no_errors	NM_000350	genbank	human	reviewed	54_36p	silent	SNP	0.085	T
FFAR4	338557	genome.wustl.edu	37	10	95347019	95347019	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr10:95347019T>G	ENST00000371483.4	+	4	843	c.787T>G	c.(787-789)Tac>Gac	p.Y263D	FFAR4_ENST00000604414.1_Intron|FFAR4_ENST00000371481.4_Missense_Mutation_p.Y247D	NM_181745.3	NP_859529.2	Q5NUL3	FFAR4_HUMAN	free fatty acid receptor 4	263					hormone secretion (GO:0046879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of inflammatory response (GO:0050728)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of glucose transport (GO:0010827)	endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fatty acid binding (GO:0005504)|taste receptor activity (GO:0008527)										AAGCCTGGCCTACTCGGAGAG	0.562																																																0			10											87.0	83.0	85.0					10																	95347019		2203	4300	6503	95337009	SO:0001583	missense	338557				CCDS31248.1, CCDS55720.1	10q23.33	2012-11-16	2012-11-16	2012-11-16	ENSG00000186188	ENSG00000186188		"""GPCR / Class A : Fatty acid receptors"""	19061	protein-coding gene	gene with protein product		609044	"""G protein-coupled receptor 129"", ""G protein-coupled receptor 120"", ""omega-3 fatty acid receptor 1"""	GPR129, GPR120, O3FAR1		20471368, 19723586, 15619630, 20813258	Standard	NM_181745		Approved	PGR4	uc010qnt.2	Q5NUL3	OTTHUMG00000034409	ENST00000371483.4:c.787T>G	10.37:g.95347019T>G	ENSP00000360538:p.Tyr263Asp	Somatic		Capture	Illumina GAIIx	4	95337009	Q495H1|Q5VY25|Q5VY26|Q7Z605|Q86SM7	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1	p.Y263D	ENST00000371483.4	37	c.787	CCDS31248.1	10	.	.	.	.	.	.	.	.	.	.	T	10.60	1.394894	0.25205	.	.	ENSG00000186188	ENST00000371481;ENST00000371483	T;T	0.62639	1.23;0.01	4.99	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	0.195715	0.35466	N	0.003192	T	0.58949	0.2158	L	0.36672	1.1	0.32093	N	0.591657	D;D	0.55800	0.97;0.973	P;P	0.52481	0.646;0.7	T	0.62737	-0.6791	10	0.23891	T	0.37	-12.714	11.0297	0.47765	0.0:0.0736:0.0:0.9264	.	247;263	Q5NUL3-2;Q5NUL3	.;O3FA1_HUMAN	D	247;263	ENSP00000360536:Y247D;ENSP00000360538:Y263D	ENSP00000360536:Y247D	Y	+	1	0	O3FAR1	95337009	0.997000	0.39634	0.222000	0.23844	0.007000	0.05969	3.493000	0.53266	1.015000	0.39444	-0.451000	0.05528	TAC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.562	FFAR4-002	KNOWN	basic|CCDS	protein_coding	GPR120	protein_coding	OTTHUMT00000083179.1	T	NM_181745		95337009	+1	no_errors	NM_181745	genbank	human	validated	54_36p	missense	SNP	0.372	G
NEDD1	121441	genome.wustl.edu	37	12	97328874	97328874	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr12:97328874G>T	ENST00000266742.4	+	7	949	c.610G>T	c.(610-612)Gta>Tta	p.V204L	NEDD1_ENST00000557644.1_Missense_Mutation_p.V211L|NEDD1_ENST00000429527.2_Missense_Mutation_p.V204L|NEDD1_ENST00000411739.2_Missense_Mutation_p.V115L|NEDD1_ENST00000457368.2_Missense_Mutation_p.V115L|NEDD1_ENST00000555114.1_3'UTR	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	204					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)				breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						CTTTGACAGTGTACACAAAGC	0.403																																																0			12											232.0	220.0	224.0					12																	97328874		2203	4300	6503	95853005	SO:0001583	missense	121441				CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.610G>T	12.37:g.97328874G>T	ENSP00000266742:p.Val204Leu	Somatic		Capture	Illumina GAIIx	4	95853005	B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.V204L	ENST00000266742.4	37	c.610	CCDS9063.1	12	.	.	.	.	.	.	.	.	.	.	G	10.77	1.444039	0.25987	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000553609;ENST00000557644;ENST00000457368	T;T;T;T;T;T	0.28666	1.63;1.63;1.6;1.63;1.63;1.6	5.71	3.37	0.38596	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.452981	0.27280	N	0.020091	T	0.17916	0.0430	N	0.17474	0.49	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17198	-1.0377	10	0.54805	T	0.06	.	8.0202	0.30404	0.7733:0.0:0.2267:0.0	.	211;204	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	L	204;204;115;115;211;115	ENSP00000266742:V204L;ENSP00000404978:V204L;ENSP00000411307:V115L;ENSP00000451830:V115L;ENSP00000451211:V211L;ENSP00000407964:V115L	ENSP00000266742:V204L	V	+	1	0	NEDD1	95853005	0.772000	0.28567	0.486000	0.27416	0.212000	0.24457	1.374000	0.34283	0.444000	0.26612	-0.312000	0.09012	GTA	-	superfamily_WD40 repeat-like,HMMSmart_SM00320		0.403	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEDD1	protein_coding	OTTHUMT00000409792.1	G			95853005	+1	no_errors	NM_152905	genbank	human	validated	54_36p	missense	SNP	0.990	T
DPYD	1806	genome.wustl.edu	37	1	98039475	98039475	+	Silent	SNP	G	G	T	rs140602333		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:98039475G>T	ENST00000370192.3	-	11	1280	c.1180C>A	c.(1180-1182)Cgg>Agg	p.R394R		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	394					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	ATAACCTTCCGTGGGGACAGG	0.383																																																0			1											102.0	93.0	96.0					1																	98039475		2203	4300	6503	97812063	SO:0001819	synonymous_variant	1806			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1180C>A	1.37:g.98039475G>T		Somatic		Capture	Illumina GAIIx	4	97812063	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Silent	SNP	superfamily_Helical_ferredxn,superfamily_SSF51971,HMMPfam_Pyr_redox_2,superfamily_SSF51395,HMMPfam_DHO_dh,superfamily_SSF54862,HMMPfam_Fer4,PatternScan_4FE4S_FER_1	p.R394	ENST00000370192.3	37	c.1180	CCDS30777.1	1																																																																																			-	superfamily_SSF51971,HMMPfam_Pyr_redox_2		0.383	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	protein_coding	OTTHUMT00000095698.3	G	NM_000110		97812063	-1	no_errors	NM_000110	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
FRRS1	391059	genome.wustl.edu	37	1	100178020	100178020	+	Missense_Mutation	SNP	G	G	A	rs200193081		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:100178020G>A	ENST00000414213.1	-	13	1976	c.1375C>T	c.(1375-1377)Ctt>Ttt	p.L459F	FRRS1_ENST00000287474.5_Missense_Mutation_p.L459F|FRRS1_ENST00000492943.1_5'UTR			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	459	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		AGAGGCTGAAGAACTGCCAAA	0.408																																																0			1											98.0	94.0	95.0					1																	100178020		2203	4300	6503	99950608	SO:0001583	missense	391059			AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.1375C>T	1.37:g.100178020G>A	ENSP00000393884:p.Leu459Phe	Somatic		Capture	Illumina GAIIx	4	99950608	A6NLN7	Missense_Mutation	SNP	HMMPfam_Reeler,HMMPfam_DOMON,HMMSmart_DoH,HMMSmart_B561	p.L459F	ENST00000414213.1	37	c.1375		1	.	.	.	.	.	.	.	.	.	.	G	7.687	0.690145	0.15039	.	.	ENSG00000156869	ENST00000414213;ENST00000287474	.	.	.	5.62	4.71	0.59529	.	0.342816	0.27627	N	0.018530	T	0.31420	0.0796	L	0.41027	1.25	0.45403	D	0.998384	B	0.12013	0.005	B	0.17433	0.018	T	0.21759	-1.0236	9	0.41790	T	0.15	-22.1062	10.5441	0.45050	0.157:0.0:0.843:0.0	.	459	Q6ZNA5-2	.	F	459	.	ENSP00000287474:L459F	L	-	1	0	FRRS1	99950608	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	1.863000	0.39459	1.384000	0.46424	0.655000	0.94253	CTT	-	HMMSmart_B561		0.408	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	FRRS1	protein_coding		G	NM_001013660		99950608	-1	no_errors	NM_001013660	genbank	human	validated	54_36p	missense	SNP	1.000	A
BTK	695	genome.wustl.edu	37	X	100617667	100617667	+	Silent	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrX:100617667G>A	ENST00000308731.7	-	6	565	c.402C>T	c.(400-402)taC>taT	p.Y134Y	BTK_ENST00000372880.1_Silent_p.Y134Y	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	134					adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GATCACTGTTGTACCGGATTA	0.453									Agammaglobulinemia, X-linked																																							0			X	GRCh37	CD002495|CM960199	BTK	D|M							157.0	146.0	150.0					X																	100617667		2203	4300	6503	100504323	SO:0001819	synonymous_variant	695	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.402C>T	X.37:g.100617667G>A		Somatic		Capture	Illumina GAIIx	4	100504323	B2RAW1|Q32ML5	Silent	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMSmart_BTK,HMMPfam_BTK,superfamily_SH3,HMMPfam_SH3_1,HMMSmart_SH3,superfamily_SSF55550,HMMSmart_SH2,HMMPfam_SH2,superfamily_Kinase_like,HMMPfam_Pkinase_Tyr,HMMSmart_TyrKc,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_TYR	p.Y134	ENST00000308731.7	37	c.402	CCDS14482.1	X																																																																																			-	superfamily_SSF50729,HMMSmart_PH		0.453	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	protein_coding	OTTHUMT00000057532.2	G	NM_000061		100504323	-1	no_errors	NM_000061	genbank	human	reviewed	54_36p	silent	SNP	1.000	A
OLFM3	118427	genome.wustl.edu	37	1	102290720	102290720	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:102290720G>C	ENST00000338858.5	-	4	513	c.514C>G	c.(514-516)Cag>Gag	p.Q172E	OLFM3_ENST00000536598.1_Missense_Mutation_p.Q77E|OLFM3_ENST00000359814.3_Missense_Mutation_p.Q172E|OLFM3_ENST00000370103.4_Missense_Mutation_p.Q152E|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	172					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TCCTTGAACTGGGTGATTAAC	0.458																																																0			1											134.0	122.0	126.0					1																	102290720		2203	4300	6503	102063308	SO:0001583	missense	118427			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.514C>G	1.37:g.102290720G>C	ENSP00000345192:p.Gln172Glu	Somatic		Capture	Illumina GAIIx	4	102063308	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	HMMPfam_OLF,HMMSmart_SM00284	p.Q152E	ENST00000338858.5	37	c.454		1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.714153	0.68730	.	.	ENSG00000118733	ENST00000424771;ENST00000370103;ENST00000338858;ENST00000536598;ENST00000359814	D;D;T;T	0.88586	-2.39;-2.4;-0.78;0.42	5.91	5.91	0.95273	.	0.052092	0.85682	D	0.000000	D	0.85435	0.5696	M	0.68952	2.095	0.54753	D	0.999982	B;B	0.29037	0.049;0.231	B;B	0.22386	0.027;0.039	D	0.83795	0.0233	10	0.66056	D	0.02	.	20.2963	0.98556	0.0:0.0:1.0:0.0	.	152;172	Q5T3V6;Q96PB7	.;NOE3_HUMAN	E	23;152;172;77;172	ENSP00000359121:Q152E;ENSP00000345192:Q172E;ENSP00000443471:Q77E;ENSP00000352867:Q172E	ENSP00000345192:Q172E	Q	-	1	0	OLFM3	102063308	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	9.848000	0.99507	2.813000	0.96785	0.655000	0.94253	CAG	-	NULL		0.458	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	OLFM3	protein_coding	OTTHUMT00000030142.1	G			102063308	-1	no_errors	NM_058170	genbank	human	validated	54_36p	missense	SNP	1.000	C
UBE2D3	7323	genome.wustl.edu	37	4	103730993	103730993	+	Missense_Mutation	SNP	C	C	T	rs563106506		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr4:103730993C>T	ENST00000453744.2	-	3	557	c.44G>A	c.(43-45)cGt>cAt	p.R15H	UBE2D3_ENST00000338145.3_Missense_Mutation_p.R15H|UBE2D3_ENST00000504211.1_De_novo_Start_OutOfFrame|UBE2D3_ENST00000394801.4_Missense_Mutation_p.R15H|UBE2D3_ENST00000357194.6_Missense_Mutation_p.R17H|UBE2D3_ENST00000343106.5_Missense_Mutation_p.R15H|UBE2D3_ENST00000321805.7_Missense_Mutation_p.R15H|UBE2D3_ENST00000394804.2_Missense_Mutation_p.R15H|UBE2D3_ENST00000350435.7_Missense_Mutation_p.R9H|UBE2D3_ENST00000513098.1_5'UTR|UBE2D3_ENST00000349311.8_Missense_Mutation_p.R15H|UBE2D3_ENST00000507845.1_De_novo_Start_OutOfFrame|UBE2D3_ENST00000505207.1_De_novo_Start_OutOfFrame|UBE2D3_ENST00000394803.5_Missense_Mutation_p.R15H|UBE2D3_ENST00000502404.1_De_novo_Start_OutOfFrame	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	15					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TGGAGGGTCACGGGCCAAATC	0.388													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16909	0.0		0.0	False		,,,				2504	0.0															0			4											113.0	114.0	114.0					4																	103730993		2203	4300	6503	103950104	SO:0001583	missense	7323			U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.44G>A	4.37:g.103730993C>T	ENSP00000396901:p.Arg15His	Somatic		Capture	Illumina GAIIx	4	103950104	A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Missense_Mutation	SNP	superfamily_UBQ-conjugat/RWD-like,HMMSmart_UBCc,HMMPfam_UQ_con,PatternScan_UBIQUITIN_CONJUGAT_1	p.R17H	ENST00000453744.2	37	c.50	CCDS3660.1	4	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996165	0.74703	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000350435;ENST00000338145;ENST00000349311;ENST00000357194;ENST00000508238;ENST00000502690;ENST00000508249	T;T;T;T;T;T;T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.58	5.58	0.84498	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.048442	0.85682	D	0.000000	T	0.51244	0.1663	M	0.77103	2.36	0.80722	D	1	B;B;B	0.11235	0.003;0.004;0.003	B;B;B	0.20184	0.004;0.028;0.003	T	0.52328	-0.8590	10	0.87932	D	0	.	19.6572	0.95847	0.0:1.0:0.0:0.0	.	17;15;15	P61077-3;P61077;P61077-2	.;UB2D3_HUMAN;.	H	15;15;15;15;15;15;9;15;15;17;15;15;15	ENSP00000396901:R15H;ENSP00000378280:R15H;ENSP00000378282:R15H;ENSP00000378283:R15H;ENSP00000345285:R15H;ENSP00000318494:R15H;ENSP00000337262:R9H;ENSP00000337208:R15H;ENSP00000344069:R15H;ENSP00000349722:R17H;ENSP00000423487:R15H;ENSP00000425762:R15H;ENSP00000421310:R15H	ENSP00000318494:R15H	R	-	2	0	UBE2D3	103950104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.541000	0.82084	2.630000	0.89119	0.650000	0.86243	CGT	-	superfamily_UBQ-conjugat/RWD-like,HMMSmart_UBCc,HMMPfam_UQ_con		0.388	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UBE2D3	protein_coding	OTTHUMT00000253791.2	C	NM_181893		103950104	-1	no_errors	NM_181893	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
APPL2	55198	genome.wustl.edu	37	12	105568105	105568105	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr12:105568105T>A	ENST00000258530.3	-	21	2207	c.1982A>T	c.(1981-1983)gAa>gTa	p.E661V	APPL2_ENST00000539978.2_Missense_Mutation_p.E618V|APPL2_ENST00000551662.1_Missense_Mutation_p.E667V|APPL2_ENST00000546731.1_Missense_Mutation_p.E104V	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	0					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TGCTTCGGATTCTGCGCCTCT	0.458																																																0			12											219.0	177.0	191.0					12																	105568105		2203	4300	6503	104092235	SO:0001583	missense	55198			AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.1982A>T	12.37:g.105568105T>A	ENSP00000258530:p.Glu661Val	Somatic		Capture	Illumina GAIIx	4	104092235	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMPfam_PID	p.E661V	ENST00000258530.3	37	c.1982	CCDS9101.1	12	.	.	.	.	.	.	.	.	.	.	T	26.5	4.746522	0.89663	.	.	ENSG00000136044	ENST00000258530;ENST00000539978;ENST00000546731;ENST00000551662	T;T;T	0.29397	2.36;1.57;2.14	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.45736	0.1357	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	T	0.45293	-0.9271	10	0.87932	D	0	-28.6731	16.3798	0.83452	0.0:0.0:0.0:1.0	.	667;661	F8W1P5;Q8NEU8	.;DP13B_HUMAN	V	661;618;104;667	ENSP00000258530:E661V;ENSP00000444472:E618V;ENSP00000446917:E667V	ENSP00000258530:E661V	E	-	2	0	APPL2	104092235	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.819000	0.69243	2.271000	0.75665	0.533000	0.62120	GAA	-	NULL		0.458	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPL2	protein_coding	OTTHUMT00000406238.3	T	NM_018171		104092235	-1	no_errors	NM_018171	genbank	human	validated	54_36p	missense	SNP	1.000	A
SRPK2	6733	genome.wustl.edu	37	7	104783758	104783758	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr7:104783758T>G	ENST00000393651.3	-	10	920	c.833A>C	c.(832-834)aAc>aCc	p.N278T	SRPK2_ENST00000489828.1_Missense_Mutation_p.N267T|SRPK2_ENST00000357311.3_Missense_Mutation_p.N267T	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						TTTCTTTTTGTTTTTAGATAT	0.378																																																0			7											50.0	51.0	51.0					7																	104783758		2203	4300	6503	104570994	SO:0001583	missense	6733			U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.833A>C	7.37:g.104783758T>G	ENSP00000377262:p.Asn278Thr	Somatic		Capture	Illumina GAIIx	4	104570994		Missense_Mutation	SNP	superfamily_Kinase_like,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST	p.N278T	ENST00000393651.3	37	c.833	CCDS34724.1	7	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279707	0.80692	.	.	ENSG00000135250	ENST00000393651;ENST00000357311;ENST00000489828	T;T;T	0.23950	1.88;1.88;1.88	5.68	5.68	0.88126	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.051274	0.85682	D	0.000000	T	0.46210	0.1381	L	0.56199	1.76	0.80722	D	1	D;D	0.71674	0.998;0.993	D;D	0.78314	0.991;0.971	T	0.24261	-1.0165	10	0.34782	T	0.22	-16.9235	15.9347	0.79694	0.0:0.0:0.0:1.0	.	278;267	P78362-2;P78362	.;SRPK2_HUMAN	T	278;267;267	ENSP00000377262:N278T;ENSP00000349863:N267T;ENSP00000419791:N267T	ENSP00000349863:N267T	N	-	2	0	SRPK2	104570994	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.506000	0.81665	2.167000	0.68274	0.454000	0.30748	AAC	-	superfamily_Kinase_like,HMMPfam_Pkinase		0.378	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	protein_coding	OTTHUMT00000348723.1	T	NM_182691		104570994	-1	no_errors	NM_182692	genbank	human	validated	54_36p	missense	SNP	1.000	G
EXPH5	23086	genome.wustl.edu	37	11	108409763	108409763	+	Missense_Mutation	SNP	A	A	T	rs139655098		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr11:108409763A>T	ENST00000265843.4	-	3	541	c.431T>A	c.(430-432)cTg>cAg	p.L144Q	EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000443411.1_5'Flank|EXPH5_ENST00000428840.1_Missense_Mutation_p.L68Q|EXPH5_ENST00000525344.1_Missense_Mutation_p.L137Q	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	144					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTTCTGTCCCAGTGATGGAAG	0.443																																																0			11											137.0	129.0	132.0					11																	108409763		2201	4298	6499	107914973	SO:0001583	missense	23086				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.431T>A	11.37:g.108409763A>T	ENSP00000265843:p.Leu144Gln	Somatic		Capture	Illumina GAIIx	4	107914973	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	NULL	p.L144Q	ENST00000265843.4	37	c.431	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	A	9.870	1.198773	0.22121	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000525344;ENST00000526312;ENST00000531386	T;T;T;T;T	0.35236	4.2;4.13;4.2;4.04;1.32	5.2	-5.06	0.02946	.	1.417150	0.04742	N	0.422998	T	0.36799	0.0980	L	0.51422	1.61	0.09310	N	0.999999	P	0.47677	0.899	P	0.51355	0.667	T	0.42015	-0.9476	10	0.25751	T	0.34	13.576	5.0912	0.14710	0.3589:0.0:0.3859:0.2553	.	144	Q8NEV8	EXPH5_HUMAN	Q	144;68;137;68;68	ENSP00000265843:L144Q;ENSP00000391966:L68Q;ENSP00000432546:L137Q;ENSP00000432683:L68Q;ENSP00000433909:L68Q	ENSP00000265843:L144Q	L	-	2	0	EXPH5	107914973	0.000000	0.05858	0.007000	0.13788	0.058000	0.15608	-0.342000	0.07801	-0.875000	0.04022	-0.451000	0.05528	CTG	-	NULL		0.443	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	protein_coding	OTTHUMT00000390279.1	A	NM_015065		107914973	-1	no_errors	NM_015065	genbank	human	validated	54_36p	missense	SNP	0.000	T
CARKD	55739	genome.wustl.edu	37	13	111287051	111287051	+	Silent	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr13:111287051C>T	ENST00000309957.2	+	7	593	c.579C>T	c.(577-579)gcC>gcT	p.A193A	CARKD_ENST00000458711.2_Silent_p.A62A|CARKD_ENST00000397191.4_3'UTR|CARKD_ENST00000424185.2_Silent_p.A83A|CARKD_ENST00000470164.2_3'UTR	NM_001242881.1|NM_018210.3	NP_001229810.1|NP_060680.2			carbohydrate kinase domain containing											NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	15						AGCAGCCGGCCCTCATCCATG	0.622																																																0			13											67.0	60.0	63.0					13																	111287051		2203	4300	6503	110085052	SO:0001819	synonymous_variant	55739			AF151071	CCDS9513.1, CCDS55903.1	13q34	2008-12-19			ENSG00000213995	ENSG00000213995			25576	protein-coding gene	gene with protein product		615910					Standard	NM_018210		Approved	LP3298, FLJ10769	uc001vrc.3	Q8IW45	OTTHUMG00000017345	ENST00000309957.2:c.579C>T	13.37:g.111287051C>T		Somatic		Capture	Illumina GAIIx	4	110085052		Silent	SNP	superfamily_SSF53613,HMMPfam_Carb_kinase	p.A193	ENST00000309957.2	37	c.579	CCDS9513.1	13																																																																																			-	superfamily_SSF53613,HMMPfam_Carb_kinase		0.622	CARKD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARKD	protein_coding	OTTHUMT00000045764.1	C	NM_018210		110085052	+1	no_errors	NM_018210	genbank	human	validated	54_36p	silent	SNP	0.998	T
ELOVL6	79071	genome.wustl.edu	37	4	110972637	110972637	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr4:110972637A>G	ENST00000394607.3	-	5	818	c.655T>C	c.(655-657)Tgg>Cgg	p.W219R	ELOVL6_ENST00000302274.3_Missense_Mutation_p.W219R			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	219					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		TGCTGCATCCAGCAGAAGACC	0.498																																																0			4											128.0	112.0	117.0					4																	110972637		2203	4300	6503	111192086	SO:0001583	missense	79071			AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.655T>C	4.37:g.110972637A>G	ENSP00000378105:p.Trp219Arg	Somatic		Capture	Illumina GAIIx	4	111192086	Q4W5L0|Q8NCD1	Missense_Mutation	SNP	HMMPfam_ELO,PatternScan_ELO	p.W219R	ENST00000394607.3	37	c.655	CCDS3690.1	4	.	.	.	.	.	.	.	.	.	.	A	16.13	3.035034	0.54896	.	.	ENSG00000170522	ENST00000394607;ENST00000302274	T;T	0.21361	2.01;2.01	5.97	4.77	0.60923	.	0.050992	0.85682	N	0.000000	T	0.37919	0.1021	M	0.83774	2.66	0.80722	D	1	B	0.26935	0.164	B	0.41412	0.356	T	0.15263	-1.0443	10	0.36615	T	0.2	-9.9727	12.5677	0.56318	0.8753:0.0:0.0:0.1247	.	219	Q9H5J4	ELOV6_HUMAN	R	219	ENSP00000378105:W219R;ENSP00000304736:W219R	ENSP00000304736:W219R	W	-	1	0	ELOVL6	111192086	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	9.281000	0.95811	1.054000	0.40438	-0.336000	0.08194	TGG	-	HMMPfam_ELO		0.498	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELOVL6	protein_coding	OTTHUMT00000255748.1	A	NM_024090		111192086	-1	no_errors	NM_024090	genbank	human	validated	54_36p	missense	SNP	1.000	G
CSMD3	114788	genome.wustl.edu	37	8	114031368	114031368	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr8:114031368T>G	ENST00000297405.5	-	6	1202	c.958A>C	c.(958-960)Aaa>Caa	p.K320Q	CSMD3_ENST00000455883.2_Missense_Mutation_p.K320Q|CSMD3_ENST00000343508.3_Missense_Mutation_p.K280Q|CSMD3_ENST00000352409.3_Missense_Mutation_p.K320Q	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	320	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGCCAGTTTTTGTTGCTGATA	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						0			8											211.0	193.0	199.0					8																	114031368		2203	4300	6503	114100544	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.958A>C	8.37:g.114031368T>G	ENSP00000297405:p.Lys320Gln	Somatic		Capture	Illumina GAIIx	4	114100544	Q96PZ3	Missense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032,PatternScan_GLYCOSYL_HYDROL_F10	p.K320Q	ENST00000297405.5	37	c.958	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	T	20.6	4.023467	0.75390	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27	5.6	5.6	0.85130	CUB (5);	0.000000	0.64402	D	0.000001	D	0.93174	0.7826	N	0.21508	0.67	0.38623	D	0.95118	D;D;D;D	0.89917	0.989;0.999;1.0;0.999	D;D;D;D	0.91635	0.985;0.996;0.999;0.998	D	0.91363	0.5113	10	0.13853	T	0.58	.	15.7878	0.78322	0.0:0.0:0.0:1.0	.	320;320;320;280	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	Q	280;320;320;320	ENSP00000345799:K280Q;ENSP00000297405:K320Q;ENSP00000412263:K320Q;ENSP00000343124:K320Q	ENSP00000297405:K320Q	K	-	1	0	CSMD3	114100544	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.694000	0.84235	2.132000	0.65825	0.377000	0.23210	AAA	-	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042		0.358	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	T	NM_052900		114100544	-1	no_errors	NM_198123	genbank	human	validated	54_36p	missense	SNP	1.000	G
TSHB	7252	genome.wustl.edu	37	1	115576841	115576841	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:115576841C>T	ENST00000369517.1	+	2	410	c.410C>T	c.(409-411)tCt>tTt	p.S137F	TSHB_ENST00000256592.1_Missense_Mutation_p.S137F			P01222	TSHB_HUMAN	thyroid stimulating hormone, beta	137					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|G-protein coupled receptor signaling pathway (GO:0007186)|peptide hormone processing (GO:0016486)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to vitamin A (GO:0033189)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7	Lung SC(450;0.211)	all_cancers(81;3.22e-07)|all_epithelial(167;1.4e-06)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)		GTAGGATTTTCTGTCTAATAG	0.333																																																0			1											87.0	87.0	87.0					1																	115576841		2203	4299	6502	115378364	SO:0001583	missense	7252			BC069298	CCDS880.1	1p13	2013-02-28			ENSG00000134200	ENSG00000134200		"""Endogenous ligands"""	12372	protein-coding gene	gene with protein product		188540				2457586, 3243440	Standard	NM_000549		Approved		uc001efs.2	P01222	OTTHUMG00000011881	ENST00000369517.1:c.410C>T	1.37:g.115576841C>T	ENSP00000358530:p.Ser137Phe	Somatic		Capture	Illumina GAIIx	4	115378364	B1AKP0|Q16163	Missense_Mutation	SNP	HMMSmart_SM00068,HMMPfam_Cys_knot,superfamily_Cystine-knot cytokines,PatternScan_GLYCO_HORMONE_BETA_1,PatternScan_GLYCO_HORMONE_BETA_2	p.S137F	ENST00000369517.1	37	c.410	CCDS880.1	1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.205789	0.58234	.	.	ENSG00000134200	ENST00000256592;ENST00000369517	T;T	0.61510	0.1;0.1	5.67	5.67	0.87782	.	0.409823	0.27650	N	0.018428	T	0.32763	0.0840	N	0.24115	0.695	0.32899	D	0.512885	P	0.38195	0.622	B	0.39562	0.303	T	0.47484	-0.9114	10	0.87932	D	0	-4.0444	12.6216	0.56605	0.0:0.9205:0.0:0.0795	.	137	P01222	TSHB_HUMAN	F	137	ENSP00000256592:S137F;ENSP00000358530:S137F	ENSP00000256592:S137F	S	+	2	0	TSHB	115378364	0.970000	0.33590	0.997000	0.53966	0.782000	0.44232	2.155000	0.42301	2.665000	0.90641	0.591000	0.81541	TCT	-	NULL		0.333	TSHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHB	protein_coding	OTTHUMT00000032833.2	C	NM_000549		115378364	+1	no_errors	NM_000549	genbank	human	validated	54_36p	missense	SNP	0.818	T
CEP164	22897	genome.wustl.edu	37	11	117280419	117280419	+	Silent	SNP	C	C	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr11:117280419C>A	ENST00000278935.3	+	30	3981	c.3834C>A	c.(3832-3834)gtC>gtA	p.V1278V	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1278					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		TGAGCAGTGTCCTCAGCATCC	0.652																																																0			11											104.0	113.0	110.0					11																	117280419		2201	4296	6497	116785629	SO:0001819	synonymous_variant	22897			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.3834C>A	11.37:g.117280419C>A		Somatic		Capture	Illumina GAIIx	4	116785629	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Silent	SNP	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW	p.V1278	ENST00000278935.3	37	c.3834	CCDS31683.1	11																																																																																			-	NULL		0.652	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	protein_coding	OTTHUMT00000392893.1	C	NM_014956		116785629	+1	no_errors	NM_014956	genbank	human	validated	54_36p	silent	SNP	0.035	A
TENM1	10178	genome.wustl.edu	37	X	123518149	123518149	+	Missense_Mutation	SNP	C	C	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chrX:123518149C>G	ENST00000371130.3	-	29	6674	c.6611G>C	c.(6610-6612)aGa>aCa	p.R2204T	TENM1_ENST00000422452.2_Missense_Mutation_p.R2211T|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2204					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TTCTCCTAATCTGGTGATGCG	0.428																																																0			X											85.0	80.0	82.0					X																	123518149		2203	4300	6503	123345830	SO:0001583	missense	10178			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6611G>C	X.37:g.123518149C>G	ENSP00000360171:p.Arg2204Thr	Somatic		Capture	Illumina GAIIx	4	123345830	B2RTR5|Q5JZ17	Missense_Mutation	SNP	HMMPfam_Ten_N,HMMSmart_EGF,HMMPfam_EGF_2,PatternScan_EGF_1,PatternScan_EGF_2,HMMPfam_EGF,superfamily_SSF57196,superfamily_SSF101898,HMMPfam_NHL,superfamily_N2O_reductase_N,HMMPfam_RHS_repeat	p.R2204T	ENST00000371130.3	37	c.6611	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	19.17	3.776010	0.70107	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86030	-2.06;-2.03	5.79	5.79	0.91817	.	0.048436	0.85682	D	0.000000	D	0.87224	0.6124	M	0.71206	2.165	0.58432	D	0.999999	P;P;D	0.54772	0.915;0.915;0.968	B;B;P	0.46110	0.395;0.321;0.504	D	0.87163	0.2216	10	0.41790	T	0.15	.	18.9778	0.92745	0.0:1.0:0.0:0.0	.	2210;2211;2204	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	T	2204;2211	ENSP00000360171:R2204T;ENSP00000403954:R2211T	ENSP00000360171:R2204T	R	-	2	0	ODZ1	123345830	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.919000	0.63383	2.430000	0.82344	0.544000	0.68410	AGA	-	NULL		0.428	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	protein_coding	OTTHUMT00000058985.1	C	NM_014253		123345830	-1	no_errors	NM_014253	genbank	human	provisional	54_36p	missense	SNP	1.000	G
UROS	7390	genome.wustl.edu	37	10	127505050	127505050	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr10:127505050T>G	ENST00000368797.4	-	2	243	c.19A>C	c.(19-21)Aag>Cag	p.K7Q	UROS_ENST00000368778.3_Missense_Mutation_p.K7Q|UROS_ENST00000368774.1_Missense_Mutation_p.K7Q|UROS_ENST00000368786.1_Missense_Mutation_p.K7Q	NM_000375.2	NP_000366.1	P10746	HEM4_HUMAN	uroporphyrinogen III synthase	7					cellular response to amine stimulus (GO:0071418)|cellular response to arsenic-containing substance (GO:0071243)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to antibiotic (GO:0046677)|small molecule metabolic process (GO:0044281)|uroporphyrinogen III biosynthetic process (GO:0006780)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|uroporphyrinogen-III synthase activity (GO:0004852)			endometrium(2)|large_intestine(2)|lung(2)|skin(1)	7		all_lung(145;0.00756)|Lung NSC(174;0.0116)|Colorectal(57;0.0855)|all_neural(114;0.0937)|Breast(234;0.203)				TTCGCATCCTTCAGTAAAAGA	0.473																																																0			10											142.0	125.0	131.0					10																	127505050		2203	4300	6503	127495040	SO:0001583	missense	7390			J03824	CCDS7648.1	10q25.2-q26.3	2008-07-31	2008-07-31		ENSG00000188690	ENSG00000188690	4.2.1.75		12592	protein-coding gene	gene with protein product	"""congenital erythropoietic porphyria"""	606938				2037278	Standard	NM_000375		Approved		uc001lix.4	P10746	OTTHUMG00000019236	ENST00000368797.4:c.19A>C	10.37:g.127505050T>G	ENSP00000357787:p.Lys7Gln	Somatic		Capture	Illumina GAIIx	4	127495040	B2RC13|D3DRF7|Q9H2T1	Missense_Mutation	SNP	superfamily_Uroporphyrinogen III synthase (U3S HemD),HMMPfam_HEM4,PatternScan_ALDEHYDE_DEHYDR_CYS	p.K7Q	ENST00000368797.4	37	c.19	CCDS7648.1	10	.	.	.	.	.	.	.	.	.	.	T	18.63	3.665634	0.67700	.	.	ENSG00000188690	ENST00000368797;ENST00000368786;ENST00000420761;ENST00000368778;ENST00000368774	D;D;D;D;D	0.93133	-3.17;-3.17;-3.17;-3.17;-3.17	5.17	5.17	0.71159	Tetrapyrrole biosynthesis, uroporphyrinogen III synthase (1);	0.000000	0.85682	D	0.000000	D	0.96262	0.8781	M	0.84433	2.695	0.53005	D	0.999963	D	0.76494	0.999	D	0.63381	0.914	D	0.96693	0.9512	10	0.87932	D	0	-22.773	12.627	0.56636	0.0:0.0:0.0:1.0	.	7	P10746	HEM4_HUMAN	Q	7	ENSP00000357787:K7Q;ENSP00000357775:K7Q;ENSP00000414833:K7Q;ENSP00000357767:K7Q;ENSP00000357763:K7Q	ENSP00000357763:K7Q	K	-	1	0	UROS	127495040	1.000000	0.71417	0.996000	0.52242	0.600000	0.36913	4.786000	0.62425	2.163000	0.67991	0.533000	0.62120	AAG	-	superfamily_Uroporphyrinogen III synthase (U3S HemD)		0.473	UROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROS	protein_coding	OTTHUMT00000050929.1	T	NM_000375		127495040	-1	no_errors	NM_000375	genbank	human	reviewed	54_36p	missense	SNP	0.977	G
THEMIS	387357	genome.wustl.edu	37	6	128134406	128134406	+	Silent	SNP	C	C	T	rs141905910		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr6:128134406C>T	ENST00000368248.2	-	4	1528	c.1380G>A	c.(1378-1380)aaG>aaA	p.K460K	THEMIS_ENST00000537166.1_Silent_p.K425K|THEMIS_ENST00000543064.1_Silent_p.K460K|THEMIS_ENST00000368250.1_Silent_p.K381K	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	460	CABIT 2.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						TGACAGACACCTTCACATTGA	0.458																																																0			6											84.0	85.0	85.0					6																	128134406		2203	4300	6503	128176099	SO:0001819	synonymous_variant	387357			AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1380G>A	6.37:g.128134406C>T		Somatic		Capture	Illumina GAIIx	4	128176099	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Silent	SNP	NULL	p.K460	ENST00000368248.2	37	c.1380	CCDS34534.1	6																																																																																			-	NULL		0.458	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	C6orf190	protein_coding		C	NM_001010923		128176099	-1	no_errors	NM_001010923	genbank	human	validated	54_36p	silent	SNP	1.000	T
OPCML	4978	genome.wustl.edu	37	11	132527095	132527095	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr11:132527095G>T	ENST00000331898.7	-	2	865	c.287C>A	c.(286-288)aCc>aAc	p.T96N	OPCML_ENST00000524381.1_Missense_Mutation_p.T89N|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000374778.4_Missense_Mutation_p.T55N|OPCML_ENST00000541867.1_Missense_Mutation_p.T96N	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	96	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GCTGTACTGGGTTGGTGTATT	0.527																																																0			11											246.0	183.0	204.0					11																	132527095		2201	4297	6498	132032305	SO:0001583	missense	4978			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.287C>A	11.37:g.132527095G>T	ENSP00000330862:p.Thr96Asn	Somatic		Capture	Illumina GAIIx	4	132032305	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408,HMMPfam_I-set,HMMPfam_ig	p.T96N	ENST00000331898.7	37	c.287	CCDS8492.1	11	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505240	0.26949	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000541867	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	5.83	5.83	0.93111	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.081085	0.46442	D	0.000299	T	0.13970	0.0338	N	0.05280	-0.08	0.40526	D	0.98088	B;B;B;B	0.17465	0.002;0.022;0.002;0.002	B;B;B;B	0.18263	0.021;0.021;0.021;0.021	T	0.18618	-1.0331	10	0.17832	T	0.49	-26.7912	15.5722	0.76349	0.0:0.1372:0.8628:0.0	.	96;89;96;96	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	N	96;89;55;96	ENSP00000330862:T96N;ENSP00000434750:T89N;ENSP00000363910:T55N;ENSP00000445496:T96N	ENSP00000330862:T96N	T	-	2	0	OPCML	132032305	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.634000	0.54302	2.762000	0.94881	0.655000	0.94253	ACC	-	HMMPfam_V-set,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMSmart_SM00408		0.527	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	protein_coding	OTTHUMT00000374689.3	G	NM_001012393		132032305	-1	no_errors	NM_002545	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CFAP46	54777	genome.wustl.edu	37	10	134660765	134660765	+	Missense_Mutation	SNP	T	T	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr10:134660765T>G	ENST00000368586.5	-	42	6113	c.6013A>C	c.(6013-6015)Aca>Cca	p.T2005P	TTC40_ENST00000263170.5_Missense_Mutation_p.T166P	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CTGGACTTTGTGGCACCCTCT	0.657																																																0			10											73.0	81.0	78.0					10																	134660765		2203	4300	6503	134510755	SO:0001583	missense	54777																														ENST00000368586.5:c.6013A>C	10.37:g.134660765T>G	ENSP00000357575:p.Thr2005Pro	Somatic		Capture	Illumina GAIIx	4	134510755		Missense_Mutation	SNP	NULL	p.T166P	ENST00000368586.5	37	c.496	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	T	7.887	0.731519	0.15507	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.12672	2.88;2.66	3.57	-5.15	0.02866	.	1.575630	0.04446	U	0.371738	T	0.07369	0.0186	N	0.08118	0	0.09310	N	1	B	0.25521	0.128	B	0.23150	0.044	T	0.33007	-0.9885	10	0.31617	T	0.26	.	12.2398	0.54536	0.0:0.8353:0.0:0.1647	.	166	Q8IYW2	CJ092_HUMAN	P	2005;166	ENSP00000357575:T2005P;ENSP00000263170:T166P	ENSP00000263170:T166P	T	-	1	0	C10orf93	134510755	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.513000	0.02256	-1.271000	0.02430	-0.415000	0.06103	ACA	-	NULL		0.657	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	C10orf92	protein_coding	OTTHUMT00000051095.3	T			134510755	-1	no_errors	ENST00000263170	ensembl	human	known	54_36p	missense	SNP	0.000	G
SURF4	6836	genome.wustl.edu	37	9	136231900	136231900	+	Missense_Mutation	SNP	T	T	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr9:136231900T>A	ENST00000371989.3	-	5	488	c.359A>T	c.(358-360)aAc>aTc	p.N120I	SURF4_ENST00000545297.1_Intron|SURF4_ENST00000485435.2_Missense_Mutation_p.N120I|SURF4_ENST00000371991.3_Missense_Mutation_p.N120I|SURF4_ENST00000467910.1_5'UTR	NM_001280788.1|NM_001280790.1|NM_001280791.1|NM_033161.2	NP_001267717.1|NP_001267719.1|NP_001267720.1|NP_149351.1	O15260	SURF4_HUMAN	surfeit 4	120					Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(5)	8				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		CAGGGCCAGGTTCCTGAGGAA	0.592																																																0			9											24.0	20.0	22.0					9																	136231900		2200	4295	6495	135221721	SO:0001583	missense	6836				CCDS6968.1, CCDS65177.1, CCDS65178.1, CCDS75929.1	9q33-q34	2008-07-21			ENSG00000148248	ENSG00000148248			11476	protein-coding gene	gene with protein product	"""surfeit locus protein 4"", ""surface 4 integral membrane protein"""	185660				8499913, 7540914	Standard	NM_033161		Approved	ERV29, FLJ22993, MGC102753	uc004cdj.3	O15260	OTTHUMG00000020868	ENST00000371989.3:c.359A>T	9.37:g.136231900T>A	ENSP00000361057:p.Asn120Ile	Somatic		Capture	Illumina GAIIx	4	135221721	B7Z6A4|O60923|Q5T8U6|Q9UNZ0|Q9UNZ1	Missense_Mutation	SNP	HMMPfam_SURF4,PatternScan_SURF4	p.N120I	ENST00000371989.3	37	c.359	CCDS6968.1	9	.	.	.	.	.	.	.	.	.	.	T	25.6	4.655718	0.88056	.	.	ENSG00000148248	ENST00000371989;ENST00000485435;ENST00000541390;ENST00000371991	.	.	.	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.84566	0.5500	M	0.92923	3.36	0.80722	D	1	D;D	0.63046	0.992;0.992	D;D	0.68943	0.961;0.961	D	0.88400	0.3014	9	0.87932	D	0	-3.3779	13.5234	0.61580	0.0:0.0:0.0:1.0	.	111;120	B7Z7A8;O15260	.;SURF4_HUMAN	I	120;120;111;120	.	ENSP00000361057:N120I	N	-	2	0	SURF4	135221721	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.857000	0.86963	1.796000	0.52611	0.402000	0.26972	AAC	-	HMMPfam_SURF4		0.592	SURF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF4	protein_coding	OTTHUMT00000054886.1	T	NM_033161		135221721	-1	no_errors	NM_033161	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
DARS	1615	genome.wustl.edu	37	2	136670090	136670090	+	Missense_Mutation	SNP	C	C	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr2:136670090C>A	ENST00000264161.4	-	13	1411	c.1196G>T	c.(1195-1197)aGa>aTa	p.R399I	DARS_ENST00000537273.1_Missense_Mutation_p.R299I	NM_001349.2	NP_001340.2	P14868	SYDC_HUMAN	aspartyl-tRNA synthetase	399					aspartyl-tRNA aminoacylation (GO:0006422)|gene expression (GO:0010467)|protein complex assembly (GO:0006461)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacylase activity (GO:0004046)|aspartate-tRNA ligase activity (GO:0004815)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(2)	15				BRCA - Breast invasive adenocarcinoma(221;0.168)	L-Aspartic Acid(DB00128)	ATAGAAAGGTCTTACAGCCAA	0.294																																																0			2											65.0	75.0	72.0					2																	136670090		2203	4298	6501	136386560	SO:0001583	missense	1615			J05032	CCDS2180.1	2q21.3	2011-07-01			ENSG00000115866	ENSG00000115866	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	2678	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 1, cytoplasmic"""	603084				2674137	Standard	NM_001349		Approved		uc002tux.1	P14868	OTTHUMG00000131741	ENST00000264161.4:c.1196G>T	2.37:g.136670090C>A	ENSP00000264161:p.Arg399Ile	Somatic		Capture	Illumina GAIIx	4	136386560	A8K3J2|D3DP77|Q2TNI3|Q32Q69|Q53HV4|Q53YC5|Q68CR9|Q9BW52	Missense_Mutation	SNP	superfamily_Nucleic acid-binding proteins,HMMPfam_tRNA_anti,HMMPfam_tRNA-synt_2,superfamily_Class II aaRS and biotin synthetases	p.R399I	ENST00000264161.4	37	c.1196	CCDS2180.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.362683	0.95877	.	.	ENSG00000115866	ENST00000264161;ENST00000537273	T;T	0.80033	-1.33;-1.33	5.98	5.98	0.97165	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.000000	0.85682	D	0.000000	D	0.94833	0.8331	H	0.99545	4.62	0.80722	D	1	D	0.63046	0.992	D	0.67900	0.954	D	0.96486	0.9360	10	0.87932	D	0	-18.7454	20.4366	0.99092	0.0:1.0:0.0:0.0	.	399	P14868	SYDC_HUMAN	I	399;299	ENSP00000264161:R399I;ENSP00000444192:R299I	ENSP00000264161:R399I	R	-	2	0	DARS	136386560	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.578000	0.82498	2.843000	0.97960	0.585000	0.79938	AGA	-	HMMPfam_tRNA-synt_2,superfamily_Class II aaRS and biotin synthetases		0.294	DARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARS	protein_coding	OTTHUMT00000254660.5	C	NM_001349		136386560	-1	no_errors	NM_001349	genbank	human	validated	54_36p	missense	SNP	1.000	A
AGK	55750	genome.wustl.edu	37	7	141321569	141321569	+	Missense_Mutation	SNP	G	G	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr7:141321569G>C	ENST00000355413.4	+	9	816	c.556G>C	c.(556-558)Gag>Cag	p.E186Q	AGK_ENST00000535825.1_Missense_Mutation_p.E183Q|AGK_ENST00000473247.1_Missense_Mutation_p.E158Q	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	186	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					TGTGAAAGGAGAGACAGTTCC	0.353																																																0			7											154.0	140.0	145.0					7																	141321569		2203	4300	6503	140968038	SO:0001583	missense	55750			BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.556G>C	7.37:g.141321569G>C	ENSP00000347581:p.Glu186Gln	Somatic		Capture	Illumina GAIIx	4	140968038	Q75KN1|Q96GC3|Q9NP48	Missense_Mutation	SNP	HMMPfam_DAGK_cat,HMMSmart_SM00046	p.E186Q	ENST00000355413.4	37	c.556	CCDS5865.1	7	.	.	.	.	.	.	.	.	.	.	G	17.23	3.336714	0.60963	.	.	ENSG00000006530	ENST00000355413;ENST00000473247;ENST00000535825	T;T;T	0.43294	2.53;2.53;0.95	4.61	3.7	0.42460	Diacylglycerol kinase, catalytic domain (2);	0.050960	0.85682	D	0.000000	T	0.27278	0.0669	N	0.13003	0.285	0.54753	D	0.999988	B	0.26318	0.146	B	0.33254	0.16	T	0.04737	-1.0930	10	0.13853	T	0.58	.	13.0876	0.59151	0.0:0.0:0.8379:0.1621	.	186	Q53H12	AGK_HUMAN	Q	186;158;183	ENSP00000347581:E186Q;ENSP00000420776:E158Q;ENSP00000444349:E183Q	ENSP00000347581:E186Q	E	+	1	0	AGK	140968038	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.897000	0.69831	1.243000	0.43853	0.561000	0.74099	GAG	-	HMMPfam_DAGK_cat,HMMSmart_SM00046		0.353	AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGK	protein_coding	OTTHUMT00000348969.1	G	NM_018238		140968038	+1	no_errors	NM_018238	genbank	human	validated	54_36p	missense	SNP	1.000	C
CYP11B1	1584	genome.wustl.edu	37	8	143956688	143956688	+	Missense_Mutation	SNP	A	A	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr8:143956688A>T	ENST00000292427.4	-	7	1194	c.1162T>A	c.(1162-1164)Tca>Aca	p.S388T	CYP11B1_ENST00000377675.3_Missense_Mutation_p.S459T|CYP11B1_ENST00000517471.1_Missense_Mutation_p.S388T	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	388					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	ACCAAGTCTGAGCTCGCCACT	0.607									Familial Hyperaldosteronism type I																																							0			8											72.0	68.0	69.0					8																	143956688		2203	4300	6503	143953690	SO:0001583	missense	1584	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.1162T>A	8.37:g.143956688A>T	ENSP00000292427:p.Ser388Thr	Somatic		Capture	Illumina GAIIx	4	143953690	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	HMMPfam_p450,superfamily_Cytochrome_P450,PatternScan_CYTOCHROME_P450	p.S388T	ENST00000292427.4	37	c.1162	CCDS6392.1	8	.	.	.	.	.	.	.	.	.	.	.	16.44	3.124396	0.56613	.	.	ENSG00000160882	ENST00000519285;ENST00000292427;ENST00000517471;ENST00000377675	T;T;T;T	0.68479	1.56;-0.33;2.69;-0.33	3.12	3.12	0.35913	.	0.513669	0.15877	N	0.240255	T	0.69369	0.3103	L	0.41961	1.31	0.20926	N	0.999825	P;P;D;D;D	0.67145	0.899;0.875;0.976;0.996;0.982	P;P;D;D;P	0.65443	0.828;0.752;0.935;0.931;0.869	T	0.56056	-0.8042	10	0.45353	T	0.12	.	5.7155	0.17958	0.7599:0.0:0.0:0.2401	.	459;388;388;388;104	Q4VAR0;Q8TDD0;Q4VAQ9;P15538;Q8N9P8	.;.;.;C11B1_HUMAN;.	T	66;388;388;459	ENSP00000430144:S66T;ENSP00000292427:S388T;ENSP00000428043:S388T;ENSP00000366903:S459T	ENSP00000292427:S388T	S	-	1	0	CYP11B1	143953690	0.048000	0.20356	0.176000	0.23000	0.411000	0.31082	0.999000	0.29757	1.669000	0.50854	0.454000	0.30748	TCA	-	HMMPfam_p450,superfamily_Cytochrome_P450		0.607	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	protein_coding	OTTHUMT00000379475.2	A			143953690	-1	no_errors	NM_000497	genbank	human	reviewed	54_36p	missense	SNP	0.087	T
SASH1	23328	genome.wustl.edu	37	6	148865242	148865242	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr6:148865242C>T	ENST00000367467.3	+	18	3111	c.2636C>T	c.(2635-2637)gCc>gTc	p.A879V		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	879					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TCCACGAAGGCCCAGCCCCTG	0.537																																																0			6											128.0	141.0	137.0					6																	148865242		2203	4300	6503	148906935	SO:0001583	missense	23328			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.2636C>T	6.37:g.148865242C>T	ENSP00000356437:p.Ala879Val	Somatic		Capture	Illumina GAIIx	4	148906935	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	superfamily_SH3-domain,HMMSmart_SM00326,HMMPfam_SH3_2,superfamily_SAM/Pointed domain,HMMSmart_SM00454,HMMPfam_SAM_2	p.A879V	ENST00000367467.3	37	c.2636	CCDS5212.1	6	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.830889	0.00584	.	.	ENSG00000111961	ENST00000367467;ENST00000535767;ENST00000537769	T	0.36157	1.27	5.06	-6.56	0.01848	.	2.051170	0.01842	N	0.035402	T	0.10252	0.0251	N	0.16478	0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09975	-1.0650	10	0.28530	T	0.3	0.1108	19.0698	0.93127	0.0:0.8553:0.0:0.1447	.	860;879	Q6P4R9;O94885	.;SASH1_HUMAN	V	879;640;289	ENSP00000356437:A879V	ENSP00000356437:A879V	A	+	2	0	SASH1	148906935	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.350000	0.07721	-1.212000	0.02620	-0.781000	0.03364	GCC	-	NULL		0.537	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH1	protein_coding	OTTHUMT00000042619.1	C	NM_015278		148906935	+1	no_errors	NM_015278	genbank	human	validated	54_36p	missense	SNP	0.000	T
IQGAP3	128239	genome.wustl.edu	37	1	156513971	156513971	+	Silent	SNP	C	C	T	rs200820791		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:156513971C>T	ENST00000361170.2	-	21	2443	c.2433G>A	c.(2431-2433)ctG>ctA	p.L811L		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	811	IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCAGACGCCTCAGGTATTGCC	0.587																																																0			1											126.0	111.0	116.0					1																	156513971		2203	4300	6503	154780595	SO:0001819	synonymous_variant	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.2433G>A	1.37:g.156513971C>T		Somatic		Capture	Illumina GAIIx	4	154780595	Q5T3H8	Silent	SNP	superfamily_Calponin-homology,HMMPfam_CH,HMMSmart_CH,HMMSmart_IQ,superfamily_SSF52540,HMMPfam_IQ,superfamily_Rho_GAP,HMMSmart_RasGAP,HMMPfam_RasGAP,PatternScan_RAS_GTPASE_ACTIV_1,HMMPfam_RasGAP_C	p.L811	ENST00000361170.2	37	c.2433	CCDS1144.1	1																																																																																			-	superfamily_SSF52540,HMMSmart_IQ,HMMPfam_IQ		0.587	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	protein_coding	OTTHUMT00000080657.1	C	NM_178229		154780595	-1	no_errors	NM_178229	genbank	human	validated	54_36p	silent	SNP	0.874	T
HAPLN2	60484	genome.wustl.edu	37	1	156593711	156593711	+	Nonsense_Mutation	SNP	C	C	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:156593711C>A	ENST00000255039.1	+	4	605	c.198C>A	c.(196-198)taC>taA	p.Y66*		NM_021817.2	NP_068589.1	Q9GZV7	HPLN2_HUMAN	hyaluronan and proteoglycan link protein 2	66	Ig-like V-type.				cell adhesion (GO:0007155)|establishment of blood-nerve barrier (GO:0008065)|extracellular matrix assembly (GO:0085029)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	7	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTCCCAGCTACAAGGTGCGCT	0.687																																																0			1											14.0	14.0	14.0					1																	156593711		2200	4291	6491	154860335	SO:0001587	stop_gained	60484			AB049054	CCDS1148.1	1q23.1	2013-01-11			ENSG00000132702	ENSG00000132702		"""Immunoglobulin superfamily / V-set domain containing"""	17410	protein-coding gene	gene with protein product	"""brain link protein 1"""					11027579, 11873941	Standard	NM_021817		Approved	BRAL1	uc001fpn.1	Q9GZV7	OTTHUMG00000033205	ENST00000255039.1:c.198C>A	1.37:g.156593711C>A	ENSP00000255039:p.Tyr66*	Somatic		Capture	Illumina GAIIx	4	154860335	Q5T3J0	Nonsense_Mutation	SNP	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMSmart_SM00406,HMMSmart_SM00445,HMMPfam_Xlink,superfamily_C-type lectin-like,PatternScan_LINK_1	p.Y66*	ENST00000255039.1	37	c.198	CCDS1148.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.371469	0.97511	.	.	ENSG00000132702	ENST00000255039;ENST00000544775;ENST00000456112	.	.	.	4.11	3.19	0.36642	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.6006	14.0074	0.64473	0.0:0.9149:0.0:0.0851	.	.	.	.	X	66;39;66	.	ENSP00000255039:Y66X	Y	+	3	2	HAPLN2	154860335	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.416000	0.52707	0.508000	0.28173	-1.134000	0.01955	TAC	-	HMMPfam_V-set,HMMSmart_SM00409,superfamily_Immunoglobulin,HMMSmart_SM00406		0.687	HAPLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN2	protein_coding	OTTHUMT00000081039.1	C	NM_021817		154860335	+1	no_errors	NM_021817	genbank	human	validated	54_36p	nonsense	SNP	1.000	A
PLCH1	23007	genome.wustl.edu	37	3	155215196	155215196	+	Nonsense_Mutation	SNP	G	G	A			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr3:155215196G>A	ENST00000340059.7	-	14	1770	c.1771C>T	c.(1771-1773)Cga>Tga	p.R591*	PLCH1_ENST00000494598.1_Nonsense_Mutation_p.R591*|PLCH1_ENST00000460012.1_Nonsense_Mutation_p.R573*|PLCH1_ENST00000414191.1_Nonsense_Mutation_p.R573*|PLCH1_ENST00000447496.2_Nonsense_Mutation_p.R591*|PLCH1_ENST00000334686.6_Nonsense_Mutation_p.R573*	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	591					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GTTTTCCTTCGGCGACCCAAT	0.468																																																0			3											108.0	99.0	102.0					3																	155215196		2203	4300	6503	156697890	SO:0001587	stop_gained	23007			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.1771C>T	3.37:g.155215196G>A	ENSP00000345988:p.Arg591*	Somatic		Capture	Illumina GAIIx	4	156697890	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Nonsense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1,superfamily_SSF47473,HMMPfam_efhand_like,HMMSmart_PLCXc,HMMPfam_PI-PLC-X,superfamily_PLC-like_Pdiesterase_TIM-brl,HMMPfam_PI-PLC-Y,HMMSmart_PLCYc,superfamily_C2_CaLB,HMMSmart_C2,HMMPfam_C2	p.R573*	ENST00000340059.7	37	c.1717	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	G	39	7.653879	0.98412	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	.	.	.	5.76	3.72	0.42706	.	0.193168	0.45606	D	0.000353	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.0241	0.80528	0.0:0.0:0.728:0.272	.	.	.	.	X	591;573;591;591;573;573	.	ENSP00000335469:R573X	R	-	1	2	PLCH1	156697890	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.232000	0.43018	1.360000	0.45960	0.655000	0.94253	CGA	-	superfamily_PLC-like_Pdiesterase_TIM-brl		0.468	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	protein_coding	OTTHUMT00000351125.1	G	NM_014996		156697890	-1	no_errors	NM_014996	genbank	human	validated	54_36p	nonsense	SNP	0.996	A
KCNH7	90134	genome.wustl.edu	37	2	163256871	163256871	+	Silent	SNP	G	G	C	rs143736950		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr2:163256871G>C	ENST00000332142.5	-	10	2334	c.2235C>G	c.(2233-2235)gcC>gcG	p.A745A		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	745					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CCCCCCGAAAGGCTTTGCAGT	0.478																																					GBM(196;1492 2208 17507 24132 45496)											0			2											129.0	132.0	131.0					2																	163256871		2203	4300	6503	162965117	SO:0001819	synonymous_variant	90134			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2235C>G	2.37:g.163256871G>C		Somatic		Capture	Illumina GAIIx	4	162965117	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Silent	SNP	superfamily_PYP-like sensor domain (PAS domain),superfamily_Voltage-gated potassium channels,HMMPfam_Ion_trans,superfamily_cAMP-binding domain-like,HMMSmart_SM00100,HMMPfam_cNMP_binding	p.A745	ENST00000332142.5	37	c.2235	CCDS2219.1	2																																																																																			-	superfamily_cAMP-binding domain-like,HMMSmart_SM00100		0.478	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	protein_coding	OTTHUMT00000255093.1	G	NM_033272		162965117	-1	no_errors	NM_033272	genbank	human	reviewed	54_36p	silent	SNP	0.995	C
DUSP27	92235	genome.wustl.edu	37	1	167095052	167095052	+	Silent	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:167095052C>T	ENST00000361200.2	+	6	850	c.684C>T	c.(682-684)ggC>ggT	p.G228G	DUSP27_ENST00000271385.5_Silent_p.G228G|DUSP27_ENST00000443333.1_Silent_p.G228G			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	228	Tyrosine-protein phosphatase.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GCGAAATGGGCATCAGCCGGT	0.488																																																0			1											83.0	71.0	75.0					1																	167095052		2203	4300	6503	165361676	SO:0001819	synonymous_variant	92235			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.684C>T	1.37:g.167095052C>T		Somatic		Capture	Illumina GAIIx	4	165361676	A0AUM4|Q9C074	Silent	SNP	PatternScan_TYR_PHOSPHATASE_1,superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc	p.G228	ENST00000361200.2	37	c.684	CCDS30932.1	1																																																																																			-	superfamily_SSF52799,HMMPfam_DSPc,HMMSmart_DSPc		0.488	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	protein_coding	OTTHUMT00000083244.1	C	NM_001080426		165361676	+1	no_errors	NM_001080426	genbank	human	provisional	54_36p	silent	SNP	0.856	T
WWC1	23286	genome.wustl.edu	37	5	167826539	167826539	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr5:167826539A>C	ENST00000265293.4	+	5	1059	c.557A>C	c.(556-558)cAg>cCg	p.Q186P	WWC1_ENST00000521089.1_Missense_Mutation_p.Q186P	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	186					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		CACGAGCTGCAGTTCAAAGAG	0.587																																																0			5											102.0	90.0	94.0					5																	167826539		2203	4300	6503	167759117	SO:0001583	missense	23286			AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.557A>C	5.37:g.167826539A>C	ENSP00000265293:p.Gln186Pro	Somatic		Capture	Illumina GAIIx	4	167759117	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	superfamily_WW domain,HMMSmart_SM00456,HMMPfam_WW,PatternScan_WW_DOMAIN_1,superfamily_C2 domain (Calcium/lipid-binding domain CaLB)	p.Q186P	ENST00000265293.4	37	c.557	CCDS4366.1	5	.	.	.	.	.	.	.	.	.	.	A	21.0	4.080831	0.76528	.	.	ENSG00000113645	ENST00000265293;ENST00000521089	T;T	0.05786	3.39;3.39	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000001	T	0.16727	0.0402	L	0.60455	1.87	0.58432	D	0.999995	D;D;D	0.65815	0.979;0.995;0.993	P;P;P	0.58266	0.78;0.836;0.756	T	0.00520	-1.1692	10	0.42905	T	0.14	.	12.8954	0.58095	1.0:0.0:0.0:0.0	.	186;92;186	Q8IX03-2;B3KX05;Q8IX03	.;.;KIBRA_HUMAN	P	186	ENSP00000265293:Q186P;ENSP00000427772:Q186P	ENSP00000265293:Q186P	Q	+	2	0	WWC1	167759117	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	3.783000	0.55409	2.027000	0.59764	0.460000	0.39030	CAG	-	NULL		0.587	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	protein_coding	OTTHUMT00000252791.2	A	NM_015238		167759117	+1	no_errors	NM_015238	genbank	human	provisional	54_36p	missense	SNP	1.000	C
XIRP2	129446	genome.wustl.edu	37	2	168100110	168100110	+	Silent	SNP	C	C	T	rs76149079	byFrequency	TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr2:168100110C>T	ENST00000409195.1	+	9	2297	c.2208C>T	c.(2206-2208)ttC>ttT	p.F736F	XIRP2_ENST00000295237.9_Silent_p.F736F|XIRP2_ENST00000409273.1_Silent_p.F514F|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	561					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TAAAATGTTTCGAAACTCAAC	0.368													C|||	18	0.00359425	0.0136	0.0	5008	,	,		19910	0.0		0.0	False		,,,				2504	0.0															0			2						C	,,,,	34,3672		0,34,1819	58.0	55.0	56.0		,,1542,,2208	2.2	1.0	2	dbSNP_132	56	0,8182		0,0,4091	no	intron,intron,coding-synonymous,intron,coding-synonymous	XIRP2	NM_001079810.3,NM_001199143.1,NM_001199144.1,NM_001199145.1,NM_152381.5	,,,,	0,34,5910	TT,TC,CC		0.0,0.9174,0.286	,,,,	,,514/3328,,736/3550	168100110	34,11854	1853	4091	5944	167808356	SO:0001819	synonymous_variant	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2208C>T	2.37:g.168100110C>T		Somatic		Capture	Illumina GAIIx	4	167808356	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	HMMPfam_Xin	p.F736	ENST00000409195.1	37	c.2208	CCDS42769.1	2																																																																																			-	HMMPfam_Xin		0.368	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	protein_coding	OTTHUMT00000333547.1	C	NM_152381		167808356	+1	no_errors	NM_152381	genbank	human	validated	54_36p	silent	SNP	1.000	T
ITGA6	3655	genome.wustl.edu	37	2	173368904	173368904	+	Missense_Mutation	SNP	A	A	G			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr2:173368904A>G	ENST00000264106.6	+	26	3520	c.3317A>G	c.(3316-3318)aAa>aGa	p.K1106R	AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000409080.1_Missense_Mutation_p.K1067R|ITGA6_ENST00000409532.1_3'UTR|ITGA6_ENST00000343713.4_3'UTR|ITGA6_ENST00000375221.2_3'UTR|ITGA6_ENST00000264107.7_3'UTR|AC093818.1_ENST00000450443.1_RNA			P23229	ITA6_HUMAN	integrin, alpha 6	1106					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			CGAGAGATCAAAGATGAAAAG	0.403																																																0			2											52.0	48.0	49.0					2																	173368904		1850	4094	5944	173077150	SO:0001583	missense	3655				CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.3317A>G	2.37:g.173368904A>G	ENSP00000264106:p.Lys1106Arg	Somatic		Capture	Illumina GAIIx	4	173077150	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	superfamily_Integrin alpha N-terminal domain,HMMSmart_SM00191,HMMPfam_FG-GAP,HMMPfam_Integrin_alpha2,superfamily_Integrin domains,PatternScan_INTEGRIN_ALPHA	p.K1067R	ENST00000264106.6	37	c.3200		2	.	.	.	.	.	.	.	.	.	.	A	9.082	0.999631	0.19121	.	.	ENSG00000091409	ENST00000264106;ENST00000409080;ENST00000442250;ENST00000458358;ENST00000416789	T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95	5.87	2.07	0.26955	.	0.597033	0.20229	N	0.096526	T	0.10078	0.0247	N	0.17474	0.49	0.80722	D	1	B	0.06786	0.001	B	0.09377	0.004	T	0.21484	-1.0244	10	0.07990	T	0.79	.	8.317	0.32106	0.6852:0.2502:0.0645:0.0	.	1067	G5E9H1	.	R	1106;1067;1106;1062;234	ENSP00000264106:K1106R;ENSP00000386896:K1067R;ENSP00000406694:K1106R;ENSP00000394169:K1062R;ENSP00000388435:K234R	ENSP00000264106:K1106R	K	+	2	0	ITGA6	173077150	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	2.767000	0.47637	0.114000	0.18032	0.533000	0.62120	AAA	-	NULL		0.403	ITGA6-201	KNOWN	basic	protein_coding	ITGA6	protein_coding		A			173077150	+1	no_errors	NM_001079818	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
PDE11A	50940	genome.wustl.edu	37	2	178936570	178936570	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr2:178936570G>T	ENST00000286063.6	-	1	912	c.595C>A	c.(595-597)Cat>Aat	p.H199N	PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	199					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CGCTCATTATGCTTTTTCAGA	0.483									Primary Pigmented Nodular Adrenocortical Disease, Familial																																							0			2											115.0	103.0	107.0					2																	178936570		2203	4300	6503	178644816	SO:0001583	missense	50940	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.595C>A	2.37:g.178936570G>T	ENSP00000286063:p.His199Asn	Somatic		Capture	Illumina GAIIx	4	178644816	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	superfamily_GAF domain-like,HMMPfam_GAF,HMMSmart_SM00065,superfamily_HD-domain/PDEase-like,HMMSmart_SM00471,HMMPfam_PDEase_I,PatternScan_PDEASE_I	p.H199N	ENST00000286063.6	37	c.595	CCDS33334.1	2	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118425	0.37339	.	.	ENSG00000128655	ENST00000286063	T	0.68479	-0.33	5.28	4.37	0.52481	.	0.196939	0.52532	D	0.000074	T	0.56834	0.2012	L	0.50333	1.59	0.80722	D	1	B	0.31026	0.304	B	0.21151	0.033	T	0.55642	-0.8109	10	0.24483	T	0.36	.	14.3806	0.66908	0.0:0.0:0.852:0.148	.	199	Q9HCR9	PDE11_HUMAN	N	199	ENSP00000286063:H199N	ENSP00000286063:H199N	H	-	1	0	PDE11A	178644816	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.057000	0.64294	2.473000	0.83533	0.655000	0.94253	CAT	-	superfamily_GAF domain-like		0.483	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE11A	protein_coding	OTTHUMT00000334313.2	G			178644816	-1	no_errors	NM_016953	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179579731	179579731	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr2:179579731C>T	ENST00000591111.1	-	88	25455	c.25231G>A	c.(25231-25233)Ggt>Agt	p.G8411S	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.G8728S|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.G7484S|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12583	Ig-like 66.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCGATGGAACCAACGCAAGTG	0.483																																																0			2											207.0	202.0	204.0					2																	179579731		2045	4199	6244	179287976	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25231G>A	2.37:g.179579731C>T	ENSP00000465570:p.Gly8411Ser	Somatic		Capture	Illumina GAIIx	4	179287976	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,HMMPfam_Titin_Z,HMMSmart_SM00406,PatternScan_IG_MHC,HMMPfam_PPAK,HMMPfam_ig,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,PatternScan_FGGY_KINASES_1,PatternScan_PEROXIDASE_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_TYR	p.G7484S	ENST00000591111.1	37	c.22450		2	.	.	.	.	.	.	.	.	.	.	C	6.218	0.408304	0.11754	.	.	ENSG00000155657	ENST00000342992	T	0.40476	1.03	5.91	5.03	0.67393	Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.38348	0.1037	L	0.39633	1.23	0.25521	N	0.987369	B	0.12630	0.006	B	0.17722	0.019	T	0.36480	-0.9746	9	0.87932	D	0	.	13.7901	0.63135	0.3945:0.6055:0.0:0.0	.	8411	Q8WZ42	TITIN_HUMAN	S	7484	ENSP00000343764:G7484S	ENSP00000343764:G7484S	G	-	1	0	TTN	179287976	0.000000	0.05858	0.022000	0.16811	0.025000	0.11179	0.099000	0.15210	1.499000	0.48617	0.655000	0.94253	GGT	-	superfamily_Concanavalin A-like lectins/glucanases,superfamily_vWA-like,superfamily_WD40 repeat-like,superfamily_Positive stranded ssRNA viruses,superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00406		0.483	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179287976	-1	no_errors	ENST00000375038	ensembl	human	known	54_36p	missense	SNP	0.001	T
GNB4	59345	genome.wustl.edu	37	3	179134325	179134325	+	Missense_Mutation	SNP	G	G	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	G	G					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr3:179134325G>T	ENST00000232564.3	-	5	509	c.223C>A	c.(223-225)Caa>Aaa	p.Q75K	GNB4_ENST00000465153.1_5'Flank|GNB4_ENST00000468623.1_Missense_Mutation_p.Q75K	NM_021629.3	NP_067642.1	Q9HAV0	GBB4_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 4	75					cell death (GO:0008219)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	16	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			TTTCCATCTTGAGAAGCACTG	0.303																																					Melanoma(105;1405 1491 7265 20440 33721)											0			3											47.0	51.0	50.0					3																	179134325		2203	4281	6484	180617019	SO:0001583	missense	59345			AF300648	CCDS3230.1	3q27.1	2013-01-10			ENSG00000114450	ENSG00000114450		"""WD repeat domain containing"""	20731	protein-coding gene	gene with protein product		610863				10644457, 11842130	Standard	NM_021629		Approved		uc003fjv.4	Q9HAV0	OTTHUMG00000157440	ENST00000232564.3:c.223C>A	3.37:g.179134325G>T	ENSP00000232564:p.Gln75Lys	Somatic		Capture	Illumina GAIIx	4	180617019	B3KMH5|D3DNR8	Missense_Mutation	SNP	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1	p.Q75K	ENST00000232564.3	37	c.223	CCDS3230.1	3	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460997	0.84317	.	.	ENSG00000114450	ENST00000232564;ENST00000468623;ENST00000497513	T;T;T	0.59083	0.29;0.29;0.29	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);G-protein, beta subunit (1);	0.105582	0.64402	D	0.000002	T	0.51839	0.1698	L	0.28344	0.845	0.80722	D	1	P	0.48016	0.904	B	0.43728	0.429	T	0.57159	-0.7859	10	0.59425	D	0.04	-16.7921	19.2636	0.93977	0.0:0.0:1.0:0.0	.	75	Q9HAV0	GBB4_HUMAN	K	75	ENSP00000232564:Q75K;ENSP00000419693:Q75K;ENSP00000420606:Q75K	ENSP00000232564:Q75K	Q	-	1	0	GNB4	180617019	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.674000	0.98633	2.550000	0.86006	0.655000	0.94253	CAA	-	superfamily_WD40 repeat-like,HMMSmart_SM00320,HMMPfam_WD40,PatternScan_WD_REPEATS_1		0.303	GNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB4	protein_coding	OTTHUMT00000258218.1	G	NM_021629		180617019	-1	no_errors	NM_021629	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
CERKL	375298	genome.wustl.edu	37	2	182413527	182413527	+	Missense_Mutation	SNP	A	A	C			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	A	A					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr2:182413527A>C	ENST00000339098.5	-	8	1030	c.1031T>G	c.(1030-1032)tTt>tGt	p.F344C	CERKL_ENST00000374969.2_Missense_Mutation_p.F205C|CERKL_ENST00000409440.3_Missense_Mutation_p.F300C|CERKL_ENST00000374970.2_Missense_Mutation_p.F249C|CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000410087.3_Missense_Mutation_p.F318C			Q49MI3	CERKL_HUMAN	ceramide kinase-like	344					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGAGAACCCAAAGCGAAGAAG	0.458																																																0			2											74.0	77.0	76.0					2																	182413527		2203	4300	6503	182121772	SO:0001583	missense	375298			BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.1031T>G	2.37:g.182413527A>C	ENSP00000341159:p.Phe344Cys	Somatic		Capture	Illumina GAIIx	4	182121772	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	HMMPfam_DAGK_cat	p.F318C	ENST00000339098.5	37	c.953	CCDS42789.1	2	.	.	.	.	.	.	.	.	.	.	A	17.22	3.334444	0.60853	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05	5.62	4.4	0.53042	.	0.054966	0.64402	D	0.000001	T	0.40015	0.1100	L	0.59967	1.855	0.53005	D	0.999967	P;P;D;P;P	0.89917	0.593;0.588;1.0;0.716;0.779	B;B;D;B;B	0.85130	0.267;0.302;0.997;0.275;0.267	T	0.08953	-1.0697	10	0.37606	T	0.19	.	12.3989	0.55402	0.8597:0.1403:0.0:0.0	.	300;205;249;318;344	B4DEY1;Q49MI3-4;Q49MI3-3;Q49MI3-2;Q49MI3	.;.;.;.;CERKL_HUMAN	C	318;300;205;344;249	ENSP00000386725:F318C;ENSP00000387080:F300C;ENSP00000364108:F205C;ENSP00000341159:F344C;ENSP00000364109:F249C	ENSP00000341159:F344C	F	-	2	0	CERKL	182121772	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.175000	0.77632	2.136000	0.66102	0.533000	0.62120	TTT	-	NULL		0.458	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERKL	protein_coding	OTTHUMT00000334811.1	A			182121772	-1	no_errors	NM_201548	genbank	human	validated	54_36p	missense	SNP	1.000	C
TRIML1	339976	genome.wustl.edu	37	4	189068431	189068431	+	Nonsense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr4:189068431C>T	ENST00000332517.3	+	6	1452	c.1312C>T	c.(1312-1314)Caa>Taa	p.Q438*	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	438	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		GGCTTCTTTCCAAGAGGCCCT	0.532																																					Melanoma(31;213 1036 16579 23968 32372)											0			4											88.0	88.0	88.0					4																	189068431		2203	4300	6503	189305425	SO:0001587	stop_gained	339976			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.1312C>T	4.37:g.189068431C>T	ENSP00000327738:p.Gln438*	Somatic		Capture	Illumina GAIIx	4	189305425	Q96BE5	Nonsense_Mutation	SNP	superfamily_SSF57850,HMMSmart_RING,HMMPfam_zf-C3HC4,PatternScan_ZF_RING_1,HMMSmart_PRY,HMMPfam_SPRY,HMMSmart_SPRY	p.Q438*	ENST00000332517.3	37	c.1312	CCDS3851.1	4	.	.	.	.	.	.	.	.	.	.	c	15.33	2.800159	0.50208	.	.	ENSG00000184108	ENST00000332517	.	.	.	4.92	1.11	0.20524	.	0.553916	0.16693	N	0.203476	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-3.043	8.8048	0.34932	0.2761:0.3197:0.4042:0.0	.	.	.	.	X	438	.	ENSP00000327738:Q438X	Q	+	1	0	TRIML1	189305425	0.000000	0.05858	0.984000	0.44739	0.118000	0.20060	-0.091000	0.11146	0.066000	0.16515	0.552000	0.68991	CAA	-	HMMPfam_SPRY,HMMSmart_SPRY		0.532	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIML1	protein_coding	OTTHUMT00000359813.1	C	NM_178556		189305425	+1	no_errors	NM_178556	genbank	human	provisional	54_36p	nonsense	SNP	0.945	T
OR13G1	441933	genome.wustl.edu	37	1	247836022	247836022	+	Missense_Mutation	SNP	C	C	T			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	C	C					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr1:247836022C>T	ENST00000359688.2	-	1	343	c.322G>A	c.(322-324)Gag>Aag	p.E108K	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGAACCATCTCAGCTCCCAGA	0.463																																																0			1											89.0	73.0	79.0					1																	247836022		2203	4300	6503	245902645	SO:0001583	missense	441933			AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.322G>A	1.37:g.247836022C>T	ENSP00000352717:p.Glu108Lys	Somatic		Capture	Illumina GAIIx	4	245902645	B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	PatternScan_G_PROTEIN_RECEP_F1_1,superfamily_SSF81321,HMMPfam_7tm_1	p.E108K	ENST00000359688.2	37	c.322	CCDS31094.1	1	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795309	0.70452	.	.	ENSG00000197437	ENST00000359688	T	0.00414	7.52	4.2	3.29	0.37713	GPCR, rhodopsin-like superfamily (1);	0.155196	0.29972	N	0.010736	T	0.01489	0.0048	M	0.93375	3.41	0.28096	N	0.931611	D	0.76494	0.999	D	0.72338	0.977	T	0.05903	-1.0857	10	0.87932	D	0	-25.9036	10.017	0.42020	0.0:0.8991:0.0:0.1009	.	108	Q8NGZ3	O13G1_HUMAN	K	108	ENSP00000352717:E108K	ENSP00000352717:E108K	E	-	1	0	OR13G1	245902645	0.058000	0.20735	0.039000	0.18376	0.945000	0.59286	1.856000	0.39389	1.114000	0.41781	0.563000	0.77884	GAG	-	superfamily_SSF81321,HMMPfam_7tm_1		0.463	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	protein_coding	OTTHUMT00000096869.1	C	NM_001005487		245902645	-1	no_errors	NM_001005487	genbank	human	provisional	54_36p	missense	SNP	0.398	T
STRAP	11171	genome.wustl.edu	37	12	16042945	16042945	+	Splice_Site	DEL	T	T	-			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	T	T					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr12:16042945delT	ENST00000419869.2	+	3	643		c.e3+2		STRAP_ENST00000025399.6_Splice_Site|STRAP_ENST00000538352.1_Splice_Site	NM_007178.3	NP_009109.3	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated protein						maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|spliceosomal snRNP assembly (GO:0000387)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	15		Hepatocellular(102;0.121)				TTCACGCAGGTATCAGAAAAT	0.358																																																0			12											94.0	90.0	91.0					12																	16042945		2203	4300	6503	15934212	SO:0001630	splice_region_variant	11171			AB024327	CCDS8676.1	12p13.1	2013-01-10			ENSG00000023734	ENSG00000023734		"""WD repeat domain containing"""	30796	protein-coding gene	gene with protein product	"""Unr-interacting protein"""	605986					Standard	NM_007178		Approved	UNRIP, pt-wd, MAWD	uc001rdc.4	Q9Y3F4	OTTHUMG00000168791	ENST00000419869.2:c.330+2T>-	12.37:g.16042945delT		Somatic		Capture	Illumina GAIIx	4	15934212	B2R5S5|B4DNJ6|Q5TZT4|Q9NTK0|Q9UQC8	Splice_Site	DEL	-	e3+2	ENST00000419869.2	37	c.330+2	CCDS8676.1	12																																																																																			(deletion:intron[15934211,15934797])	-		0.358	STRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRAP	protein_coding	OTTHUMT00000401114.1	T	NM_007178	Intron	15934212	+1	no_errors	NM_007178	genbank	human	validated	54_36p	splice_site_del	DEL	1.000	-
DSC1	1823	genome.wustl.edu	37	18	28719710	28719716	+	Splice_Site	DEL	CCTGCAT	CCTGCAT	-			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	CCTGCAT	CCTGCAT					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr18:28719710_28719716delCCTGCAT	ENST00000257198.5	-	11	1919_1925	c.1658_1664delATGCAGG	c.(1657-1665)gatgcaggt>gt	p.DAG553fs	DSC1_ENST00000257197.3_Splice_Site_p.DAG553fs|RP11-408H20.2_ENST00000581836.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	553	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.?(2)|p.A554E(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			ATGGCACTCACCTGCATCCACTGCAAC	0.314																																																4	Substitution - Missense(2)|Unknown(2)	lung(4)	18																																								26973714	SO:0001630	splice_region_variant	1823			AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.1663+1ATGCAGG>-	18.37:g.28719710_28719716delCCTGCAT		Somatic		Capture	Illumina GAIIx	4	26973708	Q9HB01	Splice_Site	DEL	-	e12-1	ENST00000257198.5	37	c.1663+7_1663+1	CCDS11894.1	18																																																																																			(deletion:intron[26968746,26973708], cds_exon[26973709,26973851])	-		0.314	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC1	protein_coding	OTTHUMT00000254946.1	CCTGCAT	NM_004948, NM_024421	Frame_Shift_Del	26973714	-1	no_errors	NM_024421	genbank	human	reviewed	54_36p	splice_site_del	DEL	0.988:0.816:0.797:0.777:0.750:0.789:0.794	-
Unknown	0	genome.wustl.edu	37	15	35385342	35385344	+	IGR	DEL	CCA	CCA	-			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	CCA	CCA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr15:35385342_35385344delCCA								RP11-463I20.2 (81950 upstream) : RP11-323I15.5 (5878 downstream)																							tggcggtggcccaggcggcggcg	0.616																																																0			15																																								33172636	SO:0001628	intergenic_variant	441722																															15.37:g.35385342_35385344delCCA		Somatic		Capture	Illumina GAIIx	4	33172634		In_Frame_Del	DEL	superfamily_CCCH zinc finger,HMMPfam_zf-CCCH,HMMSmart_SM00356,superfamily_RNA-binding domain RBD,HMMSmart_SM00361	p.P221in_frame_del		37	c.661_663		15																																																																																			(deletion:cds_exon[33171974,33172705])	NULL	0	0.616					LOC441722			CCA			33172636	+1	no_errors	XM_497450	genbank	human	model	54_36p	in_frame_del	DEL	0.992:0.999:1.000	-
SPATA31A6	389730	genome.wustl.edu	37	9	43624986	43624990	+	Frame_Shift_Del	DEL	TTCTG	TTCTG	-			TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	TTCTG	TTCTG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr9:43624986_43624990delTTCTG	ENST00000332857.6	-	4	3725_3729	c.3697_3701delCAGAA	c.(3697-3702)cagaagfs	p.QK1233fs	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	1233					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGCTTGAAACTTCTGTTTGTGCTGA	0.507																																																0			9																																								43564986	SO:0001589	frameshift_variant	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.3697_3701delCAGAA	9.37:g.43624986_43624990delTTCTG	ENSP00000329825:p.Gln1233fs	Somatic		Capture	Illumina GAIIx	4	43564982		Frame_Shift_Del	DEL	NULL	p.Q1233fs	ENST00000332857.6	37	c.3701_3697	CCDS47973.1	9																																																																																			(deletion:cds_exon[43564651,43568374])	NULL		0.507	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A6	protein_coding	OTTHUMT00000036987.1	TTCTG	NM_001145196		43564986	-1	no_errors	ENST00000332857	ensembl	human	known	54_36p	frame_shift_del	DEL	0.002:0.001:0.002:0.001:0.001	-
POT1	25913	genome.wustl.edu	37	7	124465383	124465395	+	Frame_Shift_Del	DEL	TCTGATGCTGGAA	TCTGATGCTGGAA	-	rs34541898|rs543210278		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	TCTGATGCTGGAA	TCTGATGCTGGAA					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr7:124465383_124465395delTCTGATGCTGGAA	ENST00000357628.3	-	18	2301_2313	c.1703_1715delTTCCAGCATCAGA	c.(1702-1716)attccagcatcagaafs	p.IPASE568fs	POT1_ENST00000393329.1_Frame_Shift_Del_p.IPASE437fs	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	568					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)	p.E572K(2)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						CATCAGAACTTCTGATGCTGGAATCTGGAAGAA	0.286																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)											2	Substitution - Missense(2)	breast(2)	7																																								124252631	SO:0001589	frameshift_variant	25913			AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.1703_1715delTTCCAGCATCAGA	7.37:g.124465383_124465395delTCTGATGCTGGAA	ENSP00000350249:p.Ile568fs	Somatic		Capture	Illumina GAIIx	4	124252619	O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Frame_Shift_Del	DEL	superfamily_Nucleic acid-binding proteins,HMMPfam_Telo_bind	p.I568fs	ENST00000357628.3	37	c.1715_1703	CCDS5793.1	7																																																																																			(deletion:cds_exon[124252542,124252647])	NULL		0.286	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POT1	protein_coding	OTTHUMT00000347861.1	TCTGATGCTGGAA			124252631	-1	no_errors	NM_015450	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.970:0.995:0.997:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000:1.000	-
LAMA2	3908	genome.wustl.edu	37	6	129766963	129766971	+	Splice_Site	DEL	TTCTGTAAG	TTCTGTAAG	-	rs150730793	byFrequency	TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	TTCTGTAAG	TTCTGTAAG					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr6:129766963_129766971delTTCTGTAAG	ENST00000421865.2	+	45	6475_6478	c.6426_6429delTTCTGTAAG	c.(6424-6429)aattct>aa	p.NS2142del		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2142	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AACAAGCCAATTCTGTAAGTTCTTTTTAT	0.368																																																0			6																																								129808664	SO:0001630	splice_region_variant	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.6429+1TTCTGTAAG>-	6.37:g.129766963_129766971delTTCTGTAAG		Somatic		Capture	Illumina GAIIx	4	129808656	Q14736|Q5VUM2|Q93022	Frame_Shift_Del	DEL	HMMSmart_LamNT,HMMPfam_Laminin_N,superfamily_Gal_bind_like,HMMPfam_Laminin_EGF,HMMSmart_EGF_Lam,superfamily_ConA_like_lec_gl,PatternScan_EGF_1,PatternScan_EGF_LAM_1,superfamily_SSF57196,PatternScan_EGF_2,HMMSmart_LamB,HMMPfam_Laminin_B,HMMPfam_Laminin_I,superfamily_SSF56399,HMMPfam_Laminin_II,HMMSmart_LamG,HMMPfam_Laminin_G_1,HMMPfam_Laminin_G_2	p.N2142fs	ENST00000421865.2	37	c.6426_6429	CCDS5138.1	6																																																																																			(deletion:cds_exon[129808505,129808659], intron[129808660,129815825])	superfamily_ConA_like_lec_gl,HMMPfam_Laminin_II		0.368	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	protein_coding	OTTHUMT00000042180.1	TTCTGTAAG		In_Frame_Del	129808664	+1	no_errors	NM_000426	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:1.000:0.999	-
TOP1MT	116447	genome.wustl.edu	37	8	144407606	144407608	+	In_Frame_Del	DEL	GGC	GGC	-	rs368057294		TCGA-61-1907-01A-01W-0639-09	TCGA-61-1907-11A-01W-0640-09	GGC	GGC					Unknown	Unknown	Somatic	Phase_I	WXS	none	1	dbGAP	Illumina GAIIx	7c50e035-7786-4766-b151-7915a077be43	9c90329c-f516-46bc-b797-cc2ef0003ff5	g.chr8:144407606_144407608delGGC	ENST00000329245.4	-	5	613_615	c.579_581delGCC	c.(577-582)ccgcct>cct	p.193_194PP>P	TOP1MT_ENST00000519148.1_In_Frame_Del_p.95_96PP>P|TOP1MT_ENST00000523676.1_In_Frame_Del_p.95_96PP>P|TOP1MT_ENST00000521193.1_In_Frame_Del_p.95_96PP>P	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	193					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)			endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	GAACAAGCCAGGCGGCTCAATCT	0.502																																																0			8																																								144478983	SO:0001651	inframe_deletion	116447			AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.579_581delGCC	8.37:g.144407609_144407611delGGC	ENSP00000328835:p.Pro194del	Somatic		Capture	Illumina GAIIx	4	144478981	B7ZAR5|E7ES89|Q86ST4|Q86V82	In_Frame_Del	DEL	superfamily_TopoI_DNA_bd_euk,HMMPfam_Topoisom_I_N,HMMSmart_TOPEUc,superfamily_DNA_brk_join_enz,HMMPfam_Topoisom_I,superfamily_Topismrse_insert,PatternScan_TOPOISOMERASE_I_EUK	p.P194in_frame_del	ENST00000329245.4	37	c.581_579	CCDS6400.1	8																																																																																			(deletion:cds_exon[144478891,144479078])	superfamily_TopoI_DNA_bd_euk,HMMPfam_Topoisom_I_N		0.502	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP1MT	protein_coding	OTTHUMT00000381247.3	GGC	NM_052963		144478983	-1	no_errors	NM_052963	genbank	human	reviewed	54_36p	in_frame_del	DEL	0.999:1.000:0.990	-
